#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CDKN2D	1032	genome.wustl.edu	37	19	10676487	10676488	+	IGR	INS	-	-	C	rs61702518|rs34864064|rs570294642	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:10676487_10676488insC	ENST00000393599.2	-	0	1422				KRI1_ENST00000312962.6_Intron|KRI1_ENST00000537964.1_Intron|KRI1_ENST00000361821.5_Frame_Shift_Ins_p.A27fs	NM_001800.3|NM_079421.2	NP_001791.1|NP_524145.1	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)						autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to retinoic acid (GO:0032526)|response to UV (GO:0009411)|response to vitamin D (GO:0033280)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)			endometrium(3)|lung(2)|ovary(1)	6			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			CAGACGGGATGCCCCCCCCCAG	0.733																																																	0								ENSG00000129347																																			KRI1	SO:0001628	intergenic_variant	0				HGNC		CCDS12244.1	19p13	2013-01-10				ENSG00000129355		"""Ankyrin repeat domain containing"""	1790	protein-coding gene	gene with protein product		600927				8575754	Standard	NM_079421		Approved	INK4D, p19	uc002mpa.3	P55273			19.37:g.10676496_10676496dupC		Somatic	0	16	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	50	16.67	Q13102|Q6FGE9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_KRR1-interact_protein_1	p.A27fs	ENST00000393599.2	37	c.80_79	CCDS12244.1	19																																																																																			-	NULL		0.733	CDKN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRI1	protein_coding	OTTHUMT00000452030.1	-	NM_079421			10676488	-1	no_errors	ENST00000361821	ensembl	human	putative	74_37	frame_shift_ins	INS	0.000:0.000	C
AL513487.1	0	genome.wustl.edu	37	X	121605625	121605625	+	RNA	SNP	T	T	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chrX:121605625T>A	ENST00000408390.1	-	0	46																											ttactttaaatggcaaaaacc	0.383													T|||	1	0.000264901	0.0	0.0014	3775	,	,		12371	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000221317																																			AL513487.1			0			-	Clone_based_ensembl_gene																													X.37:g.121605625T>A		Somatic	0	21	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	5	86.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408390.1	37	NULL		X																																																																																			-	-		0.383	AL513487.1-201	NOVEL	basic	miRNA	ENSG00000221317	miRNA		T		-		121605625	-1	no_errors	ENST00000408390	ensembl	human	novel	74_37	rna	SNP	0.030	A
INPP1	3628	genome.wustl.edu	37	2	191235994	191235994	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr2:191235994G>T	ENST00000322522.4	+	6	1522	c.1066G>T	c.(1066-1068)Gaa>Taa	p.E356*	INPP1_ENST00000392329.2_Nonsense_Mutation_p.E356*|INPP1_ENST00000541441.1_Nonsense_Mutation_p.E356*	NM_002194.3	NP_002185.1	P49441	INPP_HUMAN	inositol polyphosphate-1-phosphatase	356					dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	inositol-1,3,4-trisphosphate 1-phosphatase activity (GO:0052829)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|metal ion binding (GO:0046872)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(117;0.000286)|Epithelial(96;0.0186)|all cancers(119;0.057)			GTACCACGTGGAAAATGAGGG	0.522																																					Melanoma(130;184 1743 2185 19805 38428)												0								ENSG00000151689						70.0	72.0	71.0					2																	191235994		2203	4300	6503	INPP1	SO:0001587	stop_gained	0			-	HGNC		CCDS2305.1	2q32	2008-02-07			ENSG00000151689	ENSG00000151689	3.1.3.57		6071	protein-coding gene	gene with protein product		147263				8390685	Standard	NM_002194		Approved		uc010fsb.3	P49441	OTTHUMG00000132672	ENST00000322522.4:c.1066G>T	2.37:g.191235994G>T	ENSP00000325423:p.Glu356*	Somatic	0	66	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.52		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Inositol_monophosphatase	p.E356*	ENST00000322522.4	37	c.1066	CCDS2305.1	2	.	.	.	.	.	.	.	.	.	.	G	41	9.148640	0.99082	.	.	ENSG00000151689	ENST00000392329;ENST00000322522;ENST00000541441	.	.	.	5.19	4.3	0.51218	.	0.437330	0.26300	N	0.025162	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-6.1516	12.452	0.55682	0.0:0.3534:0.6466:0.0	.	.	.	.	X	356	.	ENSP00000325423:E356X	E	+	1	0	INPP1	190944239	0.561000	0.26578	0.884000	0.34674	0.775000	0.43874	1.422000	0.34826	1.385000	0.46445	0.555000	0.69702	GAA	-	pfam_Inositol_monophosphatase		0.522	INPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP1	protein_coding	OTTHUMT00000255932.2	G		-		191235994	+1	no_errors	ENST00000322522	ensembl	human	known	74_37	nonsense	SNP	0.994	T
CDHR1	92211	genome.wustl.edu	37	10	85974228	85974228	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr10:85974228G>A	ENST00000372117.3	+	17	2534	c.2431G>A	c.(2431-2433)Gtg>Atg	p.V811M	CDHR1_ENST00000440770.2_Missense_Mutation_p.V515M|CDHR1_ENST00000332904.3_Intron	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	811	Pro-rich.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CCAGTGGACCGTGCCTACTGT	0.622																																																	0								ENSG00000148600						77.0	85.0	82.0					10																	85974228		2203	4300	6503	CDHR1	SO:0001583	missense	0			-	HGNC	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.2431G>A	10.37:g.85974228G>A	ENSP00000361189:p.Val811Met	Somatic	0	20	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	28	30.00	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V811M	ENST00000372117.3	37	c.2431	CCDS7372.1	10	.	.	.	.	.	.	.	.	.	.	G	19.24	3.788764	0.70337	.	.	ENSG00000148600	ENST00000372117;ENST00000440770	T;T	0.64260	0.2;-0.09	5.49	5.49	0.81192	.	0.054530	0.64402	D	0.000001	T	0.75729	0.3889	M	0.72894	2.215	0.51767	D	0.99993	D;D	0.76494	0.999;0.999	P;D	0.63597	0.908;0.916	T	0.77928	-0.2404	10	0.66056	D	0.02	-17.0735	13.8265	0.63354	0.0:0.1537:0.8463:0.0	.	515;811	E7EN47;Q96JP9	.;CDHR1_HUMAN	M	811;515	ENSP00000361189:V811M;ENSP00000415980:V515M	ENSP00000361189:V811M	V	+	1	0	CDHR1	85964208	1.000000	0.71417	0.959000	0.39883	0.382000	0.30200	4.413000	0.59795	2.584000	0.87258	0.591000	0.81541	GTG	-	NULL		0.622	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR1	protein_coding	OTTHUMT00000049111.1	G	NM_033100	-		85974228	+1	no_errors	ENST00000372117	ensembl	human	known	74_37	missense	SNP	0.997	A
RNF213	57674	genome.wustl.edu	37	17	78360610	78360610	+	Silent	SNP	C	C	T	rs139685293	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr17:78360610C>T	ENST00000582970.1	+	63	14984	c.14841C>T	c.(14839-14841)acC>acT	p.T4947T	RNF213_ENST00000336301.6_Silent_p.T3020T|CTD-2047H16.4_ENST00000572151.1_RNA|CTD-2047H16.4_ENST00000573394.1_RNA|CTD-2047H16.4_ENST00000575034.1_RNA|RNF213_ENST00000508628.2_Silent_p.T4996T|RNF213_ENST00000427003.3_3'UTR	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	4947					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCAGAGAGACCGTGCAGGAGT	0.582													C|||	5	0.000998403	0.0038	0.0	5008	,	,		20239	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000173821	C		20,4386	27.2+/-55.0	0,20,2183	71.0	62.0	65.0		14988	-3.6	0.0	17	dbSNP_134	65	0,8600		0,0,4300	no	coding-synonymous	RNF213	NM_020914.4		0,20,6483	TT,TC,CC		0.0,0.4539,0.1538		4996/5257	78360610	20,12986	2203	4300	6503	RNF213	SO:0001819	synonymous_variant	0			-	HGNC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.14841C>T	17.37:g.78360610C>T		Somatic	0	21	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	20	33.33	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.T4947	ENST00000582970.1	37	c.14841	CCDS58606.1	17																																																																																			-	NULL		0.582	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	protein_coding	OTTHUMT00000443298.1	C	NM_020914	rs139685293		78360610	+1	no_errors	ENST00000582970	ensembl	human	known	74_37	silent	SNP	0.000	T
PHF1	5252	genome.wustl.edu	37	6	33380050	33380050	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr6:33380050delC	ENST00000374516.3	+	2	281	c.10delC	c.(10-12)cccfs	p.P5fs	PHF1_ENST00000374512.3_Frame_Shift_Del_p.P5fs|PHF1_ENST00000459809.1_3'UTR	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	5					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				AATGGCGCAGCCCCCCCGGCT	0.567																																																	0								ENSG00000112511						23.0	25.0	25.0					6																	33380050		2203	4300	6503	PHF1	SO:0001589	frameshift_variant	0				HGNC	AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.10delC	6.37:g.33380050delC	ENSP00000363640:p.Pro5fs	Somatic	0	26	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.R6fs	ENST00000374516.3	37	c.10	CCDS4777.1	6																																																																																			-	NULL		0.567	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF1	protein_coding	OTTHUMT00000076175.3	C				33380050	+1	no_errors	ENST00000374516	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
DNAH8	1769	genome.wustl.edu	37	6	38705605	38705605	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr6:38705605G>A	ENST00000359357.3	+	5	576	c.322G>A	c.(322-324)Gga>Aga	p.G108R	DNAH8_ENST00000441566.1_Missense_Mutation_p.G108R|DNAH8_ENST00000449981.2_Missense_Mutation_p.G325R			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	108					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AAGTATTGAGGGAACAGTGAA	0.259																																																	0								ENSG00000124721						80.0	82.0	82.0					6																	38705605		2203	4300	6503	DNAH8	SO:0001583	missense	0			-	HGNC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.322G>A	6.37:g.38705605G>A	ENSP00000352312:p.Gly108Arg	Somatic	0	57	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	50	19.35	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G108R	ENST00000359357.3	37	c.322		6	.	.	.	.	.	.	.	.	.	.	G	13.57	2.277710	0.40294	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.26373	1.76;1.76;1.74	5.74	5.74	0.90152	.	0.062577	0.64402	D	0.000004	T	0.20659	0.0497	M	0.61703	1.905	0.51482	D	0.999922	B	0.12013	0.005	B	0.19391	0.025	T	0.02184	-1.1199	10	0.62326	D	0.03	.	18.0855	0.89456	0.0:0.0:1.0:0.0	.	108	Q96JB1	DYH8_HUMAN	R	313;313;108;108	ENSP00000333363:G313R;ENSP00000352312:G108R;ENSP00000402294:G108R	ENSP00000333363:G313R	G	+	1	0	DNAH8	38813583	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.472000	0.60189	2.695000	0.91970	0.585000	0.79938	GGA	-	NULL		0.259	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	G	NM_001206927	-		38705605	+1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	SNP	1.000	A
MDN1	23195	genome.wustl.edu	37	6	90450009	90450009	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr6:90450009T>C	ENST00000369393.3	-	32	4652	c.4537A>G	c.(4537-4539)Aaa>Gaa	p.K1513E	MDN1_ENST00000428876.1_Missense_Mutation_p.K1513E			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1513					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CGAAATTTTTTCCCAGCAGTC	0.393																																																	0								ENSG00000112159						120.0	116.0	118.0					6																	90450009		2203	4300	6503	MDN1	SO:0001583	missense	0			-	HGNC	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.4537A>G	6.37:g.90450009T>C	ENSP00000358400:p.Lys1513Glu	Somatic	0	56	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	51	46.32	O15019|Q5T794	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.K1513E	ENST00000369393.3	37	c.4537	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	T	11.39	1.624742	0.28889	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.39229	1.09;1.09	5.25	4.07	0.47477	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.154798	0.56097	D	0.000022	T	0.05593	0.0147	N	0.01779	-0.725	0.32731	N	0.508974	B	0.16603	0.018	B	0.24701	0.055	T	0.28964	-1.0027	10	0.05620	T	0.96	.	12.5888	0.56432	0.0:0.0:0.1389:0.861	.	1513	Q9NU22	MDN1_HUMAN	E	1513	ENSP00000358400:K1513E;ENSP00000413970:K1513E	ENSP00000358400:K1513E	K	-	1	0	MDN1	90506730	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.993000	0.29680	0.922000	0.37019	0.462000	0.41574	AAA	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_Midasin		0.393	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	protein_coding	OTTHUMT00000041514.2	T		-		90450009	-1	no_errors	ENST00000369393	ensembl	human	known	74_37	missense	SNP	0.992	C
IGF2BP1	10642	genome.wustl.edu	37	17	47115649	47115649	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr17:47115649G>A	ENST00000290341.3	+	6	855	c.521G>A	c.(520-522)cGg>cAg	p.R174Q	IGF2BP1_ENST00000431824.2_Intron|RNU6-826P_ENST00000516827.1_RNA	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	174					CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						TTTGGCTCTCGGGGTCAGCCC	0.657																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)												0								ENSG00000159217						31.0	37.0	35.0					17																	47115649		2203	4300	6503	IGF2BP1	SO:0001583	missense	0			-	HGNC	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.521G>A	17.37:g.47115649G>A	ENSP00000290341:p.Arg174Gln	Somatic	0	91	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	104	38.10	C9JT33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.R174Q	ENST00000290341.3	37	c.521	CCDS11543.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.776025	0.96922	.	.	ENSG00000159217	ENST00000290341	T	0.21191	2.02	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000001	T	0.31071	0.0785	L	0.59436	1.845	0.80722	D	1	D	0.54397	0.966	P	0.47626	0.552	T	0.01472	-1.1346	10	0.31617	T	0.26	-22.2604	19.0998	0.93269	0.0:0.0:1.0:0.0	.	174	Q9NZI8	IF2B1_HUMAN	Q	174	ENSP00000290341:R174Q	ENSP00000290341:R174Q	R	+	2	0	IGF2BP1	44470648	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	5.491000	0.66887	2.585000	0.87301	0.655000	0.94253	CGG	-	NULL		0.657	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP1	protein_coding	OTTHUMT00000364046.1	G	NM_006546	-		47115649	+1	no_errors	ENST00000290341	ensembl	human	known	74_37	missense	SNP	1.000	A
LRP1	4035	genome.wustl.edu	37	12	57593005	57593005	+	Silent	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr12:57593005G>A	ENST00000243077.3	+	61	10153	c.9687G>A	c.(9685-9687)caG>caA	p.Q3229Q		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3229					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGCTGAGCCAGGACATCCCGC	0.617																																																	0								ENSG00000123384						295.0	274.0	281.0					12																	57593005		2203	4300	6503	LRP1	SO:0001819	synonymous_variant	0			-	HGNC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.9687G>A	12.37:g.57593005G>A		Somatic	0	18	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	29	21.62	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.Q3229	ENST00000243077.3	37	c.9687	CCDS8932.1	12																																																																																			-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.617	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	G	NM_002332	-		57593005	+1	no_errors	ENST00000243077	ensembl	human	known	74_37	silent	SNP	0.999	A
SELP	6403	genome.wustl.edu	37	1	169572298	169572298	+	Silent	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:169572298C>T	ENST00000263686.6	-	10	1708	c.1671G>A	c.(1669-1671)tcG>tcA	p.S557S	SELP_ENST00000367791.2_Silent_p.S433S|SELP_ENST00000367792.2_Intron|SELP_ENST00000367793.2_Silent_p.S495S|SELP_ENST00000367788.2_Silent_p.S495S|SELP_ENST00000458599.2_Intron|SELP_ENST00000367794.2_Silent_p.S495S|SELP_ENST00000367786.2_Silent_p.S495S	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	557	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	TCCAGCGTCCCGATCGAGTAC	0.448																																																	0								ENSG00000174175						108.0	99.0	102.0					1																	169572298		2203	4300	6503	SELP	SO:0001819	synonymous_variant	0			-	HGNC	BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.1671G>A	1.37:g.169572298C>T		Somatic	0	66	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	48	29.41	Q5R344|Q8IVD1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.S557	ENST00000263686.6	37	c.1671	CCDS1282.1	1																																																																																			-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.448	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	protein_coding	OTTHUMT00000083916.4	C	NM_003005	-		169572298	-1	no_errors	ENST00000263686	ensembl	human	known	74_37	silent	SNP	0.323	T
MUC5B	727897	genome.wustl.edu	37	11	1280228	1280228	+	Silent	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr11:1280228G>T	ENST00000529681.1	+	44	16708	c.16650G>T	c.(16648-16650)ggG>ggT	p.G5550G	MUC5B_ENST00000447027.1_Silent_p.G5553G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5550	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GCCTCTCTGGGGACACCCAGG	0.647																																																	0								ENSG00000117983						35.0	44.0	41.0					11																	1280228		1950	4100	6050	MUC5B	SO:0001819	synonymous_variant	0			-	HGNC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.16650G>T	11.37:g.1280228G>T		Somatic	0	50	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	40	29.82	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G5553	ENST00000529681.1	37	c.16659	CCDS44515.2	11																																																																																			-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	protein_coding	OTTHUMT00000390041.2	G	XM_001126093	-		1280228	+1	no_errors	ENST00000447027	ensembl	human	known	74_37	silent	SNP	0.000	T
ELMOD1	55531	genome.wustl.edu	37	11	107535878	107535878	+	Silent	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr11:107535878G>A	ENST00000265840.7	+	12	1225	c.960G>A	c.(958-960)gcG>gcA	p.A320A	ELMOD1_ENST00000443271.2_Silent_p.A312A|ELMOD1_ENST00000531234.1_Silent_p.A314A	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	320					phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		CAGACATGGCGCTGTGCCCAC	0.478																																																	0								ENSG00000110675						131.0	139.0	136.0					11																	107535878		2062	4204	6266	ELMOD1	SO:0001819	synonymous_variant	0			-	HGNC	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.960G>A	11.37:g.107535878G>A		Somatic	0	53	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	11	45.00	B4E167|G5E9S5|Q9NPW3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Engulfment_cell_motility_ELMO	p.A320	ENST00000265840.7	37	c.960	CCDS44723.1	11																																																																																			-	NULL		0.478	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	ELMOD1	protein_coding	OTTHUMT00000389406.1	G	NM_018712	-		107535878	+1	no_errors	ENST00000265840	ensembl	human	known	74_37	silent	SNP	0.005	A
PREX2	80243	genome.wustl.edu	37	8	69028127	69028127	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr8:69028127G>T	ENST00000288368.4	+	26	3563	c.3286G>T	c.(3286-3288)Gat>Tat	p.D1096Y		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1096					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGAACAGGAAGATTCTGGTCA	0.383																																																	0								ENSG00000046889						175.0	168.0	170.0					8																	69028127		2203	4300	6503	PREX2	SO:0001583	missense	0			-	HGNC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3286G>T	8.37:g.69028127G>T	ENSP00000288368:p.Asp1096Tyr	Somatic	0	41	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	50	10.71	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D1096Y	ENST00000288368.4	37	c.3286	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811959	0.90707	.	.	ENSG00000046889	ENST00000288368;ENST00000396539	T	0.48836	0.8	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.69088	0.3072	L	0.61218	1.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68334	-0.5436	10	0.72032	D	0.01	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	1096	Q70Z35	PREX2_HUMAN	Y	1096;1099	ENSP00000288368:D1096Y	ENSP00000288368:D1096Y	D	+	1	0	PREX2	69190681	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.329000	0.96413	2.937000	0.99478	0.650000	0.86243	GAT	-	NULL		0.383	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	protein_coding	OTTHUMT00000378620.1	G	NM_025170	-		69028127	+1	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	SNP	1.000	T
C4orf19	55286	genome.wustl.edu	37	4	37592165	37592165	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr4:37592165C>T	ENST00000284437.6	+	3	666	c.488C>T	c.(487-489)tCc>tTc	p.S163F	C4orf19_ENST00000381980.4_Missense_Mutation_p.S163F|RP11-36B15.1_ENST00000503034.1_RNA|C4orf19_ENST00000508175.1_Intron	NM_018302.2	NP_060772.2	Q8IY42	CD019_HUMAN	chromosome 4 open reading frame 19	163										large_intestine(1)|lung(3)|skin(3)|stomach(1)|urinary_tract(1)	9						AATGGAGACTCCAGAGCTCCT	0.547																																																	0								ENSG00000154274						73.0	77.0	76.0					4																	37592165		2203	4300	6503	C4orf19	SO:0001583	missense	0			-	HGNC	BC037906	CCDS3442.1	4p14	2008-02-05			ENSG00000154274	ENSG00000154274			25618	protein-coding gene	gene with protein product						12477932	Standard	NM_001104629		Approved	FLJ11017	uc003gsw.4	Q8IY42	OTTHUMG00000128580	ENST00000284437.6:c.488C>T	4.37:g.37592165C>T	ENSP00000284437:p.Ser163Phe	Somatic	0	18	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.28	Q9NV03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S163F	ENST00000284437.6	37	c.488	CCDS3442.1	4	.	.	.	.	.	.	.	.	.	.	C	11.46	1.643985	0.29246	.	.	ENSG00000154274	ENST00000381980;ENST00000284437	T;T	0.33654	1.4;1.4	4.88	-0.2	0.13216	.	0.918221	0.09225	N	0.831408	T	0.29588	0.0738	L	0.59436	1.845	0.09310	N	1	B	0.18013	0.025	B	0.17433	0.018	T	0.40979	-0.9534	10	0.72032	D	0.01	0.0025	1.4167	0.02303	0.2959:0.3509:0.198:0.1552	.	163	Q8IY42	CD019_HUMAN	F	163	ENSP00000371408:S163F;ENSP00000284437:S163F	ENSP00000284437:S163F	S	+	2	0	C4orf19	37268560	0.000000	0.05858	0.000000	0.03702	0.144000	0.21451	0.656000	0.24948	-0.186000	0.10533	0.591000	0.81541	TCC	-	NULL		0.547	C4orf19-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C4orf19	protein_coding	OTTHUMT00000250432.1	C	NM_018302	-		37592165	+1	no_errors	ENST00000284437	ensembl	human	known	74_37	missense	SNP	0.000	T
