#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ACTL9	284382	genome.wustl.edu	37	19	8807881	8807881	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr19:8807881G>A	ENST00000324436.3	-	1	1291	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	391						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R391C(1)		NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TGGAAGGCGCGCAGGGAGGCC	0.652																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000181786						37.0	39.0	38.0					19																	8807881		2203	4299	6502	ACTL9	SO:0001583	missense	0			-	HGNC		CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1171C>T	19.37:g.8807881G>A	ENSP00000316674:p.Arg391Cys	Somatic	0	52	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	35	35.19	A8K893|Q6X960	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R391C	ENST00000324436.3	37	c.1171	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	g	10.61	1.399657	0.25291	.	.	ENSG00000181786	ENST00000324436	T	0.08193	3.12	4.51	2.23	0.28157	.	0.317190	0.22565	N	0.058402	T	0.12220	0.0297	L	0.29908	0.895	0.35755	D	0.81972	D	0.76494	0.999	P	0.60886	0.88	T	0.17684	-1.0361	10	0.87932	D	0	.	6.1475	0.20293	0.0884:0.0:0.5749:0.3367	.	391	Q8TC94	ACTL9_HUMAN	C	391	ENSP00000316674:R391C	ENSP00000316674:R391C	R	-	1	0	ACTL9	8668881	0.013000	0.17824	0.431000	0.26735	0.759000	0.43091	0.742000	0.26216	0.564000	0.29238	0.457000	0.33378	CGC	-	pfam_Actin-related,smart_Actin-related		0.652	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	protein_coding	OTTHUMT00000459953.1	G	NM_178525	-		8807881	-1	no_errors	ENST00000324436	ensembl	human	known	74_37	missense	SNP	0.994	A
TNXB	7148	genome.wustl.edu	37	6	32023775	32023775	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr6:32023775C>T	ENST00000375244.3	-	24	8521	c.8320G>A	c.(8320-8322)Gac>Aac	p.D2774N	TNXB_ENST00000375247.2_Missense_Mutation_p.D2774N			P22105	TENX_HUMAN	tenascin XB	2832	Fibronectin type-III 19. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GGCCGCCCGTCCCTGTCCTTG	0.657																																																	0								ENSG00000168477						65.0	71.0	69.0					6																	32023775		1284	2558	3842	TNXB	SO:0001583	missense	0			-	HGNC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8320G>A	6.37:g.32023775C>T	ENSP00000364393:p.Asp2774Asn	Somatic	0	55	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	42	61.47	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.D2774N	ENST00000375244.3	37	c.8320		6	.	.	.	.	.	.	.	.	.	.	C	15.90	2.968721	0.53614	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.56103	0.48;0.48	5.0	3.11	0.35812	.	.	.	.	.	T	0.25382	0.0617	L	0.59967	1.855	0.23309	N	0.997933	B	0.14805	0.011	B	0.15052	0.012	T	0.17319	-1.0373	9	0.26408	T	0.33	.	7.7348	0.28808	0.1593:0.7535:0.0:0.0873	.	2774	P22105-3	.	N	2774	ENSP00000364393:D2774N;ENSP00000364396:D2774N	ENSP00000364393:D2774N	D	-	1	0	TNXB	32131753	0.012000	0.17670	0.988000	0.46212	0.958000	0.62258	1.021000	0.30040	1.070000	0.40811	0.456000	0.33151	GAC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.657	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	protein_coding	OTTHUMT00000268927.2	C	NM_019105	-		32023775	-1	no_errors	ENST00000375247	ensembl	human	known	74_37	missense	SNP	0.925	T
THAP6	152815	genome.wustl.edu	37	4	76442147	76442147	+	Silent	SNP	T	T	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr4:76442147T>C	ENST00000311638.3	+	3	314	c.246T>C	c.(244-246)ccT>ccC	p.P82P	THAP6_ENST00000508105.1_Silent_p.P41P|THAP6_ENST00000514480.1_Silent_p.P82P|RCHY1_ENST00000380840.2_5'Flank|THAP6_ENST00000507557.1_Silent_p.P41P|RCHY1_ENST00000324439.5_5'Flank|RCHY1_ENST00000512706.1_5'Flank|THAP6_ENST00000380837.3_Silent_p.P82P|RCHY1_ENST00000514021.1_5'Flank|THAP6_ENST00000502620.1_Silent_p.P41P|RCHY1_ENST00000513257.1_5'Flank|RCHY1_ENST00000451788.1_5'Flank|THAP6_ENST00000504190.1_Silent_p.P41P|THAP6_ENST00000507885.1_Silent_p.P41P|THAP6_ENST00000507556.1_Silent_p.P82P	NM_144721.4	NP_653322.1	Q8TBB0	THAP6_HUMAN	THAP domain containing 6	82						microtubule cytoskeleton (GO:0015630)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(5)	5			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AACTGAAACCTGGAGTCATAC	0.363																																																	0								ENSG00000174796						100.0	107.0	105.0					4																	76442147		2203	4300	6503	THAP6	SO:0001819	synonymous_variant	0			-	HGNC	BC022989	CCDS3568.1	4q21.21	2013-01-25			ENSG00000174796	ENSG00000174796		"""THAP (C2CH-type zinc finger) domain containing"""	23189	protein-coding gene	gene with protein product		612535				12575992	Standard	NM_144721		Approved	MGC30052	uc003him.3	Q8TBB0	OTTHUMG00000130108	ENST00000311638.3:c.246T>C	4.37:g.76442147T>C		Somatic	0	64	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B4E146|Q5HYJ7|Q5JPC6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.P82	ENST00000311638.3	37	c.246	CCDS3568.1	4																																																																																			-	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH		0.363	THAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP6	protein_coding	OTTHUMT00000252414.1	T	NM_144721	-		76442147	+1	no_errors	ENST00000311638	ensembl	human	known	74_37	silent	SNP	1.000	C
ZNF430	80264	genome.wustl.edu	37	19	21216935	21216935	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr19:21216935G>C	ENST00000261560.5	+	4	448	c.267G>C	c.(265-267)gaG>gaC	p.E89D	ZNF430_ENST00000595401.1_Missense_Mutation_p.E88D|ZNF430_ENST00000599548.1_Missense_Mutation_p.E89D	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	89	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						CCTGTCTAGAGCAAGGAAAAG	0.418																																																	0								ENSG00000118620						125.0	123.0	124.0					19																	21216935		2203	4300	6503	ZNF430	SO:0001583	missense	0			-	HGNC	AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.267G>C	19.37:g.21216935G>C	ENSP00000261560:p.Glu89Asp	Somatic	0	70	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	31	42.59	Q86V70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E89D	ENST00000261560.5	37	c.267	CCDS32978.1	19	.	.	.	.	.	.	.	.	.	.	.	9.402	1.078273	0.20227	.	.	ENSG00000118620	ENST00000261560	T	0.01113	5.32	0.195	0.195	0.15151	Krueppel-associated box (3);	.	.	.	.	T	0.03564	0.0102	M	0.84219	2.685	0.09310	N	1	P;P	0.51449	0.945;0.859	B;P	0.51453	0.388;0.67	T	0.28202	-1.0051	8	0.87932	D	0	.	.	.	.	.	88;89	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	D	89	ENSP00000261560:E89D	ENSP00000261560:E89D	E	+	3	2	ZNF430	21008775	0.005000	0.15991	0.185000	0.23176	0.189000	0.23516	-0.665000	0.05286	0.300000	0.22699	0.306000	0.20318	GAG	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.418	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF430	protein_coding	OTTHUMT00000463539.1	G	NM_025189	-		21216935	+1	no_errors	ENST00000261560	ensembl	human	known	74_37	missense	SNP	0.225	C
HECTD1	25831	genome.wustl.edu	37	14	31642438	31642438	+	Silent	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr14:31642438C>T	ENST00000399332.1	-	6	1568	c.1080G>A	c.(1078-1080)gaG>gaA	p.E360E	HECTD1_ENST00000553700.1_Silent_p.E360E	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	360					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		GATGTGAGCGCTCCCCAGAAC	0.408																																																	0								ENSG00000092148						117.0	110.0	113.0					14																	31642438		1879	4126	6005	HECTD1	SO:0001819	synonymous_variant	0			-	HGNC	AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.1080G>A	14.37:g.31642438C>T		Somatic	0	44	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_Sad1_UNC_C,pfam_Mib_Herc2,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,superfamily_Galactose-bd-like,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT	p.E360	ENST00000399332.1	37	c.1080	CCDS41939.1	14																																																																																			-	superfamily_ARM-type_fold		0.408	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD1	protein_coding	OTTHUMT00000409942.1	C		-		31642438	-1	no_errors	ENST00000399332	ensembl	human	known	74_37	silent	SNP	0.977	T
AOX2P	344454	genome.wustl.edu	37	2	201619758	201619759	+	IGR	DEL	TG	TG	-	rs563268698	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr2:201619758_201619759delTG								AC007163.3 (19858 upstream) : AOX2P (7271 downstream)																							CCTTTCAAATtgtgtgtgtgtg	0.406														2052	0.409744	0.2262	0.3775	5008	,	,		16703	0.4236		0.4254	False		,,,				2504	0.6503																0								ENSG00000243478																																			AOX2P	SO:0001628	intergenic_variant	0				HGNC																													2.37:g.201619768_201619769delTG		Somatic	0	11	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		2																																																																																			-	-	0	0.406					AOX2P			TG				201619759	+1	no_errors	ENST00000472376	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
CTPS2	56474	genome.wustl.edu	37	X	16609019	16609020	+	Intron	INS	-	-	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:16609019_16609020insA	ENST00000443824.1	-	18	2435				CTPS2_ENST00000483053.1_5'UTR|CTPS2_ENST00000359276.4_Intron|CTPS2_ENST00000380241.3_Intron	NM_001144002.1	NP_001137474.1	Q9NRF8	PYRG2_HUMAN	CTP synthase 2						'de novo' CTP biosynthetic process (GO:0044210)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleotide metabolic process (GO:0006220)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP synthase activity (GO:0003883)			breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	Hepatocellular(33;0.0997)					TAGCAAGGTATAAAAAAAAAAC	0.327																																																	0								ENSG00000047230																																			CTPS2	SO:0001627	intron_variant	0				HGNC	AF086422	CCDS14175.1	Xp22	2012-05-02	2012-05-02		ENSG00000047230	ENSG00000047230	6.3.4.2		2520	protein-coding gene	gene with protein product		300380	"""CTP synthase II"""			10899599	Standard	NM_001144002		Approved		uc004cxm.3	Q9NRF8	OTTHUMG00000021193	ENST00000443824.1:c.1692-34->T	X.37:g.16609029_16609029dupA		Somatic	0	25	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B3KWM2|Q9BRI0|Q9H809|Q9H8K9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443824.1	37	NULL	CCDS14175.1	X																																																																																			-	-		0.327	CTPS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CTPS2	protein_coding	OTTHUMT00000055906.1	-	NM_019857			16609020	-1	no_errors	ENST00000483053	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
TTLL11	158135	genome.wustl.edu	37	9	124855330	124855331	+	In_Frame_Ins	INS	-	-	TGGCCT	rs3833704|rs201653732	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr9:124855330_124855331insTGGCCT	ENST00000373776.3	-	1	554_555	c.367_368insAGGCCA	c.(367-369)aca>aAGGCCAca	p.122_123insKA	TTLL11_ENST00000474723.1_5'UTR|TTLL11_ENST00000321582.5_In_Frame_Ins_p.122_123insKA	NM_194252.2	NP_919228.2	Q8NHH1	TTL11_HUMAN	tubulin tyrosine ligase-like family, member 11	122					cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(3)|skin(1)	18						cgtctccgctgtggcctcggcc	0.762														678	0.135383	0.1044	0.1254	5008	,	,		10384	0.0367		0.2773	False		,,,				2504	0.1401																0								ENSG00000175764		,	363,1875		124,115,880					,	-4.8	0.0		dbSNP_107	2	1330,3776		463,404,1686	no	coding,coding	TTLL11	NM_194252.2,NM_001139442.1	,	587,519,2566	A1A1,A1R,RR		26.0478,16.2198,23.0528	,	,		1693,5651				TTLL11	SO:0001652	inframe_insertion	0				HGNC	AF521886	CCDS6834.2, CCDS48012.1	9q34.11	2013-02-14	2005-07-28	2005-07-28	ENSG00000175764	ENSG00000175764		"""Tubulin tyrosine ligase-like family"""	18113	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 20"""	C9orf20		15890843	Standard	NM_001139442		Approved	bA244O19.1	uc011lyl.2	Q8NHH1	OTTHUMG00000020597	ENST00000373776.3:c.362_367dupAGGCCA	9.37:g.124855331_124855336dupTGGCCT	ENSP00000362881:p.Ala122_Thr123insLysAla	Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.123in_frame_insKA	ENST00000373776.3	37	c.368_367	CCDS6834.2	9																																																																																			-	NULL		0.762	TTLL11-004	KNOWN	basic|CCDS	protein_coding	TTLL11	protein_coding	OTTHUMT00000053907.1	-	XM_088486			124855331	-1	no_errors	ENST00000321582	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.000	TGGCCT
KDELC2	143888	genome.wustl.edu	37	11	108352023	108352023	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:108352023G>T	ENST00000323468.5	-	5	1047	c.982C>A	c.(982-984)Ctg>Atg	p.L328M	KDELC2_ENST00000532730.1_Intron|KDELC2_ENST00000434945.2_Missense_Mutation_p.L272M|KDELC2_ENST00000375648.1_Missense_Mutation_p.L272M	NM_153705.4	NP_714916.3	Q7Z4H8	KDEL2_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 2	328						endoplasmic reticulum (GO:0005783)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;6.93e-06)|BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|all cancers(92;0.00016)|OV - Ovarian serous cystadenocarcinoma(223;0.132)|Colorectal(284;0.14)		TCTTTGGACAGCTGTACCAAC	0.433																																																	0								ENSG00000178202						117.0	116.0	116.0					11																	108352023		1818	4086	5904	KDELC2	SO:0001583	missense	0			-	HGNC	AF533708	CCDS41711.1	11q32	2010-11-18			ENSG00000178202	ENSG00000178202			28496	protein-coding gene	gene with protein product						12975309	Standard	NM_153705		Approved	MGC33424	uc001pkj.2	Q7Z4H8	OTTHUMG00000166535	ENST00000323468.5:c.982C>A	11.37:g.108352023G>T	ENSP00000315386:p.Leu328Met	Somatic	0	52	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q6UWW2|Q6ZUM9|Q8N7L8|Q8NE24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LipoPS_modifying,pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,smart_LipoPS_modifying,pfscan_Filamin/ABP280_repeat-like	p.L328M	ENST00000323468.5	37	c.982	CCDS41711.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.387|5.387	0.256668|0.256668	0.10185|0.10185	.|.	.|.	ENSG00000178202|ENSG00000178202	ENST00000530318|ENST00000323468;ENST00000434945;ENST00000375648	.|T;T;T	.|0.25912	.|1.77;1.77;1.77	5.17|5.17	0.76|0.76	0.18442|0.18442	.|.	.|0.344068	.|0.28307	.|N	.|0.015826	T|T	0.21103|0.21103	0.0508|0.0508	L|L	0.33189|0.33189	0.99|0.99	0.28506|0.28506	N|N	0.913768|0.913768	.|P;B	.|0.50272	.|0.933;0.337	.|P;B	.|0.50162	.|0.633;0.271	T|T	0.06899|0.06899	-1.0801|-1.0801	5|10	.|0.41790	.|T	.|0.15	-31.7423|-31.7423	4.3242|4.3242	0.11032|0.11032	0.2028:0.0:0.3785:0.4187|0.2028:0.0:0.3785:0.4187	.|.	.|328;272	.|Q7Z4H8;Q7Z4H8-2	.|KDEL2_HUMAN;.	D|M	45|328;272;272	.|ENSP00000315386:L328M;ENSP00000413429:L272M;ENSP00000364799:L272M	.|ENSP00000315386:L328M	A|L	-|-	2|1	0|2	KDELC2|KDELC2	107857233|107857233	0.002000|0.002000	0.14202|0.14202	0.998000|0.998000	0.56505|0.56505	0.476000|0.476000	0.33039|0.33039	-0.100000|-0.100000	0.10990|0.10990	0.298000|0.298000	0.22638|0.22638	-0.282000|-0.282000	0.10007|0.10007	GCT|CTG	-	pfam_LipoPS_modifying,smart_LipoPS_modifying		0.433	KDELC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELC2	protein_coding	OTTHUMT00000390273.1	G	NM_153705	-		108352023	-1	no_errors	ENST00000323468	ensembl	human	known	74_37	missense	SNP	0.110	T
CRISPLD1	83690	genome.wustl.edu	37	8	75941636	75941636	+	Silent	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr8:75941636C>T	ENST00000262207.4	+	14	1803	c.1335C>T	c.(1333-1335)tgC>tgT	p.C445C	CRISPLD1_ENST00000523524.1_Silent_p.C257C|RP11-300E4.2_ENST00000520778.1_RNA|CRISPLD1_ENST00000517786.1_Silent_p.C259C	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	445	LCCL 2. {ECO:0000255|PROSITE- ProRule:PRU00123}.				face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.C445C(1)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CCAGTATCTGCAGAGCAGCAG	0.413																																																	1	Substitution - coding silent(1)	endometrium(1)						ENSG00000121005						88.0	78.0	82.0					8																	75941636		2203	4300	6503	CRISPLD1	SO:0001819	synonymous_variant	0			-	HGNC	AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.1335C>T	8.37:g.75941636C>T		Somatic	0	44	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B2RA60|B7Z929	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.C445	ENST00000262207.4	37	c.1335	CCDS6219.1	8																																																																																			-	pfam_LCCL,superfamily_LCCL,smart_LCCL,pfscan_LCCL		0.413	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	protein_coding	OTTHUMT00000379117.1	C	NM_031461	-		75941636	+1	no_errors	ENST00000262207	ensembl	human	known	74_37	silent	SNP	1.000	T
IL13RA1	3597	genome.wustl.edu	37	X	117883649	117883649	+	Silent	SNP	T	T	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:117883649T>G	ENST00000371666.3	+	4	463	c.396T>G	c.(394-396)ctT>ctG	p.L132L	IL13RA1_ENST00000371642.1_Silent_p.L132L	NM_001560.2	NP_001551.1	P78552	I13R1_HUMAN	interleukin 13 receptor, alpha 1	132	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin production (GO:0002639)	interleukin-13 receptor complex (GO:0005898)|plasma membrane (GO:0005886)	interleukin-13 receptor activity (GO:0016515)			endometrium(2)|kidney(1)|large_intestine(2)|lung(7)	12						TGACTGAGCTTCAATGCATTT	0.443																																																	0								ENSG00000131724						319.0	257.0	278.0					X																	117883649		2203	4300	6503	IL13RA1	SO:0001819	synonymous_variant	0			-	HGNC	U62858	CCDS14573.1	Xq24	2008-02-05			ENSG00000131724	ENSG00000131724		"""Interleukins and interleukin receptors"", ""CD molecules"""	5974	protein-coding gene	gene with protein product	"""IL13 receptor alpha-1 chain"", ""CD213a1 antigen"""	300119				8910586, 9013879	Standard	NM_001560		Approved	IL-13Ra, NR4, CD213a1	uc004eqs.3	P78552	OTTHUMG00000022258	ENST00000371666.3:c.396T>G	X.37:g.117883649T>G		Somatic	0	45	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	O95646|Q5JSL4|Q99656|Q9UDY5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.L132	ENST00000371666.3	37	c.396	CCDS14573.1	X																																																																																			-	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3		0.443	IL13RA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL13RA1	protein_coding	OTTHUMT00000058009.1	T	NM_001560	-		117883649	+1	no_errors	ENST00000371666	ensembl	human	known	74_37	silent	SNP	0.048	G
EBF3	253738	genome.wustl.edu	37	10	131760436	131760436	+	Splice_Site	SNP	T	T	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr10:131760436T>C	ENST00000355311.5	-	4	482	c.410A>G	c.(409-411)cAg>cGg	p.Q137R	EBF3_ENST00000368648.3_Splice_Site_p.Q137R			Q9H4W6	COE3_HUMAN	early B-cell factor 3	137					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CTTTCTCACCTGTTTGGTCAT	0.463																																																	0								ENSG00000108001						108.0	102.0	104.0					10																	131760436		2203	4300	6503	EBF3	SO:0001630	splice_region_variant	0			-	HGNC		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.411+1A>G	10.37:g.131760436T>C		Somatic	0	41	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A0AUY1|Q5T6H9|Q9H4W5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IPT,superfamily_Ig_E-set,smart_IPT	p.Q137R	ENST00000355311.5	37	c.410		10	.	.	.	.	.	.	.	.	.	.	T	27.4	4.829260	0.90955	.	.	ENSG00000108001	ENST00000355311;ENST00000368648	T;T	0.52754	0.65;0.67	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.72779	0.3503	M	0.87758	2.905	0.80722	D	1	D	0.64830	0.994	D	0.68765	0.96	T	0.78018	-0.2368	10	0.87932	D	0	-13.4618	16.2316	0.82347	0.0:0.0:0.0:1.0	.	137	Q9H4W6-2	.	R	137	ENSP00000347463:Q137R;ENSP00000357637:Q137R	ENSP00000347463:Q137R	Q	-	2	0	EBF3	131650426	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.988000	0.88194	2.308000	0.77769	0.533000	0.62120	CAG	-	NULL		0.463	EBF3-001	KNOWN	basic|appris_principal	protein_coding	EBF3	protein_coding	OTTHUMT00000051015.2	T	NM_001005463	-	Missense_Mutation	131760436	-1	no_errors	ENST00000355311	ensembl	human	known	74_37	missense	SNP	1.000	C
