#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
MOB2	81532	genome.wustl.edu	37	11	1502032	1502032	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:1502032C>A	ENST00000329957.6	-	2	383	c.194G>T	c.(193-195)aGg>aTg	p.R65M	MOB2_ENST00000526462.1_5'UTR	NM_001172223.1	NP_001165694.1	Q70IA6	MOB2_HUMAN	MOB kinase activator 2	34					actin cytoskeleton organization (GO:0030036)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cytoplasm (GO:0005737)|neuron projection terminus (GO:0044306)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)	4						GTCGGTGATCCTGGCCTTGGT	0.632																																																	0								ENSG00000182208						41.0	46.0	44.0					11																	1502032		2077	4202	6279	MOB2	SO:0001583	missense	0			-	HGNC		CCDS53591.1	11p15.5	2011-09-28			ENSG00000182208	ENSG00000182208		"""MOB kinase activators"""	24904	protein-coding gene	gene with protein product	"""MOB2 Mps One Binder homolog (yeast)"""	611969				11223154, 15067004	Standard	NM_053005		Approved	HCCA2	uc010qwz.2	Q70IA6	OTTHUMG00000165545	ENST00000329957.6:c.194G>T	11.37:g.1502032C>A	ENSP00000328694:p.Arg65Met	Somatic	0	50	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B4DKP3|Q96M67	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.R65M	ENST00000329957.6	37	c.194	CCDS53591.1	11	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962466	0.92791	.	.	ENSG00000182208	ENST00000329957	.	.	.	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000001	T	0.74321	0.3701	L	0.48877	1.53	0.80722	D	1	D;D	0.65815	0.984;0.995	D;D	0.67900	0.954;0.938	T	0.75508	-0.3293	9	0.59425	D	0.04	-43.6118	19.0961	0.93251	0.0:1.0:0.0:0.0	.	65;34	E9PDA5;Q70IA6	.;MOB2_HUMAN	M	65	.	ENSP00000328694:R65M	R	-	2	0	AC091196.1	1458608	1.000000	0.71417	0.948000	0.38648	0.948000	0.59901	5.797000	0.69087	2.506000	0.84524	0.462000	0.41574	AGG	-	pfam_Mob1_phocein,superfamily_Mob1_phocein		0.632	MOB2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MOB2	protein_coding	OTTHUMT00000384770.1	C	NM_053005	-		1502032	-1	no_errors	ENST00000329957	ensembl	human	novel	74_37	missense	SNP	1.000	A
APLP2	334	genome.wustl.edu	37	11	130003584	130003584	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:130003584A>C	ENST00000263574.5	+	12	1717	c.1645A>C	c.(1645-1647)Aaa>Caa	p.K549Q	APLP2_ENST00000278756.7_Missense_Mutation_p.K559Q|APLP2_ENST00000345598.5_Missense_Mutation_p.K320Q|APLP2_ENST00000528499.1_Missense_Mutation_p.K493Q|APLP2_ENST00000543137.1_Missense_Mutation_p.K456Q|APLP2_ENST00000338167.5_Missense_Mutation_p.K549Q|APLP2_ENST00000539648.1_Missense_Mutation_p.K337Q	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	549					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TCTGCTCTACAAAGTACCTTA	0.468																																																	0								ENSG00000084234						117.0	107.0	111.0					11																	130003584		2201	4297	6498	APLP2	SO:0001583	missense	0			-	HGNC	L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.1645A>C	11.37:g.130003584A>C	ENSP00000263574:p.Lys549Gln	Somatic	0	43	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	33.33	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,pfam_Prot_inh_Kunz-m,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,superfamily_Prot_inh_Kunz-m,smart_Amyloid_glyco_extra,smart_Prot_inh_Kunz-m,prints_Amyloid_glyco,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.K549Q	ENST00000263574.5	37	c.1645	CCDS8486.1	11	.	.	.	.	.	.	.	.	.	.	A	19.16	3.773555	0.69992	.	.	ENSG00000084234	ENST00000528499;ENST00000539648;ENST00000263574;ENST00000345598;ENST00000338167;ENST00000278756;ENST00000543137	T;T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64;0.64	5.07	5.07	0.68467	Amyloidogenic glycoprotein, E2 domain (1);	0.000000	0.85682	D	0.000000	T	0.66396	0.2785	M	0.71581	2.175	0.80722	D	1	D;D;D;P;D;D;D	0.89917	0.999;1.0;1.0;0.839;1.0;1.0;0.999	D;D;D;P;D;D;D	0.85130	0.976;0.997;0.997;0.607;0.997;0.995;0.918	T	0.66524	-0.5902	10	0.38643	T	0.18	-15.0798	14.0522	0.64745	1.0:0.0:0.0:0.0	.	337;549;493;320;487;493;549	F5H845;Q06481;Q06481-2;Q06481-5;B4E3I5;Q06481-4;Q06481-3	.;APLP2_HUMAN;.;.;.;.;.	Q	493;337;549;320;549;559;456	ENSP00000435914:K493Q;ENSP00000443728:K337Q;ENSP00000263574:K549Q;ENSP00000263575:K320Q;ENSP00000345444:K549Q;ENSP00000278756:K559Q;ENSP00000444122:K456Q	ENSP00000263574:K549Q	K	+	1	0	APLP2	129508794	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.906000	0.92626	1.917000	0.55516	0.460000	0.39030	AAA	-	superfamily_Amyloid_glyco_E2_domain		0.468	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APLP2	protein_coding	OTTHUMT00000386109.1	A	NM_001642	-		130003584	+1	no_errors	ENST00000263574	ensembl	human	known	74_37	missense	SNP	1.000	C
ZNF175	7728	genome.wustl.edu	37	19	52090690	52090690	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr19:52090690G>T	ENST00000262259.2	+	5	1464	c.1106G>T	c.(1105-1107)gGa>gTa	p.G369V	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	369					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		CATGACTGTGGAAAAGCCTTT	0.408																																																	0								ENSG00000105497						105.0	110.0	108.0					19																	52090690		2203	4300	6503	ZNF175	SO:0001583	missense	0			-	HGNC	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.1106G>T	19.37:g.52090690G>T	ENSP00000262259:p.Gly369Val	Somatic	0	37	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	A8K9H2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G369V	ENST00000262259.2	37	c.1106	CCDS12837.1	19	.	.	.	.	.	.	.	.	.	.	G	15.26	2.780071	0.49891	.	.	ENSG00000105497	ENST00000262259	T	0.23754	1.89	2.3	2.3	0.28687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.60090	0.2242	H	0.96015	3.755	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.71391	-0.4607	9	0.87932	D	0	.	10.7252	0.46064	0.0:0.0:1.0:0.0	.	369	Q9Y473	ZN175_HUMAN	V	369	ENSP00000262259:G369V	ENSP00000262259:G369V	G	+	2	0	ZNF175	56782502	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.531000	0.53546	1.614000	0.50241	0.563000	0.77884	GGA	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.408	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF175	protein_coding	OTTHUMT00000396205.1	G	NM_007147	-		52090690	+1	no_errors	ENST00000262259	ensembl	human	known	74_37	missense	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76937766	76937769	+	Frame_Shift_Del	DEL	TTTC	TTTC	-	rs371962239		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	TTTC	TTTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chrX:76937766_76937769delTTTC	ENST00000373344.5	-	9	3193_3196	c.2979_2982delGAAA	c.