#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
USP27X	389856	genome.wustl.edu	37	X	49645301	49645301	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chrX:49645301C>T	ENST00000508866.2	+	1	832	c.391C>T	c.(391-393)Cgg>Tgg	p.R131W	USP27X-AS1_ENST00000437322.2_lincRNA	NM_001145073.1	NP_001138545.1	A6NNY8	UBP27_HUMAN	ubiquitin specific peptidase 27, X-linked	131	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			endometrium(7)	7						GTCGCTGTTTCGGGAGTTGTA	0.527																																																	0								ENSG00000242013						190.0	128.0	146.0					X																	49645301		692	1591	2283	USP27X	SO:0001583	missense	0			-	HGNC	AW851065	CCDS65260.1	Xp11.23	2007-10-05	2005-08-08			ENSG00000273820		"""Ubiquitin-specific peptidases"""	13486	protein-coding gene	gene with protein product			"""ubiquitin specific protease 27, X chromosome"", ""ubiquitin specific protease 27, X-linked"""			12838346	Standard	NM_001145073		Approved	USP27	uc004dop.3	A6NNY8		ENST00000508866.2:c.391C>T	X.37:g.49645301C>T	ENSP00000475071:p.Arg131Trp	Somatic	0	26	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.R131W	ENST00000508866.2	37	c.391		X																																																																																			-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.527	USP27X-001	KNOWN	basic|appris_principal	protein_coding	USP27X	protein_coding	OTTHUMT00000060837.3	C	XM_372213	-		49645301	+1	no_errors	ENST00000508866	ensembl	human	known	74_37	missense	SNP	1.000	T
KIAA1407	57577	genome.wustl.edu	37	3	113729865	113729865	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr3:113729865delT	ENST00000295878.3	-	9	1313	c.1167delA	c.(1165-1167)aaafs	p.K389fs	KIAA1407_ENST00000545063.1_Frame_Shift_Del_p.K220fs	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	389										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						CCAGTTGTTGTTTTCTAAGCA	0.398																																																	0								ENSG00000163617						131.0	128.0	129.0					3																	113729865		2203	4300	6503	KIAA1407	SO:0001589	frameshift_variant	0				HGNC	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.1167delA	3.37:g.113729865delT	ENSP00000295878:p.Lys389fs	Somatic	0	26	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	32	20.00	B4DYL1|Q9P2E0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.K389fs	ENST00000295878.3	37	c.1167	CCDS2977.1	3																																																																																			-	NULL		0.398	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	protein_coding	OTTHUMT00000354724.2	T	NM_020817			113729865	-1	no_errors	ENST00000295878	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ZNF547	284306	genome.wustl.edu	37	19	57888934	57888934	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr19:57888934C>A	ENST00000282282.3	+	4	740	c.590C>A	c.(589-591)tCc>tAc	p.S197Y	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	197					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATGGAAAGGTCCACACTCAAT	0.413																																																	0								ENSG00000152433						85.0	81.0	82.0					19																	57888934		2203	4300	6503	ZNF547	SO:0001583	missense	0			-	HGNC	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.590C>A	19.37:g.57888934C>A	ENSP00000282282:p.Ser197Tyr	Somatic	0	52	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A8K5Z9|Q96NC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S197Y	ENST00000282282.3	37	c.590	CCDS33131.1	19	.	.	.	.	.	.	.	.	.	.	C	0.497	-0.872590	0.02570	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	T	0.18502	2.21	1.87	-0.502	0.12004	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17323	0.0416	M	0.64170	1.965	0.09310	N	1	P;B;P	0.49635	0.926;0.024;0.886	P;B;B	0.44359	0.447;0.008;0.259	T	0.13656	-1.0501	9	0.41790	T	0.15	.	4.6089	0.12391	0.2502:0.6008:0.0:0.149	.	197;197;197	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	Y	197	ENSP00000282282:S197Y	ENSP00000282282:S197Y	S	+	2	0	ZNF547	62580746	0.000000	0.05858	0.000000	0.03702	0.772000	0.43724	-0.822000	0.04448	-0.106000	0.12110	0.491000	0.48974	TCC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.413	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF547	protein_coding	OTTHUMT00000465787.1	C	NM_173631	-		57888934	+1	no_errors	ENST00000282282	ensembl	human	known	74_37	missense	SNP	0.000	A
A2MP1	3	genome.wustl.edu	37	12	9415323	9415323	+	IGR	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr12:9415323C>T								RP11-118B22.4 (4767 upstream) : SNORA75 (23945 downstream)																							CACCAGTTATCAGAACAATTG	0.289																																																	0								ENSG00000256069																																			A2MP1	SO:0001628	intergenic_variant	0			-	HGNC																													12.37:g.9415323C>T		Somatic	0	70	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		12																																																																																			-	-	0	0.289					A2MP1			C		-		9415323	-1	no_errors	ENST00000544183	ensembl	human	known	74_37	rna	SNP	0.000	T
ACSBG2	81616	genome.wustl.edu	37	19	6147680	6147680	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr19:6147680G>C	ENST00000586696.1	+	3	567	c.291G>C	c.(289-291)ttG>ttC	p.L97F	ACSBG2_ENST00000252669.5_Missense_Mutation_p.L97F|ACSBG2_ENST00000588304.1_Missense_Mutation_p.L47F|ACSBG2_ENST00000591403.1_Missense_Mutation_p.L97F|ACSBG2_ENST00000588485.1_5'UTR			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	97					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CAAAATCCTTGATCAAGGTAA	0.398																																																	0								ENSG00000130377						88.0	92.0	91.0					19																	6147680		2203	4300	6503	ACSBG2	SO:0001583	missense	0			-	HGNC		CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.291G>C	19.37:g.6147680G>C	ENSP00000465589:p.Leu97Phe	Somatic	0	31	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.L97F	ENST00000586696.1	37	c.291	CCDS12159.1	19	.	.	.	.	.	.	.	.	.	.	G	0.018	-1.480194	0.01027	.	.	ENSG00000130377	ENST00000252669	T	0.38401	1.14	5.79	-11.6	0.00059	AMP-dependent synthetase/ligase (1);	0.719887	0.10367	N	0.683266	T	0.13286	0.0322	N	0.12611	0.24	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.23574	0.047;0.009	T	0.42682	-0.9437	10	0.02654	T	1	-14.833	12.7083	0.57076	0.1212:0.6662:0.1327:0.0798	.	97;97	B4DYU1;Q5FVE4	.;ACBG2_HUMAN	F	97	ENSP00000252669:L97F	ENSP00000252669:L97F	L	+	3	2	ACSBG2	6098680	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.670000	0.05256	-1.242000	0.02523	-0.150000	0.13652	TTG	-	pfam_AMP-dep_Synth/Lig		0.398	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG2	protein_coding	OTTHUMT00000452898.1	G	NM_030924	-		6147680	+1	no_errors	ENST00000252669	ensembl	human	known	74_37	missense	SNP	0.284	C
HPCAL4	51440	genome.wustl.edu	37	1	40148381	40148381	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:40148381C>T	ENST00000372844.3	-	4	794	c.403G>A	c.(403-405)Gtg>Atg	p.V135M		NM_001282396.1|NM_001282397.1|NM_016257.2	NP_001269325.1|NP_001269326.1|NP_057341.1	Q9UM19	HPCL4_HUMAN	hippocalcin like 4	135					central nervous system development (GO:0007417)|signal transduction (GO:0007165)	intracellular (GO:0005622)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|lung(5)|stomach(1)	8	all_cancers(7;4.65e-13)|Lung NSC(20;2.88e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;4.3e-17)|all cancers(16;8.48e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			ATCATGATCACGGTGCCCACC	0.562																																																	0								ENSG00000116983						92.0	79.0	83.0					1																	40148381		2203	4300	6503	HPCAL4	SO:0001583	missense	0			-	HGNC	AB001105	CCDS441.1, CCDS72761.1	1p34.2	2013-01-10			ENSG00000116983	ENSG00000116983		"""EF-hand domain containing"""	18212	protein-coding gene	gene with protein product						10520747	Standard	NM_016257		Approved	HLP4, DKFZp761G122	uc001cdr.3	Q9UM19	OTTHUMG00000009246	ENST00000372844.3:c.403G>A	1.37:g.40148381C>T	ENSP00000361935:p.Val135Met	Somatic	0	26	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2R5U2|D3DPU1|Q5TG97|Q8N611	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.V135M	ENST00000372844.3	37	c.403	CCDS441.1	1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.554902	0.86231	.	.	ENSG00000116983	ENST00000372844;ENST00000450300	T	0.67345	-0.26	4.54	4.54	0.55810	EF-hand-like domain (1);	0.000000	0.64402	D	0.000003	T	0.76737	0.4029	L	0.47016	1.485	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.71656	0.974;0.564	T	0.76929	-0.2777	10	0.45353	T	0.12	.	18.1681	0.89734	0.0:1.0:0.0:0.0	.	63;135	B4DGW9;Q9UM19	.;HPCL4_HUMAN	M	135;127	ENSP00000361935:V135M	ENSP00000361935:V135M	V	-	1	0	HPCAL4	39920968	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	7.655000	0.83696	2.473000	0.83533	0.313000	0.20887	GTG	-	NULL		0.562	HPCAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPCAL4	protein_coding	OTTHUMT00000025640.1	C	NM_016257	-		40148381	-1	no_errors	ENST00000372844	ensembl	human	known	74_37	missense	SNP	1.000	T
HEATR3	55027	genome.wustl.edu	37	16	50128658	50128658	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr16:50128658C>T	ENST00000299192.7	+	12	1744	c.1553C>T	c.(1552-1554)gCt>gTt	p.A518V	HEATR3_ENST00000285767.4_Missense_Mutation_p.A432V|HEATR3_ENST00000564942.1_3'UTR	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	518										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						ATAAGTAGTGCTTTGAGGGCC	0.323																																																	0								ENSG00000155393						102.0	107.0	105.0					16																	50128658		2198	4300	6498	HEATR3	SO:0001583	missense	0			-	HGNC	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1553C>T	16.37:g.50128658C>T	ENSP00000299192:p.Ala518Val	Somatic	0	42	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.A518V	ENST00000299192.7	37	c.1553	CCDS10739.1	16	.	.	.	.	.	.	.	.	.	.	C	32	5.156931	0.94686	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.69561	-0.41;-0.41	6.02	6.02	0.97574	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77498	0.4139	L	0.56769	1.78	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.68557	-0.5377	10	0.02654	T	1	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	432;518	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	V	432;518	ENSP00000285767:A432V;ENSP00000299192:A518V	ENSP00000285767:A432V	A	+	2	0	HEATR3	48686159	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.354000	0.73036	2.865000	0.98341	0.655000	0.94253	GCT	-	superfamily_ARM-type_fold		0.323	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR3	protein_coding	OTTHUMT00000256880.2	C	NM_182922	-		50128658	+1	no_errors	ENST00000299192	ensembl	human	known	74_37	missense	SNP	1.000	T
GMIP	51291	genome.wustl.edu	37	19	19746001	19746001	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr19:19746001G>A	ENST00000203556.4	-	16	1719	c.1582C>T	c.(1582-1584)Cgc>Tgc	p.R528C	GMIP_ENST00000587238.1_Missense_Mutation_p.R502C|GMIP_ENST00000445806.2_Missense_Mutation_p.R499C|GMIP_ENST00000586269.1_5'UTR	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	528					intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						TCCAGGCAGCGCTTGTGGCAG	0.582																																																	0								ENSG00000089639						22.0	25.0	24.0					19																	19746001		2203	4300	6503	GMIP	SO:0001583	missense	0			-	HGNC	AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.1582C>T	19.37:g.19746001G>A	ENSP00000203556:p.Arg528Cys	Somatic	0	23	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	33	34.00	A0AVN9|B7ZLZ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.R528C	ENST00000203556.4	37	c.1582	CCDS12408.1	19	.	.	.	.	.	.	.	.	.	.	G	17.24	3.340131	0.60963	.	.	ENSG00000089639	ENST00000203556;ENST00000445806	D;D	0.85411	-1.98;-1.98	5.05	5.05	0.67936	Protein kinase C-like, phorbol ester/diacylglycerol binding (3);	0.000000	0.44902	D	0.000407	D	0.88138	0.6356	L	0.43152	1.355	0.44862	D	0.997878	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71656	0.974;0.948;0.974	D	0.88726	0.3233	10	0.87932	D	0	-18.9195	11.0719	0.48008	0.0:0.0:0.8147:0.1853	.	499;502;528	E7ERB7;B7ZLZ0;Q9P107	.;.;GMIP_HUMAN	C	528;499	ENSP00000203556:R528C;ENSP00000397075:R499C	ENSP00000203556:R528C	R	-	1	0	GMIP	19607001	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.689000	0.54706	2.355000	0.79922	0.561000	0.74099	CGC	-	smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd		0.582	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMIP	protein_coding	OTTHUMT00000460551.1	G	NM_016573	-		19746001	-1	no_errors	ENST00000203556	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF569	148266	genome.wustl.edu	37	19	37905235	37905235	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr19:37905235C>T	ENST00000316950.6	-	6	882	c.325G>A	c.(325-327)Gaa>Aaa	p.E109K	ZNF569_ENST00000392150.2_5'UTR|ZNF569_ENST00000392149.2_Missense_Mutation_p.E109K|ZNF569_ENST00000592490.1_3'UTR	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	109					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCTTTTTCTTCAGTCAGTGTT	0.353																																																	0								ENSG00000196437						69.0	67.0	68.0					19																	37905235		2203	4299	6502	ZNF569	SO:0001583	missense	0			-	HGNC	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.325G>A	19.37:g.37905235C>T	ENSP00000325018:p.Glu109Lys	Somatic	0	34	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	52	11.86	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E109K	ENST00000316950.6	37	c.325	CCDS12503.1	19	.	.	.	.	.	.	.	.	.	.	C	0.100	-1.153743	0.01700	.	.	ENSG00000196437	ENST00000316950	T	0.06528	3.29	3.58	-0.815	0.10843	.	1.155070	0.06836	N	0.794810	T	0.03220	0.0094	N	0.16567	0.415	0.19300	N	0.999976	B	0.02656	0.0	B	0.01281	0.0	T	0.44877	-0.9299	10	0.06625	T	0.88	.	4.1748	0.10346	0.0:0.4496:0.1688:0.3817	.	109	Q5MCW4	ZN569_HUMAN	K	109	ENSP00000325018:E109K	ENSP00000325018:E109K	E	-	1	0	ZNF569	42597075	0.000000	0.05858	0.012000	0.15200	0.946000	0.59487	0.090000	0.15025	-0.157000	0.11059	-0.218000	0.12543	GAA	-	NULL		0.353	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF569	protein_coding	OTTHUMT00000109594.2	C	NM_152484	-		37905235	-1	no_errors	ENST00000316950	ensembl	human	known	74_37	missense	SNP	0.048	T
FAM169A	26049	genome.wustl.edu	37	5	74100335	74100335	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr5:74100335T>A	ENST00000389156.4	-	8	985	c.895A>T	c.(895-897)Agt>Tgt	p.S299C	FAM169A_ENST00000510496.1_Missense_Mutation_p.S239C|FAM169A_ENST00000380515.3_3'UTR	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	299						membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						TGCATCTCACTAGACTGATTG	0.338																																																	0								ENSG00000198780						150.0	137.0	141.0					5																	74100335		1839	4093	5932	FAM169A	SO:0001583	missense	0			-	HGNC		CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.895A>T	5.37:g.74100335T>A	ENSP00000373808:p.Ser299Cys	Somatic	0	45	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	34	12.82	A8K1T9|Q6MZT0|Q9H989	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S299C	ENST00000389156.4	37	c.895	CCDS43330.1	5	.	.	.	.	.	.	.	.	.	.	T	17.60	3.428713	0.62844	.	.	ENSG00000198780	ENST00000389156;ENST00000510496	T	0.49139	0.79	5.58	1.71	0.24356	.	0.476251	0.21718	N	0.070164	T	0.41236	0.1150	L	0.29908	0.895	0.47698	D	0.999492	D;D	0.58970	0.984;0.984	P;P	0.53360	0.634;0.724	T	0.30268	-0.9984	10	0.72032	D	0.01	-2.1386	4.6303	0.12498	0.0:0.1746:0.1628:0.6626	.	239;299	D6RB01;Q9Y6X4	.;F169A_HUMAN	C	299;239	ENSP00000373808:S299C	ENSP00000373808:S299C	S	-	1	0	FAM169A	74136091	0.027000	0.19231	0.760000	0.31359	0.978000	0.69477	0.638000	0.24674	0.406000	0.25560	0.528000	0.53228	AGT	-	NULL		0.338	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM169A	protein_coding	OTTHUMT00000371092.2	T		-		74100335	-1	no_errors	ENST00000389156	ensembl	human	known	74_37	missense	SNP	0.715	A
EPB41L4B	54566	genome.wustl.edu	37	9	112005921	112005921	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr9:112005921C>T	ENST00000374566.3	-	15	1903	c.1386G>A	c.(1384-1386)tgG>tgA	p.W462*	EPB41L4B_ENST00000374557.4_Nonsense_Mutation_p.W462*	NM_019114.3	NP_061987.3	Q9H329	E41LB_HUMAN	erythrocyte membrane protein band 4.1 like 4B	462					actomyosin structure organization (GO:0031032)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)	structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGTGAGGATGCCACCGGGGCT	0.423																																																	0								ENSG00000095203						84.0	90.0	88.0					9																	112005921		1908	4132	6040	EPB41L4B	SO:0001587	stop_gained	0			-	HGNC	AB032179	CCDS43859.1, CCDS43860.1	9q22.1-q22.3	2008-02-05			ENSG00000095203	ENSG00000095203			19818	protein-coding gene	gene with protein product		610340				10783258	Standard	NM_018424		Approved	EHM2	uc004bdz.1	Q9H329	OTTHUMG00000020470	ENST00000374566.3:c.1386G>A	9.37:g.112005921C>T	ENSP00000363694:p.Trp462*	Somatic	0	35	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	Q5T4G5|Q5T4G6|Q9H328|Q9P2V3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.W462*	ENST00000374566.3	37	c.1386	CCDS43859.1	9	.	.	.	.	.	.	.	.	.	.	C	43	10.148392	0.99346	.	.	ENSG00000095203	ENST00000262536;ENST00000374566;ENST00000374557;ENST00000311609	.	.	.	5.93	5.93	0.95920	.	0.000000	0.33650	N	0.004689	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.3388	0.94332	0.0:1.0:0.0:0.0	.	.	.	.	X	147;462;462;384	.	ENSP00000262536:W147X	W	-	3	0	EPB41L4B	111045742	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.871000	0.63042	2.808000	0.96608	0.655000	0.94253	TGG	-	NULL		0.423	EPB41L4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L4B	protein_coding	OTTHUMT00000053592.1	C	NM_018424	-		112005921	-1	no_errors	ENST00000374566	ensembl	human	known	74_37	nonsense	SNP	1.000	T
SLC4A9	83697	genome.wustl.edu	37	5	139747152	139747152	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr5:139747152G>T	ENST00000230993.6	+	15	2268	c.2233G>T	c.(2233-2235)Gaa>Taa	p.E745*	SLC4A9_ENST00000506545.1_Nonsense_Mutation_p.E658*|SLC4A9_ENST00000506757.2_Nonsense_Mutation_p.E721*|SLC4A9_ENST00000507527.1_Nonsense_Mutation_p.E745*|SLC4A9_ENST00000432095.2_Nonsense_Mutation_p.E707*	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	745	Membrane (anion exchange).				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACCGCATGGAATACAGACT	0.582																																																	0								ENSG00000113073						35.0	36.0	36.0					5																	139747152		2089	4237	6326	SLC4A9	SO:0001587	stop_gained	0			-	HGNC	AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.2233G>T	5.37:g.139747152G>T	ENSP00000230993:p.Glu745*	Somatic	0	23	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.E745*	ENST00000230993.6	37	c.2233	CCDS58973.1	5	.	.	.	.	.	.	.	.	.	.	G	19.34	3.808599	0.70797	.	.	ENSG00000113073	ENST00000230993;ENST00000506757;ENST00000432095;ENST00000506545;ENST00000507527	.	.	.	4.75	2.95	0.34219	.	0.083321	0.49305	D	0.000154	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	9.6999	0.40180	0.0734:0.0:0.7857:0.1409	.	.	.	.	X	745;721;707;658;745	.	ENSP00000230993:E745X	E	+	1	0	SLC4A9	139727336	1.000000	0.71417	0.395000	0.26283	0.142000	0.21351	6.607000	0.74163	0.717000	0.32145	-0.181000	0.13052	GAA	-	pfam_HCO3_transpt_C,prints_HCO3_transpt_euk,tigrfam_HCO3_transpt_euk		0.582	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	SLC4A9	protein_coding	OTTHUMT00000372823.1	G	NM_031467	-		139747152	+1	no_errors	ENST00000230993	ensembl	human	known	74_37	nonsense	SNP	0.996	T
DAPL1	92196	genome.wustl.edu	37	2	159651908	159651908	+	Silent	SNP	G	G	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:159651908G>C	ENST00000309950.3	+	1	80	c.24G>C	c.(22-24)ctG>ctC	p.L8L	DAPL1_ENST00000409042.1_Silent_p.L8L	NM_001017920.2	NP_001017920.2	A0PJW8	DAPL1_HUMAN	death associated protein-like 1	8					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)					prostate(1)	1						TGCAAGACCTGCTCTCCCCTC	0.627																																																	0								ENSG00000163331						73.0	44.0	54.0					2																	159651908		2189	4270	6459	DAPL1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33307.1	2q24	2007-06-26			ENSG00000163331	ENSG00000163331			21490	protein-coding gene	gene with protein product							Standard	NM_001017920		Approved		uc002uaf.3	A0PJW8	OTTHUMG00000153970	ENST00000309950.3:c.24G>C	2.37:g.159651908G>C		Somatic	0	51	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	44	20.00	A0PJW9|B9EIK6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L8	ENST00000309950.3	37	c.24	CCDS33307.1	2																																																																																			-	NULL		0.627	DAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPL1	protein_coding	OTTHUMT00000333265.1	G	NM_001017920	-		159651908	+1	no_errors	ENST00000309950	ensembl	human	known	74_37	silent	SNP	0.967	C
CNTNAP3	79937	genome.wustl.edu	37	9	39085765	39085765	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr9:39085765G>A	ENST00000297668.6	-	21	3483	c.3410C>T	c.(3409-3411)gCc>gTc	p.A1137V	CNTNAP3_ENST00000377656.2_Missense_Mutation_p.A1056V|CNTNAP3_ENST00000358144.2_3'UTR	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	1137	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A1137G(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGATTTGACGGCGTTGAATTC	0.398																																																	1	Substitution - Missense(1)	breast(1)						ENSG00000106714						66.0	85.0	78.0					9																	39085765		2169	4237	6406	CNTNAP3	SO:0001583	missense	0			-	HGNC	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.3410C>T	9.37:g.39085765G>A	ENSP00000297668:p.Ala1137Val	Somatic	1	314	0.32		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	223	216	50.80	B1AMA0|Q9C0E9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.A1137V	ENST00000297668.6	37	c.3410	CCDS6616.1	9	.	.	.	.	.	.	.	.	.	.	G	15.56	2.870587	0.51588	.	.	ENSG00000106714	ENST00000297668;ENST00000377656	T;T	0.76839	-1.05;-1.05	3.28	3.28	0.37604	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.75117	0.3806	M	0.62723	1.935	0.80722	D	1	P;P	0.36733	0.517;0.567	B;B	0.43194	0.25;0.411	T	0.71533	-0.4564	9	0.30854	T	0.27	.	7.8674	0.29545	0.1203:0.0:0.8797:0.0	.	1056;1137	A6NC89;Q9BZ76	.;CNTP3_HUMAN	V	1137;1056	ENSP00000297668:A1137V;ENSP00000366884:A1056V	ENSP00000297668:A1137V	A	-	2	0	CNTNAP3	39075765	1.000000	0.71417	0.986000	0.45419	0.851000	0.48451	2.669000	0.46825	1.834000	0.53371	0.485000	0.47835	GCC	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.398	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3	protein_coding	OTTHUMT00000052511.1	G	NM_033655	-		39085765	-1	no_errors	ENST00000297668	ensembl	human	known	74_37	missense	SNP	0.993	A