CLIP2	7461	genome.wustl.edu	37	7	73814723	73814723	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr7:73814723T>A	ENST00000395060.1	+	14	2904	c.2904T>A	c.(2902-2904)gaT>gaA	p.D968E	CLIP2_ENST00000223398.6_Missense_Mutation_p.D968E|CLIP2_ENST00000361545.5_Missense_Mutation_p.D933E			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	968						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CCCTGTCGGATCAGAGGCGCT	0.612																																																	0								ENSG00000106665						83.0	79.0	81.0					7																	73814723		2203	4300	6503	CLIP2	SO:0001583	missense	0			-	HGNC	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.2904T>A	7.37:g.73814723T>A	ENSP00000378500:p.Asp968Glu	Somatic	0	42	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	51	25.00	O14527|O43611	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.D968E	ENST00000395060.1	37	c.2904	CCDS5569.1	7	.	.	.	.	.	.	.	.	.	.	T	5.616	0.298435	0.10622	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.58506	0.36;0.33;0.36	4.72	-9.44	0.00603	.	0.407157	0.26293	N	0.025211	T	0.20536	0.0494	N	0.12746	0.255	0.29035	N	0.885476	B;B	0.06786	0.001;0.0	B;B	0.11329	0.006;0.003	T	0.45101	-0.9284	10	0.02654	T	1	-12.0682	4.2079	0.10497	0.1529:0.34:0.4:0.1071	.	933;968	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	E	968;968;933;968	ENSP00000223398:D968E;ENSP00000355151:D933E;ENSP00000378500:D968E	ENSP00000223398:D968E	D	+	3	2	CLIP2	73452659	0.008000	0.16893	0.353000	0.25747	0.880000	0.50808	-1.094000	0.03359	-1.474000	0.01879	-0.474000	0.04947	GAT	-	NULL		0.612	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	protein_coding	OTTHUMT00000252556.1	T	NM_003388	-		73814723	+1	no_errors	ENST00000223398	ensembl	human	known	74_37	missense	SNP	0.618	A
GRIA4	2893	genome.wustl.edu	37	11	105795174	105795174	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr11:105795174A>G	ENST00000530497.1	+	11	1526	c.1526A>G	c.(1525-1527)gAg>gGg	p.E509G	GRIA4_ENST00000393127.2_Missense_Mutation_p.E509G|GRIA4_ENST00000282499.5_Missense_Mutation_p.E509G|GRIA4_ENST00000525187.1_Missense_Mutation_p.E509G			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	509					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		GTACGAGAGGAGGTCATTGAC	0.398																																																	0								ENSG00000152578						136.0	134.0	134.0					11																	105795174		2202	4299	6501	GRIA4	SO:0001583	missense	0			-	HGNC	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.1526A>G	11.37:g.105795174A>G	ENSP00000435775:p.Glu509Gly	Somatic	0	55	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	Q86XE8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E509G	ENST00000530497.1	37	c.1526	CCDS8333.1	11	.	.	.	.	.	.	.	.	.	.	A	24.7	4.560272	0.86335	.	.	ENSG00000152578	ENST00000282499;ENST00000393127;ENST00000530497;ENST00000525187	T;T;T;T	0.39997	1.05;1.05;1.05;1.05	5.56	5.56	0.83823	Ionotropic glutamate receptor (1);	0.067087	0.64402	D	0.000009	T	0.65616	0.2708	M	0.75150	2.29	0.80722	D	1	P;D	0.89917	0.76;1.0	B;D	0.87578	0.343;0.998	T	0.69734	-0.5065	10	0.87932	D	0	.	16.002	0.80301	1.0:0.0:0.0:0.0	.	509;509	P48058;G3V164	GRIA4_HUMAN;.	G	509	ENSP00000282499:E509G;ENSP00000376835:E509G;ENSP00000435775:E509G;ENSP00000432180:E509G	ENSP00000282499:E509G	E	+	2	0	GRIA4	105300384	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.287000	0.95975	2.241000	0.73720	0.533000	0.62120	GAG	-	pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.398	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	protein_coding	OTTHUMT00000388593.1	A		-		105795174	+1	no_errors	ENST00000282499	ensembl	human	known	74_37	missense	SNP	1.000	G
PXDNL	137902	genome.wustl.edu	37	8	52287285	52287285	+	Silent	SNP	G	G	A	rs376124066		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr8:52287285G>A	ENST00000356297.4	-	18	3664	c.3564C>T	c.(3562-3564)taC>taT	p.Y1188Y	PXDNL_ENST00000543296.1_Silent_p.Y1188Y	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1188					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				CTGGAGAGCCGTACAACCTGG	0.478																																																	0								ENSG00000147485	G		1,4053		0,1,2026	55.0	55.0	55.0		3564	-6.1	0.0	8		55	0,8396		0,0,4198	no	coding-synonymous	PXDNL	NM_144651.4		0,1,6224	AA,AG,GG		0.0,0.0247,0.0080		1188/1464	52287285	1,12449	2027	4198	6225	PXDNL	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3564C>T	8.37:g.52287285G>A		Somatic	0	51	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	18	66.04	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.Y1188	ENST00000356297.4	37	c.3564	CCDS47855.1	8																																																																																			-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,prints_Haem_peroxidase_animal_subgr,pfscan_Haem_peroxidase_animal		0.478	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	protein_coding	OTTHUMT00000377905.1	G	NM_144651	-		52287285	-1	no_errors	ENST00000356297	ensembl	human	known	74_37	silent	SNP	0.001	A
ALOX5	240	genome.wustl.edu	37	10	45939709	45939709	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr10:45939709C>T	ENST00000374391.2	+	13	1873	c.1820C>T	c.(1819-1821)gCg>gTg	p.A607V	RP11-67C2.2_ENST00000435635.1_RNA|ALOX5_ENST00000542434.1_Intron	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	607	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	GCAGTGTGGGCGCTGAGCCAG	0.667																																																	0								ENSG00000012779						14.0	14.0	14.0					10																	45939709		2144	4213	6357	ALOX5	SO:0001583	missense	0			-	HGNC	J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1820C>T	10.37:g.45939709C>T	ENSP00000363512:p.Ala607Val	Somatic	0	99	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	86	25	77.48	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C,pfscan_PLAT/LH2_dom	p.A607V	ENST00000374391.2	37	c.1820	CCDS7212.1	10	.	.	.	.	.	.	.	.	.	.	C	16.36	3.102526	0.56183	.	.	ENSG00000012779	ENST00000374391	D	0.89196	-2.48	4.91	4.91	0.64330	Lipoxygenase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.89392	0.6702	L	0.35249	1.045	0.80722	D	1	D;D	0.89917	0.999;1.0	P;P	0.60236	0.846;0.871	D	0.87271	0.2286	10	0.27082	T	0.32	-34.4302	15.6441	0.77033	0.0:1.0:0.0:0.0	.	575;607	E5FPY8;P09917	.;LOX5_HUMAN	V	607	ENSP00000363512:A607V	ENSP00000363512:A607V	A	+	2	0	ALOX5	45259715	1.000000	0.71417	0.972000	0.41901	0.990000	0.78478	7.651000	0.83577	2.559000	0.86315	0.650000	0.86243	GCG	-	pfam_LipOase_C,superfamily_LipOase_C,prints_LipOase_mml		0.667	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	protein_coding	OTTHUMT00000047780.1	C		-		45939709	+1	no_errors	ENST00000374391	ensembl	human	known	74_37	missense	SNP	1.000	T
AC010970.1	0	genome.wustl.edu	37	Y	10034012	10034012	+	RNA	DEL	T	T	-	rs74404714		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chrY:10034012delT	ENST00000516157.2	+	0	32																											CTAGGCGGGCTGCCGAGGGAC	0.687																																																	0								ENSG00000251966																																			AC010970.1			0				Clone_based_ensembl_gene																													Y.37:g.10034012delT		Somatic	0	18	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000516157.2	37	NULL		Y																																																																																			-	-		0.687	AC010970.1-201	NOVEL	basic	miRNA	ENSG00000251966	miRNA		T				10034012	+1	no_errors	ENST00000516157	ensembl	human	novel	74_37	rna	DEL	0.001	-
BX119917.1	0	genome.wustl.edu	37	X	71372204	71372213	+	RNA	DEL	CGCGCACACA	CGCGCACACA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs199642163		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	CGCGCACACA	CGCGCACACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chrX:71372204_71372213delCGCGCACACA	ENST00000401114.1	-	0	51_60																											TGCATGCGCGCGCGcacacacacacacaca	0.51																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372204_71372213delCGCGCACACA		Somatic	NA	NA	NA		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.510	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCACACA				71372213	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.001:0.015:0.009:0.008:0.004:0.003:0.003	-
AK5	26289	genome.wustl.edu	37	1	77857164	77857165	+	Intron	INS	-	-	TA	rs67977834	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:77857164_77857165insTA	ENST00000354567.2	+	7	1154				AK5_ENST00000344720.5_Intron|AC095030.1_ENST00000408737.1_RNA	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5						ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						atatgtgtgtgtgtatgtgtgt	0.238																																																	0								ENSG00000221664																																			AC095030.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.892-19501->TA	1.37:g.77857164_77857165insTA		Somatic	0	45	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	88	10.20	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354567.2	37	NULL	CCDS675.1	1																																																																																			-	-		0.238	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221664	protein_coding	OTTHUMT00000026993.4	-	NM_174858			77857165	-1	no_errors	ENST00000408737	ensembl	human	novel	74_37	rna	INS	0.989:0.989	TA
RP11-114H24.7	0	genome.wustl.edu	37	15	78209076	78209077	+	lincRNA	INS	-	-	C	rs370717874		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr15:78209076_78209077insC	ENST00000565869.1	+	0	111				RN7SL214P_ENST00000487317.2_RNA|RP11-114H24.2_ENST00000567226.1_RNA																							CCTTTTAAGAACAAGATCTTGC	0.52																																																	0								ENSG00000242066																																			RN7SL214P			0				HGNC																													15.37:g.78209077_78209077dupC		Somatic	0	41	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	44	13.73		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000565869.1	37	NULL		15																																																																																			-	-		0.520	RP11-114H24.7-001	KNOWN	basic	lincRNA	RN7SL214P	lincRNA	OTTHUMT00000421587.1	-				78209077	-1	no_errors	ENST00000487317	ensembl	human	known	74_37	rna	INS	0.000:0.000	C
ZNF835	90485	genome.wustl.edu	37	19	57184372	57184372	+	5'Flank	SNP	A	A	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:57184372A>T	ENST00000537055.2	-	0	0				AC007228.5_ENST00000599726.1_lincRNA|AC007228.9_ENST00000602145.1_lincRNA	NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						TTTTTTTTTTAAAGTTTGTTT	0.279																																																	0								ENSG00000268568																																			AC007228.9	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0			19.37:g.57184372A>T	Exception_encountered	Somatic	0	54	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	78	8.24	B7Z5Y0|G3V1S0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000537055.2	37	NULL	CCDS56105.1	19																																																																																			-	-		0.279	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000268568	protein_coding	OTTHUMT00000459800.1	A	NM_001005850	-		57184372	-1	no_errors	ENST00000602145	ensembl	human	known	74_37	rna	SNP	0.999	T
AIPL1	23746	genome.wustl.edu	37	17	6330048	6330048	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr17:6330048T>A	ENST00000381129.3	-	5	751	c.671A>T	c.(670-672)aAg>aTg	p.K224M	AIPL1_ENST00000571740.1_Missense_Mutation_p.K216M|AIPL1_ENST00000250087.5_Missense_Mutation_p.K161M|AIPL1_ENST00000576776.1_Intron|AIPL1_ENST00000576307.1_Missense_Mutation_p.K164M|AIPL1_ENST00000574506.1_Missense_Mutation_p.K212M|AIPL1_ENST00000575265.1_Missense_Mutation_p.K224M|AIPL1_ENST00000570466.1_Missense_Mutation_p.K202M	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	224					negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		CTTCTCCAGCTTCAGCCACTG	0.587																																																	0								ENSG00000129221						112.0	78.0	90.0					17																	6330048		2203	4300	6503	AIPL1	SO:0001583	missense	0			-	HGNC	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.671A>T	17.37:g.6330048T>A	ENSP00000370521:p.Lys224Met	Somatic	0	30	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	32	40.74	D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PPIase_FKBP_dom,smart_TPR_repeat,pfscan_TPR-contain_dom	p.K224M	ENST00000381129.3	37	c.671	CCDS11075.1	17	.	.	.	.	.	.	.	.	.	.	T	18.54	3.645222	0.67358	.	.	ENSG00000129221	ENST00000381129;ENST00000381128;ENST00000250087;ENST00000444243	T;T	0.75589	-0.95;-0.95	5.15	5.15	0.70609	Elongated TPR repeat-containing domain (1);	0.091014	0.85682	D	0.000000	D	0.82531	0.5057	L	0.58101	1.795	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.988;0.995;0.997;1.0;0.991	P;P;D;D;P	0.71414	0.848;0.819;0.973;0.957;0.827	D	0.83972	0.0327	10	0.62326	D	0.03	-52.811	12.9088	0.58169	0.0:0.0:0.0:1.0	.	202;224;161;164;224	Q659W4;F1T0C4;Q9NZN9-3;Q9NZN9-2;Q9NZN9	.;.;.;.;AIPL1_HUMAN	M	224;164;161;224	ENSP00000370521:K224M;ENSP00000250087:K161M	ENSP00000250087:K161M	K	-	2	0	AIPL1	6270772	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.886000	0.69743	1.931000	0.55961	0.402000	0.26972	AAG	-	NULL		0.587	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AIPL1	protein_coding	OTTHUMT00000219828.3	T	NM_014336	-		6330048	-1	no_errors	ENST00000381129	ensembl	human	known	74_37	missense	SNP	1.000	A
CLIP2	7461	genome.wustl.edu	37	7	73814724	73814724	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr7:73814724C>T	ENST00000395060.1	+	14	2905	c.2905C>T	c.(2905-2907)Cag>Tag	p.Q969*	CLIP2_ENST00000223398.6_Nonsense_Mutation_p.Q969*|CLIP2_ENST00000361545.5_Nonsense_Mutation_p.Q934*			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	969						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CCTGTCGGATCAGAGGCGCTA	0.612																																																	0								ENSG00000106665						83.0	79.0	80.0					7																	73814724		2203	4300	6503	CLIP2	SO:0001587	stop_gained	0			-	HGNC	AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.2905C>T	7.37:g.73814724C>T	ENSP00000378500:p.Gln969*	Somatic	0	42	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	52	24.64	O14527|O43611	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.Q969*	ENST00000395060.1	37	c.2905	CCDS5569.1	7	.	.	.	.	.	.	.	.	.	.	C	42	9.587283	0.99213	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	.	.	.	4.72	4.72	0.59763	.	0.299370	0.33631	N	0.004706	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-40.2164	16.3226	0.82956	0.0:1.0:0.0:0.0	.	.	.	.	X	969;969;934;969	.	ENSP00000223398:Q969X	Q	+	1	0	CLIP2	73452660	1.000000	0.71417	0.947000	0.38551	0.899000	0.52679	7.124000	0.77185	2.191000	0.70037	0.456000	0.33151	CAG	-	NULL		0.612	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	protein_coding	OTTHUMT00000252556.1	C	NM_003388	-		73814724	+1	no_errors	ENST00000223398	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CCDC18	343099	genome.wustl.edu	37	1	93677634	93677659	+	Splice_Site	DEL	TTCCCTTCTTTTCTTTTGTGCCAGAA	TTCCCTTCTTTTCTTTTGTGCCAGAA	-	rs551970879|rs374771686	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	TTCCCTTCTTTTCTTTTGTGCCAGAA	TTCCCTTCTTTTCTTTTGTGCCAGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:93677634_93677659delTTCCCTTCTTTTCTTTTGTGCCAGAA	ENST00000343253.7	+	11	1836_1838	c.1334_1336delTTCCCTTCTTTTCTTTTGTGCCAGAA	c.(1333-1338)attccc>acc	p.IP445fs	CCDC18_ENST00000334652.5_5'UTR|CCDC18_ENST00000557479.1_Splice_Site_p.IP563fs|CCDC18_ENST00000338949.4_Splice_Site_p.IP244fs|CCDC18_ENST00000401026.3_Splice_Site_p.IP445fs			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	445										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		CTAATAATTTTTCCCTTCTTTTCTTTTGTGCCAGAATTAAGCTTGC	0.292																																																	0								ENSG00000122483																																			CCDC18	SO:0001630	splice_region_variant	0				HGNC			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.1335-1TTCCCTTCTTTTCTTTTGTGCCAGAA>-	1.37:g.93677634_93677659delTTCCCTTCTTTTCTTTTGTGCCAGAA		Somatic	NA	NA	NA		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6ZU17	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.R578fs	ENST00000343253.7	37	c.1713_1690		1																																																																																			-	NULL		0.292	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	CCDC18	protein_coding	OTTHUMT00000382327.1	TTCCCTTCTTTTCTTTTGTGCCAGAA	NM_206886		Frame_Shift_Del	93677659	+1	no_errors	ENST00000557479	ensembl	human	known	74_37	frame_shift_del	DEL	0.146:0.127:0.051:0.016:0.000:0.000:0.000:0.000:0.003:0.296:0.887:0.894:0.918:0.986:0.995:0.992:0.966:0.782:0.770:0.056:0.047:0.067:0.982:1.000:1.000:1.000	-
RB1	5925	genome.wustl.edu	37	13	48947546	48947546	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr13:48947546delT	ENST00000267163.4	+	12	1271	c.1133delT	c.(1132-1134)gttfs	p.V378fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	378	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCTAGGACTGTTATGAACACT	0.303		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)						ENSG00000139687						100.0	107.0	104.0					13																	48947546		2203	4293	6496	RB1	SO:0001589	frameshift_variant	0	Familial Cancer Database			HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1133delT	13.37:g.48947546delT	ENSP00000267163:p.Val378fs	Somatic	0	36	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	29	48.21	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.M379fs	ENST00000267163.4	37	c.1133	CCDS31973.1	13																																																																																			-	pfam_RB_A		0.303	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	T				48947546	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SNORD3D	780854	genome.wustl.edu	37	17	19015648	19015648	+	lincRNA	SNP	G	G	T	rs1055350	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr17:19015648G>T	ENST00000362793.1	-	0	432									small nucleolar RNA, C/D box 3D																		CCTTTCTCGCGACATTGCCAA	0.547																																																	0								ENSG00000262202																																			SNORD3D			0			-	HGNC			17p11.2	2013-09-05			ENSG00000199663				33192	non-coding RNA	RNA, small nucleolar						9365252	Standard	NR_006882		Approved	U3-4					17.37:g.19015648G>T		Somatic	0	30	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	76	14.61		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000362793.1	37	NULL		17																																																																																			-	-		0.547	SNORD3D-201	KNOWN	basic	snoRNA	SNORD3D	lincRNA		G	NR_006882	rs1055350		19015648	-1	no_errors	ENST00000573866	ensembl	human	known	74_37	rna	SNP	0.001	T
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147845	+	3'UTR	DEL	GTGTGTGTGT	GTGTGTGTGT	-	rs200264093|rs201814381|rs199597709|rs199689866|rs368179294|rs200969250|rs66612444		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	GTGTGTGTGT	GTGTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr2:50147836_50147845delGTGTGTGTGT	ENST00000406316.2	-	0	7147_7156				NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000401710.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgtgtgt	0.395																																																	0								ENSG00000179915																																			NRXN1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACACACAC>-	2.37:g.50147846_50147855delGTGTGTGTGT		Somatic	NA	NA	NA		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.395	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	GTGTGTGTGT				50147845	-1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.005:0.106:0.113:0.127:0.107:0.109:0.093:0.096	-
SCLT1	132320	genome.wustl.edu	37	4	129812244	129812244	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr4:129812244C>A	ENST00000281142.5	-	19	2381	c.1878G>T	c.(1876-1878)caG>caT	p.Q626H	SCLT1_ENST00000434680.1_Missense_Mutation_p.Q245H|SCLT1_ENST00000439369.2_Missense_Mutation_p.Q113H|SCLT1_ENST00000502495.1_5'UTR|SCLT1_ENST00000503215.1_Missense_Mutation_p.Q222H	NM_144643.2	NP_653244.2	Q96NL6	SCLT1_HUMAN	sodium channel and clathrin linker 1	626					cilium assembly (GO:0042384)|clustering of voltage-gated sodium channels (GO:0045162)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|clathrin complex (GO:0071439)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)	sodium channel regulator activity (GO:0017080)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	29						CCATTTCCAGCTGAGAAAGCA	0.398																																																	0								ENSG00000151466						122.0	116.0	118.0					4																	129812244		2203	4300	6503	SCLT1	SO:0001583	missense	0			-	HGNC	AK055217	CCDS3740.1	4q28.2	2008-05-02			ENSG00000151466	ENSG00000151466			26406	protein-coding gene	gene with protein product		611399				15797711	Standard	XM_005262732		Approved	hCAP-1A, FLJ30655	uc003igp.2	Q96NL6	OTTHUMG00000133346	ENST00000281142.5:c.1878G>T	4.37:g.129812244C>A	ENSP00000281142:p.Gln626His	Somatic	0	37	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	A4QN04|Q0VAH2|Q6P2M4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q626H	ENST00000281142.5	37	c.1878	CCDS3740.1	4	.	.	.	.	.	.	.	.	.	.	C	13.85	2.359452	0.41801	.	.	ENSG00000151466	ENST00000281142;ENST00000434680;ENST00000439369;ENST00000503215	T;T;T	0.52057	0.68;2.85;2.85	4.43	2.62	0.31277	.	0.063315	0.64402	D	0.000004	T	0.49983	0.1589	L	0.27053	0.805	0.22280	N	0.999239	D;D;D;D	0.69078	0.997;0.997;0.994;0.994	D;D;D;D	0.81914	0.995;0.995;0.931;0.991	T	0.30621	-0.9972	9	.	.	.	-7.8173	9.4631	0.38796	0.0:0.8245:0.0:0.1755	.	113;245;626;222	Q96NL6-3;Q96NL6-2;Q96NL6;D6RBP0	.;.;SCLT1_HUMAN;.	H	626;245;113;222	ENSP00000281142:Q626H;ENSP00000401539:Q245H;ENSP00000424029:Q222H	.	Q	-	3	2	SCLT1	130031694	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.821000	0.39041	1.059000	0.40554	0.585000	0.79938	CAG	-	NULL		0.398	SCLT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCLT1	protein_coding	OTTHUMT00000257176.2	C	NM_144643	-		129812244	-1	no_errors	ENST00000281142	ensembl	human	known	74_37	missense	SNP	1.000	A