(2977-2982)aagaaafs	p.KK993fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.KK955fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	993					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AGTCTGAAGGTTTCTTTTTTTCTT	0.338			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224																																			ATRX	SO:0001589	frameshift_variant	0				HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.2979_2982delGAAA	X.37:g.76937766_76937769delTTTC	ENSP00000362441:p.Lys993fs	Somatic	0	41	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	13	50.00	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K993fs	ENST00000373344.5	37	c.2982_2979	CCDS14434.1	X																																																																																			-	NULL		0.338	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	TTTC	NM_000489			76937769	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_del	DEL	0.936:0.944:0.949:0.993	-
SIRPB2	284759	genome.wustl.edu	37	20	1456846	1456846	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr20:1456846A>C	ENST00000359801.3	-	5	1031	c.995T>G	c.(994-996)aTg>aGg	p.M332R	SIRPB2_ENST00000608747.1_5'Flank|SIRPB2_ENST00000444444.2_Missense_Mutation_p.M234R	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	366	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TAAGGTGTTCATGGCTCCTGC	0.587																																																	0								ENSG00000196209						144.0	125.0	131.0					20																	1456846		1568	3582	5150	SIRPB2	SO:0001583	missense	0			-	HGNC	AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.995T>G	20.37:g.1456846A>C	ENSP00000352849:p.Met332Arg	Somatic	0	52	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	30	21.05	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.M332R	ENST00000359801.3	37	c.995	CCDS42849.1	20	.	.	.	.	.	.	.	.	.	.	A	8.690	0.907264	0.17833	.	.	ENSG00000196209	ENST00000359801;ENST00000444444	T;T	0.02197	4.62;4.4	3.46	-2.0	0.07433	.	8.769010	0.00424	U	0.000060	T	0.01387	0.0045	N	0.14661	0.345	0.09310	N	1	B;B	0.16166	0.016;0.008	B;B	0.12156	0.007;0.007	T	0.42749	-0.9433	10	0.10902	T	0.67	-7.7086	0.9568	0.01387	0.2579:0.3219:0.1042:0.3159	.	234;332	E9PCW6;Q5JXA9	.;SIRB2_HUMAN	R	332;234	ENSP00000352849:M332R;ENSP00000402438:M234R	ENSP00000352849:M332R	M	-	2	0	SIRPB2	1404846	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.349000	0.07731	-0.433000	0.07286	0.402000	0.26972	ATG	-	NULL		0.587	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPB2	protein_coding	OTTHUMT00000077544.1	A	NM_178459	-		1456846	-1	no_errors	ENST00000359801	ensembl	human	known	74_37	missense	SNP	0.000	C
STT3B	201595	genome.wustl.edu	37	3	31574393	31574394	+	5'UTR	INS	-	-	TACTCC	rs529181821|rs375544928	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:31574393_31574394insTACTCC	ENST00000295770.2	+	0	112_113				STT3B_ENST00000453168.1_3'UTR	NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)						co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						ctcctttttcttcctcctcctc	0.738																																																	0								ENSG00000163527																																			STT3B	SO:0001623	5_prime_UTR_variant	0				HGNC	AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.-97->TACTCC	3.37:g.31574393_31574394insTACTCC		Somatic	NA	NA	NA		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96JZ4|Q96KY7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000295770.2	37	NULL	CCDS2650.1	3																																																																																			-	-		0.738	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	protein_coding	OTTHUMT00000253166.2	-	NM_178862			31574394	+1	no_errors	ENST00000453168	ensembl	human	known	74_37	rna	INS	0.007:0.977	TACTCC
ULK4P3	89837	genome.wustl.edu	37	15	30396080	30396080	+	RNA	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:30396080C>A	ENST00000568486.1	+	0	146					NR_026859.1				ULK4 pseudogene 3																		GCTCCTTTTCCGCGCCCCTCC	0.682																																																	0								ENSG00000178081																																			ULK4P3			0			-	HGNC	BC023564		15q13.2	2014-03-20	2013-09-12	2011-11-25	ENSG00000178081	ENSG00000178081			15777	pseudogene	pseudogene			"""family with sequence similarity 7, member A3"", ""unc-51-like kinase 4 (C. elegans) pseudogene 3"""	FAM7A3		11829490	Standard	NR_026859		Approved	D-X	uc001zdk.3		OTTHUMG00000175637		15.37:g.30396080C>A		Somatic	1	326	0.31		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	209	13.88		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000568486.1	37	NULL		15																																																																																			-	-		0.682	ULK4P3-002	PUTATIVE	basic	processed_transcript	ULK4P3	pseudogene	OTTHUMT00000430688.1	C		-		30396080	+1	no_errors	ENST00000565158	ensembl	human	putative	74_37	rna	SNP	0.062	A
FLOT2	2319	genome.wustl.edu	37	17	27207228	27207228	+	3'UTR	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:27207228G>C	ENST00000394908.4	-	0	1742				FLOT2_ENST00000577789.1_5'UTR|FLOT2_ENST00000394906.2_3'UTR|FLOT2_ENST00000585169.1_3'UTR	NM_004475.2	NP_004466.2	Q14254	FLOT2_HUMAN	flotillin 2						cell adhesion (GO:0007155)|epidermis development (GO:0008544)|establishment of protein localization to plasma membrane (GO:0090002)|negative regulation of amyloid precursor protein catabolic process (GO:1902992)|negative regulation of gene expression (GO:0010629)|protein stabilization (GO:0050821)	acrosomal membrane (GO:0002080)|caveola (GO:0005901)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|flotillin complex (GO:0016600)|focal adhesion (GO:0005925)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				endometrium(3)|lung(6)|prostate(1)|urinary_tract(1)	11	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;3.26e-06)|all cancers(11;1.76e-05)|BRCA - Breast invasive adenocarcinoma(11;0.00015)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			AGGATTCTGAGGAGCAGCAGG	0.517																																																	0								ENSG00000132589																																			FLOT2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	M60922	CCDS11245.2	17q11-q12	2008-07-18			ENSG00000132589	ENSG00000132589			3758	protein-coding gene	gene with protein product	"""Flotillin 2 (epidermal surface antigen 1)"", ""membrane component, chromosome 17, surface marker 1 (35kD protein identified by monoclonal antibody ECS-1)"""	131560		M17S1		1769667	Standard	XM_005257950		Approved	ESA, ESA1, ECS-1, ECS1	uc002hdc.3	Q14254	OTTHUMG00000132674	ENST00000394908.4:c.*351C>G	17.37:g.27207228G>C		Somatic	0	36	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000394908.4	37	NULL	CCDS11245.2	17																																																																																			-	-		0.517	FLOT2-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	FLOT2	protein_coding	OTTHUMT00000255935.3	G	NM_004475	-		27207228	-1	no_errors	ENST00000577789	ensembl	human	known	74_37	rna	SNP	0.991	C