C1orf27	54953	genome.wustl.edu	37	1	186367574	186367574	+	Splice_Site	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:186367574G>A	ENST00000287859.6	+	10	1034		c.e10+1		C1orf27_ENST00000432021.3_Splice_Site|OCLM_ENST00000574641.1_5'Flank|C1orf27_ENST00000367470.3_Splice_Site|AL596220.1_ENST00000598663.1_5'Flank|C1orf27_ENST00000419367.3_Splice_Site	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27							integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						TGCTGTGCAGGTACAAAAAGG	0.333																																																	0								ENSG00000157181						80.0	73.0	75.0					1																	186367574		1849	4099	5948	C1orf27	SO:0001630	splice_region_variant	0			-	HGNC	BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.909+1G>A	1.37:g.186367574G>A		Somatic	0	55	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e9+1	ENST00000287859.6	37	c.909+1	CCDS53448.1	1	.	.	.	.	.	.	.	.	.	.	G	15.05	2.717318	0.48622	.	.	ENSG00000157181	ENST00000367470;ENST00000419367;ENST00000432021;ENST00000287859	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5266	0.90975	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf27	184634197	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	7.454000	0.80714	2.359000	0.80004	0.467000	0.42956	.	-	-		0.333	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C1orf27	protein_coding	OTTHUMT00000086352.2	G	NM_017847	-	Intron	186367574	+1	no_errors	ENST00000287859	ensembl	human	known	74_37	splice_site	SNP	1.000	A
C4orf22	255119	genome.wustl.edu	37	4	81504291	81504291	+	Missense_Mutation	SNP	C	C	T	rs142731425		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr4:81504291C>T	ENST00000358105.3	+	3	336	c.287C>T	c.(286-288)aCg>aTg	p.T96M	C4orf22_ENST00000508675.1_Missense_Mutation_p.T96M|C4orf22_ENST00000512931.1_3'UTR	NM_152770.2	NP_689983.2	Q6V702	CD022_HUMAN	chromosome 4 open reading frame 22	96										NS(1)|large_intestine(3)|lung(5)|prostate(1)|skin(5)	15						AATTTTCTGACGGCCCTGGCA	0.353													C|||	1	0.000199681	0.0	0.0014	5008	,	,		13447	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000197826	C	MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	81.0	80.0	80.0		287,287	1.8	1.0	4	dbSNP_134	80	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	C4orf22	NM_001206997.1,NM_152770.2	81,81	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	possibly-damaging,possibly-damaging	96/251,96/234	81504291	2,13004	2203	4300	6503	C4orf22	SO:0001583	missense	0			GMAF=0.0005	HGNC	BC034296	CCDS3587.1, CCDS56336.1	4q21.21	2008-02-05			ENSG00000197826	ENSG00000197826			28554	protein-coding gene	gene with protein product						12477932	Standard	NM_152770		Approved		uc010ijp.3	Q6V702	OTTHUMG00000130289	ENST00000358105.3:c.287C>T	4.37:g.81504291C>T	ENSP00000350818:p.Thr96Met	Somatic	0	44	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	6	61.11	E7EQ13|Q6ZQY4|Q8N4G9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T96M	ENST00000358105.3	37	c.287	CCDS3587.1	4	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	3.828	-0.036334	0.07497	2.27E-4	1.16E-4	ENSG00000197826	ENST00000358105;ENST00000508675	T;T	0.30448	1.53;1.53	5.55	1.79	0.24919	.	0.190189	0.43110	N	0.000604	T	0.12092	0.0294	N	0.08118	0	0.26925	N	0.966598	B;B	0.20887	0.039;0.049	B;B	0.19391	0.021;0.025	T	0.16188	-1.0411	10	0.27082	T	0.32	.	3.2936	0.06958	0.5331:0.2648:0.0705:0.1316	.	96;96	E7EQ13;Q6V702	.;CD022_HUMAN	M	96	ENSP00000350818:T96M;ENSP00000425786:T96M	ENSP00000350818:T96M	T	+	2	0	C4orf22	81723315	1.000000	0.71417	1.000000	0.80357	0.009000	0.06853	1.547000	0.36190	0.171000	0.19730	-2.610000	0.00160	ACG	-	NULL		0.353	C4orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf22	protein_coding	OTTHUMT00000252629.2	C	NM_152770	rs142731425		81504291	+1	no_errors	ENST00000508675	ensembl	human	known	74_37	missense	SNP	1.000	T
HSPG2	3339	genome.wustl.edu	37	1	22149775	22149775	+	3'UTR	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:22149775G>A	ENST00000374695.3	-	0	13289				LDLRAD2_ENST00000543870.1_Intron|HSPG2_ENST00000486901.1_5'UTR|LDLRAD2_ENST00000344642.2_3'UTR	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2						angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GGGCTGGGGCGTGGCCCGGGA	0.607																																																	0								ENSG00000142798						2.0	3.0	2.0					1																	22149775		1403	3201	4604	HSPG2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.*34C>T	1.37:g.22149775G>A		Somatic	0	26	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	Q16287|Q5SZI3|Q9H3V5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374695.3	37	NULL	CCDS30625.1	1																																																																																			-	-		0.607	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	protein_coding	OTTHUMT00000007598.1	G	NM_005529	-		22149775	-1	no_errors	ENST00000486901	ensembl	human	known	74_37	rna	SNP	0.001	A
RNFT2	84900	genome.wustl.edu	37	12	117290182	117290183	+	3'UTR	INS	-	-	TTCCCC	rs140709252|rs71099009|rs201262887	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr12:117290182_117290183insTTCCCC	ENST00000392549.2	+	0	1644_1645				RNFT2_ENST00000319176.7_3'UTR|RNFT2_ENST00000551251.1_3'UTR|RNFT2_ENST00000407967.3_Intron	NM_001109903.1	NP_001103373.1	Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		AAACCAGGACTTTCCCCTTGGC	0.564														2254	0.45008	0.0386	0.7738	5008	,	,		20897	0.4732		0.7296	False		,,,				2504	0.4652																0								ENSG00000135119																																			RNFT2	SO:0001624	3_prime_UTR_variant	0				HGNC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000392549.2:c.*77->TTCCCC	12.37:g.117290183_117290188dupTTCCCC		Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PAM7|Q96SU5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392549.2	37	NULL	CCDS44987.1	12																																																																																			-	-		0.564	RNFT2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	protein_coding		-	NM_032814			117290183	+1	no_errors	ENST00000551251	ensembl	human	known	74_37	rna	INS	0.014:0.009	TTCCCC
CCDC22	28952	genome.wustl.edu	37	X	49106184	49106184	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:49106184C>A	ENST00000376227.3	+	16	1938	c.1768C>A	c.(1768-1770)Cag>Aag	p.Q590K		NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	590										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						CCTCGAGGAGCAGGTGAGGCC	0.637																																																	0								ENSG00000101997						34.0	28.0	30.0					X																	49106184		2203	4300	6503	CCDC22	SO:0001583	missense	0			-	HGNC	BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.1768C>A	X.37:g.49106184C>A	ENSP00000365401:p.Gln590Lys	Somatic	0	81	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	49	38.75	A8K7G1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF812	p.Q590K	ENST00000376227.3	37	c.1768	CCDS14322.1	X	.	.	.	.	.	.	.	.	.	.	C	23.6	4.430492	0.83776	.	.	ENSG00000101997	ENST00000376227	.	.	.	5.24	5.24	0.73138	.	0.055533	0.64402	D	0.000001	T	0.75072	0.3800	L	0.60957	1.885	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.71794	-0.4485	9	0.25106	T	0.35	-19.5507	16.5457	0.84445	0.0:1.0:0.0:0.0	.	590	O60826	CCD22_HUMAN	K	590	.	ENSP00000365401:Q590K	Q	+	1	0	CCDC22	48993128	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	6.897000	0.75671	2.163000	0.67991	0.436000	0.28706	CAG	-	pfam_DUF812		0.637	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC22	protein_coding	OTTHUMT00000060822.1	C	NM_014008	-		49106184	+1	no_errors	ENST00000376227	ensembl	human	known	74_37	missense	SNP	1.000	A
ORC5	5001	genome.wustl.edu	37	7	103805705	103805705	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr7:103805705T>C	ENST00000297431.4	-	11	1158	c.1016A>G	c.(1015-1017)aAc>aGc	p.N339S	ORC5_ENST00000545943.1_Missense_Mutation_p.N207S	NM_002553.3	NP_002544.1	O43913	ORC5_HUMAN	origin recognition complex, subunit 5	339					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			kidney(1)|large_intestine(2)|lung(9)|pancreas(1)|upper_aerodigestive_tract(1)	14						TTTTAGAAAGTTGGTTTTCTT	0.254																																																	0								ENSG00000164815						38.0	36.0	36.0					7																	103805705		2180	4263	6443	ORC5	SO:0001583	missense	0			-	HGNC		CCDS5734.1, CCDS47681.1	7q22.1	2014-06-13	2010-10-12	2010-10-12	ENSG00000164815	ENSG00000164815			8491	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 117"""	602331	"""origin recognition complex, subunit 5 (yeast homolog)-like"", ""origin recognition complex, subunit 5-like (yeast)"", ""origin recognition complex, subunit 5 homolog (yeast)"""	ORC5L		9417919, 9829972	Standard	NM_002553		Approved	Orc5p, ORC5T, PPP1R117	uc003vcb.3	O43913	OTTHUMG00000157275	ENST00000297431.4:c.1016A>G	7.37:g.103805705T>C	ENSP00000297431:p.Asn339Ser	Somatic	0	56	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A4D0P8|O60590|O95268	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.N339S	ENST00000297431.4	37	c.1016	CCDS5734.1	7	.	.	.	.	.	.	.	.	.	.	T	15.10	2.733453	0.48939	.	.	ENSG00000164815	ENST00000297431;ENST00000545943	T;T	0.39787	2.08;1.06	5.04	5.04	0.67666	.	0.041746	0.85682	D	0.000000	T	0.31575	0.0801	L	0.38175	1.15	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.11494	-1.0585	10	0.08837	T	0.75	.	14.7283	0.69360	0.0:0.0:0.0:1.0	.	339	O43913	ORC5_HUMAN	S	339;207	ENSP00000297431:N339S;ENSP00000438018:N207S	ENSP00000297431:N339S	N	-	2	0	ORC5	103592941	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.773000	0.62331	2.008000	0.58898	0.454000	0.30748	AAC	-	NULL		0.254	ORC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC5	protein_coding	OTTHUMT00000348286.1	T	NM_002553	-		103805705	-1	no_errors	ENST00000297431	ensembl	human	known	74_37	missense	SNP	1.000	C
TCP11	6954	genome.wustl.edu	37	6	35109033	35109040	+	5'Flank	DEL	GCGGCCTG	GCGGCCTG	-	rs142118879|rs112303926	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	GCGGCCTG	GCGGCCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr6:35109033_35109040delGCGGCCTG	ENST00000512012.1	-	0	0				TCP11_ENST00000244645.3_5'UTR|TCP11_ENST00000311875.5_5'UTR|TCP11_ENST00000510465.1_5'UTR|TCP11_ENST00000373974.4_5'UTR|TCP11_ENST00000418521.2_Intron|TCP11_ENST00000373979.2_5'UTR|TCP11_ENST00000444780.2_5'UTR|TCP11_ENST00000412155.2_5'UTR			Q8WWU5	TCP11_HUMAN	t-complex 11, testis-specific						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)				breast(1)|kidney(5)|large_intestine(3)|lung(10)|ovary(3)|prostate(1)|skin(4)	27						GGTGGGCCTCGCGGCCTGGCGGCCTGGA	0.769														2193	0.437899	0.1831	0.611	5008	,	,		9765	0.3085		0.6849	False		,,,				2504	0.5389																0								ENSG00000124678		,	265,1133		113,39,547					,	0.6	0.0		dbSNP_130	1	1818,1276		830,158,559	no	utr-5,utr-5	TCP11	NM_018679.4,NM_001093728.1	,	943,197,1106	A1A1,A1R,RR		41.2411,18.9557,46.3713	,	,		2083,2409				TCP11	SO:0001631	upstream_gene_variant	0				HGNC		CCDS4799.1, CCDS47413.1, CCDS59015.1, CCDS59016.1, CCDS59017.1, CCDS59018.1	6p21.31	2012-09-20	2012-09-20		ENSG00000124678	ENSG00000124678			11658	protein-coding gene	gene with protein product	"""fertilization-promoting peptide receptor"""	186982	"""t-complex 11 (a murine tcp homolog)"", ""t-complex 11 homolog (mouse)"""	D6S230E		1427894, 11756566, 21597245	Standard	NM_001093728		Approved	KIAA0229, FPPR	uc003okd.2	Q8WWU5	OTTHUMG00000014560		6.37:g.35109041_35109048delGCGGCCTG	Exception_encountered	Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RCE9|B3KQ27|B7Z7B5|B7Z7G1|B7Z7H4|B7Z7S8|E7EP29|J3KNG1|Q8NF85|Q9NQZ9|Q9NR39	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000512012.1	37	NULL		6																																																																																			-	-		0.769	TCP11-014	PUTATIVE	basic	protein_coding	TCP11	protein_coding	OTTHUMT00000370354.1	GCGGCCTG	NM_001093728			35109040	-1	no_errors	ENST00000394696	ensembl	human	known	74_37	rna	DEL	0.001:0.000:0.000:0.001:0.002:0.001:0.000:0.000	-
LSAMP	4045	genome.wustl.edu	37	3	116163774	116163774	+	Silent	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr3:116163774G>A	ENST00000490035.2	-	1	604	c.105C>T	c.(103-105)aaC>aaT	p.N35N	LSAMP_ENST00000539563.1_Silent_p.N32N	NM_002338.3	NP_002329.2	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein	35	Ig-like C2-type 1.				cell adhesion (GO:0007155)|locomotory exploration behavior (GO:0035641)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|kidney(1)|large_intestine(4)|lung(14)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	31		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		CCGTGCCTCGGTTAAAATCCA	0.572																																																	0								ENSG00000185565						109.0	90.0	96.0					3																	116163774		2203	4300	6503	LSAMP	SO:0001819	synonymous_variant	0			-	HGNC	U41901	CCDS2982.1	3q13.2-q21	2013-01-11			ENSG00000185565	ENSG00000185565		"""Immunoglobulin superfamily / I-set domain containing"""	6705	protein-coding gene	gene with protein product	"""IgLON family member 3"""	603241				9615236	Standard	NM_002338		Approved	LAMP, IGLON3	uc003ebs.3	Q13449	OTTHUMG00000159308	ENST00000490035.2:c.105C>T	3.37:g.116163774G>A		Somatic	0	39	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q8IV49	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.N35	ENST00000490035.2	37	c.105	CCDS2982.1	3																																																																																			-	pfam_Ig_I-set,pfscan_Ig-like_dom		0.572	LSAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LSAMP	protein_coding	OTTHUMT00000354495.4	G	NM_002338	-		116163774	-1	no_errors	ENST00000490035	ensembl	human	known	74_37	silent	SNP	1.000	A
ANGEL2	90806	genome.wustl.edu	37	1	213168525	213168525	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:213168525A>G	ENST00000366962.3	-	9	1647	c.1493T>C	c.(1492-1494)gTt>gCt	p.V498A	ANGEL2_ENST00000544555.1_Missense_Mutation_p.V329A|ANGEL2_ENST00000535388.1_3'UTR|ANGEL2_ENST00000540642.1_Missense_Mutation_p.V372A|ANGEL2_ENST00000473303.1_5'UTR|ANGEL2_ENST00000360506.2_Missense_Mutation_p.V329A	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	498										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		AACCAAAGCAACTTCAGCTCC	0.343																																																	0								ENSG00000174606						107.0	107.0	107.0					1																	213168525		2203	4300	6503	ANGEL2	SO:0001583	missense	0			-	HGNC	AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.1493T>C	1.37:g.213168525A>G	ENSP00000355929:p.Val498Ala	Somatic	0	29	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	29	29.27	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.V498A	ENST00000366962.3	37	c.1493	CCDS1512.1	1	.	.	.	.	.	.	.	.	.	.	A	6.616	0.482042	0.12581	.	.	ENSG00000174606	ENST00000366962;ENST00000360506;ENST00000544555;ENST00000540642	T;D;D;T	0.95137	1.95;-3.62;-3.62;1.58	5.75	3.43	0.39272	Endonuclease/exonuclease/phosphatase (2);	0.376505	0.28442	N	0.015334	D	0.85687	0.5754	N	0.19112	0.55	0.09310	N	0.999998	B;B	0.16802	0.004;0.019	B;B	0.22152	0.012;0.038	T	0.69143	-0.5223	10	0.06625	T	0.88	-10.9649	6.1939	0.20540	0.6269:0.0:0.0714:0.3016	.	372;498	F5H476;Q5VTE6	.;ANGE2_HUMAN	A	498;329;329;372	ENSP00000355929:V498A;ENSP00000353696:V329A;ENSP00000443193:V329A;ENSP00000446124:V372A	ENSP00000353696:V329A	V	-	2	0	ANGEL2	211235148	0.001000	0.12720	0.977000	0.42913	0.935000	0.57460	0.728000	0.26013	0.446000	0.26666	-0.757000	0.03467	GTT	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase		0.343	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	protein_coding	OTTHUMT00000089693.1	A	NM_144567	-		213168525	-1	no_errors	ENST00000366962	ensembl	human	known	74_37	missense	SNP	0.015	G
ANKS4B	257629	genome.wustl.edu	37	16	21261992	21261992	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr16:21261992A>G	ENST00000311620.5	+	2	1178	c.1105A>G	c.(1105-1107)Att>Gtt	p.I369V		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	369	SAM.				response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		GAGAGAGCAGATTGATCTAGA	0.507																																																	0								ENSG00000175311						88.0	92.0	91.0					16																	21261992		1999	4179	6178	ANKS4B	SO:0001583	missense	0			-	HGNC	AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.1105A>G	16.37:g.21261992A>G	ENSP00000308772:p.Ile369Val	Somatic	0	26	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.I369V	ENST00000311620.5	37	c.1105	CCDS42130.1	16	.	.	.	.	.	.	.	.	.	.	A	8.078	0.771842	0.16051	.	.	ENSG00000175311	ENST00000311620	T	0.54479	0.57	5.81	5.81	0.92471	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.124395	0.56097	D	0.000036	T	0.48840	0.1522	L	0.41027	1.25	0.80722	D	1	B	0.26577	0.153	B	0.30943	0.122	T	0.49390	-0.8945	10	0.72032	D	0.01	-16.0392	15.3293	0.74193	1.0:0.0:0.0:0.0	.	369	Q8N8V4	ANS4B_HUMAN	V	369	ENSP00000308772:I369V	ENSP00000308772:I369V	I	+	1	0	ANKS4B	21169493	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	2.809000	0.47971	2.224000	0.72417	0.528000	0.53228	ATT	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM		0.507	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS4B	protein_coding	OTTHUMT00000436535.1	A	NM_145865	-		21261992	+1	no_errors	ENST00000311620	ensembl	human	known	74_37	missense	SNP	1.000	G
FXR2	9513	genome.wustl.edu	37	17	7496167	7496167	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr17:7496167G>A	ENST00000250113.7	-	14	1908	c.1574C>T	c.(1573-1575)tCt>tTt	p.S525F	FXR2_ENST00000573057.1_5'Flank|SOX15_ENST00000250055.2_5'Flank|SOX15_ENST00000570788.1_5'Flank|SOX15_ENST00000538513.2_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	525						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		CTCTGGTTCAGACGTGTCCAA	0.602																																																	0								ENSG00000129245						37.0	37.0	37.0					17																	7496167		1866	4118	5984	FXR2	SO:0001583	missense	0			-	HGNC	U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1574C>T	17.37:g.7496167G>A	ENSP00000250113:p.Ser525Phe	Somatic	0	22	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	10	76.19	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,smart_KH_dom,pfscan_KH_dom_type_1	p.S525F	ENST00000250113.7	37	c.1574	CCDS45604.1	17	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803734	0.70682	.	.	ENSG00000129245	ENST00000250113	T	0.33438	1.41	5.57	5.57	0.84162	.	0.199418	0.44688	D	0.000437	T	0.36799	0.0980	N	0.19112	0.55	0.43364	D	0.995443	D	0.56746	0.977	P	0.56343	0.796	T	0.17137	-1.0379	10	0.72032	D	0.01	-0.0218	17.3985	0.87453	0.0:0.0:1.0:0.0	.	525	P51116	FXR2_HUMAN	F	525	ENSP00000250113:S525F	ENSP00000250113:S525F	S	-	2	0	FXR2	7436892	0.998000	0.40836	0.991000	0.47740	0.993000	0.82548	4.173000	0.58249	2.785000	0.95823	0.655000	0.94253	TCT	-	pfam_Frag_X_MRP_fam		0.602	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR2	protein_coding	OTTHUMT00000441084.1	G		-		7496167	-1	no_errors	ENST00000250113	ensembl	human	known	74_37	missense	SNP	0.997	A