PSMD7	5713	genome.wustl.edu	37	16	74339214	74339214	+	Silent	SNP	T	T	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr16:74339214T>A	ENST00000219313.4	+	7	698	c.558T>A	c.(556-558)acT>acA	p.T186T	PSMD7_ENST00000567958.1_Intron|AC009120.6_ENST00000565313.1_RNA|AC009120.6_ENST00000566411.1_RNA|PSMD7_ENST00000540379.1_Silent_p.T109T	NM_002811.4	NP_002802.2	P51665	PSMD7_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 7	186					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	protein homodimerization activity (GO:0042803)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	15						CGGTGGGCACTCTGTCCCAGC	0.483																																																	0								ENSG00000103035						52.0	51.0	51.0					16																	74339214		2198	4300	6498	PSMD7	SO:0001819	synonymous_variant	0			-	HGNC	D50063	CCDS10910.1	16q22.3	2010-10-15	2007-07-06		ENSG00000103035	ENSG00000103035		"""Proteasome (prosome, macropain) subunits"""	9565	protein-coding gene	gene with protein product	"""Mov34 homolog"""	157970	"""proteasome (prosome, macropain) 26S subunit, non-ATPase, 7 (Mov34 homolog)"""			7755639	Standard	NM_002811		Approved	S12, P40, MOV34, Rpn8	uc002fcq.3	P51665	OTTHUMG00000137601	ENST00000219313.4:c.558T>A	16.37:g.74339214T>A		Somatic	0	24	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	26	48.00	D3DWS9|Q6PKI2|Q96E97	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.T186	ENST00000219313.4	37	c.558	CCDS10910.1	16																																																																																			-	NULL		0.483	PSMD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD7	protein_coding	OTTHUMT00000269010.2	T	NM_002811	-		74339214	+1	no_errors	ENST00000219313	ensembl	human	known	74_37	silent	SNP	0.985	A
ANXA4	307	genome.wustl.edu	37	2	70043324	70043324	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr2:70043324A>T	ENST00000394295.4	+	9	874	c.626A>T	c.(625-627)cAt>cTt	p.H209L	ANXA4_ENST00000536030.1_Missense_Mutation_p.H125L|ANXA4_ENST00000409920.1_Missense_Mutation_p.H187L	NM_001153.3	NP_001144.1	P09525	ANXA4_HUMAN	annexin A4	207					epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						CACCTGTTGCATGGTAAGGCA	0.433																																																	0								ENSG00000196975						94.0	94.0	94.0					2																	70043324		2203	4300	6503	ANXA4	SO:0001583	missense	0			-	HGNC	M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000394295.4:c.626A>T	2.37:g.70043324A>T	ENSP00000377833:p.His209Leu	Somatic	0	61	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	41	28.07	B4DDF9|Q96F33|Q9BWK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinIV,prints_AnnexinV	p.H209L	ENST00000394295.4	37	c.626	CCDS1894.1	2	.	.	.	.	.	.	.	.	.	.	A	16.43	3.121988	0.56613	.	.	ENSG00000196975	ENST00000409920;ENST00000394295;ENST00000536030	T;T;T	0.03004	4.08;4.08;4.08	5.35	5.35	0.76521	Annexin repeat, conserved site (1);	0.155014	0.56097	D	0.000035	T	0.01029	0.0034	N	0.00149	-1.99	0.41960	D	0.990708	P;B;B	0.36465	0.554;0.232;0.01	B;B;B	0.34991	0.135;0.193;0.004	T	0.64394	-0.6418	9	.	.	.	.	13.3339	0.60505	1.0:0.0:0.0:0.0	.	207;187;209	P09525;Q6P452;Q6LES2	ANXA4_HUMAN;.;.	L	187;209;125	ENSP00000386756:H187L;ENSP00000377833:H209L;ENSP00000441931:H125L	.	H	+	2	0	ANXA4	69896828	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.898000	0.39809	2.250000	0.74265	0.533000	0.62120	CAT	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_AnnexinV		0.433	ANXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA4	protein_coding	OTTHUMT00000251848.2	A	NM_001153	-		70043324	+1	no_errors	ENST00000394295	ensembl	human	known	74_37	missense	SNP	1.000	T
LRP8	7804	genome.wustl.edu	37	1	53724068	53724068	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:53724068G>T	ENST00000306052.6	-	14	2233	c.2132C>A	c.(2131-2133)tCc>tAc	p.S711Y	LRP8_ENST00000371454.2_Missense_Mutation_p.S711Y|LRP8_ENST00000465675.1_Missense_Mutation_p.S264Y|LRP8_ENST00000460214.1_5'UTR|LRP8_ENST00000347547.2_Missense_Mutation_p.S541Y|LRP8_ENST00000354412.3_Missense_Mutation_p.S582Y	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	711					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						AGAGTGGCTGGAGATCTGAGG	0.557																																																	0								ENSG00000157193						149.0	130.0	136.0					1																	53724068		2203	4300	6503	LRP8	SO:0001583	missense	0			-	HGNC	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2132C>A	1.37:g.53724068G>T	ENSP00000303634:p.Ser711Tyr	Somatic	0	21	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.S711Y	ENST00000306052.6	37	c.2132	CCDS578.1	1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.535299	0.64972	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64	5.35	4.44	0.53790	Growth factor, receptor (1);Epidermal growth factor-like (1);	.	.	.	.	D	0.87881	0.6289	L	0.55481	1.735	0.48632	D	0.999681	P;D;D;D;D;P	0.69078	0.897;0.997;0.996;0.995;0.969;0.897	P;D;D;P;P;P	0.66602	0.492;0.943;0.945;0.861;0.845;0.492	D	0.88841	0.3312	9	0.87932	D	0	.	13.8573	0.63537	0.0738:0.0:0.9262:0.0	.	264;582;541;711;711;264	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	Y	711;711;264;582;541	ENSP00000303634:S711Y;ENSP00000360509:S711Y;ENSP00000437009:S264Y;ENSP00000346391:S582Y;ENSP00000334522:S541Y	ENSP00000303634:S711Y	S	-	2	0	LRP8	53496656	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.711000	0.54868	1.249000	0.43950	0.563000	0.77884	TCC	-	superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom		0.557	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRP8	protein_coding	OTTHUMT00000024699.1	G	NM_004631	-		53724068	-1	no_errors	ENST00000306052	ensembl	human	known	74_37	missense	SNP	1.000	T
TRIM46	80128	genome.wustl.edu	37	1	155154488	155154488	+	Silent	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:155154488C>T	ENST00000334634.4	+	9	1749	c.1749C>T	c.(1747-1749)ggC>ggT	p.G583G	TRIM46_ENST00000543729.1_3'UTR|TRIM46_ENST00000368382.1_Silent_p.G560G|TRIM46_ENST00000392451.2_3'UTR|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000368383.3_Silent_p.G583G|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000545012.1_Silent_p.G457G	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	583	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TGGTCCTGGGCGACGTGGCTG	0.667																																																	0								ENSG00000163462						23.0	23.0	23.0					1																	155154488		2203	4299	6502	TRIM46	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.1749C>T	1.37:g.155154488C>T		Somatic	0	108	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	106	29.33	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.G583	ENST00000334634.4	37	c.1749	CCDS1097.1	1																																																																																			-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY		0.667	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	protein_coding	OTTHUMT00000086728.1	C	NM_025058	-		155154488	+1	no_errors	ENST00000334634	ensembl	human	known	74_37	silent	SNP	0.898	T
LRP1	4035	genome.wustl.edu	37	12	57594262	57594262	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr12:57594262G>A	ENST00000243077.3	+	63	10518	c.10052G>A	c.(10051-10053)tGg>tAg	p.W3351*		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3351	LDL-receptor class A 21. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCCTTCTGGTGGAAGTGTGAC	0.627																																																	0								ENSG00000123384						48.0	45.0	46.0					12																	57594262		2203	4300	6503	LRP1	SO:0001587	stop_gained	0			-	HGNC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.10052G>A	12.37:g.57594262G>A	ENSP00000243077:p.Trp3351*	Somatic	0	29	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	Q2PP12|Q86SW0|Q8IVG8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.W3351*	ENST00000243077.3	37	c.10052	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	G	54	22.031832	0.99945	.	.	ENSG00000123384	ENST00000243077	.	.	.	4.56	4.56	0.56223	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.3322	0.83039	0.0:0.0:1.0:0.0	.	.	.	.	X	3351	.	ENSP00000243077:W3351X	W	+	2	0	LRP1	55880529	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.764000	0.85297	2.386000	0.81285	0.555000	0.69702	TGG	-	pfam_LDrepeatLR_classA_rpt,superfamily_Growth_fac_rcpt_N_dom,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.627	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	G	NM_002332	-		57594262	+1	no_errors	ENST00000243077	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ACAT1	38	genome.wustl.edu	37	11	108018022	108018022	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr11:108018022C>A	ENST00000265838.4	+	12	1280	c.1189C>A	c.(1189-1191)Cat>Aat	p.H397N		NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1	397					adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	GATTGTTGGTCATTTGACTCA	0.388																																																	0			GRCh37	CM041981	ACAT1	M		ENSG00000075239						138.0	121.0	127.0					11																	108018022		2201	4298	6499	ACAT1	SO:0001583	missense	0			-	HGNC	D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	ENST00000265838.4:c.1189C>A	11.37:g.108018022C>A	ENSP00000265838:p.His397Asn	Somatic	0	63	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B2R6H1|G3XAB4|Q96FG8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thiolase_N,pfam_Thiolase_C,pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.H397N	ENST00000265838.4	37	c.1189	CCDS8339.1	11	.	.	.	.	.	.	.	.	.	.	C	24.1	4.495427	0.85069	.	.	ENSG00000075239	ENST00000265838	D	0.92495	-3.05	5.87	5.87	0.94306	Thiolase-like, subgroup (1);Thiolase-like (1);Thiolase, C-terminal (1);	0.050357	0.85682	D	0.000000	D	0.95968	0.8687	M	0.72576	2.205	0.80722	D	1	D	0.63880	0.993	D	0.79784	0.993	D	0.95601	0.8663	10	0.66056	D	0.02	-16.258	20.2182	0.98305	0.0:1.0:0.0:0.0	.	397	P24752	THIL_HUMAN	N	397	ENSP00000265838:H397N	ENSP00000265838:H397N	H	+	1	0	ACAT1	107523232	1.000000	0.71417	0.243000	0.24186	0.773000	0.43773	7.539000	0.82063	2.785000	0.95823	0.655000	0.94253	CAT	-	pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase		0.388	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT1	protein_coding	OTTHUMT00000389474.1	C	NM_000019	-		108018022	+1	no_errors	ENST00000265838	ensembl	human	known	74_37	missense	SNP	1.000	A
TIGD7	91151	genome.wustl.edu	37	16	3349014	3349014	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr16:3349014T>C	ENST00000396862.1	-	2	3429	c.1601A>G	c.(1600-1602)aAt>aGt	p.N534S	TIGD7_ENST00000574598.1_5'Flank|TIGD7_ENST00000268674.2_Missense_Mutation_p.N534S	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	534						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						GTCCTTAATATTATGAGGCCT	0.368																																																	0								ENSG00000140993						61.0	60.0	60.0					16																	3349014		2197	4300	6497	TIGD7	SO:0001583	missense	0			-	HGNC	AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.1601A>G	16.37:g.3349014T>C	ENSP00000380071:p.Asn534Ser	Somatic	0	92	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	74	44.78	Q9BXZ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.N534S	ENST00000396862.1	37	c.1601	CCDS10500.1	16	.	.	.	.	.	.	.	.	.	.	T	0.014	-1.598628	0.00857	.	.	ENSG00000140993	ENST00000396862;ENST00000268674	T;T	0.35605	1.3;1.3	4.44	3.19	0.36642	.	0.840456	0.09555	U	0.786388	T	0.20210	0.0486	N	0.14661	0.345	0.20074	N	0.999937	B	0.19200	0.034	B	0.18263	0.021	T	0.33854	-0.9852	10	0.15499	T	0.54	.	6.9254	0.24412	0.2798:0.0:0.0:0.7202	.	534	Q6NT04	TIGD7_HUMAN	S	534	ENSP00000380071:N534S;ENSP00000268674:N534S	ENSP00000268674:N534S	N	-	2	0	TIGD7	3289015	0.021000	0.18746	0.889000	0.34880	0.749000	0.42624	0.350000	0.20079	0.352000	0.24053	0.533000	0.62120	AAT	-	NULL		0.368	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	protein_coding	OTTHUMT00000251465.1	T	NM_033208	-		3349014	-1	no_errors	ENST00000268674	ensembl	human	known	74_37	missense	SNP	0.996	C
TATDN2	9797	genome.wustl.edu	37	3	10302199	10302199	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr3:10302199C>T	ENST00000287652.4	+	3	1844	c.793C>T	c.(793-795)Cca>Tca	p.P265S	RP11-438J1.1_ENST00000450534.1_3'UTR|TATDN2_ENST00000448281.2_Missense_Mutation_p.P265S	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	265					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						TAAGACAGTGCCAGAGAGGAG	0.532																																																	0								ENSG00000157014						69.0	65.0	67.0					3																	10302199		2203	4300	6503	TATDN2	SO:0001583	missense	0			-	HGNC	D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.793C>T	3.37:g.10302199C>T	ENSP00000287652:p.Pro265Ser	Somatic	0	22	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	18.18	Q3MIL9|Q5BKU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TatD_family	p.P265S	ENST00000287652.4	37	c.793	CCDS33698.1	3	.	.	.	.	.	.	.	.	.	.	C	6.713	0.500222	0.12762	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	T;T	0.21361	2.01;2.01	4.05	1.06	0.20224	.	1.838110	0.03789	U	0.262627	T	0.16128	0.0388	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.31166	-0.9953	10	0.59425	D	0.04	8.8594	6.859	0.24056	0.1944:0.4296:0.3761:0.0	.	265	Q93075	TATD2_HUMAN	S	265	ENSP00000287652:P265S;ENSP00000408736:P265S	ENSP00000287652:P265S	P	+	1	0	TATDN2	10277199	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.054000	0.14205	0.219000	0.20840	0.650000	0.86243	CCA	-	NULL		0.532	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TATDN2	protein_coding	OTTHUMT00000339641.1	C	XM_376203	-		10302199	+1	no_errors	ENST00000287652	ensembl	human	known	74_37	missense	SNP	0.000	T
RP11-597A11.2	0	genome.wustl.edu	37	14	20151749	20151749	+	lincRNA	SNP	T	T	A	rs377278686	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr14:20151749T>A	ENST00000547175.1	+	0	344																											TAGAGATATGTATAAAGGCTT	0.438													.|||	245	0.0489217	0.0061	0.0634	5008	,	,		32007	0.0496		0.0954	False		,,,				2504	0.0481																0								ENSG00000257395																																			RP11-597A11.2			0			-	Clone_based_vega_gene																													14.37:g.20151749T>A		Somatic	0	21	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000547175.1	37	NULL		14																																																																																			-	-		0.438	RP11-597A11.2-001	KNOWN	basic	lincRNA	ENSG00000257395	lincRNA	OTTHUMT00000409598.1	T		-		20151749	+1	no_errors	ENST00000547175	ensembl	human	known	74_37	rna	SNP	1.000	A
CHGB	1114	genome.wustl.edu	37	20	5904558	5904558	+	Missense_Mutation	SNP	G	G	A	rs148235020		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr20:5904558G>A	ENST00000378961.4	+	4	1972	c.1768G>A	c.(1768-1770)Gcc>Acc	p.A590T		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	590						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						GAGAAACCTCGCCAGGGTCCC	0.498																																																	0								ENSG00000089199	G	THR/ALA	0,4406		0,0,2203	44.0	43.0	43.0		1768	-3.0	0.0	20	dbSNP_134	43	2,8598	2.2+/-6.3	0,2,4298	yes	missense	CHGB	NM_001819.2	58	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	590/678	5904558	2,13004	2203	4300	6503	CHGB	SO:0001583	missense	0			-	HGNC		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.1768G>A	20.37:g.5904558G>A	ENSP00000368244:p.Ala590Thr	Somatic	0	73	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	39	54.12	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Granin,prints_Chromogranin_AB	p.A590T	ENST00000378961.4	37	c.1768	CCDS13092.1	20	.	.	.	.	.	.	.	.	.	.	G	13.36	2.212732	0.39102	0.0	2.33E-4	ENSG00000089199	ENST00000378961	T	0.01804	4.63	5.79	-2.98	0.05513	.	0.935397	0.08957	N	0.869218	T	0.01592	0.0051	N	0.25647	0.755	0.09310	N	1	P	0.51653	0.947	B	0.43889	0.435	T	0.49021	-0.8982	10	0.49607	T	0.09	-0.1548	5.6767	0.17753	0.1719:0.4561:0.2788:0.0931	.	590	P05060	SCG1_HUMAN	T	590	ENSP00000368244:A590T	ENSP00000368244:A590T	A	+	1	0	CHGB	5852558	0.000000	0.05858	0.000000	0.03702	0.778000	0.44026	-0.002000	0.12924	-0.139000	0.11414	0.561000	0.74099	GCC	-	pfam_Granin		0.498	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHGB	protein_coding	OTTHUMT00000077897.2	G	NM_001819	rs148235020		5904558	+1	no_errors	ENST00000378961	ensembl	human	known	74_37	missense	SNP	0.000	A
LAMA1	284217	genome.wustl.edu	37	18	6999551	6999551	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr18:6999551C>T	ENST00000389658.3	-	32	4649	c.4556G>A	c.(4555-4557)gGt>gAt	p.G1519D		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1519	Laminin EGF-like 17. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GTCACAGTCACCGTGGACAGA	0.577																																																	0								ENSG00000101680						62.0	49.0	53.0					18																	6999551		2203	4300	6503	LAMA1	SO:0001583	missense	0			-	HGNC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4556G>A	18.37:g.6999551C>T	ENSP00000374309:p.Gly1519Asp	Somatic	0	41	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G1519D	ENST00000389658.3	37	c.4556	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	3.985	-0.005591	0.07773	.	.	ENSG00000101680	ENST00000389658	T	0.60548	0.18	5.87	4.1	0.47936	EGF-like, laminin (3);	1.193250	0.05528	N	0.563537	T	0.42944	0.1225	N	0.24115	0.695	0.09310	N	1	P	0.41475	0.751	B	0.40982	0.345	T	0.25984	-1.0116	10	0.12766	T	0.61	.	5.2692	0.15615	0.1338:0.592:0.0:0.2742	.	1519	P25391	LAMA1_HUMAN	D	1519	ENSP00000374309:G1519D	ENSP00000374309:G1519D	G	-	2	0	LAMA1	6989551	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.041000	0.13927	0.841000	0.35020	-0.140000	0.14226	GGT	-	pfam_EGF_laminin,smart_EG-like_dom,smart_EGF_laminin,pfscan_EGF_laminin		0.577	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	protein_coding	OTTHUMT00000257369.1	C	NM_005559	-		6999551	-1	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	SNP	0.000	T
DIEXF	27042	genome.wustl.edu	37	1	210001516	210001516	+	Splice_Site	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:210001516G>T	ENST00000491415.2	+	1	164		c.e1+1			NM_014388.6	NP_055203.4	Q68CQ4	DIEXF_HUMAN	digestive organ expansion factor homolog (zebrafish)						multicellular organismal development (GO:0007275)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(15)|large_intestine(7)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(2)	53						TCTATGACAGGTCTGAAGGGG	0.557											OREG0014221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000117597						45.0	43.0	44.0					1																	210001516		2203	4300	6503	DIEXF	SO:0001630	splice_region_variant	0			-	HGNC	BC022964	CCDS1493.1	1q32.2	2011-08-12	2011-02-16	2011-02-16	ENSG00000117597	ENSG00000117597			28440	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 107"""	C1orf107		16322560	Standard	NM_014388		Approved	MGC29875, DEF, UTP25	uc001hhr.2	Q68CQ4	OTTHUMG00000036654	ENST00000491415.2:c.107+1G>T	1.37:g.210001516G>T		Somatic	0	27	0.00	2187	0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	O75992|Q4VY00|Q63HL9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e1+1	ENST00000491415.2	37	c.107+1	CCDS1493.1	1	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816637	0.70912	.	.	ENSG00000117597	ENST00000491415	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1484	0.89667	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DIEXF	208068139	1.000000	0.71417	0.993000	0.49108	0.882000	0.50991	6.506000	0.73712	2.367000	0.80283	0.655000	0.94253	.	-	-		0.557	DIEXF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIEXF	protein_coding	OTTHUMT00000089127.2	G	NM_014388	-	Intron	210001516	+1	no_errors	ENST00000491415	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76938366	76938367	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chrX:76938366_76938367insT	ENST00000373344.5	-	9	2595_2596	c.2381_2382insA	c.(2380-2382)aagfs	p.K794fs	ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_Frame_Shift_Ins_p.K756fs	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	794					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CTGATTTGCCCTTTTTAGTATC	0.342			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224																																			ATRX	SO:0001589	frameshift_variant	0				HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2382dupA	X.37:g.76938371_76938371dupT	ENSP00000362441:p.Lys794fs	Somatic	0	42	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	16	68.00	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K796fs	ENST00000373344.5	37	c.2382_2381	CCDS14434.1	X																																																																																			-	NULL		0.342	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	-	NM_000489			76938367	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_ins	INS	0.987:0.998	T
PRTG	283659	genome.wustl.edu	37	15	55972661	55972661	+	Intron	DEL	T	T	-	rs35467969		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr15:55972661delT	ENST00000389286.4	-	5	862				RP11-420M1.2_ENST00000561155.1_RNA	NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGGAAAAGACTTTTTTTTTTT	0.318																																																	0								ENSG00000259180						46.0	45.0	45.0					15																	55972661		1772	4046	5818	RP11-420M1.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.814+27A>-	15.37:g.55972661delT		Somatic	0	19	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	15	31.82		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389286.4	37	NULL	CCDS42040.1	15																																																																																			-	-		0.318	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259180	protein_coding	OTTHUMT00000419357.1	T	NM_173814			55972661	+1	no_errors	ENST00000561155	ensembl	human	known	74_37	rna	DEL	0.000	-
IMMP2L	83943	genome.wustl.edu	37	7	110568408	110568413	+	Intron	DEL	CACACA	CACACA	-	rs13230194|rs71692948|rs202224708|rs58639346	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	CACACA	CACACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr7:110568408_110568413delCACACA	ENST00000405709.2	-	4	748				AC005161.1_ENST00000408352.1_RNA|IMMP2L_ENST00000452895.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000450877.1_Intron	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)						ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		TATGTACCTGcacacacacacacaca	0.325														2795	0.558107	0.4917	0.5159	5008	,	,		10746	0.6706		0.4742	False		,,,				2504	0.6483																0								ENSG00000221279																																			AC005161.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.305+35142TGTGTG>-	7.37:g.110568414_110568419delCACACA		Somatic	NA	NA	NA		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000405709.2	37	NULL	CCDS5753.1	7																																																																																			-	-		0.325	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221279	protein_coding	OTTHUMT00000338109.4	CACACA	NM_032549			110568413	+1	no_errors	ENST00000408352	ensembl	human	novel	74_37	rna	DEL	0.000:0.003:0.009:0.052:0.060:0.063	-