TMEM44	93109	genome.wustl.edu	37	3	194353772	194353773	+	Intron	INS	-	-	CCGCCCGACAG	rs11273892|rs78196807	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:194353772_194353773insCCGCCCGACAG	ENST00000392432.2	-	1	343				TMEM44_ENST00000330115.3_Intron|TMEM44_ENST00000347147.4_Intron|AC046143.3_ENST00000447139.1_RNA|TMEM44_ENST00000273580.7_Intron|TMEM44_ENST00000473092.1_Intron|TMEM44_ENST00000381975.3_Intron	NM_001166305.1	NP_001159777.1	Q2T9K0	TMM44_HUMAN	transmembrane protein 44							integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|urinary_tract(1)	8	all_cancers(143;1.41e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;9.06e-06)		CGCCCGTTTCCCCGCCCGACAG	0.653														3578	0.714457	0.7632	0.621	5008	,	,		10280	0.6905		0.7674	False		,,,				2504	0.6851																0								ENSG00000229334		,,,	2118,906		906,306,300					,,,	2.1	0.0		dbSNP_120	6	4108,1674		1774,560,557	no	intron,intron,intron,intron	TMEM44	NM_138399.4,NM_001166306.1,NM_001166305.1,NM_001011655.2	,,,	2680,866,857	A1A1,A1R,RR		28.9519,29.9603,29.2982	,,,	,,,		6226,2580				AC046143.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	AL833026	CCDS3308.1, CCDS33921.1, CCDS3308.2, CCDS54698.1, CCDS54699.1	3q29	2005-08-16			ENSG00000145014	ENSG00000145014			25120	protein-coding gene	gene with protein product							Standard	NM_138399		Approved	DKFZp686O18124	uc010hzn.3	Q2T9K0	OTTHUMG00000156023	ENST00000392432.2:c.137+34->CTGTCGGGCGG	3.37:g.194353773_194353783dupCCGCCCGACAG		Somatic	NA	NA	NA		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L3V7|B7ZLZ5|B7ZLZ6|C9JJ62|E9PGA9|Q0P6F7|Q6ZT47|Q8IXR1|Q8N4G3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392432.2	37	NULL	CCDS54699.1	3																																																																																			-	-		0.653	TMEM44-002	KNOWN	basic|CCDS	protein_coding	ENSG00000229334	protein_coding	OTTHUMT00000342750.1	-	NM_138399			194353773	+1	no_errors	ENST00000447139	ensembl	human	known	74_37	rna	INS	0.030:0.049	CCGCCCGACAG
P2RX7	5027	genome.wustl.edu	37	12	121605337	121605337	+	Missense_Mutation	SNP	G	G	A	rs149639375	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:121605337G>A	ENST00000546057.1	+	8	934	c.791G>A	c.(790-792)cGt>cAt	p.R264H	P2RX7_ENST00000535250.1_Missense_Mutation_p.R174H|P2RX7_ENST00000541446.1_Intron|P2RX7_ENST00000443520.3_3'UTR|P2RX7_ENST00000328963.5_Missense_Mutation_p.R94H|P2RX7_ENST00000377162.2_Intron	NM_002562.5	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 7	264					apoptotic signaling pathway (GO:0097190)|bleb assembly (GO:0032060)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|membrane depolarization (GO:0051899)|negative regulation of bone resorption (GO:0045779)|negative regulation of MAPK cascade (GO:0043409)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|pore complex assembly (GO:0046931)|positive regulation of bone mineralization (GO:0030501)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cytolysis (GO:0045919)|positive regulation of cytoskeleton organization (GO:0051495)|positive regulation of interleukin-1 beta secretion (GO:0050718)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of killing of cells of other organism (GO:0051709)|regulation of sodium ion transport (GO:0002028)|response to ATP (GO:0033198)|sensory perception of pain (GO:0019233)	bleb (GO:0032059)|cytoplasm (GO:0005737)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|lipopolysaccharide binding (GO:0001530)|protein homodimerization activity (GO:0042803)|purinergic nucleotide receptor activity (GO:0001614)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|stomach(1)	19	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AACCTAGACCGTTGGTTCCAT	0.517																																																	0								ENSG00000089041	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	226.0	168.0	188.0		791	-2.3	0.0	12	dbSNP_134	188	4,8596	3.7+/-12.6	0,4,4296	yes	missense	P2RX7	NM_002562.5	29	0,5,6498	AA,AG,GG		0.0465,0.0227,0.0384	possibly-damaging	264/596	121605337	5,13001	2203	4300	6503	P2RX7	SO:0001583	missense	0			-	HGNC	Y09561	CCDS9213.1	12q24	2012-01-17			ENSG00000089041	ENSG00000089041		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8537	protein-coding gene	gene with protein product		602566				9038151, 9826911	Standard	NM_002562		Approved	P2X7, MGC20089	uc001tzm.3	Q99572	OTTHUMG00000169153	ENST00000546057.1:c.791G>A	12.37:g.121605337G>A	ENSP00000442349:p.Arg264His	Somatic	0	62	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39	A8K2Z0|E7EMK6|F5H6P2|F5H7E8|F8W951|O14991|Q4VKH8|Q4VKH9|Q4VKI0|Q4VKI1|Q4VKI2|Q4VKI3|Q4VKI4|Q7Z771|Q96EV7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_P2X_purnocptor,prints_P2X7_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.R264H	ENST00000546057.1	37	c.791	CCDS9213.1	12	.	.	.	.	.	.	.	.	.	.	G	12.93	2.086178	0.36855	2.27E-4	4.65E-4	ENSG00000089041	ENST00000546057;ENST00000328963;ENST00000535250	T;T;T	0.04454	3.62;3.62;3.62	6.04	-2.31	0.06765	.	1.250830	0.05304	N	0.523450	T	0.09202	0.0227	L	0.50333	1.59	0.09310	N	1	P;D;P	0.54397	0.928;0.966;0.952	B;P;P	0.51833	0.347;0.553;0.681	T	0.41822	-0.9487	10	0.30078	T	0.28	.	8.67	0.34145	0.2517:0.3609:0.3874:0.0	.	94;174;264	F8W951;F5H7E8;Q99572	.;.;P2RX7_HUMAN	H	264;94;174	ENSP00000442349:R264H;ENSP00000330696:R94H;ENSP00000442572:R174H	ENSP00000330696:R94H	R	+	2	0	P2RX7	120089720	0.000000	0.05858	0.002000	0.10522	0.720000	0.41350	0.138000	0.16016	-0.291000	0.09012	0.563000	0.77884	CGT	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor		0.517	P2RX7-008	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX7	protein_coding	OTTHUMT00000402532.1	G	NM_002562	rs149639375		121605337	+1	no_errors	ENST00000546057	ensembl	human	known	74_37	missense	SNP	0.000	A