CYHR1	50626	genome.wustl.edu	37	8	145677807	145677807	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr8:145677807C>T	ENST00000438911.2	-	4	765	c.632G>A	c.(631-633)cGc>cAc	p.R211H	CYHR1_ENST00000530374.1_Missense_Mutation_p.R253H	NM_138496.1	NP_612505.1	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1	211						cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(3)|ovary(2)	7	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CATCTCCTTGCGGTGGCTCTG	0.617																																																	0								ENSG00000187954						144.0	120.0	127.0					8																	145677807		692	1591	2283	CYHR1	SO:0001583	missense	0			-	HGNC	AB007965	CCDS6426.1, CCDS47943.1	8q24	2004-12-07	2005-07-24		ENSG00000187954	ENSG00000187954			17806	protein-coding gene	gene with protein product			"""cysteine and histidine rich 1"""			10745073	Standard	NM_138496		Approved	CHRP, KIAA0496, MGC13010	uc003zcv.2	Q6ZMK1	OTTHUMG00000165171	ENST00000438911.2:c.632G>A	8.37:g.145677807C>T	ENSP00000387426:p.Arg211His	Somatic	0	38	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B3KSX0|D3DWM3|Q9BSF6|Q9BSU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_TRAF-like,pfscan_Znf_TRAF	p.R211H	ENST00000438911.2	37	c.632	CCDS47943.1	8	.	.	.	.	.	.	.	.	.	.	C	16.19	3.051693	0.55218	.	.	ENSG00000187954	ENST00000438911;ENST00000530374;ENST00000526887;ENST00000533173	T;T;T	0.80214	-1.35;-1.35;-1.35	5.39	4.39	0.52855	.	0.141210	0.50627	D	0.000117	T	0.64778	0.2629	L	0.29908	0.895	0.80722	D	1	P	0.48350	0.909	B	0.39027	0.288	T	0.65623	-0.6123	10	0.45353	T	0.12	-43.613	4.9097	0.13816	0.0:0.7486:0.0:0.2514	.	211	Q6ZMK1	CYHR1_HUMAN	H	211;253;160;123	ENSP00000387426:R211H;ENSP00000433769:R253H;ENSP00000434470:R160H	ENSP00000387426:R211H	R	-	2	0	CYHR1	145648615	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.448000	0.60027	2.517000	0.84864	0.561000	0.74099	CGC	-	NULL		0.617	CYHR1-001	KNOWN	basic|CCDS	protein_coding	CYHR1	protein_coding	OTTHUMT00000382438.1	C	NM_032687	-		145677807	-1	no_errors	ENST00000438911	ensembl	human	known	74_37	missense	SNP	1.000	T
RBMX	27316	genome.wustl.edu	37	X	135956028	135956028	+	3'UTR	DEL	G	G	-	rs377294279		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chrX:135956028delG	ENST00000320676.7	-	0	1603				RBMX_ENST00000496459.2_5'UTR|RBMX_ENST00000431446.3_Intron|RBMX_ENST00000570135.1_3'UTR	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked						cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					GTGGCCTTTAGGGGATACTTT	0.348																																																	0								ENSG00000147274																																			RBMX	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.*273C>-	X.37:g.135956028delG		Somatic	0	15	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	31	18.42	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000320676.7	37	NULL	CCDS14661.1	X																																																																																			-	-		0.348	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX	protein_coding	OTTHUMT00000058507.1	G	NM_002139			135956028	-1	no_errors	ENST00000496459	ensembl	human	known	74_37	rna	DEL	1.000	-
PCDHA5	56143	genome.wustl.edu	37	5	140202746	140202746	+	Silent	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr5:140202746C>T	ENST00000529859.1	+	1	1386	c.1386C>T	c.(1384-1386)ttC>ttT	p.F462F	PCDHA5_ENST00000378126.3_Silent_p.F462F|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Silent_p.F462F|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron	NM_018908.2	NP_061731.1	Q9Y5H7	PCDA5_HUMAN	protocadherin alpha 5	462	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|prostate(6)|skin(4)|upper_aerodigestive_tract(3)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATACCGTGTTCGTGAAGGAGA	0.662																																																	0								ENSG00000204965						69.0	73.0	71.0					5																	140202746		2203	4300	6503	PCDHA5	SO:0001819	synonymous_variant	0			-	HGNC	AF152483	CCDS54917.1	5q31	2010-11-26				ENSG00000204965		"""Cadherins / Protocadherins : Clustered"""	8671	other	complex locus constituent	"""ortholog of mouse CNR6"", ""KIAA0345-like 9"""	606311		CNRS6		10380929, 10662547	Standard	NM_018908		Approved	CNR6, CRNR6, CNRN6, PCDH-ALPHA5		Q9Y5H7		ENST00000529859.1:c.1386C>T	5.37:g.140202746C>T		Somatic	0	121	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	95	69	57.93	O75284|Q8N4R3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.F462	ENST00000529859.1	37	c.1386	CCDS54917.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin		0.662	PCDHA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA5	protein_coding	OTTHUMT00000372883.2	C	NM_018908	-		140202746	+1	no_errors	ENST00000529859	ensembl	human	known	74_37	silent	SNP	0.919	T
HADHA	3030	genome.wustl.edu	37	2	26459850	26459850	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:26459850T>C	ENST00000380649.3	-	4	316	c.187A>G	c.(187-189)Aca>Gca	p.T63A	HADHA_ENST00000457468.2_Intron|HADHA_ENST00000461025.1_5'Flank	NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	63					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTACTCAGTGTATTTACCTGC	0.368																																																	0								ENSG00000084754						85.0	83.0	84.0					2																	26459850		2203	4300	6503	HADHA	SO:0001583	missense	0			-	HGNC	D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.187A>G	2.37:g.26459850T>C	ENSP00000370023:p.Thr63Ala	Somatic	0	43	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Crotonase_core_superfam,pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_Fa_ox_alpha_mit	p.T63A	ENST00000380649.3	37	c.187	CCDS1721.1	2	.	.	.	.	.	.	.	.	.	.	T	20.3	3.968115	0.74131	.	.	ENSG00000084754	ENST00000380649	T	0.63744	-0.06	5.78	5.78	0.91487	Crotonase, core (1);	0.000000	0.85682	D	0.000000	T	0.59595	0.2205	N	0.20610	0.595	0.80722	D	1	P	0.52316	0.952	P	0.52957	0.714	T	0.65146	-0.6239	10	0.72032	D	0.01	-28.2116	14.051	0.64736	0.0:0.0:0.0:1.0	.	63	P40939	ECHA_HUMAN	A	63	ENSP00000370023:T63A	ENSP00000370023:T63A	T	-	1	0	HADHA	26313354	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	5.890000	0.69774	2.210000	0.71456	0.482000	0.46254	ACA	-	pfam_Crotonase_core_superfam,tigrfam_Fa_ox_alpha_mit		0.368	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADHA	protein_coding	OTTHUMT00000214051.1	T	NM_000182	-		26459850	-1	no_errors	ENST00000380649	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC52A3	113278	genome.wustl.edu	37	20	746375	746375	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr20:746375C>A	ENST00000217254.7	-	2	285	c.44G>T	c.(43-45)gGc>gTc	p.G15V	SLC52A3_ENST00000381944.3_Missense_Mutation_p.G15V|SLC52A3_ENST00000473664.1_5'UTR	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	15					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)										CACCCAGGAGCCCATTCCGAA	0.637																																																	0								ENSG00000101276						32.0	34.0	33.0					20																	746375		2203	4300	6503	SLC52A3	SO:0001583	missense	0			-	HGNC	AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.44G>T	20.37:g.746375C>A	ENSP00000217254:p.Gly15Val	Somatic	0	36	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	18	30.77	A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endogenous_retrovirus_rcpt	p.G15V	ENST00000217254.7	37	c.44	CCDS13007.1	20	.	.	.	.	.	.	.	.	.	.	C	19.98	3.926126	0.73327	.	.	ENSG00000101276	ENST00000217254;ENST00000381944	T;T	0.79845	-1.31;-1.31	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.90960	0.7158	M	0.84773	2.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.983	D	0.91837	0.5480	10	0.72032	D	0.01	-24.9494	18.2483	0.89995	0.0:1.0:0.0:0.0	.	15;15	Q9NQ40-2;Q9NQ40	.;RFT2_HUMAN	V	15	ENSP00000217254:G15V;ENSP00000371370:G15V	ENSP00000217254:G15V	G	-	2	0	C20orf54	694375	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	5.943000	0.70211	2.664000	0.90586	0.655000	0.94253	GGC	-	NULL		0.637	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC52A3	protein_coding	OTTHUMT00000077482.2	C	NM_033409	-		746375	-1	no_errors	ENST00000217254	ensembl	human	known	74_37	missense	SNP	1.000	A
FRMD3	257019	genome.wustl.edu	37	9	85863362	85863362	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr9:85863362C>T	ENST00000304195.3	-	14	1471	c.1265G>A	c.(1264-1266)cGg>cAg	p.R422Q	FRMD3_ENST00000376438.1_Missense_Mutation_p.R422Q|FRMD3_ENST00000376434.1_Missense_Mutation_p.R228Q|FRMD3_ENST00000328788.1_Missense_Mutation_p.R79Q|FRMD3_ENST00000465485.1_5'UTR	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	422						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						TTCATACTCCCGGGCTGCCTT	0.443																																																	0								ENSG00000172159						72.0	72.0	72.0					9																	85863362		1847	4100	5947	FRMD3	SO:0001583	missense	0			-	HGNC	AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.1265G>A	9.37:g.85863362C>T	ENSP00000303508:p.Arg422Gln	Somatic	0	62	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	49	16.95	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.R422Q	ENST00000304195.3	37	c.1265	CCDS43840.1	9	.	.	.	.	.	.	.	.	.	.	C	5.988	0.366206	0.11352	.	.	ENSG00000172159	ENST00000376438;ENST00000376434;ENST00000328788;ENST00000304195	D;D;T;D	0.85411	-1.57;-1.98;0.97;-1.59	5.38	-0.87	0.10646	.	1.075110	0.07080	N	0.836929	T	0.73171	0.3553	N	0.21448	0.665	0.09310	N	1	B;B;B	0.20261	0.0;0.0;0.043	B;B;B	0.09377	0.0;0.001;0.004	T	0.52609	-0.8553	10	0.13470	T	0.59	.	10.6066	0.45398	0.0:0.5266:0.0:0.4734	.	422;422;79	A2A2Y4;A2A2Y4-2;A2A2Y4-4	FRMD3_HUMAN;.;.	Q	422;228;79;422	ENSP00000365621:R422Q;ENSP00000365617:R228Q;ENSP00000328615:R79Q;ENSP00000303508:R422Q	ENSP00000303508:R422Q	R	-	2	0	FRMD3	85053182	0.000000	0.05858	0.897000	0.35233	0.991000	0.79684	-0.925000	0.03992	-0.358000	0.08162	-0.131000	0.14894	CGG	-	NULL		0.443	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD3	protein_coding	OTTHUMT00000157355.1	C	NM_174938	-		85863362	-1	no_errors	ENST00000304195	ensembl	human	known	74_37	missense	SNP	0.000	T
OSBPL9	114883	genome.wustl.edu	37	1	52254982	52254982	+	IGR	SNP	T	T	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:52254982T>C	ENST00000428468.1	+	0	2893				NRD1_ENST00000539524.1_Missense_Mutation_p.I1064V|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000352171.7_Missense_Mutation_p.I1128V|NRD1_ENST00000354831.7_Missense_Mutation_p.I1196V			Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9						lipid transport (GO:0006869)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|pancreas(1)|prostate(3)|skin(1)	18						ATGGGGATGATACAATCTGCC	0.448																																																	0								ENSG00000078618						162.0	148.0	153.0					1																	52254982		2203	4300	6503	NRD1	SO:0001628	intergenic_variant	0			-	HGNC	AF392445	CCDS558.1, CCDS41332.1, CCDS41333.1, CCDS41334.1, CCDS41332.2, CCDS41332.3, CCDS41333.2, CCDS44145.1, CCDS55598.1	1p32.3	2013-01-10			ENSG00000117859	ENSG00000117859		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16386	protein-coding gene	gene with protein product		606737					Standard	NM_148904		Approved		uc001csu.3	Q96SU4	OTTHUMG00000008234		1.37:g.52254982T>C		Somatic	0	38	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	41	52.87	B1AKJ8|B3KPQ4|D3DQ31|Q5TFC0|Q6IA67|Q86YQ3|Q8NB17|Q8TAS8|Q96SK4|Q9H9X2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.I1196V	ENST00000428468.1	37	c.3586	CCDS41332.3	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.033|0.033	-1.323696|-1.323696	0.01309|0.01309	.|.	.|.	ENSG00000078618|ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665|ENST00000440943	T;T;T|.	0.28069|.	1.64;1.63;1.63|.	5.75|5.75	3.45|3.45	0.39498|0.39498	.|.	0.457798|.	0.26549|.	N|.	0.023747|.	T|T	0.09686|0.09686	0.0238|0.0238	N|N	0.01352|0.01352	-0.895|-0.895	0.22342|0.22342	N|N	0.999189|0.999189	B;B|.	0.02656|.	0.0;0.0|.	B;B|.	0.04013|.	0.001;0.001|.	T|T	0.31223|0.31223	-0.9951|-0.9951	10|5	0.12766|.	T|.	0.61|.	-0.4007|-0.4007	8.491|8.491	0.33100|0.33100	0.0:0.2906:0.0:0.7094|0.0:0.2906:0.0:0.7094	.|.	1127;1196|.	O43847;B1AKJ5|.	NRDC_HUMAN;.|.	V|C	1128;1196;1064;530|514	ENSP00000262679:I1128V;ENSP00000346890:I1196V;ENSP00000444416:I1064V|.	ENSP00000262679:I1128V|.	I|Y	-|-	1|2	0|0	NRD1|NRD1	52027570|52027570	0.072000|0.072000	0.21174|0.21174	0.495000|0.495000	0.27527|0.27527	0.856000|0.856000	0.48823|0.48823	0.397000|0.397000	0.20883|0.20883	0.464000|0.464000	0.27142|0.27142	-0.911000|-0.911000	0.02809|0.02809	ATC|TAT	-	NULL		0.448	OSBPL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRD1	protein_coding	OTTHUMT00000022584.4	T		-		52254982	-1	no_errors	ENST00000354831	ensembl	human	known	74_37	missense	SNP	0.022	C
KYNU	8942	genome.wustl.edu	37	2	143798011	143798011	+	Silent	SNP	G	G	A	rs576501053		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:143798011G>A	ENST00000264170.4	+	13	1314	c.1056G>A	c.(1054-1056)gcG>gcA	p.A352A	KYNU_ENST00000409512.1_Silent_p.A352A	NM_003937.2	NP_003928.1			kynureninase											large_intestine(10)|liver(1)|lung(18)|prostate(3)|skin(4)	36				BRCA - Breast invasive adenocarcinoma(221;0.072)		TTAAGCAAGCGACAATGAAGG	0.343													G|||	1	0.000199681	0.0	0.0	5008	,	,		19592	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000115919						76.0	75.0	75.0					2																	143798011		2203	4299	6502	KYNU	SO:0001819	synonymous_variant	0			-	HGNC	U57721	CCDS2183.1, CCDS33299.1	2q22.2	2010-11-23	2010-11-23		ENSG00000115919	ENSG00000115919	3.7.1.3		6469	protein-coding gene	gene with protein product	"""L-kynurenine hydrolase"""	605197	"""kynureninase (L-kynurenine hydrolase)"""			8706755, 9180257	Standard	NM_001199241		Approved		uc002tvl.3	Q16719	OTTHUMG00000131829	ENST00000264170.4:c.1056G>A	2.37:g.143798011G>A		Somatic	0	43	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,tigrfam_Kynureninase	p.A352	ENST00000264170.4	37	c.1056	CCDS2183.1	2																																																																																			-	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,tigrfam_Kynureninase		0.343	KYNU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KYNU	protein_coding	OTTHUMT00000254772.1	G	NM_001032998	-		143798011	+1	no_errors	ENST00000264170	ensembl	human	known	74_37	silent	SNP	0.989	A
DNM1P47	100216544	genome.wustl.edu	37	15	102294368	102294368	+	RNA	SNP	A	A	T	rs144412148		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr15:102294368A>T	ENST00000561463.1	+	0	2414									DNM1 pseudogene 47																		CAGAGCAGGCAGACCAAGGAG	0.582																																																	0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294368A>T		Somatic	0	13	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	8	46.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.582	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	A	NG_009149	rs144412148		102294368	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	1.000	T
PPOX	5498	genome.wustl.edu	37	1	161139379	161139379	+	Intron	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:161139379G>T	ENST00000367999.4	+	8	1073				PPOX_ENST00000432542.2_Intron|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000544598.1_Intron|PPOX_ENST00000495483.1_Intron|PPOX_ENST00000352210.5_Intron|B4GALT3_ENST00000470882.1_5'Flank	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase						heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			CTGAGAGTGAGGCACCAGAAG	0.468																																																	0								ENSG00000143224																																			PPOX	SO:0001627	intron_variant	0			-	HGNC	BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.808-71G>T	1.37:g.161139379G>T		Somatic	0	36	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	D3DVG0|Q5VTW8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367999.4	37	NULL	CCDS1221.1	1																																																																																			-	-		0.468	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PPOX	protein_coding	OTTHUMT00000082993.1	G	NM_000309	-		161139379	+1	no_errors	ENST00000462977	ensembl	human	known	74_37	rna	SNP	0.024	T
CFAP54	144535	genome.wustl.edu	37	12	96900705	96900705	+	Splice_Site	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr12:96900705G>A	ENST00000524981.4	+	4	590		c.e4-1		C12orf55_ENST00000298953.3_Splice_Site			Q96N23	CL055_HUMAN																			ATGTGTTTCAGTTTCATGCTT	0.433																																																	0								ENSG00000188596																																			C12orf55	SO:0001630	splice_region_variant	0			-	HGNC																												ENST00000524981.4:c.568-1G>A	12.37:g.96900705G>A		Somatic	0	73	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	51	37.80		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e4-1	ENST00000524981.4	37	c.568-1		12	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007963	0.75046	.	.	ENSG00000188596	ENST00000553778;ENST00000524981;ENST00000298953	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2129	0.93765	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C12orf63	95424836	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	6.399000	0.73248	2.645000	0.89757	0.591000	0.81541	.	-	-		0.433	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	protein_coding	OTTHUMT00000395046.4	G		-	Intron	96900705	+1	no_errors	ENST00000524981	ensembl	human	putative	74_37	splice_site	SNP	1.000	A
KLHL3	26249	genome.wustl.edu	37	5	137045465	137045465	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr5:137045465C>T	ENST00000309755.4	-	3	658	c.215G>A	c.(214-216)aGc>aAc	p.S72N	KLHL3_ENST00000508657.1_Missense_Mutation_p.S40N|KLHL3_ENST00000394937.3_Missense_Mutation_p.S72N	NM_017415.2	NP_059111.2	Q9UH77	KLHL3_HUMAN	kelch-like family member 3	72	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				distal tubule morphogenesis (GO:0072156)|ion homeostasis (GO:0050801)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|renal sodium ion absorption (GO:0070294)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|stomach(1)|upper_aerodigestive_tract(1)	21		all_hematologic(541;3.67e-07)|Breast(839;7.61e-05)|Prostate(281;0.000825)|Ovarian(839;0.0481)|all_lung(232;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	GBM - Glioblastoma multiforme(465;0.0223)		GAAGTAGGGGCTGCAGGCTGC	0.547																																																	0								ENSG00000146021						165.0	134.0	144.0					5																	137045465		2203	4300	6503	KLHL3	SO:0001583	missense	0			-	HGNC	AB032955	CCDS4192.1, CCDS58969.1, CCDS58970.1	5q31	2013-01-30	2013-01-30		ENSG00000146021	ENSG00000146021		"""Kelch-like"", ""BTB/POZ domain containing"""	6354	protein-coding gene	gene with protein product		605775	"""kelch (Drosophila)-like 3"", ""kelch-like 3 (Drosophila)"""			10843806	Standard	NM_017415		Approved	KIAA1129	uc010jek.3	Q9UH77	OTTHUMG00000129155	ENST00000309755.4:c.215G>A	5.37:g.137045465C>T	ENSP00000312397:p.Ser72Asn	Somatic	0	40	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	23	48.89	B2RBK7|Q9UH75|Q9UH76|Q9ULU0|Q9Y6V6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S72N	ENST00000309755.4	37	c.215	CCDS4192.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.308225	0.95629	.	.	ENSG00000146021	ENST00000508657;ENST00000309755;ENST00000505853;ENST00000394937	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	5.35	5.35	0.76521	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.086755	0.85682	D	0.000000	D	0.95526	0.8546	H	0.97758	4.07	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97106	0.9801	10	0.87932	D	0	.	18.6586	0.91463	0.0:1.0:0.0:0.0	.	32;72	D6RH21;Q9UH77	.;KLHL3_HUMAN	N	40;72;32;72	ENSP00000422099:S40N;ENSP00000312397:S72N;ENSP00000426173:S32N;ENSP00000378395:S72N	ENSP00000312397:S72N	S	-	2	0	KLHL3	137073364	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.137000	0.77295	2.502000	0.84385	0.650000	0.86243	AGC	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like		0.547	KLHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL3	protein_coding	OTTHUMT00000251220.2	C		-		137045465	-1	no_errors	ENST00000309755	ensembl	human	known	74_37	missense	SNP	1.000	T
SDK2	54549	genome.wustl.edu	37	17	71415426	71415426	+	Missense_Mutation	SNP	G	G	A	rs374465306		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr17:71415426G>A	ENST00000392650.3	-	16	2065	c.2065C>T	c.(2065-2067)Ccc>Tcc	p.P689S	SDK2_ENST00000388726.3_Missense_Mutation_p.P689S	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	689					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GCCGTGGGGGGCTCCTCGGGG	0.577																																																	0								ENSG00000069188	G	SER/PRO	0,4406		0,0,2203	47.0	44.0	45.0		2065	4.9	1.0	17		45	1,8599	1.2+/-3.3	0,1,4299	no	missense	SDK2	NM_001144952.1	74	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	689/2173	71415426	1,13005	2203	4300	6503	SDK2	SO:0001583	missense	0			-	HGNC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.2065C>T	17.37:g.71415426G>A	ENSP00000376421:p.Pro689Ser	Somatic	0	62	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P689S	ENST00000392650.3	37	c.2065	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	G	25.8	4.676402	0.88445	0.0	1.16E-4	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.63255	-0.03;-0.03	4.87	4.87	0.63330	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.76147	0.3947	L	0.59967	1.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.978	T	0.75935	-0.3142	10	0.41790	T	0.15	.	18.0116	0.89225	0.0:0.0:1.0:0.0	.	689;689	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	S	313;689;689;689	ENSP00000376421:P689S;ENSP00000373378:P689S	ENSP00000324967:P689S	P	-	1	0	SDK2	68927021	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.326000	0.79133	2.266000	0.75297	0.462000	0.41574	CCC	-	superfamily_Fibronectin_type3		0.577	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	G	NM_019064	-		71415426	-1	no_errors	ENST00000392650	ensembl	human	known	74_37	missense	SNP	1.000	A
LHCGR	3973	genome.wustl.edu	37	2	48982775	48982777	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:48982775_48982777delCTT	ENST00000294954.7	-	1	55_57	c.34_36delAAG	c.(34-36)aagdel	p.K12del	LHCGR_ENST00000405626.1_In_Frame_Del_p.K12del|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000344775.3_In_Frame_Del_p.K12del|LHCGR_ENST00000401907.1_In_Frame_Del_p.K12del|LHCGR_ENST00000403273.1_In_Frame_Del_p.K12del	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	12					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	gcagcagcagcttcagcagctgc	0.724																																																	0								ENSG00000138039		,	73,1487		30,13,737					,	-7.5	0.0		dbSNP_130	2	150,3028		37,76,1476	no	intron,coding	LHCGR,STON1-GTF2A1L	NM_001198593.1,NM_000233.3	,	67,89,2213	A1A1,A1R,RR		4.7199,4.6795,4.7066	,	,		223,4515				LHCGR	SO:0001651	inframe_deletion	0				HGNC		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.34_36delAAG	2.37:g.48982775_48982777delCTT	ENSP00000294954:p.Lys12del	Somatic	0	25	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62	Q14751|Q15996|Q9UEW9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_LSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.K12in_frame_del	ENST00000294954.7	37	c.36_34	CCDS1842.1	2																																																																																			-	prints_TSH_rcpt		0.724	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHCGR	protein_coding	OTTHUMT00000251364.4	CTT	NM_000233.3			48982777	-1	no_errors	ENST00000294954	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.000	-
PCSK2	5126	genome.wustl.edu	37	20	17339055	17339055	+	Silent	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr20:17339055C>T	ENST00000262545.2	+	3	681	c.366C>T	c.(364-366)aaC>aaT	p.N122N	PCSK2_ENST00000536609.1_Silent_p.N87N|PCSK2_ENST00000377899.1_Silent_p.N103N	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	122					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TCAACATGAACGATCCTCTTT	0.413																																																	0								ENSG00000125851						199.0	172.0	181.0					20																	17339055		2203	4300	6503	PCSK2	SO:0001819	synonymous_variant	0			-	HGNC	AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.366C>T	20.37:g.17339055C>T		Somatic	0	71	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.67	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.N122	ENST00000262545.2	37	c.366	CCDS13125.1	20																																																																																			-	superfamily_Peptidase_S8/S53_dom		0.413	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK2	protein_coding	OTTHUMT00000078120.2	C	NM_002594	-		17339055	+1	no_errors	ENST00000262545	ensembl	human	known	74_37	silent	SNP	0.987	T