PARL	55486	genome.wustl.edu	37	3	183551567	183551567	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr3:183551567G>A	ENST00000317096.4	-	8	935	c.875C>T	c.(874-876)cCa>cTa	p.P292L	PARL_ENST00000435888.1_Intron|PARL_ENST00000311101.5_Missense_Mutation_p.P242L	NM_018622.5	NP_061092.3	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like	292					membrane protein proteolysis (GO:0033619)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|proteolysis (GO:0006508)|regulation of protein targeting to mitochondrion (GO:1903214)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)	p.P292Q(1)		endometrium(2)|large_intestine(3)|liver(1)|lung(6)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	17	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CCTCCCTTCTGGGATCTTAGT	0.468																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000175193						93.0	87.0	89.0					3																	183551567		2203	4300	6503	PARL	SO:0001583	missense	0			-	HGNC	AF116692	CCDS3248.1, CCDS33897.1	3q27.3	2008-02-05		2006-02-28	ENSG00000175193	ENSG00000175193			18253	protein-coding gene	gene with protein product	"""rhomboid 7 homolog 1 (Drosophila)"""	607858		PSARL			Standard	XM_005247587		Approved	PRO2207, PSARL1, RHBDS1	uc003fmd.3	Q9H300	OTTHUMG00000156890	ENST00000317096.4:c.875C>T	3.37:g.183551567G>A	ENSP00000325421:p.Pro292Leu	Somatic	0	30	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	Q96CQ4|Q9BTJ6|Q9P1E3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S54_rhomboid_dom	p.P292L	ENST00000317096.4	37	c.875	CCDS3248.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.296686	0.95574	.	.	ENSG00000175193	ENST00000317096;ENST00000311101	T;T	0.12984	2.63;2.63	5.54	5.54	0.83059	Peptidase S54, rhomboid domain (1);	0.000000	0.85682	D	0.000000	T	0.55401	0.1918	H	0.96576	3.845	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.998	T	0.70985	-0.4723	10	0.87932	D	0	-12.9779	19.8379	0.96666	0.0:0.0:1.0:0.0	.	242;292	Q9H300-2;Q9H300	.;PARL_HUMAN	L	292;242	ENSP00000325421:P292L;ENSP00000310676:P242L	ENSP00000310676:P242L	P	-	2	0	PARL	185034261	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.765000	0.95021	0.655000	0.94253	CCA	-	pfam_Peptidase_S54_rhomboid_dom		0.468	PARL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARL	protein_coding	OTTHUMT00000346465.1	G	NM_018622	-		183551567	-1	no_errors	ENST00000317096	ensembl	human	known	74_37	missense	SNP	1.000	A
ABCB10	23456	genome.wustl.edu	37	1	229667402	229667402	+	Silent	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:229667402C>T	ENST00000344517.4	-	7	1458	c.1416G>A	c.(1414-1416)gaG>gaA	p.E472E		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	472					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				GCAGCTTGGGCTCTCTCTCCA	0.517																																																	0								ENSG00000135776						92.0	99.0	97.0					1																	229667402		2203	4300	6503	ABCB10	SO:0001819	synonymous_variant	0			-	HGNC	U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1416G>A	1.37:g.229667402C>T		Somatic	0	55	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	35	39.66	Q13040|Q6P1Q8|Q9H3V0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.E472	ENST00000344517.4	37	c.1416	CCDS1580.1	1																																																																																			-	superfamily_ABC1_TM_dom		0.517	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB10	protein_coding	OTTHUMT00000095240.1	C	NM_012089	-		229667402	-1	no_errors	ENST00000344517	ensembl	human	known	74_37	silent	SNP	0.996	T
TRPV6	55503	genome.wustl.edu	37	7	142571440	142571440	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr7:142571440G>T	ENST00000359396.3	-	13	1794	c.1549C>A	c.(1549-1551)Ccc>Acc	p.P517T	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	517					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					AGCTCCTCGGGGTCCTCTGTC	0.587																																																	0								ENSG00000165125						189.0	174.0	179.0					7																	142571440		2203	4300	6503	TRPV6	SO:0001583	missense	0			-	HGNC	AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1549C>A	7.37:g.142571440G>T	ENSP00000352358:p.Pro517Thr	Somatic	0	26	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	15	48.28	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6,prints_TRPV6_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.P517T	ENST00000359396.3	37	c.1549	CCDS5874.1	7	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622553	0.46840	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	D	0.88818	-2.43	5.43	4.55	0.56014	Ion transport (1);	0.185881	0.47852	D	0.000203	D	0.90998	0.7169	M	0.76002	2.32	0.58432	D	0.999998	B	0.34349	0.45	P	0.45712	0.491	D	0.89031	0.3442	10	0.33940	T	0.23	-26.1853	13.4611	0.61227	0.0757:0.0:0.9243:0.0	.	517	Q9H1D0	TRPV6_HUMAN	T	517;349	ENSP00000352358:P517T	ENSP00000310825:P349T	P	-	1	0	TRPV6	142281562	1.000000	0.71417	0.990000	0.47175	0.347000	0.29111	5.406000	0.66357	1.273000	0.44346	0.655000	0.94253	CCC	-	pfam_Ion_trans_dom,tigrfam_TRP_channel		0.587	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV6	protein_coding	OTTHUMT00000347662.1	G	NM_014274	-		142571440	-1	no_errors	ENST00000359396	ensembl	human	known	74_37	missense	SNP	1.000	T
MYO1E	4643	genome.wustl.edu	37	15	59470648	59470648	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr15:59470648C>A	ENST00000288235.4	-	19	2392	c.1993G>T	c.(1993-1995)Gac>Tac	p.D665Y		NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE	665	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		TGGTCGCTGTCCATGTTGACC	0.597																																																	0								ENSG00000157483						110.0	88.0	95.0					15																	59470648		2191	4291	6482	MYO1E	SO:0001583	missense	0			-	HGNC	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.1993G>T	15.37:g.59470648C>A	ENSP00000288235:p.Asp665Tyr	Somatic	0	53	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	44	29.03	Q14778	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.D665Y	ENST00000288235.4	37	c.1993	CCDS32254.1	15	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795063	0.90453	.	.	ENSG00000157483	ENST00000288235	D	0.90444	-2.67	4.92	4.92	0.64577	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.97012	0.9024	H	0.97659	4.05	0.80722	D	1	D	0.61080	0.989	D	0.64595	0.927	D	0.98335	1.0535	10	0.72032	D	0.01	.	18.3153	0.90218	0.0:1.0:0.0:0.0	.	665	Q12965	MYO1E_HUMAN	Y	665	ENSP00000288235:D665Y	ENSP00000288235:D665Y	D	-	1	0	MYO1E	57257940	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	7.651000	0.83577	2.563000	0.86464	0.655000	0.94253	GAC	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.597	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1E	protein_coding	OTTHUMT00000416024.1	C	NM_004998	-		59470648	-1	no_errors	ENST00000288235	ensembl	human	known	74_37	missense	SNP	1.000	A
TBC1D10B	26000	genome.wustl.edu	37	16	30381257	30381268	+	In_Frame_Del	DEL	GCCGGGGCTGGG	GCCGGGGCTGGG	-	rs570394259	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	GCCGGGGCTGGG	GCCGGGGCTGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr16:30381257_30381268delGCCGGGGCTGGG	ENST00000409939.3	-	1	317_328	c.237_248delCCCAGCCCCGGC	c.(235-249)gccccagccccggct>gct	p.79_83APAPA>A		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	79	Pro-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			GCCCGTGACAgccggggctggggccggggctg	0.792														46	0.0091853	0.0098	0.0086	5008	,	,		8323	0.001		0.0239	False		,,,				2504	0.002																0								ENSG00000169221			3,471		1,1,235						-6.7	0.0			1	39,1033		17,5,514	no	coding	TBC1D10B	NM_015527.3		18,6,749	A1A1,A1R,RR		3.6381,0.6329,2.7167				42,1504				TBC1D10B	SO:0001651	inframe_deletion	0				HGNC	BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.237_248delCCCAGCCCCGGC	16.37:g.30381257_30381268delGCCGGGGCTGGG	ENSP00000386538:p.Ala79_Pro82del	Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.PAPA80in_frame_del	ENST00000409939.3	37	c.248_237	CCDS10676.2	16																																																																																			-	NULL		0.792	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10B	protein_coding	OTTHUMT00000255527.3	GCCGGGGCTGGG	NM_015527			30381268	-1	no_errors	ENST00000409939	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001	-
CASZ1	54897	genome.wustl.edu	37	1	10720564	10720564	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:10720564C>T	ENST00000377022.3	-	6	852	c.535G>A	c.(535-537)Gcc>Acc	p.A179T	CASZ1_ENST00000344008.5_Missense_Mutation_p.A179T|CASZ1_ENST00000478728.2_5'Flank	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	179					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		ATGGTGGAGGCCGCGTAGTCC	0.652																																																	0								ENSG00000130940						28.0	29.0	29.0					1																	10720564		2203	4300	6503	CASZ1	SO:0001583	missense	0			-	HGNC	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.535G>A	1.37:g.10720564C>T	ENSP00000366221:p.Ala179Thr	Somatic	0	28	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A179T	ENST00000377022.3	37	c.535	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901294	0.92035	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	4.22	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.66317	0.2777	L	0.34521	1.04	0.52501	D	0.999958	D;D;D;D	0.76494	0.995;0.999;0.998;0.998	D;D;D;D	0.81914	0.91;0.98;0.957;0.995	T	0.67452	-0.5667	9	0.41790	T	0.15	-22.5061	16.9775	0.86317	0.0:1.0:0.0:0.0	.	203;179;179;179	B7Z1S3;B3KRV8;Q86V15-2;Q86V15	.;.;.;CASZ1_HUMAN	T	179	.	ENSP00000339445:A179T	A	-	1	0	CASZ1	10643151	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	5.682000	0.68182	2.081000	0.62600	0.491000	0.48974	GCC	-	NULL		0.652	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	protein_coding	OTTHUMT00000005673.2	C	NM_017766	-		10720564	-1	no_errors	ENST00000377022	ensembl	human	known	74_37	missense	SNP	1.000	T
LIME1	54923	genome.wustl.edu	37	20	62369426	62369427	+	Intron	INS	-	-	GGGGCG	rs150938918|rs200548769|rs3032680|rs546677524	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr20:62369426_62369427insGGGGCG	ENST00000309546.3	+	4	355				RP4-583P15.14_ENST00000467211.1_5'Flank|LIME1_ENST00000490824.1_3'UTR|SLC2A4RG_ENST00000266077.2_5'Flank|RP4-583P15.15_ENST00000490623.2_Intron	NM_017806.2	NP_060276.2	Q9H400	LIME1_HUMAN	Lck interacting transmembrane adaptor 1						B cell receptor signaling pathway (GO:0050853)|T cell receptor signaling pathway (GO:0050852)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(1)|liver(1)	3	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GAGCAGAgggcggggcgggggc	0.733														3496	0.698083	0.9629	0.6844	5008	,	,		5114	0.3373		0.7008	False		,,,				2504	0.7188																0								ENSG00000203896																																			LIME1	SO:0001627	intron_variant	0				HGNC	AK000413	CCDS13536.1	20q13.33	2010-05-11			ENSG00000203896	ENSG00000203896			26016	protein-coding gene	gene with protein product		609809				12477932	Standard	NM_017806		Approved	FLJ20406, dJ583P15.4, LIME	uc002ygp.4	Q9H400	OTTHUMG00000032999	ENST00000309546.3:c.268+13->GGGGCG	20.37:g.62369427_62369432dupGGGGCG		Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E1P5K5|E1P5K6|Q5JWJ2|Q6XYB3|Q9NX69	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000309546.3	37	NULL	CCDS13536.1	20																																																																																			-	-		0.733	LIME1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	LIME1	protein_coding	OTTHUMT00000080225.1	-	NM_017806			62369427	+1	no_errors	ENST00000465591	ensembl	human	known	74_37	rna	INS	0.000:0.000	GGGGCG
HSF4	3299	genome.wustl.edu	37	16	67202771	67202771	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr16:67202771G>T	ENST00000521374.1	+	10	1120	c.1120G>T	c.(1120-1122)Gag>Tag	p.E374*	HSF4_ENST00000264009.8_Nonsense_Mutation_p.E374*|HSF4_ENST00000584272.1_Nonsense_Mutation_p.E344*|NOL3_ENST00000432069.2_5'Flank|HSF4_ENST00000421453.1_Nonsense_Mutation_p.E344*|NOL3_ENST00000564053.1_5'Flank			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	374	Hydrophobic repeat HR-C.				camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		CAGGAGCCCAGAGAGTCTGCT	0.597																																																	0								ENSG00000102878						61.0	69.0	66.0					16																	67202771		1973	4149	6122	HSF4	SO:0001587	stop_gained	0			-	HGNC	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.1120G>T	16.37:g.67202771G>T	ENSP00000430947:p.Glu374*	Somatic	0	48	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q99472|Q9ULV6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HSF_DNA-bd,smart_HSF_DNA-bd,prints_HSF_DNA-bd	p.E374*	ENST00000521374.1	37	c.1120	CCDS42175.1	16	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	40|40|40	8.491823|8.491823|8.491823	0.98834|0.98834|0.98834	.|.|.	.|.|.	ENSG00000102878|ENSG00000102878|ENSG00000102878	ENST00000421453;ENST00000264009;ENST00000517685;ENST00000521374|ENST00000520304|ENST00000517750;ENST00000519601	.|.|.	.|.|.	.|.|.	4.17|4.17|4.17	3.22|3.22|3.22	0.36961|0.36961|0.36961	.|.|.	0.582849|.|.	0.16624|.|.	N|.|.	0.206341|.|.	.|T|T	.|0.52041|0.52041	.|0.1710|0.1710	.|.|.	.|.|.	.|.|.	0.80722|0.80722|0.80722	A|A|A	1|1|1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|T|T	.|0.61397|0.61397	.|-0.7071|-0.7071	.|3|3	0.45353|.|.	T|.|.	0.12|.|.	-8.2143|-8.2143|-8.2143	10.2008|10.2008|10.2008	0.43082|0.43082|0.43082	0.0:0.2023:0.7977:0.0|0.0:0.2023:0.7977:0.0|0.0:0.2023:0.7977:0.0	.|.|.	.|.|.	.|.|.	.|.|.	X|H|I	344;374;298;374|49|158;105	.|.|.	ENSP00000264009:E374X|.|.	E|Q|R	+|+|+	1|3|2	0|2|0	HSF4|HSF4|HSF4	65760272|65760272|65760272	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.090000|0.090000|0.090000	0.18270|0.18270|0.18270	3.173000|3.173000|3.173000	0.50839|0.50839|0.50839	1.106000|1.106000|1.106000	0.41623|0.41623|0.41623	-0.225000|-0.225000|-0.225000	0.12378|0.12378|0.12378	GAG|CAG|AGA	-	NULL		0.597	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF4	protein_coding	OTTHUMT00000375080.1	G	NM_001538	-		67202771	+1	no_errors	ENST00000264009	ensembl	human	known	74_37	nonsense	SNP	0.998	T
LY75	4065	genome.wustl.edu	37	2	160698813	160698813	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr2:160698813A>G	ENST00000263636.4	-	24	3250	c.3223T>C	c.(3223-3225)Tgg>Cgg	p.W1075R	LY75_ENST00000554112.1_Missense_Mutation_p.W1075R|LY75_ENST00000553424.1_Missense_Mutation_p.W1075R|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.W1075R|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.W1075R	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1075	C-type lectin 6. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		GTAAAATTCCACGTCCCAGTA	0.378																																																	0								ENSG00000054219						101.0	101.0	101.0					2																	160698813		2203	4300	6503	LY75	SO:0001583	missense	0			-	HGNC	AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.3223T>C	2.37:g.160698813A>G	ENSP00000263636:p.Trp1075Arg	Somatic	0	66	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.W1075R	ENST00000263636.4	37	c.3223	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	A	19.37	3.813718	0.70912	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14	5.37	5.37	0.77165	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.31268	U	0.007959	D	0.84374	0.5458	H	0.95043	3.615	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.973;1.0;0.999	D	0.88675	0.3198	10	0.87932	D	0	-1.349	12.8894	0.58064	1.0:0.0:0.0:0.0	.	1075;1075;1075	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	R	1075	ENSP00000451511:W1075R;ENSP00000451446:W1075R;ENSP00000263636:W1075R;ENSP00000423463:W1075R;ENSP00000421035:W1075R	ENSP00000423463:W1075R	W	-	1	0	LY75;LY75-CD302	160407059	1.000000	0.71417	0.943000	0.38184	0.992000	0.81027	5.590000	0.67530	2.039000	0.60335	0.528000	0.53228	TGG	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.378	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	protein_coding	OTTHUMT00000255035.1	A		-		160698813	-1	no_errors	ENST00000554112	ensembl	human	known	74_37	missense	SNP	0.987	G
MIB1	57534	genome.wustl.edu	37	18	19292022	19292022	+	Intron	SNP	A	A	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr18:19292022A>C	ENST00000578646.1	+	1	167				SNORA81_ENST00000516868.1_RNA			Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1						blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			GCATTATCACAAAAACCAAGA	0.398																																																	0								ENSG00000252677																																			SNORA81	SO:0001627	intron_variant	0			-	RFAM	AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000578646.1:c.167+6938A>C	18.37:g.19292022A>C		Somatic	0	32	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	16	36.00	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000578646.1	37	NULL		18																																																																																			-	-		0.398	MIB1-004	KNOWN	basic	processed_transcript	ENSG00000252677	protein_coding	OTTHUMT00000445642.1	A	NM_020774	-		19292022	-1	no_errors	ENST00000516868	ensembl	human	novel	74_37	rna	SNP	0.991	C
PYGM	5837	genome.wustl.edu	37	11	64518806	64518806	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:64518806C>T	ENST00000164139.3	-	16	2358	c.1960G>A	c.(1960-1962)Gcc>Acc	p.A654T	PYGM_ENST00000377432.3_Missense_Mutation_p.A566T|PYGM_ENST00000462303.1_5'UTR	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	654					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTTTCTCGGCCAGTGAGACT	0.567																																																	0								ENSG00000068976						76.0	72.0	73.0					11																	64518806		2201	4297	6498	PYGM	SO:0001583	missense	0			-	HGNC		CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1960G>A	11.37:g.64518806C>T	ENSP00000164139:p.Ala654Thr	Somatic	0	23	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	12	45.45	A0AVK1|A6NDY6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.A654T	ENST00000164139.3	37	c.1960	CCDS8079.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.462864	0.96257	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.96334	-3.82;-3.98	5.16	5.16	0.70880	.	0.000000	0.64402	D	0.000019	D	0.98532	0.9510	M	0.93507	3.425	0.80722	D	1	P;D	0.71674	0.87;0.998	P;D	0.74023	0.885;0.982	D	0.99364	1.0918	10	0.87932	D	0	-15.6311	16.1723	0.81825	0.0:1.0:0.0:0.0	.	566;654	A6NDY6;P11217	.;PYGM_HUMAN	T	566;654;635	ENSP00000366650:A566T;ENSP00000164139:A654T	ENSP00000164139:A654T	A	-	1	0	PYGM	64275382	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.545000	0.82128	2.692000	0.91855	0.561000	0.74099	GCC	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas		0.567	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGM	protein_coding	OTTHUMT00000143254.2	C	NM_005609	-		64518806	-1	no_errors	ENST00000164139	ensembl	human	known	74_37	missense	SNP	1.000	T
MLC1	23209	genome.wustl.edu	37	22	50502469	50502470	+	In_Frame_Ins	INS	-	-	GCACCCCCACCCCACAGGCCACTCACCTCCCCG	rs11568189|rs11568190	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr22:50502469_50502470insGCACCCCCACCCCACAGGCCACTCACCTCCCCG	ENST00000311597.5	-	11	1658_1659	c.1052_1053insCGGGGAGGTGAGTGGCCTGTGGGGTGGGGGTGC	c.(1051-1053)gct>gcCGGGGAGGTGAGTGGCCTGTGGGGTGGGGGTGCt	p.351_351A>AGEVSGLWGGGA	MLC1_ENST00000538737.1_In_Frame_Ins_p.317_317A>AGEVSGLWGGGA|MLC1_ENST00000431262.2_In_Frame_Ins_p.321_321A>AGEVSGLWGGGA|MLC1_ENST00000535444.1_In_Frame_Ins_p.272_272A>AGEVSGLWGGGA|MLC1_ENST00000483836.1_5'UTR|MLC1_ENST00000395876.2_In_Frame_Ins_p.351_351A>AGEVSGLWGGGA|MLC1_ENST00000450140.2_In_Frame_Ins_p.299_299A>AGEVSGLWGGGA	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	351					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		TCACCTCCCCAGCCAGGCGCTC	0.698																																																	0								ENSG00000100427																																			MLC1	SO:0001652	inframe_insertion	0				HGNC	D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.1052_1053insCGGGGAGGTGAGTGGCCTGTGGGGTGGGGGTGC	22.37:g.50502469_50502470insGCACCCCCACCCCACAGGCCACTCACCTCCCCG	Exception_encountered	Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.355in_frame_insSGLWGGGAGEV	ENST00000311597.5	37	c.1053_1052	CCDS14083.1	22																																																																																			-	NULL		0.698	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLC1	protein_coding	OTTHUMT00000316979.2	-	NM_015166			50502470	-1	no_errors	ENST00000311597	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.000	GCACCCCCACCCCACAGGCCACTCACCTCCCCG
TXNDC16	57544	genome.wustl.edu	37	14	52957587	52957587	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr14:52957587delA	ENST00000281741.4	-	10	1264	c.893delT	c.(892-894)ctgfs	p.L298fs	TXNDC16_ENST00000554399.1_Intron	NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	298					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					TGCTTTTCCCAGAAGACGCCA	0.383																																																	0								ENSG00000087301						110.0	111.0	111.0					14																	52957587		2203	4300	6503	TXNDC16	SO:0001589	frameshift_variant	0				HGNC	AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.893delT	14.37:g.52957587delA	ENSP00000281741:p.Leu298fs	Somatic	0	49	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.L298fs	ENST00000281741.4	37	c.893	CCDS32083.1	14																																																																																			-	NULL		0.383	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNDC16	protein_coding	OTTHUMT00000411681.1	A	XM_051699			52957587	-1	no_errors	ENST00000281741	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