MARCH1	55016	genome.wustl.edu	37	4	164533818	164533818	+	Intron	SNP	G	G	A	rs575707342	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:164533818G>A	ENST00000503008.1	-	5	1219				MARCH1_ENST00000514618.1_Silent_p.N205N|MARCH1_ENST00000274056.7_Intron|MARCH1_ENST00000339875.5_Intron	NM_001166373.1	NP_001159845.1	Q8TCQ1	MARH1_HUMAN	membrane-associated ring finger (C3HC4) 1, E3 ubiquitin protein ligase						antigen processing and presentation of peptide antigen via MHC class II (GO:0002495)|immune response (GO:0006955)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	ligase activity (GO:0016874)|MHC protein binding (GO:0042287)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|lung(20)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	36	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GCTCAATTCCGTTAGGAGTGG	0.413													G|||	2	0.000399361	0.0	0.0014	5008	,	,		18531	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000145416																																			MARCH1	SO:0001627	intron_variant	0			-	HGNC	AK000675	CCDS3806.1, CCDS54814.1	4q32.2	2013-01-09	2012-02-23			ENSG00000145416		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	26077	protein-coding gene	gene with protein product		613331	"""membrane-associated ring finger (C3HC4) 1"""			14722266	Standard	NM_017923		Approved	FLJ20668, MARCH-I, RNF171	uc003iqs.2	Q8TCQ1		ENST00000503008.1:c.242+647C>T	4.37:g.164533818G>A		Somatic	0	55	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	47	18.64	D3DP29|Q9NWR0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.N205	ENST00000503008.1	37	c.615	CCDS54814.1	4																																																																																			-	NULL		0.413	MARCH1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH1	protein_coding	OTTHUMT00000364493.2	G	NM_017923	-		164533818	-1	no_errors	ENST00000514618	ensembl	human	novel	74_37	silent	SNP	0.000	A
CRYBA4	1413	genome.wustl.edu	37	22	27026429	27026429	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr22:27026429G>T	ENST00000354760.3	+	6	604	c.569G>T	c.(568-570)aGc>aTc	p.S190I	CRYBA4_ENST00000466315.1_3'UTR	NM_001886.2	NP_001877.1	P53673	CRBA4_HUMAN	crystallin, beta A4	190	Beta/gamma crystallin 'Greek key' 4. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)		structural constituent of eye lens (GO:0005212)			large_intestine(6)|liver(1)|lung(6)|skin(3)|urinary_tract(2)	18						CAGGTGCAGAGCATCCGCAGG	0.582																																																	0								ENSG00000196431						50.0	45.0	47.0					22																	27026429		2203	4300	6503	CRYBA4	SO:0001583	missense	0			-	HGNC		CCDS13841.1	22q12.1	2008-06-10			ENSG00000196431	ENSG00000196431			2396	protein-coding gene	gene with protein product		123631				8999933, 960806	Standard	NM_001886		Approved		uc003acz.4	P53673	OTTHUMG00000150983	ENST00000354760.3:c.569G>T	22.37:g.27026429G>T	ENSP00000346805:p.Ser190Ile	Somatic	0	65	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	42	17.65	Q4VB22|Q6ICE4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.S190I	ENST00000354760.3	37	c.569	CCDS13841.1	22	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569729	0.65765	.	.	ENSG00000196431	ENST00000354760	D	0.91521	-2.86	4.42	3.34	0.38264	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.119374	0.56097	D	0.000028	D	0.96996	0.9019	H	0.99104	4.43	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.96576	0.9427	10	0.87932	D	0	.	10.1525	0.42803	0.0:0.3257:0.6743:0.0	.	190	P53673	CRBA4_HUMAN	I	190	ENSP00000346805:S190I	ENSP00000346805:S190I	S	+	2	0	CRYBA4	25356429	1.000000	0.71417	0.926000	0.36857	0.347000	0.29111	5.456000	0.66665	2.299000	0.77371	0.555000	0.69702	AGC	-	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin		0.582	CRYBA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYBA4	protein_coding	OTTHUMT00000320793.1	G	NM_001886	-		27026429	+1	no_errors	ENST00000354760	ensembl	human	known	74_37	missense	SNP	0.995	T
USP13	8975	genome.wustl.edu	37	3	179424851	179424851	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:179424851A>G	ENST00000263966.3	+	5	1078	c.607A>G	c.(607-609)Agg>Ggg	p.R203G	USP13_ENST00000496897.1_Missense_Mutation_p.R138G|USP13_ENST00000482333.1_3'UTR	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)	203					autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			CAATGGAGTCAGGATTCCTCC	0.413																																																	0								ENSG00000058056						93.0	82.0	86.0					3																	179424851		2203	4300	6503	USP13	SO:0001583	missense	0			-	HGNC	U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.607A>G	3.37:g.179424851A>G	ENSP00000263966:p.Arg203Gly	Somatic	0	28	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A8K2S3|B4DYF3|D3DNS2|Q96B25	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_UBA/Ts_N,pfam_Znf_UBP,superfamily_UBA-like,smart_Znf_UBP,smart_UBA/transl_elong_EF1B_N_euk,pirsf_Ubiquitinyl_hydrolase,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.R203G	ENST00000263966.3	37	c.607	CCDS3235.1	3	.	.	.	.	.	.	.	.	.	.	A	12.86	2.064027	0.36373	.	.	ENSG00000058056	ENST00000263966;ENST00000496897	T;T	0.29655	1.56;1.56	5.96	2.06	0.26882	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.39655	0.1086	M	0.81497	2.545	0.51767	D	0.999932	P;P	0.40476	0.602;0.718	B;B	0.43623	0.243;0.425	T	0.26643	-1.0097	10	0.29301	T	0.29	-19.7968	13.5396	0.61666	0.6298:0.3702:0.0:0.0	.	203;203	Q92995;A8K2S3	UBP13_HUMAN;.	G	203;138	ENSP00000263966:R203G;ENSP00000417146:R138G	ENSP00000263966:R203G	R	+	1	2	USP13	180907545	1.000000	0.71417	1.000000	0.80357	0.585000	0.36419	1.759000	0.38420	0.100000	0.17581	-0.323000	0.08544	AGG	-	pirsf_Ubiquitinyl_hydrolase		0.413	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP13	protein_coding	OTTHUMT00000349617.1	A		-		179424851	+1	no_errors	ENST00000263966	ensembl	human	known	74_37	missense	SNP	1.000	G
LAMC2	3918	genome.wustl.edu	37	1	183212350	183212350	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:183212350C>T	ENST00000264144.4	+	23	3462	c.3397C>T	c.(3397-3399)Cag>Tag	p.Q1133*		NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	1133	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						AGCCAAGACCCAGATCAACAG	0.522																																																	0								ENSG00000058085						78.0	77.0	77.0					1																	183212350		2203	4300	6503	LAMC2	SO:0001587	stop_gained	0			-	HGNC	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.3397C>T	1.37:g.183212350C>T	ENSP00000264144:p.Gln1133*	Somatic	0	37	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	40	29.82	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_B_type_IV,superfamily_Growth_fac_rcpt_N_dom,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin	p.Q1133*	ENST00000264144.4	37	c.3397	CCDS1352.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	40|40	8.129043|8.129043	0.98667|0.98667	.|.	.|.	ENSG00000058085|ENSG00000058085	ENST00000537180|ENST00000264144	.|.	.|.	.|.	5.02|5.02	3.98|3.98	0.46160|0.46160	.|.	.|0.363187	.|0.25925	.|N	.|0.027409	T|.	0.56352|.	0.1979|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.48502|.	-0.9030|.	5|.	0.54805|0.21014	T|T	0.06|0.42	.|.	12.5752|12.5752	0.56359|0.56359	0.2507:0.7493:0.0:0.0|0.2507:0.7493:0.0:0.0	.|.	.|.	.|.	.|.	L|X	975|1133	.|.	ENSP00000438496:P975L|ENSP00000264144:Q1133X	P|Q	+|+	2|1	0|0	LAMC2|LAMC2	181478973|181478973	0.392000|0.392000	0.25229|0.25229	0.991000|0.991000	0.47740|0.47740	0.807000|0.807000	0.45602|0.45602	1.012000|1.012000	0.29924|0.29924	2.479000|2.479000	0.83701|0.83701	0.650000|0.650000	0.86243|0.86243	CCA|CAG	-	NULL		0.522	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC2	protein_coding	OTTHUMT00000086258.1	C	NM_005562	-		183212350	+1	no_errors	ENST00000264144	ensembl	human	known	74_37	nonsense	SNP	0.346	T
