#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ZNF876P	642280	genome.wustl.edu	37	4	248151	248151	+	RNA	SNP	T	T	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr4:248151T>G	ENST00000356347.3	+	0	975					NR_027481.1		Q49A33	Z876P_HUMAN	zinc finger protein 876, pseudogene						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ATGTGAAGAATGCAGCAAAGC	0.373																																																	0								ENSG00000198155																																			ZNF876P			0			-	HGNC	BC028359		4p16.3	2011-04-20	2010-08-03	2009-07-22	ENSG00000198155	ENSG00000198155			32472	pseudogene	pseudogene							Standard	NR_027481		Approved		uc010iba.4	Q49A33	OTTHUMG00000159874		4.37:g.248151T>G		Somatic	0	47	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	16	46.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356347.3	37	NULL		4																																																																																			-	-		0.373	ZNF876P-001	KNOWN	basic	processed_transcript	ZNF876P	pseudogene	OTTHUMT00000357870.2	T	NR_027481	-		248151	+1	no_errors	ENST00000356347	ensembl	human	known	74_37	rna	SNP	0.974	G
ZBTB38	253461	genome.wustl.edu	37	3	141162758	141162758	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr3:141162758C>T	ENST00000514251.1	+	4	1807	c.1528C>T	c.(1528-1530)Cat>Tat	p.H510Y	ZBTB38_ENST00000321464.5_Missense_Mutation_p.H511Y|ZBTB38_ENST00000441582.2_Missense_Mutation_p.H510Y					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						TGAAATTTGGCATACGGGAGA	0.393																																																	0								ENSG00000177311						95.0	88.0	90.0					3																	141162758		1910	4128	6038	ZBTB38	SO:0001583	missense	0			-	HGNC	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.1528C>T	3.37:g.141162758C>T	ENSP00000426387:p.His510Tyr	Somatic	0	38	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.H511Y	ENST00000514251.1	37	c.1531	CCDS43157.1	3	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346406	0.82022	.	.	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.39	5.39	0.77823	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.87505	0.6194	H	0.94964	3.605	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.90805	0.4697	9	.	.	.	-26.5771	19.1701	0.93574	0.0:1.0:0.0:0.0	.	511;510	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	Y	510;510;510;511	ENSP00000424254:H510Y;ENSP00000426387:H510Y;ENSP00000406955:H510Y;ENSP00000372635:H511Y	.	H	+	1	0	ZBTB38	142645448	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.487000	0.81328	2.543000	0.85770	0.650000	0.86243	CAT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB38	protein_coding	OTTHUMT00000359329.2	C		-		141162758	+1	no_errors	ENST00000321464	ensembl	human	known	74_37	missense	SNP	1.000	T
HSPA13	6782	genome.wustl.edu	37	21	15746041	15746041	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr21:15746041G>A	ENST00000285667.3	-	5	1380	c.1313C>T	c.(1312-1314)aCg>aTg	p.T438M	HSPA13_ENST00000544452.1_Missense_Mutation_p.T230M	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	438						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						AGCCACTCCCGTTACTACTGC	0.468																																																	0								ENSG00000155304						70.0	70.0	70.0					21																	15746041		2203	4300	6503	HSPA13	SO:0001583	missense	0			-	HGNC		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.1313C>T	21.37:g.15746041G>A	ENSP00000285667:p.Thr438Met	Somatic	0	45	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	23	28.12	B2R616|Q8NE40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.T438M	ENST00000285667.3	37	c.1313	CCDS13567.1	21	.	.	.	.	.	.	.	.	.	.	G	14.61	2.586672	0.46110	.	.	ENSG00000155304	ENST00000285667;ENST00000544452	T;T	0.09350	2.99;2.99	5.65	5.65	0.86999	.	0.131888	0.64402	D	0.000002	T	0.05318	0.0141	N	0.03253	-0.375	0.58432	D	0.999999	P	0.48350	0.909	B	0.38842	0.283	T	0.37454	-0.9705	10	0.72032	D	0.01	-16.643	12.9281	0.58272	0.115:0.0:0.885:0.0	.	438	P48723	HSP13_HUMAN	M	438;230	ENSP00000285667:T438M;ENSP00000441986:T230M	ENSP00000285667:T438M	T	-	2	0	HSPA13	14667912	0.998000	0.40836	0.987000	0.45799	0.961000	0.63080	2.509000	0.45459	2.829000	0.97493	0.655000	0.94253	ACG	-	pfam_Hsp_70_fam,prints_Hsp_70_fam		0.468	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA13	protein_coding	OTTHUMT00000157815.1	G		-		15746041	-1	no_errors	ENST00000285667	ensembl	human	known	74_37	missense	SNP	0.995	A
CCNB3	85417	genome.wustl.edu	37	X	50055541	50055541	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chrX:50055541C>T	ENST00000376042.1	+	7	3630	c.3332C>T	c.(3331-3333)aCc>aTc	p.T1111I	CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.T1111I|CCNB3_ENST00000348603.2_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	1111					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					AAGCAGATAACCCCACGGGAA	0.388																																																	0								ENSG00000147082						156.0	142.0	147.0					X																	50055541		2203	4300	6503	CCNB3	SO:0001583	missense	0			-	HGNC	AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.3332C>T	X.37:g.50055541C>T	ENSP00000365210:p.Thr1111Ile	Somatic	0	34	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	38	22.45	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,pfam_Cyclin_C-dom,superfamily_Cyclin-like,smart_Cyclin-like	p.T1111I	ENST00000376042.1	37	c.3332	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	C	4.036	0.004200	0.07866	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.18338	2.22;2.22	4.97	-0.029	0.13920	.	3.304510	0.01173	N	0.006910	T	0.10294	0.0252	N	0.14661	0.345	0.09310	N	1	B;B	0.13594	0.008;0.008	B;B	0.08055	0.003;0.001	T	0.21484	-1.0244	9	.	.	.	.	4.8746	0.13650	0.1372:0.4558:0.0:0.4069	.	1111;1111	A8K8T9;Q8WWL7	.;CCNB3_HUMAN	I	1111	ENSP00000365210:T1111I;ENSP00000276014:T1111I	.	T	+	2	0	CCNB3	50072281	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.559000	0.05971	-0.560000	0.06102	-0.197000	0.12766	ACC	-	NULL		0.388	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	protein_coding	OTTHUMT00000056558.1	C		-		50055541	+1	no_errors	ENST00000276014	ensembl	human	known	74_37	missense	SNP	0.003	T
MPP2	4355	genome.wustl.edu	37	17	41958094	41958094	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr17:41958094A>G	ENST00000461854.1	-	11	1272	c.1187T>C	c.(1186-1188)aTg>aCg	p.M396T	MPP2_ENST00000269095.4_Missense_Mutation_p.M372T|MPP2_ENST00000520305.1_Missense_Mutation_p.M233T|MPP2_ENST00000377184.3_Missense_Mutation_p.M389T|MPP2_ENST00000536246.1_Missense_Mutation_p.M361T|MPP2_ENST00000523501.1_Missense_Mutation_p.M361T|MPP2_ENST00000473246.1_5'Flank|MPP2_ENST00000518766.1_Missense_Mutation_p.M417T			Q14168	MPP2_HUMAN	membrane protein, palmitoylated 2 (MAGUK p55 subfamily member 2)	396	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|liver(1)|lung(4)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.00314)		BRCA - Breast invasive adenocarcinoma(366;0.12)		TGGATCCCACATGATGAGCTT	0.652											OREG0024443	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000108852						105.0	94.0	98.0					17																	41958094		2203	4300	6503	MPP2	SO:0001583	missense	0			-	HGNC		CCDS11471.1, CCDS62206.1, CCDS62207.1, CCDS62208.1, CCDS62209.1, CCDS62210.1	17q12-q21	2008-07-18			ENSG00000108852	ENSG00000108852			7220	protein-coding gene	gene with protein product	"""MAGUK p55 subfamily member 2"", ""discs large, homolog 2"""	600723		DLG2		7590743	Standard	NM_001278370		Approved	DKFZp761D0712	uc002ieo.1	Q14168	OTTHUMG00000133840	ENST00000461854.1:c.1187T>C	17.37:g.41958094A>G	ENSP00000428286:p.Met396Thr	Somatic	0	14	0.00	905	0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GK/Ca_channel_bsu,pfam_L27_C,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.M396T	ENST00000461854.1	37	c.1187		17	.	.	.	.	.	.	.	.	.	.	a	5.523	0.281398	0.10458	.	.	ENSG00000108852	ENST00000377184;ENST00000269095;ENST00000461854;ENST00000520305;ENST00000523501;ENST00000536246;ENST00000518766	T;T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38;2.38	5.02	3.94	0.45596	.	.	.	.	.	T	0.08758	0.0217	N	0.13003	0.285	0.28350	N	0.920944	B;B	0.11235	0.004;0.004	B;B	0.14023	0.01;0.006	T	0.37526	-0.9702	9	0.11794	T	0.64	.	6.7864	0.23675	0.8143:0.0:0.1857:0.0	.	417;389	E7EV80;Q14168-3	.;.	T	389;372;396;233;361;361;417	ENSP00000366389:M389T;ENSP00000269095:M372T;ENSP00000428286:M396T;ENSP00000428136:M233T;ENSP00000430540:M361T;ENSP00000438012:M361T;ENSP00000428182:M417T	ENSP00000269095:M372T	M	-	2	0	MPP2	39313620	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.437000	0.80417	0.874000	0.35823	0.397000	0.26171	ATG	-	pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu,pfscan_Guanylate_kin-like		0.652	MPP2-003	KNOWN	non_canonical_polymorphism|basic	protein_coding	MPP2	protein_coding	OTTHUMT00000258388.2	A	NM_005374	-		41958094	-1	no_errors	ENST00000461854	ensembl	human	known	74_37	missense	SNP	1.000	G
ZNF324B	388569	genome.wustl.edu	37	19	58967100	58967100	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:58967100C>G	ENST00000336614.4	+	4	896	c.789C>G	c.(787-789)agC>agG	p.S263R	ZNF324B_ENST00000545523.1_Missense_Mutation_p.S263R|ZNF324B_ENST00000391696.1_Missense_Mutation_p.S253R	NM_207395.2	NP_997278.2	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GGGCGTGCAGCAAAGTGTTCG	0.642																																																	0								ENSG00000249471						25.0	21.0	23.0					19																	58967100		2200	4292	6492	ZNF324B	SO:0001583	missense	0			-	HGNC	AK127750	CCDS33138.1	19q13.43	2013-01-08				ENSG00000249471		"""Zinc fingers, C2H2-type"", ""-"""	33107	protein-coding gene	gene with protein product							Standard	NM_207395		Approved	FLJ45850	uc002qsv.1	Q6AW86		ENST00000336614.4:c.789C>G	19.37:g.58967100C>G	ENSP00000337473:p.Ser263Arg	Somatic	0	25	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	B2RTZ6|Q6ZMX8|Q6ZS42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S263R	ENST00000336614.4	37	c.789	CCDS33138.1	19	.	.	.	.	.	.	.	.	.	.	c	12.38	1.919718	0.33908	.	.	ENSG00000249471	ENST00000336614;ENST00000545523;ENST00000391696	T;T;T	0.07800	3.16;3.16;3.16	3.09	-0.998	0.10212	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.756258	0.11809	N	0.527374	T	0.03827	0.0108	N	0.16790	0.44	0.09310	N	1	P;B	0.45902	0.868;0.009	B;B	0.36666	0.23;0.004	T	0.37056	-0.9722	10	0.66056	D	0.02	.	3.4702	0.07565	0.1405:0.5101:0.2388:0.1105	.	263;253	Q6AW86;C9JTQ8	Z324B_HUMAN;.	R	263;263;253	ENSP00000337473:S263R;ENSP00000438930:S263R;ENSP00000375578:S253R	ENSP00000337473:S263R	S	+	3	2	ZNF324B	63658912	0.026000	0.19158	0.003000	0.11579	0.852000	0.48524	-0.861000	0.04268	-0.133000	0.11537	-1.579000	0.00862	AGC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.642	ZNF324B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF324B	protein_coding	OTTHUMT00000467038.1	C	NM_207395	-		58967100	+1	no_errors	ENST00000336614	ensembl	human	known	74_37	missense	SNP	0.063	G
KCNA1	3736	genome.wustl.edu	37	12	5021708	5021708	+	Silent	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr12:5021708G>T	ENST00000382545.3	+	2	2271	c.1164G>T	c.(1162-1164)gtG>gtT	p.V388V	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	388					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.V388V(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	GCAAGATCGTGGGCTCCTTGT	0.527																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000111262						311.0	290.0	297.0					12																	5021708		2203	4300	6503	KCNA1	SO:0001819	synonymous_variant	0			-	HGNC	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1164G>T	12.37:g.5021708G>T		Somatic	0	31	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A6NM83|Q3MIQ9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.V388	ENST00000382545.3	37	c.1164	CCDS8535.1	12																																																																																			-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl		0.527	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	protein_coding	OTTHUMT00000103343.2	G	NM_000217	-		5021708	+1	no_errors	ENST00000382545	ensembl	human	known	74_37	silent	SNP	1.000	T
LEF1-AS1	641518	genome.wustl.edu	37	4	109094633	109094633	+	RNA	DEL	T	T	-	rs568214951	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr4:109094633delT	ENST00000512637.1	+	0	998				LEF1-AS1_ENST00000507799.1_RNA|LEF1-AS1_ENST00000508286.1_RNA|LEF1-AS1_ENST00000508266.1_RNA|LEF1-AS1_ENST00000436413.1_RNA|LEF1-AS1_ENST00000512129.1_RNA	NR_029373.1				LEF1 antisense RNA 1																		TTTCCACGTGTGCTCCCAGCT	0.517																																																	0								ENSG00000232021																																			LEF1-AS1			0				HGNC			4q25	2012-10-12	2012-08-15		ENSG00000232021	ENSG00000232021		"""Long non-coding RNAs"""	40339	non-coding RNA	RNA, long non-coding			"""LEF1 antisense RNA 1 (non-protein coding)"""				Standard	NR_029373		Approved		uc021xqn.1		OTTHUMG00000161028		4.37:g.109094633delT		Somatic	0	43	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000512637.1	37	NULL		4																																																																																			-	-		0.517	LEF1-AS1-002	KNOWN	basic	antisense	LEF1-AS1	processed_transcript	OTTHUMT00000363474.1	T	NR_029373			109094633	+1	no_errors	ENST00000436413	ensembl	human	known	74_37	rna	DEL	1.000	-
LAMB3	3914	genome.wustl.edu	37	1	209800835	209800835	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:209800835G>T	ENST00000356082.4	-	12	1512	c.1378C>A	c.(1378-1380)Ccc>Acc	p.P460T	LAMB3_ENST00000367030.3_Missense_Mutation_p.P460T|LAMB3_ENST00000391911.1_Missense_Mutation_p.P460T	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	460	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TCACATTTGGGACCCACCACG	0.637											OREG0014217	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000196878						75.0	63.0	67.0					1																	209800835		2203	4300	6503	LAMB3	SO:0001583	missense	0			-	HGNC	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.1378C>A	1.37:g.209800835G>T	ENSP00000348384:p.Pro460Thr	Somatic	0	55	0.00	2185	0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_EGF_laminin,pfscan_Laminin_N	p.P460T	ENST00000356082.4	37	c.1378	CCDS1487.1	1	.	.	.	.	.	.	.	.	.	.	G	8.328	0.825941	0.16749	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.61158	0.13;0.13;0.13	5.23	3.34	0.38264	EGF-like, laminin (4);EGF-like region, conserved site (1);	0.333576	0.31495	N	0.007544	T	0.40932	0.1137	L	0.44542	1.39	0.29716	N	0.83903	B	0.16603	0.018	B	0.15870	0.014	T	0.25641	-1.0126	10	0.13853	T	0.58	.	4.464	0.11680	0.145:0.121:0.6096:0.1244	.	460	Q13751	LAMB3_HUMAN	T	460	ENSP00000375778:P460T;ENSP00000348384:P460T;ENSP00000355997:P460T	ENSP00000348384:P460T	P	-	1	0	LAMB3	207867458	0.000000	0.05858	1.000000	0.80357	0.662000	0.39071	0.215000	0.17562	0.697000	0.31718	-0.263000	0.10527	CCC	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin		0.637	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB3	protein_coding	OTTHUMT00000088525.2	G	NM_000228	-		209800835	-1	no_errors	ENST00000356082	ensembl	human	known	74_37	missense	SNP	0.958	T
C6orf132	647024	genome.wustl.edu	37	6	42075105	42075131	+	In_Frame_Del	DEL	GGTGGGGGTTCCAGCAGCAGGGGAGGT	GGTGGGGGTTCCAGCAGCAGGGGAGGT	-	rs553334748|rs539692316	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	GGTGGGGGTTCCAGCAGCAGGGGAGGT	GGTGGGGGTTCCAGCAGCAGGGGAGGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr6:42075105_42075131delGGTGGGGGTTCCAGCAGCAGGGGAGGT	ENST00000341865.4	-	4	518_544	c.519_545delACCTCCCCTGCTGCTGGAACCCCCACC	c.(517-546)ccacctcccctgctgctggaacccccaccc>ccc	p.173_182PPPLLLEPPP>P		NM_001164446.1	NP_001157918.1	Q5T0Z8	CF132_HUMAN	chromosome 6 open reading frame 132	173	Pro-rich.									breast(1)	1						gctgggcgggggtgggggttccagcagcaggggaggtggtgggggtg	0.665																																																	0								ENSG00000188112			8,1312		4,0,656						1.1	0.5			2	76,2832		27,22,1405	no	coding	C6orf132	NM_001164446.1		31,22,2061	A1A1,A1R,RR		2.6135,0.6061,1.9868				84,4144				C6orf132	SO:0001651	inframe_deletion	0				HGNC		CCDS47428.1	6p21.1	2012-02-06			ENSG00000188112	ENSG00000188112			21288	protein-coding gene	gene with protein product							Standard	NM_001164446		Approved	bA7K24.2	uc003orw.2	Q5T0Z8	OTTHUMG00000014695	ENST00000341865.4:c.519_545delACCTCCCCTGCTGCTGGAACCCCCACC	6.37:g.42075105_42075131delGGTGGGGGTTCCAGCAGCAGGGGAGGT	ENSP00000341368:p.Pro173_Pro181del	Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NI05	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.LLLEPPPPP176in_frame_del	ENST00000341865.4	37	c.545_519	CCDS47428.1	6																																																																																			-	NULL		0.665	C6orf132-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C6orf132	protein_coding	OTTHUMT00000040548.2	GGTGGGGGTTCCAGCAGCAGGGGAGGT	NM_001164446			42075131	-1	no_errors	ENST00000341865	ensembl	human	putative	74_37	in_frame_del	DEL	0.977:0.955:0.954:0.987:0.998:0.966:1.000:1.000:1.000:0.998:0.999:0.999:1.000:0.999:1.000:1.000:0.996:0.996:0.994:0.988:0.979:0.999:1.000:0.997:0.996:0.963:0.342	-
IDI2-AS1	55853	genome.wustl.edu	37	10	1081791	1081792	+	RNA	INS	-	-	CCTGGCCCA	rs146706331	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr10:1081791_1081792insCCTGGCCCA	ENST00000428780.2	+	0	154_155				IDI2-AS1_ENST00000437374.1_RNA|IDI2-AS1_ENST00000434470.1_RNA|IDI2-AS1_ENST00000536039.1_RNA|IDI2-AS1_ENST00000420381.1_RNA	NR_024628.1		Q9NZ38	IDAS1_HUMAN	IDI2 antisense RNA 1																		CTGTGCCACTGcctggcccacc	0.545														817	0.163139	0.3041	0.1383	5008	,	,		17054	0.1121		0.1322	False		,,,				2504	0.0746																0								ENSG00000232656																																			IDI2-AS1			0				HGNC	AF220183		10p15.3	2014-01-15	2012-08-15	2010-11-25	ENSG00000232656	ENSG00000232656		"""Long non-coding RNAs"""	30885	non-coding RNA	RNA, long non-coding		615391	"""chromosome 10 open reading frame 110"", ""IDI2 antisense RNA (non-protein coding)"", ""IDI2 antisense RNA 1 (non-protein coding)"""	C10orf110, IDI2-AS		24036268	Standard	NR_024628		Approved	HT009, Em:AC022536.4	uc001ifw.3	Q9NZ38	OTTHUMG00000017535		10.37:g.1081792_1081800dupCCTGGCCCA		Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428780.2	37	NULL		10																																																																																			-	-		0.545	IDI2-AS1-002	KNOWN	basic	antisense	IDI2-AS1	antisense	OTTHUMT00000046403.1	-	NR_024628			1081792	+1	no_errors	ENST00000420381	ensembl	human	known	74_37	rna	INS	0.016:0.021	CCTGGCCCA
OR5M3	219482	genome.wustl.edu	37	11	56237609	56237609	+	Missense_Mutation	SNP	A	A	G	rs200070203	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr11:56237609A>G	ENST00000312240.2	-	1	405	c.365T>C	c.(364-366)aTg>aCg	p.M122T		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					CCCAATTGCCATGTATCTATC	0.383													a|||	26	0.00519169	0.0	0.0058	5008	,	,		20815	0.0		0.0169	False		,,,				2504	0.0051																0								ENSG00000174937						92.0	86.0	88.0					11																	56237609		2201	4280	6481	OR5M3	SO:0001583	missense	0			-	HGNC	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.365T>C	11.37:g.56237609A>G	ENSP00000312208:p.Met122Thr	Somatic	0	25	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	5	50.00	B2RNM7|Q6IEW4|Q96RC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M122T	ENST00000312240.2	37	c.365	CCDS31532.1	11	.	.	.	.	.	.	.	.	.	.	A	7.717	0.696444	0.15106	.	.	ENSG00000174937	ENST00000312240	T	0.01323	5.01	5.13	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.215738	0.32852	N	0.005578	T	0.01870	0.0059	L	0.43646	1.37	0.28098	N	0.931539	B	0.06786	0.001	B	0.10450	0.005	T	0.30995	-0.9959	10	0.56958	D	0.05	-7.874	9.9755	0.41781	0.9186:0.0:0.0814:0.0	.	122	Q8NGP4	OR5M3_HUMAN	T	122	ENSP00000312208:M122T	ENSP00000312208:M122T	M	-	2	0	OR5M3	55994185	0.001000	0.12720	0.975000	0.42487	0.077000	0.17291	1.595000	0.36708	0.794000	0.33899	-0.536000	0.04276	ATG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.383	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M3	protein_coding	OTTHUMT00000391639.1	A	NM_001004742	rs200070203		56237609	-1	no_errors	ENST00000312240	ensembl	human	known	74_37	missense	SNP	1.000	G
SHARPIN	81858	genome.wustl.edu	37	8	145154939	145154939	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr8:145154939G>A	ENST00000398712.2	-	3	846	c.410C>T	c.(409-411)cCa>cTa	p.P137L	SHARPIN_ENST00000533948.1_5'UTR	NM_030974.3	NP_112236.3	Q9H0F6	SHRPN_HUMAN	SHANK-associated RH domain interactor	137	Self-association. {ECO:0000250}.				apoptotic nuclear changes (GO:0030262)|brain development (GO:0007420)|keratinization (GO:0031424)|mitochondrion organization (GO:0007005)|negative regulation of inflammatory response (GO:0050728)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein homooligomerization (GO:0051260)|protein linear polyubiquitination (GO:0097039)|regulation of CD40 signaling pathway (GO:2000348)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|LUBAC complex (GO:0071797)|postsynaptic density (GO:0014069)	polyubiquitin binding (GO:0031593)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(2)|ovary(2)	7	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;4.1e-42)|Epithelial(56;1.58e-40)|all cancers(56;6.12e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GCATGCTTCTGGGCCCAAGGC	0.602																																																	0								ENSG00000179526						217.0	226.0	223.0					8																	145154939		2167	4265	6432	SHARPIN	SO:0001583	missense	0			-	HGNC	AL136816	CCDS43777.1	8q24.3	2005-08-09				ENSG00000179526			25321	protein-coding gene	gene with protein product		611885				11178875, 12753155	Standard	NM_030974		Approved	DKFZP434N1923, SIPL1	uc003zba.3	Q9H0F6		ENST00000398712.2:c.410C>T	8.37:g.145154939G>A	ENSP00000381698:p.Pro137Leu	Somatic	0	56	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	18	71.88	A6NEG3|C0L3L2|D3DWL3|Q8IXF5|Q8IXF6|Q8N2E7|Q8TB25|Q9BUE4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.P137L	ENST00000398712.2	37	c.410	CCDS43777.1	8	.	.	.	.	.	.	.	.	.	.	G	10.34	1.324014	0.24080	.	.	ENSG00000179526	ENST00000398712;ENST00000359551	T;T	0.47528	1.51;0.84	3.28	1.48	0.22813	.	1.077510	0.07192	N	0.855922	T	0.65439	0.2691	M	0.73598	2.24	0.19775	N	0.999958	D	0.89917	1.0	D	0.83275	0.996	T	0.44847	-0.9301	10	0.72032	D	0.01	.	5.609	0.17394	0.2574:0.0:0.7426:0.0	.	137	Q9H0F6	SHRPN_HUMAN	L	137	ENSP00000381698:P137L;ENSP00000352551:P137L	ENSP00000352551:P137L	P	-	2	0	SHARPIN	145226927	0.002000	0.14202	0.286000	0.24833	0.085000	0.17905	0.648000	0.24828	0.417000	0.25871	-0.379000	0.06801	CCA	-	NULL		0.602	SHARPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHARPIN	protein_coding	OTTHUMT00000382901.1	G	NM_030974	-		145154939	-1	no_errors	ENST00000398712	ensembl	human	known	74_37	missense	SNP	0.193	A