TMEM191C	645426	genome.wustl.edu	37	22	21822373	21822385	+	lincRNA	DEL	AGGATCCGGGGGT	AGGATCCGGGGGT	-	rs3016118		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	AGGATCCGGGGGT	AGGATCCGGGGGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr22:21822373_21822385delAGGATCCGGGGGT	ENST00000449424.1	+	0	415_427							A6NGB0	T191C_HUMAN	transmembrane protein 191C							integral component of membrane (GO:0016021)											ggaagggggcaggatccgggggtggggtgaggt	0.704																																																	0								ENSG00000206140																																			TMEM191C			0				HGNC			22q11.21	2013-04-03			ENSG00000206140	ENSG00000206140			33601	other	unknown							Standard	NM_001207052		Approved		uc021wmg.1	A6NGB0	OTTHUMG00000150780		22.37:g.21822373_21822385delAGGATCCGGGGGT		Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000449424.1	37	NULL		22																																																																																			-	-		0.704	TMEM191C-004	KNOWN	basic|exp_conf	lincRNA	TMEM191C	lincRNA	OTTHUMT00000320053.1	AGGATCCGGGGGT	NM_001207052			21822385	+1	no_errors	ENST00000449424	ensembl	human	known	74_37	rna	DEL	0.003:0.005:0.001:0.001:0.002:0.003:0.000:0.000:0.000:0.057:0.077:0.000:0.000	-
SIGLEC5	8778	genome.wustl.edu	37	19	52130427	52130427	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr19:52130427A>T	ENST00000534261.2	-	8	1756	c.1357T>A	c.(1357-1359)Tgt>Agt	p.C453S	SIGLEC5_ENST00000429354.3_Missense_Mutation_p.C453S|SIGLEC5_ENST00000570106.2_Missense_Mutation_p.C453S|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.C453S|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.C453S			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	453					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		AGGCACAGACAGATACAGAGC	0.517																																																	0								ENSG00000105501						116.0	100.0	105.0					19																	52130427		2203	4300	6503	SIGLEC5	SO:0001583	missense	0			-	HGNC	U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1357T>A	19.37:g.52130427A>T	ENSP00000473238:p.Cys453Ser	Somatic	0	43	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	22	50.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.C453S	ENST00000534261.2	37	c.1357	CCDS33088.1	19	.	.	.	.	.	.	.	.	.	.	A	10.55	1.382671	0.25031	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.56611	0.45;0.45	3.55	1.26	0.21427	.	0.811143	0.10499	N	0.667432	T	0.33030	0.0849	N	0.25245	0.725	0.09310	N	1	B	0.26708	0.157	B	0.20767	0.031	T	0.21211	-1.0252	10	0.49607	T	0.09	.	4.0012	0.09580	0.569:0.2193:0.0:0.2117	.	453	O15389	SIGL5_HUMAN	S	453	ENSP00000222107:C453S;ENSP00000415200:C453S	ENSP00000222107:C453S	C	-	1	0	SIGLEC5	56822239	0.001000	0.12720	0.003000	0.11579	0.056000	0.15407	0.998000	0.29744	0.176000	0.19873	0.413000	0.27773	TGT	-	NULL		0.517	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	protein_coding	OTTHUMT00000466897.2	A	NM_003830	-		52130427	-1	no_errors	ENST00000222107	ensembl	human	known	74_37	missense	SNP	0.004	T
GPD2	2820	genome.wustl.edu	37	2	157413987	157413987	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:157413987G>T	ENST00000310454.6	+	9	1430	c.1058G>T	c.(1057-1059)gGc>gTc	p.G353V	GPD2_ENST00000409125.4_Missense_Mutation_p.G126V|GPD2_ENST00000438166.2_Missense_Mutation_p.G353V|GPD2_ENST00000540309.1_Missense_Mutation_p.G353V|GPD2_ENST00000409674.1_Missense_Mutation_p.G353V	NM_001083112.2	NP_001076581.2	P43304	GPDM_HUMAN	glycerol-3-phosphate dehydrogenase 2 (mitochondrial)	353					camera-type eye development (GO:0043010)|cellular lipid metabolic process (GO:0044255)|gluconeogenesis (GO:0006094)|glycerol catabolic process (GO:0019563)|glycerol-3-phosphate metabolic process (GO:0006072)|multicellular organism growth (GO:0035264)|small molecule metabolic process (GO:0044281)	glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (GO:0052591)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|stomach(1)	22						ACGATCGCTGGCACTACTGAT	0.438																																																	0								ENSG00000115159						124.0	108.0	113.0					2																	157413987		2203	4300	6503	GPD2	SO:0001583	missense	0			-	HGNC		CCDS2202.1	2q24.1	2013-01-10			ENSG00000115159	ENSG00000115159	1.1.1.8	"""EF-hand domain containing"""	4456	protein-coding gene	gene with protein product		138430					Standard	NM_001083112		Approved		uc002tzd.4	P43304	OTTHUMG00000131951	ENST00000310454.6:c.1058G>T	2.37:g.157413987G>T	ENSP00000308610:p.Gly353Val	Somatic	0	40	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.33	A8K4V0|B3KSA9|Q59FR1|Q9HAP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_G3P_DH_FAD-dep	p.G353V	ENST00000310454.6	37	c.1058	CCDS2202.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.136552	0.94517	.	.	ENSG00000115159	ENST00000310454;ENST00000409125;ENST00000438166;ENST00000540309;ENST00000409674	D;D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2;-2.2	5.7	5.7	0.88788	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.96972	0.9011	H	0.99404	4.55	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98461	1.0596	10	0.87932	D	0	.	19.8405	0.96681	0.0:0.0:1.0:0.0	.	353	P43304	GPDM_HUMAN	V	353;126;353;353;353	ENSP00000308610:G353V;ENSP00000386484:G126V;ENSP00000409708:G353V;ENSP00000440892:G353V;ENSP00000386425:G353V	ENSP00000308610:G353V	G	+	2	0	GPD2	157122233	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	9.869000	0.99810	2.692000	0.91855	0.655000	0.94253	GGC	-	pfam_FAD-dep_OxRdtase		0.438	GPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD2	protein_coding	OTTHUMT00000254910.3	G		-		157413987	+1	no_errors	ENST00000310454	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKRD26	22852	genome.wustl.edu	37	10	27335425	27335425	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr10:27335425T>A	ENST00000376087.4	-	18	2007	c.1842A>T	c.(1840-1842)gaA>gaT	p.E614D	ANKRD26_ENST00000376070.3_Missense_Mutation_p.E171D|ANKRD26_ENST00000436985.2_Missense_Mutation_p.E630D	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	613					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						TGCTCTTTACTTCCTTCATTT	0.393																																																	0								ENSG00000107890						111.0	102.0	105.0					10																	27335425		1816	4081	5897	ANKRD26	SO:0001583	missense	0			-	HGNC	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1842A>T	10.37:g.27335425T>A	ENSP00000365255:p.Glu614Asp	Somatic	0	49	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	55	8.33	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Polyketide_synth_docking,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E630D	ENST00000376087.4	37	c.1890	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	T	12.26	1.883197	0.33255	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	T;T;T	0.36157	3.72;4.32;1.27	4.34	-3.6	0.04570	.	1.083160	0.07214	N	0.859773	T	0.24314	0.0589	L	0.49350	1.555	0.09310	N	1	B;B;B	0.20550	0.046;0.027;0.001	B;B;B	0.15484	0.013;0.006;0.001	T	0.33497	-0.9866	10	0.38643	T	0.18	.	0.1487	0.00090	0.2996:0.1886:0.1539:0.3579	.	614;613;630	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	D	171;614;630	ENSP00000365238:E171D;ENSP00000365255:E614D;ENSP00000405112:E630D	ENSP00000365238:E171D	E	-	3	2	ANKRD26	27375431	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-0.313000	0.08103	-0.400000	0.07656	0.248000	0.18094	GAA	-	NULL		0.393	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	protein_coding	OTTHUMT00000047296.1	T		-		27335425	-1	no_errors	ENST00000436985	ensembl	human	known	74_37	missense	SNP	0.000	A
TP53	7157	genome.wustl.edu	37	17	7577514	7577515	+	Frame_Shift_Ins	INS	-	-	TA	rs587781433		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr17:7577514_7577515insTA	ENST00000269305.4	-	7	955_956	c.766_767insTA	c.(766-768)acafs	p.T256fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Ins_p.T256fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.T256fs|TP53_ENST00000413465.2_Frame_Shift_Ins_p.T256fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.T256fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.T256fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	256	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		T -> I (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.T256fs*89(4)|p.T256A(3)|p.T256fs*8(2)|p.T256I(2)|p.T256K(2)|p.T256S(2)|p.?(1)|p.T256P(1)|p.I254fs*7(1)|p.T256fs*90(1)|p.T256del(1)|p.R249_T256delRPILTIIT(1)|p.T256fs*87(1)|p.T256fs*17(1)|p.I254_T256del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCTTCCAGTGTGATGATGGTG	0.594		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	32	Substitution - Missense(10)|Whole gene deletion(8)|Deletion - Frameshift(6)|Insertion - Frameshift(4)|Deletion - In frame(3)|Unknown(1)	central_nervous_system(6)|ovary(5)|bone(5)|breast(5)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|urinary_tract(1)|oesophagus(1)|kidney(1)|skin(1)|lung(1)	GRCh37	CM951232	TP53	M		ENSG00000141510																																			TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.766_767insTA	17.37:g.7577514_7577515insTA	ENSP00000269305:p.Thr256fs	Somatic	0	50	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	14	73.08	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.T256fs	ENST00000269305.4	37	c.767_766	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.594	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	-	NM_000546			7577515	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_ins	INS	0.998:1.000	TA
MAP3K4	4216	genome.wustl.edu	37	6	161470949	161470949	+	Silent	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr6:161470949C>T	ENST00000392142.4	+	3	1793	c.1645C>T	c.(1645-1647)Cta>Tta	p.L549L	MAP3K4_ENST00000366920.2_Silent_p.L549L|MAP3K4_ENST00000348824.7_Silent_p.L549L|MAP3K4_ENST00000366919.2_Silent_p.L549L	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	549					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		ACTTCACAAGCTAATGGATGG	0.383																																																	0								ENSG00000085511						94.0	97.0	96.0					6																	161470949		2203	4300	6503	MAP3K4	SO:0001819	synonymous_variant	0			-	HGNC	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.1645C>T	6.37:g.161470949C>T		Somatic	0	40	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	23	46.51	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L549	ENST00000392142.4	37	c.1645	CCDS34565.1	6																																																																																			-	NULL		0.383	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	protein_coding	OTTHUMT00000042988.3	C		-		161470949	+1	no_errors	ENST00000392142	ensembl	human	known	74_37	silent	SNP	1.000	T
GEMIN5	25929	genome.wustl.edu	37	5	154287187	154287187	+	Missense_Mutation	SNP	G	G	A	rs200476714		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr5:154287187G>A	ENST00000285873.7	-	16	2434	c.2359C>T	c.(2359-2361)Cgg>Tgg	p.R787W		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	787					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)	p.R787W(1)		breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TCCGGCTCCCGTGCTTGCTCC	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		17400	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						ENSG00000082516						152.0	132.0	138.0					5																	154287187		2203	4300	6503	GEMIN5	SO:0001583	missense	0			GMAF=0.0005	HGNC	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.2359C>T	5.37:g.154287187G>A	ENSP00000285873:p.Arg787Trp	Somatic	0	56	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	43	37.68	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R787W	ENST00000285873.7	37	c.2359	CCDS4330.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	10.94	1.491680	0.26774	.	.	ENSG00000082516	ENST00000285873	T	0.70631	-0.5	5.33	3.37	0.38596	.	1.655010	0.02727	N	0.114597	T	0.66761	0.2822	L	0.36672	1.1	0.09310	N	1	D;D	0.56968	0.978;0.978	B;B	0.40410	0.328;0.328	T	0.63341	-0.6659	10	0.72032	D	0.01	-1.6832	14.1953	0.65667	0.0:0.2846:0.7154:0.0	.	786;787	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	W	787	ENSP00000285873:R787W	ENSP00000285873:R787W	R	-	1	2	GEMIN5	154267380	0.111000	0.22076	0.213000	0.23690	0.099000	0.18886	3.127000	0.50484	1.332000	0.45431	0.563000	0.77884	CGG	-	NULL		0.498	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN5	protein_coding	OTTHUMT00000252507.1	G		rs200476714		154287187	-1	no_errors	ENST00000285873	ensembl	human	known	74_37	missense	SNP	0.054	A
MESP2	145873	genome.wustl.edu	37	15	90320135	90320146	+	In_Frame_Del	DEL	GGGCAGGGGCAG	GGGCAGGGGCAG	-	rs56192595|rs28546919|rs200021459|rs199821487	byFrequency	TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	GGGCAGGGGCAG	GGGCAGGGGCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr15:90320135_90320146delGGGCAGGGGCAG	ENST00000341735.3	+	1	547_558	c.547_558delGGGCAGGGGCAG	c.(547-558)gggcaggggcagdel	p.GQGQ199del	MESP2_ENST00000560219.1_Intron|MESP2_ENST00000558723.1_Intron	NM_001039958.1	NP_001035047.1	Q0VG99	MESP2_HUMAN	mesoderm posterior basic helix-loop-helix transcription factor 2	199	13 X 2 AA tandem repeats of G-Q.				mesodermal cell migration (GO:0008078)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q198_G205delQGQGQGQG(1)		kidney(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)			gcaggggcaagggcaggggcaggggcaggggc	0.783																																																	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)						ENSG00000188095																																			MESP2	SO:0001651	inframe_deletion	0				HGNC		CCDS42078.1	15q26.1	2014-06-30	2014-06-30			ENSG00000188095		"""Basic helix-loop-helix proteins"""	29659	protein-coding gene	gene with protein product		605195	"""mesoderm posterior 2 homolog (mouse)"""			11578861	Standard	NM_001039958		Approved	SCDO2, bHLHc6	uc002bon.3	Q0VG99		ENST00000341735.3:c.547_558delGGGCAGGGGCAG	15.37:g.90320135_90320146delGGGCAGGGGCAG	ENSP00000342392:p.Gly199_Gln202del	Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q7RTU2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.QGQG186in_frame_del	ENST00000341735.3	37	c.547_558	CCDS42078.1	15																																																																																			-	NULL		0.783	MESP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MESP2	protein_coding	OTTHUMT00000416421.1	GGGCAGGGGCAG	XM_085261			90320146	+1	no_errors	ENST00000341735	ensembl	human	known	74_37	in_frame_del	DEL	0.011:0.012:0.038:0.072:0.086:0.084:0.039:0.015:0.014:0.010:0.001:0.000	-
PCDHA9	9752	genome.wustl.edu	37	5	140242769	140242769	+	Intron	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr5:140242769C>T	ENST00000532602.1	+	1	3427				AC005609.1_ENST00000502505.1_Silent_p.T69T|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA14_ENST00000562220.1_RNA|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000506939.2_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCACCGTCACCGTGGTGGCGT	0.682																																					Melanoma(55;1800 1972 14909)												0								ENSG00000249034																																			AC005609.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2394+12295C>T	5.37:g.140242769C>T		Somatic	0	41	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	42	20.75	O15053|Q2M3S5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T69	ENST00000532602.1	37	c.207	CCDS54920.1	5																																																																																			-	NULL		0.682	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000249034	protein_coding	OTTHUMT00000372896.2	C	NM_031857	-		140242769	-1	no_errors	ENST00000502505	ensembl	human	known	74_37	silent	SNP	0.024	T
CLSTN2	64084	genome.wustl.edu	37	3	140281713	140281713	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr3:140281713G>A	ENST00000458420.3	+	14	2463	c.2273G>A	c.(2272-2274)cGt>cAt	p.R758H		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	758					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CGCAACTGGCGTCCGGCTTCC	0.562										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)												0								ENSG00000158258						56.0	53.0	54.0					3																	140281713		2203	4300	6503	CLSTN2	SO:0001583	missense	0			-	HGNC	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2273G>A	3.37:g.140281713G>A	ENSP00000402460:p.Arg758His	Somatic	0	48	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	45	19.64	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R758H	ENST00000458420.3	37	c.2273	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.677905	0.00751	.	.	ENSG00000158258	ENST00000458420	T	0.27402	1.67	4.83	-8.55	0.00908	.	1.202050	0.05498	N	0.557848	T	0.10165	0.0249	N	0.00966	-1.09	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.43972	-0.9358	9	.	.	.	-27.0406	17.2639	0.87079	0.8556:0.0:0.1444:0.0	.	758	Q9H4D0	CSTN2_HUMAN	H	758	ENSP00000402460:R758H	.	R	+	2	0	CLSTN2	141764403	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	-0.480000	0.06559	-1.760000	0.01312	-1.008000	0.02478	CGT	-	NULL		0.562	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	protein_coding	OTTHUMT00000359393.3	G	NM_022131	-		140281713	+1	no_errors	ENST00000458420	ensembl	human	known	74_37	missense	SNP	0.001	A
RASGRF2	5924	genome.wustl.edu	37	5	80382653	80382653	+	Splice_Site	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr5:80382653G>T	ENST00000265080.4	+	9	1338		c.e9-1		RASGRF2_ENST00000502677.1_Splice_Site	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		TTGTGTCACAGAGTAATGCAC	0.473																																																	0								ENSG00000113319						122.0	103.0	109.0					5																	80382653		2203	4300	6503	RASGRF2	SO:0001630	splice_region_variant	0			-	HGNC	AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.1272-1G>T	5.37:g.80382653G>T		Somatic	0	25	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B9EG89|Q9UK56	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e9-1	ENST00000265080.4	37	c.1272-1	CCDS4052.1	5	.	.	.	.	.	.	.	.	.	.	G	14.41	2.528165	0.44969	.	.	ENSG00000113319	ENST00000265080	.	.	.	5.72	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9362	0.70957	0.0688:0.0:0.9312:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RASGRF2	80418409	1.000000	0.71417	0.989000	0.46669	0.439000	0.31926	8.023000	0.88764	1.422000	0.47177	-0.143000	0.13931	.	-	-		0.473	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRF2	protein_coding	OTTHUMT00000239215.2	G	NM_006909	-	Intron	80382653	+1	no_errors	ENST00000265080	ensembl	human	known	74_37	splice_site	SNP	1.000	T
GLRA1	2741	genome.wustl.edu	37	5	151231024	151231024	+	Missense_Mutation	SNP	C	C	T	rs281864918		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr5:151231024C>T	ENST00000455880.2	-	7	1125	c.839G>A	c.(838-840)cGt>cAt	p.R280H	GLRA1_ENST00000545569.1_Missense_Mutation_p.R197H|GLRA1_ENST00000274576.4_Missense_Mutation_p.R280H|GLRA1_ENST00000471351.2_5'UTR			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	280			R -> H (in HKPX1). {ECO:0000269|PubMed:10514101}.		acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TAGGCCCACACGAGCAGGTGC	0.537																																																	0			GRCh37	CM992337	GLRA1	M		ENSG00000145888						141.0	123.0	129.0					5																	151231024		2203	4300	6503	GLRA1	SO:0001583	missense	0			-	HGNC		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.839G>A	5.37:g.151231024C>T	ENSP00000411593:p.Arg280His	Somatic	0	61	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	39	38.10	B2R6T3|Q14C77|Q6DJV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Glycine_rcpt_A1,prints_Neur_channel,tigrfam_Neur_channel	p.R280H	ENST00000455880.2	37	c.839	CCDS54942.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.441151	0.96187	.	.	ENSG00000145888	ENST00000274576;ENST00000455880;ENST00000545569	D;D;D	0.90004	-2.6;-2.6;-2.6	5.2	5.2	0.72013	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.96812	0.8959	H	0.97265	3.97	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.993;1.0;0.999	D	0.98130	1.0430	10	0.87932	D	0	.	19.1084	0.93307	0.0:1.0:0.0:0.0	.	280;197;280	P23415;Q14C71;P23415-2	GLRA1_HUMAN;.;.	H	280;280;197	ENSP00000274576:R280H;ENSP00000411593:R280H;ENSP00000445913:R197H	ENSP00000274576:R280H	R	-	2	0	GLRA1	151211217	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.642000	0.83385	2.579000	0.87056	0.655000	0.94253	CGT	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel		0.537	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA1	protein_coding	OTTHUMT00000373959.1	C		-		151231024	-1	no_errors	ENST00000455880	ensembl	human	known	74_37	missense	SNP	1.000	T
TNS3	64759	genome.wustl.edu	37	7	47454731	47454731	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr7:47454731C>G	ENST00000398879.1	-	11	913	c.547G>C	c.(547-549)Gtc>Ctc	p.V183L	TNS3_ENST00000442536.2_Missense_Mutation_p.V183L|TNS3_ENST00000355730.3_Missense_Mutation_p.V183L|TNS3_ENST00000458317.2_Missense_Mutation_p.V183L|TNS3_ENST00000311160.9_Missense_Mutation_p.V183L			Q68CZ2	TENS3_HUMAN	tensin 3	183	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						TGGAGGATGACAAAATGCAGG	0.567																																																	0								ENSG00000136205						88.0	104.0	99.0					7																	47454731		2046	4196	6242	TNS3	SO:0001583	missense	0			-	HGNC	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.547G>C	7.37:g.47454731C>G	ENSP00000381854:p.Val183Leu	Somatic	0	61	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	57	14.93	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.V183L	ENST00000398879.1	37	c.547	CCDS5506.2	7	.	.	.	.	.	.	.	.	.	.	C	15.18	2.757291	0.49468	.	.	ENSG00000136205	ENST00000311160;ENST00000538633;ENST00000398879;ENST00000355730;ENST00000457718;ENST00000450444;ENST00000442536;ENST00000458317	D;D;D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14	5.14	4.25	0.50352	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.415707	0.23631	N	0.046137	D	0.82944	0.5147	L	0.61218	1.895	0.40623	D	0.98178	B;P	0.41978	0.011;0.767	B;B	0.34991	0.018;0.193	D	0.83595	0.0125	10	0.54805	T	0.06	-38.8308	11.321	0.49421	0.1822:0.8178:0.0:0.0	.	183;183	Q68CZ2-4;Q68CZ2	.;TENS3_HUMAN	L	183;293;183;183;286;272;183;183	ENSP00000312143:V183L;ENSP00000381854:V183L;ENSP00000347968:V183L;ENSP00000414358:V286L;ENSP00000396914:V272L;ENSP00000389285:V183L;ENSP00000388318:V183L	ENSP00000312143:V183L	V	-	1	0	TNS3	47421256	0.991000	0.36638	0.839000	0.33178	0.914000	0.54420	2.916000	0.48813	1.290000	0.44636	0.655000	0.94253	GTC	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,smart_Tyr_Pase_cat,pfscan_Tensin_phosphatase_C2-dom		0.567	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS3	protein_coding	OTTHUMT00000157253.1	C	NM_022748	-		47454731	-1	no_errors	ENST00000311160	ensembl	human	known	74_37	missense	SNP	0.971	G