ARAP1	116985	genome.wustl.edu	37	11	72404505	72404505	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:72404505G>A	ENST00000393609.3	-	29	4021	c.3819C>T	c.(3817-3819)gtC>gtT	p.V1273V	ARAP1_ENST00000429686.1_Silent_p.V967V|ARAP1_ENST00000426523.1_Silent_p.V1028V|ARAP1-AS1_ENST00000542022.1_RNA|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000334211.8_Silent_p.V1028V|ARAP1_ENST00000393605.3_Silent_p.V1033V|ARAP1_ENST00000359373.5_Silent_p.V1273V|ARAP1_ENST00000455638.2_Silent_p.V1273V	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	1273					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TGGTGTCACCGACACGGCTGG	0.657																																					Ovarian(102;1198 1520 13195 17913 37529)												0								ENSG00000186635						80.0	75.0	77.0					11																	72404505		2200	4293	6493	ARAP1	SO:0001819	synonymous_variant	0			-	HGNC	AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.3819C>T	11.37:g.72404505G>A		Somatic	0	72	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	40	21.57	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_Ras-assoc,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.V1273	ENST00000393609.3	37	c.3819	CCDS41687.1	11																																																																																			-	NULL		0.657	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARAP1	protein_coding	OTTHUMT00000347428.1	G	NM_001040118	-		72404505	-1	no_errors	ENST00000393609	ensembl	human	known	74_37	silent	SNP	0.993	A
ZNF724P	440519	genome.wustl.edu	37	19	23406130	23406130	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr19:23406130C>A	ENST00000418100.1	-	4	1034	c.917G>T	c.(916-918)gGa>gTa	p.G306V				A8MTY0	ZN724_HUMAN	zinc finger protein 724, pseudogene	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G306A(2)		endometrium(3)|kidney(1)|lung(2)|ovary(2)	8						GGGCTTCTCTCCAGCATGAAT	0.353																																																	2	Substitution - Missense(2)	kidney(2)						ENSG00000196081																																			ZNF724P	SO:0001583	missense	0			-	HGNC			19p12	2014-02-14	2010-08-03		ENSG00000196081	ENSG00000196081			32460	pseudogene	pseudogene			"""zinc finger protein 724 pseudogene"", ""zinc finger protein 724 (pseudogene)"""				Standard	NR_045525		Approved		uc021uru.1	A8MTY0	OTTHUMG00000183231	ENST00000418100.1:c.917G>T	19.37:g.23406130C>A	ENSP00000413411:p.Gly306Val	Somatic	0	42	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G306V	ENST00000418100.1	37	c.917		19	.	.	.	.	.	.	.	.	.	.	C	12.83	2.055245	0.36277	.	.	ENSG00000196081	ENST00000418100	T	0.23552	1.9	1.07	1.07	0.20283	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44498	0.1296	.	.	.	0.58432	D	0.999994	D	0.71674	0.998	D	0.67382	0.951	T	0.40905	-0.9538	8	0.72032	D	0.01	.	8.9477	0.35769	0.0:1.0:0.0:0.0	.	306	A8MTY0	ZN724_HUMAN	V	306	ENSP00000413411:G306V	ENSP00000413411:G306V	G	-	2	0	ZNF724P	23197970	0.475000	0.25894	0.178000	0.23040	0.166000	0.22503	1.372000	0.34261	0.475000	0.27415	0.478000	0.44815	GGA	-	pfscan_Znf_C2H2		0.353	ZNF724P-001	NOVEL	basic|appris_principal	protein_coding	ZNF724P	protein_coding	OTTHUMT00000465743.1	C		-		23406130	-1	no_errors	ENST00000418100	ensembl	human	novel	74_37	missense	SNP	1.000	A
TRIM46	80128	genome.wustl.edu	37	1	155147426	155147426	+	Intron	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:155147426G>T	ENST00000334634.4	+	2	63				TRIM46_ENST00000368385.4_Intron|TRIM46_ENST00000392451.2_Intron|TRIM46_ENST00000543729.1_Intron|TRIM46_ENST00000545012.1_Intron|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368382.1_Intron|KRTCAP2_ENST00000295682.4_5'Flank|TRIM46_ENST00000468878.1_3'UTR|TRIM46_ENST00000368383.3_Intron|KRTCAP2_ENST00000490672.1_5'Flank	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46							intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			ACCTCGCCTGGCTATCGGGAG	0.627																																																	0								ENSG00000163462																																			TRIM46	SO:0001627	intron_variant	0			-	HGNC		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.64-436G>T	1.37:g.155147426G>T		Somatic	0	37	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	36	21.74	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000334634.4	37	NULL	CCDS1097.1	1																																																																																			-	-		0.627	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	protein_coding	OTTHUMT00000086728.1	G	NM_025058	-		155147426	+1	no_errors	ENST00000468878	ensembl	human	known	74_37	rna	SNP	0.000	T
RARB	5915	genome.wustl.edu	37	3	25636129	25636129	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:25636129C>G	ENST00000404969.1	+	7	1131	c.1131C>G	c.(1129-1131)atC>atG	p.I377M	RARB_ENST00000437042.2_Missense_Mutation_p.I258M|RARB_ENST00000330688.4_Missense_Mutation_p.I370M|RARB_ENST00000462272.1_3'UTR|RARB_ENST00000458646.1_Missense_Mutation_p.I258M			P10826	RARB_HUMAN	retinoic acid receptor, beta	377	Ligand-binding.				