KSR2	283455	genome.wustl.edu	37	12	117992986	117992986	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr12:117992986G>T	ENST00000339824.5	-	9	2233	c.1506C>A	c.(1504-1506)aaC>aaA	p.N502K	KSR2_ENST00000425217.1_Missense_Mutation_p.N473K|KSR2_ENST00000545002.1_5'UTR|KSR2_ENST00000302438.5_Missense_Mutation_p.N199K			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	502					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGTTGATTTTGTTGGTTTTGG	0.567																																																	0								ENSG00000171435						141.0	151.0	148.0					12																	117992986		1965	4155	6120	KSR2	SO:0001583	missense	0			-	HGNC	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.1506C>A	12.37:g.117992986G>T	ENSP00000339952:p.Asn502Lys	Somatic	0	57	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.N502K	ENST00000339824.5	37	c.1506		12	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843287	0.71488	.	.	ENSG00000171435	ENST00000425217;ENST00000339824;ENST00000302438;ENST00000542378	T;T;D	0.85556	-1.15;-1.15;-2.0	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.73976	0.3656	N	0.17474	0.49	0.58432	D	0.999998	P	0.42248	0.774	B	0.39660	0.306	T	0.73398	-0.3995	10	0.07813	T	0.8	.	17.5266	0.87802	0.0:0.0:1.0:0.0	.	502	Q6VAB6	KSR2_HUMAN	K	473;502;199;174	ENSP00000389715:N473K;ENSP00000339952:N502K;ENSP00000305466:N199K	ENSP00000305466:N199K	N	-	3	2	KSR2	116477369	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.453000	0.80700	2.197000	0.70478	0.563000	0.77884	AAC	-	NULL		0.567	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	protein_coding	OTTHUMT00000401987.2	G	NM_173598	-		117992986	-1	no_errors	ENST00000339824	ensembl	human	known	74_37	missense	SNP	1.000	T
ASH1L	55870	genome.wustl.edu	37	1	155340358	155340358	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:155340358C>T	ENST00000368346.3	-	12	7277	c.6638G>A	c.(6637-6639)cGc>cAc	p.R2213H	ASH1L_ENST00000392403.3_Missense_Mutation_p.R2208H			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2213	Catalytic domain.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ATTTCCCATGCGGTAACTGTC	0.433																																																	0								ENSG00000116539						245.0	215.0	225.0					1																	155340358		2203	4300	6503	ASH1L	SO:0001583	missense	0			-	HGNC	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.6638G>A	1.37:g.155340358C>T	ENSP00000357330:p.Arg2213His	Somatic	0	43	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.R2213H	ENST00000368346.3	37	c.6638		1	.	.	.	.	.	.	.	.	.	.	C	15.94	2.982162	0.53827	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	T;T	0.80738	-1.41;-1.41	4.87	3.96	0.45880	SET domain (3);	0.000000	0.85682	D	0.000000	T	0.63604	0.2525	L	0.48174	1.505	0.80722	D	1	B;B	0.25719	0.132;0.109	B;B	0.19666	0.026;0.015	T	0.68265	-0.5454	10	0.66056	D	0.02	.	12.8759	0.57989	0.0:0.9208:0.0:0.0792	.	2213;2208	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	H	2213;2208	ENSP00000357330:R2213H;ENSP00000376204:R2208H	ENSP00000357330:R2213H	R	-	2	0	ASH1L	153606982	1.000000	0.71417	1.000000	0.80357	0.015000	0.08874	5.915000	0.69973	1.300000	0.44818	-0.142000	0.14014	CGC	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom		0.433	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	protein_coding	OTTHUMT00000039400.1	C	NM_018489	-		155340358	-1	no_errors	ENST00000368346	ensembl	human	known	74_37	missense	SNP	1.000	T
SCN4A	6329	genome.wustl.edu	37	17	62022882	62022882	+	Missense_Mutation	SNP	G	G	T	rs147610324		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr17:62022882G>T	ENST00000435607.1	-	19	3634	c.3558C>A	c.(3556-3558)ttC>ttA	p.F1186L	SCN4A_ENST00000578147.1_Missense_Mutation_p.F1186L	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1186					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGCAGTAGTAGAACTTGCCGG	0.542													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19311	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000007314						267.0	267.0	267.0					17																	62022882		2202	4300	6502	SCN4A	SO:0001583	missense	0			GMAF=0.0005	HGNC	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3558C>A	17.37:g.62022882G>T	ENSP00000396320:p.Phe1186Leu	Somatic	0	38	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2	p.F1186L	ENST00000435607.1	37	c.3558	CCDS45761.1	17	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	24.4	4.524312	0.85600	.	.	ENSG00000007314	ENST00000435607	D	0.98120	-4.73	3.91	3.91	0.45181	Ion transport (1);	0.110120	0.64402	D	0.000005	D	0.96253	0.8778	M	0.75615	2.305	0.49687	D	0.999815	B	0.19935	0.04	B	0.22601	0.04	D	0.94964	0.8111	10	0.87932	D	0	.	9.2875	0.37766	0.0994:0.0:0.9006:0.0	.	1186	P35499	SCN4A_HUMAN	L	1186	ENSP00000396320:F1186L	ENSP00000396320:F1186L	F	-	3	2	SCN4A	59376614	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.284000	0.51708	2.196000	0.70406	0.561000	0.74099	TTC	-	pfam_Ion_trans_dom		0.542	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	protein_coding		G	NM_000334	rs147610324		62022882	-1	no_errors	ENST00000435607	ensembl	human	known	74_37	missense	SNP	1.000	T
CHTOP	26097	genome.wustl.edu	37	1	153614745	153614745	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:153614745G>C	ENST00000368694.3	+	4	555	c.243G>C	c.(241-243)aaG>aaC	p.K81N	CHTOP_ENST00000368687.1_Missense_Mutation_p.K56N|CHTOP_ENST00000368686.1_Missense_Mutation_p.K42N|CHTOP_ENST00000403433.1_Missense_Mutation_p.K81N|CHTOP_ENST00000495554.1_Intron|CHTOP_ENST00000368690.3_Missense_Mutation_p.K81N	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1	81					mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						GCCTGGGTAAGAGTAACATCC	0.532																																																	0								ENSG00000160679						42.0	45.0	44.0					1																	153614745		2203	4300	6503	CHTOP	SO:0001583	missense	0			-	HGNC		CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.243G>C	1.37:g.153614745G>C	ENSP00000357683:p.Lys81Asn	Somatic	0	47	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	41	24.07	D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K81N	ENST00000368694.3	37	c.243	CCDS1048.1	1	.	.	.	.	.	.	.	.	.	.	G	14.93	2.681209	0.47886	.	.	ENSG00000160679	ENST00000368694;ENST00000403433;ENST00000368690;ENST00000368687;ENST00000368686	D;D;D;D	0.91521	-2.54;-2.86;-2.86;-2.54	5.64	3.65	0.41850	.	0.044223	0.85682	D	0.000000	D	0.82953	0.5149	L	0.38531	1.155	0.54753	D	0.999988	P;P;P	0.41748	0.761;0.712;0.588	P;P;B	0.45538	0.469;0.484;0.291	D	0.85413	0.1138	10	0.87932	D	0	-0.7539	9.672	0.40017	0.1792:0.0:0.8207:0.0	.	81;82;81	Q9Y3Y2-4;Q9Y3Y2-3;Q9Y3Y2	.;.;CHTOP_HUMAN	N	81;81;81;56;42	ENSP00000357683:K81N;ENSP00000385228:K81N;ENSP00000357679:K81N;ENSP00000357676:K56N	ENSP00000357675:K42N	K	+	3	2	CHTOP	151881369	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.003000	0.29809	1.625000	0.50366	-0.157000	0.13467	AAG	-	NULL		0.532	CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHTOP	protein_coding	OTTHUMT00000089967.1	G	NM_015607	-		153614745	+1	no_errors	ENST00000368694	ensembl	human	known	74_37	missense	SNP	1.000	C
PLEKHA3	65977	genome.wustl.edu	37	2	179365893	179365893	+	Silent	SNP	A	A	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr2:179365893A>G	ENST00000234453.5	+	7	1167	c.765A>G	c.(763-765)gaA>gaG	p.E255E		NM_019091.3	NP_061964.3	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 3	255						Golgi apparatus (GO:0005794)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			TTCCTCTTGAAGACCCAGATA	0.413																																																	0								ENSG00000116095						78.0	80.0	80.0					2																	179365893		2203	4300	6503	PLEKHA3	SO:0001819	synonymous_variant	0			-	HGNC	AF286162	CCDS33336.1	2q31.2	2013-01-10	2002-01-14		ENSG00000116095	ENSG00000116095		"""Pleckstrin homology (PH) domain containing"""	14338	protein-coding gene	gene with protein product	"""four-phosphate-adaptor protein 1"""	607774	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 3"""			11001876, 15107860	Standard	NM_019091		Approved	FAPP1	uc002umn.3	Q9HB20	OTTHUMG00000154446	ENST00000234453.5:c.765A>G	2.37:g.179365893A>G		Somatic	0	68	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	19	61.22	Q4ZG69|Q86TQ1|Q9NXT3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E255	ENST00000234453.5	37	c.765	CCDS33336.1	2																																																																																			-	NULL		0.413	PLEKHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA3	protein_coding	OTTHUMT00000335241.2	A	NM_019091	-		179365893	+1	no_errors	ENST00000234453	ensembl	human	known	74_37	silent	SNP	1.000	G
ZIC3	7547	genome.wustl.edu	37	X	136651043	136651043	+	Intron	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chrX:136651043G>T	ENST00000287538.5	+	2	1610				ZIC3_ENST00000370606.3_Intron|ZIC3_ENST00000478471.1_3'UTR	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3						anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					ACCCCCCTTGGGTTTTTGCCT	0.552																																																	0								ENSG00000156925						138.0	147.0	144.0					X																	136651043		2203	4300	6503	ZIC3	SO:0001627	intron_variant	0			-	HGNC	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.1061-18G>T	X.37:g.136651043G>T		Somatic	0	35	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	B2CNW4|Q14DE5|Q5JY75	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000287538.5	37	NULL	CCDS14663.1	X																																																																																			-	-		0.552	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC3	protein_coding	OTTHUMT00000058526.1	G		-		136651043	+1	no_errors	ENST00000478471	ensembl	human	known	74_37	rna	SNP	0.000	T
CASR	846	genome.wustl.edu	37	3	122002847	122002847	+	Silent	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr3:122002847G>A	ENST00000490131.1	+	7	2418	c.2046G>A	c.(2044-2046)ccG>ccA	p.P682P	CASR_ENST00000296154.5_Silent_p.P682P|CASR_ENST00000498619.1_Silent_p.P692P|AC068754.1_ENST00000408547.1_RNA	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	682					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TGCGCCAGCCGGCCTTTGGCA	0.607																																																	0								ENSG00000036828						89.0	77.0	81.0					3																	122002847		2203	4300	6503	CASR	SO:0001819	synonymous_variant	0			-	HGNC	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2046G>A	3.37:g.122002847G>A		Somatic	0	22	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	2	81.82	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,superfamily_Growth_fac_rcpt_N_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.P692	ENST00000490131.1	37	c.2076	CCDS3010.1	3																																																																																			-	pfam_GPCR_3_C,pfscan_GPCR_3_C		0.607	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	protein_coding	OTTHUMT00000355761.1	G	NM_000388	-		122002847	+1	no_errors	ENST00000498619	ensembl	human	known	74_37	silent	SNP	0.016	A
OR2Z1	284383	genome.wustl.edu	37	19	8841961	8841961	+	Missense_Mutation	SNP	G	G	T	rs374555313	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:8841961G>T	ENST00000324060.2	+	1	646	c.571G>T	c.(571-573)Gat>Tat	p.D191Y		NM_001004699.1	NP_001004699.1	Q8NG97	OR2Z1_HUMAN	olfactory receptor, family 2, subfamily Z, member 1	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTCCTGTGCAGATACCTGTGC	0.572																																																	0								ENSG00000181733						156.0	140.0	145.0					19																	8841961		2203	4300	6503	OR2Z1	SO:0001583	missense	0			-	HGNC	AC008753	CCDS32895.1	19p13.2	2013-09-20	2002-11-13		ENSG00000181733	ENSG00000181733		"""GPCR / Class A : Olfactory receptors"""	15391	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily Z, member 2"""	OR2Z2			Standard	NM_001004699		Approved		uc010xkg.2	Q8NG97	OTTHUMG00000182195	ENST00000324060.2:c.571G>T	19.37:g.8841961G>T	ENSP00000316284:p.Asp191Tyr	Somatic	0	30	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B9EH50|Q6IFK0|Q96R25	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D191Y	ENST00000324060.2	37	c.571	CCDS32895.1	19	.	.	.	.	.	.	.	.	.	.	G	11.16	1.557671	0.27827	.	.	ENSG00000181733	ENST00000324060	T	0.00267	8.38	4.56	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.084785	0.50627	D	0.000101	T	0.00608	0.0020	M	0.89287	3.02	0.30280	N	0.791428	D	0.89917	1.0	D	0.83275	0.996	T	0.05699	-1.0869	10	0.87932	D	0	.	10.8802	0.46933	0.0942:0.0:0.9058:0.0	.	191	Q8NG97	OR2Z1_HUMAN	Y	191	ENSP00000316284:D191Y	ENSP00000316284:D191Y	D	+	1	0	OR2Z1	8702961	0.792000	0.28813	0.601000	0.28877	0.003000	0.03518	2.298000	0.43602	1.077000	0.40990	-0.287000	0.09952	GAT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.572	OR2Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2Z1	protein_coding	OTTHUMT00000459954.1	G		-		8841961	+1	no_errors	ENST00000324060	ensembl	human	known	74_37	missense	SNP	0.984	T
CNIH4	29097	genome.wustl.edu	37	1	224553606	224553606	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:224553606A>G	ENST00000465271.1	+	3	239	c.164A>G	c.(163-165)cAt>cGt	p.H55R	CNIH4_ENST00000366857.5_Missense_Mutation_p.H55R|CNIH4_ENST00000468318.1_3'UTR|CNIH4_ENST00000366856.3_Missense_Mutation_p.H55R|CNIH4_ENST00000366858.3_Missense_Mutation_p.H55R	NM_014184.3	NP_054903.1	Q9P003	CNIH4_HUMAN	cornichon family AMPA receptor auxiliary protein 4	55					intracellular signal transduction (GO:0035556)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(3)|lung(2)|ovary(2)	7				GBM - Glioblastoma multiforme(131;0.00341)		TTGATTGGCCATACCATTGTC	0.388																																																	0								ENSG00000143771						476.0	355.0	396.0					1																	224553606		2203	4300	6503	CNIH4	SO:0001583	missense	0			-	HGNC		CCDS1543.1, CCDS60429.1, CCDS60430.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143771	ENSG00000143771			25013	protein-coding gene	gene with protein product			"""cornichon homolog 4 (Drosophila)"""			11042152	Standard	NM_014184		Approved	HSPC163	uc001hom.2	Q9P003	OTTHUMG00000037635	ENST00000465271.1:c.164A>G	1.37:g.224553606A>G	ENSP00000420443:p.His55Arg	Somatic	0	57	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	10	81.82	A8K1Q8|B2R553|Q9H0X8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cornichon	p.H55R	ENST00000465271.1	37	c.164	CCDS1543.1	1	.	.	.	.	.	.	.	.	.	.	A	19.61	3.860255	0.71834	.	.	ENSG00000143771	ENST00000465271;ENST00000366858;ENST00000366857;ENST00000366856	T;T;T;T	0.52754	0.65;0.65;0.65;0.65	5.24	5.24	0.73138	.	0.047916	0.85682	D	0.000000	T	0.60919	0.2306	M	0.89287	3.02	0.80722	D	1	B	0.32653	0.379	B	0.38378	0.272	T	0.68164	-0.5481	10	0.87932	D	0	-14.3962	15.4341	0.75129	1.0:0.0:0.0:0.0	.	55	Q9P003	CNIH4_HUMAN	R	55	ENSP00000420443:H55R;ENSP00000355823:H55R;ENSP00000355822:H55R;ENSP00000355821:H55R	ENSP00000355821:H55R	H	+	2	0	CNIH4	222620229	1.000000	0.71417	0.917000	0.36280	0.993000	0.82548	6.772000	0.75001	2.107000	0.64212	0.379000	0.24179	CAT	-	pfam_Cornichon		0.388	CNIH4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNIH4	protein_coding	OTTHUMT00000091754.1	A	NM_014184	-		224553606	+1	no_errors	ENST00000465271	ensembl	human	known	74_37	missense	SNP	0.999	G
RAP1GDS1	5910	genome.wustl.edu	37	4	99313196	99313205	+	Frame_Shift_Del	DEL	TGTGTCTTGT	TGTGTCTTGT	-			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	TGTGTCTTGT	TGTGTCTTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr4:99313196_99313205delTGTGTCTTGT	ENST00000408927.3	+	6	715_724	c.602_611delTGTGTCTTGT	c.(601-612)atgtgtcttgttfs	p.MCLV201fs	RAP1GDS1_ENST00000339360.5_Frame_Shift_Del_p.MCLV202fs|RAP1GDS1_ENST00000264572.7_Intron|RAP1GDS1_ENST00000408900.3_Frame_Shift_Del_p.MCLV152fs|RAP1GDS1_ENST00000380158.4_Frame_Shift_Del_p.MCLV153fs|RAP1GDS1_ENST00000453712.2_Frame_Shift_Del_p.MCLV202fs	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	201					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		CTTACAGAAATGTGTCTTGTTGCATTTGGT	0.338			T	NUP98	T-ALL																																			Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	0								ENSG00000138698																																			RAP1GDS1	SO:0001589	frameshift_variant	0				HGNC		CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.602_611delTGTGTCTTGT	4.37:g.99313196_99313205delTGTGTCTTGT	ENSP00000386153:p.Met201fs	Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.C203fs	ENST00000408927.3	37	c.605_614	CCDS43253.1	4																																																																																			-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo		0.338	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAP1GDS1	protein_coding	OTTHUMT00000363273.2	TGTGTCTTGT	NM_001100426			99313205	+1	no_errors	ENST00000339360	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.958:1.000:1.000	-
SLC35E2B	728661	genome.wustl.edu	37	1	1607527	1607527	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:1607527G>A	ENST00000378662.1	-	4	1194	c.434C>T	c.(433-435)aCg>aTg	p.T145M	SLC35E2B_ENST00000234800.6_Missense_Mutation_p.T145M|RP11-345P4.7_ENST00000596308.1_RNA			P0CK96	S352B_HUMAN	solute carrier family 35, member E2B	145						integral component of membrane (GO:0016021)				kidney(1)|lung(1)	2						AAACAGCATCGTCATAAGGAA	0.478																																																	0								ENSG00000189339						32.0	25.0	27.0					1																	1607527		688	1445	2133	SLC35E2B	SO:0001583	missense	0			-	HGNC		CCDS44041.1	1p36.33	2013-05-22			ENSG00000189339	ENSG00000189339		"""Solute carriers"""	33941	protein-coding gene	gene with protein product							Standard	XM_006710870		Approved		uc001ahg.4	P0CK96	OTTHUMG00000078639	ENST00000378662.1:c.434C>T	1.37:g.1607527G>A	ENSP00000367931:p.Thr145Met	Somatic	0	127	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	45	19.64	B3KWR0|O75035|Q2TAY8|Q569F8|Q5CZA4|Q9Y3J8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tpt_PEP_trans_dom,pfam_DMT,pfam_UAA	p.T145M	ENST00000378662.1	37	c.434	CCDS44041.1	1	.	.	.	.	.	.	.	.	.	.	g	13.21	2.169401	0.38315	.	.	ENSG00000189339	ENST00000378662;ENST00000234800	D;D	0.92299	-3.01;-3.01	4.46	0.223	0.15292	Drug/metabolite transporter (1);	0.187954	0.43110	D	0.000618	D	0.84696	0.5529	N	0.22421	0.69	0.31742	N	0.635681	P	0.51351	0.944	P	0.49047	0.599	T	0.80913	-0.1170	10	0.35671	T	0.21	-27.989	2.6496	0.04995	0.4979:0.0:0.2876:0.2144	.	145	P0CK96	S352B_HUMAN	M	145	ENSP00000367931:T145M;ENSP00000234800:T145M	ENSP00000234800:T145M	T	-	2	0	SLC35E2B	1597390	1.000000	0.71417	0.999000	0.59377	0.726000	0.41606	3.074000	0.50065	0.232000	0.21100	0.313000	0.20887	ACG	-	pfam_DMT,pfam_UAA		0.478	SLC35E2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35E2B	protein_coding	OTTHUMT00000171589.1	G		-		1607527	-1	no_errors	ENST00000234800	ensembl	human	known	74_37	missense	SNP	1.000	A
DMXL2	23312	genome.wustl.edu	37	15	51751092	51751097	+	Intron	DEL	AGCAGC	AGCAGC	-	rs76476368|rs111734926|rs28362472|rs578027761|rs370429483|rs555701753	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	AGCAGC	AGCAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr15:51751092_51751097delAGCAGC	ENST00000251076.5	-	34	8211				RP11-707P17.2_ENST00000560727.1_RNA|RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Intron|RP11-707P17.2_ENST00000559173.1_RNA|RP11-707P17.2_ENST00000559977.1_RNA|DMXL2_ENST00000449909.3_Intron	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AAGAAAATGTagcagcagcagcagca	0.369																																																	0								ENSG00000259668																																			RP11-707P17.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7924-100GCTGCT>-	15.37:g.51751098_51751103delAGCAGC		Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RTR3|B7ZMH3|F5GWF1|O94938	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000251076.5	37	NULL	CCDS10141.1	15																																																																																			-	-		0.369	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	ENSG00000259668	protein_coding	OTTHUMT00000254671.2	AGCAGC	NM_015263			51751097	+1	no_errors	ENST00000559173	ensembl	human	known	74_37	rna	DEL	0.994:0.992:0.991:0.990:0.990:0.990	-
RIMS2	9699	genome.wustl.edu	37	8	104863873	104863878	+	Intron	DEL	ACACAC	ACACAC	-	rs56306101|rs10529078|rs369439768|rs59712615	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	ACACAC	ACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr8:104863873_104863878delACACAC	ENST00000507740.1	+	1	358				RIMS2_ENST00000406091.3_Intron|RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000522174.1_Intron|AP001572.1_ENST00000401294.1_RNA	NM_014677.4	NP_055492.3	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AATGCTATGTacacacacacacacac	0.359										HNSCC(12;0.0054)																																							0								ENSG00000216113																																			AP001572.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000507740.1:c.122+32016ACACAC>-	8.37:g.104863879_104863884delACACAC		Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000507740.1	37	NULL	CCDS43761.1	8																																																																																			-	-		0.359	RIMS2-005	NOVEL	basic|CCDS	protein_coding	ENSG00000216113	protein_coding	OTTHUMT00000367215.1	ACACAC	NM_001100117			104863878	+1	no_errors	ENST00000401294	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000	-
SPATA3	130560	genome.wustl.edu	37	2	231861214	231861214	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr2:231861214C>T	ENST00000452881.1	+	1	374	c.266C>T	c.(265-267)gCt>gTt	p.A89V	AC105344.2_ENST00000414876.1_lincRNA|SPATA3_ENST00000424440.1_Missense_Mutation_p.A89V|SPATA3_ENST00000433428.2_Missense_Mutation_p.A89V|SPATA3_ENST00000455816.1_Missense_Mutation_p.A89V			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	89										endometrium(2)|lung(1)	3						TCTCCAGATGCTAACGTGAAG	0.562																																																	0								ENSG00000173699						53.0	60.0	58.0					2																	231861214		692	1591	2283	SPATA3	SO:0001583	missense	0			-	HGNC	AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.266C>T	2.37:g.231861214C>T	ENSP00000388895:p.Ala89Val	Somatic	0	27	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q86WX5|Q8N9Y6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A89V	ENST00000452881.1	37	c.266	CCDS2481.1	2	.	.	.	.	.	.	.	.	.	.	C	11.46	1.645115	0.29246	.	.	ENSG00000173699	ENST00000424440;ENST00000452881;ENST00000433428;ENST00000455816;ENST00000355662;ENST00000440792	.	.	.	3.67	-0.525	0.11917	.	1.776180	0.03393	N	0.202140	T	0.16257	0.0391	N	0.14661	0.345	0.09310	N	1	P	0.36535	0.557	B	0.28139	0.086	T	0.17018	-1.0383	9	0.38643	T	0.18	2.316	6.3687	0.21469	0.3371:0.3331:0.3299:0.0	.	80	Q8NHX4	SPTA3_HUMAN	V	89;89;89;89;80;55	.	ENSP00000347884:A80V	A	+	2	0	SPATA3	231569458	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.106000	0.10890	-0.108000	0.12066	0.655000	0.94253	GCT	-	NULL		0.562	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SPATA3	protein_coding	OTTHUMT00000256956.2	C	NM_139073	-		231861214	+1	no_errors	ENST00000424440	ensembl	human	known	74_37	missense	SNP	0.000	T