NFKB1	4790	genome.wustl.edu	37	4	103500090	103500090	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr4:103500090G>A	ENST00000505458.1	+	8	898	c.621G>A	c.(619-621)atG>atA	p.M207I	NFKB1_ENST00000600343.1_Missense_Mutation_p.M27I|NFKB1_ENST00000226574.4_Missense_Mutation_p.M208I|NFKB1_ENST00000510638.1_3'UTR|NFKB1_ENST00000394820.4_Missense_Mutation_p.M207I			P19838	NFKB1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 1	207	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				apoptotic process (GO:0006915)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of cytokine production (GO:0001818)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-12 biosynthetic process (GO:0045083)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|response to copper ion (GO:0046688)|response to oxidative stress (GO:0006979)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleic acid binding transcription factor activity (GO:0001071)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			biliary_tract(1)|breast(4)|endometrium(2)|large_intestine(6)|lung(7)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.59e-08)	Acetylsalicylic acid(DB00945)|Pranlukast(DB01411)|Thalidomide(DB01041)|Triflusal(DB08814)	CCAAGGAGATGGACCTCAGCG	0.542																																																	0								ENSG00000109320						120.0	107.0	111.0					4																	103500090		2203	4300	6503	NFKB1	SO:0001583	missense	0			-	HGNC	M58603	CCDS3657.1, CCDS54783.1	4q24	2013-01-10	2008-07-28		ENSG00000109320	ENSG00000109320		"""Ankyrin repeat domain containing"""	7794	protein-coding gene	gene with protein product		164011				1992489	Standard	NM_003998		Approved	KBF1, p105, NFKB-p50, p50, NF-kappaB, NFkappaB, NF-kB1	uc011cep.2	P19838	OTTHUMG00000161080	ENST00000505458.1:c.621G>A	4.37:g.103500090G>A	ENSP00000424790:p.Met207Ile	Somatic	0	50	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	43	32.81	A8K5Y5|B3KVE8|Q68D84|Q86V43|Q8N4X7|Q9NZC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RHD,pfam_Ankyrin_rpt,pfam_Death_domain,superfamily_p53-like_TF_DNA-bd,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ig_E-set,superfamily_DEATH-like_dom,smart_IPT,smart_Ankyrin_rpt,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_RHD,prints_NF_Rel_Dor,prints_Ankyrin_rpt	p.M208I	ENST00000505458.1	37	c.624	CCDS54783.1	4	.	.	.	.	.	.	.	.	.	.	G	3.440	-0.114174	0.06881	.	.	ENSG00000109320	ENST00000226574;ENST00000394820;ENST00000505458;ENST00000508584	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.51	5.51	0.81932	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.043946	0.85682	D	0.000000	T	0.20088	0.0483	N	0.03948	-0.315	0.54753	D	0.999989	P;B;B	0.35821	0.523;0.405;0.055	B;B;B	0.30029	0.11;0.11;0.058	T	0.13683	-1.0500	10	0.49607	T	0.09	.	12.723	0.57152	0.0755:0.0:0.9245:0.0	.	27;207;208	B3KVE8;P19838;P19838-2	.;NFKB1_HUMAN;.	I	208;207;207;1	ENSP00000226574:M208I;ENSP00000378297:M207I;ENSP00000424790:M207I;ENSP00000424815:M1I	ENSP00000226574:M208I	M	+	3	0	NFKB1	103719128	1.000000	0.71417	1.000000	0.80357	0.398000	0.30690	5.369000	0.66138	2.589000	0.87451	0.585000	0.79938	ATG	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD		0.542	NFKB1-003	KNOWN	alternative_5_UTR|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	NFKB1	protein_coding	OTTHUMT00000363411.1	G		-		103500090	+1	no_errors	ENST00000226574	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM132B	151176	genome.wustl.edu	37	2	239071412	239071412	+	Silent	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:239071412C>T	ENST00000546354.1	+	3	357	c.357C>T	c.(355-357)ccC>ccT	p.P119P				Q4G0M1	ERFE_HUMAN	family with sequence similarity 132, member B	119	Pro-rich.				cellular iron ion homeostasis (GO:0006879)|positive regulation of fatty acid transport (GO:2000193)|regulation of fatty acid metabolic process (GO:0019217)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)										CTCCCGGTCCCCAGGGCCCCC	0.667																																																	0								ENSG00000178752																																			FAM132B	SO:0001819	synonymous_variant	0			-	HGNC	AK094353		2q37.3	2012-04-12			ENSG00000178752	ENSG00000178752			26727	protein-coding gene	gene with protein product	"""myonectin"""	615099				22351773	Standard	XM_006710143		Approved	FLJ37034, CTRP15, C1QTNF15	uc002vxt.3	Q4G0M1	OTTHUMG00000152901	ENST00000546354.1:c.357C>T	2.37:g.239071412C>T		Somatic	0	70	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	21	58.82	W8S2M9	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Tumour_necrosis_fac-like_dom	p.P119	ENST00000546354.1	37	c.357		2																																																																																			-	NULL		0.667	FAM132B-008	PUTATIVE	basic|appris_principal	protein_coding	FAM132B	protein_coding	OTTHUMT00000328509.2	C	XM_001127207	-		239071412	+1	no_errors	ENST00000546354	ensembl	human	putative	74_37	silent	SNP	0.632	T
TUBBP5	643224	genome.wustl.edu	37	9	141071190	141071190	+	RNA	SNP	T	T	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr9:141071190T>C	ENST00000503395.1	+	0	1735									tubulin, beta pseudogene 5																		ATGCCTGGCTTTGCCCCACTG	0.617																																																	0								ENSG00000159247																																			TUBBP5			0			-	HGNC	AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141071190T>C		Somatic	0	75	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	41	16.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			-	-		0.617	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	pseudogene	OTTHUMT00000373087.1	T	NR_027156	-		141071190	+1	no_errors	ENST00000290377	ensembl	human	known	74_37	rna	SNP	1.000	C
MRGPRF	116535	genome.wustl.edu	37	11	68773521	68773521	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr11:68773521G>C	ENST00000309099.6	-	3	639	c.257C>G	c.(256-258)gCc>gGc	p.A86G	MRGPRF_ENST00000441623.1_Missense_Mutation_p.A86G|RP11-554A11.5_ENST00000562506.1_RNA	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	86						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			ATCGGCGCTGGCCAGGTGCAG	0.612																																																	0								ENSG00000172935						35.0	34.0	35.0					11																	68773521		2194	4290	6484	MRGPRF	SO:0001583	missense	0			-	HGNC	AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.257C>G	11.37:g.68773521G>C	ENSP00000309782:p.Ala86Gly	Somatic	0	47	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	36	36.84	B3KV43|Q8NBK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A86G	ENST00000309099.6	37	c.257	CCDS8188.1	11	.	.	.	.	.	.	.	.	.	.	G	18.28	3.589916	0.66105	.	.	ENSG00000172935	ENST00000441623;ENST00000309099	T;T	0.56611	0.45;0.45	4.86	4.86	0.63082	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44688	D	0.000440	T	0.73923	0.3649	M	0.85299	2.745	0.39824	D	0.972887	D	0.89917	1.0	D	0.77557	0.99	T	0.79403	-0.1818	10	0.62326	D	0.03	-40.3379	13.5118	0.61517	0.0:0.0:1.0:0.0	.	86	Q96AM1	MRGRF_HUMAN	G	86	ENSP00000403660:A86G;ENSP00000309782:A86G	ENSP00000309782:A86G	A	-	2	0	MRGPRF	68530097	1.000000	0.71417	0.941000	0.38009	0.523000	0.34469	5.019000	0.64060	2.248000	0.74166	0.561000	0.74099	GCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.612	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRF	protein_coding	OTTHUMT00000396875.1	G	NM_145015	-		68773521	-1	no_errors	ENST00000309099	ensembl	human	known	74_37	missense	SNP	1.000	C
SLIT2	9353	genome.wustl.edu	37	4	20620477	20620477	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr4:20620477C>G	ENST00000504154.1	+	37	4687	c.4435C>G	c.(4435-4437)Cga>Gga	p.R1479G	SLIT2_ENST00000273739.5_Missense_Mutation_p.R1492G|SLIT2_ENST00000503823.1_Missense_Mutation_p.R1471G|SLIT2_ENST00000503837.1_Missense_Mutation_p.R1475G	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1479	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039, ECO:0000305}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)	p.R1479R(1)		NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						GAAGGTGTCCCGATTAGAGTG	0.507																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000145147						106.0	91.0	96.0					4																	20620477		2203	4300	6503	SLIT2	SO:0001583	missense	0			-	HGNC	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.4435C>G	4.37:g.20620477C>G	ENSP00000422591:p.Arg1479Gly	Somatic	0	61	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	64	20.00	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.R1479G	ENST00000504154.1	37	c.4435	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490889	0.44249	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.80566	-1.38;-1.39;-1.3;-1.36	6.17	5.33	0.75918	Cystine knot, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.77980	0.4212	L	0.53249	1.67	0.80722	D	1	P;P	0.40197	0.706;0.577	B;B	0.41723	0.365;0.16	T	0.75584	-0.3267	10	0.27785	T	0.31	.	13.8072	0.63240	0.4128:0.5872:0.0:0.0	.	1471;1479	O94813-3;O94813	.;SLIT2_HUMAN	G	1471;1479;1492;1475;1475	ENSP00000427548:R1471G;ENSP00000422591:R1479G;ENSP00000273739:R1492G;ENSP00000422261:R1475G	ENSP00000273739:R1492G	R	+	1	2	SLIT2	20229575	0.938000	0.31826	0.029000	0.17559	0.901000	0.52897	2.077000	0.41557	1.615000	0.50252	0.655000	0.94253	CGA	-	smart_Cys_knot_C,pfscan_Cys_knot_C		0.507	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	protein_coding	OTTHUMT00000250396.2	C		-		20620477	+1	no_errors	ENST00000504154	ensembl	human	known	74_37	missense	SNP	0.962	G
CDH13	1012	genome.wustl.edu	37	16	82875745	82875750	+	Intron	DEL	ACATAT	ACATAT	-	rs12446276|rs543969962|rs12921381|rs12921382	byFrequency	TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	ACATAT	ACATAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr16:82875745_82875750delACATAT	ENST00000566620.1	+	2	335				RN7SL134P_ENST00000579756.1_RNA|CDH13_ENST00000431540.3_Intron|AC099506.1_ENST00000408468.1_RNA|CDH13_ENST00000567445.1_Intron|CDH13_ENST00000565636.1_Intron|CDH13_ENST00000446376.2_Intron|CDH13_ENST00000428848.3_Intron|CDH13_ENST00000268613.10_Intron	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13						adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		atatatatacacatatatatatatat	0.257																																																	0								ENSG00000221395																																			AC099506.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.46-16217ACATAT>-	16.37:g.82875745_82875750delACATAT		Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000566620.1	37	NULL	CCDS58486.1	16																																																																																			-	-		0.257	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221395	protein_coding	OTTHUMT00000432917.1	ACATAT	NM_001257			82875750	+1	no_errors	ENST00000408468	ensembl	human	novel	74_37	rna	DEL	0.003:0.002:0.004:0.004:0.003:0.003	-
ZNF663P	100130934	genome.wustl.edu	37	20	45084777	45084777	+	RNA	SNP	A	A	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr20:45084777A>G	ENST00000400371.2	-	0	1741									zinc finger protein 663, pseudogene																		TCCCACACTCAGGACATCTGT	0.403																																																	0								ENSG00000215452																																			ZNF663P			0			-	HGNC			20q13.12	2014-03-13	2013-09-26	2013-09-26	ENSG00000215452	ENSG00000215452		"""Zinc fingers, C2H2-type"""	25342	pseudogene	pseudogene			"""zinc finger protein 663"""	ZNF663			Standard	NR_045983		Approved	DKFZp547G0215	uc031rtv.1		OTTHUMG00000032648		20.37:g.45084777A>G		Somatic	0	59	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	75	24.24		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000400371.2	37	NULL		20																																																																																			-	-		0.403	ZNF663P-002	KNOWN	basic	processed_transcript	ZNF663P	pseudogene	OTTHUMT00000079571.1	A	NM_173643	-		45084777	-1	no_errors	ENST00000400371	ensembl	human	known	74_37	rna	SNP	0.000	G
KIAA1598	57698	genome.wustl.edu	37	10	118644866	118644867	+	3'UTR	INS	-	-	T	rs145381187		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr10:118644866_118644867insT	ENST00000355371.4	-	0	3381_3382				KIAA1598_ENST00000260777.10_3'UTR|KIAA1598_ENST00000392903.2_Intron|KIAA1598_ENST00000497044.1_5'UTR|ENO4_ENST00000369207.2_Intron	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598						axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		AGCTGCATAAGTTTTTTTTTTA	0.262																																																	0								ENSG00000187164																																			KIAA1598	SO:0001624	3_prime_UTR_variant	0				HGNC	BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.*989->A	10.37:g.118644876_118644876dupT		Somatic	0	57	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000355371.4	37	NULL	CCDS44482.1	10																																																																																			-	-		0.262	KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1598	protein_coding		-	NM_018330			118644867	-1	no_errors	ENST00000497044	ensembl	human	known	74_37	rna	INS	1.000:0.999	T
LCT	3938	genome.wustl.edu	37	2	136575391	136575391	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:136575391G>T	ENST00000264162.2	-	6	1237	c.1227C>A	c.(1225-1227)agC>agA	p.S409R	AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	409	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GATCCCAGATGCTCACCCCTC	0.632																																																	0								ENSG00000115850						68.0	69.0	69.0					2																	136575391		2203	4300	6503	LCT	SO:0001583	missense	0			-	HGNC	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.1227C>A	2.37:g.136575391G>T	ENSP00000264162:p.Ser409Arg	Somatic	0	64	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	39	42.65	Q4ZG58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.S409R	ENST00000264162.2	37	c.1227	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.141038	0.77775	.	.	ENSG00000115850	ENST00000264162	T	0.39997	1.05	5.77	1.81	0.25067	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.097978	0.64402	D	0.000001	T	0.68613	0.3020	H	0.97158	3.95	0.33046	D	0.532136	D	0.56968	0.978	P	0.58577	0.841	T	0.79911	-0.1603	10	0.72032	D	0.01	-26.8842	10.4388	0.44452	0.351:0.0:0.649:0.0	.	409	P09848	LPH_HUMAN	R	409	ENSP00000264162:S409R	ENSP00000264162:S409R	S	-	3	2	LCT	136291861	0.960000	0.32886	0.710000	0.30468	0.028000	0.11728	0.541000	0.23207	0.408000	0.25621	-0.140000	0.14226	AGC	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF		0.632	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	protein_coding	OTTHUMT00000254657.1	G	NM_002299	-		136575391	-1	no_errors	ENST00000264162	ensembl	human	known	74_37	missense	SNP	1.000	T
GDF10	2662	genome.wustl.edu	37	10	48438537	48438537	+	Silent	SNP	C	C	T	rs45620039		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr10:48438537C>T	ENST00000224605.2	-	1	439	c.174G>A	c.(172-174)cgG>cgA	p.R58R		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	58					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						CCCCAGGGTGCCGCTGGAGAT	0.731																																																	0								ENSG00000107623						7.0	7.0	7.0					10																	48438537		2124	4201	6325	GDF10	SO:0001819	synonymous_variant	0			-	HGNC	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.174G>A	10.37:g.48438537C>T		Somatic	0	41	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q5VSQ8|Q9UCX6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,pirsf_BMP3/GDF10	p.R58	ENST00000224605.2	37	c.174	CCDS7220.1	10																																																																																			-	pirsf_BMP3/GDF10		0.731	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF10	protein_coding	OTTHUMT00000047884.1	C	NM_004962	rs45620039		48438537	-1	no_errors	ENST00000224605	ensembl	human	known	74_37	silent	SNP	0.030	T
MYCBP2	23077	genome.wustl.edu	37	13	77629706	77629730	+	Frame_Shift_Del	DEL	TAGCACACATAATATGCATATCTAT	TAGCACACATAATATGCATATCTAT	-	rs567496054		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	TAGCACACATAATATGCATATCTAT	TAGCACACATAATATGCATATCTAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr13:77629706_77629730delTAGCACACATAATATGCATATCTAT	ENST00000544440.2	-	80	13513_13537	c.13496_13520delATAGATATGCATATTATGTGTGCTA	c.(13495-13521)aatagatatgcatattatgtgtgctacfs	p.NRYAYYVCY4499fs	MYCBP2_ENST00000357337.6_Frame_Shift_Del_p.NRYAYYVCY4499fs|MYCBP2_ENST00000407578.2_Frame_Shift_Del_p.NRYAYYVCY4537fs					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TCTGCATTTGTAGCACACATAATATGCATATCTATTCATTGCATA	0.329																																																	0								ENSG00000005810																																			MYCBP2	SO:0001589	frameshift_variant	0				HGNC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.13496_13520delATAGATATGCATATTATGTGTGCTA	13.37:g.77629706_77629730delTAGCACACATAATATGCATATCTAT	ENSP00000444596:p.Asn4499fs	Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.N4537fs	ENST00000544440.2	37	c.13634_13610		13																																																																																			-	NULL		0.329	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	protein_coding	OTTHUMT00000045326.1	TAGCACACATAATATGCATATCTAT	NM_015057			77629730	-1	no_errors	ENST00000407578	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:0.972:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.997:1.000:1.000:1.000:1.000:0.998:0.947:1.000	-
ZFHX3	463	genome.wustl.edu	37	16	72992883	72992883	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr16:72992883C>G	ENST00000268489.5	-	2	1834	c.1162G>C	c.(1162-1164)Gag>Cag	p.E388Q	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	388					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				TGGGGCTGCTCGGGGCCAGCG	0.607																																																	0								ENSG00000140836						48.0	62.0	57.0					16																	72992883		2190	4295	6485	ZFHX3	SO:0001583	missense	0			-	HGNC	D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.1162G>C	16.37:g.72992883C>G	ENSP00000268489:p.Glu388Gln	Somatic	0	31	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	37	15.91	D3DWS8|O15101|Q13719	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.E388Q	ENST00000268489.5	37	c.1162	CCDS10908.1	16	.	.	.	.	.	.	.	.	.	.	C	9.207	1.030038	0.19512	.	.	ENSG00000140836	ENST00000268489	T	0.74632	-0.86	4.92	4.92	0.64577	.	0.000000	0.49305	D	0.000149	T	0.77731	0.4174	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.69307	0.963	T	0.80466	-0.1370	10	0.52906	T	0.07	.	18.4761	0.90793	0.0:1.0:0.0:0.0	.	388	Q15911	ZFHX3_HUMAN	Q	388	ENSP00000268489:E388Q	ENSP00000268489:E388Q	E	-	1	0	ZFHX3	71550384	1.000000	0.71417	0.993000	0.49108	0.915000	0.54546	4.776000	0.62354	2.448000	0.82819	0.591000	0.81541	GAG	-	NULL		0.607	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	protein_coding	OTTHUMT00000269008.1	C	NM_006885	-		72992883	-1	no_errors	ENST00000268489	ensembl	human	known	74_37	missense	SNP	0.998	G
ANP32A	8125	genome.wustl.edu	37	15	69072347	69072347	+	3'UTR	DEL	G	G	-	rs3214818	byFrequency	TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr15:69072347delG	ENST00000465139.2	-	0	966				ANP32A_ENST00000483551.2_5'Flank	NM_006305.3	NP_006296.1	P39687	AN32A_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member A						gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|nucleocytoplasmic transport (GO:0006913)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						CAGGATTGGAGGGGGGGGGGA	0.478													|||unknown(HR)	16	0.00319489	0.0083	0.0029	5008	,	,		8789	0.001		0.0	False		,,,				2504	0.002																0								ENSG00000140350																																			ANP32A	SO:0001624	3_prime_UTR_variant	0				HGNC	AF025684	CCDS45292.1	15q23	2008-05-14			ENSG00000140350	ENSG00000140350		"""ANP32 acidic nuclear phosphoproteins"""	13233	protein-coding gene	gene with protein product		600832		C15orf1		8970164, 9144194	Standard	NM_006305		Approved	LANP, PP32, I1PP2A, PHAPI, MAPM, mapmodulin	uc002arl.3	P39687	OTTHUMG00000154502	ENST00000465139.2:c.*73C>-	15.37:g.69072347delG		Somatic	0	45	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	47	14.55	B2R6T4|Q53FK4|Q5J8L8|Q7M4N6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000465139.2	37	NULL	CCDS45292.1	15																																																																																			-	-		0.478	ANP32A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32A	protein_coding	OTTHUMT00000335525.2	G				69072347	-1	no_errors	ENST00000267918	ensembl	human	known	74_37	rna	DEL	0.000	-
FAM181B	220382	genome.wustl.edu	37	11	82443505	82443505	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr11:82443505delC	ENST00000329203.3	-	1	1401	c.1267delG	c.(1267-1269)gcgfs	p.A423fs		NM_175885.3	NP_787081.2	A6NEQ2	F181B_HUMAN	family with sequence similarity 181, member B	423										large_intestine(1)|lung(2)|prostate(1)	4						TCCCGGTGCGCCCCCTCCTCC	0.632																																																	0								ENSG00000182103						12.0	15.0	14.0					11																	82443505		2194	4287	6481	FAM181B	SO:0001589	frameshift_variant	0				HGNC	AK095054, BC039262	CCDS31648.1	11q14.1	2011-11-30			ENSG00000182103	ENSG00000182103			28512	protein-coding gene	gene with protein product						12477932	Standard	NM_175885		Approved	LOC220382, MGC33846	uc001ozp.3	A6NEQ2	OTTHUMG00000166869	ENST00000329203.3:c.1267delG	11.37:g.82443505delC	ENSP00000365295:p.Ala423fs	Somatic	0	30	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	B2RWP1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.A423fs	ENST00000329203.3	37	c.1267	CCDS31648.1	11																																																																																			-	NULL		0.632	FAM181B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM181B	protein_coding	OTTHUMT00000391626.1	C	NM_175885			82443505	-1	no_errors	ENST00000329203	ensembl	human	known	74_37	frame_shift_del	DEL	0.832	-
SCUBE2	57758	genome.wustl.edu	37	11	9101004	9101007	+	Frame_Shift_Del	DEL	CAAA	CAAA	-			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	CAAA	CAAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr11:9101004_9101007delCAAA	ENST00000309263.3	-	3	378_381	c.306_309delTTTG	c.(304-309)tgtttgfs	p.CL102fs	SCUBE2_ENST00000520467.1_Frame_Shift_Del_p.CL102fs|SCUBE2_ENST00000450649.2_Frame_Shift_Del_p.CL102fs|SCUBE2_ENST00000534295.1_5'Flank|SCUBE2_ENST00000457346.2_Frame_Shift_Del_p.CL102fs			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	102	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		CTGGAATATTCAAACAGTCATGGA	0.407																																																	0								ENSG00000175356																																			SCUBE2	SO:0001589	frameshift_variant	0				HGNC	AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.306_309delTTTG	11.37:g.9101004_9101007delCAAA	ENSP00000310658:p.Cys102fs	Somatic	0	38	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	34	27.66	Q2NKQ8|Q6ZWI1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.C102fs	ENST00000309263.3	37	c.309_306		11																																																																																			-	smart_EGF-like_Ca-bd_dom,smart_EG-like_dom		0.407	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	SCUBE2	protein_coding	OTTHUMT00000385812.2	CAAA	NM_020974			9101007	-1	no_errors	ENST00000457346	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