embryonic digestive tract development (GO:0048566)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage development (GO:0003417)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of myelination (GO:0031641)|retinal pigment epithelium development (GO:0003406)|signal transduction (GO:0007165)|striatum development (GO:0021756)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ureteric bud development (GO:0001657)|ventricular cardiac muscle cell differentiation (GO:0055012)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(3)|kidney(1)|large_intestine(10)|lung(11)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	28					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TTCCAAAGATCTTAATGAAAA	0.418																																																	0								ENSG00000077092						119.0	113.0	115.0					3																	25636129		2203	4300	6503	RARB	SO:0001583	missense	0			-	HGNC	Y00291	CCDS2642.1, CCDS46775.1	3p24	2013-01-16			ENSG00000077092	ENSG00000077092		"""Nuclear hormone receptors"""	9865	protein-coding gene	gene with protein product		180220					Standard	NM_016152		Approved	HAP, NR1B2, RRB2	uc003cdh.3	P10826	OTTHUMG00000130480	ENST00000404969.1:c.1131C>G	3.37:g.25636129C>G	ENSP00000385865:p.Ile377Met	Somatic	0	43	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	29	38.78	P12891|Q00989|Q15298|Q9UN48	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Nuc_orph_rcpt,prints_Retinoid-X_rcpt/HNF4	p.I377M	ENST00000404969.1	37	c.1131		3	.	.	.	.	.	.	.	.	.	.	C	1.932	-0.445682	0.04604	.	.	ENSG00000077092	ENST00000383772;ENST00000404969;ENST00000538226;ENST00000437042;ENST00000330688;ENST00000458646	T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.14	5.13	5.13	0.70059	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.051494	0.85682	D	0.000000	T	0.17874	0.0429	N	0.04116	-0.275	0.44611	D	0.997588	B;B	0.09022	0.002;0.001	B;B	0.24701	0.055;0.038	T	0.12477	-1.0546	10	0.11182	T	0.66	.	12.3238	0.54999	0.0:0.9221:0.0:0.0779	.	377;370	P10826;F1D8S6	RARB_HUMAN;.	M	377;377;377;258;370;258	ENSP00000373282:I377M;ENSP00000385865:I377M;ENSP00000398840:I258M;ENSP00000332296:I370M;ENSP00000391391:I258M	ENSP00000332296:I370M	I	+	3	3	RARB	25611133	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.811000	0.27198	2.558000	0.86282	0.591000	0.81541	ATC	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Nuc_orph_rcpt		0.418	RARB-201	KNOWN	basic	protein_coding	RARB	protein_coding		C	NM_000965, NM_016152	-		25636129	+1	no_errors	ENST00000404969	ensembl	human	known	74_37	missense	SNP	1.000	G
SLC10A7	84068	genome.wustl.edu	37	4	147227160	147227160	+	Splice_Site	SNP	A	A	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:147227160A>G	ENST00000507030.1	-	7	472	c.473T>C	c.(472-474)cTt>cCt	p.L158P	SLC10A7_ENST00000394062.3_Splice_Site_p.L158P|SLC10A7_ENST00000335472.7_Splice_Site_p.L158P|SLC10A7_ENST00000432059.2_Splice_Site_p.L145P|SLC10A7_ENST00000264986.3_3'UTR			Q0GE19	NTCP7_HUMAN	solute carrier family 10, member 7	158					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(3)|lung(8)|skin(1)	16	all_hematologic(180;0.151)					AGATGAACCAAGCTGTAAAAC	0.348																																																	0								ENSG00000120519						70.0	66.0	67.0					4																	147227160		2203	4300	6503	SLC10A7	SO:0001630	splice_region_variant	0			-	HGNC	AY346324	CCDS3768.1, CCDS34073.1, CCDS75198.1	4q31.2	2013-07-18	2013-07-18	2006-12-19	ENSG00000120519	ENSG00000120519		"""Solute carriers"""	23088	protein-coding gene	gene with protein product		611459	"""chromosome 4 open reading frame 13"""	C4orf13		15932064	Standard	NM_032128		Approved	MGC25043, DKFZp566M114, DKFZp313H0531, DKFZp779O2438	uc003ikr.2	Q0GE19	OTTHUMG00000161437	ENST00000507030.1:c.472-1T>C	4.37:g.147227160A>G		Somatic	0	42	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A7E2E6|A7MAX9|Q0VAP9|Q45NG1|Q45NG2|Q5H9S6|Q6P4E6|Q8IZ62|Q8NBP8|Q9H0M9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BilAc/Na_symport,pirsf_Put_Na-Bile_cotransptr	p.L158P	ENST00000507030.1	37	c.473	CCDS34073.1	4	.	.	.	.	.	.	.	.	.	.	A	22.4	4.278792	0.80692	.	.	ENSG00000120519	ENST00000432059;ENST00000335472;ENST00000507030;ENST00000394062	.	.	.	5.95	5.95	0.96441	.	0.057870	0.64402	D	0.000001	D	0.83755	0.5323	M	0.85197	2.74	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77004	0.982;0.989;0.974	D	0.86385	0.1732	9	0.87932	D	0	-17.4096	16.4237	0.83790	1.0:0.0:0.0:0.0	.	145;158;158	Q0GE19-3;Q0GE19;Q0GE19-2	.;NTCP7_HUMAN;.	P	145;158;158;158	.	ENSP00000334594:L158P	L	-	2	0	SLC10A7	147446610	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.842000	0.86851	2.279000	0.76181	0.533000	0.62120	CTT	-	pfam_BilAc/Na_symport,pirsf_Put_Na-Bile_cotransptr		0.348	SLC10A7-009	KNOWN	basic|CCDS	protein_coding	SLC10A7	protein_coding	OTTHUMT00000366932.1	A	NM_032128	-	Missense_Mutation	147227160	-1	no_errors	ENST00000394062	ensembl	human	known	74_37	missense	SNP	1.000	G
KIF3B	9371	genome.wustl.edu	37	20	30917948	30917948	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr20:30917948A>G	ENST00000375712.3	+	8	2140	c.1973A>G	c.(1972-1974)gAa>gGa	p.E658G	KIF3B_ENST00000418717.2_Missense_Mutation_p.E284G	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	658	Globular.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CTGCAGGCAGAAAACATTGTG	0.552																																																	0								ENSG00000101350						50.0	46.0	47.0					20																	30917948		2203	4300	6503	KIF3B	SO:0001583	missense	0			-	HGNC	AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.1973A>G	20.37:g.30917948A>G	ENSP00000364864:p.Glu658Gly	Somatic	0	55	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	56	9.68	B2RMP4|B4DSR5|E1P5M5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E658G	ENST00000375712.3	37	c.1973	CCDS13200.1	20	.	.	.	.	.	.	.	.	.	.	A	25.2	4.614297	0.87359	.	.	ENSG00000101350	ENST00000375712;ENST00000418717	T;T	0.78126	-1.15;0.0	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.87569	0.6210	M	0.85777	2.775	0.80722	D	1	D;D	0.64830	0.969;0.994	P;P	0.62813	0.785;0.907	D	0.89294	0.3621	10	0.56958	D	0.05	.	14.5009	0.67722	1.0:0.0:0.0:0.0	.	284;658	B4DSR5;O15066	.;KIF3B_HUMAN	G	658;284	ENSP00000364864:E658G;ENSP00000406287:E284G	ENSP00000364864:E658G	E	+	2	0	KIF3B	30381609	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.609000	0.90898	2.069000	0.61940	0.533000	0.62120	GAA	-	NULL		0.552	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	protein_coding	OTTHUMT00000078619.1	A	NM_004798	-		30917948	+1	no_errors	ENST00000375712	ensembl	human	known	74_37	missense	SNP	1.000	G