NRP2	8828	genome.wustl.edu	37	2	206588537	206588537	+	Silent	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr2:206588537G>T	ENST00000357785.5	+	5	724	c.693G>T	c.(691-693)ggG>ggT	p.G231G	NRP2_ENST00000357118.4_Silent_p.G231G|NRP2_ENST00000355117.4_Silent_p.G231G|NRP2_ENST00000360409.3_Silent_p.G231G|NRP2_ENST00000540841.1_Silent_p.G231G|NRP2_ENST00000412873.2_Silent_p.G231G|NRP2_ENST00000417189.1_Silent_p.G231G|NRP2_ENST00000272849.3_Silent_p.G231G|NRP2_ENST00000540178.1_Silent_p.G231G			Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						AGTACTGTGGGACCAAAACAC	0.502																																																	0								ENSG00000118257						108.0	94.0	99.0					2																	206588537		2203	4300	6503	NRP2	SO:0001819	synonymous_variant	0			-	HGNC	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.693G>T	2.37:g.206588537G>T		Somatic	0	60	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	25	30.56	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Neuropilin,pfam_CUB_dom,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.G231	ENST00000357785.5	37	c.693	CCDS46496.1	2																																																																																			-	pirsf_Neuropilin,pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.502	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	protein_coding	OTTHUMT00000336467.1	G		-		206588537	+1	no_errors	ENST00000360409	ensembl	human	known	74_37	silent	SNP	0.962	T
KIAA1217	56243	genome.wustl.edu	37	10	24813596	24813596	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr10:24813596A>G	ENST00000376454.3	+	13	2831	c.2801A>G	c.(2800-2802)cAg>cGg	p.Q934R	KIAA1217_ENST00000458595.1_Missense_Mutation_p.Q899R|KIAA1217_ENST00000376451.2_Missense_Mutation_p.Q617R|KIAA1217_ENST00000396445.1_Missense_Mutation_p.Q617R|KIAA1217_ENST00000307544.6_Missense_Mutation_p.Q617R|KIAA1217_ENST00000396446.1_Missense_Mutation_p.Q617R|KIAA1217_ENST00000376452.3_Missense_Mutation_p.Q899R|KIAA1217_ENST00000376462.1_Missense_Mutation_p.Q854R|KIAA1217_ENST00000430453.2_Intron	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	934					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						CAGGCTCCGCAGTCCCCACAG	0.577																																																	0								ENSG00000120549						52.0	49.0	50.0					10																	24813596		2203	4300	6503	KIAA1217	SO:0001583	missense	0			-	HGNC	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.2801A>G	10.37:g.24813596A>G	ENSP00000365637:p.Gln934Arg	Somatic	0	34	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AIP3_C	p.Q934R	ENST00000376454.3	37	c.2801	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	A	9.180	1.023465	0.19433	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000442879;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000307544;ENST00000450158;ENST00000396445;ENST00000376451;ENST00000396446	T;T;T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.0	0.943	0.19531	.	0.460479	0.22979	N	0.053326	T	0.42063	0.1186	L	0.56769	1.78	0.35255	D	0.779078	P;B;B;B;P;B;P;P	0.47962	0.478;0.323;0.418;0.001;0.673;0.33;0.903;0.467	B;B;B;B;B;B;P;B	0.45610	0.225;0.05;0.173;0.004;0.178;0.165;0.487;0.201	T	0.50056	-0.8872	10	0.18276	T	0.48	.	8.3541	0.32321	0.3298:0.5438:0.0:0.1264	.	899;899;617;617;617;617;934;934	Q5T5P2-7;A6NLF3;Q5T5P2-4;Q5T5P2-8;Q5T5P2-3;Q5T5P2-6;Q5T5P2;Q5T5P2-2	.;.;.;.;.;.;SKT_HUMAN;.	R	854;899;899;617;934;899;749;617;617;617;617;617	ENSP00000365645:Q854R;ENSP00000365639:Q899R;ENSP00000392625:Q899R;ENSP00000365637:Q934R;ENSP00000365635:Q899R;ENSP00000404798:Q749R;ENSP00000302343:Q617R;ENSP00000379722:Q617R;ENSP00000365634:Q617R;ENSP00000379723:Q617R	ENSP00000302343:Q617R	Q	+	2	0	KIAA1217	24853602	0.288000	0.24324	0.930000	0.37139	0.262000	0.26303	0.277000	0.18734	0.216000	0.20781	0.459000	0.35465	CAG	-	NULL		0.577	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	protein_coding	OTTHUMT00000047223.2	A	NM_019590	-		24813596	+1	no_errors	ENST00000376454	ensembl	human	known	74_37	missense	SNP	0.976	G
IL2RG	3561	genome.wustl.edu	37	X	70328508	70328508	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:70328508G>C	ENST00000374202.2	-	6	886	c.795C>G	c.(793-795)atC>atG	p.I265M	CXorf65_ENST00000374251.5_5'Flank|IL2RG_ENST00000456850.2_Missense_Mutation_p.I75M|IL2RG_ENST00000374188.3_Intron	NM_000206.2	NP_000197.1	P31785	IL2RG_HUMAN	interleukin 2 receptor, gamma	265					immune response (GO:0006955)|interleukin-2-mediated signaling pathway (GO:0038110)|interleukin-4-mediated signaling pathway (GO:0035771)|interleukin-7-mediated signaling pathway (GO:0038111)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|interleukin-2 binding (GO:0019976)			breast(1)|endometrium(3)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	15	Renal(35;0.156)				Aldesleukin(DB00041)|Denileukin diftitox(DB00004)	AGCCAACAGAGATAACCACGG	0.448									Severe Combined Immunodeficiency, X-linked																																								0								ENSG00000147168						52.0	42.0	46.0					X																	70328508		2201	4292	6493	IL2RG	SO:0001583	missense	0	Familial Cancer Database	Agammaglobulinemia, Swiss Type	-	HGNC	D11086	CCDS14406.1	Xq13	2014-09-17	2010-06-24		ENSG00000147168	ENSG00000147168		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6010	protein-coding gene	gene with protein product		308380	"""severe combined immunodeficiency"", ""combined immunodeficiency, X-linked"""	SCIDX1, IMD4, CIDX		1631559, 7883965	Standard	NM_000206		Approved	CD132	uc004dyw.2	P31785	OTTHUMG00000021787	ENST00000374202.2:c.795C>G	X.37:g.70328508G>C	ENSP00000363318:p.Ile265Met	Somatic	0	20	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	17	34.62	Q5FC12	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IL-6_rcpt_alpha-bd,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.I265M	ENST00000374202.2	37	c.795	CCDS14406.1	X	.	.	.	.	.	.	.	.	.	.	G	13.46	2.242340	0.39598	.	.	ENSG00000147168	ENST00000374202;ENST00000456850	D;D	0.98075	-4.05;-4.7	4.87	3.01	0.34805	.	0.359502	0.29572	N	0.011771	D	0.97365	0.9138	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.99;0.999	P;D	0.63488	0.901;0.915	D	0.95762	0.8801	10	0.46703	T	0.11	-5.1941	4.3208	0.11016	0.1178:0.0:0.6555:0.2267	.	75;265	Q5FC12;P31785	.;IL2RG_HUMAN	M	265;75	ENSP00000363318:I265M;ENSP00000388967:I75M	ENSP00000363318:I265M	I	-	3	3	IL2RG	70245233	0.420000	0.25457	0.987000	0.45799	0.342000	0.28953	-0.147000	0.10234	2.240000	0.73641	0.600000	0.82982	ATC	-	NULL		0.448	IL2RG-004	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RG	protein_coding	OTTHUMT00000057102.2	G		-		70328508	-1	no_errors	ENST00000374202	ensembl	human	known	74_37	missense	SNP	0.918	C
P2RX2	22953	genome.wustl.edu	37	12	133197922	133197922	+	Silent	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr12:133197922G>A	ENST00000389110.3	+	9	1024	c.987G>A	c.(985-987)gtG>gtA	p.V329V	P2RX2_ENST00000351222.4_Silent_p.V237V|P2RX2_ENST00000449132.2_Silent_p.V295V|P2RX2_ENST00000348800.5_Silent_p.V329V|P2RX2_ENST00000350048.5_Silent_p.V305V|P2RX2_ENST00000343948.4_Silent_p.V329V|P2RX2_ENST00000352418.4_Silent_p.V257V	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	329	Pore-forming motif. {ECO:0000255}.				behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		ACGTCATTGTGCATGGACAGG	0.607																																																	0								ENSG00000187848						121.0	111.0	114.0					12																	133197922		2203	4300	6503	P2RX2	SO:0001819	synonymous_variant	0			-	HGNC	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.987G>A	12.37:g.133197922G>A		Somatic	0	30	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_P2X_purnocptor,prints_P2X2_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.V329	ENST00000389110.3	37	c.987	CCDS31931.1	12																																																																																			-	pfam_P2X_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor		0.607	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P2RX2	protein_coding	OTTHUMT00000397542.1	G		-		133197922	+1	no_errors	ENST00000343948	ensembl	human	known	74_37	silent	SNP	1.000	A
PAPOLB	56903	genome.wustl.edu	37	7	4901098	4901098	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr7:4901098A>G	ENST00000404991.1	-	1	527	c.341T>C	c.(340-342)aTt>aCt	p.I114T	RADIL_ENST00000536091.1_Intron|RADIL_ENST00000399583.3_Intron	NM_020144.4	NP_064529.4	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	114					mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			kidney(1)|large_intestine(6)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		CAAGGCGTCAATATCTGCGCC	0.423																																																	0								ENSG00000218823						85.0	85.0	85.0					7																	4901098		2091	4258	6349	PAPOLB	SO:0001583	missense	0			-	HGNC	AF218840		7p22.1	2008-02-08			ENSG00000218823	ENSG00000218823	2.7.7.19		15970	protein-coding gene	gene with protein product		607436				11150526	Standard	NM_020144		Approved	PAPT	uc003snk.3	Q9NRJ5	OTTHUMG00000151759	ENST00000404991.1:c.341T>C	7.37:g.4901098A>G	ENSP00000384700:p.Ile114Thr	Somatic	0	35	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	10	33.33	Q75LH1|Q8NE14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PolA_pol_cen_dom,pfam_PolA_pol_RNA-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.I114T	ENST00000404991.1	37	c.341		7	.	.	.	.	.	.	.	.	.	.	A	12.21	1.870839	0.33069	.	.	ENSG00000218823	ENST00000404991	.	.	.	3.98	3.98	0.46160	.	.	.	.	.	D	0.85353	0.5677	H	0.97635	4.045	0.80722	D	1	D	0.59357	0.985	P	0.61132	0.884	D	0.89466	0.3740	8	0.87932	D	0	.	11.4944	0.50400	1.0:0.0:0.0:0.0	.	115	A4D1Z6	.	T	114	.	ENSP00000384700:I114T	I	-	2	0	PAPOLB	4867624	1.000000	0.71417	0.883000	0.34634	0.091000	0.18340	8.925000	0.92832	2.044000	0.60594	0.477000	0.44152	ATT	-	pfam_PolA_pol_cen_dom,pfam_Nucleotidyltransferase,pirsf_PolyA_polymerase		0.423	PAPOLB-001	KNOWN	basic|appris_principal	protein_coding	PAPOLB	protein_coding	OTTHUMT00000323797.1	A	NM_020144	-		4901098	-1	no_errors	ENST00000404991	ensembl	human	known	74_37	missense	SNP	1.000	G
MOK	5891	genome.wustl.edu	37	14	102698898	102698898	+	Silent	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr14:102698898C>T	ENST00000361847.2	-	9	1071	c.840G>A	c.(838-840)ctG>ctA	p.L280L	MOK_ENST00000523231.1_Missense_Mutation_p.C13Y|MOK_ENST00000522867.1_Missense_Mutation_p.C13Y|MOK_ENST00000524370.1_Missense_Mutation_p.C13Y|MOK_ENST00000524214.1_Silent_p.L250L|MOK_ENST00000193029.6_Silent_p.L46L|MOK_ENST00000522874.1_Silent_p.L279L|MOK_ENST00000517966.1_Missense_Mutation_p.C13Y|MOK_ENST00000519058.1_Missense_Mutation_p.C13Y|MOK_ENST00000522534.1_Missense_Mutation_p.C13Y|MOK_ENST00000561150.1_Missense_Mutation_p.C13Y|MOK_ENST00000520266.1_Intron	NM_014226.1	NP_055041.1	Q9UQ07	MOK_HUMAN	MOK protein kinase	280	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)										AGGGGTGCTGCAGGGCCTGGT	0.582																																																	0								ENSG00000080823						128.0	132.0	131.0					14																	102698898		2203	4300	6503	MOK	SO:0001819	synonymous_variant	0			-	HGNC	AB022694	CCDS9971.1, CCDS61552.1	14q32	2014-04-23	2011-09-06	2011-09-06	ENSG00000080823	ENSG00000080823			9833	protein-coding gene	gene with protein product		605762	"""renal tumor antigen"""	RAGE		8781117, 10421840	Standard	NM_014226		Approved	RAGE1, STK30	uc001ylm.4	Q9UQ07	OTTHUMG00000164896	ENST00000361847.2:c.840G>A	14.37:g.102698898C>T		Somatic	0	72	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B2R6Z4|B7Z7P6|E7ER76|E7ERR8|Q92790|Q93067	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C13Y	ENST00000361847.2	37	c.38	CCDS9971.1	14	.	.	.	.	.	.	.	.	.	.	.	11.04	1.523005	0.27211	.	.	ENSG00000080823	ENST00000519058	.	.	.	5.5	2.52	0.30459	.	.	.	.	.	T	0.55970	0.1954	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55108	-0.8192	5	0.87932	D	0	-0.0775	1.8449	0.03157	0.2529:0.4403:0.1173:0.1895	.	.	.	.	Y	13	.	ENSP00000429672:C13Y	C	-	2	0	RAGE	101768651	0.999000	0.42202	1.000000	0.80357	0.947000	0.59692	0.598000	0.24074	0.220000	0.20860	0.462000	0.41574	TGC	-	NULL		0.582	MOK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOK	protein_coding	OTTHUMT00000380848.3	C		-		102698898	-1	no_errors	ENST00000559138	ensembl	human	known	74_37	missense	SNP	1.000	T
DNM1P34	729809	genome.wustl.edu	37	15	75592881	75592908	+	RNA	DEL	CGGGCTTCCCTCTTCTCTGGTCACCCTC	CGGGCTTCCCTCTTCTCTGGTCACCCTC	-	rs34982072|rs560156590	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	CGGGCTTCCCTCTTCTCTGGTCACCCTC	CGGGCTTCCCTCTTCTCTGGTCACCCTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr15:75592881_75592908delCGGGCTTCCCTCTTCTCTGGTCACCCTC	ENST00000567292.1	-	0	1661_1688							Q6PK57	DMP34_HUMAN	DNM1 pseudogene 34							microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										TCAGCCCCCTCGGGCTTCCCTCTTCTCTGGTCACCCTCCCCTTCCAAC	0.658																																																	0								ENSG00000260357																																			DNM1P34			0				HGNC	AJ576251		15q24.2	2013-04-25			ENSG00000260357	ENSG00000260357			35181	pseudogene	pseudogene				DNM1DN8@			Standard	NG_009143		Approved	DNM1DN8-1, DNM1DN8-5	uc002azx.1	Q6PK57	OTTHUMG00000172673		15.37:g.75592881_75592908delCGGGCTTCCCTCTTCTCTGGTCACCCTC		Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567292.1	37	NULL		15																																																																																			-	-		0.658	DNM1P34-001	KNOWN	basic	processed_transcript	DNM1P34	pseudogene	OTTHUMT00000419799.1	CGGGCTTCCCTCTTCTCTGGTCACCCTC	NG_009143			75592908	-1	no_errors	ENST00000567292	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.002:0.003:0.016:0.019:0.542:0.707:0.754:0.765:0.759:0.735:0.645:0.577:0.391:0.379:0.371:0.364:0.334:0.225:0.038:0.019:0.014:0.015:0.015:0.021:0.029:0.030	-
NINL	22981	genome.wustl.edu	37	20	25443278	25443279	+	Intron	INS	-	-	TTTGTTTTGT	rs200513281|rs377227803|rs113237945		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr20:25443278_25443279insTTTGTTTTGT	ENST00000278886.6	-	20	3497				NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						TTAAGTAGTCAtttgttttgtt	0.361																																																	0								ENSG00000101004																																			NINL	SO:0001627	intron_variant	0				HGNC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3424-101->ACAAAACAAA	20.37:g.25443279_25443288dupTTTGTTTTGT		Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000278886.6	37	NULL	CCDS33452.1	20																																																																																			-	-		0.361	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	protein_coding	OTTHUMT00000078445.3	-	NM_025176			25443279	-1	no_errors	ENST00000496509	ensembl	human	known	74_37	rna	INS	0.010:0.013	TTTGTTTTGT
TRMT61B	55006	genome.wustl.edu	37	2	29092575	29092575	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr2:29092575C>T	ENST00000306108.5	-	1	592	c.569G>A	c.(568-570)gGc>gAc	p.G190D		NM_017910.3	NP_060380.3	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B (S. cerevisiae)	190					mitochondrial tRNA methylation (GO:0070901)|protein homooligomerization (GO:0051260)	mitochondrion (GO:0005739)|tRNA (m1A) methyltransferase complex (GO:0031515)	tRNA (adenine-N1-)-methyltransferase activity (GO:0016429)			endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	13						CACGATCTTGCCGAACGGGAC	0.468																																																	0								ENSG00000171103						89.0	96.0	94.0					2																	29092575		2203	4300	6503	TRMT61B	SO:0001583	missense	0			-	HGNC	BC010365	CCDS1768.1	2p23.2	2009-01-09			ENSG00000171103	ENSG00000171103			26070	protein-coding gene	gene with protein product						11230166	Standard	NM_017910		Approved	FLJ20628	uc002rmm.3	Q9BVS5	OTTHUMG00000128433	ENST00000306108.5:c.569G>A	2.37:g.29092575C>T	ENSP00000302801:p.Gly190Asp	Somatic	0	42	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	Q9H0Q9|Q9NWS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_tRNA_MeTrfase_GCD14,pfam_PCMT	p.G190D	ENST00000306108.5	37	c.569	CCDS1768.1	2	.	.	.	.	.	.	.	.	.	.	C	3.017	-0.202650	0.06219	.	.	ENSG00000171103	ENST00000306108	T	0.18960	2.18	5.5	4.51	0.55191	.	0.575576	0.18415	N	0.141946	T	0.03695	0.0105	N	0.00223	-1.815	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.37865	-0.9687	10	0.02654	T	1	.	7.7347	0.28806	0.1627:0.7295:0.0:0.1078	.	190;190	F8WDR2;Q9BVS5	.;TR61B_HUMAN	D	190	ENSP00000302801:G190D	ENSP00000302801:G190D	G	-	2	0	TRMT61B	28946079	0.093000	0.21703	0.881000	0.34555	0.880000	0.50808	0.170000	0.16663	2.590000	0.87494	0.561000	0.74099	GGC	-	pfam_tRNA_MeTrfase_GCD14		0.468	TRMT61B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT61B	protein_coding	OTTHUMT00000250224.1	C	NM_017910	-		29092575	-1	no_errors	ENST00000306108	ensembl	human	known	74_37	missense	SNP	0.506	T
ATRX	546	genome.wustl.edu	37	X	76939577	76939577	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:76939577G>A	ENST00000373344.5	-	9	1385	c.1171C>T	c.(1171-1173)Cag>Tag	p.Q391*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.Q353*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	391					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GCCTTAAGCTGACGTAATTTT	0.373			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						198.0	205.0	203.0					X																	76939577		2203	4296	6499	ATRX	SO:0001587	stop_gained	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.1171C>T	X.37:g.76939577G>A	ENSP00000362441:p.Gln391*	Somatic	0	51	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	16	42.86	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q391*	ENST00000373344.5	37	c.1171	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	g	38	6.843642	0.97881	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	4.91	4.91	0.64330	.	0.139211	0.49305	D	0.000143	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-2.3421	17.355	0.87333	0.0:0.0:1.0:0.0	.	.	.	.	X	391;353;347	.	ENSP00000362441:Q391X	Q	-	1	0	ATRX	76826233	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.152000	0.71812	2.022000	0.59522	0.509000	0.49947	CAG	-	NULL		0.373	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	G	NM_000489	-		76939577	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	SNP	1.000	A
SNRNP40	9410	genome.wustl.edu	37	1	31744332	31744332	+	Silent	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:31744332G>T	ENST00000263694.4	-	6	687	c.669C>A	c.(667-669)cgC>cgA	p.R223R	SNRNP40_ENST00000373720.3_5'Flank|SNRNP40_ENST00000446633.2_Silent_p.R223R|SNRNP40_ENST00000489853.1_5'UTR	NM_004814.2	NP_004805.2	Q96DI7	SNR40_HUMAN	small nuclear ribonucleoprotein 40kDa (U5)	223					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nucleolar ribonucleoprotein complex (GO:0005732)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	7						GCTTGTTCTGGCGCAGGTCCC	0.448																																																	0								ENSG00000060688						70.0	70.0	70.0					1																	31744332		2203	4300	6503	SNRNP40	SO:0001819	synonymous_variant	0			-	HGNC	AF090988	CCDS340.1	1p35.2	2013-01-09	2008-10-29	2008-10-29	ENSG00000060688	ENSG00000060688		"""WD repeat domain containing"""	30857	protein-coding gene	gene with protein product		607797	"""WD repeat domain 57 (U5 snRNP specific)"""	WDR57		9774689, 9731529, 10788320	Standard	NM_004814		Approved	PRP8BP, SPF38, PRPF8BP, HPRP8BP	uc009vtt.3	Q96DI7	OTTHUMG00000003790	ENST00000263694.4:c.669C>A	1.37:g.31744332G>T		Somatic	0	18	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	B4DQJ1|O75938|O95320	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R223	ENST00000263694.4	37	c.669	CCDS340.1	1																																																																																			-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.448	SNRNP40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP40	protein_coding	OTTHUMT00000010657.1	G	NM_004814	-		31744332	-1	no_errors	ENST00000446633	ensembl	human	known	74_37	silent	SNP	1.000	T