DMD	1756	genome.wustl.edu	37	X	31986600	31986600	+	De_novo_Start_OutOfFrame	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chrX:31986600G>T	ENST00000474231.1	-	0	130				DMD_ENST00000378677.2_Missense_Mutation_p.T2153N|DMD_ENST00000378707.3_De_novo_Start_OutOfFrame|DMD_ENST00000541735.1_De_novo_Start_OutOfFrame|DMD_ENST00000359836.1_De_novo_Start_OutOfFrame|DMD_ENST00000343523.2_De_novo_Start_OutOfFrame|DMD_ENST00000357033.4_Missense_Mutation_p.T2157N	NM_004021.2	NP_004012	P11532	DMD_HUMAN	dystrophin						cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TCTGACAACAGTTTGCCGCTG	0.393																																																	0								ENSG00000198947						76.0	67.0	70.0					X																	31986600		2202	4298	6500	DMD			0			-	HGNC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000474231.1:c.-911C>A	X.37:g.31986600G>T		Somatic	0	22	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.T2157N	ENST00000474231.1	37	c.6470		X	.	.	.	.	.	.	.	.	.	.	G	9.825	1.186855	0.21870	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.34275	1.37;1.37	5.37	2.57	0.30868	.	0.475587	0.14810	U	0.297118	T	0.29223	0.0727	L	0.54323	1.7	0.80722	D	1	B;B;B;B;P;B	0.36789	0.305;0.232;0.301;0.274;0.57;0.044	B;B;B;B;B;B	0.33254	0.054;0.086;0.16;0.14;0.14;0.072	T	0.02526	-1.1146	10	0.18710	T	0.47	.	9.9858	0.41841	0.0726:0.2533:0.6741:0.0	.	816;2149;2157;2153;816;813	P11532-2;P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;.;DMD_HUMAN;.;.;.	N	2149;816;813;2153;2157;2157;2034	ENSP00000367948:T2153N;ENSP00000354923:T2157N	ENSP00000354923:T2157N	T	-	2	0	DMD	31896521	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	2.138000	0.42140	0.112000	0.17975	0.538000	0.68166	ACT	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.393	DMD-016	PUTATIVE	basic	protein_coding	DMD	protein_coding	OTTHUMT00000356267.1	G	NM_004006	-		31986600	-1	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF202	7753	genome.wustl.edu	37	11	123597592	123597592	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr11:123597592A>G	ENST00000529691.1	-	7	1279	c.1060T>C	c.(1060-1062)Tgg>Cgg	p.W354R	ZNF202_ENST00000530393.1_Missense_Mutation_p.W354R|ZNF202_ENST00000336139.4_Missense_Mutation_p.W354R			O95125	ZN202_HUMAN	zinc finger protein 202	354					lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		ACTATTTCCCAATCTGGAGTC	0.408																																																	0								ENSG00000166261						127.0	145.0	139.0					11																	123597592		2202	4298	6500	ZNF202	SO:0001583	missense	0			-	HGNC	AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.1060T>C	11.37:g.123597592A>G	ENSP00000433881:p.Trp354Arg	Somatic	0	52	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.W354R	ENST00000529691.1	37	c.1060	CCDS8443.1	11	.	.	.	.	.	.	.	.	.	.	A	12.03	1.814995	0.32053	.	.	ENSG00000166261	ENST00000336139;ENST00000530393;ENST00000529691	T;T;T	0.05786	3.39;3.39;3.39	4.41	4.41	0.53225	.	0.150963	0.31685	N	0.007225	T	0.05044	0.0135	N	0.22421	0.69	0.34278	D	0.681773	B	0.12013	0.005	B	0.11329	0.006	T	0.25676	-1.0125	10	0.25106	T	0.35	-5.7543	11.916	0.52765	1.0:0.0:0.0:0.0	.	354	O95125	ZN202_HUMAN	R	354	ENSP00000337724:W354R;ENSP00000432504:W354R;ENSP00000433881:W354R	ENSP00000337724:W354R	W	-	1	0	ZNF202	123102802	0.002000	0.14202	0.996000	0.52242	0.854000	0.48673	1.408000	0.34668	1.973000	0.57446	0.533000	0.62120	TGG	-	NULL		0.408	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF202	protein_coding	OTTHUMT00000387419.1	A	NM_003455	-		123597592	-1	no_errors	ENST00000336139	ensembl	human	known	74_37	missense	SNP	0.965	G
TNC	3371	genome.wustl.edu	37	9	117848623	117848623	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr9:117848623A>G	ENST00000350763.4	-	3	1798	c.1387T>C	c.(1387-1389)Tat>Cat	p.Y463H	TNC_ENST00000535648.1_Missense_Mutation_p.Y463H|TNC_ENST00000341037.4_Missense_Mutation_p.Y463H|TNC_ENST00000537320.1_Missense_Mutation_p.Y463H|TNC_ENST00000345230.3_Missense_Mutation_p.Y463H|TNC_ENST00000423613.2_Missense_Mutation_p.Y463H|TNC_ENST00000340094.3_Missense_Mutation_p.Y463H|TNC_ENST00000346706.3_Missense_Mutation_p.Y463H|TNC_ENST00000542877.1_Missense_Mutation_p.Y463H	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	463	EGF-like 10. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CTGCAGTCATAGCCCTTGAAG	0.567																																																	0								ENSG00000041982						152.0	142.0	145.0					9																	117848623		2203	4300	6503	TNC	SO:0001583	missense	0			-	HGNC		CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.1387T>C	9.37:g.117848623A>G	ENSP00000265131:p.Tyr463His	Somatic	0	29	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.Y463H	ENST00000350763.4	37	c.1387	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	A	7.070	0.568125	0.13560	.	.	ENSG00000041982	ENST00000340094;ENST00000535648;ENST00000346706;ENST00000345230;ENST00000350763;ENST00000442945;ENST00000341037;ENST00000423613;ENST00000537320;ENST00000542877	T;T;T;T;T;T;T;T;T	0.03242	4.0;4.0;4.0;4.0;4.0;4.0;4.0;4.0;4.0	5.82	2.1	0.27182	Epidermal growth factor-like (1);EGF-like region, conserved site (2);	0.516583	0.22485	N	0.059442	T	0.02267	0.0070	N	0.13235	0.315	0.21290	N	0.999738	B;B	0.16396	0.017;0.003	B;B	0.16289	0.015;0.004	T	0.48422	-0.9037	10	0.18710	T	0.47	.	8.9094	0.35543	0.3668:0.5565:0.0767:0.0	.	463;463	E9PC84;P24821	.;TENA_HUMAN	H	463	ENSP00000344400:Y463H;ENSP00000438152:Y463H;ENSP00000344555:Y463H;ENSP00000345861:Y463H;ENSP00000265131:Y463H;ENSP00000339553:Y463H;ENSP00000411406:Y463H;ENSP00000443478:Y463H;ENSP00000442242:Y463H	ENSP00000344400:Y463H	Y	-	1	0	TNC	116888444	0.010000	0.17322	0.584000	0.28653	0.845000	0.48019	0.970000	0.29383	0.415000	0.25817	0.379000	0.24179	TAT	-	pfam_EGF_extracell,smart_EG-like_dom		0.567	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	protein_coding	OTTHUMT00000055418.2	A	NM_002160	-		117848623	-1	no_errors	ENST00000350763	ensembl	human	known	74_37	missense	SNP	0.699	G
ADAM28	10863	genome.wustl.edu	37	8	24170916	24170916	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr8:24170916G>T	ENST00000265769.4	+	6	509	c.399G>T	c.(397-399)caG>caT	p.Q133H	RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000397649.3_5'UTR|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAM28_ENST00000540823.1_Intron|ADAM28_ENST00000437154.2_Missense_Mutation_p.Q133H	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	133					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		ACTTCAGTCAGGGGGATCAAA	0.388																																					NSCLC(193;488 2149 22258 34798 40734)												0								ENSG00000042980						78.0	75.0	76.0					8																	24170916		2203	4300	6503	ADAM28	SO:0001583	missense	0			-	HGNC	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.399G>T	8.37:g.24170916G>T	ENSP00000265769:p.Gln133His	Somatic	0	60	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	56	21.13	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Q133H	ENST00000265769.4	37	c.399	CCDS34865.1	8	.	.	.	.	.	.	.	.	.	.	G	3.317	-0.139510	0.06669	.	.	ENSG00000042980	ENST00000265769;ENST00000437154	T;T	0.05649	3.41;3.41	5.48	-1.51	0.08664	Peptidase M12B, propeptide (1);	.	.	.	.	T	0.03136	0.0092	N	0.16266	0.395	0.29732	N	0.837806	B;B	0.22909	0.077;0.003	B;B	0.23419	0.046;0.006	T	0.47535	-0.9110	9	0.14656	T	0.56	.	3.8979	0.09147	0.4538:0.0:0.35:0.1963	.	133;133	Q9UKQ2;Q9UKQ2-2	ADA28_HUMAN;.	H	133	ENSP00000265769:Q133H;ENSP00000393699:Q133H	ENSP00000265769:Q133H	Q	+	3	2	ADAM28	24226861	0.994000	0.37717	0.859000	0.33776	0.166000	0.22503	0.006000	0.13152	-0.014000	0.14175	-0.378000	0.06908	CAG	-	pfam_Peptidase_M12B_N		0.388	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	protein_coding	OTTHUMT00000375441.2	G	NM_021778	-		24170916	+1	no_errors	ENST00000265769	ensembl	human	known	74_37	missense	SNP	0.367	T
CNTNAP4	85445	genome.wustl.edu	37	16	76482698	76482698	+	Silent	SNP	C	C	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr16:76482698C>A	ENST00000476707.1	+	5	925	c.786C>A	c.(784-786)gtC>gtA	p.V262V	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000478060.1_Silent_p.V234V|CNTNAP4_ENST00000307431.8_Silent_p.V258V|CNTNAP4_ENST00000377504.4_Silent_p.V258V			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	259	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						CCACCCTGGTCAATCTCACCC	0.463																																																	0								ENSG00000152910						112.0	92.0	99.0					16																	76482698		2198	4300	6498	CNTNAP4	SO:0001819	synonymous_variant	0			-	HGNC	AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.786C>A	16.37:g.76482698C>A		Somatic	0	51	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	5	83.87	E9PFZ6|Q86YZ7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.V258	ENST00000476707.1	37	c.774		16																																																																																			-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.463	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	protein_coding	OTTHUMT00000348216.1	C	NM_033401	-		76482698	+1	no_errors	ENST00000307431	ensembl	human	known	74_37	silent	SNP	0.939	A
CRYAA	1409	genome.wustl.edu	37	21	44590745	44590745	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr21:44590745G>A	ENST00000291554.2	+	2	400	c.308G>A	c.(307-309)cGc>cAc	p.R103H	CRYAA_ENST00000398132.1_Missense_Mutation_p.R66H|CRYAA_ENST00000398133.1_Missense_Mutation_p.R83H|CRYAA_ENST00000482775.1_3'UTR	NM_000394.2	NP_000385.1	P02489	CRYAA_HUMAN	crystallin, alpha A	103					negative regulation of apoptotic process (GO:0043066)|negative regulation of intracellular transport (GO:0032387)|protein homooligomerization (GO:0051260)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural constituent of eye lens (GO:0005212)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						CACAACGAGCGCCAGGTGAGC	0.637																																																	0								ENSG00000160202						81.0	64.0	70.0					21																	44590745		2203	4300	6503	CRYAA	SO:0001583	missense	0			-	HGNC		CCDS13695.1	21q22.3	2011-09-05			ENSG00000160202	ENSG00000160202		"""Heat shock proteins / HSPB"""	2388	protein-coding gene	gene with protein product		123580		CRYA1			Standard	XM_005261093		Approved	HSPB4	uc002zdd.1	P02489	OTTHUMG00000086842	ENST00000291554.2:c.308G>A	21.37:g.44590745G>A	ENSP00000291554:p.Arg103His	Somatic	0	55	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	42	25.00	Q53X53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_a-crystallin/Hsp20_dom,pfam_Alpha-crystallin_N,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	p.R103H	ENST00000291554.2	37	c.308	CCDS13695.1	21	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923433	0.92319	.	.	ENSG00000160202	ENST00000291554;ENST00000398133;ENST00000398132	D;D;D	0.92911	-3.13;-3.13;-3.13	3.85	3.85	0.44370	Heat shock protein Hsp20 (2);HSP20-like chaperone (1);	0.000000	0.85682	D	0.000000	D	0.96451	0.8842	M	0.88906	2.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97487	1.0051	10	0.87932	D	0	-21.5652	15.7682	0.78143	0.0:0.0:1.0:0.0	.	103	P02489	CRYAA_HUMAN	H	103;83;66	ENSP00000291554:R103H;ENSP00000381201:R83H;ENSP00000381200:R66H	ENSP00000291554:R103H	R	+	2	0	CRYAA	43463814	1.000000	0.71417	0.998000	0.56505	0.855000	0.48748	4.780000	0.62382	1.671000	0.50874	0.561000	0.74099	CGC	-	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP		0.637	CRYAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYAA	protein_coding	OTTHUMT00000195562.1	G		-		44590745	+1	no_errors	ENST00000291554	ensembl	human	known	74_37	missense	SNP	1.000	A
RBM28	55131	genome.wustl.edu	37	7	127950921	127950921	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr7:127950921delA	ENST00000223073.2	-	19	2323	c.2209delT	c.(2209-2211)tatfs	p.Y737fs	RBM28_ENST00000481788.1_5'UTR|RBM28_ENST00000415472.2_Frame_Shift_Del_p.Y596fs	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	737					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						TTCTGCTTATATTGTTCGACC	0.403																																																	0								ENSG00000106344						185.0	181.0	183.0					7																	127950921		2203	4300	6503	RBM28	SO:0001589	frameshift_variant	0				HGNC	AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.2209delT	7.37:g.127950921delA	ENSP00000223073:p.Tyr737fs	Somatic	0	54	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	49	14.04	A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Y737fs	ENST00000223073.2	37	c.2209	CCDS5801.1	7																																																																																			-	NULL		0.403	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM28	protein_coding	OTTHUMT00000349442.2	A	NM_018077			127950921	-1	no_errors	ENST00000223073	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
MMRN1	22915	genome.wustl.edu	37	4	90857734	90857734	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr4:90857734A>T	ENST00000394980.1	+	7	3222	c.2903A>T	c.(2902-2904)gAa>gTa	p.E968V	MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000264790.2_Missense_Mutation_p.E968V|MMRN1_ENST00000508372.1_Missense_Mutation_p.E710V			Q13201	MMRN1_HUMAN	multimerin 1	968					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		GAATTTGTGGAACCAATAATT	0.383																																																	0								ENSG00000138722						52.0	54.0	54.0					4																	90857734		2203	4299	6502	MMRN1	SO:0001583	missense	0			-	HGNC	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.2903A>T	4.37:g.90857734A>T	ENSP00000378431:p.Glu968Val	Somatic	0	41	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	26	58.73	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C1q,pfam_EMI_domain,pfam_EG-like_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EG-like_dom,pfscan_EMI_domain	p.E968V	ENST00000394980.1	37	c.2903	CCDS3635.1	4	.	.	.	.	.	.	.	.	.	.	A	8.830	0.939560	0.18281	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000508372	T;T;T	0.69306	-0.07;-0.07;-0.39	5.1	-0.0588	0.13796	.	0.313431	0.31210	N	0.008055	T	0.69548	0.3123	M	0.61703	1.905	0.25518	N	0.987399	D	0.57899	0.981	P	0.55161	0.77	T	0.63888	-0.6535	10	0.72032	D	0.01	.	9.2577	0.37593	0.7202:0.0:0.2798:0.0	.	968	Q13201	MMRN1_HUMAN	V	968;968;710	ENSP00000378431:E968V;ENSP00000264790:E968V;ENSP00000426461:E710V	ENSP00000264790:E968V	E	+	2	0	MMRN1	91076757	0.965000	0.33210	0.015000	0.15790	0.012000	0.07955	2.625000	0.46452	-0.068000	0.12953	-0.250000	0.11733	GAA	-	NULL		0.383	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	protein_coding	OTTHUMT00000253546.2	A	NM_007351	-		90857734	+1	no_errors	ENST00000264790	ensembl	human	known	74_37	missense	SNP	0.148	T
UMAD1	729852	genome.wustl.edu	37	7	7781981	7781981	+	Intron	SNP	T	T	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr7:7781981T>C	ENST00000469183.1	+	4	417				AC007161.5_ENST00000418534.2_lincRNA																							TTGTTTCTCCTGGGGGCGCTC	0.517																																																	0								ENSG00000234718																																			AC007161.5	SO:0001627	intron_variant	0			-	Clone_based_vega_gene																												ENST00000469183.1:c.418-59320T>C	7.37:g.7781981T>C		Somatic	0	29	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000469183.1	37	NULL		7																																																																																			-	-		0.517	RPA3-AS1-002	KNOWN	basic	processed_transcript	ENSG00000234718	protein_coding	OTTHUMT00000324787.1	T		-		7781981	-1	no_errors	ENST00000418534	ensembl	human	known	74_37	rna	SNP	0.999	C
ADAM15	8751	genome.wustl.edu	37	1	155030370	155030370	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:155030370G>T	ENST00000356955.2	+	14	1561	c.1460G>T	c.(1459-1461)tGt>tTt	p.C487F	ADAM15_ENST00000449910.2_Missense_Mutation_p.C487F|ADAM15_ENST00000447332.3_Missense_Mutation_p.C471F|ADAM15_ENST00000359280.4_Missense_Mutation_p.C487F|ADAM15_ENST00000360674.4_Missense_Mutation_p.C487F|ADAM15_ENST00000368413.1_Missense_Mutation_p.C193F|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000355956.2_Missense_Mutation_p.C487F|ADAM15_ENST00000368412.3_Missense_Mutation_p.C487F|ADAM15_ENST00000271836.6_Missense_Mutation_p.C487F|ADAM15_ENST00000368410.2_Missense_Mutation_p.C193F|ADAM15_ENST00000531455.1_Missense_Mutation_p.C497F	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	487	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			AGAGGGGATTGTGACTTGCCT	0.632																																																	0								ENSG00000143537						122.0	123.0	123.0					1																	155030370		2203	4300	6503	ADAM15	SO:0001583	missense	0			-	HGNC	U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.1460G>T	1.37:g.155030370G>T	ENSP00000349436:p.Cys487Phe	Somatic	0	37	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B_N,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.C487F	ENST00000356955.2	37	c.1460	CCDS1087.1	1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.414164	0.83449	.	.	ENSG00000143537	ENST00000356955;ENST00000449910;ENST00000359280;ENST00000360674;ENST00000368412;ENST00000355956;ENST00000368410;ENST00000271836;ENST00000368413;ENST00000531455	T;T;T;T;T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98;1.98	5.06	5.06	0.68205	Blood coagulation inhibitor, Disintegrin (5);	0.000000	0.44688	D	0.000438	T	0.59348	0.2187	H	0.98996	4.395	0.80722	D	1	D;D;D;P;P;P;P;P;P;P;P	0.67145	0.979;0.979;0.996;0.757;0.847;0.949;0.912;0.912;0.847;0.796;0.929	P;P;D;P;P;P;P;P;P;P;P	0.70227	0.905;0.905;0.968;0.787;0.787;0.847;0.847;0.847;0.847;0.865;0.905	T	0.76780	-0.2833	10	0.87932	D	0	.	16.0444	0.80711	0.0:0.0:1.0:0.0	.	497;504;471;487;487;487;487;487;487;487;484	E9PN65;B7Z390;B4DMH8;Q13444-10;Q13444-2;Q13444-4;Q13444-5;Q13444-3;Q13444-9;Q13444;Q59GF2	.;.;.;.;.;.;.;.;.;ADA15_HUMAN;.	F	487;487;487;487;487;487;193;487;193;497	ENSP00000349436:C487F;ENSP00000403843:C487F;ENSP00000352226:C487F;ENSP00000353892:C487F;ENSP00000357397:C487F;ENSP00000348227:C487F;ENSP00000357395:C193F;ENSP00000271836:C487F;ENSP00000357398:C193F;ENSP00000432927:C497F	ENSP00000271836:C487F	C	+	2	0	ADAM15	153296994	1.000000	0.71417	0.991000	0.47740	0.949000	0.60115	8.224000	0.89781	2.639000	0.89480	0.650000	0.86243	TGT	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin		0.632	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM15	protein_coding	OTTHUMT00000387168.1	G	NM_003815	-		155030370	+1	no_errors	ENST00000356955	ensembl	human	known	74_37	missense	SNP	1.000	T
TIGD4	201798	genome.wustl.edu	37	4	153691034	153691034	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr4:153691034A>G	ENST00000304337.2	-	2	1943	c.1123T>C	c.(1123-1125)Tat>Cat	p.Y375H		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	375	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					GCCTCTTCATAGCTTTTAACA	0.423																																																	0								ENSG00000169989						133.0	133.0	133.0					4																	153691034		2203	4300	6503	TIGD4	SO:0001583	missense	0			-	HGNC	AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.1123T>C	4.37:g.153691034A>G	ENSP00000355162:p.Tyr375His	Somatic	0	46	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q96LP5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,pfam_Centromere_CenpB_dimerisation,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.Y375H	ENST00000304337.2	37	c.1123	CCDS34079.1	4	.	.	.	.	.	.	.	.	.	.	A	17.43	3.387492	0.61956	.	.	ENSG00000169989	ENST00000304337	T	0.47869	0.83	6.17	6.17	0.99709	.	0.148500	0.31660	N	0.007278	T	0.49677	0.1571	L	0.29908	0.895	0.37583	D	0.919871	D	0.53885	0.963	P	0.51487	0.671	T	0.58042	-0.7706	10	0.87932	D	0	-16.9208	16.4957	0.84242	1.0:0.0:0.0:0.0	.	375	Q8IY51	TIGD4_HUMAN	H	375	ENSP00000355162:Y375H	ENSP00000355162:Y375H	Y	-	1	0	TIGD4	153910484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.219000	0.72231	2.371000	0.80710	0.533000	0.62120	TAT	-	pfam_DDE_SF_endonuclease_CENPB-like		0.423	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD4	protein_coding	OTTHUMT00000365028.1	A	NM_145720	-		153691034	-1	no_errors	ENST00000304337	ensembl	human	known	74_37	missense	SNP	1.000	G
TCHH	7062	genome.wustl.edu	37	1	152084915	152084915	+	Silent	SNP	A	A	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:152084915A>G	ENST00000368804.1	-	2	777	c.778T>C	c.(778-780)Ttg>Ctg	p.L260L		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	260					keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTTCCTGCAACTTCTCTTCT	0.587																																																	0								ENSG00000159450						111.0	126.0	121.0					1																	152084915		2096	4213	6309	TCHH	SO:0001819	synonymous_variant	0			-	HGNC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.778T>C	1.37:g.152084915A>G		Somatic	0	31	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	27	57.14	Q5VUI3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.L260	ENST00000368804.1	37	c.778	CCDS41396.1	1																																																																																			-	NULL		0.587	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	protein_coding	OTTHUMT00000036671.2	A	NM_007113	-		152084915	-1	no_errors	ENST00000368804	ensembl	human	known	74_37	silent	SNP	0.000	G
FBN2	2201	genome.wustl.edu	37	5	127681117	127681117	+	Missense_Mutation	SNP	G	G	A	rs150506063		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr5:127681117G>A	ENST00000508053.1	-	30	4123	c.3149C>T	c.(3148-3150)aCg>aTg	p.T1050M	FBN2_ENST00000262464.4_Missense_Mutation_p.T1050M|FBN2_ENST00000508989.1_Missense_Mutation_p.T1017M			P35556	FBN2_HUMAN	fibrillin 2	1050	TB 5.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.T1050M(1)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGGGCACAGCGTCTCGTATTC	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		13630	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						ENSG00000138829	G	MET/THR	2,4404	4.2+/-10.8	0,2,2201	86.0	89.0	88.0		3149	4.3	0.9	5	dbSNP_134	88	0,8600		0,0,4300	yes	missense	FBN2	NM_001999.3	81	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	1050/2913	127681117	2,13004	2203	4300	6503	FBN2	SO:0001583	missense	0			-	HGNC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3149C>T	5.37:g.127681117G>A	ENSP00000424571:p.Thr1050Met	Somatic	0	61	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	35	45.31	B4DU01|Q59ES6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.T1050M	ENST00000508053.1	37	c.3149	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	G	9.090	1.001488	0.19121	4.54E-4	0.0	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.93076	-3.16;-3.16;-3.16	4.32	4.32	0.51571	Matrix fibril-associated (3);TGF-beta binding (1);	0.393089	0.22703	N	0.056667	D	0.92185	0.7522	L	0.46157	1.445	0.09310	N	1	D;P	0.57899	0.981;0.621	P;B	0.55545	0.778;0.128	D	0.84890	0.0836	10	0.45353	T	0.12	.	5.6623	0.17676	0.159:0.0:0.6721:0.1689	.	1017;1050	D6RJI3;P35556	.;FBN2_HUMAN	M	1050;1050;1017	ENSP00000262464:T1050M;ENSP00000424571:T1050M;ENSP00000425596:T1017M	ENSP00000262464:T1050M	T	-	2	0	FBN2	127709016	0.004000	0.15560	0.940000	0.37924	0.247000	0.25773	1.512000	0.35812	2.701000	0.92244	0.563000	0.77884	ACG	-	pirsf_FBN,pfam_TB_dom,superfamily_TB_dom		0.622	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	protein_coding	OTTHUMT00000371618.2	G	NM_001999	rs150506063		127681117	-1	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	SNP	0.006	A
CACNA1A	773	genome.wustl.edu	37	19	13318673	13318678	+	In_Frame_Del	DEL	CTGCTG	CTGCTG	-	rs16054|rs370146696	byFrequency	TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	CTGCTG	CTGCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr19:13318673_13318678delCTGCTG	ENST00000360228.5	-	47	6969_6974	c.6970_6975delCAGCAG	c.(6970-6975)cagcagdel	p.QQ2324del	CACNA1A_ENST00000573710.2_3'UTR	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2323	Poly-Gln.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	TGGCCACCGCctgctgctgctgctgc	0.767																																																	0								ENSG00000141837																																			CACNA1A	SO:0001651	inframe_deletion	0				HGNC	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6970_6975delCAGCAG	19.37:g.13318679_13318684delCTGCTG	ENSP00000353362:p.Gln2324_Gln2325del	Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.QQ2324in_frame_del	ENST00000360228.5	37	c.6975_6970	CCDS45998.1	19																																																																																			-	NULL		0.767	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	protein_coding	OTTHUMT00000104062.2	CTGCTG	NM_000068			13318678	-1	no_errors	ENST00000360228	ensembl	human	known	74_37	in_frame_del	DEL	0.259:0.316:0.374:0.432:0.459:0.497	-