ACSL6	23305	genome.wustl.edu	37	5	131298244	131298244	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:131298244T>C	ENST00000379240.1	-	18	1919	c.1766A>G	c.(1765-1767)cAt>cGt	p.H589R	ACSL6_ENST00000379264.2_Missense_Mutation_p.H614R|ACSL6_ENST00000379272.2_Missense_Mutation_p.H604R|AC034228.4_ENST00000446275.1_RNA|ACSL6_ENST00000296869.4_Missense_Mutation_p.H614R|ACSL6_ENST00000379249.3_Missense_Mutation_p.H589R|ACSL6_ENST00000357096.1_Missense_Mutation_p.H514R|ACSL6_ENST00000379255.1_Missense_Mutation_p.H514R|ACSL6_ENST00000543479.1_Missense_Mutation_p.H589R|ACSL6_ENST00000431707.1_Missense_Mutation_p.H569R|ACSL6_ENST00000379246.1_Missense_Mutation_p.H600R|ACSL6_ENST00000544770.1_Missense_Mutation_p.H498R|ACSL6_ENST00000379244.1_Missense_Mutation_p.H589R			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	589					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCTGTCCCCATGGACATAGAT	0.468																																																	0								ENSG00000164398						82.0	77.0	79.0					5																	131298244		2203	4300	6503	ACSL6	SO:0001583	missense	0			-	HGNC	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1766A>G	5.37:g.131298244T>C	ENSP00000368542:p.His589Arg	Somatic	0	27	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	11.63	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.H614R	ENST00000379240.1	37	c.1841		5	.	.	.	.	.	.	.	.	.	.	T	22.1	4.246085	0.80024	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479	T;T;T;T;T;T;T;T;T;T;T;T	0.17691	2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26;2.26	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.57359	0.2048	H	0.96576	3.845	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.995;0.992;0.999;0.995;0.997;0.995	D;D;P;D;D;D;D	0.79784	0.993;0.962;0.899;0.984;0.962;0.975;0.962	T	0.73512	-0.3959	10	0.87932	D	0	.	15.7884	0.78326	0.0:0.0:0.0:1.0	.	589;604;579;589;514;614;614	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	R	589;614;604;514;514;614;600;589;498;589;569;589	ENSP00000368551:H589R;ENSP00000368566:H614R;ENSP00000368574:H604R;ENSP00000349608:H514R;ENSP00000368557:H514R;ENSP00000296869:H614R;ENSP00000368548:H600R;ENSP00000368546:H589R;ENSP00000445154:H498R;ENSP00000368542:H589R;ENSP00000413329:H569R;ENSP00000442124:H589R	ENSP00000296869:H614R	H	-	2	0	ACSL6	131326143	1.000000	0.71417	0.990000	0.47175	0.832000	0.47134	7.953000	0.87836	2.144000	0.66660	0.459000	0.35465	CAT	-	NULL		0.468	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	ACSL6	protein_coding	OTTHUMT00000132622.1	T	NM_015256	-		131298244	-1	no_errors	ENST00000296869	ensembl	human	known	74_37	missense	SNP	1.000	C
TSPEAR	54084	genome.wustl.edu	37	21	45929222	45929222	+	Silent	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr21:45929222G>T	ENST00000323084.4	-	10	1679	c.1614C>A	c.(1612-1614)atC>atA	p.I538I	TSPEAR-AS1_ENST00000430181.1_RNA|TSPEAR-AS1_ENST00000451035.1_RNA|TSPEAR_ENST00000397916.1_Silent_p.I470I	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	538					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						CAGCGAGGAAGATCCTCTCCC	0.567																																																	0								ENSG00000175894						170.0	111.0	131.0					21																	45929222		2203	4300	6503	TSPEAR	SO:0001819	synonymous_variant	0			-	HGNC	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1614C>A	21.37:g.45929222G>T		Somatic	0	31	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EPTP,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_EAR	p.I538	ENST00000323084.4	37	c.1614	CCDS13712.1	21																																																																																			-	pfam_EPTP,pfscan_EAR		0.567	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	protein_coding	OTTHUMT00000098761.1	G	NM_144991	-		45929222	-1	no_errors	ENST00000323084	ensembl	human	known	74_37	silent	SNP	0.867	T
ZFR	51663	genome.wustl.edu	37	5	32379260	32379260	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:32379260G>A	ENST00000265069.8	-	17	2898	c.2796C>T	c.(2794-2796)ctC>ctT	p.L932L	ZFR_ENST00000510369.1_5'UTR|AC008949.1_ENST00000411029.1_RNA	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	932	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		CTCGCTGACAGAGGTCTCGAA	0.388																																																	0								ENSG00000056097						81.0	78.0	79.0					5																	32379260		2203	4300	6503	ZFR	SO:0001819	synonymous_variant	0			-	HGNC	AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2796C>T	5.37:g.32379260G>A		Somatic	0	21	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.L932	ENST00000265069.8	37	c.2796	CCDS34139.1	5																																																																																			-	pfam_DZF,smart_DZF		0.388	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	protein_coding	OTTHUMT00000366586.1	G		-		32379260	-1	no_errors	ENST00000265069	ensembl	human	known	74_37	silent	SNP	0.993	A
MAGEL2	54551	genome.wustl.edu	37	15	23890932	23890932	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:23890932G>C	ENST00000532292.1	-	1	243	c.149C>G	c.(148-150)cCg>cGg	p.P50R		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	0					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		TTGGGAGGGCGGGGCTCCCTG	0.692																																																	0								ENSG00000254585						5.0	6.0	6.0					15																	23890932		1773	3915	5688	MAGEL2	SO:0001583	missense	0			-	HGNC	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.149C>G	15.37:g.23890932G>C	ENSP00000433433:p.Pro50Arg	Somatic	0	46	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	24	25.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.P50R	ENST00000532292.1	37	c.149		15	.	.	.	.	.	.	.	.	.	.	G	3.706	-0.060633	0.07317	.	.	ENSG00000254585	ENST00000532292	.	.	.	3.43	0.294	0.15747	.	.	.	.	.	T	0.32971	0.0847	L	0.40543	1.245	0.09310	N	1	.	.	.	.	.	.	T	0.27020	-1.0086	5	.	.	.	.	5.5434	0.17051	0.1042:0.0:0.5683:0.3276	.	.	.	.	G	82	.	.	R	-	1	0	MAGEL2	21442025	0.000000	0.05858	0.003000	0.11579	0.218000	0.24690	-0.471000	0.06631	0.063000	0.16370	0.197000	0.17608	CGC	-	NULL		0.692	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	protein_coding	OTTHUMT00000395182.2	G	NM_019066	-		23890932	-1	no_errors	ENST00000532292	ensembl	human	known	74_37	missense	SNP	0.068	C