ANXA7	310	genome.wustl.edu	37	10	75156285	75156285	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr10:75156285G>C	ENST00000372921.5	-	5	483	c.427C>G	c.(427-429)Cct>Gct	p.P143A	ANXA7_ENST00000535178.1_Missense_Mutation_p.P13A|ANXA7_ENST00000492380.1_5'UTR	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	143	Repeat-rich region.				autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					ACCTGACTAGGGTAAGTAGGT	0.413																																																	0								ENSG00000138279						70.0	67.0	68.0					10																	75156285		2203	4300	6503	ANXA7	SO:0001583	missense	0			-	HGNC	J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.427C>G	10.37:g.75156285G>C	ENSP00000362012:p.Pro143Ala	Somatic	0	43	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	5	58.33	Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVII,prints_AnnexinIV	p.P143A	ENST00000372921.5	37	c.427	CCDS7325.1	10	.	.	.	.	.	.	.	.	.	.	G	13.74	2.328166	0.41197	.	.	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178;ENST00000394847	T;T;T	0.04603	3.59;4.37;3.59	5.27	3.4	0.38934	.	1.448060	0.03889	N	0.278457	T	0.03477	0.0100	N	0.08118	0	0.42641	D	0.99341	P;P;B;P;B	0.39940	0.518;0.696;0.245;0.459;0.323	B;B;B;B;B	0.36464	0.114;0.214;0.118;0.225;0.114	T	0.36768	-0.9734	10	0.37606	T	0.19	.	7.5114	0.27575	0.0899:0.1673:0.7427:0.0	.	143;143;70;143;143	Q53HM8;B2R7L2;B4DWU2;P20073-2;P20073	.;.;.;.;ANXA7_HUMAN	A	143;143;13;143	ENSP00000362012:P143A;ENSP00000362010:P143A;ENSP00000442864:P13A	ENSP00000362010:P143A	P	-	1	0	ANXA7	74826291	0.995000	0.38212	0.722000	0.30670	0.988000	0.76386	0.983000	0.29552	0.699000	0.31761	0.650000	0.86243	CCT	-	NULL		0.413	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA7	protein_coding	OTTHUMT00000048646.2	G	NM_001156	-		75156285	-1	no_errors	ENST00000372919	ensembl	human	known	74_37	missense	SNP	0.924	C
SMCHD1	23347	genome.wustl.edu	37	18	2740716	2740727	+	In_Frame_Del	DEL	ATCAGTACGGAA	ATCAGTACGGAA	-	rs372029124		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	ATCAGTACGGAA	ATCAGTACGGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr18:2740716_2740727delATCAGTACGGAA	ENST00000320876.6	+	28	3868_3879	c.3530_3541delATCAGTACGGAA	c.(3529-3543)gatcagtacggaaat>gat	p.QYGN1178del	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_In_Frame_Del_p.QYGN1178del	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1178					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						ATAATTACAGATCAGTACGGAAATCAGATTCA	0.297																																																	0								ENSG00000101596																																			SMCHD1	SO:0001651	inframe_deletion	0				HGNC	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.3530_3541delATCAGTACGGAA	18.37:g.2740716_2740727delATCAGTACGGAA	ENSP00000326603:p.Gln1178_Asn1181del	Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_HATPase_ATP-bd,smart_SMC_hinge	p.YGNQ1179in_frame_del	ENST00000320876.6	37	c.3530_3541	CCDS45822.1	18																																																																																			-	NULL		0.297	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	protein_coding	OTTHUMT00000441082.2	ATCAGTACGGAA				2740727	+1	no_errors	ENST00000320876	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
FEZF1	389549	genome.wustl.edu	37	7	121943846	121943846	+	Missense_Mutation	SNP	C	C	A	rs570106853		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr7:121943846C>A	ENST00000442488.2	-	1	713	c.646G>T	c.(646-648)Gta>Tta	p.V216L	FEZF1_ENST00000427185.2_Missense_Mutation_p.V166L|FEZF1-AS1_ENST00000428449.1_RNA|FEZF1_ENST00000331178.4_Missense_Mutation_p.V216L|FEZF1-AS1_ENST00000437317.1_RNA	NM_001024613.2|NM_001160264.1	NP_001019784.2|NP_001153736.1	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1	216					axon guidance (GO:0007411)|forebrain anterior/posterior pattern specification (GO:0021797)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|large_intestine(3)|lung(18)|ovary(2)|prostate(1)	25						TTGAAAGCTACTCCAGAAGGG	0.502																																																	0								ENSG00000128610						64.0	69.0	68.0					7																	121943846		2203	4300	6503	FEZF1	SO:0001583	missense	0			-	HGNC	AY726588	CCDS34741.1, CCDS34741.2, CCDS55157.1	7q31.32	2013-01-08	2006-08-15	2006-08-15	ENSG00000128610	ENSG00000128610		"""Zinc fingers, C2H2-type"""	22788	protein-coding gene	gene with protein product		613301	"""zinc finger protein 312B"""	ZNF312B			Standard	NM_001024613		Approved		uc003vkd.3	A0PJY2	OTTHUMG00000157091	ENST00000442488.2:c.646G>T	7.37:g.121943846C>A	ENSP00000411145:p.Val216Leu	Somatic	0	52	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	A0PJY3|A4D0W3|B4DUP9|B7ZM98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V216L	ENST00000442488.2	37	c.646	CCDS34741.2	7	.	.	.	.	.	.	.	.	.	.	C	11.02	1.516525	0.27123	.	.	ENSG00000128610	ENST00000442488;ENST00000331178;ENST00000427185	T;T;T	0.06687	3.27;3.4;3.34	5.24	4.3	0.51218	.	0.137987	0.46758	D	0.000273	T	0.06416	0.0165	N	0.24115	0.695	0.36266	D	0.854888	B;B	0.18013	0.015;0.025	B;B	0.18871	0.01;0.023	T	0.30238	-0.9985	10	0.13470	T	0.59	-9.0225	15.0537	0.71894	0.0:0.7505:0.2495:0.0	.	216;166	A0PJY2;A0PJY2-2	FEZF1_HUMAN;.	L	216;216;166	ENSP00000411145:V216L;ENSP00000332777:V216L;ENSP00000392727:V166L	ENSP00000332777:V216L	V	-	1	0	FEZF1	121731082	0.894000	0.30519	1.000000	0.80357	0.776000	0.43924	2.291000	0.43540	2.595000	0.87683	0.555000	0.69702	GTA	-	NULL		0.502	FEZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEZF1	protein_coding	OTTHUMT00000347410.1	C	NM_001024613	-		121943846	-1	no_errors	ENST00000442488	ensembl	human	known	74_37	missense	SNP	0.996	A
ZC3H12D	340152	genome.wustl.edu	37	6	149783053	149783053	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr6:149783053C>T	ENST00000409806.3	-	3	677	c.359G>A	c.(358-360)tGg>tAg	p.W120*	ZC3H12D_ENST00000389942.5_Nonsense_Mutation_p.W120*|ZC3H12D_ENST00000409948.1_Nonsense_Mutation_p.W120*|ZC3H12D_ENST00000542614.1_Nonsense_Mutation_p.W120*|ZC3H12D_ENST00000416573.2_Nonsense_Mutation_p.W120*			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D	120					negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		GTCCCTGAACCAGTCAACAGC	0.478																																																	0								ENSG00000178199						79.0	79.0	79.0					6																	149783053		1979	4161	6140	ZC3H12D	SO:0001587	stop_gained	0			-	HGNC			6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.359G>A	6.37:g.149783053C>T	ENSP00000386616:p.Trp120*	Somatic	0	59	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_Zc3h12	p.W120*	ENST00000409806.3	37	c.359		6	.	.	.	.	.	.	.	.	.	.	C	36	5.951446	0.97139	.	.	ENSG00000178199	ENST00000389942;ENST00000416573;ENST00000409806;ENST00000542614;ENST00000409948	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.051	18.9014	0.92444	0.0:1.0:0.0:0.0	.	.	.	.	X	120	.	ENSP00000374592:W120X	W	-	2	0	ZC3H12D	149824746	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.254000	0.58798	2.709000	0.92574	0.563000	0.77884	TGG	-	pfam_RNase_Zc3h12		0.478	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	ZC3H12D	protein_coding	OTTHUMT00000286400.2	C	NM_207360	-		149783053	-1	no_errors	ENST00000389942	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CALB2	794	genome.wustl.edu	37	16	71423757	71423757	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr16:71423757delC	ENST00000302628.4	+	11	882	c.805delC	c.(805-807)cccfs	p.P270fs	CALB2_ENST00000349553.5_3'UTR	NM_001740.4	NP_001731.2	P22676	CALB2_HUMAN	calbindin 2	270	EF-hand 6. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cytosolic calcium ion homeostasis (GO:0051480)	cytoplasm (GO:0005737)|gap junction (GO:0005921)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18		Ovarian(137;0.125)				CTGCAGCGAGCCCCCCATGTA	0.587																																																	0								ENSG00000172137						69.0	69.0	69.0					16																	71423757		2198	4300	6498	CALB2	SO:0001589	frameshift_variant	0				HGNC	X56667	CCDS10899.1	16q22.2	2013-01-10	2008-05-19		ENSG00000172137	ENSG00000172137		"""EF-hand domain containing"""	1435	protein-coding gene	gene with protein product	"""calretinin"""	114051	"""calbindin 2, 29kDa (calretinin)"""			1906795	Standard	NM_001740		Approved	CAL2	uc002faa.4	P22676	OTTHUMG00000137589	ENST00000302628.4:c.805delC	16.37:g.71423757delC	ENSP00000307508:p.Pro270fs	Somatic	0	36	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	A8K4Y1|Q53HD2|Q96BK4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.M271fs	ENST00000302628.4	37	c.805	CCDS10899.1	16																																																																																			-	NULL		0.587	CALB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALB2	protein_coding	OTTHUMT00000268988.1	C	NM_001740			71423757	+1	no_errors	ENST00000302628	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PCNXL3	399909	genome.wustl.edu	37	11	65385164	65385164	+	Silent	SNP	G	G	A	rs369630534	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr11:65385164G>A	ENST00000355703.3	+	5	1103	c.564G>A	c.(562-564)tcG>tcA	p.S188S		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	188						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						AGCTCAGCTCGCAGGAGAAAC	0.582													G|||	2	0.000399361	0.0	0.0	5008	,	,		18687	0.002		0.0	False		,,,				2504	0.0																0								ENSG00000197136	G		0,4220		0,0,2110	28.0	31.0	30.0		564	-10.3	0.6	11		30	1,8417		0,1,4208	no	coding-synonymous	PCNXL3	NM_032223.2		0,1,6318	AA,AG,GG		0.0119,0.0,0.0079		188/2035	65385164	1,12637	2110	4209	6319	PCNXL3	SO:0001819	synonymous_variant	0			-	HGNC	BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.564G>A	11.37:g.65385164G>A		Somatic	0	26	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	Q6MZN8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pecanex	p.S188	ENST00000355703.3	37	c.564	CCDS44650.1	11																																																																																			-	NULL		0.582	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	protein_coding	OTTHUMT00000390321.1	G	NM_032223	-		65385164	+1	no_errors	ENST00000355703	ensembl	human	known	74_37	silent	SNP	0.525	A
SPERT	220082	genome.wustl.edu	37	13	46287374	46287374	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr13:46287374G>A	ENST00000310521.1	+	3	294	c.214G>A	c.(214-216)Gcg>Acg	p.A72T	SPERT_ENST00000378966.3_Missense_Mutation_p.A36T	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	72						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		CCCTCGCTGCGCGCAGCAGGC	0.652																																																	0								ENSG00000174015						30.0	31.0	30.0					13																	46287374		2202	4299	6501	SPERT	SO:0001583	missense	0			-	HGNC	AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.214G>A	13.37:g.46287374G>A	ENSP00000309189:p.Ala72Thr	Somatic	0	80	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	16	68.63	A8K8I5|Q8NHV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A72T	ENST00000310521.1	37	c.214	CCDS9399.1	13	.	.	.	.	.	.	.	.	.	.	G	8.728	0.916016	0.17907	.	.	ENSG00000174015	ENST00000310521;ENST00000533564;ENST00000378966	T;T	0.47869	0.89;0.83	5.1	-2.28	0.06826	.	0.690130	0.12656	N	0.450036	T	0.20455	0.0492	N	0.22421	0.69	0.09310	N	1	P;P	0.39326	0.668;0.668	B;B	0.28465	0.09;0.09	T	0.15378	-1.0439	10	0.56958	D	0.05	.	0.4051	0.00432	0.2059:0.2402:0.1976:0.3563	.	36;72	Q8NA61-2;Q8NA61	.;SPERT_HUMAN	T	72;45;36	ENSP00000309189:A72T;ENSP00000368249:A36T	ENSP00000309189:A72T	A	+	1	0	SPERT	45185375	0.000000	0.05858	0.005000	0.12908	0.142000	0.21351	-0.200000	0.09478	-0.284000	0.09102	0.650000	0.86243	GCG	-	NULL		0.652	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPERT	protein_coding	OTTHUMT00000044786.2	G	NM_152719	-		46287374	+1	no_errors	ENST00000310521	ensembl	human	known	74_37	missense	SNP	0.008	A
VPS39	23339	genome.wustl.edu	37	15	42459092	42459092	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr15:42459092G>T	ENST00000348544.4	-	15	1429	c.1430C>A	c.(1429-1431)gCc>gAc	p.A477D	VPS39_ENST00000318006.5_Missense_Mutation_p.A466D			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	477					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		TAGCAAGGGGGCCACCAGGGC	0.567																																																	0								ENSG00000166887						80.0	82.0	81.0					15																	42459092		2203	4299	6502	VPS39	SO:0001583	missense	0			-	HGNC	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.1430C>A	15.37:g.42459092G>T	ENSP00000335193:p.Ala477Asp	Somatic	0	31	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Citron,pfam_VPS39/TGF_beta_rcpt-assoc_2,pfam_VPS39/TGF_beta_rcpt-assoc_1,pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,smart_Citron	p.A477D	ENST00000348544.4	37	c.1430	CCDS10083.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.122552	0.94429	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.46451	0.87;0.88	5.74	5.74	0.90152	Vacuolar sorting protein 39/Transforming growth factor beta receptor-associated domain 1 (1);	0.050485	0.85682	D	0.000000	T	0.46889	0.1416	L	0.46157	1.445	0.80722	D	1	P;P	0.43392	0.805;0.768	P;B	0.48089	0.566;0.43	T	0.12142	-1.0559	10	0.11182	T	0.66	-14.8212	20.2982	0.98569	0.0:0.0:1.0:0.0	.	477;466	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	D	466;477	ENSP00000326534:A466D;ENSP00000335193:A477D	ENSP00000326534:A466D	A	-	2	0	VPS39	40246384	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.873000	0.98535	0.563000	0.77884	GCC	-	pfam_VPS39/TGF_beta_rcpt-assoc_1,pfam_Clathrin_H-chain/VPS_repeat		0.567	VPS39-002	KNOWN	basic|CCDS	protein_coding	VPS39	protein_coding	OTTHUMT00000420472.1	G	NM_015289	-		42459092	-1	no_errors	ENST00000348544	ensembl	human	known	74_37	missense	SNP	1.000	T
NR4A3	8013	genome.wustl.edu	37	9	102590467	102590467	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr9:102590467C>T	ENST00000395097.2	+	3	872	c.143C>T	c.(142-144)aCg>aTg	p.T48M	NR4A3_ENST00000338488.4_Missense_Mutation_p.T48M|NR4A3_ENST00000330847.1_Missense_Mutation_p.T59M	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	48					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)		TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				ACTGAGATCACGGCTACAGCC	0.567			T	EWSR1	extraskeletal myxoid chondrosarcoma																																			Dom	yes		9	9q22	8013	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""		M	0								ENSG00000119508						153.0	120.0	131.0					9																	102590467		2203	4300	6503	NR4A3	SO:0001583	missense	0			-	HGNC	U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.143C>T	9.37:g.102590467C>T	ENSP00000378531:p.Thr48Met	Somatic	0	20	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	6	72.73	A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_NOR1_rcpt,prints_Nuc_orph_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt	p.T59M	ENST00000395097.2	37	c.176	CCDS6743.1	9	.	.	.	.	.	.	.	.	.	.	C	10.61	1.399789	0.25291	.	.	ENSG00000119508	ENST00000395097;ENST00000338488;ENST00000330847	D;D;D	0.91407	-2.84;-2.42;-2.84	5.77	4.86	0.63082	.	1.302190	0.04699	N	0.415546	D	0.89040	0.6602	L	0.55481	1.735	0.27941	N	0.937526	B;B;B	0.26258	0.008;0.005;0.145	B;B;B	0.18263	0.003;0.001;0.021	T	0.76342	-0.2994	10	0.45353	T	0.12	.	10.3449	0.43901	0.0:0.7906:0.1358:0.0737	.	59;48;48	Q92570-3;Q92570;Q92570-2	.;NR4A3_HUMAN;.	M	48;48;59	ENSP00000378531:T48M;ENSP00000340301:T48M;ENSP00000333122:T59M	ENSP00000333122:T59M	T	+	2	0	NR4A3	101630288	0.998000	0.40836	0.984000	0.44739	0.539000	0.34962	4.342000	0.59341	1.409000	0.46915	0.557000	0.71058	ACG	-	NULL		0.567	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR4A3	protein_coding	OTTHUMT00000055482.1	C		-		102590467	+1	no_errors	ENST00000330847	ensembl	human	known	74_37	missense	SNP	0.845	T
DPY19L1	23333	genome.wustl.edu	37	7	35006559	35006559	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr7:35006559C>A	ENST00000310974.4	-	10	964	c.820G>T	c.(820-822)Gtt>Ttt	p.V274F	DPY19L1_ENST00000462134.2_5'UTR	NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	274						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						TACCCGACAACATATACTGCA	0.249																																																	0								ENSG00000173852						42.0	39.0	40.0					7																	35006559		1780	4017	5797	DPY19L1	SO:0001583	missense	0			-	HGNC	AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.820G>T	7.37:g.35006559C>A	ENSP00000308695:p.Val274Phe	Somatic	0	220	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	10	84.85	O94954|Q4G151	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dpy-19	p.V274F	ENST00000310974.4	37	c.820	CCDS43567.1	7	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299901	0.60195	.	.	ENSG00000173852	ENST00000310974;ENST00000446375	T;T	0.56444	0.46;0.46	4.78	4.78	0.61160	.	0.116278	0.56097	D	0.000030	T	0.61515	0.2353	M	0.70275	2.135	0.36129	D	0.84601	D	0.59767	0.986	P	0.55161	0.77	T	0.69771	-0.5055	10	0.45353	T	0.12	-18.8203	9.3418	0.38085	0.0:0.9003:0.0:0.0997	.	274	Q2PZI1	D19L1_HUMAN	F	274;73	ENSP00000308695:V274F;ENSP00000400510:V73F	ENSP00000308695:V274F	V	-	1	0	DPY19L1	34973084	1.000000	0.71417	0.998000	0.56505	0.916000	0.54674	1.415000	0.34748	2.365000	0.80145	0.555000	0.69702	GTT	-	pfam_Dpy-19		0.249	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L1	protein_coding	OTTHUMT00000337506.1	C		-		35006559	-1	no_errors	ENST00000310974	ensembl	human	known	74_37	missense	SNP	1.000	A
OR2B11	127623	genome.wustl.edu	37	1	247615033	247615033	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:247615033C>A	ENST00000318749.6	-	1	275	c.252G>T	c.(250-252)caG>caT	p.Q84H		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TGACCAGCATCTGAGGGACTG	0.567																																																	0								ENSG00000177535						142.0	135.0	137.0					1																	247615033		2203	4300	6503	OR2B11	SO:0001583	missense	0			-	HGNC		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.252G>T	1.37:g.247615033C>A	ENSP00000325682:p.Gln84His	Somatic	0	33	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	9	64.00	B2RP03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q84H	ENST00000318749.6	37	c.252	CCDS31090.1	1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900281	0.52227	.	.	ENSG00000177535	ENST00000318749	T	0.01902	4.57	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000142	T	0.08670	0.0215	M	0.81942	2.565	0.30613	N	0.759316	D	0.67145	0.996	P	0.56700	0.804	T	0.00978	-1.1493	10	0.62326	D	0.03	.	9.4788	0.38889	0.0:0.9057:0.0:0.0943	.	84	Q5JQS5	OR2BB_HUMAN	H	84	ENSP00000325682:Q84H	ENSP00000325682:Q84H	Q	-	3	2	OR2B11	245681656	0.000000	0.05858	1.000000	0.80357	0.848000	0.48234	-0.481000	0.06552	2.749000	0.94314	0.551000	0.68910	CAG	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.567	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B11	protein_coding	OTTHUMT00000097620.1	C	NM_001004492	-		247615033	-1	no_errors	ENST00000318749	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF600	162966	genome.wustl.edu	37	19	53270275	53270275	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:53270275G>A	ENST00000338230.3	-	3	1001	c.734C>T	c.(733-735)tCt>tTt	p.S245F		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	245					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		ACACTTGTGAGATTTTACTGC	0.398																																					Esophageal Squamous(196;1235 2112 2375 33339 34207)												0								ENSG00000189190						171.0	163.0	165.0					19																	53270275		2203	4300	6503	ZNF600	SO:0001583	missense	0			-	HGNC	U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.734C>T	19.37:g.53270275G>A	ENSP00000344791:p.Ser245Phe	Somatic	0	84	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	85	9.57	Q6MZR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S245F	ENST00000338230.3	37	c.734	CCDS12856.1	19	.	.	.	.	.	.	.	.	.	.	.	9.594	1.126887	0.20959	.	.	ENSG00000189190	ENST00000338230	T	0.60672	0.17	1.58	1.58	0.23477	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.52386	0.1731	L	0.33093	0.98	0.09310	N	1	P	0.52577	0.954	P	0.48952	0.596	T	0.45131	-0.9282	9	0.87932	D	0	.	10.1465	0.42767	0.0:0.0:1.0:0.0	.	245	Q6ZNG1	ZN600_HUMAN	F	245	ENSP00000344791:S245F	ENSP00000344791:S245F	S	-	2	0	ZNF600	57962087	0.004000	0.15560	0.006000	0.13384	0.026000	0.11368	1.341000	0.33907	0.883000	0.36040	0.306000	0.20318	TCT	-	pfscan_Znf_C2H2		0.398	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF600	protein_coding	OTTHUMT00000463093.1	G	NM_198457	-		53270275	-1	no_errors	ENST00000338230	ensembl	human	known	74_37	missense	SNP	0.019	A
RALYL	138046	genome.wustl.edu	37	8	85800008	85800008	+	Silent	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr8:85800008G>A	ENST00000521268.1	+	8	1960	c.855G>A	c.(853-855)gaG>gaA	p.E285E	RALYL_ENST00000522455.1_Silent_p.E285E|RALYL_ENST00000521376.1_Intron|RALYL_ENST00000521695.1_Silent_p.E285E|RALYL_ENST00000523850.1_Silent_p.E212E|RALYL_ENST00000518566.1_Silent_p.E274E|RALYL_ENST00000517638.1_Silent_p.E298E	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	285							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						GGGGTCATGAGCTGGTAGGAA	0.453																																																	0								ENSG00000184672						128.0	130.0	129.0					8																	85800008		1987	4155	6142	RALYL	SO:0001819	synonymous_variant	0			-	HGNC		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.855G>A	8.37:g.85800008G>A		Somatic	0	61	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	35	28.57	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.E285	ENST00000521268.1	37	c.855	CCDS55253.1	8																																																																																			-	pirsf_hnRNP_C_Raly		0.453	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALYL	protein_coding	OTTHUMT00000379448.1	G		-		85800008	+1	no_errors	ENST00000521268	ensembl	human	known	74_37	silent	SNP	1.000	A
AL157884.1	0	genome.wustl.edu	37	9	32764361	32764361	+	RNA	SNP	A	A	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr9:32764361A>G	ENST00000408769.1	+	0	68																											aatcgcaattacttttgcacc	0.333																																																	0								ENSG00000221696																																			AL157884.1			0			-	Clone_based_ensembl_gene																													9.37:g.32764361A>G		Somatic	0	49	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408769.1	37	NULL		9																																																																																			-	-		0.333	AL157884.1-201	NOVEL	basic	miRNA	ENSG00000221696	miRNA		A		-		32764361	+1	no_errors	ENST00000408769	ensembl	human	novel	74_37	rna	SNP	0.002	G