VIP	7432	genome.wustl.edu	37	6	153077274	153077274	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr6:153077274A>T	ENST00000367244.3	+	5	513	c.341A>T	c.(340-342)aAc>aTc	p.N114I	VIP_ENST00000367243.3_Missense_Mutation_p.N113I	NM_003381.3	NP_003372.1	P01282	VIP_HUMAN	vasoactive intestinal peptide	114					body fluid secretion (GO:0007589)|G-protein coupled receptor signaling pathway (GO:0007186)|learning or memory (GO:0007611)|negative regulation of apoptotic process (GO:0043066)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of penile erection (GO:0060406)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of vasodilation (GO:0045909)|regulation of protein localization (GO:0032880)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)	extracellular region (GO:0005576)|neuronal cell body (GO:0043025)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)			haematopoietic_and_lymphoid_tissue(1)|lung(4)|skin(1)	6		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		CTTAGCAGTAACATCTCAGAA	0.383																																																	0								ENSG00000146469						84.0	89.0	87.0					6																	153077274		2203	4300	6503	VIP	SO:0001583	missense	0			-	HGNC		CCDS5240.1, CCDS5241.1	6q24-q27	2013-02-28			ENSG00000146469	ENSG00000146469		"""Endogenous ligands"""	12693	protein-coding gene	gene with protein product	"""prepro-VIP"""	192320					Standard	NM_003381		Approved		uc003qpe.4	P01282	OTTHUMG00000015851	ENST00000367244.3:c.341A>T	6.37:g.153077274A>T	ENSP00000356213:p.Asn114Ile	Somatic	0	42	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	Q5TCY8|Q5TCY9|Q96QK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	p.N114I	ENST00000367244.3	37	c.341	CCDS5240.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.36|15.36	2.811563|2.811563	0.50527|0.50527	.|.	.|.	ENSG00000146469|ENSG00000146469	ENST00000367244;ENST00000367243|ENST00000431366	T;T|.	0.26067|.	1.81;1.76|.	6.16|6.16	-10.4|-10.4	0.00318|0.00318	.|.	0.788122|.	0.12465|.	N|.	0.466509|.	T|.	0.15478|.	0.0373|.	L|L	0.58101|0.58101	1.795|1.795	0.09310|0.09310	N|N	1|1	P;P;B|.	0.42993|.	0.694;0.797;0.021|.	B;B;B|.	0.37943|.	0.189;0.261;0.012|.	T|.	0.22452|.	-1.0216|.	10|.	0.54805|.	T|.	0.06|.	.|.	3.654|3.654	0.08214|0.08214	0.2522:0.2868:0.3649:0.0961|0.2522:0.2868:0.3649:0.0961	.|.	113;113;114|.	A8K7E4;P01282-2;P01282|.	.;.;VIP_HUMAN|.	I|Y	114;113|63	ENSP00000356213:N114I;ENSP00000356212:N113I|.	ENSP00000356212:N113I|.	N|X	+|+	2|3	0|2	VIP|VIP	153118967|153118967	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.072000|0.072000	0.16883|0.16883	0.345000|0.345000	0.19979|0.19979	-1.600000|-1.600000	0.01603|0.01603	-0.297000|-0.297000	0.09499|0.09499	AAC|TAA	-	NULL		0.383	VIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VIP	protein_coding	OTTHUMT00000042751.1	A		-		153077274	+1	no_errors	ENST00000367244	ensembl	human	known	74_37	missense	SNP	0.000	T
FAM120C	54954	genome.wustl.edu	37	X	54209302	54209303	+	In_Frame_Ins	INS	-	-	GGCGGC			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:54209302_54209303insGGCGGC	ENST00000375180.2	-	1	385_386	c.329_330insGCCGCC	c.(328-330)ccc>ccGCCGCCc	p.110_110P>PPP	FAM120C_ENST00000497680.1_5'Flank|FAM120C_ENST00000328235.4_In_Frame_Ins_p.110_110P>PPP|FAM120C_ENST00000477084.1_In_Frame_Ins_p.110_110P>PPP	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	110							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GCAGCTGAGGGGGCGGCGGCGG	0.748														77	0.0203974	0.0045	0.0159	3775	,	,		9228	0.0		0.0467	False		,,,				2504	0.0133																0								ENSG00000184083																																			FAM120C	SO:0001652	inframe_insertion	0				HGNC	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.324_329dupGCCGCC	X.37:g.54209303_54209308dupGGCGGC	ENSP00000364324:p.ProPro110dup	Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RMT7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.112in_frame_insPP	ENST00000375180.2	37	c.330_329	CCDS14356.1	X																																																																																			-	NULL		0.748	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	protein_coding	OTTHUMT00000056795.2	-	NM_017848			54209303	-1	no_errors	ENST00000375180	ensembl	human	known	74_37	in_frame_ins	INS	0.999:0.998	GGCGGC
INTS5	80789	genome.wustl.edu	37	11	62415487	62415487	+	Silent	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:62415487G>A	ENST00000330574.2	-	2	2117	c.2065C>T	c.(2065-2067)Ctg>Ttg	p.L689L	GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000346178.4_5'Flank|GANAB_ENST00000534779.1_5'Flank|GANAB_ENST00000356638.3_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	689					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						AGCAGCTGCAGGACAGCCTTG	0.567																																																	0								ENSG00000185085						73.0	75.0	74.0					11																	62415487		2202	4299	6501	INTS5	SO:0001819	synonymous_variant	0			-	HGNC	AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.2065C>T	11.37:g.62415487G>A		Somatic	0	40	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	Q8N6W5|Q9C0G5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L689	ENST00000330574.2	37	c.2065	CCDS8027.1	11																																																																																			-	NULL		0.567	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS5	protein_coding	OTTHUMT00000395327.1	G	NM_030628	-		62415487	-1	no_errors	ENST00000330574	ensembl	human	known	74_37	silent	SNP	0.999	A
XKR4	114786	genome.wustl.edu	37	8	56436473	56436473	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr8:56436473G>A	ENST00000327381.6	+	3	1740	c.1640G>A	c.(1639-1641)cGg>cAg	p.R547Q	RP11-628E19.2_ENST00000522918.1_RNA	NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	547						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			AGCACCCTACGGTCCATCTCC	0.587																																																	0								ENSG00000206579						67.0	68.0	67.0					8																	56436473		2203	4300	6503	XKR4	SO:0001583	missense	0			-	HGNC	AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.1640G>A	8.37:g.56436473G>A	ENSP00000328326:p.Arg547Gln	Somatic	0	44	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	25	26.47	Q96PZ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transport_prot_XK	p.R547Q	ENST00000327381.6	37	c.1640	CCDS34893.1	8	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289843	0.59976	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	D	0.85258	-1.96	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.90130	0.6916	L	0.42245	1.32	0.58432	D	0.999996	D	0.89917	1.0	D	0.71656	0.974	D	0.89496	0.3760	10	0.54805	T	0.06	-0.557	20.3931	0.98965	0.0:0.0:1.0:0.0	.	547	Q5GH76	XKR4_HUMAN	Q	547	ENSP00000328326:R547Q	ENSP00000328326:R547Q	R	+	2	0	XKR4	56599027	1.000000	0.71417	0.954000	0.39281	0.018000	0.09664	8.062000	0.89475	2.824000	0.97209	0.655000	0.94253	CGG	-	NULL		0.587	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	protein_coding	OTTHUMT00000378129.2	G	NM_052898	-		56436473	+1	no_errors	ENST00000327381	ensembl	human	known	74_37	missense	SNP	1.000	A
TIMM50	92609	genome.wustl.edu	37	19	39971423	39971423	+	5'Flank	SNP	T	T	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr19:39971423T>A	ENST00000607714.1	+	0	0				TIMM50_ENST00000314349.4_Missense_Mutation_p.I80N|TIMM50_ENST00000544017.1_5'Flank|TIMM50_ENST00000599794.1_5'Flank			Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)						cellular protein metabolic process (GO:0044267)|mitochondrial membrane organization (GO:0007006)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein targeting to mitochondrion (GO:0006626)|release of cytochrome c from mitochondria (GO:0001836)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)	interleukin-2 receptor binding (GO:0005134)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)			NS(1)|endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)	14	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CGCGTTTCCATTGGCTGTAGC	0.706																																																	0								ENSG00000105197						15.0	19.0	18.0					19																	39971423		2200	4298	6498	TIMM50	SO:0001631	upstream_gene_variant	0			-	HGNC	BC009072	CCDS33023.1	19q13.2	2010-06-21	2006-04-04		ENSG00000105197	ENSG00000105197		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	23656	protein-coding gene	gene with protein product		607381	"""translocase of inner mitochondrial membrane 50 homolog (yeast)"""			12437925	Standard	NM_001001563		Approved	TIM50L	uc002olu.1	Q3ZCQ8			19.37:g.39971423T>A	Exception_encountered	Somatic	0	77	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	227	11.67	Q330K1|Q6QA00|Q96FJ5|Q96GY2|Q9H370	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF	p.I80N	ENST00000607714.1	37	c.239		19	.	.	.	.	.	.	.	.	.	.	T	16.62	3.172810	0.57584	.	.	ENSG00000105197	ENST00000314349	.	.	.	4.57	4.57	0.56435	.	0.407398	0.21861	N	0.068030	T	0.49236	0.1545	N	0.08118	0	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.47394	-0.9121	8	.	.	.	-8.9525	10.5134	0.44874	0.0:0.0:0.0:1.0	.	80	Q3ZCQ8-2	.	N	80	.	.	I	+	2	0	TIMM50	44663263	1.000000	0.71417	0.986000	0.45419	0.043000	0.13939	3.126000	0.50477	2.053000	0.61076	0.379000	0.24179	ATT	-	NULL		0.706	TIMM50-021	KNOWN	basic|appris_principal	protein_coding	TIMM50	protein_coding	OTTHUMT00000470728.1	T	NM_001001563	-		39971423	+1	no_errors	ENST00000314349	ensembl	human	known	74_37	missense	SNP	0.995	A
PEX5L	51555	genome.wustl.edu	37	3	179525571	179525571	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr3:179525571G>A	ENST00000467460.1	-	14	1897	c.1567C>T	c.(1567-1569)Cgc>Tgc	p.R523C	PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000485199.1_Missense_Mutation_p.R488C|PEX5L_ENST00000263962.8_Missense_Mutation_p.R521C|PEX5L_ENST00000472994.1_Missense_Mutation_p.R464C|PEX5L_ENST00000464614.1_Missense_Mutation_p.R415C|PEX5L_ENST00000465751.1_Missense_Mutation_p.R499C|PEX5L_ENST00000468741.1_Missense_Mutation_p.R331C|PEX5L_ENST00000392649.3_Missense_Mutation_p.R415C|PEX5L_ENST00000476138.1_Missense_Mutation_p.R480C	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	523					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TCCTCGCTGCGGTCTCCGTTC	0.532																																																	0								ENSG00000114757						122.0	128.0	126.0					3																	179525571		2203	4300	6503	PEX5L	SO:0001583	missense	0			-	HGNC	AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.1567C>T	3.37:g.179525571G>A	ENSP00000419975:p.Arg523Cys	Somatic	0	27	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R523C	ENST00000467460.1	37	c.1567	CCDS3236.1	3	.	.	.	.	.	.	.	.	.	.	G	28.6	4.937309	0.92458	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751	T;T;T;T;T;T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43;-1.43	6.07	6.07	0.98685	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.92064	0.7485	M	0.92784	3.345	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.91;0.91;0.997;0.998;0.997;0.999	D	0.93172	0.6567	10	0.87932	D	0	-13.8905	16.059	0.80826	0.0:0.1332:0.8668:0.0	.	464;499;415;521;488;523	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	C	523;521;488;521;415;331;480;411;464;415;499	ENSP00000419975:R523C;ENSP00000263962:R521C;ENSP00000418440:R488C;ENSP00000376420:R415C;ENSP00000418665:R331C;ENSP00000420555:R480C;ENSP00000418054:R464C;ENSP00000417270:R415C;ENSP00000419348:R499C	ENSP00000263962:R521C	R	-	1	0	PEX5L	181008265	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.929000	0.87595	2.890000	0.99128	0.585000	0.79938	CGC	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.532	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PEX5L	protein_coding	OTTHUMT00000348577.1	G	NM_016559	-		179525571	-1	no_errors	ENST00000467460	ensembl	human	known	74_37	missense	SNP	1.000	A
GOLGA8N	643699	genome.wustl.edu	37	15	32890118	32890118	+	Silent	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr15:32890118A>G	ENST00000569659.1	+	7	426	c.426A>G	c.(424-426)aaA>aaG	p.K142K	GOLGA8N_ENST00000426622.2_Intron|GOLGA8N_ENST00000448387.2_Silent_p.K142K					golgin A8 family, member N																		TCATACAGAAAGAGGAACTAA	0.458																																																	0								ENSG00000232653																																			GOLGA8N	SO:0001819	synonymous_variant	0			-	HGNC			15q13.3	2014-01-02			ENSG00000232653	ENSG00000232653			44405	protein-coding gene	gene with protein product							Standard	NM_001282494		Approved			F8WBI6	OTTHUMG00000175401	ENST00000569659.1:c.426A>G	15.37:g.32890118A>G		Somatic	0	52	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	65	30.85		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K142	ENST00000569659.1	37	c.426		15																																																																																			-	NULL		0.458	GOLGA8N-001	NOVEL	basic|appris_candidate	protein_coding	GOLGA8N	protein_coding	OTTHUMT00000429858.1	A	NM_001282494	-		32890118	+1	no_errors	ENST00000448387	ensembl	human	known	74_37	silent	SNP	0.187	G
ATP2B4	493	genome.wustl.edu	37	1	203698739	203698739	+	Intron	SNP	C	C	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:203698739C>G	ENST00000357681.5	+	20	4432				SNORA77_ENST00000408716.1_RNA|ATP2B4_ENST00000341360.2_Intron|ATP2B4_ENST00000367218.3_Intron|ATP2B4_ENST00000367219.3_Intron|ATP2B4_ENST00000391954.2_Intron	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4						blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ACTGTACTTCCAGGCAGGTGC	0.502																																																	0								ENSG00000221643						18.0	16.0	17.0					1																	203698739		876	1991	2867	SNORA77	SO:0001627	intron_variant	0			-	HGNC	M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.3309+2040C>G	1.37:g.203698739C>G		Somatic	0	32	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000357681.5	37	NULL	CCDS1440.1	1																																																																																			-	-		0.502	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA77	protein_coding	OTTHUMT00000087462.1	C	NM_001001396	-		203698739	+1	no_errors	ENST00000408716	ensembl	human	known	74_37	rna	SNP	0.556	G
PPP2R3A	5523	genome.wustl.edu	37	3	135806749	135806749	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr3:135806749G>T	ENST00000264977.3	+	9	3430	c.2813G>T	c.(2812-2814)aGg>aTg	p.R938M	PPP2R3A_ENST00000490467.1_Missense_Mutation_p.R202M|RP11-305O4.3_ENST00000608883.1_RNA|PPP2R3A_ENST00000334546.2_Missense_Mutation_p.R317M	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	938					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ATTATTGAAAGGATATTCTCT	0.313																																																	0								ENSG00000073711						153.0	153.0	153.0					3																	135806749		2203	4300	6503	PPP2R3A	SO:0001583	missense	0			-	HGNC	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.2813G>T	3.37:g.135806749G>T	ENSP00000264977:p.Arg938Met	Somatic	0	46	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	21	44.74	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_EF_hand_dom	p.R938M	ENST00000264977.3	37	c.2813	CCDS3087.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.110229	0.94292	.	.	ENSG00000073711	ENST00000264977;ENST00000490467;ENST00000334546	T;T;T	0.56611	0.45;0.45;0.45	5.98	5.98	0.97165	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.83078	0.5176	H	0.97103	3.94	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.995	D	0.87890	0.2683	10	0.87932	D	0	.	19.4402	0.94817	0.0:0.0:1.0:0.0	.	317;938	Q06190-2;Q06190	.;P2R3A_HUMAN	M	938;202;317	ENSP00000264977:R938M;ENSP00000419344:R202M;ENSP00000334748:R317M	ENSP00000264977:R938M	R	+	2	0	PPP2R3A	137289439	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.543000	0.98089	2.838000	0.97847	0.591000	0.81541	AGG	-	NULL		0.313	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R3A	protein_coding	OTTHUMT00000357232.1	G	NM_002718	-		135806749	+1	no_errors	ENST00000264977	ensembl	human	known	74_37	missense	SNP	1.000	T
CHD8	57680	genome.wustl.edu	37	14	21899129	21899129	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr14:21899129G>A	ENST00000557364.1	-	2	937	c.674C>T	c.(673-675)gCc>gTc	p.A225V	RN7SL650P_ENST00000583681.1_RNA|CHD8_ENST00000399982.2_Missense_Mutation_p.A225V|CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Intron			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	225					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GACCTTGGCGGCCAACACTGT	0.557																																																	0								ENSG00000100888						43.0	40.0	41.0					14																	21899129		1568	3582	5150	CHD8	SO:0001583	missense	0			-	HGNC	AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.674C>T	14.37:g.21899129G>A	ENSP00000451601:p.Ala225Val	Somatic	0	50	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A225V	ENST00000557364.1	37	c.674	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061408	0.76187	.	.	ENSG00000100888	ENST00000399982;ENST00000557364	D;D	0.89485	-2.52;-2.52	5.87	5.87	0.94306	.	0.423876	0.13567	U	0.378309	D	0.86260	0.5890	N	0.14661	0.345	0.37087	D	0.899267	.	.	.	.	.	.	D	0.86313	0.1687	8	0.41790	T	0.15	-6.0876	17.1211	0.86701	0.0:0.0:1.0:0.0	.	.	.	.	V	225	ENSP00000382863:A225V;ENSP00000451601:A225V	ENSP00000382863:A225V	A	-	2	0	CHD8	20968969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.497000	0.66924	2.779000	0.95612	0.591000	0.81541	GCC	-	NULL		0.557	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	protein_coding	OTTHUMT00000410436.1	G	NM_020920	-		21899129	-1	no_errors	ENST00000399982	ensembl	human	known	74_37	missense	SNP	1.000	A
CACNG8	59283	genome.wustl.edu	37	19	54481448	54481448	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr19:54481448C>T	ENST00000270458.2	+	2	435	c.332C>T	c.(331-333)aCg>aTg	p.T111M		NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	111					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		CCGGAGGACACGGACTACGAC	0.642																																																	0								ENSG00000142408						44.0	38.0	40.0					19																	54481448		2203	4299	6502	CACNG8	SO:0001583	missense	0			-	HGNC	AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.332C>T	19.37:g.54481448C>T	ENSP00000270458:p.Thr111Met	Somatic	0	73	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	Q9BXT0|Q9BY23	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_VDCC_g8su,prints_Claudin	p.T111M	ENST00000270458.2	37	c.332	CCDS33104.1	19	.	.	.	.	.	.	.	.	.	.	C	24.7	4.564736	0.86439	.	.	ENSG00000142408	ENST00000270458	D	0.88975	-2.45	5.04	5.04	0.67666	.	0.069412	0.56097	U	0.000023	D	0.92159	0.7514	L	0.50333	1.59	0.24569	N	0.993932	D	0.76494	0.999	D	0.68943	0.961	D	0.91873	0.5509	9	0.44086	T	0.13	-4.2802	16.3246	0.82970	0.0:1.0:0.0:0.0	.	111	Q8WXS5	CCG8_HUMAN	M	111	ENSP00000270458:T111M	ENSP00000270458:T111M	T	+	2	0	CACNG8	59173260	0.454000	0.25728	1.000000	0.80357	0.996000	0.88848	1.382000	0.34374	2.512000	0.84698	0.549000	0.68633	ACG	-	pfam_PMP22/EMP/MP20/Claudin		0.642	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	CACNG8	protein_coding	OTTHUMT00000139361.3	C		-		54481448	+1	no_errors	ENST00000270458	ensembl	human	known	74_37	missense	SNP	1.000	T