HAO1	54363	genome.wustl.edu	37	20	7894822	7894822	+	Silent	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr20:7894822C>T	ENST00000378789.3	-	3	585	c.534G>A	c.(532-534)ccG>ccA	p.P178P		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	178	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						TGAGTTGTGGCGGCAGTTTGA	0.527																																																	0								ENSG00000101323						141.0	103.0	116.0					20																	7894822		2203	4300	6503	HAO1	SO:0001819	synonymous_variant	0			-	HGNC	AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.534G>A	20.37:g.7894822C>T		Somatic	0	47	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	21	54.35	Q14CQ0|Q9UPZ0|Q9Y3I7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FMN-dep_DH,pfam_Glu_synth_centr_C,pirsf_Alpha-hydoxy_acid_DH_FMN	p.P178	ENST00000378789.3	37	c.534	CCDS13100.1	20																																																																																			-	pfam_FMN-dep_DH,pirsf_Alpha-hydoxy_acid_DH_FMN		0.527	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAO1	protein_coding	OTTHUMT00000077926.2	C		-		7894822	-1	no_errors	ENST00000378789	ensembl	human	known	74_37	silent	SNP	0.926	T
DGKK	139189	genome.wustl.edu	37	X	50114724	50114724	+	RNA	SNP	T	T	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chrX:50114724T>C	ENST00000376025.2	-	0	3669							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					ATTACGCACCTCTGGAACAAA	0.473																																																	0								ENSG00000204466						112.0	99.0	103.0					X																	50114724		1935	4124	6059	DGKK			0			-	HGNC	AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50114724T>C		Somatic	0	32	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	39	23.53	B2RP91	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			-	-		0.473	DGKK-001	KNOWN	basic	processed_transcript	DGKK	processed_transcript	OTTHUMT00000368187.1	T	NM_001013742	-		50114724	-1	no_errors	ENST00000376025	ensembl	human	known	74_37	rna	SNP	0.998	C
HUWE1	10075	genome.wustl.edu	37	X	53631666	53631666	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chrX:53631666A>G	ENST00000342160.3	-	25	3083	c.2626T>C	c.(2626-2628)Tgc>Cgc	p.C876R	HUWE1_ENST00000218328.8_Missense_Mutation_p.C876R|HUWE1_ENST00000262854.6_Missense_Mutation_p.C876R			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	876					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TTGCCTGCGCAAGCCAGTTCT	0.567																																																	0								ENSG00000086758						80.0	62.0	68.0					X																	53631666		2203	4300	6503	HUWE1	SO:0001583	missense	0			-	HGNC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.2626T>C	X.37:g.53631666A>G	ENSP00000340648:p.Cys876Arg	Somatic	0	23	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	47	46.59	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.C876R	ENST00000342160.3	37	c.2626	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	A	12.19	1.863683	0.32884	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.41758	1.3;1.3;0.99	5.82	5.82	0.92795	.	0.828025	0.11217	N	0.587093	T	0.35913	0.0948	L	0.43152	1.355	0.53005	D	0.999963	P	0.45126	0.851	B	0.34180	0.177	T	0.28004	-1.0057	10	0.59425	D	0.04	.	14.0469	0.64710	1.0:0.0:0.0:0.0	.	876	Q7Z6Z7	HUWE1_HUMAN	R	876	ENSP00000340648:C876R;ENSP00000262854:C876R;ENSP00000218328:C876R	ENSP00000218328:C876R	C	-	1	0	HUWE1	53648391	0.996000	0.38824	1.000000	0.80357	0.690000	0.40134	2.439000	0.44846	1.963000	0.57068	0.486000	0.48141	TGC	-	NULL		0.567	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	protein_coding	OTTHUMT00000056766.1	A	XM_497119	-		53631666	-1	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	SNP	0.989	G
USP10	9100	genome.wustl.edu	37	16	84801916	84801916	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr16:84801916G>C	ENST00000219473.7	+	11	2063	c.1950G>C	c.(1948-1950)ttG>ttC	p.L650F	USP10_ENST00000570191.1_Missense_Mutation_p.L654F	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	650	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						TGGAGAGCTTGGTGGCAAGAG	0.438																																																	0								ENSG00000103194						34.0	31.0	32.0					16																	84801916		1908	4128	6036	USP10	SO:0001583	missense	0			-	HGNC	D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.1950G>C	16.37:g.84801916G>C	ENSP00000219473:p.Leu650Phe	Somatic	0	27	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_Ataxin-2_C,pfscan_Peptidase_C19/C67	p.L654F	ENST00000219473.7	37	c.1962	CCDS45537.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.21|19.21	3.783957|3.783957	0.70222|0.70222	.|.	.|.	ENSG00000103194|ENSG00000103194	ENST00000397953|ENST00000219473	.|T	.|0.25414	.|1.8	5.51|5.51	4.56|4.56	0.56223|0.56223	.|Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.|0.225469	.|0.37669	.|N	.|0.001989	T|T	0.22975|0.22975	0.0555|0.0555	N|N	0.05050|0.05050	-0.12|-0.12	0.58432|0.58432	D|D	0.999999|0.999999	.|D;P	.|0.62365	.|0.991;0.885	.|P;P	.|0.59889	.|0.865;0.824	T|T	0.09952|0.09952	-1.0651|-1.0651	6|10	0.87932|0.40728	D|T	0|0.16	-13.1471|-13.1471	9.919|9.919	0.41453|0.41453	0.1542:0.0:0.8458:0.0|0.1542:0.0:0.8458:0.0	.|.	.|654;650	.|Q14694-3;Q14694	.|.;UBP10_HUMAN	R|F	212|650	.|ENSP00000219473:L650F	ENSP00000381044:G212R|ENSP00000219473:L650F	G|L	+|+	1|3	0|2	USP10|USP10	83359417|83359417	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.830000|0.830000	0.47004|0.47004	5.315000|5.315000	0.65810|0.65810	1.466000|1.466000	0.48025|0.48025	0.655000|0.655000	0.94253|0.94253	GGT|TTG	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.438	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	USP10	protein_coding	OTTHUMT00000433660.1	G		-		84801916	+1	no_errors	ENST00000570191	ensembl	human	known	74_37	missense	SNP	1.000	C
WIZ	58525	genome.wustl.edu	37	19	15547866	15547866	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:15547866C>T	ENST00000389282.4	-	4	2560	c.2347G>A	c.(2347-2349)Ggc>Agc	p.G783S	WIZ_ENST00000263381.7_Missense_Mutation_p.G94S			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	783					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CTGGAGAGGCCGGCCCGTGTG	0.632																																																	0								ENSG00000011451						29.0	39.0	35.0					19																	15547866		2123	4231	6354	WIZ	SO:0001583	missense	0			-	HGNC	AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.2347G>A	19.37:g.15547866C>T	ENSP00000373933:p.Gly783Ser	Somatic	0	58	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	44	57.69	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G783S	ENST00000389282.4	37	c.2347		19	.	.	.	.	.	.	.	.	.	.	C	32	5.171259	0.94807	.	.	ENSG00000011451	ENST00000389282;ENST00000263381	T;T	0.26660	1.73;1.72	4.26	4.26	0.50523	.	0.144593	0.45126	D	0.000394	T	0.52338	0.1728	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.59461	-0.7450	9	0.72032	D	0.01	-23.3357	15.6849	0.77402	0.0:1.0:0.0:0.0	.	94	O95785-2	.	S	783;94	ENSP00000373933:G783S;ENSP00000263381:G94S	ENSP00000263381:G94S	G	-	1	0	WIZ	15408866	1.000000	0.71417	0.968000	0.41197	0.991000	0.79684	7.196000	0.77805	2.215000	0.71742	0.449000	0.29647	GGC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.632	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	protein_coding		C	NM_021241	-		15547866	-1	no_errors	ENST00000389282	ensembl	human	known	74_37	missense	SNP	0.999	T
KIF19	124602	genome.wustl.edu	37	17	72340475	72340475	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr17:72340475C>G	ENST00000389916.4	+	6	708	c.570C>G	c.(568-570)atC>atG	p.I190M		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	190	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						TCTCCACCATCAATGCCAAGG	0.652																																																	0								ENSG00000196169						32.0	30.0	30.0					17																	72340475		2203	4300	6503	KIF19	SO:0001583	missense	0			-	HGNC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.570C>G	17.37:g.72340475C>G	ENSP00000374566:p.Ile190Met	Somatic	0	10	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	11	42.11	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.I190M	ENST00000389916.4	37	c.570	CCDS32718.2	17	.	.	.	.	.	.	.	.	.	.	C	10.45	1.353437	0.24512	.	.	ENSG00000196169	ENST00000389916	T	0.74737	-0.87	5.79	2.63	0.31362	Kinesin, motor domain (4);	.	.	.	.	T	0.70395	0.3219	N	0.21324	0.655	0.43588	D	0.995936	D;P	0.59767	0.986;0.513	D;P	0.64595	0.927;0.521	T	0.67329	-0.5698	9	0.54805	T	0.06	.	3.2877	0.06937	0.1447:0.5673:0.1395:0.1485	.	190;190	Q2TAC6;Q2TAC6-2	KIF19_HUMAN;.	M	190	ENSP00000374566:I190M	ENSP00000374566:I190M	I	+	3	3	KIF19	69852070	1.000000	0.71417	0.998000	0.56505	0.018000	0.09664	1.486000	0.35530	0.340000	0.23745	-0.334000	0.08254	ATC	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.652	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	protein_coding	OTTHUMT00000319644.2	C	NM_153209	-		72340475	+1	no_errors	ENST00000389916	ensembl	human	known	74_37	missense	SNP	1.000	G
LRRC7	57554	genome.wustl.edu	37	1	70503937	70503937	+	Silent	SNP	G	G	T	rs12567778	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:70503937G>T	ENST00000035383.5	+	19	2346	c.2316G>T	c.(2314-2316)tcG>tcT	p.S772S	LRRC7_ENST00000310961.5_Silent_p.S777S|LRRC7_ENST00000415775.2_Silent_p.S56S	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	772						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)		p.S772S(2)		breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						CTGATGGCTCGCATTATGACA	0.507																																																	2	Substitution - coding silent(2)	lung(1)|stomach(1)						ENSG00000033122						152.0	139.0	143.0					1																	70503937		2203	4300	6503	LRRC7	SO:0001819	synonymous_variant	0			-	HGNC		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2316G>T	1.37:g.70503937G>T		Somatic	0	41	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.S772	ENST00000035383.5	37	c.2316	CCDS645.1	1																																																																																			-	NULL		0.507	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	protein_coding	OTTHUMT00000131261.1	G	NM_020794	-		70503937	+1	no_errors	ENST00000035383	ensembl	human	known	74_37	silent	SNP	0.017	T
GABRA1	2554	genome.wustl.edu	37	5	161309663	161309663	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr5:161309663T>C	ENST00000428797.2	+	8	1014	c.659T>C	c.(658-660)cTt>cCt	p.L220P	GABRA1_ENST00000420560.1_Missense_Mutation_p.L220P|GABRA1_ENST00000444819.1_Missense_Mutation_p.L220P|GABRA1_ENST00000393943.4_Missense_Mutation_p.L220P|GABRA1_ENST00000437025.2_Missense_Mutation_p.L220P|GABRA1_ENST00000023897.6_Missense_Mutation_p.L220P	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	220					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	CAGTATGACCTTCTTGGACAA	0.408																																																	0								ENSG00000022355						151.0	132.0	138.0					5																	161309663		2203	4300	6503	GABRA1	SO:0001583	missense	0			-	HGNC		CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.659T>C	5.37:g.161309663T>C	ENSP00000393097:p.Leu220Pro	Somatic	0	55	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	D3DQK6|Q8N629	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.L220P	ENST00000428797.2	37	c.659	CCDS4357.1	5	.	.	.	.	.	.	.	.	.	.	T	25.0	4.595512	0.86953	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000420560;ENST00000444819	D;D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55;-1.55	5.34	5.34	0.76211	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.92038	0.7477	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93435	0.6789	10	0.87932	D	0	.	15.6069	0.76679	0.0:0.0:0.0:1.0	.	220	P14867	GBRA1_HUMAN	P	220	ENSP00000023897:L220P;ENSP00000393097:L220P;ENSP00000377517:L220P;ENSP00000415441:L220P;ENSP00000408041:L220P;ENSP00000414232:L220P	ENSP00000023897:L220P	L	+	2	0	GABRA1	161242241	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.903000	0.87398	2.146000	0.66826	0.528000	0.53228	CTT	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,tigrfam_Neur_channel		0.408	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	protein_coding	OTTHUMT00000252702.2	T	NM_000806.5	-		161309663	+1	no_errors	ENST00000023897	ensembl	human	known	74_37	missense	SNP	1.000	C
ATP7B	540	genome.wustl.edu	37	13	52536007	52536007	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr13:52536007C>A	ENST00000242839.4	-	6	2068	c.1912G>T	c.(1912-1914)Gct>Tct	p.A638S	ATP7B_ENST00000418097.2_Missense_Mutation_p.A638S|ATP7B_ENST00000400370.3_Intron|ATP7B_ENST00000542656.1_Intron|ATP7B_ENST00000482841.1_Intron|ATP7B_ENST00000344297.5_Intron|ATP7B_ENST00000417240.2_5'UTR|ATP7B_ENST00000400366.3_Missense_Mutation_p.A527S|ATP7B_ENST00000448424.2_Missense_Mutation_p.A638S	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide	638					cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	AAGTGATGAGCGTTGGGGTTT	0.453									Wilson disease																																								0								ENSG00000123191						200.0	191.0	193.0					13																	52536007		1897	4104	6001	ATP7B	SO:0001583	missense	0	Familial Cancer Database		-	HGNC	U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.1912G>T	13.37:g.52536007C>A	ENSP00000242839:p.Ala638Ser	Somatic	0	69	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	93	21.85	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HeavyMe-assoc_HMA,pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_Cation_transp_P_typ_ATPase,tigrfam_Cation_transp_P-typ_ATPase_IB,tigrfam_Cation_transp_P_typ_ATPase,tigrfam_HMA_Cu_ion-bd	p.A638S	ENST00000242839.4	37	c.1912	CCDS41892.1	13	.	.	.	.	.	.	.	.	.	.	C	20.2	3.955514	0.73902	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000448424;ENST00000418097	D;D;D;D	0.96459	-3.98;-3.97;-3.96;-4.02	5.46	5.46	0.80206	Heavy metal-associated domain, HMA (1);	0.435181	0.28365	N	0.015618	D	0.96294	0.8791	L	0.45352	1.415	0.80722	D	1	D;B;D;B;B	0.64830	0.994;0.25;0.988;0.023;0.406	D;B;D;B;B	0.67725	0.947;0.158;0.953;0.095;0.149	D	0.94004	0.7278	10	0.11794	T	0.64	-8.4717	14.5714	0.68213	0.0:0.9275:0.0:0.0725	.	638;638;638;527;638	E7ET55;B7ZLR4;F5H748;P35670-3;P35670	.;.;.;.;ATP7B_HUMAN	S	638;527;638;638	ENSP00000242839:A638S;ENSP00000383217:A527S;ENSP00000416738:A638S;ENSP00000393343:A638S	ENSP00000242839:A638S	A	-	1	0	ATP7B	51434008	0.999000	0.42202	0.387000	0.26183	0.824000	0.46624	4.192000	0.58378	2.562000	0.86427	0.650000	0.86243	GCT	-	superfamily_HeavyMe-assoc_HMA		0.453	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7B	protein_coding	OTTHUMT00000045981.1	C	NM_000053	-		52536007	-1	no_errors	ENST00000242839	ensembl	human	known	74_37	missense	SNP	0.995	A
IL12RB1	3594	genome.wustl.edu	37	19	18179264	18179264	+	Missense_Mutation	SNP	G	G	A	rs201548803		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:18179264G>A	ENST00000600835.2	-	12	1560	c.1262C>T	c.(1261-1263)tCt>tTt	p.S421F	IL12RB1_ENST00000593993.2_Missense_Mutation_p.S421F			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	421	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						GGGGTGCGCAGAGGCAAAGAT	0.517																																																	0								ENSG00000096996						129.0	130.0	130.0					19																	18179264		2038	4185	6223	IL12RB1	SO:0001583	missense	0			-	HGNC	U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1262C>T	19.37:g.18179264G>A	ENSP00000470788:p.Ser421Phe	Somatic	0	45	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	98	32.41	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S421F	ENST00000600835.2	37	c.1262	CCDS54232.1	19	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213203	0.58452	.	.	ENSG00000096996	ENST00000430026	D	0.84223	-1.82	4.6	4.6	0.57074	.	0.244102	0.29286	N	0.012591	D	0.89458	0.6721	M	0.66939	2.045	0.80722	D	1	D;P	0.53885	0.963;0.938	P;P	0.60473	0.875;0.754	D	0.88634	0.3171	10	0.39692	T	0.17	-18.5864	13.2552	0.60074	0.0:0.0:1.0:0.0	.	421;421	P42701-2;P42701	.;I12R1_HUMAN	F	421	ENSP00000403103:S421F	ENSP00000403103:S421F	S	-	2	0	IL12RB1	18040264	0.997000	0.39634	0.361000	0.25849	0.123000	0.20343	4.287000	0.59001	2.266000	0.75297	0.561000	0.74099	TCT	-	NULL		0.517	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB1	protein_coding	OTTHUMT00000466525.3	G		rs201548803		18179264	-1	no_errors	ENST00000593993	ensembl	human	known	74_37	missense	SNP	0.646	A
CTNNA2	1496	genome.wustl.edu	37	2	80085281	80085281	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr2:80085281G>A	ENST00000402739.4	+	3	446	c.441G>A	c.(439-441)atG>atA	p.M147I	CTNNA2_ENST00000466387.1_Missense_Mutation_p.M147I|CTNNA2_ENST00000496558.1_Missense_Mutation_p.M147I|CTNNA2_ENST00000361291.4_Missense_Mutation_p.M181I|CTNNA2_ENST00000540488.1_Missense_Mutation_p.M147I|CTNNA2_ENST00000541047.1_Missense_Mutation_p.M147I	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	147					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CAGATGTCATGAGACTTTTAT	0.498																																																	0								ENSG00000066032						65.0	64.0	64.0					2																	80085281		2013	4180	6193	CTNNA2	SO:0001583	missense	0			-	HGNC		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.441G>A	2.37:g.80085281G>A	ENSP00000384638:p.Met147Ile	Somatic	0	23	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	25	30.56	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.M181I	ENST00000402739.4	37	c.543		2	.	.	.	.	.	.	.	.	.	.	G	15.62	2.886337	0.51908	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T	0.36520	1.25;1.25;1.25;1.25;1.25;1.25	5.67	5.67	0.87782	.	0.049329	0.85682	D	0.000000	T	0.30262	0.0759	N	0.19112	0.55	0.47819	D	0.99952	B;B;B	0.18741	0.002;0.03;0.03	B;B;B	0.23018	0.004;0.007;0.043	T	0.04664	-1.0935	10	0.46703	T	0.11	.	19.773	0.96379	0.0:0.0:1.0:0.0	.	147;147;147	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	I	147;147;181;147;147;147	ENSP00000418191:M147I;ENSP00000419295:M147I;ENSP00000355398:M181I;ENSP00000384638:M147I;ENSP00000444675:M147I;ENSP00000441705:M147I	ENSP00000355398:M181I	M	+	3	0	CTNNA2	79938789	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.424000	0.66464	2.677000	0.91161	0.655000	0.94253	ATG	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin		0.498	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	protein_coding	OTTHUMT00000328511.4	G	NM_004389	-		80085281	+1	no_errors	ENST00000361291	ensembl	human	known	74_37	missense	SNP	1.000	A
CNTN2	6900	genome.wustl.edu	37	1	205028265	205028265	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:205028265G>A	ENST00000331830.4	+	6	825	c.541G>A	c.(541-543)Ggg>Agg	p.G181R		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	181	Ig-like C2-type 2.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CCCGACGGACGGGCGTCACTT	0.582																																					Melanoma(183;2548 2817 37099 41192)												0								ENSG00000184144						70.0	60.0	63.0					1																	205028265		2203	4300	6503	CNTN2	SO:0001583	missense	0			-	HGNC	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.541G>A	1.37:g.205028265G>A	ENSP00000330633:p.Gly181Arg	Somatic	0	32	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	17	37.04	P78432|Q5T054	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G181R	ENST00000331830.4	37	c.541	CCDS1449.1	1	.	.	.	.	.	.	.	.	.	.	G	12.04	1.818420	0.32145	.	.	ENSG00000184144	ENST00000331830	T	0.78364	-1.17	4.47	3.56	0.40772	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.114163	0.38959	N	0.001501	T	0.58935	0.2157	L	0.28608	0.87	0.47994	D	0.999563	P;P;B	0.36974	0.576;0.576;0.394	B;B;B	0.28139	0.086;0.086;0.086	T	0.54417	-0.8297	10	0.27082	T	0.32	.	7.8387	0.29384	0.2592:0.0:0.7408:0.0	.	181;181;72	A1L3A3;Q02246;Q68DA2	.;CNTN2_HUMAN;.	R	181	ENSP00000330633:G181R	ENSP00000330633:G181R	G	+	1	0	CNTN2	203294888	1.000000	0.71417	0.973000	0.42090	0.958000	0.62258	5.549000	0.67261	1.027000	0.39758	-0.203000	0.12734	GGG	-	smart_Ig_sub,pfscan_Ig-like_dom		0.582	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	protein_coding	OTTHUMT00000090080.3	G	NM_005076	-		205028265	+1	no_errors	ENST00000331830	ensembl	human	known	74_37	missense	SNP	0.980	A
SCG3	29106	genome.wustl.edu	37	15	51987960	51987960	+	Intron	DEL	A	A	-	rs78233272|rs370571693		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr15:51987960delA	ENST00000220478.3	+	8	1271				SCG3_ENST00000542355.2_Intron|RP11-313P18.2_ENST00000559918.1_lincRNA	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		ctcgtctttgaaaaaaaaaaa	0.403																																																	0								ENSG00000259241																																			RP11-313P18.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.869-112A>-	15.37:g.51987960delA		Somatic	0	17	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000220478.3	37	NULL	CCDS10142.1	15																																																																																			-	-		0.403	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259241	protein_coding	OTTHUMT00000254670.2	A	NM_013243			51987960	-1	no_errors	ENST00000559918	ensembl	human	known	74_37	rna	DEL	0.006	-
UBXN8	7993	genome.wustl.edu	37	8	30601706	30601706	+	RNA	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr8:30601706C>T	ENST00000519246.1	+	0	16							O00124	UBXN8_HUMAN	UBX domain protein 8						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|single fertilization (GO:0007338)	integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(1)|lung(2)	3						CTTCCGCCACCATGGCTTCAC	0.627																																					Colon(169;855 1943 17895 39459 47884)												0								ENSG00000104691						69.0	72.0	71.0					8																	30601706		1916	4124	6040	UBXN8			0			-	HGNC	D83767	CCDS75723.1, CCDS75724.1, CCDS75725.1	8p12-p11.2	2012-07-06	2008-07-25	2008-07-25		ENSG00000104691		"""UBX domain containing"""	30307	protein-coding gene	gene with protein product		602155	"""UBX domain containing 6"""	UBXD6		9027507, 21949850	Standard	NM_005671		Approved	D8S2298E, REP8	uc003xii.3	O00124			8.37:g.30601706C>T		Somatic	0	37	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	27	35.71	Q7Z6F2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000519246.1	37	NULL		8																																																																																			-	-		0.627	UBXN8-001	KNOWN	basic	processed_transcript	UBXN8	processed_transcript	OTTHUMT00000375957.1	C	NM_005671	-		30601706	+1	no_errors	ENST00000265616	ensembl	human	known	74_37	rna	SNP	0.193	T