CEP78	84131	genome.wustl.edu	37	9	80861647	80861647	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr9:80861647G>T	ENST00000424347.2	+	6	1130	c.841G>T	c.(841-843)Gaa>Taa	p.E281*	CEP78_ENST00000415759.2_Nonsense_Mutation_p.E281*|CEP78_ENST00000376598.2_Nonsense_Mutation_p.E281*|CEP78_ENST00000376597.4_Nonsense_Mutation_p.E281*|CEP78_ENST00000277082.5_Nonsense_Mutation_p.E281*			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	281					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						AGAGGCCCTTGAAACCAATAC	0.393																																																	0								ENSG00000148019						83.0	83.0	83.0					9																	80861647		1838	4087	5925	CEP78	SO:0001587	stop_gained	0			-	HGNC	BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.841G>T	9.37:g.80861647G>T	ENSP00000411284:p.Glu281*	Somatic	0	83	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E281*	ENST00000424347.2	37	c.841		9	.	.	.	.	.	.	.	.	.	.	G	35	5.554765	0.96514	.	.	ENSG00000148019	ENST00000424347;ENST00000415085;ENST00000415759;ENST00000376597;ENST00000277082;ENST00000376598	.	.	.	5.75	5.75	0.90469	.	0.130352	0.49916	D	0.000123	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	-25.3063	13.5239	0.61584	0.0:0.2555:0.7445:0.0	.	.	.	.	X	281	.	ENSP00000277082:E281X	E	+	1	0	CEP78	80051467	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.231000	0.51294	2.696000	0.92011	0.655000	0.94253	GAA	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.393	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	CEP78	protein_coding	OTTHUMT00000052766.2	G	XM_095991	-		80861647	+1	no_errors	ENST00000376597	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TNR	7143	genome.wustl.edu	37	1	175348838	175348838	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:175348838G>A	ENST00000367674.2	-	9	2521	c.1813C>T	c.(1813-1815)Cgc>Tgc	p.R605C	TNR_ENST00000263525.2_Missense_Mutation_p.R605C			Q92752	TENR_HUMAN	tenascin R	605	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					GTTGCTGTGCGAGAACCAACT	0.473																																																	0								ENSG00000116147						99.0	75.0	83.0					1																	175348838		2203	4300	6503	TNR	SO:0001583	missense	0			-	HGNC	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1813C>T	1.37:g.175348838G>A	ENSP00000356646:p.Arg605Cys	Somatic	0	48	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	9	75.61	C9J563|Q15568|Q5R3G0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_Fibronectin_type3	p.R605C	ENST00000367674.2	37	c.1813	CCDS1318.1	1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344307	0.82022	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	T;T	0.57752	0.38;0.38	5.59	5.59	0.84812	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.131490	0.50627	D	0.000103	T	0.65523	0.2699	M	0.70275	2.135	0.54753	D	0.999982	D	0.63880	0.993	P	0.51895	0.683	T	0.68387	-0.5422	10	0.56958	D	0.05	.	19.1795	0.93617	0.0:0.0:1.0:0.0	.	605	Q92752	TENR_HUMAN	C	605	ENSP00000356646:R605C;ENSP00000263525:R605C	ENSP00000263525:R605C	R	-	1	0	TNR	173615461	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	6.314000	0.72848	2.619000	0.88677	0.655000	0.94253	CGC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.473	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNR	protein_coding	OTTHUMT00000084414.4	G	NM_003285	-		175348838	-1	no_errors	ENST00000263525	ensembl	human	known	74_37	missense	SNP	1.000	A
WDR45B	56270	genome.wustl.edu	37	17	80606364	80606365	+	5'UTR	INS	-	-	CGTGCGTG	rs368655024|rs150551798	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr17:80606364_80606365insCGTGCGTG	ENST00000392325.4	-	0	46_47					NM_019613.3	NP_062559.2	Q5MNZ6	WIPI3_HUMAN	WD repeat domain 45B																		tgtgtgctggacgtgcgtgcgt	0.738														1211	0.241813	0.1014	0.3329	5008	,	,		6912	0.2927		0.2922	False		,,,				2504	0.2628																0								ENSG00000141580																																			WDR45B	SO:0001623	5_prime_UTR_variant	0				HGNC	AF091083	CCDS11815.2	17q25.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000141580	ENSG00000141580		"""WD repeat domain containing"""	25072	protein-coding gene	gene with protein product		609226	"""WDR45-like"""	WDR45L		12477932	Standard	NM_019613		Approved	WIPI3	uc002kfq.3	Q5MNZ6	OTTHUMG00000150146	ENST00000392325.4:c.-149->CACGCACG	17.37:g.80606365_80606372dupCGTGCGTG		Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O95328|Q2MCP6|Q6IBN2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392325.4	37	NULL	CCDS11815.2	17																																																																																			-	-		0.738	WDR45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR45B	protein_coding	OTTHUMT00000316536.1	-	NM_019613			80606365	-1	no_errors	ENST00000574828	ensembl	human	known	74_37	rna	INS	0.042:0.012	CGTGCGTG
PRDM9	56979	genome.wustl.edu	37	5	23524559	23524559	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr5:23524559G>T	ENST00000296682.3	+	10	1249	c.1067G>T	c.(1066-1068)tGg>tTg	p.W356L		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	356	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CTGCTGGTCTGGTATGGGGAT	0.527										HNSCC(3;0.000094)																																							0								ENSG00000164256						112.0	112.0	112.0					5																	23524559		1937	4128	6065	PRDM9	SO:0001583	missense	0			-	HGNC	AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.1067G>T	5.37:g.23524559G>T	ENSP00000296682:p.Trp356Leu	Somatic	0	90	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	62	10.14	B4DX22|Q27Q50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.W356L	ENST00000296682.3	37	c.1067	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062406	0.76187	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.73575	-0.76	4.23	4.23	0.50019	SET domain (2);	.	.	.	.	D	0.87916	0.6298	M	0.90870	3.155	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.90273	0.4309	9	0.87932	D	0	-7.1501	12.4978	0.55937	0.0:0.0:1.0:0.0	.	356	Q9NQV7	PRDM9_HUMAN	L	356;150	ENSP00000296682:W356L	ENSP00000253473:W150L	W	+	2	0	PRDM9	23560316	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	5.223000	0.65283	2.080000	0.62538	0.597000	0.82753	TGG	-	pfscan_SET_dom		0.527	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	protein_coding	OTTHUMT00000366375.1	G	NM_020227	-		23524559	+1	no_errors	ENST00000296682	ensembl	human	known	74_37	missense	SNP	1.000	T
KRT84	3890	genome.wustl.edu	37	12	52771877	52771877	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr12:52771877C>T	ENST00000257951.3	-	9	1810	c.1744G>A	c.(1744-1746)Ggc>Agc	p.G582S	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	582	Tail.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GAGCTGCGGCCGCCGCTGCAG	0.677																																																	0								ENSG00000161849						12.0	14.0	13.0					12																	52771877		2182	4273	6455	KRT84	SO:0001583	missense	0			-	HGNC	Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.1744G>A	12.37:g.52771877C>T	ENSP00000257951:p.Gly582Ser	Somatic	0	35	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	25	26.47	B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.G582S	ENST00000257951.3	37	c.1744	CCDS8825.1	12	.	.	.	.	.	.	.	.	.	.	C	5.470	0.271695	0.10349	.	.	ENSG00000161849	ENST00000257951	D	0.81908	-1.55	3.57	2.66	0.31614	.	0.230288	0.22348	N	0.061253	T	0.70649	0.3248	L	0.36672	1.1	0.09310	N	1	P	0.52842	0.956	B	0.41088	0.347	T	0.63292	-0.6670	10	0.37606	T	0.19	.	6.1951	0.20546	0.0:0.8602:0.0:0.1398	.	582	Q9NSB2	KRT84_HUMAN	S	582	ENSP00000257951:G582S	ENSP00000257951:G582S	G	-	1	0	KRT84	51058144	0.697000	0.27767	0.207000	0.23584	0.189000	0.23516	1.818000	0.39012	1.991000	0.58162	0.462000	0.41574	GGC	-	NULL		0.677	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT84	protein_coding	OTTHUMT00000405187.1	C	NM_033045	-		52771877	-1	no_errors	ENST00000257951	ensembl	human	known	74_37	missense	SNP	0.102	T
PLIN5	440503	genome.wustl.edu	37	19	4523577	4523577	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:4523577G>A	ENST00000381848.3	-	8	1435	c.1355C>T	c.(1354-1356)cCg>cTg	p.P452L		NM_001013706.2	NP_001013728.2	Q00G26	PLIN5_HUMAN	perilipin 5	452	Interaction with PNPLA2 and ABHD5. {ECO:0000250}.|Recruits mitochondria at the lipid droplet surface. {ECO:0000250}.				lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|mitochondrion localization (GO:0051646)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of lipase activity (GO:0060192)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of triglyceride catabolic process (GO:0010897)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of lipase activity (GO:0060193)|positive regulation of lipid storage (GO:0010884)|positive regulation of sequestering of triglyceride (GO:0010890)|positive regulation of triglyceride biosynthetic process (GO:0010867)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lipid particle (GO:0005811)|mitochondrion (GO:0005739)				endometrium(4)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10						GTGCTTGACCGGGCAGCTGGG	0.672											OREG0025168	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000214456						62.0	71.0	68.0					19																	4523577		2031	4178	6209	PLIN5	SO:0001583	missense	0			-	HGNC	DQ839131	CCDS42473.1	19p13.3	2009-08-12			ENSG00000214456	ENSG00000214456		"""Perilipins"""	33196	protein-coding gene	gene with protein product	"""lipid storage droplet protein 5"""	613248				17234449, 19638644	Standard	NM_001013706		Approved	LSDP5, LSDA5, OXPAT, MLDP	uc002mas.3	Q00G26		ENST00000381848.3:c.1355C>T	19.37:g.4523577G>A	ENSP00000371272:p.Pro452Leu	Somatic	0	73	0.00	619	0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	41	30.51	A2RRC1|Q6ZS68	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Perilipin,pirsf_Perilipin	p.P452L	ENST00000381848.3	37	c.1355	CCDS42473.1	19	.	.	.	.	.	.	.	.	.	.	G	9.943	1.218098	0.22373	.	.	ENSG00000214456	ENST00000381848	T	0.10960	2.82	4.69	-0.619	0.11572	.	0.510052	0.16761	U	0.200603	T	0.05318	0.0141	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31503	-0.9941	10	0.66056	D	0.02	-6.0239	1.9882	0.03441	0.1117:0.14:0.3039:0.4443	.	452	Q00G26	PLIN5_HUMAN	L	452	ENSP00000371272:P452L	ENSP00000371272:P452L	P	-	2	0	PLIN5	4474577	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.128000	0.15810	0.315000	0.23110	0.561000	0.74099	CCG	-	NULL		0.672	PLIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN5	protein_coding	OTTHUMT00000458647.1	G	NM_001013706	-		4523577	-1	no_errors	ENST00000381848	ensembl	human	known	74_37	missense	SNP	0.000	A
ZNF420	147923	genome.wustl.edu	37	19	37621149	37621149	+	3'UTR	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:37621149G>T	ENST00000337995.3	+	0	3471				ZNF420_ENST00000586540.1_3'UTR|ZNF585A_ENST00000588723.1_Intron|CTC-454I21.4_ENST00000587645.1_RNA|ZNF420_ENST00000304239.7_3'UTR	NM_144689.3	NP_653290.2	Q8TAQ5	ZN420_HUMAN	zinc finger protein 420						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|large_intestine(9)|lung(10)|prostate(1)|skin(3)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			tgactttgtggaacagccata	0.403																																																	0								ENSG00000197050																																			ZNF420	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK056695	CCDS12498.1	19q13.12	2013-01-08			ENSG00000197050	ENSG00000197050		"""Zinc fingers, C2H2-type"", ""-"""	20649	protein-coding gene	gene with protein product							Standard	NM_144689		Approved	FLJ32191	uc002ofl.3	Q8TAQ5	OTTHUMG00000048168	ENST00000337995.3:c.*1189G>T	19.37:g.37621149G>T		Somatic	0	30	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B2RDY6|Q96ML5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337995.3	37	NULL	CCDS12498.1	19																																																																																			-	-		0.403	ZNF420-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF420	protein_coding	OTTHUMT00000109587.3	G	NM_144689	-		37621149	+1	no_errors	ENST00000586540	ensembl	human	known	74_37	rna	SNP	0.000	T
PTPRVP	148713	genome.wustl.edu	37	1	202156135	202156136	+	RNA	INS	-	-	CCTCGCT	rs369231344|rs139095833|rs78957599|rs368169635	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:202156135_202156136insCCTCGCT	ENST00000482597.1	+	0	3411_3412					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		CTGCAGGCCCCcctcgctcctc	0.639														3092	0.617412	0.3094	0.6816	5008	,	,		20478	0.6835		0.7137	False		,,,				2504	0.8211																0								ENSG00000243323																																			PTPRVP			0				HGNC	AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202156136_202156142dupCCTCGCT		Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			-	-		0.639	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	pseudogene	OTTHUMT00000334021.1	-	XM_086287			202156136	+1	no_errors	ENST00000482597	ensembl	human	known	74_37	rna	INS	0.022:0.016	CCTCGCT
PLEKHG5	57449	genome.wustl.edu	37	1	6530806	6530806	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:6530806C>T	ENST00000400915.3	-	15	1765	c.1699G>A	c.(1699-1701)Gtc>Atc	p.V567I	PLEKHG5_ENST00000377732.1_Missense_Mutation_p.V548I|PLEKHG5_ENST00000377748.1_Missense_Mutation_p.V588I|PLEKHG5_ENST00000377737.2_Missense_Mutation_p.V511I|PLEKHG5_ENST00000544978.1_Missense_Mutation_p.V511I|PLEKHG5_ENST00000400913.1_Missense_Mutation_p.V511I|PLEKHG5_ENST00000340850.5_Missense_Mutation_p.V511I|PLEKHG5_ENST00000377725.1_Missense_Mutation_p.V511I|PLEKHG5_ENST00000535355.1_Missense_Mutation_p.V580I|PLEKHG5_ENST00000537245.1_Missense_Mutation_p.V590I|PLEKHG5_ENST00000377740.3_Missense_Mutation_p.V588I|PLEKHG5_ENST00000377728.3_Missense_Mutation_p.V511I	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	567	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		ATGGCGACGACGGCCTCCTTG	0.677																																																	0								ENSG00000171680						15.0	14.0	14.0					1																	6530806		2180	4271	6451	PLEKHG5	SO:0001583	missense	0			-	HGNC	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.1699G>A	1.37:g.6530806C>T	ENSP00000383706:p.Val567Ile	Somatic	0	20	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	3	66.67	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.V590I	ENST00000400915.3	37	c.1768	CCDS41241.1	1	.	.	.	.	.	.	.	.	.	.	c	5.640	0.302682	0.10678	.	.	ENSG00000171680	ENST00000377748;ENST00000340850;ENST00000400913;ENST00000400915;ENST00000377740;ENST00000377732;ENST00000377728;ENST00000377725;ENST00000535355;ENST00000377737;ENST00000535966;ENST00000537245;ENST00000544978	T;T;T;T;T;T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05;0.05	4.7	-0.304	0.12788	Dbl homology (DH) domain (5);	0.332477	0.29205	N	0.012828	T	0.26304	0.0642	N	0.02379	-0.575	0.21841	N	0.999518	B;B;B;B;B	0.17852	0.001;0.004;0.002;0.02;0.024	B;B;B;B;B	0.09377	0.003;0.003;0.004;0.003;0.004	T	0.13495	-1.0507	10	0.20046	T	0.44	-17.4035	3.925	0.09259	0.0:0.2588:0.2009:0.5403	.	580;511;588;588;567	F5GZ21;O94827-4;Q5SY18;O94827-2;O94827	.;.;.;.;PKHG5_HUMAN	I	588;511;511;567;588;548;511;511;580;511;417;590;511	ENSP00000366977:V588I;ENSP00000344570:V511I;ENSP00000383704:V511I;ENSP00000383706:V567I;ENSP00000366969:V588I;ENSP00000366961:V548I;ENSP00000366957:V511I;ENSP00000366954:V511I;ENSP00000441445:V580I;ENSP00000366966:V511I;ENSP00000439625:V590I;ENSP00000437710:V511I	ENSP00000344570:V511I	V	-	1	0	PLEKHG5	6453393	0.380000	0.25131	0.532000	0.27989	0.688000	0.40055	-0.108000	0.10857	0.051000	0.15978	0.457000	0.33378	GTC	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.677	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHG5	protein_coding	OTTHUMT00000002631.1	C	NM_020631	-		6530806	-1	no_errors	ENST00000537245	ensembl	human	known	74_37	missense	SNP	0.965	T
UGT2B15	7366	genome.wustl.edu	37	4	69535762	69535762	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr4:69535762G>A	ENST00000338206.5	-	1	584	c.575C>T	c.(574-576)cCt>cTt	p.P192L		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	192					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	TACATAGGAAGGAGGGAACAG	0.358																																																	0								ENSG00000196620						167.0	166.0	166.0					4																	69535762		2203	4296	6499	UGT2B15	SO:0001583	missense	0			-	HGNC	AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.575C>T	4.37:g.69535762G>A	ENSP00000341045:p.Pro192Leu	Somatic	0	109	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	54	18.18	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.P192L	ENST00000338206.5	37	c.575	CCDS3524.1	4	.	.	.	.	.	.	.	.	.	.	g	4.975	0.181030	0.09443	.	.	ENSG00000196620	ENST00000338206	T	0.62232	0.04	2.79	2.79	0.32731	.	0.182885	0.36409	U	0.002605	T	0.53077	0.1774	L	0.47716	1.5	0.39029	D	0.959908	B	0.22983	0.078	B	0.34931	0.192	T	0.51513	-0.8696	10	0.32370	T	0.25	.	5.72	0.17982	0.1551:0.0:0.8449:0.0	.	192	P54855	UDB15_HUMAN	L	192	ENSP00000341045:P192L	ENSP00000341045:P192L	P	-	2	0	UGT2B15	69218357	1.000000	0.71417	0.686000	0.30086	0.044000	0.14063	6.678000	0.74508	1.536000	0.49237	0.442000	0.29010	CCT	-	pfam_UDP_glucos_trans		0.358	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	protein_coding	OTTHUMT00000365172.1	G	NM_001076	-		69535762	-1	no_errors	ENST00000338206	ensembl	human	known	74_37	missense	SNP	1.000	A
RPS6	6194	genome.wustl.edu	37	9	19378401	19378401	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr9:19378401C>T	ENST00000380394.4	-	4	519	c.461G>A	c.(460-462)cGc>cAc	p.R154H	RP11-513M16.8_ENST00000609982.1_RNA|RPS6_ENST00000380384.1_Missense_Mutation_p.R123H|RPS6_ENST00000498815.1_5'Flank|RPS6_ENST00000315377.4_Missense_Mutation_p.R123H	NM_001010.2	NP_001001.2	P62753	RS6_HUMAN	ribosomal protein S6	154					activation-induced cell death of T cells (GO:0006924)|cellular protein metabolic process (GO:0044267)|erythrocyte development (GO:0048821)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|oogenesis stage (GO:0022605)|placenta development (GO:0001890)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell differentiation in thymus (GO:0033077)|T cell proliferation involved in immune response (GO:0002309)|TOR signaling (GO:0031929)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|dendrite (GO:0030425)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|urinary_tract(1)	7		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		AACATACTGGCGGACATCATC	0.423																																																	0								ENSG00000137154						72.0	73.0	73.0					9																	19378401		2203	4300	6503	RPS6	SO:0001583	missense	0			-	HGNC		CCDS6492.1	9p21	2011-04-05			ENSG00000137154	ENSG00000137154		"""S ribosomal proteins"""	10429	protein-coding gene	gene with protein product	"""40S ribosomal protein S6"", ""phosphoprotein NP33"""	180460				1577483	Standard	NM_001010		Approved	S6	uc003znv.1	P62753	OTTHUMG00000019642	ENST00000380394.4:c.461G>A	9.37:g.19378401C>T	ENSP00000369757:p.Arg154His	Somatic	0	46	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	P08227|P10660|Q4VBY7|Q8N6Z7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_S6e,pirsf_Ribosomal_S6_euk	p.R154H	ENST00000380394.4	37	c.461	CCDS6492.1	9	.	.	.	.	.	.	.	.	.	.	C	21.5	4.160405	0.78226	.	.	ENSG00000137154	ENST00000380394;ENST00000380384;ENST00000315377	T;T;T	0.51817	0.69;0.7;0.7	5.19	5.19	0.71726	.	0.107041	0.64402	D	0.000008	T	0.46092	0.1375	L	0.56280	1.765	0.80722	D	1	B;B	0.18461	0.014;0.028	B;B	0.11329	0.006;0.006	T	0.33777	-0.9855	9	.	.	.	-14.19	19.0715	0.93140	0.0:1.0:0.0:0.0	.	123;154	A2A3R5;P62753	.;RS6_HUMAN	H	154;123;123	ENSP00000369757:R154H;ENSP00000369745:R123H;ENSP00000369743:R123H	.	R	-	2	0	RPS6	19368401	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	7.705000	0.84606	2.578000	0.87016	0.563000	0.77884	CGC	-	pirsf_Ribosomal_S6_euk		0.423	RPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6	protein_coding	OTTHUMT00000051858.1	C	NM_001010	-		19378401	-1	no_errors	ENST00000380394	ensembl	human	known	74_37	missense	SNP	1.000	T
PASD1	139135	genome.wustl.edu	37	X	150840063	150840063	+	Missense_Mutation	SNP	C	C	T	rs201707889		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chrX:150840063C>T	ENST00000370357.4	+	13	1494	c.1249C>T	c.(1249-1251)Cgc>Tgc	p.R417C		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	417						nucleus (GO:0005634)	signal transducer activity (GO:0004871)	p.R417C(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					AAACACATTACGCCACGTTGT	0.498																																																	1	Substitution - Missense(1)	breast(1)						ENSG00000166049	C	CYS/ARG	0,3835		0,0,1632,571	216.0	171.0	186.0		1249	-5.2	0.0	X		186	1,6727		0,1,2427,1872	yes	missense	PASD1	NM_173493.2	180	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	benign	417/774	150840063	1,10562	2203	4300	6503	PASD1	SO:0001583	missense	0			-	HGNC	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1249C>T	X.37:g.150840063C>T	ENSP00000359382:p.Arg417Cys	Somatic	0	17	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	2	81.82	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PAS,smart_PAS,pfscan_PAS	p.R417C	ENST00000370357.4	37	c.1249	CCDS35431.1	X	.	.	.	.	.	.	.	.	.	.	C	3.252	-0.153046	0.06585	0.0	1.49E-4	ENSG00000166049	ENST00000370357	T	0.19250	2.16	3.29	-5.21	0.02815	.	.	.	.	.	T	0.07503	0.0189	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.23940	-1.0174	9	0.38643	T	0.18	-28.8384	1.7157	0.02901	0.1165:0.3389:0.2296:0.315	.	417	Q8IV76	PASD1_HUMAN	C	417	ENSP00000359382:R417C	ENSP00000359382:R417C	R	+	1	0	PASD1	150590719	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.494000	0.02296	-2.249000	0.00702	-2.831000	0.00106	CGC	-	NULL		0.498	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PASD1	protein_coding	OTTHUMT00000060879.2	C	NM_173493	rs201707889		150840063	+1	no_errors	ENST00000370357	ensembl	human	known	74_37	missense	SNP	0.000	T
PSD3	23362	genome.wustl.edu	37	8	18393462	18393462	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr8:18393462G>A	ENST00000327040.8	-	16	3037	c.2935C>T	c.(2935-2937)Cgc>Tgc	p.R979C	PSD3_ENST00000286485.8_Missense_Mutation_p.R445C|PSD3_ENST00000523619.1_Missense_Mutation_p.R914C|PSD3_ENST00000440756.2_Missense_Mutation_p.R981C|PSD3_ENST00000428502.2_Missense_Mutation_p.R308C	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3	980					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		ATTTCATAGCGGGTTTTCTGA	0.478																																																	0								ENSG00000156011						76.0	70.0	72.0					8																	18393462		2203	4300	6503	PSD3	SO:0001583	missense	0			-	HGNC	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.2935C>T	8.37:g.18393462G>A	ENSP00000324127:p.Arg979Cys	Somatic	0	16	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	24	25.00	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom	p.R981C	ENST00000327040.8	37	c.2941	CCDS43720.1	8	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012378	0.54468	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000381690;ENST00000286485;ENST00000428502;ENST00000523619	T;T;T;T	0.33865	2.06;2.06;1.39;2.06	5.8	5.8	0.92144	.	0.000000	0.39759	U	0.001273	T	0.62282	0.2415	M	0.83603	2.65	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;0.932	T	0.66436	-0.5924	10	0.87932	D	0	.	12.4853	0.55868	0.0:0.0:0.8329:0.1671	.	979;980;445;308	E9KL50;Q9NYI0;Q9NYI0-3;B4DKF8	.;PSD3_HUMAN;.;.	C	979;981;201;445;308;914	ENSP00000324127:R979C;ENSP00000401704:R981C;ENSP00000286485:R445C;ENSP00000430640:R914C	ENSP00000286485:R445C	R	-	1	0	PSD3	18437742	1.000000	0.71417	0.996000	0.52242	0.381000	0.30169	5.912000	0.69948	2.733000	0.93635	0.655000	0.94253	CGC	-	NULL		0.478	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSD3	protein_coding	OTTHUMT00000374867.1	G	NM_015310	-		18393462	-1	no_errors	ENST00000440756	ensembl	human	known	74_37	missense	SNP	0.999	A