SYCP3	50511	genome.wustl.edu	37	12	102131694	102131694	+	Missense_Mutation	SNP	T	T	C	rs376033096		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr12:102131694T>C	ENST00000392927.3	-	2	151	c.20A>G	c.(19-21)aAg>aGg	p.K7R	SYCP3_ENST00000392924.1_Missense_Mutation_p.K7R|SYCP3_ENST00000266743.2_Missense_Mutation_p.K7R	NM_001177948.1|NM_001177949.1|NM_153694.4	NP_001171419.1|NP_001171420.1|NP_710161.1	Q8IZU3	SYCP3_HUMAN	synaptonemal complex protein 3	7					male meiosis I (GO:0007141)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(1)	11						CCTGGAATACTTTTTTCCGGA	0.373																																																	0								ENSG00000139351						156.0	155.0	155.0					12																	102131694		2203	4300	6503	SYCP3	SO:0001583	missense	0			-	HGNC	AF492003, AI075991	CCDS9087.1	12q23.2	2007-02-05			ENSG00000139351	ENSG00000139351			18130	protein-coding gene	gene with protein product		604759				12213195, 10854409	Standard	NM_153694		Approved		uc001tis.3	Q8IZU3	OTTHUMG00000150132	ENST00000392927.3:c.20A>G	12.37:g.102131694T>C	ENSP00000376658:p.Lys7Arg	Somatic	0	51	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cor1/Xlr/Xmr	p.K7R	ENST00000392927.3	37	c.20	CCDS9087.1	12	.	.	.	.	.	.	.	.	.	.	T	15.99	2.995833	0.54147	.	.	ENSG00000139351	ENST00000266743;ENST00000392927;ENST00000392924	.	.	.	5.23	4.08	0.47627	.	0.059509	0.64402	D	0.000006	T	0.75102	0.3804	M	0.77103	2.36	0.41845	D	0.990148	D	0.76494	0.999	D	0.66084	0.941	T	0.73892	-0.3839	9	0.34782	T	0.22	-20.3707	10.8731	0.46896	0.0:0.0745:0.0:0.9255	.	7	Q8IZU3	SYCP3_HUMAN	R	7	.	ENSP00000266743:K7R	K	-	2	0	SYCP3	100655825	0.999000	0.42202	0.006000	0.13384	0.114000	0.19823	3.729000	0.54999	0.832000	0.34804	0.533000	0.62120	AAG	-	NULL		0.373	SYCP3-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_principal|CCDS	protein_coding	SYCP3	protein_coding	OTTHUMT00000316478.2	T	NM_153694	-		102131694	-1	no_errors	ENST00000266743	ensembl	human	known	74_37	missense	SNP	0.921	C
ENPP1	5167	genome.wustl.edu	37	6	132196961	132196961	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr6:132196961G>T	ENST00000360971.2	+	17	1701	c.1681G>T	c.(1681-1683)Gct>Tct	p.A561S		NM_006208.2	NP_006199.2	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 1	561	Phosphodiesterase.				3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|ATP catabolic process (GO:0006200)|biomineral tissue development (GO:0031214)|bone remodeling (GO:0046849)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to insulin stimulus (GO:0032869)|generation of precursor metabolites and energy (GO:0006091)|immune response (GO:0006955)|inorganic diphosphate transport (GO:0030505)|negative regulation of cell growth (GO:0030308)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of ossification (GO:0030279)|negative regulation of protein autophosphorylation (GO:0031953)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)|regulation of bone mineralization (GO:0030500)|riboflavin metabolic process (GO:0006771)|sequestering of triglyceride (GO:0030730)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|insulin receptor binding (GO:0005158)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|protein homodimerization activity (GO:0042803)|scavenger receptor activity (GO:0005044)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(22)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	46	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	TGGCATTGAGGCTGACACCTT	0.413																																					Colon(104;336 1535 5856 11019 33782)												0								ENSG00000197594						146.0	139.0	141.0					6																	132196961		2203	4300	6503	ENPP1	SO:0001583	missense	0			-	HGNC	M57736	CCDS5150.2	6q22-q23	2008-02-07			ENSG00000197594	ENSG00000197594	3.1.4.1, 3.6.1.9		3356	protein-coding gene	gene with protein product		173335		NPPS, M6S1, PDNP1		1315502	Standard	NM_006208		Approved	PC-1, PCA1	uc011ecf.2	P22413	OTTHUMG00000015572	ENST00000360971.2:c.1681G>T	6.37:g.132196961G>T	ENSP00000354238:p.Ala561Ser	Somatic	0	46	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q5T9R6|Q9NPZ3|Q9P1P6|Q9UP61|Q9Y6K3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.A561S	ENST00000360971.2	37	c.1681	CCDS5150.2	6	.	.	.	.	.	.	.	.	.	.	G	19.04	3.749169	0.69533	.	.	ENSG00000197594	ENST00000360971	T	0.74842	-0.88	6.16	5.3	0.74995	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.118785	0.56097	D	0.000023	T	0.47229	0.1434	N	0.20845	0.615	0.21782	N	0.999545	B;B	0.30584	0.286;0.001	B;B	0.31390	0.129;0.003	T	0.51426	-0.8707	10	0.59425	D	0.04	-13.3579	15.4266	0.75055	0.0669:0.0:0.9331:0.0	.	561;191	P22413;Q7Z3P5	ENPP1_HUMAN;.	S	561	ENSP00000354238:A561S	ENSP00000354238:A561S	A	+	1	0	ENPP1	132238654	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	5.178000	0.65037	1.623000	0.50342	0.650000	0.86243	GCT	-	superfamily_Alkaline_phosphatase_core		0.413	ENPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP1	protein_coding	OTTHUMT00000042238.2	G		-		132196961	+1	no_errors	ENST00000360971	ensembl	human	known	74_37	missense	SNP	1.000	T
SEPT8	23176	genome.wustl.edu	37	5	132097299	132097299	+	Nonsense_Mutation	SNP	G	G	T	rs75721931	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr5:132097299G>T	ENST00000378719.2	-	7	1050	c.813C>A	c.(811-813)tgC>tgA	p.C271*	SEPT8_ENST00000378699.2_Nonsense_Mutation_p.C211*|SEPT8_ENST00000448933.1_Nonsense_Mutation_p.C211*|SEPT8_ENST00000378701.1_Nonsense_Mutation_p.C269*|SEPT8_ENST00000378721.4_Nonsense_Mutation_p.C269*|SEPT8_ENST00000458488.2_Nonsense_Mutation_p.C271*|SEPT8_ENST00000296873.7_Nonsense_Mutation_p.C271*|SEPT8_ENST00000378706.1_Nonsense_Mutation_p.C271*|SEPT8_ENST00000481030.1_5'Flank	NM_001098811.1	NP_001092281.1	Q92599	SEPT8_HUMAN	septin 8	271	Septin-type G.				cell cycle (GO:0007049)	septin complex (GO:0031105)	GTP binding (GO:0005525)		SEPT8/AFF4(2)	kidney(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.0751)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCACGAAGTCGCAGTGATTCT	0.617																																																	0								ENSG00000164402						55.0	61.0	59.0					5																	132097299		2193	4295	6488	SEPT8	SO:0001587	stop_gained	0			-	HGNC	AF179995	CCDS43358.1, CCDS43359.1, CCDS43360.1, CCDS47262.1, CCDS75298.1	5q31	2013-01-21			ENSG00000164402	ENSG00000164402		"""Septins"""	16511	protein-coding gene	gene with protein product		608418				9039502, 9149945	Standard	NM_001098812		Approved	KIAA0202, SEP2	uc003kxr.2	Q92599	OTTHUMG00000059735	ENST00000378719.2:c.813C>A	5.37:g.132097299G>T	ENSP00000367991:p.Cys271*	Somatic	0	37	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A6NC65|A6NKP6|F6W7K9|Q8IX36|Q8IX37|Q9BVB3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.C271*	ENST00000378719.2	37	c.813	CCDS43358.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.785515	0.96937	.	.	ENSG00000164402	ENST00000378719;ENST00000378721;ENST00000296873;ENST00000448933;ENST00000378706;ENST00000378699;ENST00000378701;ENST00000458488	.	.	.	5.28	-2.57	0.06248	.	0.148962	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.9372	0.29937	0.6868:0.1183:0.1949:0.0	.	.	.	.	X	271;269;271;211;271;211;269;271	.	ENSP00000296873:C271X	C	-	3	2	SEPT8	132125198	0.193000	0.23313	0.971000	0.41717	0.995000	0.86356	-0.219000	0.09228	-0.399000	0.07668	0.561000	0.74099	TGC	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin		0.617	SEPT8-002	KNOWN	basic|CCDS	protein_coding	SEPT8	protein_coding	OTTHUMT00000132827.2	G	XM_034872	-		132097299	-1	no_errors	ENST00000378719	ensembl	human	known	74_37	nonsense	SNP	0.928	T
SHANK2	22941	genome.wustl.edu	37	11	70332776	70332776	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:70332776G>A	ENST00000423696.2	-	15	2521	c.2485C>T	c.(2485-2487)Cgg>Tgg	p.R829W	SHANK2_ENST00000338508.4_Missense_Mutation_p.R1209W|SHANK2_ENST00000449833.2_Missense_Mutation_p.R613W|SHANK2_ENST00000409161.1_Missense_Mutation_p.R612W			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	829					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TCAAGCAGCCGCCCTGTGAGT	0.682																																																	0								ENSG00000162105						31.0	38.0	36.0					11																	70332776		2200	4294	6494	SHANK2	SO:0001583	missense	0			-	HGNC	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.2485C>T	11.37:g.70332776G>A	ENSP00000394536:p.Arg829Trp	Somatic	0	84	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	44	18.52	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.R1209W	ENST00000423696.2	37	c.3625		11	.	.	.	.	.	.	.	.	.	.	G	12.62	1.992611	0.35131	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82	4.88	-5.51	0.02568	.	0.096878	0.64402	D	0.000002	T	0.56543	0.1992	L	0.47716	1.5	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	P;D;D	0.64776	0.852;0.929;0.929	T	0.62784	-0.6781	10	0.87932	D	0	.	19.8969	0.96969	0.0:0.0:0.1141:0.8859	.	829;1208;613	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	W	613;612;487;1209;829;847;832	ENSP00000399423:R613W;ENSP00000386491:R612W;ENSP00000402944:R487W;ENSP00000345193:R1209W;ENSP00000394536:R829W;ENSP00000294018:R832W	ENSP00000294018:R832W	R	-	1	2	SHANK2	70010424	0.986000	0.35501	0.113000	0.21522	0.342000	0.28953	1.676000	0.37565	-1.124000	0.02936	-0.397000	0.06425	CGG	-	NULL		0.682	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	protein_coding		G	NM_012309	-		70332776	-1	no_errors	ENST00000338508	ensembl	human	known	74_37	missense	SNP	0.907	A
C2orf74	339804	genome.wustl.edu	37	2	61391639	61391639	+	Nonsense_Mutation	SNP	C	C	T	rs376938479		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr2:61391639C>T	ENST00000432605.1	+	4	562	c.562C>T	c.(562-564)Cga>Tga	p.R188*	RP11-493E12.1_ENST00000605902.1_lincRNA|C2orf74_ENST00000426997.1_Nonsense_Mutation_p.R109*	NM_001143959.1	NP_001137431.1	A8MZ97	CB074_HUMAN	chromosome 2 open reading frame 74	188						integral component of membrane (GO:0016021)				endometrium(1)	1						AAGCTATACTCGAGAACATAA	0.373																																																	0								ENSG00000237651						110.0	87.0	94.0					2																	61391639		692	1591	2283	C2orf74	SO:0001587	stop_gained	0			-	HGNC			2p15	2012-08-06			ENSG00000237651	ENSG00000237651			34439	protein-coding gene	gene with protein product							Standard	NM_001143959		Approved	LOC339804	uc010ypm.1	A8MZ97		ENST00000432605.1:c.562C>T	2.37:g.61391639C>T	ENSP00000402915:p.Arg188*	Somatic	0	39	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	C9JP62	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R188*	ENST00000432605.1	37	c.562		2	.	.	.	.	.	.	.	.	.	.	C	5.261	0.233666	0.09969	.	.	ENSG00000237651	ENST00000426997;ENST00000432605	.	.	.	4.83	-0.768	0.11013	.	.	.	.	.	.	.	.	.	.	.	0.20764	N	0.999856	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.9965	3.2633	0.06856	0.4698:0.3044:0.1386:0.0872	.	.	.	.	X	109;188	.	ENSP00000398725:R109X	R	+	1	2	C2orf74	61245143	0.008000	0.16893	0.001000	0.08648	0.535000	0.34838	-0.084000	0.11268	0.014000	0.14944	-1.409000	0.01127	CGA	-	NULL		0.373	C2orf74-202	KNOWN	basic|appris_principal	protein_coding	C2orf74	protein_coding		C	NM_001143959	-		61391639	+1	no_errors	ENST00000432605	ensembl	human	known	74_37	nonsense	SNP	0.001	T
FANCB	2187	genome.wustl.edu	37	X	14862776	14862776	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chrX:14862776T>A	ENST00000324138.3	-	8	2167	c.2014A>T	c.(2014-2016)Atg>Ttg	p.M672L	FANCB_ENST00000398334.1_Missense_Mutation_p.M672L	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	672					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					CACACCTTCATTGAATTCAGG	0.378								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0								ENSG00000181544						77.0	76.0	76.0					X																	14862776		2203	4300	6503	FANCB	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	HGNC	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.2014A>T	X.37:g.14862776T>A	ENSP00000326819:p.Met672Leu	Somatic	0	64	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	36	28.00	B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.M672L	ENST00000324138.3	37	c.2014	CCDS14161.1	X	.	.	.	.	.	.	.	.	.	.	T	6.287	0.420975	0.11928	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	5.5	-6.54	0.01860	.	1.054140	0.07306	N	0.874936	T	0.36248	0.0960	L	0.40543	1.245	0.09310	N	1	B	0.24920	0.114	B	0.20955	0.032	T	0.30736	-0.9968	9	0.51188	T	0.08	0.1749	13.0205	0.58784	0.1083:0.672:0.0:0.2197	.	672	Q8NB91	FANCB_HUMAN	L	672	.	ENSP00000326819:M672L	M	-	1	0	FANCB	14772697	0.318000	0.24598	0.000000	0.03702	0.015000	0.08874	-0.280000	0.08468	-1.543000	0.01723	-0.368000	0.07277	ATG	-	NULL		0.378	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCB	protein_coding	OTTHUMT00000055835.1	T	NM_152633	-		14862776	-1	no_errors	ENST00000324138	ensembl	human	known	74_37	missense	SNP	0.000	A
MTHFSD	64779	genome.wustl.edu	37	16	86575760	86575760	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr16:86575760T>A	ENST00000360900.6	-	6	527	c.502A>T	c.(502-504)Atg>Ttg	p.M168L	MTHFSD_ENST00000546093.1_Missense_Mutation_p.M5L|MTHFSD_ENST00000322911.6_Missense_Mutation_p.M167L|MTHFSD_ENST00000543303.2_Missense_Mutation_p.M167L|MTHFSD_ENST00000381214.5_Missense_Mutation_p.M168L	NM_001159380.1	NP_001152852.1	Q2M296	MTHSD_HUMAN	methenyltetrahydrofolate synthetase domain containing	168							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(3)|lung(6)|skin(1)	11						ACGGCGCCCATGGATACCATC	0.577																																																	0								ENSG00000103248						77.0	76.0	76.0					16																	86575760		1994	4175	6169	MTHFSD	SO:0001583	missense	0			-	HGNC	AK023060	CCDS54047.1, CCDS54048.1, CCDS58490.1	16q24.1	2013-02-12				ENSG00000103248		"""RNA binding motif (RRM) containing"""	25778	protein-coding gene	gene with protein product						12477932	Standard	NM_022764		Approved	FLJ12998	uc010vor.2	Q2M296		ENST00000360900.6:c.502A>T	16.37:g.86575760T>A	ENSP00000354152:p.Met168Leu	Somatic	0	15	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	8	55.56	A8MQ77|B7ZLC0|B7ZLC2|D3DUM9|E9PAM1|Q9H878|Q9H954	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FTHF_cligase,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.M168L	ENST00000360900.6	37	c.502	CCDS54047.1	16	.	.	.	.	.	.	.	.	.	.	T	11.06	1.526910	0.27299	.	.	ENSG00000103248	ENST00000543303;ENST00000381214;ENST00000360900;ENST00000322911;ENST00000546093	T;T;T;T	0.17528	2.67;2.67;2.67;2.27	5.6	4.44	0.53790	5-formyltetrahydrofolate cyclo-ligase-like domain (1);	0.069984	0.85682	D	0.000000	T	0.11836	0.0288	N	0.20986	0.625	0.37426	D	0.913827	B;B;B;B;B	0.17465	0.002;0.022;0.007;0.002;0.002	B;B;B;B;B	0.21708	0.022;0.036;0.009;0.011;0.007	T	0.14090	-1.0485	10	0.29301	T	0.29	-12.0177	10.8492	0.46761	0.1411:0.0:0.0:0.8589	.	168;167;5;168;167	E9PAM1;B7ZLC0;B3KUB0;Q2M296;Q2M296-2	.;.;.;MTHSD_HUMAN;.	L	166;168;168;167;5	ENSP00000370612:M168L;ENSP00000354152:M168L;ENSP00000326777:M167L;ENSP00000438761:M5L	ENSP00000326777:M167L	M	-	1	0	MTHFSD	85133261	1.000000	0.71417	0.981000	0.43875	0.341000	0.28922	5.484000	0.66844	2.111000	0.64477	0.533000	0.62120	ATG	-	pfam_FTHF_cligase		0.577	MTHFSD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTHFSD	protein_coding	OTTHUMT00000432182.1	T	NM_022764	-		86575760	-1	no_errors	ENST00000360900	ensembl	human	known	74_37	missense	SNP	0.994	A
UBOX5	22888	genome.wustl.edu	37	20	3102120	3102120	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr20:3102120G>T	ENST00000217173.2	-	3	1636	c.1165C>A	c.(1165-1167)Cct>Act	p.P389T	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Missense_Mutation_p.P389T	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5											endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						AAGACCAAAGGGCTTGTGGCA	0.473																																																	0								ENSG00000185019						107.0	88.0	94.0					20																	3102120		2203	4300	6503	UBOX5	SO:0001583	missense	0			-	HGNC	AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.1165C>A	20.37:g.3102120G>T	ENSP00000217173:p.Pro389Thr	Somatic	0	64	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	10.87		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ubox_domain,smart_Ubox_domain,pfscan_Znf_RING	p.P389T	ENST00000217173.2	37	c.1165	CCDS13046.1	20	.	.	.	.	.	.	.	.	.	.	G	8.426	0.847615	0.17034	.	.	ENSG00000185019	ENST00000217173;ENST00000348031	T;T	0.28666	1.61;1.6	5.43	4.48	0.54585	.	2.036360	0.02211	U	0.063188	T	0.23210	0.0561	N	0.19112	0.55	0.25649	N	0.986113	B;B;B	0.20671	0.02;0.047;0.02	B;B;B	0.19148	0.016;0.024;0.016	T	0.11372	-1.0590	10	0.23302	T	0.38	-3.5007	8.0563	0.30606	0.195:0.0:0.805:0.0	.	389;389;389	Q53GQ5;Q86X87;O94941	.;.;RNF37_HUMAN	T	389	ENSP00000217173:P389T;ENSP00000311726:P389T	ENSP00000217173:P389T	P	-	1	0	UBOX5	3050120	1.000000	0.71417	1.000000	0.80357	0.455000	0.32408	2.436000	0.44819	2.543000	0.85770	0.655000	0.94253	CCT	-	NULL		0.473	UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBOX5	protein_coding	OTTHUMT00000077706.2	G	NM_014948	-		3102120	-1	no_errors	ENST00000217173	ensembl	human	known	74_37	missense	SNP	1.000	T
CASP5	838	genome.wustl.edu	37	11	104879687	104879687	+	Frame_Shift_Del	DEL	T	T	-	rs372526393		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:104879687delT	ENST00000260315.3	-	2	27	c.28delA	c.(28-30)aggfs	p.R11fs	CASP5_ENST00000531367.1_Intron|CASP5_ENST00000444749.2_Intron|CASP5_ENST00000393139.2_5'UTR|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000393141.2_Frame_Shift_Del_p.R24fs|CASP5_ENST00000526056.1_Frame_Shift_Del_p.R24fs			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	11					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		TTCTTACGCCTTTTTTTTTTG	0.388																																																	0								ENSG00000137757		,,,	18,749,3497		0,0,18,1,747,1366	101.0	98.0	99.0		,,,	-1.9	0.0	11		107	8,1495,6751		0,0,8,0,1495,2624	no	codingComplex,codingComplex,intron,intron	CASP5	NM_004347.3,NM_001136112.1,NM_001136110.1,NM_001136109.1	,,,	0,0,26,1,2242,3990	A1A1,A1A2,A1R,A2A2,A2R,RR		18.2094,17.9878,18.1339	,,,	,,,	104879687	26,2244,10248	2201	4299	6500	CASP5	SO:0001589	frameshift_variant	0				HGNC		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.28delA	11.37:g.104879687delT	ENSP00000260315:p.Arg11fs	Somatic	0	56	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.R23fs	ENST00000260315.3	37	c.67	CCDS8328.2	11																																																																																			-	NULL		0.388	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	protein_coding	OTTHUMT00000109397.2	T	NM_004347			104879687	-1	no_errors	ENST00000393141	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
NAPEPLD	222236	genome.wustl.edu	37	7	102760030	102760030	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr7:102760030T>C	ENST00000417955.1	-	3	1089	c.935A>G	c.(934-936)gAa>gGa	p.E312G	NAPEPLD_ENST00000427257.1_Missense_Mutation_p.E312G|NAPEPLD_ENST00000341533.4_Missense_Mutation_p.E312G|NAPEPLD_ENST00000455523.2_Missense_Mutation_p.E385G|NAPEPLD_ENST00000465647.1_Missense_Mutation_p.E312G			Q6IQ20	NAPEP_HUMAN	N-acyl phosphatidylethanolamine phospholipase D	312					phospholipid catabolic process (GO:0009395)	extracellular vesicular exosome (GO:0070062)|photoreceptor outer segment membrane (GO:0042622)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						ATACCTCGGTTCATAAGCTCC	0.348																																																	0								ENSG00000161048						54.0	54.0	54.0					7																	102760030		2203	4300	6503	NAPEPLD	SO:0001583	missense	0			-	HGNC	BC037350, AY357337	CCDS5729.1	7q22.1	2014-03-14			ENSG00000161048	ENSG00000161048	3.1.4.54		21683	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 18, N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D"""	612334				14634025, 15820312, 18067139	Standard	NM_198990		Approved	FMP30, C7orf18, NAPE-PLD	uc003vbd.2	Q6IQ20	OTTHUMG00000157204	ENST00000417955.1:c.935A>G	7.37:g.102760030T>C	ENSP00000407112:p.Glu312Gly	Somatic	0	42	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q5CZ87|Q769K1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E385G	ENST00000417955.1	37	c.1154	CCDS5729.1	7	.	.	.	.	.	.	.	.	.	.	T	13.22	2.172330	0.38315	.	.	ENSG00000161048	ENST00000341533;ENST00000417955;ENST00000465647;ENST00000427257;ENST00000455523	T;T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27;-1.27	5.25	1.46	0.22682	.	0.517332	0.23648	N	0.045941	T	0.75012	0.3792	L	0.61387	1.9	0.43103	D	0.994791	P;B	0.41848	0.763;0.096	P;B	0.45794	0.493;0.261	T	0.69680	-0.5080	10	0.45353	T	0.12	-2.9589	7.4848	0.27425	0.0:0.0701:0.2709:0.659	.	385;312	B4E3B0;Q6IQ20	.;NAPEP_HUMAN	G	312;312;312;312;385	ENSP00000340093:E312G;ENSP00000407112:E312G;ENSP00000419188:E312G;ENSP00000392775:E312G;ENSP00000414364:E385G	ENSP00000340093:E312G	E	-	2	0	NAPEPLD	102547266	0.997000	0.39634	0.957000	0.39632	0.911000	0.54048	1.426000	0.34870	0.092000	0.17331	0.482000	0.46254	GAA	-	NULL		0.348	NAPEPLD-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NAPEPLD	protein_coding	OTTHUMT00000347904.1	T	NM_198990	-		102760030	-1	no_errors	ENST00000455523	ensembl	human	known	74_37	missense	SNP	0.919	C