MYT1L	23040	genome.wustl.edu	37	2	1947065	1947065	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr2:1947065T>A	ENST00000399161.2	-	9	941	c.194A>T	c.(193-195)gAt>gTt	p.D65V	MYT1L_ENST00000428368.2_Missense_Mutation_p.D65V	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	65					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GGGCTGTTTATCTTGTGTTTT	0.433																																																	0								ENSG00000186487						65.0	57.0	59.0					2																	1947065		1921	4130	6051	MYT1L	SO:0001583	missense	0			-	HGNC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.194A>T	2.37:g.1947065T>A	ENSP00000382114:p.Asp65Val	Somatic	0	42	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	10	64.29	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myelin_TF,pfam_Znf_C2HC	p.D65V	ENST00000399161.2	37	c.194		2	.	.	.	.	.	.	.	.	.	.	T	17.69	3.451879	0.63290	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.53423	0.62;0.62	5.46	5.46	0.80206	.	0.058680	0.64402	D	0.000003	T	0.40473	0.1118	N	0.19112	0.55	0.80722	D	1	B;P	0.35908	0.392;0.527	B;B	0.41332	0.193;0.354	T	0.38866	-0.9641	10	0.49607	T	0.09	-39.3063	15.5524	0.76164	0.0:0.0:0.0:1.0	.	65;65	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	V	65	ENSP00000382114:D65V;ENSP00000396103:D65V	ENSP00000295067:D65V	D	-	2	0	MYT1L	1926072	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.023000	0.76437	2.079000	0.62486	0.455000	0.32223	GAT	-	NULL		0.433	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	protein_coding	OTTHUMT00000322493.1	T	NM_015025	-		1947065	-1	no_errors	ENST00000399161	ensembl	human	known	74_37	missense	SNP	1.000	A
SLX4	84464	genome.wustl.edu	37	16	3646204	3646204	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr16:3646204G>A	ENST00000294008.3	-	8	2514	c.1874C>T	c.(1873-1875)gCc>gTc	p.A625V		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	625	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						CCACGGGCTGGCGCTCAGTCC	0.731								Direct reversal of damage																																									0								ENSG00000188827						5.0	7.0	7.0					16																	3646204		2108	4143	6251	SLX4	SO:0001583	missense	0			-	HGNC	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1874C>T	16.37:g.3646204G>A	ENSP00000294008:p.Ala625Val	Somatic	0	18	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	17	39.29	Q69YT8|Q8TF15|Q96JP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.A625V	ENST00000294008.3	37	c.1874	CCDS10506.2	16	.	.	.	.	.	.	.	.	.	.	G	14.50	2.554007	0.45487	.	.	ENSG00000188827	ENST00000294008	T	0.19532	2.14	5.21	1.59	0.23543	.	0.989318	0.08225	N	0.978555	T	0.12732	0.0309	L	0.39898	1.24	0.21020	N	0.999803	P	0.39480	0.675	B	0.26094	0.066	T	0.23013	-1.0200	10	0.42905	T	0.14	.	4.2962	0.10902	0.1621:0.4948:0.3431:0.0	.	625	Q8IY92	SLX4_HUMAN	V	625	ENSP00000294008:A625V	ENSP00000294008:A625V	A	-	2	0	SLX4	3586205	0.868000	0.29978	0.465000	0.27155	0.256000	0.26092	1.360000	0.34125	0.534000	0.28695	0.561000	0.74099	GCC	-	NULL		0.731	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLX4	protein_coding	OTTHUMT00000157301.3	G	NM_032444	-		3646204	-1	no_errors	ENST00000294008	ensembl	human	known	74_37	missense	SNP	0.694	A
FHOD3	80206	genome.wustl.edu	37	18	34205614	34205614	+	Silent	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr18:34205614G>T	ENST00000359247.4	+	10	1098	c.1098G>T	c.(1096-1098)tcG>tcT	p.S366S	FHOD3_ENST00000445677.1_Silent_p.S366S|FHOD3_ENST00000257209.4_Silent_p.S366S|FHOD3_ENST00000590592.1_Silent_p.S366S|FHOD3_ENST00000591635.1_Missense_Mutation_p.R41L	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	366	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GCAGGCACTCGGTGCAGAGCA	0.672																																																	0								ENSG00000134775						74.0	77.0	76.0					18																	34205614		2203	4300	6503	FHOD3	SO:0001819	synonymous_variant	0			-	HGNC	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1098G>T	18.37:g.34205614G>T		Somatic	0	39	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,smart_FH2_Formin	p.R41L	ENST00000359247.4	37	c.122		18																																																																																			-	NULL		0.672	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	protein_coding	OTTHUMT00000460884.1	G	XM_371114	-		34205614	+1	no_errors	ENST00000591635	ensembl	human	putative	74_37	missense	SNP	0.014	T
PTP4A2	8073	genome.wustl.edu	37	1	32384717	32384717	+	5'UTR	DEL	A	A	-	rs532230753|rs370536901	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:32384717delA	ENST00000602725.1	-	0	367				PTP4A2_ENST00000344035.6_5'UTR|PTP4A2_ENST00000457805.2_5'UTR|PTP4A2_ENST00000526960.1_5'Flank|PTP4A2_ENST00000356536.3_5'UTR|PTP4A2_ENST00000470404.1_5'UTR|RP11-84A19.4_ENST00000602889.1_lincRNA			Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2						peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				GGGGAAAGTGAAAAAAAAAAA	0.368													|||unknown(HR)	282	0.0563099	0.1762	0.013	5008	,	,		21482	0.0079		0.0139	False		,,,				2504	0.0184																0								ENSG00000184007						35.0	38.0	37.0					1																	32384717		2203	4300	6503	PTP4A2	SO:0001623	5_prime_UTR_variant	0				HGNC	L48723	CCDS348.1, CCDS53292.1, CCDS59193.1	1p35	2011-06-09			ENSG00000184007	ENSG00000184007		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9635	protein-coding gene	gene with protein product		601584		PTP4A		8661118, 9514946	Standard	NM_080391		Approved	HU-PP-1, PTPCAAX2, OV-1, ptp-IV1a, PRL-2	uc001bty.2	Q12974	OTTHUMG00000003801	ENST00000602725.1:c.-51T>-	1.37:g.32384717delA		Somatic	0	14	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A8K9I8|B4DM39|D3DPP0|E9PGJ6|O00649|Q15197|Q15259|Q15260|Q15261|R4GN50	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000602725.1	37	NULL	CCDS348.1	1																																																																																			-	-		0.368	PTP4A2-019	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A2	protein_coding	OTTHUMT00000468092.1	A	NM_080391			32384717	-1	no_errors	ENST00000532289	ensembl	human	known	74_37	rna	DEL	0.000	-
KIF28P	100130097	genome.wustl.edu	37	1	246954051	246954051	+	RNA	SNP	C	C	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:246954051C>A	ENST00000451123.1	-	0	0				RP11-439E19.3_ENST00000505748.1_RNA|RP11-439E19.3_ENST00000421003.1_RNA|RP11-439E19.3_ENST00000419361.1_RNA																							GAGTGACCGTCACTTTACCGT	0.498																																																	0								ENSG00000227953																																			RP11-439E19.3			0			-	Clone_based_vega_gene																													1.37:g.246954051C>A		Somatic	0	48	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	51	27.14		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000451123.1	37	NULL		1																																																																																			-	-		0.498	RP11-439E19.8-002	KNOWN	basic|exp_conf	processed_transcript	LOC149134	pseudogene	OTTHUMT00000331247.2	C		-		246954051	+1	no_errors	ENST00000419361	ensembl	human	known	74_37	rna	SNP	0.999	A
USP25	29761	genome.wustl.edu	37	21	17183456	17183456	+	Splice_Site	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr21:17183456G>T	ENST00000285679.6	+	9	1227	c.858G>T	c.(856-858)acG>acT	p.T286T	USP25_ENST00000400183.2_Splice_Site_p.T286T|USP25_ENST00000285681.2_Splice_Site_p.T286T|USP25_ENST00000351097.5_Intron|USP25_ENST00000547201.1_3'UTR	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	286	USP.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		CATACTTTAGGGATGAAGAGA	0.318																																																	0								ENSG00000155313						122.0	127.0	125.0					21																	17183456		2203	4300	6503	USP25	SO:0001630	splice_region_variant	0			-	HGNC	AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.858-1G>T	21.37:g.17183456G>T		Somatic	0	111	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	83	22.43	C0LSZ0|Q6DHZ9|Q9H9W1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_Ubiquitin-int_motif,superfamily_UBA-like,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19/C67	p.T286	ENST00000285679.6	37	c.858	CCDS33515.1	21																																																																																			-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.318	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP25	protein_coding	OTTHUMT00000157964.1	G		-	Silent	17183456	+1	no_errors	ENST00000400183	ensembl	human	known	74_37	silent	SNP	1.000	T
HERC4	26091	genome.wustl.edu	37	10	69716602	69716603	+	Intron	INS	-	-	A	rs78135151		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr10:69716602_69716603insA	ENST00000395198.3	-	18	2297				HERC4_ENST00000277817.6_Intron|HERC4_ENST00000412272.2_Intron|HERC4_ENST00000480158.1_5'UTR|HERC4_ENST00000395187.2_Intron|HERC4_ENST00000373700.4_Intron	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4						cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						AAGAAACAATTAAAAAAAAAAA	0.332																																																	0								ENSG00000148634																																			HERC4	SO:0001627	intron_variant	0				HGNC	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.2049+31->T	10.37:g.69716613_69716613dupA		Somatic	0	42	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	100	9.91	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395198.3	37	NULL	CCDS41533.1	10																																																																																			-	-		0.332	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC4	protein_coding	OTTHUMT00000359262.1	-	NM_015601			69716603	-1	no_errors	ENST00000480158	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
ZNF540	163255	genome.wustl.edu	37	19	38039815	38039815	+	5'Flank	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:38039815C>T	ENST00000592533.1	+	0	0				ZNF571-AS1_ENST00000588382.1_RNA|ZNF571-AS1_ENST00000591430.1_RNA|ZNF571-AS1_ENST00000590838.1_RNA|ZNF571-AS1_ENST00000587121.1_RNA|ZNF571-AS1_ENST00000592392.1_RNA|CTD-3064H18.4_ENST00000316807.2_RNA|ZNF571-AS1_ENST00000589802.1_RNA|ZNF571-AS1_ENST00000586139.1_RNA|ZNF571-AS1_ENST00000585578.1_RNA|ZNF571-AS1_ENST00000586013.1_RNA|ZNF571-AS1_ENST00000592575.1_RNA|ZNF571-AS1_ENST00000589750.1_RNA	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540						negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCACCGTTGCCGGGGGACTGG	0.697																																																	0								ENSG00000180458																																			CTD-3064H18.4	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6			19.37:g.38039815C>T	Exception_encountered	Somatic	0	98	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	106	25.35	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000592533.1	37	NULL	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	C	9.430	1.085230	0.20390	.	.	ENSG00000180458	ENST00000316807	.	.	.	0.364	0.364	0.16124	.	.	.	.	.	T	0.54967	0.1891	.	.	.	.	.	.	.	.	.	.	.	.	T	0.65146	-0.6239	3	0.87932	D	0	.	.	.	.	.	.	.	.	S	63	.	ENSP00000324876:G63S	G	-	1	0	AC022148.1	42731655	0.139000	0.22563	0.006000	0.13384	0.005000	0.04900	0.212000	0.17497	0.406000	0.25560	0.407000	0.27541	GGC	-	-		0.697	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000180458	protein_coding	OTTHUMT00000459481.1	C	NM_152606	-		38039815	-1	no_errors	ENST00000316807	ensembl	human	known	74_37	rna	SNP	0.006	T
PARD3	56288	genome.wustl.edu	37	10	35103843	35103843	+	Silent	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr10:35103843G>T	ENST00000374789.3	-	1	406	c.81C>A	c.(79-81)atC>atA	p.I27I	PARD3_ENST00000374776.1_Silent_p.I27I|PARD3_ENST00000340077.5_Silent_p.I27I|PARD3_ENST00000374788.3_Silent_p.I27I|PARD3_ENST00000374773.1_Silent_p.I27I|PARD3_ENST00000545260.1_Silent_p.I27I|PARD3_ENST00000545693.1_Silent_p.I27I|PARD3_ENST00000346874.4_Silent_p.I27I|PARD3_ENST00000374790.3_Silent_p.I27I|PARD3_ENST00000350537.4_Silent_p.I27I|PARD3-AS1_ENST00000446211.1_RNA|PARD3_ENST00000374794.3_Silent_p.I27I	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	27					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CCGCCTGCTGGATGAGGCTGA	0.731																																																	0								ENSG00000148498						10.0	9.0	9.0					10																	35103843		2176	4241	6417	PARD3	SO:0001819	synonymous_variant	0			-	HGNC	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.81C>A	10.37:g.35103843G>T		Somatic	0	24	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.I27	ENST00000374789.3	37	c.81	CCDS7178.1	10																																																																																			-	pfam_DUF3534		0.731	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	protein_coding	OTTHUMT00000047527.1	G	NM_019619	-		35103843	-1	no_errors	ENST00000374789	ensembl	human	known	74_37	silent	SNP	1.000	T
PKP2	5318	genome.wustl.edu	37	12	32977078	32977078	+	Silent	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr12:32977078G>A	ENST00000070846.6	-	8	1731	c.1707C>T	c.(1705-1707)ggC>ggT	p.G569G	PKP2_ENST00000340811.4_Silent_p.G525G	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	569					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TCCCATCAGCGCCAGCAGAAC	0.413																																																	0								ENSG00000057294						117.0	101.0	107.0					12																	32977078		2203	4300	6503	PKP2	SO:0001819	synonymous_variant	0			-	HGNC	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1707C>T	12.37:g.32977078G>A		Somatic	0	37	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.G569	ENST00000070846.6	37	c.1707	CCDS8731.1	12																																																																																			-	superfamily_ARM-type_fold		0.413	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	protein_coding	OTTHUMT00000404449.1	G	NM_004572	-		32977078	-1	no_errors	ENST00000070846	ensembl	human	known	74_37	silent	SNP	0.996	A
CYP4V2	285440	genome.wustl.edu	37	4	187118756	187118756	+	Splice_Site	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr4:187118756G>T	ENST00000378802.4	+	5	978	c.674G>T	c.(673-675)aGa>aTa	p.R225I		NM_207352.3	NP_997235.3	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily V, polypeptide 2	225					fatty acid omega-oxidation (GO:0010430)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)|stomach(2)	20		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		GCAGTTTATAGGTAAATGGAG	0.318																																																	0								ENSG00000145476						124.0	127.0	126.0					4																	187118756		2203	4300	6503	CYP4V2	SO:0001630	splice_region_variant	0			-	HGNC	AK022114	CCDS34119.1	4q35.2	2004-07-05			ENSG00000145476	ENSG00000145476		"""Cytochrome P450s"""	23198	protein-coding gene	gene with protein product		608614				15042513	Standard	NM_207352		Approved	CYP4AH1	uc003iyw.4	Q6ZWL3	OTTHUMG00000160379	ENST00000378802.4:c.674+1G>T	4.37:g.187118756G>T		Somatic	0	45	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B7U6W2|Q6ZTM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.R225I	ENST00000378802.4	37	c.674	CCDS34119.1	4	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179438	0.78564	.	.	ENSG00000145476	ENST00000378802;ENST00000274118	T	0.68903	-0.36	5.2	5.2	0.72013	.	0.091352	0.85682	D	0.000000	T	0.61375	0.2342	L	0.48174	1.505	0.80722	D	1	P	0.37158	0.585	B	0.38985	0.287	T	0.64774	-0.6328	10	0.59425	D	0.04	.	11.9254	0.52817	0.0799:0.0:0.9201:0.0	.	225	Q6ZWL3	CP4V2_HUMAN	I	225;203	ENSP00000368079:R225I	ENSP00000274118:R203I	R	+	2	0	CYP4V2	187355750	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	1.840000	0.39230	2.698000	0.92095	0.655000	0.94253	AGA	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.318	CYP4V2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4V2	protein_coding	OTTHUMT00000360398.1	G	XM_209612	-	Missense_Mutation	187118756	+1	no_errors	ENST00000378802	ensembl	human	known	74_37	missense	SNP	1.000	T
FCGR3A	2214	genome.wustl.edu	37	1	161512900	161512900	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:161512900T>C	ENST00000436743.1	-	6	821	c.667A>G	c.(667-669)Aca>Gca	p.T223A	RP11-25K21.6_ENST00000537821.2_RNA|FCGR3A_ENST00000540048.1_Missense_Mutation_p.T223A|FCGR3A_ENST00000476031.1_5'Flank|FCGR3A_ENST00000367969.3_Missense_Mutation_p.T259A|FCGR3A_ENST00000443193.1_Missense_Mutation_p.T258A	NM_001127593.1|NM_001127595.1|NM_001127596.1	NP_001121065.1|NP_001121067.1|NP_001121068.1	P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)	223					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TATAGTCCTGTGTCCACTGCA	0.428																																																	0								ENSG00000203747						123.0	125.0	125.0					1																	161512900		2203	4300	6503	FCGR3A	SO:0001583	missense	0			-	HGNC	BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000436743.1:c.667A>G	1.37:g.161512900T>C	ENSP00000416607:p.Thr223Ala	Somatic	0	84	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	71	27.55	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,pfscan_Ig-like_dom	p.T259A	ENST00000436743.1	37	c.775	CCDS44266.1	1	.	.	.	.	.	.	.	.	.	.	T	18.25	3.582205	0.65992	.	.	ENSG00000203747	ENST00000367969;ENST00000443193;ENST00000436743;ENST00000367967;ENST00000540048	T;T;T;T;T	0.02121	4.44;4.44;4.57;4.57;4.57	4.44	4.44	0.53790	.	4.491350	0.01193	N	0.007372	T	0.07683	0.0193	M	0.79011	2.435	0.33871	D	0.634989	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.78314	0.991;0.991;0.963	T	0.01488	-1.1342	10	0.54805	T	0.06	.	10.267	0.43460	0.0:0.0:0.0:1.0	.	223;258;223	P08637;E9PG94;Q9UPY7	FCG3A_HUMAN;.;.	A	259;258;223;223;223	ENSP00000356946:T259A;ENSP00000392047:T258A;ENSP00000416607:T223A;ENSP00000356944:T223A;ENSP00000444971:T223A	ENSP00000356944:T223A	T	-	1	0	FCGR3A	159779524	1.000000	0.71417	0.991000	0.47740	0.864000	0.49448	3.118000	0.50414	1.989000	0.58080	0.482000	0.46254	ACA	-	NULL		0.428	FCGR3A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGR3A	protein_coding	OTTHUMT00000102169.2	T	NM_000569	-		161512900	-1	no_errors	ENST00000367969	ensembl	human	known	74_37	missense	SNP	0.997	C
LILRB4	11006	genome.wustl.edu	37	19	55179188	55179188	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:55179188G>T	ENST00000391736.1	+	13	1459	c.1144G>T	c.(1144-1146)Gaa>Taa	p.E382*	LILRB4_ENST00000391734.3_Intron|LILRB4_ENST00000270452.2_Nonsense_Mutation_p.E382*|LILRB4_ENST00000391733.3_Nonsense_Mutation_p.E383*|LILRB4_ENST00000430952.2_Nonsense_Mutation_p.E381*	NM_001278426.2|NM_001278428.2|NM_001278429.2|NM_001278430.2	NP_001265355.1|NP_001265357.1|NP_001265358.1|NP_001265359.1	Q8NHJ6	LIRB4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4	382					immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(20)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	39				GBM - Glioblastoma multiforme(193;0.035)		ACTGTCTGGGGAATTCCTGGA	0.592																																																	0								ENSG00000186818						68.0	68.0	68.0					19																	55179188		2201	4297	6498	LILRB4	SO:0001587	stop_gained	0			-	HGNC	U82979	CCDS12902.1, CCDS42618.1	19q13.4	2013-01-11				ENSG00000186818		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6608	protein-coding gene	gene with protein product		604821				9151699, 9079806	Standard	XM_005277050		Approved	LIR-5, ILT3, HM18, LIR5, CD85k	uc002qgp.3	Q8NHJ6		ENST00000391736.1:c.1144G>T	19.37:g.55179188G>T	ENSP00000375616:p.Glu382*	Somatic	0	79	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	90	11.76	A8MVL8|O15468|O75021|Q6FGQ9|Q8N1C7|Q8NHL5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,pfscan_Ig-like_dom	p.E382*	ENST00000391736.1	37	c.1144	CCDS12902.1	19	.	.	.	.	.	.	.	.	.	.	G	13.94	2.388375	0.42308	.	.	ENSG00000186818	ENST00000391736;ENST00000270452;ENST00000430952;ENST00000391733;ENST00000434286	.	.	.	2.36	2.36	0.29203	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	8.2257	0.31568	0.0:0.0:1.0:0.0	.	.	.	.	X	382;382;381;383;381	.	ENSP00000270452:E382X	E	+	1	0	LILRB4	59871000	0.000000	0.05858	0.010000	0.14722	0.150000	0.21749	-0.510000	0.06328	1.332000	0.45431	0.561000	0.74099	GAA	-	NULL		0.592	LILRB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB4	protein_coding	OTTHUMT00000141127.3	G		-		55179188	+1	no_errors	ENST00000270452	ensembl	human	known	74_37	nonsense	SNP	0.008	T
SEZ6L	23544	genome.wustl.edu	37	22	26688873	26688873	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr22:26688873C>A	ENST00000248933.6	+	2	691	c.596C>A	c.(595-597)cCc>cAc	p.P199H	SEZ6L_ENST00000403121.1_5'UTR|SEZ6L_ENST00000404234.3_Missense_Mutation_p.P199H|SEZ6L_ENST00000343706.4_Missense_Mutation_p.P199H|SEZ6L_ENST00000529632.2_Missense_Mutation_p.P199H|SEZ6L_ENST00000402979.1_5'UTR|SEZ6L_ENST00000360929.3_Missense_Mutation_p.P199H			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	199					adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						ACACCCGCACCCCTGCAAATC	0.672																																																	0								ENSG00000100095						56.0	59.0	58.0					22																	26688873		2203	4298	6501	SEZ6L	SO:0001583	missense	0			-	HGNC	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.596C>A	22.37:g.26688873C>A	ENSP00000248933:p.Pro199His	Somatic	0	31	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	25	34.21	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P199H	ENST00000248933.6	37	c.596	CCDS13833.1	22	.	.	.	.	.	.	.	.	.	.	C	13.39	2.222253	0.39300	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706	T;T;T;T;T	0.33216	1.65;1.79;1.83;1.67;1.42	4.49	4.49	0.54785	.	0.164112	0.28877	N	0.013844	T	0.30665	0.0772	N	0.08118	0	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.998;1.0;1.0;0.998;0.998	D;P;D;D;P;P	0.76575	0.915;0.87;0.964;0.988;0.87;0.87	T	0.20739	-1.0266	10	0.72032	D	0.01	.	7.4588	0.27283	0.1656:0.7458:0.0:0.0886	.	199;199;199;199;199;199	B7ZLJ8;B7ZLJ6;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;SE6L1_HUMAN	H	199	ENSP00000384772:P199H;ENSP00000437037:P199H;ENSP00000354185:P199H;ENSP00000248933:P199H;ENSP00000342661:P199H	ENSP00000248933:P199H	P	+	2	0	SEZ6L	25018873	0.028000	0.19301	0.992000	0.48379	0.302000	0.27658	1.868000	0.39509	2.216000	0.71823	0.508000	0.49915	CCC	-	NULL		0.672	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	protein_coding	OTTHUMT00000320359.3	C		-		26688873	+1	no_errors	ENST00000248933	ensembl	human	known	74_37	missense	SNP	0.930	A