OR10G8	219869	genome.wustl.edu	37	11	123900388	123900388	+	Missense_Mutation	SNP	C	C	T	rs141086209		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr11:123900388C>T	ENST00000431524.1	+	1	92	c.59C>T	c.(58-60)gCg>gTg	p.A20V		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CATGCCCCAGCGCTGGACGCC	0.567																																																	0								ENSG00000234560						181.0	172.0	175.0					11																	123900388		2201	4299	6500	OR10G8	SO:0001583	missense	0			-	HGNC	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.59C>T	11.37:g.123900388C>T	ENSP00000389072:p.Ala20Val	Somatic	0	94	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	81	7	92.05	B2RNJ3|Q6IEV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A20V	ENST00000431524.1	37	c.59	CCDS31704.1	11	.	.	.	.	.	.	.	.	.	.	c	9.648	1.140764	0.21205	.	.	ENSG00000234560	ENST00000431524	T	0.00444	7.4	2.95	-4.46	0.03536	.	0.839687	0.10105	N	0.715454	T	0.00144	0.0004	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.27640	-1.0068	10	0.33141	T	0.24	.	1.1766	0.01836	0.3869:0.2971:0.1277:0.1884	.	20	Q8NGN5	O10G8_HUMAN	V	20	ENSP00000389072:A20V	ENSP00000389072:A20V	A	+	2	0	OR10G8	123405598	0.000000	0.05858	0.005000	0.12908	0.002000	0.02628	-0.166000	0.09954	-0.645000	0.05458	-1.091000	0.02175	GCG	-	NULL		0.567	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G8	protein_coding	OTTHUMT00000387270.1	C	NM_001004464	-		123900388	+1	no_errors	ENST00000431524	ensembl	human	known	74_37	missense	SNP	0.045	T
ZSCAN1	284312	genome.wustl.edu	37	19	58549417	58549417	+	Silent	SNP	G	G	A	rs143287637	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:58549417G>A	ENST00000282326.1	+	3	460	c.213G>A	c.(211-213)gcG>gcA	p.A71A	ZSCAN1_ENST00000601162.1_Silent_p.A71A|ZSCAN1_ENST00000391700.1_Silent_p.A71A	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	71	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GGCCCGAGGCGCGCTCCAAGG	0.701													G|||	2	0.000399361	0.0008	0.0	5008	,	,		10866	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000152467	G		2,4366		0,2,2182	15.0	15.0	15.0		213	-4.2	0.0	19	dbSNP_134	15	0,8512		0,0,4256	no	coding-synonymous	ZSCAN1	NM_182572.3		0,2,6438	AA,AG,GG		0.0,0.0458,0.0155		71/409	58549417	2,12878	2184	4256	6440	ZSCAN1	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.213G>A	19.37:g.58549417G>A		Somatic	0	29	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	31	29.55	Q3B798|Q6WLH8|Q86WS8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A71	ENST00000282326.1	37	c.213	CCDS12969.1	19																																																																																			-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.701	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN1	protein_coding	OTTHUMT00000466427.1	G	NM_182572	rs143287637		58549417	+1	no_errors	ENST00000282326	ensembl	human	known	74_37	silent	SNP	0.000	A
ADGB	79747	genome.wustl.edu	37	6	147057642	147057642	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr6:147057642G>T	ENST00000397944.3	+	23	2879	c.2803G>T	c.(2803-2805)Gaa>Taa	p.E935*	ADGB_ENST00000367493.3_Nonsense_Mutation_p.E354*	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	935	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						AGACACAAAAGAAAATATCAG	0.303																																																	0								ENSG00000118492						89.0	82.0	84.0					6																	147057642		692	1589	2281	ADGB	SO:0001587	stop_gained	0			-	HGNC	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.2803G>T	6.37:g.147057642G>T	ENSP00000381036:p.Glu935*	Somatic	0	63	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q5T402|Q5T904|Q5T905	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.E935*	ENST00000397944.3	37	c.2803		6	.	.	.	.	.	.	.	.	.	.	G	53	21.016894	0.99936	.	.	ENSG00000118492	ENST00000397944;ENST00000367493	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	17.0303	0.86459	0.0:0.0:1.0:0.0	.	.	.	.	X	935;354	.	ENSP00000356463:E354X	E	+	1	0	C6orf103	147099335	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.591000	0.61019	2.696000	0.92011	0.655000	0.94253	GAA	-	pfscan_IQ_motif_EF-hand-BS		0.303	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	protein_coding	OTTHUMT00000376350.2	G	NM_024694	-		147057642	+1	no_errors	ENST00000397944	ensembl	human	known	74_37	nonsense	SNP	1.000	T
WDR17	116966	genome.wustl.edu	37	4	177094499	177094499	+	Nonsense_Mutation	SNP	T	T	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr4:177094499T>G	ENST00000280190.4	+	27	3599	c.3443T>G	c.(3442-3444)tTa>tGa	p.L1148*	WDR17_ENST00000393643.2_Nonsense_Mutation_p.L1124*|WDR17_ENST00000508596.1_Nonsense_Mutation_p.L1109*|WDR17_ENST00000507824.2_Nonsense_Mutation_p.L1123*			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	1148										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		ACTGAAAAATTACTCTTGCAT	0.333																																																	0								ENSG00000150627						88.0	82.0	84.0					4																	177094499		2203	4300	6503	WDR17	SO:0001587	stop_gained	0			-	HGNC	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.3443T>G	4.37:g.177094499T>G	ENSP00000280190:p.Leu1148*	Somatic	0	98	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	72	8.86	E7EQX0|Q0QD35	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L1148*	ENST00000280190.4	37	c.3443	CCDS3825.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	39|39	7.792046|7.792046	0.98492|0.98492	.|.	.|.	ENSG00000150627|ENSG00000150627	ENST00000443118|ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	.|.	.|.	.|.	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.099373	.|0.40818	.|N	.|0.001006	T|.	0.38161|.	0.1030|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.35226|.	-0.9797|.	3|.	.|0.02654	.|T	.|1	-6.9139|-6.9139	15.7271|15.7271	0.77770|0.77770	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	M|X	382|1109;1124;1148;1124	.|.	.|ENSP00000280190:L1148X	I|L	+|+	3|2	3|0	WDR17|WDR17	177331493|177331493	1.000000|1.000000	0.71417|0.71417	0.044000|0.044000	0.18714|0.18714	0.317000|0.317000	0.28152|0.28152	7.176000|7.176000	0.77643|0.77643	2.123000|2.123000	0.65237|0.65237	0.477000|0.477000	0.44152|0.44152	ATT|TTA	-	NULL		0.333	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	protein_coding	OTTHUMT00000362334.2	T		-		177094499	+1	no_errors	ENST00000280190	ensembl	human	known	74_37	nonsense	SNP	0.294	G
PRIM2	5558	genome.wustl.edu	37	6	57512786	57512787	+	3'UTR	INS	-	-	GC	rs555766381|rs373452397|rs386701662		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr6:57512786_57512787insGC	ENST00000389488.2	+	0	1701_1702				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gttgcactctgttgtgtaattg	0.426																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1699->GC	6.37:g.57512786_57512787insGC		Somatic	0	37	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.426	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	-	NM_000947			57512787	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	INS	0.067:0.057	GC
PRIM2	5558	genome.wustl.edu	37	6	57512785	57512786	+	3'UTR	INS	-	-	CACCAA	rs555766381		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr6:57512785_57512786insCACCAA	ENST00000389488.2	+	0	1700_1701				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tgttgcactctgttgtgtaatt	0.426																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1698->CACCAA	6.37:g.57512785_57512786insCACCAA		Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.426	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	-	NM_000947			57512786	+1	no_errors	ENST00000389488	ensembl	human	known	74_37	rna	INS	0.067:0.067	CACCAA
DNAH3	55567	genome.wustl.edu	37	16	21030952	21030952	+	Nonsense_Mutation	SNP	C	C	A	rs201663699		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr16:21030952C>A	ENST00000261383.3	-	41	6015	c.6016G>T	c.(6016-6018)Gaa>Taa	p.E2006*	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2006					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTACCTCTTTCTGGAAAGATG	0.388																																																	0								ENSG00000158486						178.0	155.0	163.0					16																	21030952		2201	4300	6501	DNAH3	SO:0001587	stop_gained	0			-	HGNC	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.6016G>T	16.37:g.21030952C>A	ENSP00000261383:p.Glu2006*	Somatic	0	126	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	35	22.22	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.E2006*	ENST00000261383.3	37	c.6016	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	46	12.227152	0.99648	.	.	ENSG00000158486	ENST00000261383	.	.	.	5.72	5.72	0.89469	.	8.569490	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	.	19.8862	0.96913	0.0:1.0:0.0:0.0	.	.	.	.	X	2006	.	ENSP00000261383:E2006X	E	-	1	0	DNAH3	20938453	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.628000	0.61282	2.693000	0.91896	0.563000	0.77884	GAA	-	superfamily_P-loop_NTPase		0.388	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	protein_coding	OTTHUMT00000207361.1	C	NM_017539	-		21030952	-1	no_errors	ENST00000261383	ensembl	human	known	74_37	nonsense	SNP	1.000	A
NOD1	10392	genome.wustl.edu	37	7	30491184	30491184	+	Missense_Mutation	SNP	G	G	A	rs140167031		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr7:30491184G>A	ENST00000222823.4	-	6	2374	c.1849C>T	c.(1849-1851)Cgc>Tgc	p.R617C		NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	617					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						AGGGCCTTGCGCTTTCTCCTC	0.612													G|||	1	0.000199681	0.0	0.0	5008	,	,		17946	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000106100	G	CYS/ARG	0,4404		0,0,2202	29.0	33.0	31.0		1849	5.5	1.0	7	dbSNP_134	31	7,8591	5.7+/-21.5	0,7,4292	yes	missense	NOD1	NM_006092.2	180	0,7,6494	AA,AG,GG		0.0814,0.0,0.0538	probably-damaging	617/954	30491184	7,12995	2202	4299	6501	NOD1	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.1849C>T	7.37:g.30491184G>A	ENSP00000222823:p.Arg617Cys	Somatic	0	31	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.29	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.R617C	ENST00000222823.4	37	c.1849	CCDS5427.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.33	3.094209	0.56075	0.0	8.14E-4	ENSG00000106100	ENST00000222823	T	0.71817	-0.6	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.81875	0.4915	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82331	-0.0510	10	0.52906	T	0.07	.	12.0279	0.53382	0.0:0.0:0.7264:0.2736	.	617	Q9Y239	NOD1_HUMAN	C	617	ENSP00000222823:R617C	ENSP00000222823:R617C	R	-	1	0	NOD1	30457709	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	4.798000	0.62510	2.571000	0.86741	0.655000	0.94253	CGC	-	NULL		0.612	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD1	protein_coding	OTTHUMT00000250443.2	G		rs140167031		30491184	-1	no_errors	ENST00000222823	ensembl	human	known	74_37	missense	SNP	1.000	A
TENM4	26011	genome.wustl.edu	37	11	78807961	78807962	+	Intron	DEL	GC	GC	-	rs66695606|rs369257696|rs398016808		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr11:78807961_78807962delGC	ENST00000278550.7	-	5	398				CTD-2337I7.1_ENST00000526091.1_lincRNA	NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4						cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										Gcacgcacatgcgcgcgcgcgc	0.48																																																	0								ENSG00000255345																																			CTD-2337I7.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.65-26907GC>-	11.37:g.78807971_78807972delGC		Somatic	0	10	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000278550.7	37	NULL	CCDS44688.1	11																																																																																			-	-		0.480	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101928921	protein_coding	OTTHUMT00000391406.2	GC				78807962	+1	no_errors	ENST00000526091	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
TRAF7	84231	genome.wustl.edu	37	16	2215902	2215902	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr16:2215902G>T	ENST00000326181.6	+	3	236	c.104G>T	c.(103-105)gGa>gTa	p.G35V		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	35					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						ACGACCTTCGGACCCGCCTTT	0.612																																																	0								ENSG00000131653						146.0	112.0	123.0					16																	2215902		2198	4300	6498	TRAF7	SO:0001583	missense	0			-	HGNC	AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.104G>T	16.37:g.2215902G>T	ENSP00000318944:p.Gly35Val	Somatic	0	50	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	Q9H073	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_TRAF-like,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING,pfscan_Znf_TRAF,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G35V	ENST00000326181.6	37	c.104	CCDS10461.1	16	.	.	.	.	.	.	.	.	.	.	G	19.01	3.743988	0.69418	.	.	ENSG00000131653	ENST00000326181	T	0.27890	1.64	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.36936	0.0985	L	0.34521	1.04	0.80722	D	1	P	0.52463	0.953	P	0.51170	0.661	T	0.20273	-1.0280	10	0.87932	D	0	-28.1076	17.6526	0.88169	0.0:0.0:1.0:0.0	.	35	Q6Q0C0	TRAF7_HUMAN	V	35	ENSP00000318944:G35V	ENSP00000318944:G35V	G	+	2	0	TRAF7	2155903	1.000000	0.71417	0.389000	0.26208	0.549000	0.35272	8.206000	0.89745	2.431000	0.82371	0.455000	0.32223	GGA	-	NULL		0.612	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF7	protein_coding	OTTHUMT00000250762.1	G	NM_032271	-		2215902	+1	no_errors	ENST00000326181	ensembl	human	known	74_37	missense	SNP	0.993	T
MYBPC3	4607	genome.wustl.edu	37	11	47364235	47364235	+	Silent	SNP	G	G	A	rs397515908		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr11:47364235G>A	ENST00000545968.1	-	17	1572	c.1518C>T	c.(1516-1518)gaC>gaT	p.D506D	MYBPC3_ENST00000399249.2_Silent_p.D506D|MYBPC3_ENST00000256993.4_Silent_p.D505D	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	506	Ig-like C2-type 3.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		GTCTCTGCCCGTCCTTCTTGA	0.627																																																	0								ENSG00000134571						169.0	171.0	171.0					11																	47364235		2167	4268	6435	MYBPC3	SO:0001819	synonymous_variant	0			-	HGNC	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.1518C>T	11.37:g.47364235G>A		Somatic	0	44	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D506	ENST00000545968.1	37	c.1518	CCDS53621.1	11																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.627	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYBPC3	protein_coding	OTTHUMT00000392271.3	G		-		47364235	-1	no_errors	ENST00000399249	ensembl	human	known	74_37	silent	SNP	0.919	A
MSLNL	401827	genome.wustl.edu	37	16	830643	830643	+	Intron	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr16:830643G>T	ENST00000442466.1	-	2	37				MSLNL_ENST00000293892.3_Missense_Mutation_p.H120N			Q96KJ4	MSLNL_HUMAN	mesothelin-like						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GTGACAGTGTGCACAGGTAGG	0.562																																																	0								ENSG00000162006						296.0	254.0	268.0					16																	830643		2190	4263	6453	MSLNL	SO:0001627	intron_variant	0			-	HGNC			16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.38-481C>A	16.37:g.830643G>T		Somatic	0	49	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	14	65.85		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mesothelin	p.H120N	ENST00000442466.1	37	c.358		16	.	.	.	.	.	.	.	.	.	.	G	6.832	0.522619	0.13066	.	.	ENSG00000162006	ENST00000293892	T	0.12465	2.68	1.43	-2.86	0.05717	.	.	.	.	.	T	0.08133	0.0203	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32824	-0.9892	5	.	.	.	.	4.6579	0.12628	0.337:0.2193:0.4437:0.0	.	.	.	.	N	120	ENSP00000293892:H120N	.	H	-	1	0	MSLNL	770644	0.022000	0.18835	0.000000	0.03702	0.001000	0.01503	1.246000	0.32803	-1.918000	0.01072	-0.533000	0.04299	CAC	-	NULL		0.562	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	protein_coding		G	NM_001025190	-		830643	-1	no_errors	ENST00000293892	ensembl	human	known	74_37	missense	SNP	0.150	T
RIMBP2	23504	genome.wustl.edu	37	12	130907024	130907024	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr12:130907024G>T	ENST00000261655.4	-	13	2607	c.2444C>A	c.(2443-2445)tCc>tAc	p.S815Y	RP11-117L5.4_ENST00000539532.1_lincRNA	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	815					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CACGGGCCGGGACCTCTGAGG	0.567																																																	0								ENSG00000060709						53.0	44.0	47.0					12																	130907024		2203	4300	6503	RIMBP2	SO:0001583	missense	0			-	HGNC	AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2444C>A	12.37:g.130907024G>T	ENSP00000261655:p.Ser815Tyr	Somatic	0	38	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	31	34.04	Q96ID2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.S815Y	ENST00000261655.4	37	c.2444	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	G	9.793	1.178420	0.21787	.	.	ENSG00000060709	ENST00000261655	T	0.20598	2.06	4.69	3.76	0.43208	.	1.010670	0.07944	N	0.979857	T	0.14056	0.0340	N	0.22421	0.69	0.80722	D	1	B	0.31054	0.306	B	0.28139	0.086	T	0.07635	-1.0762	10	0.02654	T	1	-6.4438	13.68	0.62479	0.0:0.0:0.8394:0.1606	.	815	O15034	RIMB2_HUMAN	Y	815	ENSP00000261655:S815Y	ENSP00000261655:S815Y	S	-	2	0	RIMBP2	129472977	1.000000	0.71417	0.008000	0.14137	0.099000	0.18886	5.339000	0.65953	0.891000	0.36235	0.561000	0.74099	TCC	-	NULL		0.567	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	protein_coding	OTTHUMT00000399520.1	G	NM_015347	-		130907024	-1	no_errors	ENST00000261655	ensembl	human	known	74_37	missense	SNP	0.991	T
NACAD	23148	genome.wustl.edu	37	7	45123761	45123761	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr7:45123761C>T	ENST00000490531.2	-	2	2037	c.2018G>A	c.(2017-2019)gGc>gAc	p.G673D		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	673					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TAAGGTGAGGCCCTCTTCAGC	0.607																																																	0								ENSG00000136274						1.0	2.0	2.0					7																	45123761		151	606	757	NACAD	SO:0001583	missense	0			-	HGNC	AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.2018G>A	7.37:g.45123761C>T	ENSP00000420477:p.Gly673Asp	Somatic	0	76	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nas_poly-pep-assoc_cplx_dom,pfscan_Nas_poly-pep-assoc_cplx_dom	p.G673D	ENST00000490531.2	37	c.2018	CCDS47582.1	7	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.197224	0.00299	.	.	ENSG00000136274	ENST00000490531	T	0.16457	2.34	2.06	-4.11	0.03928	.	.	.	.	.	T	0.08626	0.0214	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27468	-1.0073	9	0.19590	T	0.45	.	5.8212	0.18528	0.1322:0.463:0.0:0.4047	.	673	O15069	NACAD_HUMAN	D	673	ENSP00000420477:G673D	ENSP00000420477:G673D	G	-	2	0	NACAD	45090286	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.945000	0.03909	-3.043000	0.00262	-2.620000	0.00156	GGC	-	NULL		0.607	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACAD	protein_coding	OTTHUMT00000353652.2	C	NM_001146334	-		45123761	-1	no_errors	ENST00000490531	ensembl	human	known	74_37	missense	SNP	0.000	T
DIRC2	84925	genome.wustl.edu	37	3	122514372	122514372	+	Silent	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr3:122514372G>T	ENST00000261038.5	+	1	731	c.333G>T	c.(331-333)ctG>ctT	p.L111L	HSPBAP1_ENST00000383659.1_5'Flank|HSPBAP1_ENST00000465044.1_5'Flank|HSPBAP1_ENST00000306103.2_5'Flank	NM_032839.2	NP_116228.1	Q96SL1	DIRC2_HUMAN	disrupted in renal carcinoma 2	111					transport (GO:0006810)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)				endometrium(2)|large_intestine(1)|lung(14)|prostate(1)	18				GBM - Glioblastoma multiforme(114;0.0614)		TGTGGCTCCTGGACAAGAGAG	0.721																																																	0								ENSG00000138463						15.0	17.0	16.0					3																	122514372		2201	4295	6496	DIRC2	SO:0001819	synonymous_variant	0			-	HGNC	AK027690	CCDS3018.1	3q21.1	2013-05-22			ENSG00000138463	ENSG00000138463		"""Solute carriers"""	16628	protein-coding gene	gene with protein product	"""renal cell carcinoma 4"", ""disrupted in renal cancer protein 2"""	602773				11912179	Standard	NM_032839		Approved	FLJ14784, RCC4	uc003efw.4	Q96SL1	OTTHUMG00000159553	ENST00000261038.5:c.333G>T	3.37:g.122514372G>T		Somatic	0	50	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8K561|Q8NBX9	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_MFS_dom_general_subst_transpt	p.L111	ENST00000261038.5	37	c.333	CCDS3018.1	3																																																																																			-	superfamily_MFS_dom_general_subst_transpt		0.721	DIRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIRC2	protein_coding	OTTHUMT00000356180.2	G	NM_032839	-		122514372	+1	no_errors	ENST00000261038	ensembl	human	known	74_37	silent	SNP	1.000	T
LARP1B	55132	genome.wustl.edu	37	4	129012526	129012526	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr4:129012526A>T	ENST00000326639.6	+	7	738	c.527A>T	c.(526-528)tAt>tTt	p.Y176F	LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000264584.5_Missense_Mutation_p.Y129F|LARP1B_ENST00000427266.1_Missense_Mutation_p.Y176F|LARP1B_ENST00000432347.2_Missense_Mutation_p.Y176F|LARP1B_ENST00000441387.1_Missense_Mutation_p.Y176F|LARP1B_ENST00000512292.1_Missense_Mutation_p.Y176F|LARP1B_ENST00000394288.3_Missense_Mutation_p.Y176F	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	176						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						TCATATGGTTATCAAGAACAT	0.313																																																	0								ENSG00000138709						90.0	87.0	88.0					4																	129012526		2203	4300	6503	LARP1B	SO:0001583	missense	0			-	HGNC		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.527A>T	4.37:g.129012526A>T	ENSP00000321997:p.Tyr176Phe	Somatic	0	65	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.Y176F	ENST00000326639.6	37	c.527	CCDS3738.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.54|13.54	2.269015|2.269015	0.40095|0.40095	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000507377|ENST00000326639;ENST00000512292;ENST00000508819;ENST00000394288;ENST00000432347;ENST00000264584;ENST00000441387;ENST00000427266	.|T;T;T;T;T;T;T;T	.|0.49139	.|1.84;1.39;1.39;0.81;0.79;1.81;1.82;1.39	4.29|4.29	3.05|3.05	0.35203|0.35203	.|.	.|0.225765	.|0.38663	.|N	.|0.001613	T|T	0.33177|0.33177	0.0854|0.0854	L|L	0.38953|0.38953	1.18|1.18	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.27625	.|0.026;0.05;0.05;0.183	.|B;B;B;B	.|0.28011	.|0.02;0.085;0.051;0.085	T|T	0.05178|0.05178	-1.0901|-1.0901	5|10	.|0.10902	.|T	.|0.67	.|.	10.0988|10.0988	0.42491|0.42491	0.6749:0.3251:0.0:0.0|0.6749:0.3251:0.0:0.0	.|.	.|176;176;176;176	.|Q659C4;G3XAJ5;Q659C4-3;G3V0E9	.|LAR1B_HUMAN;.;.;.	F|F	144|176;176;129;176;176;129;176;176	.|ENSP00000321997:Y176F;ENSP00000422850:Y176F;ENSP00000427281:Y129F;ENSP00000377829:Y176F;ENSP00000390395:Y176F;ENSP00000264584:Y129F;ENSP00000396521:Y176F;ENSP00000403586:Y176F	.|ENSP00000264584:Y129F	L|Y	+|+	3|2	2|0	LARP1B|LARP1B	129231976|129231976	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	3.519000|3.519000	0.53458|0.53458	0.759000|0.759000	0.33084|0.33084	0.454000|0.454000	0.30748|0.30748	TTA|TAT	-	NULL		0.313	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LARP1B	protein_coding	OTTHUMT00000257173.2	A	NM_018078	-		129012526	+1	no_errors	ENST00000326639	ensembl	human	known	74_37	missense	SNP	1.000	T