ADAMTS3	9508	genome.wustl.edu	37	4	73414431	73414431	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr4:73414431C>A	ENST00000286657.4	-	3	304	c.268G>T	c.(268-270)Gat>Tat	p.D90Y	ADAMTS3_ENST00000505193.1_5'UTR	NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	90					collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGATGAAAATCTTTTCCAAAT	0.488																																					NSCLC(168;1941 2048 2918 13048 43078)												0								ENSG00000156140						108.0	103.0	105.0					4																	73414431		2203	4300	6503	ADAMTS3	SO:0001583	missense	0			-	HGNC	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.268G>T	4.37:g.73414431C>A	ENSP00000286657:p.Asp90Tyr	Somatic	0	51	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	28	30.00	A1L3U9|Q9BXZ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.D90Y	ENST00000286657.4	37	c.268	CCDS3553.1	4	.	.	.	.	.	.	.	.	.	.	C	19.27	3.794667	0.70452	.	.	ENSG00000156140	ENST00000286657	T	0.07114	3.22	5.74	4.03	0.46877	Peptidase M12B, propeptide (1);	0.160162	0.38959	N	0.001515	T	0.21841	0.0526	M	0.78916	2.43	0.45087	D	0.9981	D	0.55385	0.971	P	0.54815	0.761	T	0.00918	-1.1515	10	0.62326	D	0.03	.	11.8215	0.52240	0.0:0.8585:0.0:0.1415	.	90	O15072	ATS3_HUMAN	Y	90	ENSP00000286657:D90Y	ENSP00000286657:D90Y	D	-	1	0	ADAMTS3	73633295	1.000000	0.71417	1.000000	0.80357	0.659000	0.38960	4.899000	0.63245	0.894000	0.36317	0.643000	0.83706	GAT	-	pfam_Peptidase_M12B_N		0.488	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS3	protein_coding	OTTHUMT00000252164.2	C		-		73414431	-1	no_errors	ENST00000286657	ensembl	human	known	74_37	missense	SNP	1.000	A
PTK2B	2185	genome.wustl.edu	37	8	27288893	27288893	+	Intron	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr8:27288893G>T	ENST00000397501.1	+	14	1618				PTK2B_ENST00000346049.5_Intron|PTK2B_ENST00000420218.2_Intron|PTK2B_ENST00000544172.1_Intron|PTK2B_ENST00000517339.1_Intron|PTK2B_ENST00000338238.4_Intron|PTK2B_ENST00000397497.4_Missense_Mutation_p.Q9H	NM_173174.2	NP_775266.1	Q14289	FAK2_HUMAN	protein tyrosine kinase 2 beta						activation of Janus kinase activity (GO:0042976)|activation of Rac GTPase activity (GO:0032863)|apoptotic process (GO:0006915)|blood vessel endothelial cell migration (GO:0043534)|bone resorption (GO:0045453)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|cellular response to retinoic acid (GO:0071300)|chemokine-mediated signaling pathway (GO:0070098)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|glial cell proliferation (GO:0014009)|integrin-mediated signaling pathway (GO:0007229)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term synaptic potentiation (GO:0060291)|MAPK cascade (GO:0000165)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of potassium ion transport (GO:0043267)|neuron projection development (GO:0031175)|oocyte maturation (GO:0001556)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of establishment of cell polarity (GO:2000114)|regulation of inositol trisphosphate biosynthetic process (GO:0032960)|regulation of macrophage chemotaxis (GO:0010758)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000058)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to hormone (GO:0009725)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|stress fiber assembly (GO:0043149)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	apical dendrite (GO:0097440)|axon (GO:0030424)|cell body (GO:0044297)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(17)|ovary(4)|skin(12)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Ovarian(32;2.72e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|Epithelial(17;6.61e-10)|BRCA - Breast invasive adenocarcinoma(99;0.226)|Colorectal(74;0.229)	Leflunomide(DB01097)	TGGAACAACAGTCCACTCTCC	0.502																																																	0								ENSG00000120899						65.0	57.0	60.0					8																	27288893		2203	4300	6503	PTK2B	SO:0001627	intron_variant	0			-	HGNC	U33284	CCDS6057.1, CCDS6058.1	8p21.1	2013-02-18	2013-02-18		ENSG00000120899	ENSG00000120899			9612	protein-coding gene	gene with protein product		601212	"""protein tyrosine kinase 2 beta"", ""PTK2B protein tyrosine kinase 2 beta"""	FAK2		7544443, 7499242	Standard	NM_173174		Approved	CAKB, PYK2, RAFTK, PTK, CADTK	uc003xfp.2	Q14289	OTTHUMG00000102082	ENST00000397501.1:c.811-22G>T	8.37:g.27288893G>T		Somatic	0	67	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	47	44.71	D3DST0|Q13475|Q14290|Q16709|Q6PID4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q9H	ENST00000397501.1	37	c.27	CCDS6057.1	8	.	.	.	.	.	.	.	.	.	.	G	13.03	2.114285	0.37339	.	.	ENSG00000120899	ENST00000397497	T	0.74209	-0.82	5.8	-2.73	0.05950	.	.	.	.	.	T	0.58977	0.2160	.	.	.	0.09310	N	1	P	0.34837	0.472	B	0.35859	0.212	T	0.53429	-0.8440	8	0.72032	D	0.01	.	1.8726	0.03211	0.3009:0.222:0.3646:0.1125	.	9	E9PBI4	.	H	9	ENSP00000380634:Q9H	ENSP00000380634:Q9H	Q	+	3	2	PTK2B	27344810	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.108000	0.10857	-0.422000	0.07405	0.655000	0.94253	CAG	-	pfscan_FERM_domain		0.502	PTK2B-009	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTK2B	protein_coding	OTTHUMT00000219916.1	G	NM_004103	-		27288893	+1	no_errors	ENST00000397497	ensembl	human	putative	74_37	missense	SNP	0.000	T
NEB	4703	genome.wustl.edu	37	2	152582033	152582033	+	Silent	SNP	T	T	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:152582033T>G	ENST00000172853.10	-	6	483	c.336A>C	c.(334-336)ccA>ccC	p.P112P	NEB_ENST00000409198.1_Silent_p.P112P|NEB_ENST00000427231.2_Silent_p.P112P|NEB_ENST00000397345.3_Silent_p.P112P|NEB_ENST00000604864.1_Silent_p.P112P|NEB_ENST00000603639.1_Silent_p.P112P			P20929	NEBU_HUMAN	nebulin	112					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGCTGGCGTATGGCTGTCCTT	0.393																																																	0								ENSG00000183091						234.0	225.0	228.0					2																	152582033		1896	4115	6011	NEB	SO:0001819	synonymous_variant	0			-	HGNC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.336A>C	2.37:g.152582033T>G		Somatic	0	74	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	46	43.21	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.P112	ENST00000172853.10	37	c.336		2																																																																																			-	pfscan_Nebulin_35r-motif		0.393	NEB-201	KNOWN	basic	protein_coding	NEB	protein_coding		T	NM_004543	-		152582033	-1	no_errors	ENST00000397345	ensembl	human	known	74_37	silent	SNP	0.848	G
CCDC40	55036	genome.wustl.edu	37	17	78039342	78039342	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr17:78039342C>T	ENST00000397545.4	+	10	1526	c.1499C>T	c.(1498-1500)gCc>gTc	p.A500V	CCDC40_ENST00000374876.4_Intron|CCDC40_ENST00000269318.5_Missense_Mutation_p.A500V|CCDC40_ENST00000374877.3_Missense_Mutation_p.A500V	NM_017950.3	NP_060420.2	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	500					axonemal dynein complex assembly (GO:0070286)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement (GO:0003351)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)|regulation of cilium beat frequency (GO:0003356)	cilium (GO:0005929)|cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(7)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	38	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CAGCAATGGGCCAGCAGCCTG	0.652																																																	0								ENSG00000141519						52.0	61.0	58.0					17																	78039342		2133	4239	6372	CCDC40	SO:0001583	missense	0			-	HGNC	AB046860	CCDS42395.1, CCDS58604.1	17q25.3	2013-11-15			ENSG00000141519	ENSG00000141519			26090	protein-coding gene	gene with protein product		613799				21131974	Standard	NM_017950		Approved	FLJ20753, KIAA1640, FLJ32021, CILD15, FAP172	uc010dht.3	Q4G0X9	OTTHUMG00000132707	ENST00000397545.4:c.1499C>T	17.37:g.78039342C>T	ENSP00000380679:p.Ala500Val	Somatic	0	45	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8MTD2|C9JTI9|C9JTJ0|C9JXW1|Q6PE47|Q9HCD2|Q9NWL5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_E3_ubiquit_lig_BRE1	p.A500V	ENST00000397545.4	37	c.1499	CCDS42395.1	17	.	.	.	.	.	.	.	.	.	.	C	8.418	0.845746	0.16963	.	.	ENSG00000141519	ENST00000374877;ENST00000269318;ENST00000397545	T;D;T	0.81739	0.84;-1.53;0.86	4.84	-2.71	0.05986	.	.	.	.	.	T	0.64316	0.2587	L	0.43152	1.355	0.09310	N	1	P;P	0.35656	0.514;0.478	B;B	0.27170	0.077;0.072	T	0.52343	-0.8588	9	0.51188	T	0.08	-4.163	2.5005	0.04632	0.2341:0.2861:0.3426:0.1372	.	500;283	Q4G0X9;Q4G0X9-3	CCD40_HUMAN;.	V	500	ENSP00000364011:A500V;ENSP00000269318:A500V;ENSP00000380679:A500V	ENSP00000269318:A500V	A	+	2	0	CCDC40	75653937	0.000000	0.05858	0.008000	0.14137	0.084000	0.17831	-0.501000	0.06398	-0.852000	0.04141	-0.972000	0.02603	GCC	-	NULL		0.652	CCDC40-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC40	protein_coding	OTTHUMT00000256005.2	C	XM_371082	-		78039342	+1	no_errors	ENST00000397545	ensembl	human	known	74_37	missense	SNP	0.000	T
PYHIN1	149628	genome.wustl.edu	37	1	158906932	158906932	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:158906932C>A	ENST00000368140.1	+	2	477	c.232C>A	c.(232-234)Ctt>Att	p.L78I	PYHIN1_ENST00000392252.3_Missense_Mutation_p.L78I|PYHIN1_ENST00000368138.3_Missense_Mutation_p.L78I|PYHIN1_ENST00000368135.4_Missense_Mutation_p.L78I|PYHIN1_ENST00000392254.2_Missense_Mutation_p.L78I	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	78	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					ACTGGGAGACCTTGCTGAAAC	0.433																																																	0								ENSG00000163564						57.0	58.0	58.0					1																	158906932		2203	4300	6503	PYHIN1	SO:0001583	missense	0			-	HGNC	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.232C>A	1.37:g.158906932C>A	ENSP00000357122:p.Leu78Ile	Somatic	0	43	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	54	12.90	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.L78I	ENST00000368140.1	37	c.232	CCDS1178.1	1	.	.	.	.	.	.	.	.	.	.	C	3.049	-0.195862	0.06259	.	.	ENSG00000163564	ENST00000458222;ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252;ENST00000368135	T;T;T;T;T;T	0.59083	0.29;0.29;0.29;0.29;0.29;0.29	2.83	-5.66	0.02451	Pyrin (2);	.	.	.	.	T	0.22437	0.0541	N	0.26130	0.795	0.09310	N	1	B;P;B;P;B	0.39003	0.235;0.602;0.235;0.654;0.22	B;B;B;B;B	0.42138	0.131;0.259;0.131;0.377;0.069	T	0.19614	-1.0300	9	0.21014	T	0.42	.	14.0587	0.64786	0.8421:0.1579:0.0:0.0	.	78;78;78;78;78	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9;Q6K0P9-5	.;.;.;IFIX_HUMAN;.	I	78	ENSP00000407616:L78I;ENSP00000357122:L78I;ENSP00000357120:L78I;ENSP00000376083:L78I;ENSP00000376082:L78I;ENSP00000357117:L78I	ENSP00000357117:L78I	L	+	1	0	PYHIN1	157173556	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.064000	0.03461	-2.463000	0.00535	-0.457000	0.05445	CTT	-	pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN		0.433	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PYHIN1	protein_coding	OTTHUMT00000090110.1	C	NM_152501	-		158906932	+1	no_errors	ENST00000368140	ensembl	human	known	74_37	missense	SNP	0.000	A
OSBPL1A	114876	genome.wustl.edu	37	18	21739532	21739532	+	IGR	SNP	C	C	T	rs143686609		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr18:21739532C>T	ENST00000319481.3	-	0	4195				CABYR_ENST00000327201.6_Missense_Mutation_p.P115L|CABYR_ENST00000415309.2_Intron|CABYR_ENST00000399499.1_Missense_Mutation_p.P213L|CABYR_ENST00000399496.3_Missense_Mutation_p.P213L|CABYR_ENST00000399481.2_3'UTR|CABYR_ENST00000581397.1_Missense_Mutation_p.P213L|RP11-799B12.4_ENST00000583267.1_lincRNA	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CACCCATCACCGCCACCTGCA	0.463																																																	0								ENSG00000154040	C	,LEU/PRO,LEU/PRO,,LEU/PRO,	3,4403	6.2+/-15.9	0,3,2200	100.0	95.0	97.0		,344,638,,638,	4.8	1.0	18	dbSNP_134	97	0,8600		0,0,4300	no	utr-3,missense,missense,utr-3,missense,intron	CABYR	NM_012189.2,NM_138643.1,NM_138644.1,NM_153768.1,NM_153769.1,NM_153770.1	,98,98,,98,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,,,,,	,115/282,213/380,,213/380,	21739532	3,13003	2203	4300	6503	CABYR	SO:0001628	intergenic_variant	0			-	HGNC	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944		18.37:g.21739532C>T		Somatic	0	58	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	3	91.67	B7Z7D3|Q9BZF5|Q9NW87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b	p.P213L	ENST00000319481.3	37	c.638	CCDS11884.1	18	.	.	.	.	.	.	.	.	.	.	C	16.58	3.163228	0.57476	6.81E-4	0.0	ENSG00000154040	ENST00000399496;ENST00000327201;ENST00000399499	T;T	0.62232	0.04;0.04	4.85	4.85	0.62838	.	.	.	.	.	T	0.46870	0.1415	L	0.29908	0.895	0.80722	D	1	B	0.31519	0.327	B	0.28553	0.091	T	0.52238	-0.8602	9	0.87932	D	0	.	7.8238	0.29303	0.0:0.8489:0.0:0.1511	.	213	O75952-3	.	L	213;115;213	ENSP00000382419:P213L;ENSP00000382421:P213L	ENSP00000317095:P115L	P	+	2	0	CABYR	19993530	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.050000	0.49877	2.227000	0.72691	0.563000	0.77884	CCG	-	NULL		0.463	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABYR	protein_coding	OTTHUMT00000254902.1	C	NM_080597	rs143686609		21739532	+1	no_errors	ENST00000399496	ensembl	human	known	74_37	missense	SNP	1.000	T
LOXHD1	125336	genome.wustl.edu	37	18	44057439	44057439	+	Intron	SNP	A	A	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr18:44057439A>G	ENST00000398722.4	-	34	5806				LOXHD1_ENST00000579038.1_Intron|LOXHD1_ENST00000300591.6_Intron|LOXHD1_ENST00000398705.2_Intron|LOXHD1_ENST00000582408.1_Missense_Mutation_p.V1100A|LOXHD1_ENST00000441893.2_Missense_Mutation_p.V1144A|LOXHD1_ENST00000536736.1_Missense_Mutation_p.V2211A|LOXHD1_ENST00000398686.4_Missense_Mutation_p.V512A|LOXHD1_ENST00000441551.2_Missense_Mutation_p.V2067A			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1						calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						AGCCCCTCAGACAGAAGGGAA	0.602																																																	0								ENSG00000167210						10.0	15.0	13.0					18																	44057439		692	1590	2282	LOXHD1	SO:0001627	intron_variant	0			-	HGNC	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.5806+177T>C	18.37:g.44057439A>G		Somatic	0	82	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	23	58.93	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.V2211A	ENST00000398722.4	37	c.6632		18	.	.	.	.	.	.	.	.	.	.	A	10.10	1.256676	0.22965	.	.	ENSG00000167210	ENST00000536736;ENST00000441893;ENST00000398686	T;T;T	0.06768	3.28;3.26;3.29	5.31	4.11	0.48088	.	.	.	.	.	T	0.06826	0.0174	L	0.33485	1.01	0.22719	N	0.998813	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.34229	-0.9837	9	0.49607	T	0.09	.	4.6757	0.12710	0.6229:0.0:0.0962:0.2809	.	2211;1144	F5GZB4;F8WA52	.;.	A	2211;1144;512	ENSP00000444586:V2211A;ENSP00000409062:V1144A;ENSP00000381676:V512A	ENSP00000381676:V512A	V	-	2	0	LOXHD1	42311437	0.999000	0.42202	0.971000	0.41717	0.742000	0.42306	2.976000	0.49289	0.813000	0.34350	-0.366000	0.07423	GTC	-	NULL		0.602	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	protein_coding		A	NM_144612	-		44057439	-1	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	SNP	0.986	G
MYH8	4626	genome.wustl.edu	37	17	10309387	10309387	+	Silent	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr17:10309387C>T	ENST00000403437.2	-	21	2497	c.2403G>A	c.(2401-2403)agG>agA	p.R801R	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	801	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GATATTCTACCCTCATTAGGA	0.368									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0								ENSG00000133020						164.0	160.0	162.0					17																	10309387		2203	4300	6503	MYH8	SO:0001819	synonymous_variant	0	Familial Cancer Database	Carney Complex Variant	-	HGNC		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.2403G>A	17.37:g.10309387C>T		Somatic	0	60	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	11	82.54	Q14910	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R801	ENST00000403437.2	37	c.2403	CCDS11153.1	17																																																																																			-	superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS		0.368	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	protein_coding	OTTHUMT00000252724.2	C	NM_002472	-		10309387	-1	no_errors	ENST00000403437	ensembl	human	known	74_37	silent	SNP	0.998	T
AKAP9	10142	genome.wustl.edu	37	7	91714967	91714986	+	Frame_Shift_Del	DEL	AATTACAAAGATGCAACTGC	AATTACAAAGATGCAACTGC	-			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	AATTACAAAGATGCAACTGC	AATTACAAAGATGCAACTGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr7:91714967_91714986delAATTACAAAGATGCAACTGC	ENST00000359028.2	+	36	9228_9247	c.9003_9022delAATTACAAAGATGCAACTGC	c.(9001-9024)ttaattacaaagatgcaactgcaafs	p.ITKMQLQ3002fs	AKAP9_ENST00000358100.2_Frame_Shift_Del_p.ITKMQLQ2948fs|AKAP9_ENST00000356239.3_Frame_Shift_Del_p.ITKMQLQ2998fs			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3002					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TAAAGGATTTAATTACAAAGATGCAACTGCAAAGAGAAGC	0.305			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0								ENSG00000127914																																			AKAP9	SO:0001589	frameshift_variant	0				HGNC	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.9003_9022delAATTACAAAGATGCAACTGC	7.37:g.91714967_91714986delAATTACAAAGATGCAACTGC	ENSP00000351922:p.Ile3002fs	Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.I3002fs	ENST00000359028.2	37	c.9003_9022		7																																																																																			-	NULL		0.305	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	protein_coding		AATTACAAAGATGCAACTGC	NM_005751			91714986	+1	no_errors	ENST00000359028	ensembl	human	known	74_37	frame_shift_del	DEL	0.986:1.000:1.000:1.000:0.982:0.998:0.997:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.970:0.905:0.944:0.964:0.996	-
PTPN5	84867	genome.wustl.edu	37	11	18751262	18751262	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr11:18751262A>C	ENST00000358540.2	-	13	1863	c.1433T>G	c.(1432-1434)gTg>gGg	p.V478G	RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396170.1_Missense_Mutation_p.V446G|PTPN5_ENST00000477854.1_Missense_Mutation_p.V282G|PTPN5_ENST00000396171.4_Missense_Mutation_p.V478G|PTPN5_ENST00000396168.1_Missense_Mutation_p.V454G|PTPN5_ENST00000396166.3_Missense_Mutation_p.V84G|PTPN5_ENST00000396167.2_Missense_Mutation_p.V446G	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	478	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						TGCCTCCTCCACCTCCCGCAC	0.697																																																	0								ENSG00000110786						27.0	35.0	32.0					11																	18751262		2122	4262	6384	PTPN5	SO:0001583	missense	0			-	HGNC	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.1433T>G	11.37:g.18751262A>C	ENSP00000351342:p.Val478Gly	Somatic	0	68	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	61	14.08	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.V478G	ENST00000358540.2	37	c.1433	CCDS7845.1	11	.	.	.	.	.	.	.	.	.	.	A	19.77	3.890033	0.72524	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396166;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T;T;T	0.38077	1.16;1.16;2.12;1.16;1.16;1.16;1.16	4.26	4.26	0.50523	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	D	0.000001	T	0.72269	0.3439	H	0.97240	3.965	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82855	-0.0251	10	0.87932	D	0	.	13.5421	0.61681	1.0:0.0:0.0:0.0	.	478;446	P54829;B3KXG7	PTN5_HUMAN;.	G	282;478;84;446;478;446;454	ENSP00000435056:V282G;ENSP00000351342:V478G;ENSP00000379469:V84G;ENSP00000379473:V446G;ENSP00000379474:V478G;ENSP00000379470:V446G;ENSP00000379471:V454G	ENSP00000351342:V478G	V	-	2	0	PTPN5	18707838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.106000	0.77039	1.793000	0.52555	0.533000	0.62120	GTG	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt		0.697	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	protein_coding	OTTHUMT00000259196.2	A	NM_001039970	-		18751262	-1	no_errors	ENST00000358540	ensembl	human	known	74_37	missense	SNP	1.000	C
DUSP10	11221	genome.wustl.edu	37	1	221875156	221875157	+	3'UTR	INS	-	-	A	rs571834010		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:221875156_221875157insA	ENST00000366899.3	-	0	2284_2285				DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000323825.3_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CCCAGAGAAGGAAAAAAAAAAA	0.351																																																	0								ENSG00000143507																																			DUSP10	SO:0001624	3_prime_UTR_variant	0				HGNC	AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*598->T	1.37:g.221875167_221875167dupA		Somatic	0	17	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	D3DTB4|Q6GSI4|Q9H9Z5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			-	-		0.351	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	protein_coding	OTTHUMT00000090716.1	-	NM_007207			221875157	-1	no_errors	ENST00000468085	ensembl	human	known	74_37	rna	INS	0.002:0.000	A
GALNT14	79623	genome.wustl.edu	37	2	31215825	31215825	+	Silent	SNP	G	G	T	rs148056182		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:31215825G>T	ENST00000349752.5	-	2	817	c.178C>A	c.(178-180)Cgg>Agg	p.R60R	GALNT14_ENST00000356174.3_Silent_p.R60R|GALNT14_ENST00000406653.1_Silent_p.R40R|AC009305.1_ENST00000449780.1_RNA|GALNT14_ENST00000420311.2_Silent_p.R25R|GALNT14_ENST00000324589.5_Intron	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	60					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					TTCAGATACCGCCGCTCATCA	0.572																																																	0								ENSG00000158089						92.0	79.0	84.0					2																	31215825		2203	4300	6503	GALNT14	SO:0001819	synonymous_variant	0			-	HGNC	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.178C>A	2.37:g.31215825G>T		Somatic	0	45	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R60	ENST00000349752.5	37	c.178	CCDS1773.2	2																																																																																			-	NULL		0.572	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT14	protein_coding	OTTHUMT00000157264.1	G	NM_024572	-		31215825	-1	no_errors	ENST00000349752	ensembl	human	known	74_37	silent	SNP	0.957	T
MYLK	4638	genome.wustl.edu	37	3	123457851	123457851	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr3:123457851G>T	ENST00000475616.1	-	4	480	c.481C>A	c.(481-483)Cca>Aca	p.P161T	MYLK_ENST00000346322.5_Missense_Mutation_p.P161T|MYLK_ENST00000360304.3_Missense_Mutation_p.P161T|MYLK_ENST00000359169.1_Missense_Mutation_p.P161T|MYLK_ENST00000360772.3_Missense_Mutation_p.P161T			Q15746	MYLK_HUMAN	myosin light chain kinase	161	Ig-like C2-type 2.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)	p.P161S(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		GCAAACTTTGGTGGGCACTCC	0.562																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000065534						73.0	62.0	66.0					3																	123457851		2203	4300	6503	MYLK	SO:0001583	missense	0			-	HGNC	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.481C>A	3.37:g.123457851G>T	ENSP00000418335:p.Pro161Thr	Somatic	0	58	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	62	29.55	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P161T	ENST00000475616.1	37	c.481	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	G	24.5	4.533637	0.85812	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	D;D;D;D;D	0.92397	-3.03;-3.03;-3.03;-3.03;-3.03	4.52	4.52	0.55395	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.97829	0.9287	H	0.98901	4.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.988;0.999;0.998;0.988;0.998;0.993	D	0.99282	1.0896	9	0.87932	D	0	.	16.5127	0.84290	0.0:0.0:1.0:0.0	.	161;161;161;161;161;161	Q15746-6;Q15746-5;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	T	161	ENSP00000354004:P161T;ENSP00000353452:P161T;ENSP00000352088:P161T;ENSP00000320622:P161T;ENSP00000418335:P161T	ENSP00000320622:P161T	P	-	1	0	MYLK	124940541	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.180000	0.89694	2.497000	0.84241	0.655000	0.94253	CCA	-	pfam_Ig_I-set,pfscan_Ig-like_dom		0.562	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	protein_coding	OTTHUMT00000356464.1	G	NM_053025	-		123457851	-1	no_errors	ENST00000360304	ensembl	human	known	74_37	missense	SNP	1.000	T