TTN	7273	genome.wustl.edu	37	2	179470001	179470001	+	Missense_Mutation	SNP	C	C	T	rs200100660		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr2:179470001C>T	ENST00000591111.1	-	230	49204	c.48980G>A	c.(48979-48981)cGt>cAt	p.R16327H	TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R9028H|TTN_ENST00000460472.2_Missense_Mutation_p.R8903H|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R17968H|TTN_ENST00000342175.6_Missense_Mutation_p.R9095H|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R15400H|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16327	Ig-like 100.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACACTCAGACGCAACTTAAT	0.433																																																	0								ENSG00000155657	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	1,3767		0,1,1883	27.0	25.0	26.0		26708,46199,27083,27284	5.7	1.0	2		26	3,8183		0,3,4090	yes	missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	29,29,29,29	0,4,5973	TT,TC,CC		0.0366,0.0265,0.0335	probably-damaging,probably-damaging,probably-damaging,probably-damaging	8903/26927,15400/33424,9028/27052,9095/27119	179470001	4,11950	1884	4093	5977	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48980G>A	2.37:g.179470001C>T	ENSP00000465570:p.Arg16327His	Somatic	0	63	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	30	43.64	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R15400H	ENST00000591111.1	37	c.46199		2	.	.	.	.	.	.	.	.	.	.	C	12.36	1.914675	0.33815	2.65E-4	3.66E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63096	-0.02;0.16;0.14;0.13	5.74	5.74	0.90152	Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.64527	0.2606	N	0.24115	0.695	0.33490	D	0.588604	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	P;P;P;P	0.60609	0.877;0.877;0.877;0.877	T	0.73767	-0.3879	9	0.87932	D	0	.	13.1728	0.59609	0.0:0.9273:0.0:0.0727	.	8903;9028;9095;16327	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	15400;8903;9095;9028;8903	ENSP00000343764:R15400H;ENSP00000434586:R8903H;ENSP00000340554:R9095H;ENSP00000352154:R9028H	ENSP00000340554:R9095H	R	-	2	0	TTN	179178246	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.691000	0.47010	2.712000	0.92718	0.563000	0.77884	CGT	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Ig-like_dom		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378	rs200100660		179470001	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	T
ATP6V0A4	50617	genome.wustl.edu	37	7	138429926	138429926	+	Silent	SNP	A	A	G			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr7:138429926A>G	ENST00000310018.2	-	14	1702	c.1420T>C	c.(1420-1422)Ttg>Ctg	p.L474L	ATP6V0A4_ENST00000393054.1_Silent_p.L474L|ATP6V0A4_ENST00000353492.4_Silent_p.L474L	NM_020632.2|NM_130840.2	NP_065683.2|NP_570855.2	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a4	474					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			NS(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(15)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						AAGATGTTCAAGGACTTGGAG	0.488																																																	0								ENSG00000105929						189.0	165.0	173.0					7																	138429926		2203	4300	6503	ATP6V0A4	SO:0001819	synonymous_variant	0			-	HGNC	AF245517	CCDS5849.1	7q34	2011-06-09	2006-01-20	2002-05-10	ENSG00000105929	ENSG00000105929		"""ATPases / V-type"""	866	protein-coding gene	gene with protein product		605239	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1B"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 4"", ""ATPase, H+ transporting, lysosomal V0 subunit A4"""	ATP6N1B, ATP6N2, RTA1C		10577919, 10973252	Standard	XM_005250393		Approved	RDRTA2, VPP2, RTADR, a4, Vph1, Stv1	uc003vuf.3	Q9HBG4	OTTHUMG00000157122	ENST00000310018.2:c.1420T>C	7.37:g.138429926A>G		Somatic	0	45	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	39	45.21	A4D1R4|A8KA80|Q32M47	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_V-ATPase_116kDa_su	p.L474	ENST00000310018.2	37	c.1420	CCDS5849.1	7																																																																																			-	pfam_V-ATPase_116kDa_su		0.488	ATP6V0A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0A4	protein_coding	OTTHUMT00000347514.1	A	NM_020632	-		138429926	-1	no_errors	ENST00000310018	ensembl	human	known	74_37	silent	SNP	0.009	G
USH2A	7399	genome.wustl.edu	37	1	216256823	216256823	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:216256823T>A	ENST00000307340.3	-	26	5659	c.5273A>T	c.(5272-5274)aAc>aTc	p.N1758I	USH2A_ENST00000366943.2_Missense_Mutation_p.N1758I|RP11-22M7.2_ENST00000445619.1_RNA|RP11-22M7.2_ENST00000430890.1_RNA|RP11-22M7.2_ENST00000446411.1_RNA|RP11-22M7.2_ENST00000442606.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1758	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.N1758T(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCATCTTTGTTATAAACGAA	0.303										HNSCC(13;0.011)																																							1	Substitution - Missense(1)	lung(1)						ENSG00000042781						95.0	99.0	97.0					1																	216256823		2202	4299	6501	USH2A	SO:0001583	missense	0			-	HGNC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5273A>T	1.37:g.216256823T>A	ENSP00000305941:p.Asn1758Ile	Somatic	0	140	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	55	37.50	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.N1758I	ENST00000307340.3	37	c.5273	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.514563	0.64522	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.80566	-1.39;-1.39	4.38	3.25	0.37280	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Fibronectin, type III (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.48286	D	0.000186	D	0.87229	0.6125	M	0.73598	2.24	0.37378	D	0.911926	D	0.89917	1.0	D	0.75020	0.985	D	0.88077	0.2804	10	0.62326	D	0.03	.	9.8214	0.40885	0.0:0.0824:0.0:0.9176	.	1758	O75445	USH2A_HUMAN	I	1758	ENSP00000305941:N1758I;ENSP00000355910:N1758I	ENSP00000305941:N1758I	N	-	2	0	USH2A	214323446	1.000000	0.71417	0.946000	0.38457	0.929000	0.56500	2.642000	0.46596	0.656000	0.30886	0.533000	0.62120	AAC	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Laminin_G,pfscan_Laminin_G		0.303	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	T	NM_007123	-		216256823	-1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	SNP	0.994	A
ALDOB	229	genome.wustl.edu	37	9	104193131	104193131	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr9:104193131C>A	ENST00000374855.4	-	2	163	c.39G>T	c.(37-39)aaG>aaT	p.K13N	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	13					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				AGAGCTCCTTCTTCTGCTCCT	0.517																																																	0								ENSG00000136872						109.0	94.0	99.0					9																	104193131		2203	4300	6503	ALDOB	SO:0001583	missense	0			-	HGNC	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.39G>T	9.37:g.104193131C>A	ENSP00000363988:p.Lys13Asn	Somatic	0	30	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aldolase_I	p.K13N	ENST00000374855.4	37	c.39	CCDS6756.1	9	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442087	0.83993	.	.	ENSG00000136872	ENST00000374855;ENST00000374853;ENST00000430164	D	0.86164	-2.08	6.17	4.33	0.51752	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	D	0.91958	0.7453	M	0.83774	2.66	0.27288	N	0.957928	D	0.57257	0.979	P	0.58660	0.843	D	0.86906	0.2057	10	0.87932	D	0	-16.2921	12.4895	0.55891	0.0:0.8641:0.0:0.1359	.	13	P05062	ALDOB_HUMAN	N	13	ENSP00000363988:K13N	ENSP00000363986:K13N	K	-	3	2	ALDOB	103232952	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	4.100000	0.57762	1.631000	0.50456	0.655000	0.94253	AAG	-	NULL		0.517	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDOB	protein_coding	OTTHUMT00000053434.2	C		-		104193131	-1	no_errors	ENST00000374855	ensembl	human	known	74_37	missense	SNP	1.000	A
ZSCAN31	64288	genome.wustl.edu	37	6	28297405	28297405	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr6:28297405G>A	ENST00000414429.1	-	6	959	c.56C>T	c.(55-57)cCt>cTt	p.P19L	ZSCAN31_ENST00000344279.6_Missense_Mutation_p.P19L|ZSCAN31_ENST00000396838.2_Missense_Mutation_p.P19L|ZSCAN31_ENST00000481934.1_5'Flank|ZSCAN31_ENST00000439158.1_Missense_Mutation_p.P19L|ZSCAN31_ENST00000446474.1_Intron			Q96LW9	ZSC31_HUMAN	zinc finger and SCAN domain containing 31	19					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTCCCAGATAGGGTCTTCCTC	0.463																																																	0								ENSG00000235109						84.0	82.0	83.0					6																	28297405		2203	4300	6503	ZSCAN31	SO:0001583	missense	0			-	HGNC		CCDS4649.1, CCDS59001.1	6p	2013-01-09	2013-01-08	2013-01-08	ENSG00000235109	ENSG00000235109		"""-"", ""Zinc fingers, C2H2-type"""	14097	protein-coding gene	gene with protein product		610794	"""zinc finger protein 310 pseudogene"", ""zinc finger protein 323"""	ZNF310P, ZNF323			Standard	NM_001135216		Approved		uc003nla.3	Q96LW9	OTTHUMG00000014518	ENST00000414429.1:c.56C>T	6.37:g.28297405G>A	ENSP00000390076:p.Pro19Leu	Somatic	0	62	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	35	37.50	Q6P178|Q8WWS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.P19L	ENST00000414429.1	37	c.56	CCDS4649.1	6	.	.	.	.	.	.	.	.	.	.	G	2.570	-0.299958	0.05532	.	.	ENSG00000235109	ENST00000396838;ENST00000439158;ENST00000414429;ENST00000344279;ENST00000453745;ENST00000439636;ENST00000447021;ENST00000426756;ENST00000446222;ENST00000434036;ENST00000444081	T;T;T;T;T;T;T;T;T;T	0.04970	3.52;3.52;3.52;3.52;4.44;4.38;4.16;3.82;3.71;3.58	4.09	-3.73	0.04398	.	.	.	.	.	T	0.01254	0.0041	M	0.63428	1.95	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.49688	-0.8913	9	0.10377	T	0.69	.	0.3738	0.00384	0.3697:0.138:0.2119:0.2804	.	19	Q96LW9	ZN323_HUMAN	L	19	ENSP00000380050:P19L;ENSP00000413705:P19L;ENSP00000390076:P19L;ENSP00000345339:P19L;ENSP00000389479:P19L;ENSP00000412519:P19L;ENSP00000416108:P19L;ENSP00000406376:P19L;ENSP00000411033:P19L;ENSP00000416225:P19L	ENSP00000345339:P19L	P	-	2	0	ZNF323	28405384	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-0.361000	0.07612	-0.763000	0.04658	-0.222000	0.12452	CCT	-	NULL		0.463	ZSCAN31-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZSCAN31	protein_coding	OTTHUMT00000346804.1	G	NM_030899	-		28297405	-1	no_errors	ENST00000344279	ensembl	human	known	74_37	missense	SNP	0.000	A
ELMOD3	84173	genome.wustl.edu	37	2	85618139	85618147	+	3'UTR	DEL	CAGTGGAGC	CAGTGGAGC	-	rs73945729|rs138054626	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	CAGTGGAGC	CAGTGGAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr2:85618139_85618147delCAGTGGAGC	ENST00000409890.2	+	0	1867_1875				ELMOD3_ENST00000315658.7_3'UTR|ELMOD3_ENST00000409344.3_3'UTR|ELMOD3_ENST00000490508.1_3'UTR|ELMOD3_ENST00000393852.4_3'UTR|ELMOD3_ENST00000409013.3_3'UTR			Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3						phagocytosis (GO:0006909)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	12						TTCAGGGGGTCAGTGGAGCCATGTCAGGA	0.589														214	0.0427316	0.0439	0.0432	5008	,	,		19716	0.006		0.0656	False		,,,				2504	0.0552																0								ENSG00000115459																																			ELMOD3	SO:0001624	3_prime_UTR_variant	0				HGNC	AF258573	CCDS1973.1, CCDS46352.1	2p11.2	2014-01-28	2008-08-14	2008-08-14	ENSG00000115459	ENSG00000115459		"""RNA binding motif (RRM) containing"""	26158	protein-coding gene	gene with protein product		615427	"""RNA binding motif protein 29"", ""RNA binding motif and ELMO/CED-12 domain 1"", ""deafness, autosomal recessive 88"""	RBM29, RBED1, DFNB88		24039609	Standard	NM_032213		Approved	FLJ21977	uc010ysn.2	Q96FG2	OTTHUMG00000130170	ENST00000409890.2:c.*62CAGTGGAGC>-	2.37:g.85618139_85618147delCAGTGGAGC		Somatic	NA	NA	NA		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B8ZZD6|D6W5K4|Q2M1K3|Q2XSU3|Q2XSU4|Q8NAC1|Q8TCK4|Q8WV70|Q8WY75|Q9H6Q8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409890.2	37	NULL	CCDS46352.1	2																																																																																			-	-		0.589	ELMOD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMOD3	protein_coding	OTTHUMT00000329124.1	CAGTGGAGC	NM_032213			85618147	+1	no_errors	ENST00000490508	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
ZNF732	654254	genome.wustl.edu	37	4	265951	265951	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr4:265951A>C	ENST00000419098.1	-	4	705	c.695T>G	c.(694-696)tTt>tGt	p.F232C		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	232					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						GGATGTGGTAAAGATGTTGCC	0.343																																																	0								ENSG00000186777						79.0	69.0	72.0					4																	265951		692	1591	2283	ZNF732	SO:0001583	missense	0			-	HGNC	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.695T>G	4.37:g.265951A>C	ENSP00000415774:p.Phe232Cys	Somatic	0	28	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	28	47.17		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F232C	ENST00000419098.1	37	c.695	CCDS46990.1	4	.	.	.	.	.	.	.	.	.	.	A	10.95	1.494803	0.26774	.	.	ENSG00000186777	ENST00000419098	T	0.45668	0.89	0.946	0.946	0.19549	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.62588	0.2440	M	0.88241	2.94	0.09310	N	0.999991	D	0.89917	1.0	D	0.87578	0.998	T	0.49808	-0.8900	9	0.72032	D	0.01	.	2.9462	0.05847	0.6852:0.0:0.3148:0.0	.	232	B4DXR9	ZN732_HUMAN	C	232	ENSP00000415774:F232C	ENSP00000415774:F232C	F	-	2	0	ZNF732	255951	0.839000	0.29477	0.080000	0.20451	0.072000	0.16883	2.723000	0.47277	0.339000	0.23719	0.329000	0.21502	TTT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.343	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF732	protein_coding	OTTHUMT00000357937.2	A	NM_001137608	-		265951	-1	no_errors	ENST00000419098	ensembl	human	known	74_37	missense	SNP	0.264	C
KIAA1841	84542	genome.wustl.edu	37	2	61315639	61315640	+	Intron	DEL	TA	TA	-	rs377349663|rs375991537	byFrequency	TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr2:61315639_61315640delTA	ENST00000402291.1	+	10	1329				KIAA1841_ENST00000356719.2_Intron|KIAA1841_ENST00000453873.1_Intron|KIAA1841_ENST00000482513.1_3'UTR|KIAA1841_ENST00000295031.5_Intron	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841											breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			tgtatttttgtatatatatata	0.391																																																	0								ENSG00000162929		,	335,63,3410		22,3,288,4,52,1535					,	-1.2	0.0			16	699,131,6732		46,2,605,7,115,3006	no	intron,intron	KIAA1841	NM_032506.2,NM_001129993.1	,	68,5,893,11,167,4541	A1A1,A1A2,A1R,A2A2,A2R,RR		10.9759,10.4517,10.8004	,	,		1034,194,10142				KIAA1841	SO:0001627	intron_variant	0				HGNC	BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.1088+36TA>-	2.37:g.61315649_61315650delTA		Somatic	0	39	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	Q49AF0|Q6ZND0|Q96JI6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402291.1	37	NULL	CCDS46296.1	2																																																																																			-	-		0.391	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1841	protein_coding	OTTHUMT00000325477.1	TA	NM_032506			61315640	+1	no_errors	ENST00000482513	ensembl	human	known	74_37	rna	DEL	0.001:0.000	-
PPP1R12A	4659	genome.wustl.edu	37	12	80200022	80200022	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr12:80200022G>T	ENST00000450142.2	-	13	2013	c.1747C>A	c.(1747-1749)Cag>Aag	p.Q583K	PPP1R12A_ENST00000437004.2_Missense_Mutation_p.Q583K|AC073569.1_ENST00000598624.1_Intron|PPP1R12A_ENST00000550107.1_Intron|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.Q583K|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.Q496K	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	583	Ser/Thr-rich.				centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						AGGCTTTTCTGAAGCCCAGCT	0.438																																																	0								ENSG00000058272						268.0	263.0	265.0					12																	80200022		1962	4154	6116	PPP1R12A	SO:0001583	missense	0			-	HGNC	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.1747C>A	12.37:g.80200022G>T	ENSP00000389168:p.Gln583Lys	Somatic	0	52	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q583K	ENST00000450142.2	37	c.1747	CCDS44947.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.96|12.96	2.093223|2.093223	0.36952|0.36952	.|.	.|.	ENSG00000058272|ENSG00000058272	ENST00000553081|ENST00000261207;ENST00000546189;ENST00000360825;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000547330	.|T;T;T;T;T	.|0.37058	.|1.32;1.32;1.34;1.35;1.22	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.638589	.|0.16904	.|N	.|0.194774	T|T	0.29652|0.29652	0.0740|0.0740	L|L	0.34521|0.34521	1.04|1.04	0.33532|0.33532	D|D	0.593691|0.593691	.|B;B;B	.|0.27732	.|0.187;0.187;0.118	.|B;B;B	.|0.29716	.|0.073;0.106;0.049	T|T	0.29274|0.29274	-1.0017|-1.0017	5|10	.|0.14252	.|T	.|0.57	.|.	15.1626|15.1626	0.72795|0.72795	0.0:0.1407:0.8593:0.0|0.0:0.1407:0.8593:0.0	.|.	.|583;583;583	.|F8W8Q6;O14974-2;O14974	.|.;.;MYPT1_HUMAN	L|K	174|583;583;583;583;583;583;496;583	.|ENSP00000261207:Q583K;ENSP00000389168:Q583K;ENSP00000416769:Q583K;ENSP00000449514:Q496K;ENSP00000446816:Q583K	.|ENSP00000261207:Q583K	F|Q	-|-	3|1	2|0	PPP1R12A|PPP1R12A	78724153|78724153	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.185000|7.185000	0.77714|0.77714	2.641000|2.641000	0.89580|0.89580	0.591000|0.591000	0.81541|0.81541	TTC|CAG	-	pirsf_Pase-1_reg_su_12A/B/C_euk		0.438	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12A	protein_coding	OTTHUMT00000407254.2	G	NM_002480	-		80200022	-1	no_errors	ENST00000261207	ensembl	human	known	74_37	missense	SNP	1.000	T
COX7C	1350	genome.wustl.edu	37	5	85913886	85913886	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr5:85913886G>T	ENST00000509578.1	+	1	114	c.14G>T	c.(13-15)aGc>aTc	p.S5I	COX7C_ENST00000513124.1_Intron|COX7C_ENST00000247655.3_Missense_Mutation_p.S5I|MIR3607_ENST00000362392.1_RNA|COX7C_ENST00000515763.1_Missense_Mutation_p.S5I			P15954	COX7C_HUMAN	cytochrome c oxidase subunit VIIc	5					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)			endometrium(1)|lung(1)	2		all_cancers(142;7e-06)|Lung NSC(167;0.000601)|all_lung(232;0.000693)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;1.56e-40)|Epithelial(54;3.17e-34)|all cancers(79;3.36e-29)		TTGGGCCAGAGCATCCGGAGG	0.577																																																	0								ENSG00000127184						54.0	58.0	56.0					5																	85913886		2203	4300	6503	COX7C	SO:0001583	missense	0			-	HGNC	BC001005	CCDS4063.1	5q14	2011-07-04			ENSG00000127184	ENSG00000127184	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2292	protein-coding gene	gene with protein product		603774				10072584	Standard	NM_001867		Approved		uc003kir.3	P15954	OTTHUMG00000119049	ENST00000509578.1:c.14G>T	5.37:g.85913886G>T	ENSP00000425759:p.Ser5Ile	Somatic	0	52	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q6NR81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_COX7C/Cox8,superfamily_COX7C/Cox8	p.S5I	ENST00000509578.1	37	c.14	CCDS4063.1	5	.	.	.	.	.	.	.	.	.	.	G	16.66	3.183804	0.57800	.	.	ENSG00000127184	ENST00000247655;ENST00000509578;ENST00000515763	.	.	.	5.83	4.94	0.65067	.	0.201093	0.53938	D	0.000051	T	0.47948	0.1473	.	.	.	0.31498	N	0.665097	P	0.46784	0.884	B	0.44224	0.444	T	0.61879	-0.6972	8	0.87932	D	0	-6.4396	13.2181	0.59871	0.0:0.1594:0.8406:0.0	.	5	P15954	COX7C_HUMAN	I	5	.	ENSP00000247655:S5I	S	+	2	0	COX7C	85949642	1.000000	0.71417	0.997000	0.53966	0.254000	0.26022	2.552000	0.45828	1.578000	0.49821	0.644000	0.83932	AGC	-	pfam_COX7C/Cox8		0.577	COX7C-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	COX7C	protein_coding	OTTHUMT00000369746.1	G	NM_001867	-		85913886	+1	no_errors	ENST00000247655	ensembl	human	known	74_37	missense	SNP	1.000	T
OR1A1	8383	genome.wustl.edu	37	17	3119374	3119374	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr17:3119374G>A	ENST00000304094.1	+	1	460	c.460G>A	c.(460-462)Gcc>Acc	p.A154T		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						GATTGGAAATGCCAATGCCCT	0.517																																																	0								ENSG00000172146						156.0	135.0	142.0					17																	3119374		2203	4300	6503	OR1A1	SO:0001583	missense	0			-	HGNC	AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.460G>A	17.37:g.3119374G>A	ENSP00000305207:p.Ala154Thr	Somatic	0	27	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	24	45.45	A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A154T	ENST00000304094.1	37	c.460	CCDS11022.1	17	.	.	.	.	.	.	.	.	.	.	G	8.110	0.778656	0.16120	.	.	ENSG00000172146	ENST00000304094	T	0.38401	1.14	4.96	-7.05	0.01573	GPCR, rhodopsin-like superfamily (1);	1.225090	0.05727	N	0.598880	T	0.21550	0.0519	L	0.38953	1.18	0.09310	N	1	B	0.14805	0.011	B	0.20955	0.032	T	0.34875	-0.9811	10	0.54805	T	0.06	.	1.0286	0.01533	0.424:0.1555:0.1325:0.288	.	154	Q9P1Q5	OR1A1_HUMAN	T	154	ENSP00000305207:A154T	ENSP00000305207:A154T	A	+	1	0	OR1A1	3066124	0.000000	0.05858	0.000000	0.03702	0.285000	0.27093	-2.078000	0.01370	-0.859000	0.04105	0.436000	0.28706	GCC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.517	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A1	protein_coding	OTTHUMT00000207292.1	G	NM_014565	-		3119374	+1	no_errors	ENST00000304094	ensembl	human	known	74_37	missense	SNP	0.000	A
APPBP2	10513	genome.wustl.edu	37	17	58529372	58529372	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr17:58529372A>T	ENST00000083182.3	-	12	1660	c.1373T>A	c.(1372-1374)aTt>aAt	p.I458N		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	458					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			TTGTTCTTTAATCTGAATTGC	0.323																																																	0								ENSG00000062725						96.0	95.0	95.0					17																	58529372		2203	4298	6501	APPBP2	SO:0001583	missense	0			-	HGNC	AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.1373T>A	17.37:g.58529372A>T	ENSP00000083182:p.Ile458Asn	Somatic	0	67	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	60	17.81	A8K862|O95095|Q8WVC9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I458N	ENST00000083182.3	37	c.1373	CCDS32699.1	17	.	.	.	.	.	.	.	.	.	.	A	22.7	4.330213	0.81690	.	.	ENSG00000062725	ENST00000083182	D	0.95518	-3.73	5.2	5.2	0.72013	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.98002	0.9342	M	0.92555	3.32	0.80722	D	1	P	0.49961	0.93	P	0.62298	0.9	D	0.99104	1.0844	10	0.87932	D	0	-11.2485	15.1204	0.72438	1.0:0.0:0.0:0.0	.	458	Q92624	APBP2_HUMAN	N	458	ENSP00000083182:I458N	ENSP00000083182:I458N	I	-	2	0	APPBP2	55884154	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.677000	0.91203	1.969000	0.57287	0.373000	0.22412	ATT	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.323	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPBP2	protein_coding	OTTHUMT00000449465.1	A	NM_006380	-		58529372	-1	no_errors	ENST00000083182	ensembl	human	known	74_37	missense	SNP	1.000	T