MYH1	4619	genome.wustl.edu	37	17	10405167	10405167	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr17:10405167T>G	ENST00000226207.5	-	25	3267	c.3173A>C	c.(3172-3174)aAa>aCa	p.K1058T	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1058					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCCCTCTAGTTTTCTCTTTGC	0.338																																																	0								ENSG00000109061						96.0	78.0	84.0					17																	10405167		2202	4298	6500	MYH1	SO:0001583	missense	0			-	HGNC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3173A>C	17.37:g.10405167T>G	ENSP00000226207:p.Lys1058Thr	Somatic	0	80	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	54	10.00	Q14CA4|Q9Y622	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K1058T	ENST00000226207.5	37	c.3173	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	T	23.4	4.407677	0.83340	.	.	ENSG00000109061	ENST00000226207	D	0.95518	-3.73	5.62	5.62	0.85841	.	0.000000	0.45867	U	0.000324	D	0.98598	0.9531	H	0.97940	4.11	0.58432	D	0.999999	D	0.71674	0.998	D	0.67231	0.95	D	0.99758	1.1020	10	0.87932	D	0	.	16.1323	0.81449	0.0:0.0:0.0:1.0	.	1058	P12882	MYH1_HUMAN	T	1058	ENSP00000226207:K1058T	ENSP00000226207:K1058T	K	-	2	0	MYH1	10345892	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.910000	0.87451	2.277000	0.76020	0.528000	0.53228	AAA	-	NULL		0.338	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	T	NM_005963	-		10405167	-1	no_errors	ENST00000226207	ensembl	human	known	74_37	missense	SNP	1.000	G
CPNE8	144402	genome.wustl.edu	37	12	39079417	39079417	+	Silent	SNP	A	A	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr12:39079417A>G	ENST00000331366.5	-	16	1242	c.1146T>C	c.(1144-1146)aaT>aaC	p.N382N	CPNE8_ENST00000538596.2_Silent_p.N51N|CPNE8_ENST00000360449.3_Silent_p.N370N	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	382	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				GAGGATTCCCATTCTGTAGAA	0.383																																																	0								ENSG00000139117						88.0	95.0	93.0					12																	39079417		2203	4300	6503	CPNE8	SO:0001819	synonymous_variant	0			-	HGNC	AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.1146T>C	12.37:g.39079417A>G		Somatic	0	59	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	47	9.62	Q2TB41|Q86VY2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.N382	ENST00000331366.5	37	c.1146	CCDS8733.1	12																																																																																			-	pfam_Copine,smart_VWF_A,pfscan_VWF_A		0.383	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	protein_coding	OTTHUMT00000403856.1	A	NM_153634	-		39079417	-1	no_errors	ENST00000331366	ensembl	human	known	74_37	silent	SNP	1.000	G
TRANK1	9881	genome.wustl.edu	37	3	36873669	36873669	+	Missense_Mutation	SNP	G	G	A	rs369117311		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr3:36873669G>A	ENST00000429976.2	-	21	7520	c.7273C>T	c.(7273-7275)Cgc>Tgc	p.R2425C	TRANK1_ENST00000428977.2_Missense_Mutation_p.R1875C|TRANK1_ENST00000301807.6_Missense_Mutation_p.R1875C	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2425							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TTCCAGAGGCGGGCCAGCACC	0.527																																																	0								ENSG00000168016	G	CYS/ARG	0,3866		0,0,1933	104.0	112.0	110.0		7273	4.4	1.0	3		110	1,8287		0,1,4143	no	missense	TRANK1	NM_014831.2	180	0,1,6076	AA,AG,GG		0.0121,0.0,0.0082	benign	2425/2926	36873669	1,12153	1933	4144	6077	TRANK1	SO:0001583	missense	0			-	HGNC	AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.7273C>T	3.37:g.36873669G>A	ENSP00000416168:p.Arg2425Cys	Somatic	0	64	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	29	21.62	Q8N8K0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UvrD-like_ATP-bd,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.R2425C	ENST00000429976.2	37	c.7273	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	G	13.01	2.109344	0.37242	0.0	1.21E-4	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.38401	1.14;1.54;1.14	5.27	4.39	0.52855	.	0.108387	0.41500	N	0.000871	T	0.29126	0.0724	L	0.32530	0.975	0.54753	D	0.99998	B	0.27068	0.167	B	0.20767	0.031	T	0.11324	-1.0592	10	0.87932	D	0	.	14.2186	0.65809	0.0722:0.0:0.9278:0.0	.	2425	O15050	TRNK1_HUMAN	C	1875;2425;1875	ENSP00000416826:R1875C;ENSP00000416168:R2425C;ENSP00000301807:R1875C	ENSP00000301807:R1875C	R	-	1	0	TRANK1	36848673	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.299000	0.59073	1.373000	0.46208	0.561000	0.74099	CGC	-	NULL		0.527	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	protein_coding		G	NM_014831	-		36873669	-1	no_errors	ENST00000429976	ensembl	human	known	74_37	missense	SNP	1.000	A
OR8H2	390151	genome.wustl.edu	37	11	55872824	55872824	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr11:55872824C>A	ENST00000313503.1	+	1	306	c.306C>A	c.(304-306)ttC>ttA	p.F102L		NM_001005200.1	NP_001005200.1	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H, member 2	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(38)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	61	Esophageal squamous(21;0.00693)					CCCAGATGTTCTTTTTTGCCT	0.438										HNSCC(53;0.14)																																							0								ENSG00000181767						302.0	306.0	305.0					11																	55872824		2201	4296	6497	OR8H2	SO:0001583	missense	0			-	HGNC	AB065657	CCDS31518.1	11q11	2012-08-09			ENSG00000181767	ENSG00000181767		"""GPCR / Class A : Olfactory receptors"""	15308	protein-coding gene	gene with protein product							Standard	NM_001005200		Approved		uc010riy.2	Q8N162	OTTHUMG00000166832	ENST00000313503.1:c.306C>A	11.37:g.55872824C>A	ENSP00000323982:p.Phe102Leu	Somatic	0	68	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	35	44.44	Q6IFC1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F102L	ENST00000313503.1	37	c.306	CCDS31518.1	11	.	.	.	.	.	.	.	.	.	.	c	6.512	0.462771	0.12402	.	.	ENSG00000181767	ENST00000313503	T	0.02067	4.47	3.44	-3.67	0.04476	GPCR, rhodopsin-like superfamily (1);	0.761015	0.11716	N	0.536418	T	0.03178	0.0093	M	0.64676	1.99	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.30001	-0.9993	10	0.59425	D	0.04	.	11.003	0.47618	0.0:0.3229:0.0:0.6771	.	102	Q8N162	OR8H2_HUMAN	L	102	ENSP00000323982:F102L	ENSP00000323982:F102L	F	+	3	2	OR8H2	55629400	0.000000	0.05858	0.000000	0.03702	0.100000	0.18952	-1.037000	0.03557	-0.716000	0.04962	0.281000	0.19383	TTC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.438	OR8H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H2	protein_coding	OTTHUMT00000391540.1	C	NM_001005200	-		55872824	+1	no_errors	ENST00000313503	ensembl	human	known	74_37	missense	SNP	0.000	A
TET1	80312	genome.wustl.edu	37	10	70442683	70442683	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr10:70442683delG	ENST00000373644.4	+	10	5214	c.5005delG	c.(5005-5007)gctfs	p.A1669fs		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1669					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GGACTTCTGTGCTCATCCCCA	0.463																																																	0								ENSG00000138336						138.0	121.0	126.0					10																	70442683		2203	4300	6503	TET1	SO:0001589	frameshift_variant	0				HGNC	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5005delG	10.37:g.70442683delG	ENSP00000362748:p.Ala1669fs	Somatic	0	48	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.A1669fs	ENST00000373644.4	37	c.5005	CCDS7281.1	10																																																																																			-	NULL		0.463	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	protein_coding	OTTHUMT00000048354.1	G	NM_030625			70442683	+1	no_errors	ENST00000373644	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ZNF600	162966	genome.wustl.edu	37	19	53270247	53270247	+	Silent	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:53270247G>A	ENST00000338230.3	-	3	1029	c.762C>T	c.(760-762)atC>atT	p.I254I		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	254					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		TTTGACCAAAGATCTTGCCAC	0.383																																					Esophageal Squamous(196;1235 2112 2375 33339 34207)												0								ENSG00000189190						161.0	153.0	156.0					19																	53270247		2203	4300	6503	ZNF600	SO:0001819	synonymous_variant	0			-	HGNC	U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.762C>T	19.37:g.53270247G>A		Somatic	0	76	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	96	10.28	Q6MZR0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I254	ENST00000338230.3	37	c.762	CCDS12856.1	19																																																																																			-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.383	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF600	protein_coding	OTTHUMT00000463093.1	G	NM_198457	-		53270247	-1	no_errors	ENST00000338230	ensembl	human	known	74_37	silent	SNP	0.039	A
LRP1	4035	genome.wustl.edu	37	12	57587731	57587731	+	Missense_Mutation	SNP	C	C	G	rs563379987		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr12:57587731C>G	ENST00000243077.3	+	48	8320	c.7854C>G	c.(7852-7854)atC>atG	p.I2618M	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2618	LDL-receptor class A 13. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGACCTGCATCGGGAACTCCA	0.617																																																	0								ENSG00000123384						100.0	92.0	95.0					12																	57587731		2203	4300	6503	LRP1	SO:0001583	missense	0			-	HGNC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.7854C>G	12.37:g.57587731C>G	ENSP00000243077:p.Ile2618Met	Somatic	0	71	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	101	20.47	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.I2618M	ENST00000243077.3	37	c.7854	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	12.64	1.997677	0.35226	.	.	ENSG00000123384	ENST00000243077	D	0.98381	-4.9	5.09	-8.8	0.00817	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.98595	0.9530	M	0.91406	3.205	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.99945	1.1459	10	0.87932	D	0	.	12.917	0.58211	0.0928:0.1403:0.0:0.7668	.	2618	Q07954	LRP1_HUMAN	M	2618	ENSP00000243077:I2618M	ENSP00000243077:I2618M	I	+	3	3	LRP1	55873998	0.000000	0.05858	0.110000	0.21437	0.515000	0.34225	-3.836000	0.00354	-2.110000	0.00837	-0.906000	0.02833	ATC	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.617	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	C	NM_002332	-		57587731	+1	no_errors	ENST00000243077	ensembl	human	known	74_37	missense	SNP	0.073	G
BTK	695	genome.wustl.edu	37	X	100611813	100611813	+	Silent	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chrX:100611813G>T	ENST00000308731.7	-	14	1471	c.1308C>A	c.(1306-1308)tcC>tcA	p.S436S	BTK_ENST00000372880.1_Intron	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	436	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CTTCAGACATGGAGCCTTCTT	0.448									Agammaglobulinemia, X-linked																																								0								ENSG00000010671						290.0	246.0	261.0					X																	100611813		2203	4300	6503	BTK	SO:0001819	synonymous_variant	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	-	HGNC	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.1308C>A	X.37:g.100611813G>T		Somatic	0	43	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B2RAW1|Q32ML5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.S436	ENST00000308731.7	37	c.1308	CCDS14482.1	X																																																																																			-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.448	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	protein_coding	OTTHUMT00000057532.2	G	NM_000061	-		100611813	-1	no_errors	ENST00000308731	ensembl	human	known	74_37	silent	SNP	1.000	T
NOC3L	64318	genome.wustl.edu	37	10	96109108	96109134	+	Splice_Site	DEL	TCACAGCTTCACAACACATTTCAGATA	TCACAGCTTCACAACACATTTCAGATA	-			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	TCACAGCTTCACAACACATTTCAGATA	TCACAGCTTCACAACACATTTCAGATA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr10:96109108_96109134delTCACAGCTTCACAACACATTTCAGATA	ENST00000371361.3	-	10	1230_1256	c.1130_1156delTATCTGAAATGTGTTGTGAAGCTGTGA	c.(1129-1158)atatctgaaatgtgttgtgaagctgtgaag>aag	p.ISEMCCEAV377del	NOC3L_ENST00000543788.1_Splice_Site_p.ISEMCCEAV115del|NOC3L_ENST00000371350.1_Splice_Site_p.ISEMCCEAV377del|NOC3L_ENST00000463649.1_5'UTR	NM_022451.9	NP_071896.8	Q8WTT2	NOC3L_HUMAN	nucleolar complex associated 3 homolog (S. cerevisiae)	377					fat cell differentiation (GO:0045444)	nuclear speck (GO:0016607)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(17)|lung(5)|ovary(1)|skin(2)|stomach(1)	29		Colorectal(252;0.0897)				AAGAGTTTCTTCACAGCTTCACAACACATTTCAGATATCTGAAAAAT	0.379																																																	0								ENSG00000173145																																			NOC3L	SO:0001630	splice_region_variant	0				HGNC	AL355341	CCDS7433.1	10q23.33	2004-04-20	2005-08-01	2005-08-01	ENSG00000173145	ENSG00000173145			24034	protein-coding gene	gene with protein product		610769	"""chromosome 10 open reading frame 117"""	C10orf117		15564382	Standard	NM_022451		Approved	AD24, FLJ12820, FAD24	uc001kjq.1	Q8WTT2	OTTHUMG00000018788	ENST00000371361.3:c.1129-1TATCTGAAATGTGTTGTGAAGCTGTGA>-	10.37:g.96109108_96109134delTCACAGCTTCACAACACATTTCAGATA		Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q9H5M6|Q9H9D8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CCAAT-binding_factor,pfam_NOC3p,superfamily_ARM-type_fold,pirsf_Nucleolar_cplx-assoc_3	p.ISEMCCEAV377in_frame_del	ENST00000371361.3	37	c.1156_1130	CCDS7433.1	10																																																																																			-	superfamily_ARM-type_fold,pirsf_Nucleolar_cplx-assoc_3		0.379	NOC3L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOC3L	protein_coding	OTTHUMT00000049466.1	TCACAGCTTCACAACACATTTCAGATA	NM_022451		In_Frame_Del	96109134	-1	no_errors	ENST00000371350	ensembl	human	known	74_37	in_frame_del	DEL	0.984:0.526:0.997:0.998:0.981:1.000:1.000:0.980:1.000:1.000:1.000:1.000:1.000:0.998:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.999:1.000:1.000:0.995:1.000	-
SYNE1	23345	genome.wustl.edu	37	6	152552672	152552672	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr6:152552672G>T	ENST00000367255.5	-	114	21494	c.20893C>A	c.(20893-20895)Ctg>Atg	p.L6965M	SYNE1_ENST00000265368.4_Missense_Mutation_p.L6965M|SYNE1_ENST00000423061.1_Missense_Mutation_p.L6894M|SYNE1_ENST00000448038.1_Missense_Mutation_p.L6894M|SYNE1_ENST00000356820.4_Missense_Mutation_p.L1489M|SYNE1_ENST00000341594.5_Missense_Mutation_p.L6577M	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6965					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCCACTGTCAGCTGTTTACAG	0.378										HNSCC(10;0.0054)																																							0								ENSG00000131018						86.0	79.0	81.0					6																	152552672		2203	4300	6503	SYNE1	SO:0001583	missense	0			-	HGNC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20893C>A	6.37:g.152552672G>T	ENSP00000356224:p.Leu6965Met	Somatic	0	71	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L6965M	ENST00000367255.5	37	c.20893	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921569	0.52653	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.58060	0.46;0.45;0.36;0.44;0.57;2.49	6.03	-8.86	0.00795	.	0.000000	0.48286	D	0.000185	T	0.51770	0.1694	L	0.59912	1.85	0.45690	D	0.998608	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.77330	-0.2628	10	0.54805	T	0.06	.	17.3894	0.87426	0.3315:0.0:0.6685:0.0	.	6965;6965;6894	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	M	6965;6894;6965;6894;6577;1489	ENSP00000356224:L6965M;ENSP00000396024:L6894M;ENSP00000265368:L6965M;ENSP00000390975:L6894M;ENSP00000341887:L6577M;ENSP00000349276:L1489M	ENSP00000265368:L6965M	L	-	1	2	SYNE1	152594365	0.881000	0.30235	0.587000	0.28692	0.749000	0.42624	-0.028000	0.12350	-1.919000	0.01071	-1.105000	0.02106	CTG	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.378	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	G	NM_182961	-		152552672	-1	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	SNP	0.845	T
SLC38A10	124565	genome.wustl.edu	37	17	79226885	79226885	+	Missense_Mutation	SNP	G	G	A	rs142761487		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr17:79226885G>A	ENST00000374759.3	-	12	1827	c.1444C>T	c.(1444-1446)Cgc>Tgc	p.R482C	SLC38A10_ENST00000288439.5_Missense_Mutation_p.R482C	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	482					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TGCCCAGGGCGATCGAGCTGT	0.687											OREG0024813	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000157637		CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	68.0	77.0	74.0		1444,1444	4.7	1.0	17	dbSNP_134	74	0,8600		0,0,4300	no	missense,missense	SLC38A10	NM_001037984.1,NM_138570.2	180,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign	482/1120,482/781	79226885	1,13005	2203	4300	6503	SLC38A10	SO:0001583	missense	0			-	HGNC	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.1444C>T	17.37:g.79226885G>A	ENSP00000363891:p.Arg482Cys	Somatic	0	55	0.00	1189	0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	16	66.67	Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AA_transpt_TM	p.R482C	ENST00000374759.3	37	c.1444	CCDS42397.1	17	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025372	0.35701	2.27E-4	0.0	ENSG00000157637	ENST00000374759;ENST00000288439	T;T	0.19938	2.2;2.11	4.69	4.69	0.59074	.	0.382817	0.26646	N	0.023231	T	0.21801	0.0525	L	0.54323	1.7	0.80722	D	1	P;B	0.34546	0.456;0.128	B;B	0.24701	0.055;0.017	T	0.07908	-1.0748	10	0.62326	D	0.03	-33.2671	17.4176	0.87505	0.0:0.0:1.0:0.0	.	482;482	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	C	482	ENSP00000363891:R482C;ENSP00000288439:R482C	ENSP00000288439:R482C	R	-	1	0	SLC38A10	76841480	1.000000	0.71417	0.967000	0.41034	0.031000	0.12232	7.415000	0.80131	2.440000	0.82611	0.500000	0.49745	CGC	-	NULL		0.687	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	protein_coding	OTTHUMT00000397747.1	G	NM_138570	rs142761487		79226885	-1	no_errors	ENST00000374759	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF600	162966	genome.wustl.edu	37	19	53270569	53270569	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:53270569G>A	ENST00000338230.3	-	3	707	c.440C>T	c.(439-441)tCa>tTa	p.S147L		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	147					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		TGGGAGTAGTGAAGAATTCGG	0.393																																					Esophageal Squamous(196;1235 2112 2375 33339 34207)												0								ENSG00000189190						111.0	117.0	115.0					19																	53270569		2202	4300	6502	ZNF600	SO:0001583	missense	0			-	HGNC	U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.440C>T	19.37:g.53270569G>A	ENSP00000344791:p.Ser147Leu	Somatic	0	111	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	89	9.18	Q6MZR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S147L	ENST00000338230.3	37	c.440	CCDS12856.1	19	.	.	.	.	.	.	.	.	.	.	.	10.86	1.469878	0.26423	.	.	ENSG00000189190	ENST00000338230	T	0.17854	2.25	1.15	1.15	0.20763	.	.	.	.	.	T	0.45438	0.1342	M	0.94063	3.49	0.09310	N	1	D	0.54601	0.967	D	0.63597	0.916	T	0.19614	-1.0300	9	0.62326	D	0.03	.	8.2416	0.31662	0.0:0.0:1.0:0.0	.	147	Q6ZNG1	ZN600_HUMAN	L	147	ENSP00000344791:S147L	ENSP00000344791:S147L	S	-	2	0	ZNF600	57962381	0.086000	0.21541	0.002000	0.10522	0.018000	0.09664	0.124000	0.15728	0.979000	0.38497	0.298000	0.19748	TCA	-	NULL		0.393	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF600	protein_coding	OTTHUMT00000463093.1	G	NM_198457	-		53270569	-1	no_errors	ENST00000338230	ensembl	human	known	74_37	missense	SNP	0.003	A
ABCC2	1244	genome.wustl.edu	37	10	101552069	101552069	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr10:101552069G>A	ENST00000370449.4	+	3	399	c.286G>A	c.(286-288)Gtc>Atc	p.V96I	ABCC2_ENST00000496621.1_3'UTR|ABCC2_ENST00000370434.1_Missense_Mutation_p.V96I	NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	96					cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ACAAGCCACAGTCCCTGCTGT	0.468																																																	0								ENSG00000023839						144.0	122.0	129.0					10																	101552069		2203	4300	6503	ABCC2	SO:0001583	missense	0			-	HGNC	U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.286G>A	10.37:g.101552069G>A	ENSP00000359478:p.Val96Ile	Somatic	0	43	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.V96I	ENST00000370449.4	37	c.286	CCDS7484.1	10	.	.	.	.	.	.	.	.	.	.	G	9.149	1.015849	0.19355	.	.	ENSG00000023839	ENST00000370449;ENST00000370434	T;T	0.35421	1.31;1.31	5.37	-0.547	0.11836	.	0.600014	0.17833	N	0.160445	T	0.14960	0.0361	N	0.13043	0.29	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.24048	-1.0171	10	0.12103	T	0.63	-13.2247	4.8055	0.13317	0.4545:0.2763:0.2692:0.0	.	96	Q92887	MRP2_HUMAN	I	96	ENSP00000359478:V96I;ENSP00000359463:V96I	ENSP00000359463:V96I	V	+	1	0	ABCC2	101542059	0.000000	0.05858	0.067000	0.19924	0.830000	0.47004	-0.358000	0.07641	0.134000	0.18681	0.561000	0.74099	GTC	-	tigrfam_Multidrug-R_assoc		0.468	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	protein_coding	OTTHUMT00000049825.1	G	NM_000392	-		101552069	+1	no_errors	ENST00000370449	ensembl	human	known	74_37	missense	SNP	0.000	A
CSE1L	1434	genome.wustl.edu	37	20	47712900	47712900	+	Silent	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr20:47712900G>T	ENST00000262982.2	+	25	2964	c.2841G>T	c.(2839-2841)gtG>gtT	p.V947V	CSE1L_ENST00000396192.3_Silent_p.V891V|CSE1L_ENST00000469700.1_3'UTR|CSE1L_ENST00000542325.1_Silent_p.V730V	NM_001256135.1|NM_001316.3	NP_001243064.1|NP_001307.2	P55060	XPO2_HUMAN	CSE1 chromosome segregation 1-like (yeast)	947					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	importin-alpha export receptor activity (GO:0008262)			breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(11)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	35			BRCA - Breast invasive adenocarcinoma(12;0.000491)|Colorectal(8;0.198)			CATCAATGGTGAGCACCAGCC	0.502																																																	0								ENSG00000124207						138.0	111.0	120.0					20																	47712900		2203	4300	6503	CSE1L	SO:0001819	synonymous_variant	0			-	HGNC	U33286	CCDS13412.1, CCDS58773.1	20q13	2013-05-01	2001-11-28		ENSG00000124207	ENSG00000124207		"""Exportins"""	2431	protein-coding gene	gene with protein product	"""cellular apoptosis susceptibility"""	601342	"""chromosome segregation 1 (yeast homolog)-like"""			8963895, 7479798	Standard	NM_001316		Approved	CAS, XPO2, CSE1	uc002xty.4	P55060	OTTHUMG00000033046	ENST00000262982.2:c.2841G>T	20.37:g.47712900G>T		Somatic	0	47	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A3RLL6|B2R5T4|E1P5Y0|F8W904|O75432|Q32M40|Q9H5B7|Q9NTS0|Q9UP98|Q9UP99|Q9UPA0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CAS_CSE1_C,pfam_Cse1,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.V947	ENST00000262982.2	37	c.2841	CCDS13412.1	20																																																																																			-	pfam_CAS_CSE1_C,superfamily_ARM-type_fold		0.502	CSE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSE1L	protein_coding	OTTHUMT00000080345.2	G	NM_001316	-		47712900	+1	no_errors	ENST00000262982	ensembl	human	known	74_37	silent	SNP	1.000	T