ZDHHC5	25921	genome.wustl.edu	37	11	57471519	57471521	+	IGR	DEL	GCT	GCT	-			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:57471519_57471521delGCT	ENST00000287169.3	+	0	4666				MED19_ENST00000337672.2_3'UTR|MED19_ENST00000431606.2_In_Frame_Del_p.S242del	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5						protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						ATTAGCGTAGGCTGCTGCTGCTG	0.542																																																	0								ENSG00000156603																																			MED19	SO:0001628	intergenic_variant	0				HGNC	AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198		11.37:g.57471528_57471530delGCT		Somatic	0	34	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med19_met,pfam_DNA-dir_RNA_pol1_su_RPA34	p.S242in_frame_del	ENST00000287169.3	37	c.726_724	CCDS7965.1	11																																																																																			-	NULL		0.542	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED19	protein_coding	OTTHUMT00000393694.1	GCT	NM_015457			57471521	-1	no_errors	ENST00000431606	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
TPTE2P5	100616668	genome.wustl.edu	37	13	41429945	41429945	+	RNA	SNP	C	C	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr13:41429945C>A	ENST00000432905.1	-	0	0									transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 pseudogene 5																		AGAAACTGCACGACTTCCTAA	0.348																																																	0								ENSG00000168852																																			TPTE2P5			0			-	HGNC			13q14.11	2012-06-20			ENSG00000168852	ENSG00000168852			42356	pseudogene	pseudogene							Standard	NR_038258		Approved		uc001uxo.2		OTTHUMG00000016779		13.37:g.41429945C>A		Somatic	0	53	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	80	30.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000432905.1	37	NULL		13																																																																																			-	-		0.348	TPTE2P5-003	KNOWN	basic	processed_transcript	TPTE2P5	pseudogene	OTTHUMT00000044650.1	C		-		41429945	-1	no_errors	ENST00000379515	ensembl	human	known	74_37	rna	SNP	0.334	A
KRTAP5-5	439915	genome.wustl.edu	37	11	1651597	1651597	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:1651597C>T	ENST00000399676.2	+	1	565	c.527C>T	c.(526-528)tCc>tTc	p.S176F		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	176	8 X 4 AA repeats of C-C-X-P.			Missing (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.Y192_P201delYCCQSSCCKP(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGCTGCCAGTCCAGCTGCTGT	0.617																																																	1	Deletion - In frame(1)	ovary(1)						ENSG00000185940						79.0	94.0	89.0					11																	1651597		2201	4298	6499	KRTAP5-5	SO:0001583	missense	0			-	HGNC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.527C>T	11.37:g.1651597C>T	ENSP00000382584:p.Ser176Phe	Somatic	0	116	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	95	18.80	A8MWN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S176F	ENST00000399676.2	37	c.527	CCDS41592.1	11	.	.	.	.	.	.	.	.	.	.	c	2.923	-0.222699	0.06061	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01538	4.79	3.78	2.86	0.33363	.	.	.	.	.	T	0.05364	0.0142	M	0.90759	3.145	0.09310	N	1	B	0.18166	0.026	B	0.19391	0.025	T	0.10154	-1.0642	9	0.59425	D	0.04	.	11.064	0.47964	0.0:0.8095:0.1904:0.0	.	176	Q701N2	KRA55_HUMAN	F	176;147	ENSP00000382584:S176F	ENSP00000382584:S176F	S	+	2	0	KRTAP5-5	1608173	0.001000	0.12720	0.434000	0.26772	0.031000	0.12232	0.209000	0.17435	0.583000	0.29574	-0.243000	0.11985	TCC	-	NULL		0.617	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	C		-		1651597	+1	no_errors	ENST00000399676	ensembl	human	known	74_37	missense	SNP	0.192	T
ID4	3400	genome.wustl.edu	37	6	19838106	19838108	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	GCG	GCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr6:19838106_19838108delGCG	ENST00000378700.3	+	1	490_492	c.121_123delGCG	c.(121-123)gcgdel	p.A48del	RP1-167F1.2_ENST00000432171.2_RNA	NM_001546.3	NP_001537.1	P47928	ID4_HUMAN	inhibitor of DNA binding 4, dominant negative helix-loop-helix protein	48	Poly-Ala.				cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex neuron differentiation (GO:0021895)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|hippocampus development (GO:0021766)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuroblast proliferation (GO:0007405)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			lung(1)	1	Ovarian(93;0.0355)|Breast(50;0.0654)|all_epithelial(95;0.12)		OV - Ovarian serous cystadenocarcinoma(7;0.00659)|all cancers(50;0.0327)|Epithelial(50;0.0621)			CTCCGCAGCCgcggcggcggcgg	0.788																																					Esophageal Squamous(13;105 518 19978 28644 46870)												0								ENSG00000172201			0,152		0,0,76						-2.7	0.9			1	16,642		6,4,319	no	coding	ID4	NM_001546.2		6,4,395	A1A1,A1R,RR		2.4316,0.0,1.9753				16,794				ID4	SO:0001651	inframe_deletion	0				HGNC	U16153	CCDS4544.1	6p22.3	2013-05-21			ENSG00000172201	ENSG00000172201		"""Basic helix-loop-helix proteins"""	5363	protein-coding gene	gene with protein product		600581				7665172	Standard	NM_001546		Approved	bHLHb27	uc003ncw.4	P47928	OTTHUMG00000014333	ENST00000378700.3:c.121_123delGCG	6.37:g.19838115_19838117delGCG	ENSP00000367972:p.Ala48del	Somatic	0	13	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	Q13005	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,smart_bHLH_dom,pfscan_bHLH_dom	p.A44in_frame_del	ENST00000378700.3	37	c.121_123	CCDS4544.1	6																																																																																			-	superfamily_Trp_syn_b_sub_like_PLP_eny_SF		0.788	ID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ID4	protein_coding	OTTHUMT00000039979.1	GCG	NM_001546			19838108	+1	no_errors	ENST00000378700	ensembl	human	known	74_37	in_frame_del	DEL	0.988:0.989:0.984	-
HGF	3082	genome.wustl.edu	37	7	81392065	81392065	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr7:81392065G>T	ENST00000222390.5	-	2	438	c.212C>A	c.(211-213)gCt>gAt	p.A71D	HGF_ENST00000453018.1_5'UTR|HGF_ENST00000453411.1_Missense_Mutation_p.A71D|HGF_ENST00000457544.2_Missense_Mutation_p.A71D|HGF_ENST00000444829.2_Missense_Mutation_p.A71D|HGF_ENST00000423064.2_Missense_Mutation_p.A71D|HGF_ENST00000354224.6_Missense_Mutation_p.A71D	NM_000601.4	NP_000592.3	P14210	HGF_HUMAN	hepatocyte growth factor (hepapoietin A; scatter factor)	71	PAN. {ECO:0000255|PROSITE- ProRule:PRU00315}.				activation of MAPK activity (GO:0000187)|blood coagulation (GO:0007596)|cell chemotaxis (GO:0060326)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epithelial to mesenchymal transition (GO:0001837)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|hyaluronan metabolic process (GO:0030212)|liver development (GO:0001889)|mitotic nuclear division (GO:0007067)|myoblast proliferation (GO:0051450)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of hydrogen peroxide-mediated programmed cell death (GO:1901299)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|organ regeneration (GO:0031100)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	catalytic activity (GO:0003824)|chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|identical protein binding (GO:0042802)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(41)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	75						ACATCTATTAGCACATTGGTC	0.308																																																	0								ENSG00000019991						197.0	179.0	185.0					7																	81392065		2203	4296	6499	HGF	SO:0001583	missense	0			-	HGNC		CCDS5597.1, CCDS47626.1, CCDS47627.1, CCDS47628.1, CCDS47629.1	7q21.1	2009-09-11			ENSG00000019991	ENSG00000019991			4893	protein-coding gene	gene with protein product	"""hepatopoietin A"", ""fibroblast-derived tumor cytotoxic factor"", ""scatter factor"", ""lung fibroblast-derived mitogen"""	142409	"""deafness, autosomal recessive 39"""	DFNB39		1837206, 19576567	Standard	XM_006715956		Approved	SF, F-TCF, HGFB, HPTA	uc003uhl.3	P14210	OTTHUMG00000023804	ENST00000222390.5:c.212C>A	7.37:g.81392065G>T	ENSP00000222390:p.Ala71Asp	Somatic	0	53	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A1L3U6|Q02935|Q13494|Q14519|Q3KRB2|Q8TCE2|Q9BYL9|Q9BYM0|Q9UDU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kringle,pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.A71D	ENST00000222390.5	37	c.212	CCDS5597.1	7	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570238	0.86542	.	.	ENSG00000019991	ENST00000222390;ENST00000457544;ENST00000444829;ENST00000453411;ENST00000394769;ENST00000423064;ENST00000354224;ENST00000412881;ENST00000421558	D;D;D;D;D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67;-2.67;-2.67;-2.67;-2.67	5.72	5.72	0.89469	PAN-1 domain (1);Apple-like (2);	0.000000	0.85682	D	0.000000	D	0.95249	0.8459	M	0.72894	2.215	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.998	D	0.95211	0.8325	10	0.87932	D	0	.	19.8968	0.96969	0.0:0.0:1.0:0.0	.	106;71;71;71;71	Q59H59;P14210-5;P14210-2;P14210-3;P14210	.;.;.;.;HGF_HUMAN	D	71	ENSP00000222390:A71D;ENSP00000391238:A71D;ENSP00000389854:A71D;ENSP00000408270:A71D;ENSP00000413829:A71D;ENSP00000346164:A71D;ENSP00000396307:A71D;ENSP00000388592:A71D	ENSP00000222390:A71D	A	-	2	0	HGF	81230001	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.451000	0.73481	2.691000	0.91804	0.655000	0.94253	GCT	-	pfam_PAN-1_domain,smart_Pan_app,pfscan_Pan_app		0.308	HGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGF	protein_coding	OTTHUMT00000253315.2	G	NM_000601	-		81392065	-1	no_errors	ENST00000222390	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKRD28	23243	genome.wustl.edu	37	3	15838150	15838151	+	Intron	INS	-	-	TT	rs397988804|rs144777884|rs34139082|rs192856159|rs201201313	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr3:15838150_15838151insTT	ENST00000399451.2	-	2	395				ANKRD28_ENST00000497037.1_Intron|ANKRD28_ENST00000383777.1_5'Flank	NM_001195098.1|NM_001195099.1|NM_015199.3	NP_001182027.1|NP_001182028.1|NP_056014.2	O15084	ANR28_HUMAN	ankyrin repeat domain 28							nucleus (GO:0005634)				breast(2)|endometrium(1)|large_intestine(2)|prostate(1)	6						GCACAGCTGGGTTTTTTTTTTT	0.297																																																	0								ENSG00000206560																																			ANKRD28	SO:0001627	intron_variant	0				HGNC	AY367056	CCDS46769.1, CCDS74908.1	3p25.1	2013-01-10			ENSG00000206560	ENSG00000206560		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	29024	protein-coding gene	gene with protein product	"""phosphatase interactor targeting K protein"", ""protein phosphatase 6 ankyrin repeat subunit A"", ""protein phosphatase 1, regulatory subunit 65"""	611122				9205841	Standard	NM_015199		Approved	KIAA0379, PITK, PP6-ARS-A, PPP1R65	uc003caj.1	O15084	OTTHUMG00000155379	ENST00000399451.2:c.28-1337->AA	3.37:g.15838159_15838160dupTT		Somatic	0	13	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	4	50.00	B4DES5|Q1WWL4|Q29RW6|Q3B857|Q6ULS0|Q6ZT57	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399451.2	37	NULL	CCDS46769.1	3																																																																																			-	-		0.297	ANKRD28-003	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ANKRD28	protein_coding	OTTHUMT00000339758.1	-	NM_015199			15838151	-1	no_errors	ENST00000461696	ensembl	human	known	74_37	rna	INS	0.016:0.428	TT
BTAF1	9044	genome.wustl.edu	37	10	93717044	93717044	+	Silent	SNP	C	C	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr10:93717044C>A	ENST00000265990.6	+	8	1202	c.894C>A	c.(892-894)tcC>tcA	p.S298S	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	298					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TTAATCCCTCCTGGGAGGTAA	0.358																																																	0								ENSG00000095564						99.0	97.0	97.0					10																	93717044		2203	4300	6503	BTAF1	SO:0001819	synonymous_variant	0			-	HGNC	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.894C>A	10.37:g.93717044C>A		Somatic	0	26	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B4E0W6|O43578	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S298	ENST00000265990.6	37	c.894	CCDS7419.1	10																																																																																			-	superfamily_ARM-type_fold		0.358	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	protein_coding	OTTHUMT00000049380.4	C	NM_003972	-		93717044	+1	no_errors	ENST00000265990	ensembl	human	known	74_37	silent	SNP	0.990	A
CCDC43	124808	genome.wustl.edu	37	17	42761285	42761285	+	Nonsense_Mutation	SNP	G	G	A	rs369330972		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr17:42761285G>A	ENST00000315286.8	-	2	255	c.247C>T	c.(247-249)Cga>Tga	p.R83*	CCDC43_ENST00000457422.2_Nonsense_Mutation_p.R83*|C17orf104_ENST00000588805.1_Intron|CCDC43_ENST00000588210.1_Nonsense_Mutation_p.R83*	NM_144609.2	NP_653210.2	Q96MW1	CCD43_HUMAN	coiled-coil domain containing 43	83										lung(2)	2		Prostate(33;0.0322)				TCTGACCATCGTTCCACAATC	0.413																																																	0								ENSG00000180329	G	stop/ARG,stop/ARG	0,3724		0,0,1862	119.0	113.0	115.0		247,247	4.9	1.0	17		115	1,8193		0,1,4096	no	stop-gained,stop-gained	CCDC43	NM_001099225.1,NM_144609.2	,	0,1,5958	AA,AG,GG		0.0122,0.0,0.0084	,	83/155,83/225	42761285	1,11917	1862	4097	5959	CCDC43	SO:0001587	stop_gained	0			-	HGNC	AK056357	CCDS45704.1, CCDS45705.1	17q21.31	2005-12-16							26472	protein-coding gene	gene with protein product						12477932	Standard	NM_001099225		Approved	FLJ31795	uc002ihc.2	Q96MW1		ENST00000315286.8:c.247C>T	17.37:g.42761285G>A	ENSP00000323782:p.Arg83*	Somatic	0	30	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	C9JVK9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R83*	ENST00000315286.8	37	c.247	CCDS45704.1	17	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645266	0.87859	0.0	1.22E-4	ENSG00000180329	ENST00000315286;ENST00000457422	.	.	.	5.9	4.92	0.64577	.	0.226773	0.42172	D	0.000757	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07990	T	0.79	0.0084	8.7035	0.34340	0.0764:0.0:0.6868:0.2368	.	.	.	.	X	83	.	ENSP00000323782:R83X	R	-	1	2	CCDC43	40116811	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.833000	0.55790	2.788000	0.95919	0.650000	0.86243	CGA	-	NULL		0.413	CCDC43-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	CCDC43	protein_coding	OTTHUMT00000457812.1	G	NM_144609	-		42761285	-1	no_errors	ENST00000315286	ensembl	human	known	74_37	nonsense	SNP	0.996	A
ADH1A	124	genome.wustl.edu	37	4	100200649	100200649	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr4:100200649delA	ENST00000209668.2	-	8	1150	c.1037delT	c.(1036-1038)ttafs	p.L346fs	RP11-696N14.1_ENST00000500358.2_RNA|RP11-696N14.1_ENST00000506160.1_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	346					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	ATGGGTTATTAATGCATCCAA	0.318																																																	0								ENSG00000187758						99.0	102.0	101.0					4																	100200649		2203	4299	6502	ADH1A	SO:0001589	frameshift_variant	0				HGNC	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.1037delT	4.37:g.100200649delA	ENSP00000209668:p.Leu346fs	Somatic	0	59	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	A8K3E3|Q17R68	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.L346fs	ENST00000209668.2	37	c.1037	CCDS3648.1	4																																																																																			-	superfamily_GroES-like,smart_PKS_ER		0.318	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH1A	protein_coding	OTTHUMT00000253669.1	A	NM_000667			100200649	-1	no_errors	ENST00000209668	ensembl	human	known	74_37	frame_shift_del	DEL	0.923	-
OS9	10956	genome.wustl.edu	37	12	58112966	58112966	+	Splice_Site	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr12:58112966G>T	ENST00000315970.7	+	12	1641		c.e12+1		OS9_ENST00000439210.2_Splice_Site|OS9_ENST00000435406.2_Splice_Site|OS9_ENST00000257966.8_Splice_Site|OS9_ENST00000389146.6_Splice_Site|OS9_ENST00000413095.2_Splice_Site|OS9_ENST00000551035.1_Splice_Site|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000552285.1_Splice_Site|OS9_ENST00000389142.5_Splice_Site	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			CAACCTACAGGTGAGAGCAGT	0.512																																																	0								ENSG00000135506						72.0	70.0	71.0					12																	58112966		2203	4300	6503	OS9	SO:0001630	splice_region_variant	0			-	HGNC	AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.1600+1G>T	12.37:g.58112966G>T		Somatic	0	41	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e12+1	ENST00000315970.7	37	c.1600+1	CCDS31843.1	12	.	.	.	.	.	.	.	.	.	.	G	18.51	3.640615	0.67244	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000439210;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000389142	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6968	0.62585	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OS9	56399233	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.124000	0.57924	2.619000	0.88677	0.455000	0.32223	.	-	-		0.512	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	protein_coding	OTTHUMT00000408344.1	G	NM_006812	-	Intron	58112966	+1	no_errors	ENST00000315970	ensembl	human	known	74_37	splice_site	SNP	1.000	T
SEC16A	9919	genome.wustl.edu	37	9	139347922	139347922	+	Silent	SNP	G	G	T	rs144334278	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr9:139347922G>T	ENST00000371706.3	-	20	5616	c.5583C>A	c.(5581-5583)tcC>tcA	p.S1861S	SEC16A_ENST00000398335.1_5'Flank|SEC16A_ENST00000431893.2_Silent_p.S1861S|SEC16A_ENST00000313050.7_Silent_p.S2039S|SEC16A_ENST00000290037.6_Silent_p.S1861S			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	1861	Pro-rich.				COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		CGCTTAGCTCGGAAAGTGAGT	0.453																																																	0								ENSG00000148396						86.0	88.0	87.0					9																	139347922		1901	4120	6021	SEC16A	SO:0001819	synonymous_variant	0			-	HGNC	AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.5583C>A	9.37:g.139347922G>T		Somatic	0	66	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S2039	ENST00000371706.3	37	c.6117		9																																																																																			-	NULL		0.453	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	protein_coding	OTTHUMT00000055077.1	G	XM_088459	-		139347922	-1	no_errors	ENST00000313050	ensembl	human	known	74_37	silent	SNP	0.010	T
KRTAP5-5	439915	genome.wustl.edu	37	11	1651627	1651627	+	Missense_Mutation	SNP	C	C	T	rs576867883|rs71025765		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:1651627C>T	ENST00000399676.2	+	1	595	c.557C>T	c.(556-558)tCc>tTc	p.S186F		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	186	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.Y182_P191delYCCQSSCCKP(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGCTGCCAGTCCAGCTGCTGT	0.602																																																	1	Deletion - In frame(1)	urinary_tract(1)						ENSG00000185940						67.0	72.0	70.0					11																	1651627		2200	4292	6492	KRTAP5-5	SO:0001583	missense	0			-	HGNC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.557C>T	11.37:g.1651627C>T	ENSP00000382584:p.Ser186Phe	Somatic	0	101	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	102	8.93	A8MWN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S186F	ENST00000399676.2	37	c.557	CCDS41592.1	11	.	.	.	.	.	.	.	.	.	.	c	6.961	0.547285	0.13312	.	.	ENSG00000185940	ENST00000399676;ENST00000422553	T	0.01505	4.82	3.51	3.51	0.40186	.	.	.	.	.	T	0.06371	0.0164	M	0.93763	3.455	0.26180	N	0.979737	B	0.25850	0.136	B	0.24394	0.053	T	0.03443	-1.1036	9	0.72032	D	0.01	.	12.5263	0.56087	0.0:1.0:0.0:0.0	.	186	Q701N2	KRA55_HUMAN	F	186;157	ENSP00000382584:S186F	ENSP00000382584:S186F	S	+	2	0	KRTAP5-5	1608203	0.609000	0.26975	0.995000	0.50966	0.160000	0.22226	0.369000	0.20416	1.491000	0.48482	0.471000	0.43371	TCC	-	NULL		0.602	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	C		-		1651627	+1	no_errors	ENST00000399676	ensembl	human	known	74_37	missense	SNP	0.931	T