PLAGL2	5326	genome.wustl.edu	37	20	30784433	30784433	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr20:30784433A>T	ENST00000246229.4	-	3	1577	c.1313T>A	c.(1312-1314)gTc>gAc	p.V438D		NM_002657.3	NP_002648.1	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	438					chylomicron assembly (GO:0034378)|lipid metabolic process (GO:0006629)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|post-embryonic development (GO:0009791)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|liver(1)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GTAGCCCATGACCAGGCCTCC	0.612																																					Colon(163;15 1893 11280 16306 47518)												0								ENSG00000126003						33.0	34.0	34.0					20																	30784433		2203	4300	6503	PLAGL2	SO:0001583	missense	0			-	HGNC		CCDS13197.1	20q11.21	2013-01-08			ENSG00000126003	ENSG00000126003		"""Zinc fingers, C2H2-type"""	9047	protein-coding gene	gene with protein product	"""C2H2-type zinc finger protein"""	604866				15585652, 17950244	Standard	NM_002657		Approved	ZNF900	uc002wxn.2	Q9UPG8	OTTHUMG00000032210	ENST00000246229.4:c.1313T>A	20.37:g.30784433A>T	ENSP00000246229:p.Val438Asp	Somatic	0	35	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	51	19.05	A8K8T5|E1P5M3|Q92584	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V438D	ENST00000246229.4	37	c.1313	CCDS13197.1	20	.	.	.	.	.	.	.	.	.	.	A	13.70	2.315088	0.40996	.	.	ENSG00000126003	ENST00000246229	T	0.10382	2.88	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.15522	0.0374	L	0.40543	1.245	0.80722	D	1	D	0.59357	0.985	P	0.51974	0.686	T	0.00756	-1.1579	10	0.52906	T	0.07	.	10.8134	0.46559	0.8417:0.1583:0.0:0.0	.	438	Q9UPG8	PLAL2_HUMAN	D	438	ENSP00000246229:V438D	ENSP00000246229:V438D	V	-	2	0	PLAGL2	30248094	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.743000	0.68655	2.058000	0.61347	0.477000	0.44152	GTC	-	NULL		0.612	PLAGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAGL2	protein_coding	OTTHUMT00000078615.2	A	NM_002657	-		30784433	-1	no_errors	ENST00000246229	ensembl	human	known	74_37	missense	SNP	1.000	T
RAI1	10743	genome.wustl.edu	37	17	17682105	17682106	+	Intron	DEL	TG	TG	-			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr17:17682105_17682106delTG	ENST00000353383.1	+	3	453				SMCR5_ENST00000543475.1_RNA|RP1-253P7.1_ENST00000583598.1_RNA	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1						circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		ACAGCAGTTCTGGGGCCAGGCC	0.559																																																	0								ENSG00000226746																																			SMCR5	SO:0001627	intron_variant	0				HGNC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.-16-14141TG>-	17.37:g.17682105_17682106delTG		Somatic	0	23	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	28	42.86	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000353383.1	37	NULL	CCDS11188.1	17																																																																																			-	-		0.559	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR5	protein_coding	OTTHUMT00000131775.1	TG	NM_030665			17682106	-1	no_errors	ENST00000543475	ensembl	human	known	74_37	rna	DEL	0.018:0.381	-
ADAMDEC1	27299	genome.wustl.edu	37	8	24254877	24254877	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr8:24254877G>A	ENST00000256412.4	+	6	755	c.535G>A	c.(535-537)Gaa>Aaa	p.E179K	RP11-624C23.1_ENST00000523578.1_RNA|ADAMDEC1_ENST00000522298.1_Missense_Mutation_p.E100K|ADAMDEC1_ENST00000538205.1_Missense_Mutation_p.E100K|RP11-624C23.1_ENST00000519689.1_RNA	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	179					immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		TAACCAGGAGGAACAAGACCC	0.458																																					Ovarian(147;687 1849 3699 25981 31337)												0								ENSG00000134028						221.0	213.0	216.0					8																	24254877		2203	4300	6503	ADAMDEC1	SO:0001583	missense	0			-	HGNC	Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.535G>A	8.37:g.24254877G>A	ENSP00000256412:p.Glu179Lys	Somatic	0	49	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78	B7ZAK5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.E179K	ENST00000256412.4	37	c.535	CCDS6044.1	8	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893755	0.33442	.	.	ENSG00000134028	ENST00000256412;ENST00000538205;ENST00000522298	T;T;T	0.02656	4.21;4.22;4.22	5.53	4.65	0.58169	.	0.312065	0.27595	N	0.018665	T	0.02012	0.0063	N	0.08118	0	0.09310	N	1	B	0.33379	0.41	B	0.37267	0.245	T	0.50162	-0.8860	10	0.11182	T	0.66	-14.8166	12.4375	0.55608	0.0:0.1684:0.8316:0.0	.	179	O15204	ADEC1_HUMAN	K	179;100;100	ENSP00000256412:E179K;ENSP00000442592:E100K;ENSP00000428993:E100K	ENSP00000256412:E179K	E	+	1	0	ADAMDEC1	24310822	0.761000	0.28439	0.016000	0.15963	0.033000	0.12548	3.368000	0.52357	1.325000	0.45301	0.557000	0.71058	GAA	-	NULL		0.458	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMDEC1	protein_coding	OTTHUMT00000215149.2	G	NM_014479	-		24254877	+1	no_errors	ENST00000256412	ensembl	human	known	74_37	missense	SNP	0.073	A
BCR	613	genome.wustl.edu	37	22	23658274	23658275	+	3'UTR	INS	-	-	TGC	rs199982774|rs202178919		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr22:23658274_23658275insTGC	ENST00000305877.8	+	0	5132_5133				BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CATTCTTGGCTTTCTTTTTCTT	0.47			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0								ENSG00000186716																																			BCR	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.*566->TGC	22.37:g.23658274_23658275insTGC		Somatic	0	14	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	P78501|Q12842|Q4LE80|Q6NZI3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			-	-		0.470	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	protein_coding	OTTHUMT00000075819.1	-	NM_004327			23658275	+1	no_errors	ENST00000436990	ensembl	human	known	74_37	rna	INS	0.000:0.000	TGC
PITPNM2	57605	genome.wustl.edu	37	12	123485013	123485013	+	Intron	SNP	T	T	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr12:123485013T>A	ENST00000542749.1	-	8	1288				PITPNM2_ENST00000451868.2_5'UTR|PITPNM2_ENST00000280562.5_Intron|PITPNM2_ENST00000392428.1_Intron|PITPNM2_ENST00000320201.4_Intron|PITPNM2_ENST00000546049.1_Missense_Mutation_p.I451F			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2						metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		AAGGTGAAGATCTTATTTTTG	0.483																																																	0								ENSG00000090975																																			PITPNM2	SO:0001627	intron_variant	0			-	HGNC	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.1224+311A>T	12.37:g.123485013T>A		Somatic	0	35	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	Q9P271	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PI_transfer,prints_PI_transfer	p.I451F	ENST00000542749.1	37	c.1351	CCDS9242.1	12																																																																																			-	NULL		0.483	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PITPNM2	protein_coding	OTTHUMT00000401342.1	T	NM_020845	-		123485013	-1	no_errors	ENST00000546049	ensembl	human	putative	74_37	missense	SNP	0.295	A
SPTB	6710	genome.wustl.edu	37	14	65220346	65220346	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr14:65220346C>T	ENST00000556626.1	-	33	6653	c.6511G>A	c.(6511-6513)Gcc>Acc	p.A2171T	SPTB_ENST00000389722.3_Missense_Mutation_p.A2171T|SPTB_ENST00000342835.4_5'UTR			P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	0					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TCCCGCGGGGCCGGCAGCGTT	0.632																																																	0								ENSG00000070182						87.0	94.0	91.0					14																	65220346		2203	4300	6503	SPTB	SO:0001583	missense	0			-	HGNC		CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000556626.1:c.6511G>A	14.37:g.65220346C>T	ENSP00000451752:p.Ala2171Thr	Somatic	0	26	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	13	38.10	Q15510|Q15519	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.A2171T	ENST00000556626.1	37	c.6511	CCDS32099.1	14	.	.	.	.	.	.	.	.	.	.	C	12.05	1.822650	0.32237	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626	T;T;T	0.71222	-0.55;0.21;-0.55	5.54	4.65	0.58169	.	0.678105	0.14424	N	0.320442	T	0.56615	0.1997	N	0.19112	0.55	0.80722	D	1	B;B	0.20780	0.015;0.048	B;B	0.19946	0.027;0.015	T	0.48948	-0.8989	10	0.27785	T	0.31	.	13.1621	0.59550	0.0:0.9214:0.0:0.0786	.	955;2175	E7EV95;Q59FP5	.;.	T	2175;2171;955;836;2171	ENSP00000374372:A2171T;ENSP00000451324:A836T;ENSP00000451752:A2171T	ENSP00000334218:A955T	A	-	1	0	SPTB	64290099	0.946000	0.32159	0.733000	0.30861	0.011000	0.07611	2.088000	0.41663	1.354000	0.45846	0.511000	0.50034	GCC	-	pirsf_Spectrin_bsu,smart_Spectrin/alpha-actinin		0.632	SPTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTB	protein_coding	OTTHUMT00000414076.1	C		-		65220346	-1	no_errors	ENST00000389722	ensembl	human	known	74_37	missense	SNP	0.997	T
TTLL7	79739	genome.wustl.edu	37	1	84373161	84373161	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:84373161G>T	ENST00000260505.8	-	16	2347	c.1970C>A	c.(1969-1971)gCc>gAc	p.A657D	TTLL7_ENST00000477524.1_5'UTR	NM_024686.4	NP_078962.4	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	657					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			kidney(1)|large_intestine(8)|lung(15)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	29				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		GGTAGAGCAGGCATCATTACT	0.478																																																	0								ENSG00000137941						129.0	117.0	121.0					1																	84373161		2203	4300	6503	TTLL7	SO:0001583	missense	0			-	HGNC	AY170843	CCDS690.2	1p31.1	2013-02-14			ENSG00000137941	ENSG00000137941		"""Tubulin tyrosine ligase-like family"""	26242	protein-coding gene	gene with protein product						15890843	Standard	XM_005271208		Approved	FLJ23033	uc001djc.3	Q6ZT98	OTTHUMG00000009932	ENST00000260505.8:c.1970C>A	1.37:g.84373161G>T	ENSP00000260505:p.Ala657Asp	Somatic	0	52	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q5TAX8|Q5TAX9|Q6P990|Q86YS1|Q9H5U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.A657D	ENST00000260505.8	37	c.1970	CCDS690.2	1	.	.	.	.	.	.	.	.	.	.	G	6.966	0.548113	0.13312	.	.	ENSG00000137941	ENST00000260505;ENST00000370704;ENST00000370703	T	0.03772	3.81	5.13	-0.131	0.13494	.	3.281660	0.00622	N	0.000452	T	0.00784	0.0026	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45760	-0.9239	10	0.16896	T	0.51	.	1.6042	0.02680	0.3074:0.1397:0.4106:0.1423	.	657	Q6ZT98	TTLL7_HUMAN	D	657;434;657	ENSP00000260505:A657D	ENSP00000260505:A657D	A	-	2	0	TTLL7	84145749	0.000000	0.05858	0.055000	0.19348	0.006000	0.05464	0.308000	0.19314	0.333000	0.23563	-0.225000	0.12378	GCC	-	NULL		0.478	TTLL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL7	protein_coding	OTTHUMT00000027498.1	G	NM_024686	-		84373161	-1	no_errors	ENST00000260505	ensembl	human	known	74_37	missense	SNP	0.000	T
ZNF280A	129025	genome.wustl.edu	37	22	22869380	22869380	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr22:22869380G>T	ENST00000302097.3	-	2	827	c.575C>A	c.(574-576)tCt>tAt	p.S192Y	snoU13_ENST00000459485.1_RNA	NM_080740.3	NP_542778.1	P59817	Z280A_HUMAN	zinc finger protein 280A	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	18	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CACAGCTAAAGAAGGTACCCC	0.428																																																	0								ENSG00000169548						119.0	109.0	113.0					22																	22869380		2203	4300	6503	ZNF280A	SO:0001583	missense	0			-	HGNC	D87009	CCDS13800.1	22q11.21	2007-09-20	2007-09-20	2007-09-20	ENSG00000169548	ENSG00000169548			18597	protein-coding gene	gene with protein product			"""zinc finger protein 280"", ""suppressor of hairy wing homolog 1 (Drosophila)"""	ZNF280, SUHW1		9074928	Standard	NM_080740		Approved	3'OY11.1, ZNF636	uc002zwe.3	P59817	OTTHUMG00000030545	ENST00000302097.3:c.575C>A	22.37:g.22869380G>T	ENSP00000302855:p.Ser192Tyr	Somatic	0	21	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S192Y	ENST00000302097.3	37	c.575	CCDS13800.1	22	.	.	.	.	.	.	.	.	.	.	G	14.05	2.418958	0.42918	.	.	ENSG00000169548	ENST00000302097	T	0.25414	1.8	3.57	2.47	0.30058	.	.	.	.	.	T	0.42832	0.1220	L	0.57536	1.79	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.11131	-1.0600	9	0.87932	D	0	-6.154	7.7553	0.28921	0.0:0.0:0.6703:0.3297	.	192	P59817	Z280A_HUMAN	Y	192	ENSP00000302855:S192Y	ENSP00000302855:S192Y	S	-	2	0	ZNF280A	21199380	0.000000	0.05858	0.001000	0.08648	0.121000	0.20230	0.049000	0.14099	0.893000	0.36288	0.655000	0.94253	TCT	-	NULL		0.428	ZNF280A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280A	protein_coding	OTTHUMT00000075433.3	G	NM_080740	-		22869380	-1	no_errors	ENST00000302097	ensembl	human	known	74_37	missense	SNP	0.001	T
PRAMEF22	653606	genome.wustl.edu	37	1	13036643	13036643	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:13036643C>G	ENST00000376187.1	+	2	715	c.715C>G	c.(715-717)Ctc>Gtc	p.L239V	PRAMEF6_ENST00000376192.5_Intron	NM_001100631.1	NP_001094101.1	A3QJZ6	PRA22_HUMAN	PRAME family member 22	239					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					kidney(1)|large_intestine(2)|lung(1)|skin(1)	5						TCTTCGCAAACTCTTCATCTC	0.488																																																	0								ENSG00000204508						136.0	160.0	152.0					1																	13036643		2201	4297	6498	PRAMEF22	SO:0001583	missense	0			-	HGNC			1p36.21	2013-01-17			ENSG00000204508			"""-"""	34393	protein-coding gene	gene with protein product							Standard	NM_001100631		Approved	PRAMEF3L	uc009vnq.1	A3QJZ6	OTTHUMG00000074726	ENST00000376187.1:c.715C>G	1.37:g.13036643C>G	ENSP00000365358:p.Leu239Val	Somatic	0	253	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	104	257	28.81	A6NMM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L239V	ENST00000376187.1	37	c.715	CCDS41256.1	1	.	.	.	.	.	.	.	.	.	.	.	10.72	1.428761	0.25726	.	.	ENSG00000204508	ENST00000376187	T	0.73258	-0.73	1.18	1.18	0.20946	.	0.082846	0.46758	D	0.000274	T	0.78672	0.4320	M	0.74467	2.265	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.64445	-0.6406	10	0.52906	T	0.07	.	5.7626	0.18209	0.0:1.0:0.0:0.0	.	239	A3QJZ6	PRA22_HUMAN	V	239	ENSP00000365358:L239V	ENSP00000365358:L239V	L	+	1	0	PRAMEF22	12959230	0.001000	0.12720	0.012000	0.15200	0.079000	0.17450	0.167000	0.16602	0.959000	0.37980	0.194000	0.17425	CTC	-	NULL		0.488	PRAMEF22-001	KNOWN	mRNA_start_NF|mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	PRAMEF22	protein_coding	OTTHUMT00000158511.1	C	NM_001100631	-		13036643	+1	no_errors	ENST00000376187	ensembl	human	known	74_37	missense	SNP	0.014	G
PNPLA7	375775	genome.wustl.edu	37	9	140395146	140395146	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr9:140395146T>C	ENST00000277531.4	-	15	1865	c.1679A>G	c.(1678-1680)tAt>tGt	p.Y560C	PNPLA7_ENST00000371457.1_Missense_Mutation_p.Y166C|PNPLA7_ENST00000406427.1_Missense_Mutation_p.Y585C	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	560					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		GACTCACTCATAGAAGTGGGC	0.677																																																	0								ENSG00000130653						70.0	54.0	59.0					9																	140395146		2196	4284	6480	PNPLA7	SO:0001583	missense	0			-	HGNC	AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.1679A>G	9.37:g.140395146T>C	ENSP00000277531:p.Tyr560Cys	Somatic	0	54	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	82	23.36	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.Y585C	ENST00000277531.4	37	c.1754	CCDS7045.1	9	.	.	.	.	.	.	.	.	.	.	T	23.8	4.458126	0.84317	.	.	ENSG00000130653	ENST00000371457;ENST00000277531;ENST00000406427;ENST00000371451;ENST00000434090	D;D;D;D	0.92752	-3.1;-3.1;-3.1;-3.1	4.76	4.76	0.60689	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.96081	0.8723	M	0.85542	2.76	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	D	0.96682	0.9504	10	0.87932	D	0	.	13.7287	0.62774	0.0:0.0:0.0:1.0	.	585;560	Q6ZV29-5;Q6ZV29	.;PLPL7_HUMAN	C	166;560;585;560;551	ENSP00000360512:Y166C;ENSP00000277531:Y560C;ENSP00000384610:Y585C;ENSP00000400582:Y551C	ENSP00000277531:Y560C	Y	-	2	0	PNPLA7	139514967	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.627000	0.83176	1.899000	0.54978	0.379000	0.24179	TAT	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom		0.677	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA7	protein_coding	OTTHUMT00000254787.1	T	NM_152286	-		140395146	-1	no_errors	ENST00000406427	ensembl	human	known	74_37	missense	SNP	1.000	C
ZFR2	23217	genome.wustl.edu	37	19	3806098	3806098	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:3806098C>T	ENST00000262961.4	-	19	2679	c.2669G>A	c.(2668-2670)cGg>cAg	p.R890Q		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	890	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.						nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GTGGGTCTGCCGGAAGGCCAG	0.706																																																	0								ENSG00000105278						8.0	11.0	10.0					19																	3806098		1961	4122	6083	ZFR2	SO:0001583	missense	0			-	HGNC	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.2669G>A	19.37:g.3806098C>T	ENSP00000262961:p.Arg890Gln	Somatic	0	8	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DZF,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.R890Q	ENST00000262961.4	37	c.2669	CCDS45921.1	19	.	.	.	.	.	.	.	.	.	.	C	15.47	2.843794	0.51164	.	.	ENSG00000105278	ENST00000262961	T	0.41400	1.0	3.42	1.26	0.21427	DZF (2);	0.000000	0.64402	U	0.000010	T	0.61813	0.2377	M	0.87180	2.865	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.59862	-0.7374	10	0.66056	D	0.02	-27.2308	5.6445	0.17582	0.0:0.7404:0.0:0.2596	.	890	Q9UPR6	ZFR2_HUMAN	Q	890	ENSP00000262961:R890Q	ENSP00000262961:R890Q	R	-	2	0	ZFR2	3757098	1.000000	0.71417	0.998000	0.56505	0.122000	0.20287	3.081000	0.50120	0.287000	0.22375	-0.148000	0.13756	CGG	-	pfam_DZF,smart_DZF		0.706	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR2	protein_coding	OTTHUMT00000453648.2	C	NM_015174	-		3806098	-1	no_errors	ENST00000262961	ensembl	human	known	74_37	missense	SNP	1.000	T
KLK12	43849	genome.wustl.edu	37	19	51537872	51537872	+	Silent	SNP	C	C	T	rs552324076		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:51537872C>T	ENST00000525263.1	-	1	125	c.6G>A	c.(4-6)ggG>ggA	p.G2G	KLK12_ENST00000319590.4_Silent_p.G2G|KLK12_ENST00000529888.1_Silent_p.G2G|CTC-518B2.9_ENST00000594910.1_RNA|KLK12_ENST00000250351.4_Silent_p.G2G|KLK12_ENST00000250352.11_5'UTR			Q9UKR0	KLK12_HUMAN	kallikrein-related peptidase 12	2					proteolysis (GO:0006508)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	12		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00399)		AGATGCTGAGCCCCATGGTGG	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		18282	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000186474						70.0	65.0	66.0					19																	51537872		2203	4300	6503	KLK12	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12820.1, CCDS12821.1, CCDS54298.1	19q13.33	2008-02-05	2006-10-27		ENSG00000186474	ENSG00000186474		"""Kallikreins"""	6360	protein-coding gene	gene with protein product		605539	"""kallikrein 12"""			16800724, 16800723	Standard	NM_019598		Approved	KLK-L5	uc002pvh.1	Q9UKR0	OTTHUMG00000165806	ENST00000525263.1:c.6G>A	19.37:g.51537872C>T		Somatic	0	52	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	38	25.49	Q9UKR1|Q9UKR2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G2	ENST00000525263.1	37	c.6	CCDS12821.1	19																																																																																			-	NULL		0.587	KLK12-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLK12	protein_coding	OTTHUMT00000386288.1	C	NM_019598	-		51537872	-1	no_errors	ENST00000250351	ensembl	human	known	74_37	silent	SNP	0.000	T
ALG6	29929	genome.wustl.edu	37	1	63879619	63879619	+	Intron	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr1:63879619G>A	ENST00000371108.4	+	10	1121				ALG6_ENST00000263440.4_Intron	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)			endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						TTATAATTGTGACTAAAAGTT	0.308																																																	0								ENSG00000088035																																			ALG6	SO:0001627	intron_variant	0			-	HGNC	AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.817-113G>A	1.37:g.63879619G>A		Somatic	0	65	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	45	26.23	B3KMU2|Q5SXR9|Q9H3I0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371108.4	37	NULL	CCDS30735.1	1																																																																																			-	-		0.308	ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	ALG6	protein_coding	OTTHUMT00000025330.2	G	NM_013339	-		63879619	+1	no_errors	ENST00000465969	ensembl	human	known	74_37	rna	SNP	0.003	A
TDRP	157695	genome.wustl.edu	37	8	442474	442474	+	Silent	SNP	G	G	A	rs375957326		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr8:442474G>A	ENST00000324079.6	-	3	723	c.483C>T	c.(481-483)cgC>cgT	p.R161R	TDRP_ENST00000524229.1_5'Flank|TDRP_ENST00000427263.2_Silent_p.R161R|TDRP_ENST00000523656.1_Silent_p.R161R			Q86YL5	TDRP_HUMAN	testis development related protein	161					spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											TCCCTGCCGCGCGCAGGCTCC	0.672																																																	0								ENSG00000180190	G		0,4028		0,0,2014	16.0	19.0	18.0		483	1.7	0.0	8		18	2,8336		0,2,4167	no	coding-synonymous	C8orf42	NM_175075.3		0,2,6181	AA,AG,GG		0.024,0.0,0.0162		161/186	442474	2,12364	2014	4169	6183	TDRP	SO:0001819	synonymous_variant	0			-	HGNC	AY194292	CCDS47759.1, CCDS59090.1	8p23.3	2013-06-03	2013-06-03	2013-06-03	ENSG00000180190	ENSG00000180190			26951	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 42"""	C8orf42		20170638	Standard	NM_175075		Approved	INM01, TDRP1, TDRP2		Q86YL5	OTTHUMG00000163593	ENST00000324079.6:c.483C>T	8.37:g.442474G>A		Somatic	0	27	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	24	54.72	B6VF03|B9EG53	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R161	ENST00000324079.6	37	c.483	CCDS47759.1	8																																																																																			-	NULL		0.672	TDRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDRP	protein_coding	OTTHUMT00000374442.1	G	NM_175075	-		442474	-1	no_errors	ENST00000427263	ensembl	human	known	74_37	silent	SNP	0.353	A