GPR149	344758	genome.wustl.edu	37	3	154055902	154055902	+	Silent	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr3:154055902G>A	ENST00000389740.2	-	4	1881	c.1782C>T	c.(1780-1782)tcC>tcT	p.S594S		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	594					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CAACACTTTTGGATCGATAGA	0.408																																																	0								ENSG00000174948						127.0	127.0	127.0					3																	154055902		1847	4097	5944	GPR149	SO:0001819	synonymous_variant	0			-	HGNC	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.1782C>T	3.37:g.154055902G>A		Somatic	0	75	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	39	25.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.S594	ENST00000389740.2	37	c.1782	CCDS43162.1	3																																																																																			-	NULL		0.408	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	protein_coding	OTTHUMT00000353430.1	G	XM_293580	-		154055902	-1	no_errors	ENST00000389740	ensembl	human	known	74_37	silent	SNP	0.997	A
SVEP1	79987	genome.wustl.edu	37	9	113217882	113217882	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr9:113217882A>C	ENST00000401783.2	-	22	4111	c.3775T>G	c.(3775-3777)Tca>Gca	p.S1259A	SVEP1_ENST00000374469.1_Missense_Mutation_p.S1236A|SVEP1_ENST00000302728.8_Missense_Mutation_p.S1259A|SVEP1_ENST00000467821.1_5'UTR	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	1259	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GTGTAACCTGATGGGCACTCA	0.398																																																	0								ENSG00000165124						72.0	68.0	69.0					9																	113217882		1876	4108	5984	SVEP1	SO:0001583	missense	0			-	HGNC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.3775T>G	9.37:g.113217882A>C	ENSP00000384917:p.Ser1259Ala	Somatic	0	72	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.67	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Growth_fac_rcpt_N_dom,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.S1259A	ENST00000401783.2	37	c.3775	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.118005	0.00349	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728	D;D;D	0.91521	-2.86;-2.86;-2.24	5.79	-2.75	0.05914	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.477333	0.24431	N	0.038587	T	0.70535	0.3235	N	0.03999	-0.3	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.002;0.003	T	0.62690	-0.6801	10	0.06891	T	0.86	.	7.6922	0.28575	0.3115:0.375:0.3134:0.0	.	1259;1259	E9PBN8;Q4LDE5	.;SVEP1_HUMAN	A	1259;1236;1259	ENSP00000384917:S1259A;ENSP00000363593:S1236A;ENSP00000304118:S1259A	ENSP00000304118:S1259A	S	-	1	0	SVEP1	112257703	0.004000	0.15560	0.000000	0.03702	0.086000	0.17979	0.300000	0.19156	-0.385000	0.07833	-1.345000	0.01243	TCA	-	pfam_EG-like_dom,pfam_EGF_extracell,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.398	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	protein_coding		A		-		113217882	-1	no_errors	ENST00000401783	ensembl	human	known	74_37	missense	SNP	0.000	C
SLC5A1	6523	genome.wustl.edu	37	22	32498162	32498162	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr22:32498162G>A	ENST00000266088.4	+	13	1853	c.1603G>A	c.(1603-1605)Gcc>Acc	p.A535T	SLC5A1_ENST00000543737.1_Missense_Mutation_p.A408T	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	535					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	TATCCTCTTCGCCATTTCTTT	0.488																																																	0								ENSG00000100170						400.0	310.0	340.0					22																	32498162		2203	4300	6503	SLC5A1	SO:0001583	missense	0			-	HGNC		CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.1603G>A	22.37:g.32498162G>A	ENSP00000266088:p.Ala535Thr	Somatic	0	48	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	7	80.00	B2R7E2|B7Z4Q9|B7ZA69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.A535T	ENST00000266088.4	37	c.1603	CCDS13902.1	22	.	.	.	.	.	.	.	.	.	.	G	3.414	-0.119540	0.06838	.	.	ENSG00000100170	ENST00000266088;ENST00000543737	T;T	0.79352	-1.26;-1.26	5.75	0.096	0.14488	.	1.516990	0.03493	N	0.216936	T	0.59088	0.2168	N	0.12961	0.28	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40194	-0.9576	10	0.13853	T	0.58	.	4.961	0.14066	0.3456:0.0:0.5236:0.1308	.	535	P13866	SC5A1_HUMAN	T	535;408	ENSP00000266088:A535T;ENSP00000444898:A408T	ENSP00000266088:A535T	A	+	1	0	SLC5A1	30828162	0.976000	0.34144	0.014000	0.15608	0.026000	0.11368	1.918000	0.40006	-0.109000	0.12044	-0.126000	0.14955	GCC	-	NULL		0.488	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A1	protein_coding	OTTHUMT00000075656.3	G	NM_000343	-		32498162	+1	no_errors	ENST00000266088	ensembl	human	known	74_37	missense	SNP	0.061	A
PDCD7	10081	genome.wustl.edu	37	15	65425295	65425295	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr15:65425295G>T	ENST00000204549.4	-	1	879	c.825C>A	c.(823-825)gaC>gaA	p.D275E		NM_005707.1	NP_005698.1	Q8N8D1	PDCD7_HUMAN	programmed cell death 7	275	Arg/Glu-rich.				apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of T cell apoptotic process (GO:0070234)|response to glucocorticoid (GO:0051384)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)				endometrium(4)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7						CCCTCCAGCGGTCAATCTCCT	0.701																																																	0								ENSG00000090470						50.0	50.0	50.0					15																	65425295		2202	4299	6501	PDCD7	SO:0001583	missense	0			-	HGNC	AF083930	CCDS10201.1	15q22.2	2012-06-07			ENSG00000090470	ENSG00000090470			8767	protein-coding gene	gene with protein product	"""U11/U12 snRNP 59K"""	608138				10037816	Standard	NM_005707		Approved	HES18, ES18	uc002aol.3	Q8N8D1	OTTHUMG00000133117	ENST00000204549.4:c.825C>A	15.37:g.65425295G>T	ENSP00000204549:p.Asp275Glu	Somatic	0	35	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q96AK8|Q9Y6D7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D275E	ENST00000204549.4	37	c.825	CCDS10201.1	15	.	.	.	.	.	.	.	.	.	.	g	15.26	2.781432	0.49891	.	.	ENSG00000090470	ENST00000204549;ENST00000431964;ENST00000380204	.	.	.	3.44	2.46	0.29980	.	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	M	0.78049	2.395	0.28921	N	0.892143	B	0.28998	0.23	B	0.27170	0.077	T	0.43956	-0.9359	9	0.48119	T	0.1	-2.9081	4.1242	0.10119	0.2406:0.1931:0.5664:0.0	.	275	Q8N8D1	PDCD7_HUMAN	E	275;60;69	.	ENSP00000204549:D275E	D	-	3	2	PDCD7	63212348	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	1.178000	0.31981	0.674000	0.31244	0.306000	0.20318	GAC	-	NULL		0.701	PDCD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD7	protein_coding	OTTHUMT00000256784.2	G	NM_005707	-		65425295	-1	no_errors	ENST00000204549	ensembl	human	known	74_37	missense	SNP	1.000	T
CADPS	8618	genome.wustl.edu	37	3	62499312	62499312	+	Intron	SNP	C	C	T	rs557590790		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr3:62499312C>T	ENST00000383710.4	-	17	2931				CADPS_ENST00000357948.3_Intron|CADPS_ENST00000283269.9_Splice_Site	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator						catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		TAGGTACTCACGAATGGTTAA	0.433													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18230	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000163618						124.0	98.0	107.0					3																	62499312		2203	4300	6503	CADPS	SO:0001627	intron_variant	0			-	HGNC	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2582-869G>A	3.37:g.62499312C>T		Somatic	0	51	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	20	47.37	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e17+1	ENST00000383710.4	37	c.2650+1	CCDS46858.1	3	.	.	.	.	.	.	.	.	.	.	C	16.06	3.016081	0.54468	.	.	ENSG00000163618	ENST00000283269	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0887	0.97806	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CADPS	62474352	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.825000	0.97269	0.655000	0.94253	.	-	-		0.433	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	protein_coding	OTTHUMT00000351951.5	C	NM_003716, NM_183393, NM_183394	-		62499312	-1	no_errors	ENST00000283269	ensembl	human	known	74_37	splice_site	SNP	1.000	T
TRRAP	8295	genome.wustl.edu	37	7	98569420	98569420	+	Splice_Site	SNP	A	A	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr7:98569420A>G	ENST00000359863.4	+	52	7880		c.e52-1		TRRAP_ENST00000446306.3_Splice_Site|TRRAP_ENST00000355540.3_Splice_Site	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein						chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TTTGTTTCTTAGGATGTAGAG	0.428																																																	0								ENSG00000196367						208.0	224.0	218.0					7																	98569420		2203	4300	6503	TRRAP	SO:0001630	splice_region_variant	0			-	HGNC	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.7672-1A>G	7.37:g.98569420A>G		Somatic	0	81	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	A4D265|O75218|Q9Y631|Q9Y6H4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e51-2	ENST00000359863.4	37	c.7672-2	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	A	16.96	3.265553	0.59431	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306;ENST00000456197	.	.	.	5.69	4.5	0.54988	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.679	0.56912	0.862:0.138:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRRAP	98407356	1.000000	0.71417	0.536000	0.28039	0.673000	0.39480	9.339000	0.96797	0.948000	0.37687	0.533000	0.62120	.	-	-		0.428	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	protein_coding	OTTHUMT00000317978.1	A	NM_003496	-	Intron	98569420	+1	no_errors	ENST00000359863	ensembl	human	known	74_37	splice_site	SNP	0.988	G
SERTAD3	29946	genome.wustl.edu	37	19	40949659	40949659	+	Intron	SNP	C	C	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:40949659C>G	ENST00000322354.3	-	1	491				SERTAD3_ENST00000601217.1_5'Flank|CTC-492K19.4_ENST00000599050.1_RNA|SERTAD3_ENST00000392028.4_5'Flank	NM_203344.2	NP_976219.1	Q9UJW9	SRTD3_HUMAN	SERTA domain containing 3						negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)	7			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACATTGAACTCTTCCCGGCAA	0.542																																																	0								ENSG00000268366						92.0	89.0	90.0					19																	40949659		692	1591	2283	CTC-492K19.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF192529	CCDS12558.1	19q13.2	2008-02-05				ENSG00000167565			17931	protein-coding gene	gene with protein product	"""RPA-binding trans-activator"""	612125				10982866, 11331592	Standard	NM_013368		Approved	RBT1	uc002onv.4	Q9UJW9		ENST00000322354.3:c.5+462G>C	19.37:g.40949659C>G		Somatic	0	40	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	55	12.70	B3KQB3|Q96CQ2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000322354.3	37	NULL	CCDS12558.1	19																																																																																			-	-		0.542	SERTAD3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ENSG00000268366	protein_coding	OTTHUMT00000462573.1	C	NM_013368	-		40949659	+1	no_errors	ENST00000599050	ensembl	human	known	74_37	rna	SNP	0.032	G
PPHLN1	51535	genome.wustl.edu	37	12	42836472	42836472	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr12:42836472delC	ENST00000395568.2	+	11	1138	c.1054delC	c.(1054-1056)cccfs	p.P353fs	PPHLN1_ENST00000256678.8_Frame_Shift_Del_p.P233fs|PPHLN1_ENST00000337898.6_Frame_Shift_Del_p.P298fs|PPHLN1_ENST00000317560.9_Intron|PPHLN1_ENST00000432191.2_Frame_Shift_Del_p.P298fs	NM_016488.6	NP_057572.5	Q8NEY8	PPHLN_HUMAN	periphilin 1	353					keratinization (GO:0031424)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(5)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	16	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		gcaGCAggtaccccctgtgag	0.552																																																	0								ENSG00000134283						130.0	130.0	130.0					12																	42836472		2203	4300	6503	PPHLN1	SO:0001589	frameshift_variant	0				HGNC	AY157850	CCDS8741.1, CCDS31777.1, CCDS41773.1, CCDS44860.1, CCDS44861.1, CCDS55817.1	12q12	2006-10-24				ENSG00000134283			19369	protein-coding gene	gene with protein product		608150					Standard	NM_016488		Approved		uc001rng.1	Q8NEY8		ENST00000395568.2:c.1054delC	12.37:g.42836472delC	ENSP00000378935:p.Pro353fs	Somatic	0	77	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	69	9.21	E9PAX8|Q86YT2|Q8IXN3|Q8TB09|Q96NB9|Q9NXL4|Q9P0P6|Q9P0R9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.P353fs	ENST00000395568.2	37	c.1054	CCDS31777.1	12																																																																																			-	NULL		0.552	PPHLN1-010	KNOWN	basic|CCDS	protein_coding	PPHLN1	protein_coding	OTTHUMT00000404047.1	C	NM_201515			42836472	+1	no_errors	ENST00000395568	ensembl	human	known	74_37	frame_shift_del	DEL	0.319	-
FCGBP	8857	genome.wustl.edu	37	19	40396215	40396215	+	Silent	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:40396215G>A	ENST00000221347.6	-	15	7189	c.7182C>T	c.(7180-7182)caC>caT	p.H2394H		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2394	Cys-rich.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGCGGTCATCGTGGAGGCAGC	0.642																																																	0								ENSG00000090920						2.0	2.0	2.0					19																	40396215		1206	2255	3461	FCGBP	SO:0001819	synonymous_variant	0			-	HGNC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.7182C>T	19.37:g.40396215G>A		Somatic	0	16	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25	O95784	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.H2394	ENST00000221347.6	37	c.7182	CCDS12546.1	19																																																																																			-	smart_VWC_out,smart_VWF_C		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	G	NM_003890	-		40396215	-1	no_errors	ENST00000221347	ensembl	human	known	74_37	silent	SNP	0.017	A
DLGAP1	9229	genome.wustl.edu	37	18	3879946	3879946	+	Silent	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr18:3879946G>T	ENST00000315677.3	-	4	718	c.123C>A	c.(121-123)ccC>ccA	p.P41P	DLGAP1_ENST00000515196.2_Silent_p.P41P|DLGAP1_ENST00000584874.1_Silent_p.P41P|DLGAP1_ENST00000581527.1_Silent_p.P41P|DLGAP1-AS3_ENST00000577649.1_RNA	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	41					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GGTGGTCTGCGGGGTGGTGCT	0.677																																																	0								ENSG00000170579						57.0	56.0	57.0					18																	3879946		2203	4300	6503	DLGAP1	SO:0001819	synonymous_variant	0			-	HGNC	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.123C>A	18.37:g.3879946G>T		Somatic	0	67	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GKAP	p.P41	ENST00000315677.3	37	c.123	CCDS11836.1	18																																																																																			-	NULL		0.677	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	protein_coding	OTTHUMT00000254394.4	G		-		3879946	-1	no_errors	ENST00000315677	ensembl	human	known	74_37	silent	SNP	0.000	T
SCUBE3	222663	genome.wustl.edu	37	6	35205748	35205748	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr6:35205748C>A	ENST00000274938.7	+	7	782	c.782C>A	c.(781-783)aCc>aAc	p.T261N	SCUBE3_ENST00000394681.1_Missense_Mutation_p.T277N	NM_152753.2	NP_689966.2			signal peptide, CUB domain, EGF-like 3											breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	37						GTCCACTGCACCTGCCCTGTG	0.552																																																	0								ENSG00000146197						114.0	95.0	102.0					6																	35205748		2203	4300	6503	SCUBE3	SO:0001583	missense	0			-	HGNC	AF452494.1	CCDS4800.1	6p21.3	2008-02-05	2004-05-19	2004-05-21		ENSG00000146197			13655	protein-coding gene	gene with protein product		614708	"""CUB domain and EGF-like repeat containing 3"""	CEGF3		12270931	Standard	NM_152753		Approved	FLJ34743	uc003okf.1	Q8IX30		ENST00000274938.7:c.782C>A	6.37:g.35205748C>A	ENSP00000274938:p.Thr261Asn	Somatic	0	68	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	4	90.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Thrombomodulin	p.T277N	ENST00000274938.7	37	c.830	CCDS4800.1	6	.	.	.	.	.	.	.	.	.	.	C	16.35	3.098145	0.56183	.	.	ENSG00000146197	ENST00000394681;ENST00000274938	D;D	0.96365	-3.99;-3.99	5.38	3.48	0.39840	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.046777	0.85682	D	0.000000	D	0.92087	0.7492	L	0.50847	1.595	0.36099	D	0.843971	B;B	0.20164	0.012;0.042	B;B	0.24701	0.045;0.055	D	0.90565	0.4518	10	0.72032	D	0.01	.	15.2029	0.73153	0.0:0.2785:0.7215:0.0	.	277;261	Q8IX30-2;Q8IX30	.;SCUB3_HUMAN	N	277;261	ENSP00000378174:T277N;ENSP00000274938:T261N	ENSP00000274938:T261N	T	+	2	0	SCUBE3	35313726	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.548000	0.73896	1.265000	0.44215	-0.479000	0.04858	ACC	-	smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,prints_Thrombomodulin		0.552	SCUBE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE3	protein_coding	OTTHUMT00000040275.1	C	NM_152753	-		35205748	+1	no_errors	ENST00000394681	ensembl	human	known	74_37	missense	SNP	1.000	A
DLGAP4	22839	genome.wustl.edu	37	20	35156622	35156623	+	3'UTR	INS	-	-	T	rs141906314|rs370393999	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr20:35156622_35156623insT	ENST00000339266.5	+	0	4167_4168				RP5-977B1.7_ENST00000439595.1_RNA|RP5-977B1.7_ENST00000425233.1_RNA|DLGAP4_ENST00000475894.1_3'UTR|DLGAP4_ENST00000401952.2_3'UTR|RP5-977B1.7_ENST00000433238.1_RNA|DLGAP4_ENST00000373913.3_3'UTR			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4						cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				TTTCTGTTCTATTTTTTTTTTA	0.574																																																	0								ENSG00000080845																																			DLGAP4	SO:0001624	3_prime_UTR_variant	0				HGNC	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000339266.5:c.*1189->T	20.37:g.35156632_35156632dupT		Somatic	0	39	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000339266.5	37	NULL		20																																																																																			-	-		0.574	DLGAP4-201	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	protein_coding		-	NM_014902			35156623	+1	no_errors	ENST00000475894	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
WDR3	10885	genome.wustl.edu	37	1	118483844	118483844	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr1:118483844G>A	ENST00000349139.5	+	8	934	c.887G>A	c.(886-888)tGc>tAc	p.C296Y	WDR3_ENST00000369441.3_3'UTR	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	296						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		ATTCTTGCTTGCCATGTGAGT	0.413																																																	0								ENSG00000065183						83.0	80.0	81.0					1																	118483844		2203	4300	6503	WDR3	SO:0001583	missense	0			-	HGNC	AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.887G>A	1.37:g.118483844G>A	ENSP00000308179:p.Cys296Tyr	Somatic	0	67	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.C296Y	ENST00000349139.5	37	c.887	CCDS898.1	1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.534757	0.85812	.	.	ENSG00000065183	ENST00000349139	T	0.81078	-1.45	5.7	5.7	0.88788	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.084385	0.85682	D	0.000000	D	0.87018	0.6073	M	0.81497	2.545	0.80722	D	1	D	0.71674	0.998	P	0.60789	0.879	D	0.88514	0.3091	10	0.87932	D	0	-10.5827	16.1291	0.81414	0.0:0.0:0.866:0.134	.	296	Q9UNX4	WDR3_HUMAN	Y	296	ENSP00000308179:C296Y	ENSP00000308179:C296Y	C	+	2	0	WDR3	118285367	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.816000	0.75247	2.673000	0.90976	0.655000	0.94253	TGC	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.413	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	protein_coding	OTTHUMT00000033720.2	G	NM_006784	-		118483844	+1	no_errors	ENST00000349139	ensembl	human	known	74_37	missense	SNP	1.000	A
TENM3	55714	genome.wustl.edu	37	4	183268045	183268045	+	Silent	SNP	A	A	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr4:183268045A>G	ENST00000511685.1	+	3	597	c.474A>G	c.(472-474)acA>acG	p.T158T	TENM3_ENST00000406950.2_Silent_p.T158T			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	158	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCACCCTGACAGATACGGAGC	0.512																																																	0								ENSG00000218336						72.0	76.0	74.0					4																	183268045		1998	4184	6182	TENM3	SO:0001819	synonymous_variant	0			-	HGNC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.474A>G	4.37:g.183268045A>G		Somatic	0	45	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	2	89.47	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.T158	ENST00000511685.1	37	c.474	CCDS47165.1	4																																																																																			-	pfam_Ten_N		0.512	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	protein_coding	OTTHUMT00000361734.1	A		-		183268045	+1	no_errors	ENST00000406950	ensembl	human	known	74_37	silent	SNP	0.997	G
ROBO1	6091	genome.wustl.edu	37	3	79633775	79633776	+	Intron	INS	-	-	TACGTGTA	rs145141260		TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr3:79633775_79633776insTACGTGTA	ENST00000464233.1	-	2	202				AC117479.1_ENST00000401297.1_RNA	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		gtgtgtgtgtgtgtgtgtgtgt	0.406																																																	0								ENSG00000216116																																			AC117479.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.88+5197->TACACGTA	3.37:g.79633775_79633776insTACGTGTA		Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000464233.1	37	NULL	CCDS54611.1	3																																																																																			-	-		0.406	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216116	protein_coding	OTTHUMT00000352610.1	-	NM_002941			79633776	-1	no_errors	ENST00000401297	ensembl	human	novel	74_37	rna	INS	0.001:0.000	TACGTGTA