OR4D1	26689	genome.wustl.edu	37	17	56232674	56232674	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr17:56232674C>T	ENST00000268912.5	+	1	181	c.160C>T	c.(160-162)Cgg>Tgg	p.R54W		NM_012374.1	NP_036506.1	Q15615	OR4D1_HUMAN	olfactory receptor, family 4, subfamily D, member 1	54			R -> Q (in dbSNP:rs12602205).		detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13						TTTTGACTGCCGGCTCCACAC	0.478																																																	0								ENSG00000141194						175.0	173.0	173.0					17																	56232674		2106	4267	6373	OR4D1	SO:0001583	missense	0			-	HGNC	X89670	CCDS42365.1	17q22	2012-08-09			ENSG00000141194	ENSG00000141194		"""GPCR / Class A : Olfactory receptors"""	8293	protein-coding gene	gene with protein product				OR4D3		9119360	Standard	NM_012374		Approved	TPCR16	uc010wno.2	Q15615		ENST00000268912.5:c.160C>T	17.37:g.56232674C>T	ENSP00000365451:p.Arg54Trp	Somatic	0	78	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	80	20.00	B2RN14|Q8NGB1|Q96R76	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R54W	ENST00000268912.5	37	c.160	CCDS42365.1	17	.	.	.	.	.	.	.	.	.	.	c	11.47	1.647600	0.29246	.	.	ENSG00000141194	ENST00000268912	T	0.01152	5.26	5.63	2.48	0.30137	GPCR, rhodopsin-like superfamily (1);	0.795760	0.10072	U	0.719604	T	0.02649	0.0080	M	0.85373	2.75	0.09310	N	1	B	0.23591	0.088	B	0.20184	0.028	T	0.31943	-0.9925	10	0.54805	T	0.06	-1.8757	7.6792	0.28502	0.3007:0.6209:0.0:0.0784	.	54	Q15615	OR4D1_HUMAN	W	54	ENSP00000365451:R54W	ENSP00000365451:R54W	R	+	1	2	OR4D1	53587673	0.000000	0.05858	0.000000	0.03702	0.859000	0.49053	-0.729000	0.04920	0.285000	0.22329	0.543000	0.68304	CGG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.478	OR4D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D1	protein_coding	OTTHUMT00000443364.1	C		-		56232674	+1	no_errors	ENST00000268912	ensembl	human	known	74_37	missense	SNP	0.001	T
KIAA0922	23240	genome.wustl.edu	37	4	154547353	154547353	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr4:154547353T>C	ENST00000409663.3	+	30	4149	c.4097T>C	c.(4096-4098)cTt>cCt	p.L1366P	KIAA0922_ENST00000409959.3_Missense_Mutation_p.L1367P|KIAA0922_ENST00000440693.1_Missense_Mutation_p.L1283P	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1366						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				TCCTTGAATCTTTCTCATAAC	0.323																																																	0								ENSG00000121210						217.0	230.0	225.0					4																	154547353		2203	4299	6502	KIAA0922	SO:0001583	missense	0			-	HGNC	AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.4097T>C	4.37:g.154547353T>C	ENSP00000386574:p.Leu1366Pro	Somatic	0	55	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	27	47.06	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3651_TMEM131	p.L1367P	ENST00000409663.3	37	c.4100	CCDS3783.2	4	.	.	.	.	.	.	.	.	.	.	T	19.71	3.877528	0.72294	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.22336	2.24;1.96;2.24;1.96	5.4	5.4	0.78164	.	0.435229	0.23342	N	0.049230	T	0.42921	0.1224	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.30149	-0.9988	10	0.66056	D	0.02	-14.9728	15.4243	0.75038	0.0:0.0:0.0:1.0	.	1283;1367;1366	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	P	1366;1283;1367;1144	ENSP00000386574:L1366P;ENSP00000409663:L1283P;ENSP00000386787:L1367P;ENSP00000240487:L1144P	ENSP00000240487:L1144P	L	+	2	0	KIAA0922	154766803	1.000000	0.71417	0.752000	0.31206	0.996000	0.88848	5.083000	0.64456	2.042000	0.60477	0.533000	0.62120	CTT	-	NULL		0.323	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	protein_coding	OTTHUMT00000330370.1	T	NM_015196	-		154547353	+1	no_errors	ENST00000409959	ensembl	human	known	74_37	missense	SNP	1.000	C
AKAP9	10142	genome.wustl.edu	37	7	91714957	91714957	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr7:91714957delT	ENST00000359028.2	+	36	9218	c.8993delT	c.(8992-8994)ctafs	p.L2998fs	AKAP9_ENST00000358100.2_Frame_Shift_Del_p.L2944fs|AKAP9_ENST00000356239.3_Frame_Shift_Del_p.L2994fs			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2998					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATCTCATCTCTAAAGGATTTA	0.343			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0								ENSG00000127914						59.0	61.0	60.0					7																	91714957		2203	4300	6503	AKAP9	SO:0001589	frameshift_variant	0				HGNC	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.8993delT	7.37:g.91714957delT	ENSP00000351922:p.Leu2998fs	Somatic	0	30	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	42	14.29	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.L2998fs	ENST00000359028.2	37	c.8993		7																																																																																			-	NULL		0.343	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	protein_coding		T	NM_005751			91714957	+1	no_errors	ENST00000359028	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PPM1E	22843	genome.wustl.edu	37	17	56833457	56833458	+	In_Frame_Ins	INS	-	-	GAACCC	rs3834568|rs201186780|rs74256772	byFrequency	TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr17:56833457_56833458insGAACCC	ENST00000308249.2	+	1	228_229	c.99_100insGAACCC	c.(100-102)gaa>GAACCCgaa	p.34_34E>EPE		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			agccggagccggaacccgaacc	0.673														1948	0.388978	0.4493	0.2896	5008	,	,		9152	0.3323		0.4036	False		,,,				2504	0.4213																0								ENSG00000175175																																			PPM1E	SO:0001652	inframe_insertion	0				HGNC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.124_129dupGAACCC	17.37:g.56833458_56833463dupGAACCC	ENSP00000312411:p.ProGlu44dup	Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8N8J9|Q96DB8	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.37in_frame_insEP	ENST00000308249.2	37	c.99_100	CCDS11613.1	17																																																																																			-	NULL		0.673	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1E	protein_coding	OTTHUMT00000445458.1	-	NM_014906			56833458	+1	no_errors	ENST00000308249	ensembl	human	known	74_37	in_frame_ins	INS	0.984:0.982	GAACCC
UBR4	23352	genome.wustl.edu	37	1	19511667	19511667	+	Silent	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:19511667G>T	ENST00000375254.3	-	15	1891	c.1864C>A	c.(1864-1866)Cgg>Agg	p.R622R	UBR4_ENST00000375217.2_Silent_p.R622R|UBR4_ENST00000375226.2_Silent_p.R622R|UBR4_ENST00000375267.2_Silent_p.R622R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	622	Pro-rich.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CTTTTAACCCGAGGAGAGCTT	0.527																																																	0								ENSG00000127481						144.0	164.0	157.0					1																	19511667		2203	4300	6503	UBR4	SO:0001819	synonymous_variant	0			-	HGNC	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1864C>A	1.37:g.19511667G>T		Somatic	0	53	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	78	10.34	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.R622	ENST00000375254.3	37	c.1864	CCDS189.1	1																																																																																			-	NULL		0.527	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	protein_coding	OTTHUMT00000007085.1	G	NM_020765	-		19511667	-1	no_errors	ENST00000375267	ensembl	human	known	74_37	silent	SNP	0.990	T
NR2C1	7181	genome.wustl.edu	37	12	95422248	95422248	+	Silent	SNP	T	T	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr12:95422248T>C	ENST00000333003.5	-	12	1776	c.1446A>G	c.(1444-1446)ctA>ctG	p.L482L	NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	482					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						AAAACTCCTGTAGTTTGAAGA	0.318																																																	0								ENSG00000120798						132.0	120.0	124.0					12																	95422248		2203	4300	6503	NR2C1	SO:0001819	synonymous_variant	0			-	HGNC	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1446A>G	12.37:g.95422248T>C		Somatic	0	81	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	82	18.00	A8K5K4|Q15625|Q15626	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.L482	ENST00000333003.5	37	c.1446	CCDS9051.1	12																																																																																			-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.318	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2C1	protein_coding	OTTHUMT00000407565.2	T	NM_003297	-		95422248	-1	no_errors	ENST00000333003	ensembl	human	known	74_37	silent	SNP	0.890	C
KSR2	283455	genome.wustl.edu	37	12	118198926	118198926	+	Silent	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr12:118198926C>T	ENST00000339824.5	-	4	1603	c.876G>A	c.(874-876)ccG>ccA	p.P292P	KSR2_ENST00000425217.1_Silent_p.P263P			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	292	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGGAGGAGGGCGGTGGGGTCC	0.677																																																	0								ENSG00000171435						100.0	121.0	114.0					12																	118198926		1914	4108	6022	KSR2	SO:0001819	synonymous_variant	0			-	HGNC	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.876G>A	12.37:g.118198926C>T		Somatic	0	83	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	82	15.46	A0PJT2|Q3B828|Q8N775	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.P292	ENST00000339824.5	37	c.876		12																																																																																			-	NULL		0.677	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	protein_coding	OTTHUMT00000401987.2	C	NM_173598	-		118198926	-1	no_errors	ENST00000339824	ensembl	human	known	74_37	silent	SNP	0.297	T
MYLK	4638	genome.wustl.edu	37	3	123457850	123457850	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr3:123457850G>T	ENST00000475616.1	-	4	481	c.482C>A	c.(481-483)cCa>cAa	p.P161Q	MYLK_ENST00000346322.5_Missense_Mutation_p.P161Q|MYLK_ENST00000360304.3_Missense_Mutation_p.P161Q|MYLK_ENST00000359169.1_Missense_Mutation_p.P161Q|MYLK_ENST00000360772.3_Missense_Mutation_p.P161Q			Q15746	MYLK_HUMAN	myosin light chain kinase	161	Ig-like C2-type 2.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		AGCAAACTTTGGTGGGCACTC	0.562																																																	0								ENSG00000065534						73.0	62.0	66.0					3																	123457850		2203	4300	6503	MYLK	SO:0001583	missense	0			-	HGNC	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.482C>A	3.37:g.123457850G>T	ENSP00000418335:p.Pro161Gln	Somatic	0	60	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	59	31.03	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P161Q	ENST00000475616.1	37	c.482	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	G	25.6	4.651110	0.88056	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04	4.52	4.52	0.55395	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.97829	0.9287	H	0.98901	4.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.992;1.0;0.999;0.992;0.999;0.996	D	0.99282	1.0896	9	0.87932	D	0	.	16.5127	0.84290	0.0:0.0:1.0:0.0	.	161;161;161;161;161;161	Q15746-6;Q15746-5;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;.;MYLK_HUMAN	Q	161	ENSP00000354004:P161Q;ENSP00000353452:P161Q;ENSP00000352088:P161Q;ENSP00000320622:P161Q;ENSP00000418335:P161Q	ENSP00000320622:P161Q	P	-	2	0	MYLK	124940540	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.180000	0.89694	2.497000	0.84241	0.655000	0.94253	CCA	-	pfam_Ig_I-set,pfscan_Ig-like_dom		0.562	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	protein_coding	OTTHUMT00000356464.1	G	NM_053025	-		123457850	-1	no_errors	ENST00000360304	ensembl	human	known	74_37	missense	SNP	1.000	T
NR6A1	2649	genome.wustl.edu	37	9	127316690	127316690	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr9:127316690T>A	ENST00000487099.2	-	3	459	c.302A>T	c.(301-303)aAc>aTc	p.N101I	NR6A1_ENST00000373584.3_Missense_Mutation_p.N97I|NR6A1_ENST00000344523.4_Missense_Mutation_p.N101I|NR6A1_ENST00000416460.2_Missense_Mutation_p.N97I	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	101					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						CATGACACAGTTCTTGTCACG	0.532																																					Esophageal Squamous(192;272 2884 6208 20560)												0								ENSG00000148200						181.0	146.0	158.0					9																	127316690		2203	4300	6503	NR6A1	SO:0001583	missense	0			-	HGNC	U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.302A>T	9.37:g.127316690T>A	ENSP00000420267:p.Asn101Ile	Somatic	0	25	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.N101I	ENST00000487099.2	37	c.302	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614559	0.87359	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523;ENST00000475178	D;D;D;D;D	0.96774	-4.12;-4.12;-4.12;-4.12;-4.12	5.51	5.51	0.81932	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.97763	0.9266	M	0.83312	2.635	0.80722	D	1	P;P;D	0.67145	0.924;0.915;0.996	P;P;P	0.61201	0.717;0.835;0.885	D	0.98346	1.0541	10	0.66056	D	0.02	.	14.8113	0.69996	0.0:0.0:0.0:1.0	.	97;101;97	F1DAM1;Q15406;Q15406-5	.;NR6A1_HUMAN;.	I	101;97;97;101;59	ENSP00000420267:N101I;ENSP00000362686:N97I;ENSP00000413701:N97I;ENSP00000341135:N101I;ENSP00000420587:N59I	ENSP00000341135:N101I	N	-	2	0	NR6A1	126356511	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.036000	0.88901	2.083000	0.62718	0.460000	0.39030	AAC	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt		0.532	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	protein_coding	OTTHUMT00000054043.4	T		-		127316690	-1	no_errors	ENST00000487099	ensembl	human	known	74_37	missense	SNP	1.000	A
MIPEP	4285	genome.wustl.edu	37	13	24449010	24449010	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr13:24449010C>A	ENST00000382172.3	-	5	676	c.578G>T	c.(577-579)aGt>aTt	p.S193I		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	193					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		ATGGATTCCACTAATTTCAAA	0.328																																																	0								ENSG00000027001						118.0	123.0	121.0					13																	24449010		2203	4300	6503	MIPEP	SO:0001583	missense	0			-	HGNC		CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.578G>T	13.37:g.24449010C>A	ENSP00000371607:p.Ser193Ile	Somatic	0	32	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_M3A_M3B	p.S193I	ENST00000382172.3	37	c.578	CCDS9303.1	13	.	.	.	.	.	.	.	.	.	.	C	26.4	4.735786	0.89482	.	.	ENSG00000027001	ENST00000382172	T	0.10382	2.88	5.68	5.68	0.88126	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.44138	0.1279	M	0.91510	3.215	0.58432	D	0.999999	D	0.76494	0.999	D	0.73380	0.98	T	0.52117	-0.8618	10	0.87932	D	0	.	19.1345	0.93420	0.0:1.0:0.0:0.0	.	193	Q99797	MIPEP_HUMAN	I	193	ENSP00000371607:S193I	ENSP00000371607:S193I	S	-	2	0	MIPEP	23347010	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.713000	0.74686	2.834000	0.97654	0.655000	0.94253	AGT	-	NULL		0.328	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPEP	protein_coding	OTTHUMT00000044169.1	C		-		24449010	-1	no_errors	ENST00000382172	ensembl	human	known	74_37	missense	SNP	1.000	A
RP11-744K17.2	0	genome.wustl.edu	37	17	21934924	21934924	+	lincRNA	SNP	C	C	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr17:21934924C>T	ENST00000582527.1	+	0	206																											CCACCGGCCCCGCCGCCCCAG	0.701																																																	0								ENSG00000266885																																			RP11-744K17.2			0			-	Clone_based_vega_gene																													17.37:g.21934924C>T		Somatic	0	17	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	3	75.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000582527.1	37	NULL		17																																																																																			-	-		0.701	RP11-744K17.2-001	KNOWN	basic	lincRNA	ENSG00000266885	lincRNA	OTTHUMT00000431350.1	C		-		21934924	+1	no_errors	ENST00000582527	ensembl	human	known	74_37	rna	SNP	0.002	T
ATRX	546	genome.wustl.edu	37	X	76937049	76937053	+	Frame_Shift_Del	DEL	TAAAT	TAAAT	-			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	TAAAT	TAAAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chrX:76937049_76937053delTAAAT	ENST00000373344.5	-	9	3909_3913	c.3695_3699delATTTA	c.(3694-3699)aatttafs	p.NL1232fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.NL1194fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1232	Interaction with DAXX.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAGACAGCACTAAATTTTCAGTCAC	0.346			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224																																			ATRX	SO:0001589	frameshift_variant	0				HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3695_3699delATTTA	X.37:g.76937049_76937053delTAAAT	ENSP00000362441:p.Asn1232fs	Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.N1232fs	ENST00000373344.5	37	c.3699_3695	CCDS14434.1	X																																																																																			-	NULL		0.346	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	TAAAT	NM_000489			76937053	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:0.995:0.993:0.994	-
SEL1L3	23231	genome.wustl.edu	37	4	25783928	25783928	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr4:25783928G>A	ENST00000399878.3	-	15	2515	c.2393C>T	c.(2392-2394)gCg>gTg	p.A798V	SEL1L3_ENST00000502949.1_Missense_Mutation_p.A645V|SEL1L3_ENST00000264868.5_Missense_Mutation_p.A763V	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	798						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						ATTGTATGACGCATCTGGGTT	0.458																																																	0								ENSG00000091490						254.0	238.0	243.0					4																	25783928		1898	4121	6019	SEL1L3	SO:0001583	missense	0			-	HGNC	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.2393C>T	4.37:g.25783928G>A	ENSP00000382767:p.Ala798Val	Somatic	0	58	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	52	26.76	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sel1-like,superfamily_ConA-like_lec_gl_sf,smart_Sel1-like	p.A798V	ENST00000399878.3	37	c.2393	CCDS47037.1	4	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798206	0.90538	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.59906	0.23;0.23;0.23	5.66	5.66	0.87406	Tetratricopeptide-like helical (1);	0.055934	0.64402	D	0.000001	T	0.74891	0.3776	L	0.58810	1.83	0.44129	D	0.996919	D;D	0.89917	0.997;1.0	P;D	0.83275	0.894;0.996	T	0.76049	-0.3101	10	0.87932	D	0	-16.6981	19.7554	0.96287	0.0:0.0:1.0:0.0	.	205;798	B4DTH5;Q68CR1	.;SE1L3_HUMAN	V	798;763;645	ENSP00000382767:A798V;ENSP00000264868:A763V;ENSP00000425438:A645V	ENSP00000264868:A763V	A	-	2	0	SEL1L3	25393026	1.000000	0.71417	0.893000	0.35052	0.960000	0.62799	8.188000	0.89710	2.665000	0.90641	0.563000	0.77884	GCG	-	pfam_Sel1-like,smart_Sel1-like		0.458	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L3	protein_coding	OTTHUMT00000360261.1	G	NM_015187	-		25783928	-1	no_errors	ENST00000399878	ensembl	human	known	74_37	missense	SNP	0.996	A
DLEC1	9940	genome.wustl.edu	37	3	38135096	38135096	+	Splice_Site	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr3:38135096G>T	ENST00000308059.6	+	12	1778	c.1757G>T	c.(1756-1758)gGa>gTa	p.G586V	DLEC1_ENST00000346219.3_Splice_Site_p.G586V|DLEC1_ENST00000452631.2_Splice_Site_p.G586V					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		ACTTTGGCAGGAATTGGGCAG	0.517																																																	0								ENSG00000008226						96.0	96.0	96.0					3																	38135096		1975	4146	6121	DLEC1	SO:0001630	splice_region_variant	0			-	HGNC	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.1757-1G>T	3.37:g.38135096G>T		Somatic	0	53	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	46	22.03		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PapD-like	p.G586V	ENST00000308059.6	37	c.1757	CCDS2672.2	3	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290775	0.80914	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.36878	1.23;1.24;1.46	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.62159	0.2405	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.65195	-0.6227	9	.	.	.	.	15.4156	0.74966	0.0:0.0:1.0:0.0	.	586;586;586	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	V	586	ENSP00000308597:G586V;ENSP00000315914:G586V;ENSP00000410427:G586V	.	G	+	2	0	DLEC1	38110100	1.000000	0.71417	0.960000	0.40013	0.898000	0.52572	8.359000	0.90093	2.347000	0.79759	0.655000	0.94253	GGA	-	NULL		0.517	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DLEC1	protein_coding	OTTHUMT00000253745.3	G	NM_007337	-	Missense_Mutation	38135096	+1	no_errors	ENST00000346219	ensembl	human	known	74_37	missense	SNP	0.999	T
WDR11	55717	genome.wustl.edu	37	10	122648750	122648751	+	3'UTR	INS	-	-	TTTTGTTTTG	rs71019800|rs369445236|rs141904743	byFrequency	TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr10:122648750_122648751insTTTTGTTTTG	ENST00000604509.1	+	0	2177_2178				WDR11_ENST00000263461.6_Intron			Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						AAATGAAATCtttttgttttgt	0.411														1378	0.27516	0.3154	0.3271	5008	,	,		15252	0.3899		0.1581	False		,,,				2504	0.1861																0								ENSG00000120008																																			WDR11	SO:0001624	3_prime_UTR_variant	0				HGNC	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000604509.1:c.*2175->TTTTGTTTTG	10.37:g.122648751_122648760dupTTTTGTTTTG		Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000604509.1	37	NULL		10																																																																																			-	-		0.411	WDR11-006	KNOWN	non_canonical_U12|basic	processed_transcript	WDR11	protein_coding	OTTHUMT00000468479.1	-				122648751	+1	no_errors	ENST00000604509	ensembl	human	known	74_37	rna	INS	0.024:0.006	TTTTGTTTTG
ARID3C	138715	genome.wustl.edu	37	9	34621478	34621478	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr9:34621478G>A	ENST00000378909.2	-	7	1308	c.1216C>T	c.(1216-1218)Ccc>Tcc	p.P406S	DCTN3_ENST00000378916.4_5'Flank|DCTN3_ENST00000477738.2_5'Flank|DCTN3_ENST00000378913.2_5'Flank|DCTN3_ENST00000259632.7_5'Flank|DCTN3_ENST00000341694.2_5'Flank|DCTN3_ENST00000447983.2_5'Flank	NM_001017363.1	NP_001017363.1	A6NKF2	ARI3C_HUMAN	AT rich interactive domain 3C (BRIGHT-like)	406	Pro-rich.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane raft (GO:0045121)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)	14	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.175)		CTGGAAGGGGGCCCTGTGGAG	0.622																																																	0								ENSG00000205143						25.0	29.0	28.0					9																	34621478		2203	4300	6503	ARID3C	SO:0001583	missense	0			-	HGNC		CCDS35006.1	9p13.2	2013-02-07	2006-11-08		ENSG00000205143	ENSG00000205143		"""-"""	21209	protein-coding gene	gene with protein product			"""AT rich interactive domain 3C (BRIGHT- like)"""				Standard	NM_001017363		Approved		uc011lon.2	A6NKF2	OTTHUMG00000000445	ENST00000378909.2:c.1216C>T	9.37:g.34621478G>A	ENSP00000368189:p.Pro406Ser	Somatic	0	61	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	107	10.83		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.P406S	ENST00000378909.2	37	c.1216	CCDS35006.1	9	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041164	0.35989	.	.	ENSG00000205143	ENST00000378909	T	0.58060	0.36	4.37	3.46	0.39613	.	0.000000	0.45126	D	0.000393	T	0.41650	0.1168	L	0.44542	1.39	0.27944	N	0.937405	B	0.23377	0.084	B	0.21360	0.034	T	0.28459	-1.0043	10	0.28530	T	0.3	-10.8031	10.3801	0.44106	0.0:0.1994:0.8006:0.0	.	406	A6NKF2	ARI3C_HUMAN	S	406	ENSP00000368189:P406S	ENSP00000368189:P406S	P	-	1	0	ARID3C	34611478	0.994000	0.37717	0.991000	0.47740	0.863000	0.49368	2.386000	0.44380	1.176000	0.42840	0.549000	0.68633	CCC	-	NULL		0.622	ARID3C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3C	protein_coding	OTTHUMT00000348265.1	G	XM_071061	-		34621478	-1	no_errors	ENST00000378909	ensembl	human	known	74_37	missense	SNP	0.995	A