CDHR2	54825	genome.wustl.edu	37	5	176002819	176002819	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr5:176002819G>C	ENST00000510636.1	+	11	1213	c.939G>C	c.(937-939)gaG>gaC	p.E313D	CDHR2_ENST00000261944.5_Missense_Mutation_p.E313D|CDHR2_ENST00000506348.1_Missense_Mutation_p.E313D	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	313	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						AGGCGGATGAGGAGGTGCAGC	0.632																																																	0								ENSG00000074276						28.0	25.0	26.0					5																	176002819		2180	4247	6427	CDHR2	SO:0001583	missense	0			-	HGNC	AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.939G>C	5.37:g.176002819G>C	ENSP00000424565:p.Glu313Asp	Somatic	0	48	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	69	13.75	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E313D	ENST00000510636.1	37	c.939	CCDS34297.1	5	.	.	.	.	.	.	.	.	.	.	G	10.06	1.246322	0.22796	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.60920	0.15;0.15;0.15	4.4	1.32	0.21799	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.41373	0.1156	L	0.31926	0.97	0.46078	D	0.998852	B	0.25521	0.128	B	0.28553	0.091	T	0.09773	-1.0659	9	0.17832	T	0.49	-31.6127	8.2664	0.31817	0.3166:0.0:0.6834:0.0	.	313	Q9BYE9	CDHR2_HUMAN	D	313	ENSP00000424565:E313D;ENSP00000261944:E313D;ENSP00000421078:E313D	ENSP00000261944:E313D	E	+	3	2	CDHR2	175935425	1.000000	0.71417	0.989000	0.46669	0.569000	0.35902	0.647000	0.24812	0.461000	0.27071	0.549000	0.68633	GAG	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.632	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR2	protein_coding	OTTHUMT00000372201.1	G	NM_017675	-		176002819	+1	no_errors	ENST00000261944	ensembl	human	known	74_37	missense	SNP	0.999	C
RHOBTB1	9886	genome.wustl.edu	37	10	62648024	62648024	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr10:62648024G>A	ENST00000337910.5	-	6	1739	c.1402C>T	c.(1402-1404)Cac>Tac	p.H468Y	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.H468Y	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	468					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					TTCCTTACGTGAAAGGCTTTC	0.478																																																	0								ENSG00000072422						104.0	97.0	99.0					10																	62648024		2203	4300	6503	RHOBTB1	SO:0001583	missense	0			-	HGNC	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.1402C>T	10.37:g.62648024G>A	ENSP00000338671:p.His468Tyr	Somatic	0	33	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	56	11.11		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Small_GTPase,pfam_MIRO-like,superfamily_P-loop_NTPase,superfamily_BTB/POZ_fold,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_BTB/POZ-like,pfscan_BTB/POZ-like,prints_Small_GTPase	p.H468Y	ENST00000337910.5	37	c.1402	CCDS7261.1	10	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724120	0.89298	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.16597	2.33;2.33	5.75	5.75	0.90469	BTB/POZ fold (1);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.39292	-0.9621	10	0.59425	D	0.04	.	19.9525	0.97208	0.0:0.0:1.0:0.0	.	468	O94844	RHBT1_HUMAN	Y	468	ENSP00000350595:H468Y;ENSP00000338671:H468Y	ENSP00000338671:H468Y	H	-	1	0	RHOBTB1	62318030	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	9.803000	0.99136	2.719000	0.93026	0.655000	0.94253	CAC	-	superfamily_BTB/POZ_fold		0.478	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB1	protein_coding	OTTHUMT00000048220.1	G		-		62648024	-1	no_errors	ENST00000337910	ensembl	human	known	74_37	missense	SNP	1.000	A
THBS4	7060	genome.wustl.edu	37	5	79351744	79351744	+	Silent	SNP	C	C	G			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr5:79351744C>G	ENST00000350881.2	+	3	619	c.429C>G	c.(427-429)ctC>ctG	p.L143L	THBS4_ENST00000511733.1_Silent_p.L52L|CTD-2201I18.1_ENST00000503007.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	143	Laminin G-like.				behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		CCCTAGAGCTCTACCTGGACT	0.567																																																	0								ENSG00000113296						67.0	72.0	70.0					5																	79351744		2203	4300	6503	THBS4	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.429C>G	5.37:g.79351744C>G		Somatic	0	34	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	17	43.33	B2R909|Q86TG2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_C,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.L143	ENST00000350881.2	37	c.429	CCDS4049.1	5																																																																																			-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.567	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS4	protein_coding	OTTHUMT00000226977.1	C		-		79351744	+1	no_errors	ENST00000350881	ensembl	human	known	74_37	silent	SNP	1.000	G
CAPN12	147968	genome.wustl.edu	37	19	39229227	39229227	+	Missense_Mutation	SNP	G	G	A	rs374083881		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:39229227G>A	ENST00000328867.4	-	6	1099	c.791C>T	c.(790-792)aCg>aTg	p.T264M	CTD-2540F13.2_ENST00000602255.1_RNA|CAPN12_ENST00000601953.1_Missense_Mutation_p.T115M	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	264	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			GTGTGTGCCCGTGATGGAATA	0.622																																																	0								ENSG00000182472	G	MET/THR	2,4404	4.2+/-10.8	0,2,2201	135.0	103.0	114.0		791	5.0	1.0	19		114	0,8600		0,0,4300	no	missense	CAPN12	NM_144691.3	81	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	probably-damaging	264/720	39229227	2,13004	2203	4300	6503	CAPN12	SO:0001583	missense	0			-	HGNC	BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.791C>T	19.37:g.39229227G>A	ENSP00000331636:p.Thr264Met	Somatic	0	38	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	60	20.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.T264M	ENST00000328867.4	37	c.791	CCDS12519.1	19	.	.	.	.	.	.	.	.	.	.	G	17.77	3.472125	0.63737	4.54E-4	0.0	ENSG00000182472	ENST00000328867	T	0.17691	2.26	5.02	5.02	0.67125	Peptidase C2, calpain, catalytic domain (3);	0.172559	0.49916	D	0.000133	T	0.41419	0.1158	M	0.67397	2.05	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.27773	-1.0064	10	0.87932	D	0	.	16.1807	0.81895	0.0:0.0:1.0:0.0	.	264	Q6ZSI9	CAN12_HUMAN	M	264	ENSP00000331636:T264M	ENSP00000331636:T264M	T	-	2	0	CAPN12	43921067	1.000000	0.71417	0.998000	0.56505	0.243000	0.25628	8.876000	0.92379	2.505000	0.84491	0.462000	0.41574	ACG	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat		0.622	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN12	protein_coding	OTTHUMT00000462151.1	G		-		39229227	-1	no_errors	ENST00000328867	ensembl	human	known	74_37	missense	SNP	1.000	A
TFR2	7036	genome.wustl.edu	37	7	100218565	100218565	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr7:100218565C>T	ENST00000462107.1	-	19	2608	c.2321G>A	c.(2320-2322)cGt>cAt	p.R774H	TFR2_ENST00000431692.1_3'UTR|TFR2_ENST00000223051.3_Missense_Mutation_p.R774H|TFR2_ENST00000544242.1_Missense_Mutation_p.R315H			Q9UP52	TFR2_HUMAN	transferrin receptor 2	774					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	GGCTAGCTGACGCCGGAAACG	0.657																																																	0								ENSG00000106327						31.0	29.0	30.0					7																	100218565		2203	4300	6503	TFR2	SO:0001583	missense	0			-	HGNC	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.2321G>A	7.37:g.100218565C>T	ENSP00000420525:p.Arg774His	Somatic	0	47	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.R774H	ENST00000462107.1	37	c.2321	CCDS34707.1	7	.	.	.	.	.	.	.	.	.	.	C	25.4	4.634411	0.87660	.	.	ENSG00000106327	ENST00000223051;ENST00000462107;ENST00000544242	T;T;T	0.60171	0.21;0.21;0.21	5.54	4.64	0.57946	Transferrin receptor-like, dimerisation domain (3);	0.114726	0.53938	D	0.000050	T	0.61776	0.2374	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.59852	-0.7376	10	0.48119	T	0.1	-12.2735	10.5447	0.45054	0.0:0.9109:0.0:0.0891	.	774	Q9UP52	TFR2_HUMAN	H	774;774;315	ENSP00000223051:R774H;ENSP00000420525:R774H;ENSP00000443656:R315H	ENSP00000223051:R774H	R	-	2	0	TFR2	100056501	0.000000	0.05858	1.000000	0.80357	0.989000	0.77384	0.281000	0.18810	2.890000	0.99128	0.650000	0.86243	CGT	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom		0.657	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	protein_coding	OTTHUMT00000356392.3	C	NM_003227	-		100218565	-1	no_errors	ENST00000223051	ensembl	human	known	74_37	missense	SNP	1.000	T
HMGB2	3148	genome.wustl.edu	37	4	174253279	174253279	+	Silent	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr4:174253279C>T	ENST00000296503.5	-	5	1455	c.582G>A	c.(580-582)gaG>gaA	p.E194E	HMGB2_ENST00000446922.2_Silent_p.E194E|HMGB2_ENST00000438704.2_Silent_p.E194E|RP11-798M19.3_ENST00000507803.1_RNA			P26583	HMGB2_HUMAN	high mobility group box 2	194	Asp/Glu-rich (acidic).				apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cell chemotaxis (GO:0060326)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to lipopolysaccharide (GO:0071222)|chromatin organization (GO:0006325)|DNA ligation involved in DNA repair (GO:0051103)|DNA topological change (GO:0006265)|male gonad development (GO:0008584)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive chemotaxis (GO:0050918)|positive regulation of DNA binding (GO:0043388)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of nuclease activity (GO:0032075)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to steroid hormone (GO:0048545)|spermatid nucleus differentiation (GO:0007289)|V(D)J recombination (GO:0033151)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	chemoattractant activity (GO:0042056)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription regulatory region DNA binding (GO:0044212)	p.E194E(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(3)	14		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		cttcttcttcctcctcctcct	0.473																																																	1	Substitution - coding silent(1)	endometrium(1)						ENSG00000164104						302.0	253.0	269.0					4																	174253279		2203	4300	6503	HMGB2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3816.1	4q31	2011-07-01	2011-04-05	2002-08-16	ENSG00000164104	ENSG00000164104		"""High-mobility group / Canonical"""	5000	protein-coding gene	gene with protein product		163906	"""high-mobility group (nonhistone chromosomal) protein 2"", ""high-mobility group box 2"""	HMG2		1754403	Standard	NM_002129		Approved		uc011ckc.1	P26583	OTTHUMG00000160799	ENST00000296503.5:c.582G>A	4.37:g.174253279C>T		Somatic	0	36	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B2R4K8|D3DP37|Q5U072	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.E194	ENST00000296503.5	37	c.582	CCDS3816.1	4																																																																																			-	NULL		0.473	HMGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGB2	protein_coding	OTTHUMT00000362362.1	C	NM_001130688	-		174253279	-1	no_errors	ENST00000296503	ensembl	human	known	74_37	silent	SNP	0.850	T
RYR1	6261	genome.wustl.edu	37	19	38976304	38976304	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr19:38976304G>A	ENST00000359596.3	+	34	5009	c.5009G>A	c.(5008-5010)cGc>cAc	p.R1670H	RYR1_ENST00000360985.3_Missense_Mutation_p.R1670H|RYR1_ENST00000355481.4_Missense_Mutation_p.R1670H			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1670	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)	p.R1670H(1)		NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CGCCTCTACCGCGCTGTGTGC	0.662																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000196218						46.0	44.0	45.0					19																	38976304		2202	4296	6498	RYR1	SO:0001583	missense	0			-	HGNC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.5009G>A	19.37:g.38976304G>A	ENSP00000352608:p.Arg1670His	Somatic	0	9	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	15	31.82	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.R1670H	ENST00000359596.3	37	c.5009	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372571	0.61624	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96830	-4.13;-4.14;-4.14	4.07	4.07	0.47477	.	0.550372	0.17167	U	0.184416	D	0.94578	0.8253	N	0.14661	0.345	0.34064	D	0.65757	D;D	0.71674	0.998;0.997	P;P	0.55222	0.731;0.771	D	0.96950	0.9694	10	0.66056	D	0.02	.	16.0625	0.80847	0.0:0.0:1.0:0.0	.	1670;1670	P21817-2;P21817	.;RYR1_HUMAN	H	1670	ENSP00000352608:R1670H;ENSP00000347667:R1670H;ENSP00000354254:R1670H	ENSP00000347667:R1670H	R	+	2	0	RYR1	43668144	0.975000	0.34042	0.978000	0.43139	0.947000	0.59692	1.891000	0.39738	2.096000	0.63516	0.650000	0.86243	CGC	-	NULL		0.662	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	G		-		38976304	+1	no_errors	ENST00000359596	ensembl	human	known	74_37	missense	SNP	0.999	A
CASP8AP2	9994	genome.wustl.edu	37	6	90583756	90583756	+	RNA	SNP	T	T	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr6:90583756T>A	ENST00000551025.1	+	0	14688									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		ATATTTATTTTTAAACATGTT	0.274																																					Colon(187;1656 2025 17045 31481 39901)												0								ENSG00000118412																																			CASP8AP2			0			-	HGNC	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90583756T>A		Somatic	0	41	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	54	22.86		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			-	-		0.274	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	processed_transcript		T	NM_001137667	-		90583756	+1	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	SNP	0.902	A
LRP1	4035	genome.wustl.edu	37	12	57595284	57595284	+	Silent	SNP	G	G	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr12:57595284G>A	ENST00000243077.3	+	66	10816	c.10350G>A	c.(10348-10350)gaG>gaA	p.E3450E		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3450	LDL-receptor class A 23. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCACAGCCGAGGTGACCTGCG	0.607																																																	0								ENSG00000123384						74.0	67.0	69.0					12																	57595284		2203	4300	6503	LRP1	SO:0001819	synonymous_variant	0			-	HGNC	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.10350G>A	12.37:g.57595284G>A		Somatic	0	47	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	44	34.33	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.E3450	ENST00000243077.3	37	c.10350	CCDS8932.1	12																																																																																			-	superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt		0.607	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	protein_coding	OTTHUMT00000412772.2	G	NM_002332	-		57595284	+1	no_errors	ENST00000243077	ensembl	human	known	74_37	silent	SNP	0.997	A
CTNND2	1501	genome.wustl.edu	37	5	10973629	10973629	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr5:10973629C>T	ENST00000304623.8	-	22	3803	c.3614G>A	c.(3613-3615)cGt>cAt	p.R1205H	CTNND2_ENST00000359640.2_Missense_Mutation_p.R1147H|CTNND2_ENST00000458100.2_Missense_Mutation_p.R772H|CTNND2_ENST00000503622.1_Missense_Mutation_p.R868H|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Missense_Mutation_p.R1114H	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	1205					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R1205H(1)		NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						ACTGTAGGGACGGGCAGCTGA	0.612																																																	1	Substitution - Missense(1)	prostate(1)						ENSG00000169862						90.0	86.0	88.0					5																	10973629		2203	4300	6503	CTNND2	SO:0001583	missense	0			-	HGNC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.3614G>A	5.37:g.10973629C>T	ENSP00000307134:p.Arg1205His	Somatic	0	27	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	27	25.00	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R1205H	ENST00000304623.8	37	c.3614	CCDS3881.1	5	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404966	0.83230	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	D;D;D;D;D	0.83163	-1.61;-1.69;-1.59;-1.65;-1.61	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.88198	0.6372	L	0.36672	1.1	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.76071	0.987;0.987;0.984	D	0.88751	0.3250	10	0.87932	D	0	-8.9039	20.0522	0.97631	0.0:1.0:0.0:0.0	.	868;797;1205	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	H	1205;1147;1114;300;772;868	ENSP00000307134:R1205H;ENSP00000352661:R1147H;ENSP00000426510:R1114H;ENSP00000391155:R772H;ENSP00000426887:R868H	ENSP00000307134:R1205H	R	-	2	0	CTNND2	11026629	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.737000	0.93849	0.563000	0.77884	CGT	-	NULL		0.612	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	protein_coding	OTTHUMT00000206999.1	C	NM_001332	-		10973629	-1	no_errors	ENST00000304623	ensembl	human	known	74_37	missense	SNP	1.000	T
DNHD1	144132	genome.wustl.edu	37	11	6555132	6555132	+	Silent	SNP	G	G	T			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr11:6555132G>T	ENST00000527990.2	+	12	2727	c.2727G>T	c.(2725-2727)ctG>ctT	p.L909L	DNHD1_ENST00000254579.6_Silent_p.L909L			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	909					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CACAGCTTCTGGATATGTGGG	0.567																																																	0								ENSG00000179532						99.0	95.0	96.0					11																	6555132		692	1591	2283	DNHD1	SO:0001819	synonymous_variant	0			-	HGNC	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.2727G>T	11.37:g.6555132G>T		Somatic	0	22	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_P-loop_NTPase,superfamily_t-SNARE	p.L909	ENST00000527990.2	37	c.2727	CCDS44532.1	11																																																																																			-	NULL		0.567	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	protein_coding	OTTHUMT00000384673.2	G	NM_144666	-		6555132	+1	no_errors	ENST00000254579	ensembl	human	known	74_37	silent	SNP	0.450	T
AC079610.1	0	genome.wustl.edu	37	2	213628318	213628325	+	RNA	DEL	TGTGTGTG	TGTGTGTG	-	rs57305053|rs34611679|rs76851700		TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	TGTGTGTG	TGTGTGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr2:213628318_213628325delTGTGTGTG	ENST00000415387.1	-	0	381				AC093865.1_ENST00000408461.1_RNA																							tatatatatatgtgtgtgtatatatata	0.197																																																	0								ENSG00000221388																																			AC093865.1			0				Clone_based_ensembl_gene																													2.37:g.213628318_213628325delTGTGTGTG		Somatic	NA	NA	NA		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000415387.1	37	NULL		2																																																																																			-	-		0.197	AC079610.1-001	KNOWN	basic	sense_overlapping	ENSG00000221388	sense_overlapping	OTTHUMT00000337265.1	TGTGTGTG				213628325	-1	no_errors	ENST00000408461	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
VPS13A	23230	genome.wustl.edu	37	9	79897094	79897094	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr9:79897094A>C	ENST00000360280.3	+	29	3282	c.3022A>C	c.(3022-3024)Aat>Cat	p.N1008H	VPS13A_ENST00000376634.4_Missense_Mutation_p.N1008H|VPS13A_ENST00000357409.5_Missense_Mutation_p.N1008H|VPS13A_ENST00000423463.2_3'UTR|VPS13A_ENST00000376636.3_Missense_Mutation_p.N1008H	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1008					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)		p.N1008H(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GAATACAATAAATTATCTTCA	0.323																																																	2	Substitution - Missense(2)	large_intestine(2)						ENSG00000197969						70.0	75.0	73.0					9																	79897094		2202	4295	6497	VPS13A	SO:0001583	missense	0			-	HGNC	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.3022A>C	9.37:g.79897094A>C	ENSP00000353422:p.Asn1008His	Somatic	0	86	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	69	25.81	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.N1008H	ENST00000360280.3	37	c.3022	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	A	16.42	3.117240	0.56505	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.20463	2.07;2.07;2.07;2.07	5.18	4.02	0.46733	.	0.053759	0.64402	D	0.000001	T	0.38904	0.1058	M	0.69823	2.125	0.80722	D	1	P;P;D;P	0.56521	0.659;0.811;0.976;0.881	P;P;P;P	0.57960	0.694;0.602;0.83;0.776	T	0.20840	-1.0263	10	0.66056	D	0.02	.	11.836	0.52323	0.853:0.147:0.0:0.0	.	1008;1008;1008;1008	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	H	1008	ENSP00000365821:N1008H;ENSP00000365823:N1008H;ENSP00000353422:N1008H;ENSP00000349985:N1008H	ENSP00000349985:N1008H	N	+	1	0	VPS13A	79086914	1.000000	0.71417	0.987000	0.45799	0.694000	0.40290	7.449000	0.80643	0.791000	0.33826	-0.460000	0.05396	AAT	-	NULL		0.323	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	protein_coding	OTTHUMT00000052753.2	A	NM_015186	-		79897094	+1	no_errors	ENST00000360280	ensembl	human	known	74_37	missense	SNP	1.000	C
OR2B2	81697	genome.wustl.edu	37	6	27879447	27879447	+	Silent	SNP	C	C	A			TCGA-DX-A8BM-01A-11D-A417-09	TCGA-DX-A8BM-10B-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7d7641fa-0687-400b-bf80-67686179fd46	c55775b2-c64d-4761-bbad-9ce34418426b	g.chr6:27879447C>A	ENST00000303324.2	-	1	727	c.651G>T	c.(649-651)tcG>tcT	p.S217S		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						TAAAAGCATACGATATAAGGA	0.433																																																	0								ENSG00000168131						126.0	112.0	117.0					6																	27879447		2203	4300	6503	OR2B2	SO:0001819	synonymous_variant	0			-	HGNC	Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.651G>T	6.37:g.27879447C>A		Somatic	0	36	0.00		0.6808959473514592	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B2RNH2|Q9GZL2|Q9Y299	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S217	ENST00000303324.2	37	c.651	CCDS4641.1	6																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.433	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B2	protein_coding	OTTHUMT00000040163.1	C		-		27879447	-1	no_errors	ENST00000303324	ensembl	human	known	74_37	silent	SNP	0.000	A