ZNF529	57711	genome.wustl.edu	37	19	37038807	37038807	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:37038807A>G	ENST00000591340.1	-	5	811	c.653T>C	c.(652-654)cTg>cCg	p.L218P	ZNF529_ENST00000334116.7_Missense_Mutation_p.L113P	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	Esophageal squamous(110;0.198)					ATGAATATTCAGTTGTAACAT	0.294																																																	0								ENSG00000186020						60.0	57.0	58.0					19																	37038807		1824	4081	5905	ZNF529	SO:0001583	missense	0			-	HGNC	AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.653T>C	19.37:g.37038807A>G	ENSP00000465578:p.Leu218Pro	Somatic	0	33	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	K7EKE1|Q9H731|Q9HCF7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L218P	ENST00000591340.1	37	c.653	CCDS54256.1	19	.	.	.	.	.	.	.	.	.	.	A	20.1	3.934156	0.73442	.	.	ENSG00000186020	ENST00000334116	.	.	.	3.68	1.37	0.22104	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46946	0.1419	L	0.55990	1.75	0.43896	D	0.996524	B;B	0.20988	0.05;0.03	B;B	0.24394	0.053;0.014	T	0.47368	-0.9123	8	0.72032	D	0.01	.	3.1013	0.06327	0.4584:0.0:0.1325:0.409	.	113;185	Q6P280-2;Q6P280	.;ZN529_HUMAN	P	218	.	ENSP00000334695:L218P	L	-	2	0	ZNF529	41730647	.	.	0.041000	0.18516	0.942000	0.58702	.	.	0.494000	0.27859	0.482000	0.46254	CTG	-	pfscan_Znf_C2H2		0.294	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF529	protein_coding	OTTHUMT00000452730.1	A	NM_020951	-		37038807	-1	no_errors	ENST00000591340	ensembl	human	known	74_37	missense	SNP	0.995	G
CELP	1057	genome.wustl.edu	37	9	135962501	135962501	+	RNA	DEL	G	G	-	rs370277311|rs371110017|rs386739105|rs386739104|rs386739106|rs11243994	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr9:135962501delG	ENST00000411440.2	+	0	1008					NR_001275.2				carboxyl ester lipase pseudogene																		CTGCCCCCGTGTCCCCCTCAG	0.677																																																	0								ENSG00000170827																																			CELP			0				HGNC	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962501delG		Somatic	0	8	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	45.45		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			-	-		0.677	CELP-002	KNOWN	basic	processed_transcript	CELP	pseudogene	OTTHUMT00000339837.1	G	NM_001808			135962501	+1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	DEL	0.008	-
CCDC74B	91409	genome.wustl.edu	37	2	130900293	130900293	+	Intron	SNP	T	T	C			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr2:130900293T>C	ENST00000310463.6	-	3	433				CCDC74B_ENST00000409128.1_Intron|CCDC74B_ENST00000392984.3_Missense_Mutation_p.Q88R|CCDC74B_ENST00000409943.3_Intron	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B											endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					CCCAGAATCCTGGGCTGGGTG	0.597																																																	0								ENSG00000152076																																			CCDC74B	SO:0001627	intron_variant	0			-	HGNC		CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.296-339A>G	2.37:g.130900293T>C		Somatic	0	41	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	36	14.29	Q6NW18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q88R	ENST00000310463.6	37	c.263	CCDS2155.1	2	.	.	.	.	.	.	.	.	.	.	.	12.50	1.957472	0.34565	.	.	ENSG00000152076	ENST00000392984	T	0.26660	1.72	1.13	-2.01	0.07410	.	1.741270	0.06370	U	0.713309	T	0.15998	0.0385	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.06405	0.002	T	0.33675	-0.9859	9	0.87932	D	0	.	2.213	0.03953	0.0:0.2356:0.3195:0.4449	.	88	E7ESC5	.	R	88	ENSP00000376710:Q88R	ENSP00000376710:Q88R	Q	-	2	0	CCDC74B	130616763	0.333000	0.24731	0.002000	0.10522	0.130000	0.20726	0.607000	0.24209	-0.597000	0.05813	0.373000	0.22412	CAG	-	NULL		0.597	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74B	protein_coding	OTTHUMT00000254522.3	T	NM_207310	-		130900293	-1	no_errors	ENST00000392984	ensembl	human	known	74_37	missense	SNP	0.087	C
ZNF600	162966	genome.wustl.edu	37	19	53270527	53270527	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr19:53270527G>A	ENST00000338230.3	-	3	749	c.482C>T	c.(481-483)tCt>tTt	p.S161F		NM_198457.2	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	161					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(4)|large_intestine(9)|liver(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		ACATTGGAAAGATTTTTCTCT	0.368																																					Esophageal Squamous(196;1235 2112 2375 33339 34207)												0								ENSG00000189190						119.0	127.0	124.0					19																	53270527		2203	4300	6503	ZNF600	SO:0001583	missense	0			-	HGNC	U52096	CCDS12856.1	19q13.42	2013-01-08				ENSG00000189190		"""Zinc fingers, C2H2-type"""	30951	protein-coding gene	gene with protein product						12576331	Standard	NM_198457		Approved	KR-ZNF1, DKFZp686F06123	uc002qab.4	Q6ZNG1		ENST00000338230.3:c.482C>T	19.37:g.53270527G>A	ENSP00000344791:p.Ser161Phe	Somatic	0	133	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	102	10.43	Q6MZR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S161F	ENST00000338230.3	37	c.482	CCDS12856.1	19	.	.	.	.	.	.	.	.	.	.	.	11.84	1.757357	0.31137	.	.	ENSG00000189190	ENST00000338230	T	0.15372	2.43	1.57	0.433	0.16534	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35038	0.0918	M	0.72894	2.215	0.09310	N	1	D	0.71674	0.998	D	0.78314	0.991	T	0.09729	-1.0661	9	0.72032	D	0.01	.	6.769	0.23583	0.1667:0.0:0.8333:0.0	.	161	Q6ZNG1	ZN600_HUMAN	F	161	ENSP00000344791:S161F	ENSP00000344791:S161F	S	-	2	0	ZNF600	57962339	0.056000	0.20664	0.006000	0.13384	0.126000	0.20510	2.228000	0.42981	0.024000	0.15214	0.298000	0.19748	TCT	-	NULL		0.368	ZNF600-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF600	protein_coding	OTTHUMT00000463093.1	G	NM_198457	-		53270527	-1	no_errors	ENST00000338230	ensembl	human	known	74_37	missense	SNP	0.003	A
CASP16	197350	genome.wustl.edu	37	16	3198339	3198339	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr16:3198339G>T	ENST00000428155.1	+	8	1000	c.274G>T	c.(274-276)Ggc>Tgc	p.G92C				P0CB46	CASPG_HUMAN	caspase 16, apoptosis-related cysteine peptidase (putative)	92					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)	cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)										CTCCTGCAGGGGCACCCCTCC	0.597																																																	0								ENSG00000228146																																			CASP16	SO:0001583	missense	0			-	HGNC			16p13.3	2014-04-01			ENSG00000228146	ENSG00000228146			27290	protein-coding gene	gene with protein product						18281271	Standard	XM_003403459		Approved		uc002cuf.1	P0CB46	OTTHUMG00000177520	ENST00000428155.1:c.274G>T	16.37:g.3198339G>T	ENSP00000400592:p.Gly92Cys	Somatic	0	33	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20	p.G92C	ENST00000428155.1	37	c.274		16	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030316	0.54790	.	.	ENSG00000228146	ENST00000428155	.	.	.	4.94	4.94	0.65067	Peptidase C14, caspase catalytic (1);	.	.	.	.	T	0.47021	0.1423	N	0.22421	0.69	0.09310	N	1	D	0.63880	0.993	P	0.59948	0.866	T	0.38286	-0.9668	8	0.52906	T	0.07	.	13.6759	0.62454	0.0:0.0:1.0:0.0	.	92	P0CB46	CS14L_HUMAN	C	159	.	ENSP00000400592:G159C	G	+	1	0	AC108134.2	3138340	0.021000	0.18746	0.010000	0.14722	0.002000	0.02628	1.315000	0.33608	2.278000	0.76064	0.462000	0.41574	GGC	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core		0.597	CASP16-001	KNOWN	basic|appris_principal	protein_coding	CASP16	protein_coding	OTTHUMT00000437342.1	G	XM_003403459	-		3198339	+1	no_errors	ENST00000428155	ensembl	human	known	74_37	missense	SNP	0.032	T
SKIDA1	387640	genome.wustl.edu	37	10	21805466	21805467	+	In_Frame_Ins	INS	-	-	CCTCCT	rs112207161	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr10:21805466_21805467insCCTCCT	ENST00000449193.2	-	4	3537_3538	c.1285_1286insAGGAGG	c.(1285-1287)ggg>gAGGAGGgg	p.428_429insEE	SKIDA1_ENST00000487107.1_5'Flank|SKIDA1_ENST00000444772.3_In_Frame_Ins_p.349_350insEE	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	347						nucleus (GO:0005634)		p.E428_G429insEE(2)									CCCGCTGCccccctcctcctcc	0.619														2708	0.540735	0.916	0.4063	5008	,	,		10303	0.3244		0.5408	False		,,,				2504	0.3517																2	Insertion - In frame(2)	soft_tissue(2)						ENSG00000180592			3173,56,18,597		1435,46,11,246,5,0,0,3,1,175						3.0	1.0		dbSNP_132	7	4189,51,27,3619		1322,36,14,1495,1,0,13,2,9,1051	no	codingComplex	C10orf140	NM_207371.3		2757,82,25,1741,6,0,13,5,10,1226	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		46.8805,17.4558,37.2379				7362,107,45,4216				SKIDA1	SO:0001652	inframe_insertion	0				HGNC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1280_1285dupAGGAGG	10.37:g.21805467_21805472dupCCTCCT	ENSP00000410041:p.Glu427_Glu428dup	Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B1ANA5|Q6ZMX4|Q8N3C3	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.429in_frame_insEE	ENST00000449193.2	37	c.1286_1285	CCDS44363.1	10																																																																																			-	NULL		0.619	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	protein_coding	OTTHUMT00000286950.2	-	NM_207371			21805467	-1	no_errors	ENST00000449193	ensembl	human	known	74_37	in_frame_ins	INS	0.998:1.000	CCTCCT
NARS2	79731	genome.wustl.edu	37	11	78154810	78154811	+	Intron	INS	-	-	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr11:78154810_78154811insA	ENST00000281038.5	-	12	1540				NARS2_ENST00000528850.1_Intron|RP11-452H21.1_ENST00000534168.1_RNA	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)						asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	GCAACCTAAGGAAAAAAAAAAA	0.396																																																	0								ENSG00000254420																																			RP11-452H21.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.1165-6->T	11.37:g.78154821_78154821dupA		Somatic	0	21	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	G3V178	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000281038.5	37	NULL	CCDS8261.1	11																																																																																			-	-		0.396	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254420	protein_coding	OTTHUMT00000391138.2	-	NM_024678			78154811	+1	no_errors	ENST00000534168	ensembl	human	known	74_37	rna	INS	0.247:0.000	A
CLINT1	9685	genome.wustl.edu	37	5	157230696	157230696	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr5:157230696T>A	ENST00000411809.2	-	8	1178	c.974A>T	c.(973-975)gAc>gTc	p.D325V	CLINT1_ENST00000523908.1_Missense_Mutation_p.D325V|CLINT1_ENST00000523094.1_Missense_Mutation_p.D307V|CLINT1_ENST00000530742.1_Missense_Mutation_p.D307V|CLINT1_ENST00000296951.5_Missense_Mutation_p.D307V	NM_014666.3	NP_055481.1	Q14677	EPN4_HUMAN	clathrin interactor 1	325					clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)	clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|lipid binding (GO:0008289)			breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|urinary_tract(1)	21	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ATCAACAAGGTCACCAGATGA	0.393																																					Colon(22;427 587 2170 6147 14291)												0								ENSG00000113282						42.0	44.0	43.0					5																	157230696		1867	4110	5977	CLINT1	SO:0001583	missense	0			-	HGNC	AF434813	CCDS47330.1, CCDS56388.1, CCDS56389.1	5q33.3	2006-06-13			ENSG00000113282	ENSG00000113282			23186	protein-coding gene	gene with protein product		607265				12213833, 12429846	Standard	NM_014666		Approved	ENTH, KIAA0171, EPNR, CLINT	uc011ddv.2	Q14677	OTTHUMG00000163527	ENST00000411809.2:c.974A>T	5.37:g.157230696T>A	ENSP00000388340:p.Asp325Val	Somatic	0	62	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.00	B7Z6F8|D3DQJ6|Q8NAF1|Q96E05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Epsin_dom_N,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.D307V	ENST00000411809.2	37	c.920	CCDS47330.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.4|23.4	4.415018|4.415018	0.83449|0.83449	.|.	.|.	ENSG00000113282|ENSG00000113282	ENST00000523094;ENST00000530742;ENST00000411809;ENST00000296951;ENST00000523908|ENST00000521615	T;T;T;T;T|.	0.51325|.	0.71;0.71;0.73;0.71;0.71|.	5.82|5.82	5.82|5.82	0.92795|0.92795	.|.	0.262756|.	0.44483|.	D|.	0.000458|.	T|.	0.72334|.	0.3447|.	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	B;B|.	0.31241|.	0.315;0.174|.	B;B|.	0.20384|.	0.029;0.019|.	T|.	0.71230|.	-0.4654|.	10|.	0.39692|.	T|.	0.17|.	-14.0014|-14.0014	16.229|16.229	0.82321|0.82321	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	325;325|.	B7Z6F8;Q14677|.	.;EPN4_HUMAN|.	V|C	307;307;325;307;325|41	ENSP00000429345:D307V;ENSP00000433419:D307V;ENSP00000388340:D325V;ENSP00000296951:D307V;ENSP00000429824:D325V|.	ENSP00000296951:D307V|.	D|X	-|-	2|3	0|0	CLINT1|CLINT1	157163274|157163274	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.354000|5.354000	0.66040|0.66040	2.238000|2.238000	0.73509|0.73509	0.529000|0.529000	0.55759|0.55759	GAC|TGA	-	NULL		0.393	CLINT1-001	KNOWN	basic|CCDS	protein_coding	CLINT1	protein_coding	OTTHUMT00000374001.1	T	NM_014666	-		157230696	-1	no_errors	ENST00000296951	ensembl	human	known	74_37	missense	SNP	1.000	A
FOLR2	2350	genome.wustl.edu	37	11	71932687	71932687	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr11:71932687G>T	ENST00000298223.6	+	5	836	c.649G>T	c.(649-651)Gag>Tag	p.E217*	FOLR2_ENST00000449475.2_Nonsense_Mutation_p.E213*|FOLR2_ENST00000454954.2_Nonsense_Mutation_p.E176*	NM_000803.4|NM_001113534.1|NM_001113535.1|NM_001113536.1	NP_000794.3|NP_001107006.1|NP_001107007.1|NP_001107008.1	P14207	FOLR2_HUMAN	folate receptor 2 (fetal)	217					folic acid transport (GO:0015884)	anchored component of external side of plasma membrane (GO:0031362)|extracellular region (GO:0005576)|membrane (GO:0016020)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)			breast(3)|large_intestine(3)|ovary(1)|skin(1)	8					Folic Acid(DB00158)	CAACCCCAACGAGGAAGTGGC	0.577																																																	0								ENSG00000165457						96.0	93.0	94.0					11																	71932687		2200	4293	6493	FOLR2	SO:0001587	stop_gained	0			-	HGNC	AK222539	CCDS8212.1	11q13.3-q14.1	2010-04-08			ENSG00000165457	ENSG00000165457			3793	protein-coding gene	gene with protein product		136425				1133088, 7698003	Standard	NM_000803		Approved		uc009ytf.3	P14207	OTTHUMG00000150394	ENST00000298223.6:c.649G>T	11.37:g.71932687G>T	ENSP00000298223:p.Glu217*	Somatic	0	40	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	Q05CA5|Q6GTE8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Folate_rcpt-like	p.E217*	ENST00000298223.6	37	c.649	CCDS8212.1	11	.	.	.	.	.	.	.	.	.	.	g	21.0	4.078791	0.76528	.	.	ENSG00000165457	ENST00000449475;ENST00000298223;ENST00000454954	.	.	.	4.43	2.54	0.30619	.	0.534882	0.18726	U	0.132867	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	9.3007	0.37845	0.1793:0.0:0.8207:0.0	.	.	.	.	X	213;217;176	.	ENSP00000298223:E217X	E	+	1	0	FOLR2	71610335	0.826000	0.29277	0.593000	0.28771	0.723000	0.41478	2.047000	0.41269	0.501000	0.28013	0.462000	0.41574	GAG	-	NULL		0.577	FOLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLR2	protein_coding	OTTHUMT00000317923.2	G	NM_000803	-		71932687	+1	no_errors	ENST00000298223	ensembl	human	known	74_37	nonsense	SNP	0.778	T
PAPLN	89932	genome.wustl.edu	37	14	73739171	73739171	+	Intron	SNP	C	C	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr14:73739171C>T	ENST00000554301.1	+	26	3830				PAPLN_ENST00000427855.1_Intron|PAPLN_ENST00000555445.1_Intron|PAPLN_ENST00000381166.3_Intron|PAPLN_ENST00000340738.5_Intron|RP4-647C14.3_ENST00000556578.1_RNA			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein							basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		AGAGCTTCCTCACCACCTTCT	0.532																																																	0								ENSG00000258944						83.0	86.0	85.0					14																	73739171		2203	4300	6503	RP4-647C14.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.3668-32C>T	14.37:g.73739171C>T		Somatic	0	14	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000554301.1	37	NULL		14																																																																																			-	-		0.532	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	ENSG00000258944	protein_coding	OTTHUMT00000413182.1	C	NM_173462	-		73739171	-1	no_errors	ENST00000556578	ensembl	human	known	74_37	rna	SNP	0.000	T
TUBGCP5	114791	genome.wustl.edu	37	15	22864212	22864212	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr15:22864212A>T	ENST00000283645.4	+	16	2300	c.2170A>T	c.(2170-2172)Agg>Tgg	p.R724W	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.R724W	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	724					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		GCAAGCTATGAGGAATTTTTT	0.373																																																	0								ENSG00000153575						122.0	120.0	120.0					15																	22864212		2203	4300	6503	TUBGCP5	SO:0001583	missense	0			-	HGNC	AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.2170A>T	15.37:g.22864212A>T	ENSP00000283645:p.Arg724Trp	Somatic	0	81	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	49	15.52	E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TUBGCP	p.R724W	ENST00000283645.4	37	c.2170	CCDS10008.1	15	.	.	.	.	.	.	.	.	.	.	A	25.1	4.605839	0.87157	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.10960	2.82;2.82	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.30603	0.0770	M	0.68317	2.08	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.80764	0.994;0.994	T	0.01977	-1.1236	10	0.87932	D	0	-10.0411	13.7068	0.62644	1.0:0.0:0.0:0.0	.	724;724	Q96RT8;E9PB12	GCP5_HUMAN;.	W	724	ENSP00000283645:R724W;ENSP00000409217:R724W	ENSP00000283645:R724W	R	+	1	2	TUBGCP5	20415653	1.000000	0.71417	0.999000	0.59377	0.963000	0.63663	6.725000	0.74752	2.228000	0.72767	0.482000	0.46254	AGG	-	pfam_TUBGCP		0.373	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP5	protein_coding	OTTHUMT00000250998.2	A	NM_052903	-		22864212	+1	no_errors	ENST00000283645	ensembl	human	known	74_37	missense	SNP	1.000	T
TMEM209	84928	genome.wustl.edu	37	7	129845200	129845224	+	Start_Codon_Del	DEL	CCCGAAAACGCACCATGTCCTCTGG	CCCGAAAACGCACCATGTCCTCTGG	-	rs569579117|rs62491980|rs369367037|rs372766670	byFrequency	TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	CCCGAAAACGCACCATGTCCTCTGG	CCCGAAAACGCACCATGTCCTCTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr7:129845200_129845224delCCCGAAAACGCACCATGTCCTCTGG	ENST00000397622.2	-	0	114_126				TMEM209_ENST00000336804.8_5'UTR|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000473456.1_Start_Codon_Del|SSMEM1_ENST00000297819.3_5'Flank|TMEM209_ENST00000462753.1_5'Flank	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209							integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					CAAACACGACCCCGAAAACGCACCATGTCCTCTGGCCGGAAAACG	0.6																																																	0								ENSG00000146842																																			TMEM209	SO:0001582	initiator_codon_variant	0				HGNC		CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653		7.37:g.129845200_129845224delCCCGAAAACGCACCATGTCCTCTGG		Somatic	NA	NA	NA		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cytochrome_B561-rel	p.M1fs	ENST00000397622.2	37	c.16_1	CCDS47712.1	7																																																																																			-	NULL		0.600	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM209	protein_coding	OTTHUMT00000349339.1	CCCGAAAACGCACCATGTCCTCTGG	NM_032842			129845224	-1	no_errors	ENST00000397622	ensembl	human	known	74_37	frame_shift_del	DEL	0.997:1.000:0.999:0.984:0.992:0.992:0.996:1.000:1.000:1.000:1.000:1.000:1.000:0.990:0.710:0.588	-
DTD1	92675	genome.wustl.edu	37	20	18576785	18576785	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr20:18576785G>T	ENST00000377452.3	+	3	450	c.270G>T	c.(268-270)aaG>aaT	p.K90N	DTD1_ENST00000494921.1_3'UTR	NM_080820.4	NP_543010.3	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1	90					D-amino acid catabolic process (GO:0019478)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			large_intestine(4)|lung(1)|ovary(2)	7						AGGGAAACAAGCCTGATTTCC	0.517																																																	0								ENSG00000125821						112.0	93.0	100.0					20																	18576785		2203	4300	6503	DTD1	SO:0001583	missense	0			-	HGNC	AF332356	CCDS13138.1	20p11.23	2012-09-25	2012-09-25	2007-02-23	ENSG00000125821	ENSG00000125821			16219	protein-coding gene	gene with protein product		610996	"""chromosome 20 open reading frame 88"", ""D-tyrosyl-tRNA deacylase 1 homolog (S. cerevisiae)"""	C20orf88, HARS2			Standard	NM_080820		Approved	DUEB, MGC119131, MGC41905, bA379J5.3, bA555E18.1, pqn-68	uc002wrf.4	Q8TEA8	OTTHUMG00000031980	ENST00000377452.3:c.270G>T	20.37:g.18576785G>T	ENSP00000366672:p.Lys90Asn	Somatic	0	36	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A8K5X5|D3DW37|Q496D1|Q5W184|Q8WXU8|Q9BW67|Q9H464|Q9H474	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DTyrtRNA_deacyls,superfamily_DTD-like_dom,tigrfam_DTyrtRNA_deacyls	p.K90N	ENST00000377452.3	37	c.270	CCDS13138.1	20	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340731	0.81911	.	.	ENSG00000125821	ENST00000377452	.	.	.	5.83	4.87	0.63330	D-Tyr tRNAtyr deacylase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.87212	0.6121	H	0.96777	3.88	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.90770	0.4671	9	0.87932	D	0	-5.0136	14.441	0.67318	0.0719:0.0:0.9281:0.0	.	90	Q8TEA8	DTD1_HUMAN	N	90	.	ENSP00000366672:K90N	K	+	3	2	DTD1	18524785	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.693000	0.47027	2.741000	0.93983	0.655000	0.94253	AAG	-	pfam_DTyrtRNA_deacyls,superfamily_DTD-like_dom,tigrfam_DTyrtRNA_deacyls		0.517	DTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTD1	protein_coding	OTTHUMT00000078189.3	G	NM_080820	-		18576785	+1	no_errors	ENST00000377452	ensembl	human	known	74_37	missense	SNP	1.000	T
ABCA8	10351	genome.wustl.edu	37	17	66877336	66877336	+	Silent	SNP	T	T	C			TCGA-DX-A8BJ-01A-11D-A417-09	TCGA-DX-A8BJ-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	55a38ea9-871b-482d-9404-6ac02887e21d	bfc943c3-2cf7-44cf-ba20-26d7646ae59e	g.chr17:66877336T>C	ENST00000269080.2	-	30	3980	c.3843A>G	c.(3841-3843)ttA>ttG	p.L1281L	ABCA8_ENST00000586539.1_Silent_p.L1321L|ABCA8_ENST00000430352.2_Silent_p.L1321L	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1281	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					TGTGTCCTAATAATCCTAAAA	0.328																																																	0								ENSG00000141338						111.0	102.0	105.0					17																	66877336		2203	4299	6502	ABCA8	SO:0001819	synonymous_variant	0			-	HGNC	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3843A>G	17.37:g.66877336T>C		Somatic	0	78	0.00		0.5936851893625816	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	20	37.50	A1L3U3|C9JQE6|Q86WW0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L1321	ENST00000269080.2	37	c.3963	CCDS11680.1	17																																																																																			-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.328	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	protein_coding	OTTHUMT00000450172.1	T	NM_007168	-		66877336	-1	no_errors	ENST00000430352	ensembl	human	known	74_37	silent	SNP	0.993	C