EHBP1	23301	genome.wustl.edu	37	2	63273759	63273760	+	IGR	INS	-	-	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:63273759_63273760insT	ENST00000263991.5	+	0	5165				AC009501.4_ENST00000413549.1_RNA|AC009501.4_ENST00000437346.1_RNA|AC009501.4_ENST00000412297.1_RNA|AC009501.4_ENST00000429952.1_RNA	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1							cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			AGCTGAATAAGTTTACACCATC	0.406																																																	0								ENSG00000231609																																			AC009501.4	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453		2.37:g.63273762_63273762dupT		Somatic	0	17	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	2	77.78	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263991.5	37	NULL	CCDS1872.1	2																																																																																			-	-		0.406	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100132215	protein_coding	OTTHUMT00000251616.1	-	NM_015252			63273760	-1	no_errors	ENST00000413549	ensembl	human	known	74_37	rna	INS	0.091:0.111	T
TRIM6	117854	genome.wustl.edu	37	11	5624955	5624955	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr11:5624955A>T	ENST00000278302.5	+	2	553	c.413A>T	c.(412-414)cAg>cTg	p.Q138L	TRIM6_ENST00000515022.1_Intron|TRIM6_ENST00000445329.1_De_novo_Start_OutOfFrame|TRIM6_ENST00000506134.1_Intron|HBG2_ENST00000380259.2_Intron|TRIM6-TRIM34_ENST00000354852.5_Missense_Mutation_p.Q166L|TRIM6_ENST00000380097.3_Missense_Mutation_p.Q166L|TRIM6_ENST00000380107.1_Missense_Mutation_p.Q112L|TRIM6_ENST00000507320.1_De_novo_Start_OutOfFrame|AC015691.13_ENST00000394793.2_RNA	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	138					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		GAGGTTGCCCAGGAGTACCAG	0.522																																																	0								ENSG00000258588						71.0	67.0	69.0					11																	5624955		2201	4297	6498	TRIM6-TRIM34	SO:0001583	missense	0			-	HGNC	AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.413A>T	11.37:g.5624955A>T	ENSP00000278302:p.Gln138Leu	Somatic	0	51	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	80	9.09	A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q166L	ENST00000278302.5	37	c.497	CCDS31390.1	11	.	.	.	.	.	.	.	.	.	.	a	13.35	2.211685	0.39102	.	.	ENSG00000121236;ENSG00000121236;ENSG00000121236;ENSG00000121236;ENSG00000258659;ENSG00000258588	ENST00000278302;ENST00000380107;ENST00000380097;ENST00000396867;ENST00000337072;ENST00000354852	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	3.96	2.83	0.33086	.	.	.	.	.	T	0.53094	0.1775	M	0.86097	2.795	0.09310	N	0.999996	B;B;P;B	0.41848	0.002;0.431;0.763;0.361	B;B;B;B	0.39379	0.006;0.186;0.298;0.156	T	0.55016	-0.8206	9	0.72032	D	0.01	.	4.3695	0.11241	0.6937:0.2014:0.1049:0.0	.	112;166;166;138	E9PFM0;B2RNG4;Q9C030-2;Q9C030	.;.;.;TRIM6_HUMAN	L	138;112;166;45;166;166	ENSP00000278302:Q138L;ENSP00000369450:Q112L;ENSP00000369440:Q166L;ENSP00000346916:Q166L	ENSP00000278302:Q138L	Q	+	2	0	TRIM34;TRIM6;TRIM6-TRIM34	5581531	0.198000	0.23374	1.000000	0.80357	0.946000	0.59487	2.192000	0.42649	0.854000	0.35336	-0.359000	0.07587	CAG	-	NULL		0.522	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM6-TRIM34	protein_coding	OTTHUMT00000143376.2	A	NM_001003818	-		5624955	+1	no_errors	ENST00000354852	ensembl	human	known	74_37	missense	SNP	0.468	T
CTTNBP2NL	55917	genome.wustl.edu	37	1	113000026	113000026	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:113000026A>T	ENST00000271277.6	+	6	2137	c.1912A>T	c.(1912-1914)Agc>Tgc	p.S638C	CTTNBP2NL_ENST00000607039.1_Intron	NM_018704.2	NP_061174.1	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	638					negative regulation of transmembrane transport (GO:0034763)|negative regulation of transporter activity (GO:0032410)|protein dephosphorylation (GO:0006470)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	29		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTGCCTACCAGCAGCTAGTC	0.458																																																	0								ENSG00000143079						76.0	68.0	71.0					1																	113000026		2203	4300	6503	CTTNBP2NL	SO:0001583	missense	0			-	HGNC	AB037854	CCDS845.1	1p13.2	2008-02-05			ENSG00000143079	ENSG00000143079			25330	protein-coding gene	gene with protein product		615100				10718198	Standard	NM_018704		Approved	DKFZp547A023	uc001ebx.3	Q9P2B4	OTTHUMG00000011154	ENST00000271277.6:c.1912A>T	1.37:g.113000026A>T	ENSP00000271277:p.Ser638Cys	Somatic	0	38	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B3KMS5|Q96B40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cortactin-binding_p2_N	p.S638C	ENST00000271277.6	37	c.1912	CCDS845.1	1	.	.	.	.	.	.	.	.	.	.	A	14.69	2.611508	0.46631	.	.	ENSG00000143079	ENST00000271277	T	0.26373	1.74	5.78	5.78	0.91487	.	0.166314	0.64402	D	0.000003	T	0.20129	0.0484	L	0.27053	0.805	0.46954	D	0.999261	D	0.69078	0.997	P	0.57283	0.817	T	0.04781	-1.0927	10	0.87932	D	0	-17.8347	10.1841	0.42986	0.9252:0.0:0.0748:0.0	.	638	Q9P2B4	CT2NL_HUMAN	C	638	ENSP00000271277:S638C	ENSP00000271277:S638C	S	+	1	0	CTTNBP2NL	112801549	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.794000	0.62482	2.212000	0.71576	0.374000	0.22700	AGC	-	NULL		0.458	CTTNBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2NL	protein_coding	OTTHUMT00000030686.1	A	NM_018704	-		113000026	+1	no_errors	ENST00000271277	ensembl	human	known	74_37	missense	SNP	1.000	T
DCDC1	341019	genome.wustl.edu	37	11	31086639	31086639	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr11:31086639T>G	ENST00000597505.1	-	17	2359	c.2360A>C	c.(2359-2361)cAg>cCg	p.Q787P	DCDC1_ENST00000437348.1_5'UTR			P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					ATACTCTGTCTGGGTCACATC	0.458																																																	0								ENSG00000170959						109.0	100.0	103.0					11																	31086639		1946	4153	6099	DCDC1	SO:0001583	missense	0			-	HGNC	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.2360A>C	11.37:g.31086639T>G	ENSP00000472625:p.Gln787Pro	Somatic	0	51	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Doublecortin_dom,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.Q787P	ENST00000597505.1	37	c.2360		11																																																																																			-	superfamily_Ricin_B_lectin,pfscan_Ricin_B_lectin		0.458	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	protein_coding	OTTHUMT00000463167.1	T	NM_181807	-		31086639	-1	no_errors	ENST00000597505	ensembl	human	putative	74_37	missense	SNP	1.000	G
CAND1	55832	genome.wustl.edu	37	12	67663558	67663558	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr12:67663558G>C	ENST00000545606.1	+	1	498	c.61G>C	c.(61-63)Gac>Cac	p.D21H	CAND1_ENST00000539109.1_3'UTR	NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	21					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CAGCGACAAGGACTTTAGGTG	0.637																																																	0								ENSG00000111530						47.0	42.0	44.0					12																	67663558		2203	4300	6503	CAND1	SO:0001583	missense	0			-	HGNC		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.61G>C	12.37:g.67663558G>C	ENSP00000442318:p.Asp21His	Somatic	0	21	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.D21H	ENST00000545606.1	37	c.61	CCDS8977.1	12	.	.	.	.	.	.	.	.	.	.	G	22.7	4.330300	0.81690	.	.	ENSG00000111530	ENST00000545606;ENST00000299218	T	0.07688	3.17	4.2	3.31	0.37934	Armadillo-like helical (1);Armadillo-type fold (1);	0.100250	0.64402	D	0.000003	T	0.37019	0.0988	M	0.94142	3.5	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.49123	-0.8972	9	.	.	.	-0.3486	11.2881	0.49234	0.0928:0.0:0.9072:0.0	.	21	Q86VP6	CAND1_HUMAN	H	21	ENSP00000442318:D21H	.	D	+	1	0	CAND1	65949825	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.027000	0.70881	1.099000	0.41499	0.462000	0.41574	GAC	-	superfamily_ARM-type_fold		0.637	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND1	protein_coding	OTTHUMT00000402105.1	G	NM_018448	-		67663558	+1	no_errors	ENST00000545606	ensembl	human	known	74_37	missense	SNP	1.000	C
HRCT1	646962	genome.wustl.edu	37	9	35906595	35906596	+	In_Frame_Ins	INS	-	-	CCACCC	rs58509439		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr9:35906595_35906596insCCACCC	ENST00000354323.2	+	1	407_408	c.311_312insCCACCC	c.(310-315)caccac>caCCACCCccac	p.107_108insPH	LINC00961_ENST00000443779.1_lincRNA	NM_001039792.1	NP_001034881.1	Q6UXD1	HRCT1_HUMAN	histidine rich carboxyl terminus 1	107	His-rich.					integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)	4						caccaccaccaccacccccacc	0.673																																																	0								ENSG00000196196																																			HRCT1	SO:0001652	inframe_insertion	0				HGNC		CCDS35012.1	9p13.3	2008-09-30			ENSG00000196196	ENSG00000196196			33872	protein-coding gene	gene with protein product						12975309	Standard	NM_001039792		Approved	LGLL338, PRO537, UNQ338	uc003zyr.1	Q6UXD1	OTTHUMG00000154146	ENST00000354323.2:c.312_317dupCCACCC	9.37:g.35906596_35906601dupCCACCC	ENSP00000346283:p.Pro106_His107dup	Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7ZBJ1	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.108in_frame_insPH	ENST00000354323.2	37	c.311_312	CCDS35012.1	9																																																																																			-	NULL		0.673	HRCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRCT1	protein_coding	OTTHUMT00000334099.1	-	NM_001039792			35906596	+1	no_errors	ENST00000354323	ensembl	human	known	74_37	in_frame_ins	INS	0.012:0.005	CCACCC
NBEAL1	65065	genome.wustl.edu	37	2	203977921	203977921	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr2:203977921T>C	ENST00000449802.1	+	16	2632	c.2299T>C	c.(2299-2301)Tca>Cca	p.S767P		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	767										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CAAATTGATATCAGCTGGAAC	0.448																																																	0								ENSG00000144426						128.0	124.0	125.0					2																	203977921		692	1591	2283	NBEAL1	SO:0001583	missense	0			-	HGNC	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.2299T>C	2.37:g.203977921T>C	ENSP00000399903:p.Ser767Pro	Somatic	0	53	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	36	20.00	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S767P	ENST00000449802.1	37	c.2299	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	T	15.71	2.914614	0.52546	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.51325	0.71	5.07	5.07	0.68467	Concanavalin A-like lectin/glucanase (1);	.	.	.	.	T	0.50120	0.1597	N	0.15975	0.35	0.53688	D	0.999979	D	0.89917	1.0	D	0.75484	0.986	T	0.49254	-0.8959	9	0.26408	T	0.33	.	14.7631	0.69619	0.0:0.0:0.0:1.0	.	767	Q6ZS30	NBEL1_HUMAN	P	767	ENSP00000399903:S767P	ENSP00000344985:S767P	S	+	1	0	NBEAL1	203686166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.831000	0.69330	2.018000	0.59344	0.528000	0.53228	TCA	-	superfamily_ConA-like_lec_gl_sf		0.448	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	protein_coding	OTTHUMT00000333982.4	T		-		203977921	+1	no_errors	ENST00000449802	ensembl	human	known	74_37	missense	SNP	1.000	C
ATP8B1	5205	genome.wustl.edu	37	18	55335786	55335787	+	Intron	INS	-	-	AAAAA	rs34422185|rs56095156|rs113609179|rs386387815|rs56032749|rs201548728		TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr18:55335786_55335787insAAAAA	ENST00000283684.4	-	18	2097				RP11-35G9.3_ENST00000591854.1_RNA|ATP8B1_ENST00000536015.1_Intron|RP11-35G9.3_ENST00000599199.1_RNA|RP11-35G9.3_ENST00000592201.1_RNA|RP11-35G9.5_ENST00000588925.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1						bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				GAATGtatattaaaaaaaaaaa	0.351																																																	0								ENSG00000267040																																			RP11-35G9.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.2098-14->TTTTT	18.37:g.55335792_55335796dupAAAAA		Somatic	NA	NA	NA		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q9BTP8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000283684.4	37	NULL	CCDS11965.1	18																																																																																			-	-		0.351	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267040	protein_coding	OTTHUMT00000256097.1	-	NM_005603			55335787	+1	no_errors	ENST00000592201	ensembl	human	known	74_37	rna	INS	0.794:0.000	AAAAA
OR8B4	283162	genome.wustl.edu	37	11	124294278	124294278	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr11:124294278G>A	ENST00000356130.3	-	1	511	c.490C>T	c.(490-492)Cga>Tga	p.R164*		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R164*(1)		endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AAGGTCAGTCGCAGCATGCTT	0.542																																																	1	Substitution - Nonsense(1)	large_intestine(1)						ENSG00000198657						91.0	63.0	73.0					11																	124294278		2201	4299	6500	OR8B4	SO:0001587	stop_gained	0			-	HGNC	AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.490C>T	11.37:g.124294278G>A	ENSP00000348449:p.Arg164*	Somatic	0	16	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	7	68.18	B2RNF8|Q6IFQ7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.R164*	ENST00000356130.3	37	c.490	CCDS31710.1	11	.	.	.	.	.	.	.	.	.	.	g	15.83	2.950292	0.53186	.	.	ENSG00000198657	ENST00000356130	.	.	.	4.02	0.253	0.15551	.	0.106321	0.41938	D	0.000795	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.1545	0.20330	0.1504:0.0:0.3179:0.5317	.	.	.	.	X	164	.	ENSP00000348449:R164X	R	-	1	2	OR8B4	123799488	0.000000	0.05858	0.979000	0.43373	0.556000	0.35491	-0.751000	0.04803	0.040000	0.15660	-1.023000	0.02433	CGA	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B4	protein_coding	OTTHUMT00000387055.1	G	NM_001005196	-		124294278	-1	no_errors	ENST00000356130	ensembl	human	known	74_37	nonsense	SNP	0.747	A
ARSE	415	genome.wustl.edu	37	X	2876419	2876419	+	Silent	SNP	T	T	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chrX:2876419T>C	ENST00000381134.3	-	3	147	c.81A>G	c.(79-81)ccA>ccG	p.P27P	ARSE_ENST00000496095.1_5'Flank|ARSE_ENST00000540563.1_Intron|ARSE_ENST00000545496.1_Silent_p.P52P	NM_000047.2	NP_000038.2	P51690	ARSE_HUMAN	arylsulfatase E (chondrodysplasia punctata 1)	27					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGGAAGCTGATGGTGCCAAAC	0.542																																																	0								ENSG00000157399						120.0	82.0	95.0					X																	2876419		2203	4300	6503	ARSE	SO:0001819	synonymous_variant	0			-	HGNC	X83573	CCDS14122.1, CCDS75948.1, CCDS75949.1	Xp22.33	2013-02-14			ENSG00000157399	ENSG00000157399		"""Arylsulfatase family"""	719	protein-coding gene	gene with protein product		300180		CDPX, CDPX1		7720070	Standard	NM_000047		Approved		uc004crc.4	P51690	OTTHUMG00000137358	ENST00000381134.3:c.81A>G	X.37:g.2876419T>C		Somatic	0	12	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	31	26.19	Q53FT2|Q53FU8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.P52	ENST00000381134.3	37	c.156	CCDS14122.1	X																																																																																			-	NULL		0.542	ARSE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSE	protein_coding	OTTHUMT00000055643.1	T	NM_000047	-		2876419	-1	no_errors	ENST00000545496	ensembl	human	known	74_37	silent	SNP	0.000	C
OXSR1	9943	genome.wustl.edu	37	3	38271909	38271909	+	Silent	SNP	A	A	G			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr3:38271909A>G	ENST00000446845.1	+	10	1311	c.939A>G	c.(937-939)gaA>gaG	p.E313E	OXSR1_ENST00000311806.3_Silent_p.E313E					oxidative stress responsive 1											skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CCATTTCTGAAAGAGCAAAAA	0.279																																																	0								ENSG00000172939						63.0	77.0	72.0					3																	38271909		2203	4291	6494	OXSR1	SO:0001819	synonymous_variant	0			-	HGNC	AB017642	CCDS2675.1	3p22.2	2013-05-17	2013-05-17	2004-11-26	ENSG00000172939	ENSG00000172939			8508	protein-coding gene	gene with protein product		604046	"""oxidative-stress responsive 1"""	OSR1		10083736	Standard	XM_005265638		Approved	KIAA1101	uc003chy.3	O95747	OTTHUMG00000131084	ENST00000446845.1:c.939A>G	3.37:g.38271909A>G		Somatic	0	49	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E313	ENST00000446845.1	37	c.939		3																																																																																			-	superfamily_Kinase-like_dom		0.279	OXSR1-004	NOVEL	basic|exp_conf	protein_coding	OXSR1	protein_coding	OTTHUMT00000342708.1	A	NM_005109	-		38271909	+1	no_errors	ENST00000311806	ensembl	human	known	74_37	silent	SNP	1.000	G
PAGE5	90737	genome.wustl.edu	37	X	55248256	55248256	+	Silent	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chrX:55248256G>A	ENST00000289619.5	+	3	443	c.198G>A	c.(196-198)caG>caA	p.Q66Q	PAGE5_ENST00000374952.1_Splice_Site_p.Q46Q|PAGE5_ENST00000374955.3_Silent_p.Q46Q	NM_130467.3	NP_569734.2	Q96GU1	PAGE5_HUMAN	P antigen family, member 5 (prostate associated)	66										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8						CTGATAATCAGGGTATTGCAC	0.443																																																	0								ENSG00000158639						110.0	76.0	88.0					X																	55248256		2203	4300	6503	PAGE5	SO:0001819	synonymous_variant	0			-	HGNC	AJ344352	CCDS14368.1, CCDS35306.1	Xp11.22	2009-08-18			ENSG00000158639	ENSG00000158639			29992	protein-coding gene	gene with protein product	"""cancer/testis antigen family 16, member 1"", ""cancer/testis antigen family 16, member 2"""					11920606, 11992404	Standard	XM_006724613		Approved	PAGE-5, CT16.1, CT16.2	uc004duk.3	Q96GU1	OTTHUMG00000021650	ENST00000289619.5:c.198G>A	X.37:g.55248256G>A		Somatic	0	45	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	2	96.83	Q2NL97|Q5JUL0|Q8WWL9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GAGE	p.Q66	ENST00000289619.5	37	c.198	CCDS14368.1	X																																																																																			-	pfam_GAGE		0.443	PAGE5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAGE5	protein_coding	OTTHUMT00000056861.1	G	NM_130467	-		55248256	+1	no_errors	ENST00000289619	ensembl	human	known	74_37	silent	SNP	0.001	A
NOP14	8602	genome.wustl.edu	37	4	2949306	2949306	+	Silent	SNP	G	G	A			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr4:2949306G>A	ENST00000314262.6	-	10	1494	c.1446C>T	c.(1444-1446)ggC>ggT	p.G482G	NOP14-AS1_ENST00000505731.1_RNA|NOP14_ENST00000416614.2_Silent_p.G482G|NOP14-AS1_ENST00000503709.1_RNA|NOP14_ENST00000398071.4_Silent_p.G482G|NOP14-AS1_ENST00000507702.1_RNA|NOP14-AS1_ENST00000515194.1_RNA|NOP14_ENST00000502735.1_Silent_p.G482G	NM_003703.1	NP_003694.1	P78316	NOP14_HUMAN	NOP14 nucleolar protein	482					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000462)|ribosomal small subunit biogenesis (GO:0042274)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|membrane (GO:0016020)|mitochondrion (GO:0005739)|Noc4p-Nop14p complex (GO:0030692)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small-subunit processome (GO:0032040)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)	p.G482G(1)		NS(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	30						TAGCCAAATCGCCAACGTATT	0.448																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000087269						142.0	130.0	134.0					4																	2949306		2203	4300	6503	NOP14	SO:0001819	synonymous_variant	0			-	HGNC	AB000467	CCDS33945.1	4p16.3	2012-12-10	2012-12-10	2008-10-13	ENSG00000087269	ENSG00000087269			16821	protein-coding gene	gene with protein product	"""NOP14 homolog (S. cerevisiae)"""	611526	"""chromosome 4 open reading frame 9"", ""nucleolar protein 14"", ""nucleolar protein 14 homolog (yeast)"", ""NOP14 nucleolar protein homolog (yeast)"""	C4orf9, NOL14		9734812, 11694595	Standard	XR_241655		Approved	RES4-25, UTP2	uc003ggj.1	P78316	OTTHUMG00000159911	ENST00000314262.6:c.1446C>T	4.37:g.2949306G>A		Somatic	0	29	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	D3DVR6|Q7LGI5|Q7Z6K0|Q8TBR6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nop14	p.G482	ENST00000314262.6	37	c.1446	CCDS33945.1	4																																																																																			-	pfam_Nop14		0.448	NOP14-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	NOP14	protein_coding	OTTHUMT00000358135.2	G	NM_003703	-		2949306	-1	no_errors	ENST00000416614	ensembl	human	known	74_37	silent	SNP	0.086	A
MUC16	94025	genome.wustl.edu	37	19	9047336	9047336	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr19:9047336G>C	ENST00000397910.4	-	5	34498	c.34295C>G	c.(34294-34296)aCa>aGa	p.T11432R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11434	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AAATGAGGTTGTGGTCTCTGG	0.473																																																	0								ENSG00000181143						184.0	186.0	185.0					19																	9047336		1985	4169	6154	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.34295C>G	19.37:g.9047336G>C	ENSP00000381008:p.Thr11432Arg	Somatic	0	48	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	68	9.33	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.T11432R	ENST00000397910.4	37	c.34295	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	6.123	0.390953	0.11581	.	.	ENSG00000181143	ENST00000397910	T	0.01998	4.51	3.32	2.27	0.28462	.	.	.	.	.	T	0.06280	0.0162	L	0.40543	1.245	.	.	.	D	0.89917	1.0	D	0.87578	0.998	T	0.21895	-1.0232	8	0.87932	D	0	.	6.6978	0.23209	0.1321:0.0:0.8679:0.0	.	11432	B5ME49	.	R	11432	ENSP00000381008:T11432R	ENSP00000381008:T11432R	T	-	2	0	MUC16	8908336	0.000000	0.05858	0.021000	0.16686	0.007000	0.05969	0.095000	0.15127	0.954000	0.37851	0.486000	0.48141	ACA	-	NULL		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690	-		9047336	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.026	C
ARID1A	8289	genome.wustl.edu	37	1	27023189	27023189	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BU-01A-11D-A37C-09	TCGA-DX-A8BU-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	330b9068-ca47-4592-88e4-6c469c5cd907	6251e219-3da3-43e1-aba3-1ab654ae4151	g.chr1:27023189G>T	ENST00000324856.7	+	1	666	c.295G>T	c.(295-297)Gac>Tac	p.D99Y	ARID1A_ENST00000457599.2_Missense_Mutation_p.D99Y|RP5-968P14.2_ENST00000569378.1_RNA	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	99					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.A96fs*11(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CGCGGAGCCGGACCTGAAGAA	0.761			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	1	Deletion - Frameshift(1)	ovary(1)						ENSG00000117713						1.0	1.0	1.0					1																	27023189		256	555	811	ARID1A	SO:0001583	missense	0			-	HGNC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.295G>T	1.37:g.27023189G>T	ENSP00000320485:p.Asp99Tyr	Somatic	0	8	0.00		0.6645804110761753	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	5	66.67	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.D99Y	ENST00000324856.7	37	c.295	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.751473	0.49257	.	.	ENSG00000117713	ENST00000324856;ENST00000457599	T;T	0.03152	4.27;4.03	2.45	2.45	0.29901	.	0.080236	0.45361	U	0.000371	T	0.03520	0.0101	N	0.19112	0.55	0.80722	D	1	D;D	0.58620	0.97;0.983	B;P	0.45506	0.29;0.483	T	0.55897	-0.8068	10	0.62326	D	0.03	-5.9142	10.5651	0.45167	0.0:0.0:1.0:0.0	.	99;99	O14497;O14497-2	ARI1A_HUMAN;.	Y	99	ENSP00000320485:D99Y;ENSP00000387636:D99Y	ENSP00000320485:D99Y	D	+	1	0	ARID1A	26895776	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.607000	0.54102	1.378000	0.46305	0.385000	0.25706	GAC	-	NULL		0.761	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	protein_coding	OTTHUMT00000011437.2	G	NM_139135	-		27023189	+1	no_errors	ENST00000324856	ensembl	human	known	74_37	missense	SNP	1.000	T