SND1	27044	genome.wustl.edu	37	7	127721533	127721533	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr7:127721533A>C	ENST00000354725.3	+	18	2284	c.2090A>C	c.(2089-2091)tAc>tCc	p.Y697S	MIR593_ENST00000384856.1_RNA	NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	697					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						CTGCACTTCTACGTGCAGGAT	0.622																																																	0								ENSG00000197157						117.0	82.0	94.0					7																	127721533		2203	4300	6503	SND1	SO:0001583	missense	0			-	HGNC		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2090A>C	7.37:g.127721533A>C	ENSP00000346762:p.Tyr697Ser	Somatic	0	32	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	15	40.00	Q13122|Q96AG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Staphylococal_nuclease_OB-fold,pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Staphylococal_nuclease_OB-fold,smart_Tudor,pirsf_Silence_cplx_Nase-comp_TudorSN,pfscan_Tudor,pfscan_Staphylococal_nuclease_OB-fold	p.Y697S	ENST00000354725.3	37	c.2090	CCDS34747.1	7	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002016	0.74932	.	.	ENSG00000197157	ENST00000354725;ENST00000438400;ENST00000486037	T;T	0.13089	2.62;2.62	5.54	5.54	0.83059	Maternal tudor protein (1);	0.000000	0.85682	D	0.000000	T	0.35624	0.0938	M	0.70275	2.135	0.58432	D	0.999999	D	0.62365	0.991	D	0.76071	0.987	T	0.03278	-1.1053	10	0.39692	T	0.17	-12.9419	13.9049	0.63828	1.0:0.0:0.0:0.0	.	697	Q7KZF4	SND1_HUMAN	S	697;687;183	ENSP00000346762:Y697S;ENSP00000419327:Y183S	ENSP00000346762:Y697S	Y	+	2	0	SND1	127508769	1.000000	0.71417	0.962000	0.40283	0.991000	0.79684	6.740000	0.74832	2.234000	0.73211	0.459000	0.35465	TAC	-	pfam_Tudor,pirsf_Silence_cplx_Nase-comp_TudorSN		0.622	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SND1	protein_coding	OTTHUMT00000349148.1	A	NM_014390	-		127721533	+1	no_errors	ENST00000354725	ensembl	human	known	74_37	missense	SNP	0.997	C
TMTC3	160418	genome.wustl.edu	37	12	88589095	88589095	+	Frame_Shift_Del	DEL	A	A	-	rs533472310		TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr12:88589095delA	ENST00000266712.6	+	14	2634	c.2414delA	c.(2413-2415)gaafs	p.E805fs		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	806					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						CCACATGAAGAATATATTCAG	0.348																																																	0								ENSG00000139324						75.0	79.0	77.0					12																	88589095		2203	4298	6501	TMTC3	SO:0001589	frameshift_variant	0				HGNC		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.2414delA	12.37:g.88589095delA	ENSP00000266712:p.Glu805fs	Somatic	0	33	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TPR_2,pfam_TPR_1,pfam_DUF1736,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E805fs	ENST00000266712.6	37	c.2414	CCDS9032.1	12																																																																																			-	NULL		0.348	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC3	protein_coding	OTTHUMT00000406421.1	A	NM_181783			88589095	+1	no_errors	ENST00000266712	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SF1	7536	genome.wustl.edu	37	11	64535176	64535176	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr11:64535176G>T	ENST00000377390.3	-	10	1546	c.1209C>A	c.(1207-1209)agC>agA	p.S403R	SF1_ENST00000433274.2_Missense_Mutation_p.S377R|SF1_ENST00000377394.3_Missense_Mutation_p.S403R|SF1_ENST00000334944.5_Missense_Mutation_p.S403R|SF1_ENST00000227503.9_Missense_Mutation_p.S403R|SF1_ENST00000377387.1_Missense_Mutation_p.S528R|SF1_ENST00000422298.2_Missense_Mutation_p.S288R|SF1_ENST00000489544.1_5'Flank	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	403	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						CACCTGTCAGGCTGGGTAATG	0.652											OREG0004010|OREG0021062	type=REGULATORY REGION|Gene=LOC476031|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000168066						49.0	53.0	52.0					11																	64535176		2201	4297	6498	SF1	SO:0001583	missense	0			-	HGNC	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1209C>A	11.37:g.64535176G>T	ENSP00000366607:p.Ser403Arg	Somatic	0	36	0.00	1077	0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_KH_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_KH_dom_type_1	p.S403R	ENST00000377390.3	37	c.1209	CCDS31599.1	11	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122649	0.56613	.	.	ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000377394;ENST00000334944;ENST00000422298;ENST00000443908;ENST00000433274;ENST00000486867	T;T;T;T;T;T;T;T;T	0.52983	0.93;0.96;0.94;0.92;0.93;0.95;0.64;0.95;0.8	5.82	5.82	0.92795	.	0.225843	0.53938	D	0.000060	T	0.43634	0.1256	L	0.34521	1.04	0.45580	D	0.998523	B;P;P;B;P;P	0.42518	0.198;0.557;0.557;0.421;0.557;0.782	B;B;B;B;B;P	0.48677	0.055;0.349;0.282;0.146;0.282;0.586	T	0.13953	-1.0490	10	0.17832	T	0.49	.	10.9399	0.47268	0.0843:0.0:0.9157:0.0	.	288;403;403;403;403;528	B4DX42;Q15637-6;Q15637-4;Q15637;Q15637-2;Q15637-5	.;.;.;SF01_HUMAN;.;.	R	528;403;403;403;403;288;47;377;124	ENSP00000366604:S528R;ENSP00000366607:S403R;ENSP00000227503:S403R;ENSP00000366611:S403R;ENSP00000334414:S403R;ENSP00000413084:S288R;ENSP00000391198:S47R;ENSP00000396793:S377R;ENSP00000419062:S124R	ENSP00000227503:S403R	S	-	3	2	SF1	64291752	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.808000	0.47963	2.759000	0.94783	0.555000	0.69702	AGC	-	NULL		0.652	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SF1	protein_coding	OTTHUMT00000143242.1	G	NM_004630	-		64535176	-1	no_errors	ENST00000377390	ensembl	human	known	74_37	missense	SNP	1.000	T
SERPINF2	5345	genome.wustl.edu	37	17	1657814	1657814	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr17:1657814G>A	ENST00000324015.3	+	10	1539	c.1462G>A	c.(1462-1464)Ggc>Agc	p.G488S	SERPINF2_ENST00000382061.4_Missense_Mutation_p.G488S|SERPINF2_ENST00000450523.2_Missense_Mutation_p.G424S	NM_000934.3	NP_000925.2	P08697	A2AP_HUMAN	serpin peptidase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2	488					acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|collagen fibril organization (GO:0030199)|fibrinolysis (GO:0042730)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of proteolysis (GO:0030162)|response to organic substance (GO:0010033)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	endopeptidase inhibitor activity (GO:0004866)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(1)|kidney(2)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Ocriplasmin(DB08888)	CCCCCAGTTTGGCAGCCCCAA	0.602																																																	0								ENSG00000167711						42.0	48.0	46.0					17																	1657814		2203	4300	6503	SERPINF2	SO:0001583	missense	0			-	HGNC	D00174	CCDS11011.1, CCDS54064.1	17p13.3	2014-02-18	2005-08-18		ENSG00000167711	ENSG00000167711		"""Serine (or cysteine) peptidase inhibitors"""	9075	protein-coding gene	gene with protein product	"""alpha-2-plasmin inhibitor"", ""alpha-2-antiplasmin"""	613168	"""serine (or cysteine) proteinase inhibitor, clade F (alpha-2 antiplasmin, pigment epithelium derived factor), member 2"""	PLI		3416655, 24172014	Standard	NM_000934		Approved	API, ALPHA-2-PI, A2AP, AAP	uc002ftk.1	P08697	OTTHUMG00000090552	ENST00000324015.3:c.1462G>A	17.37:g.1657814G>A	ENSP00000321853:p.Gly488Ser	Somatic	0	18	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	2	84.62	B4E1B7|Q8N5U7|Q9UCG2|Q9UCG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.G488S	ENST00000324015.3	37	c.1462	CCDS11011.1	17	.	.	.	.	.	.	.	.	.	.	G	0.960	-0.703642	0.03255	.	.	ENSG00000167711	ENST00000324015;ENST00000450523;ENST00000382061	D;D;D	0.83914	-1.75;-1.78;-1.75	5.5	-1.51	0.08664	.	0.894418	0.09736	N	0.762503	T	0.52629	0.1746	N	0.01705	-0.755	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.06405	0.002;0.002	T	0.42916	-0.9423	9	.	.	.	.	2.5552	0.04758	0.3777:0.3601:0.1536:0.1087	.	424;488	B4E1B7;P08697	.;A2AP_HUMAN	S	488;424;488	ENSP00000321853:G488S;ENSP00000403877:G424S;ENSP00000371493:G488S	.	G	+	1	0	SERPINF2	1604564	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.152000	0.16302	-0.154000	0.11118	-1.240000	0.01540	GGC	-	NULL		0.602	SERPINF2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINF2	protein_coding	OTTHUMT00000207078.3	G	NM_000934	-		1657814	+1	no_errors	ENST00000324015	ensembl	human	known	74_37	missense	SNP	0.000	A
CENPB	1059	genome.wustl.edu	37	20	3767122	3767184	+	Start_Codon_Del	DEL	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	-	rs537544733|rs200157177|rs567385184|rs370139399|rs267605931	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr20:3767122_3767184delGGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	ENST00000379751.4	-	0	153_215				CDC25B_ENST00000379598.5_5'Flank|CDC25B_ENST00000344256.6_5'Flank	NM_001810.5	NP_001801.1	P07199	CENPB_HUMAN	centromere protein B, 80kDa						regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)	centromeric DNA binding (GO:0019237)|chromatin binding (GO:0003682)|satellite DNA binding (GO:0003696)|sequence-specific DNA binding (GO:0043565)			kidney(1)|large_intestine(2)|lung(4)|skin(1)	8						GTCGCCTCTTGGGGCCCATcccggcgcgccccccgccccggggcccggcgccgccgccgccgccccggggcggggggcccggg	0.798																																																	0								ENSG00000125817																																			CENPB	SO:0001582	initiator_codon_variant	0				HGNC	X05299	CCDS13064.1	20p13	2013-11-05	2002-08-29		ENSG00000125817	ENSG00000125817			1852	protein-coding gene	gene with protein product		117140	"""centromere protein B (80kD)"""			8406460, 11884609	Standard	NM_001810		Approved		uc002wjk.3	P07199	OTTHUMG00000031761		20.37:g.3767122_3767184delGGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG		Somatic	NA	NA	NA		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96EI4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Centromere_CenpB_dimerisation,pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_Psq,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.MGP1in_frame_del	ENST00000379751.4	37	c.9_1	CCDS13064.1	20																																																																																			-	superfamily_Homeodomain-like,pfscan_HTH_Psq		0.798	CENPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPB	protein_coding	OTTHUMT00000077772.2	GGGGCCCATCCCGGCGCGCCCCCCGCCCCGGGGCCCGGCGCCGCCGCCGCCGCCCCGGGGCGG	NM_001810			3767184	-1	no_errors	ENST00000379751	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
CRAT	1384	genome.wustl.edu	37	9	131871486	131871486	+	Intron	SNP	T	T	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr9:131871486T>A	ENST00000318080.2	-	2	322				PPP2R4_ENST00000348141.5_5'Flank|CRAT_ENST00000464290.1_Intron|PPP2R4_ENST00000393370.2_5'Flank|PPP2R4_ENST00000452489.2_5'Flank|PPP2R4_ENST00000357197.4_5'Flank|AL158151.2_ENST00000408594.1_RNA|PPP2R4_ENST00000337738.1_5'Flank|PPP2R4_ENST00000355007.3_5'Flank|PPP2R4_ENST00000358994.4_5'Flank|PPP2R4_ENST00000347048.4_5'Flank|CRAT_ENST00000393384.3_Intron	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase						carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	ATCGTTTTGATGAGGGAAAAC	0.502											OREG0003931	type=REGULATORY REGION|Gene=CRAT|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0								ENSG00000095321																																			CRAT	SO:0001627	intron_variant	0			-	HGNC	X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.28-1130A>T	9.37:g.131871486T>A		Somatic	0	17	0.00	1591	0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	24	29.41	Q5T952|Q9BW16	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H33L	ENST00000318080.2	37	c.98	CCDS6919.1	9																																																																																			-	NULL		0.502	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	protein_coding	OTTHUMT00000253700.1	T		-		131871486	-1	no_errors	ENST00000441796	ensembl	human	known	74_37	missense	SNP	0.001	A
IGDCC3	9543	genome.wustl.edu	37	15	65628224	65628224	+	Silent	SNP	G	G	A			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr15:65628224G>A	ENST00000327987.4	-	3	731	c.480C>T	c.(478-480)tgC>tgT	p.C160C	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	160	Ig-like C2-type 2.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CATGGATTTGGCACTGGAAGC	0.577																																																	0								ENSG00000174498						137.0	121.0	127.0					15																	65628224		2201	4299	6500	IGDCC3	SO:0001819	synonymous_variant	0			-	HGNC	AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.480C>T	15.37:g.65628224G>A		Somatic	0	33	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	19	38.71	O95215	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.C160	ENST00000327987.4	37	c.480	CCDS10205.1	15																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.577	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	protein_coding	OTTHUMT00000256826.1	G	NM_004884	-		65628224	-1	no_errors	ENST00000327987	ensembl	human	known	74_37	silent	SNP	1.000	A
LRRC7	57554	genome.wustl.edu	37	1	70226053	70226053	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr1:70226053A>T	ENST00000035383.5	+	1	196	c.166A>T	c.(166-168)Aat>Tat	p.N56Y	LRRC7_ENST00000370958.1_Missense_Mutation_p.N94Y|LRRC7_ENST00000310961.5_Missense_Mutation_p.N61Y|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	56						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TCTAGATGCCAATCAAATTGA	0.333																																																	0								ENSG00000033122						77.0	78.0	77.0					1																	70226053		2203	4299	6502	LRRC7	SO:0001583	missense	0			-	HGNC		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.166A>T	1.37:g.70226053A>T	ENSP00000035383:p.Asn56Tyr	Somatic	0	38	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.N56Y	ENST00000035383.5	37	c.166	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.303994	0.81136	.	.	ENSG00000033122	ENST00000310961;ENST00000370958;ENST00000035383;ENST00000335298	T;T;T	0.62232	1.37;0.04;1.65	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.80358	0.4608	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.995;1.0	D	0.85298	0.1071	10	0.87932	D	0	.	14.8723	0.70468	1.0:0.0:0.0:0.0	.	56;94	Q96NW7;B1AKT2	LRRC7_HUMAN;.	Y	61;94;56;56	ENSP00000309245:N61Y;ENSP00000359997:N94Y;ENSP00000035383:N56Y	ENSP00000035383:N56Y	N	+	1	0	LRRC7	69998641	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.339000	0.96797	2.197000	0.70478	0.477000	0.44152	AAT	-	smart_Leu-rich_rpt_typical-subtyp		0.333	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	protein_coding	OTTHUMT00000131261.1	A	NM_020794	-		70226053	+1	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	SNP	1.000	T
NOTUM	147111	genome.wustl.edu	37	17	79918624	79918624	+	Silent	SNP	C	C	T	rs181598785	byFrequency	TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr17:79918624C>T	ENST00000409678.3	-	1	545	c.162G>A	c.(160-162)ctG>ctA	p.L54L		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	54						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CCGTGAAGTCCAGCGGGAAGC	0.711																																																	0								ENSG00000185269						19.0	15.0	16.0					17																	79918624		2183	4291	6474	NOTUM	SO:0001819	synonymous_variant	0			-	HGNC	BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.162G>A	17.37:g.79918624C>T		Somatic	0	38	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q8N410|Q8NI82	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NOTUM	p.L54	ENST00000409678.3	37	c.162	CCDS32771.2	17																																																																																			-	NULL		0.711	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTUM	protein_coding	OTTHUMT00000335123.2	C	NM_178493	-		79918624	-1	no_errors	ENST00000409678	ensembl	human	known	74_37	silent	SNP	1.000	T
MAP1S	55201	genome.wustl.edu	37	19	17837618	17837618	+	Silent	SNP	C	C	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr19:17837618C>T	ENST00000324096.4	+	5	1576	c.1425C>T	c.(1423-1425)agC>agT	p.S475S	CTD-3149D2.4_ENST00000595363.1_RNA|MAP1S_ENST00000544059.2_Silent_p.S449S|MAP1S_ENST00000597681.1_Intron	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	475	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						GCAAAGAGAGCGTGGGCTCCC	0.716																																																	0								ENSG00000130479						3.0	5.0	4.0					19																	17837618		1997	3993	5990	MAP1S	SO:0001819	synonymous_variant	0			-	HGNC	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.1425C>T	19.37:g.17837618C>T		Somatic	0	33	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S475	ENST00000324096.4	37	c.1425	CCDS32954.1	19																																																																																			-	NULL		0.716	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1S	protein_coding	OTTHUMT00000466027.1	C	NM_018174	-		17837618	+1	no_errors	ENST00000324096	ensembl	human	known	74_37	silent	SNP	0.383	T
RHPN1	114822	genome.wustl.edu	37	8	144461583	144461583	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr8:144461583G>T	ENST00000289013.6	+	8	951	c.850G>T	c.(850-852)Gcc>Tcc	p.A284S		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	284	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			GATGGCCCAGGCCCAGGAATG	0.672																																																	0								ENSG00000158106						19.0	22.0	21.0					8																	144461583		2018	4179	6197	RHPN1	SO:0001583	missense	0			-	HGNC	AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.850G>T	8.37:g.144461583G>T	ENSP00000289013:p.Ala284Ser	Somatic	0	48	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	Q8TAV1|Q96PV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BRO1_dom,pfam_HR1_rho-bd,pfam_PDZ,superfamily_PDZ,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom,pfscan_PDZ	p.A284S	ENST00000289013.6	37	c.850	CCDS47927.1	8	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307897	0.81247	.	.	ENSG00000158106	ENST00000289013	T	0.53640	0.61	4.28	4.28	0.50868	.	0.062016	0.64402	D	0.000005	T	0.69940	0.3167	M	0.86953	2.85	0.53688	D	0.99997	D	0.61080	0.989	P	0.61658	0.892	T	0.77838	-0.2439	10	0.72032	D	0.01	-19.3294	16.0186	0.80464	0.0:0.0:1.0:0.0	.	284	Q8TCX5-2	.	S	284	ENSP00000289013:A284S	ENSP00000289013:A284S	A	+	1	0	RHPN1	144532726	1.000000	0.71417	1.000000	0.80357	0.475000	0.33008	5.392000	0.66272	2.099000	0.63709	0.436000	0.28706	GCC	-	pfam_BRO1_dom,pfscan_BRO1_dom		0.672	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN1	protein_coding	OTTHUMT00000381417.1	G		-		144461583	+1	no_errors	ENST00000289013	ensembl	human	known	74_37	missense	SNP	1.000	T
SKIDA1	387640	genome.wustl.edu	37	10	21805720	21805720	+	Silent	SNP	A	A	G			TCGA-DX-A8BN-01A-11D-A37C-09	TCGA-DX-A8BN-11A-22D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0238c3ff-c720-4350-b0e8-5b4823f91075	87bd9e83-45b1-430d-b7ef-bb83264ebbb3	g.chr10:21805720A>G	ENST00000449193.2	-	4	3284	c.1032T>C	c.(1030-1032)caT>caC	p.H344H	SKIDA1_ENST00000444772.3_Silent_p.H265H|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	263	Glu-rich.|Ser-rich.					nucleus (GO:0005634)											ggtggtggtgatggtggtggt	0.716																																																	0								ENSG00000180592						4.0	6.0	5.0					10																	21805720		1658	3602	5260	SKIDA1	SO:0001819	synonymous_variant	0			-	HGNC	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.1032T>C	10.37:g.21805720A>G		Somatic	0	32	0.00		0.6104760454969718	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	63	8.70	B1ANA5|Q6ZMX4|Q8N3C3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.H344	ENST00000449193.2	37	c.1032	CCDS44363.1	10																																																																																			-	NULL		0.716	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIDA1	protein_coding	OTTHUMT00000286950.2	A	NM_207371	-		21805720	-1	no_errors	ENST00000449193	ensembl	human	known	74_37	silent	SNP	0.972	G