SRCIN1	80725	genome.wustl.edu	37	17	36700164	36700164	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:36700164G>A	ENST00000264659.7	-	18	3535	c.3311C>T	c.(3310-3312)cCg>cTg	p.P1104L	SRCIN1_ENST00000578925.1_Missense_Mutation_p.P1138L|SRCIN1_ENST00000398579.4_5'UTR	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	976					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						AGAGGCCCCCGGAGTCACCAC	0.627																																																	0								ENSG00000017373						20.0	24.0	22.0					17																	36700164		2166	4262	6428	SRCIN1	SO:0001583	missense	0			-	HGNC		CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.3311C>T	17.37:g.36700164G>A	ENSP00000264659:p.Pro1104Leu	Somatic	0	137	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	101	29.86	Q75T46|Q8N4W8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AIP3_C	p.P1104L	ENST00000264659.7	37	c.3311	CCDS45660.1	17	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495434	0.64186	.	.	ENSG00000017373	ENST00000264659;ENST00000542707;ENST00000398579	T	0.49720	0.77	5.23	4.25	0.50352	.	0.070532	0.64402	D	0.000016	T	0.42177	0.1191	L	0.44542	1.39	0.51012	D	0.999901	D;D;P	0.57257	0.979;0.958;0.905	B;B;B	0.42995	0.404;0.266;0.194	T	0.44967	-0.9293	10	0.72032	D	0.01	-8.4047	13.0983	0.59206	0.0803:0.0:0.9197:0.0	.	976;976;1104	Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;SRCN1_HUMAN;.	L	1104;885;999	ENSP00000264659:P1104L	ENSP00000264659:P1104L	P	-	2	0	SRCIN1	33953690	1.000000	0.71417	0.901000	0.35422	0.981000	0.71138	4.143000	0.58051	1.179000	0.42884	0.462000	0.41574	CCG	-	NULL		0.627	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRCIN1	protein_coding	OTTHUMT00000441878.4	G	NM_025248	-		36700164	-1	no_errors	ENST00000264659	ensembl	human	known	74_37	missense	SNP	0.995	A
CEACAM5	1048	genome.wustl.edu	37	19	42224881	42224881	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr19:42224881C>G	ENST00000221992.6	+	8	1925	c.1811C>G	c.(1810-1812)tCt>tGt	p.S604C	CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000398599.4_Missense_Mutation_p.S603C|CEACAM5_ENST00000405816.1_Missense_Mutation_p.S604C	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	604	Ig-like 7.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CCAGACTCGTCTTACCTTTCG	0.547																																																	0								ENSG00000105388						139.0	137.0	138.0					19																	42224881		2203	4300	6503	CEACAM5	SO:0001583	missense	0			-	HGNC	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1811C>G	19.37:g.42224881C>G	ENSP00000221992:p.Ser604Cys	Somatic	0	79	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	54	11.48	H9KVA7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S604C	ENST00000221992.6	37	c.1811	CCDS12584.1	19	.	.	.	.	.	.	.	.	.	.	C	9.159	1.018138	0.19355	.	.	ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181	T;T	0.13307	2.6;2.6	2.17	-0.0978	0.13631	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.28699	0.0711	M	0.77486	2.375	0.09310	N	1	D;P	0.58970	0.984;0.953	D;P	0.66196	0.942;0.819	T	0.11275	-1.0594	9	0.56958	D	0.05	.	2.9099	0.05733	0.4808:0.3367:0.1824:0.0	.	604;604	P06731;Q53G30	CEAM5_HUMAN;.	C	604;604;322	ENSP00000221992:S604C;ENSP00000385072:S604C	ENSP00000221992:S604C	S	+	2	0	CEACAM5	46916721	0.010000	0.17322	0.002000	0.10522	0.004000	0.04260	0.717000	0.25851	-0.073000	0.12842	0.467000	0.42956	TCT	-	smart_Ig_sub,pfscan_Ig-like_dom		0.547	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM5	protein_coding	OTTHUMT00000321132.2	C	NM_004363	-		42224881	+1	no_errors	ENST00000221992	ensembl	human	known	74_37	missense	SNP	0.002	G
CCL15	6359	genome.wustl.edu	37	17	34324877	34324877	+	Missense_Mutation	SNP	G	G	A	rs138739843		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:34324877G>A	ENST00000354059.4	-	4	820	c.268C>T	c.(268-270)Cgg>Tgg	p.R90W	CCL14_ENST00000536149.1_5'UTR|CCL15-CCL14_ENST00000481427.2_Missense_Mutation_p.R90W	NM_032965.4	NP_116741.1	Q16663	CCL15_HUMAN	chemokine (C-C motif) ligand 15	90					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive chemotaxis (GO:0050918)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)|receptor binding (GO:0005102)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CAGACTTGCCGCCCCTTCTTG	0.522																																																	0								ENSG00000267596	G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	56.0	55.0	55.0		268	-9.4	0.0	17	dbSNP_134	55	0,8600		0,0,4300	no	missense	CCL15	NM_032965.4	101	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	90/114	34324877	1,13005	2203	4300	6503	CCL15	SO:0001583	missense	0			-	HGNC	AF031587	CCDS11304.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000267596	ENSG00000275718		"""Chemokine ligands"", ""Endogenous ligands"""	10613	protein-coding gene	gene with protein product	"""leukotactin 1"", ""CC chemokine 3"", ""macrophage inflammatory protein 5"", ""chemokine CC-2"", ""MIP-1 delta"""	601393	"""small inducible cytokine subfamily A (Cys-Cys), member 15"""	SCYA15		8661057	Standard	NM_032965		Approved	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B	uc010wcu.2	Q16663	OTTHUMG00000188406	ENST00000354059.4:c.268C>T	17.37:g.34324877G>A	ENSP00000293276:p.Arg90Trp	Somatic	0	60	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	54	14.06	B2RU34|E1P651|Q9UM74	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.R90W	ENST00000354059.4	37	c.268	CCDS11304.1	17	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710305	0.48517	2.27E-4	0.0	ENSG00000161574	ENST00000354059	T	0.07327	3.2	4.72	-9.44	0.00603	CC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	1.654160	0.04448	N	0.372034	T	0.30448	0.0765	M	0.90705	3.14	0.09310	N	1	D	0.89917	1.0	D	0.63957	0.92	T	0.59799	-0.7386	10	0.87932	D	0	.	14.6518	0.68803	0.0668:0.0:0.1316:0.8015	.	90	Q16663	CCL15_HUMAN	W	90	ENSP00000293276:R90W	ENSP00000293276:R90W	R	-	1	2	CCL15	31348990	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-1.875000	0.01634	-2.539000	0.00486	0.591000	0.81541	CGG	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom		0.522	CCL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCL15	protein_coding	OTTHUMT00000256584.2	G	NM_004167	rs138739843		34324877	-1	no_errors	ENST00000354059	ensembl	human	known	74_37	missense	SNP	0.000	A
PCDHA12	56137	genome.wustl.edu	37	5	140256852	140256852	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:140256852G>A	ENST00000398631.2	+	1	1795	c.1795G>A	c.(1795-1797)Gct>Act	p.A599T	PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	599	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCGGTGGACGCTGACTCCGG	0.682																																					Pancreas(113;759 1672 13322 24104 50104)												0								ENSG00000251664						473.0	412.0	432.0					5																	140256852		2203	4299	6502	PCDHA12	SO:0001583	missense	0			-	HGNC	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1795G>A	5.37:g.140256852G>A	ENSP00000381628:p.Ala599Thr	Somatic	0	132	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	105	11.02	O75278|Q2M1N8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A599T	ENST00000398631.2	37	c.1795	CCDS47285.1	5	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552986	0.65425	.	.	ENSG00000251664	ENST00000398631	T	0.55234	0.53	4.56	3.62	0.41486	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.72669	0.3489	M	0.89534	3.04	0.24087	N	0.995927	D;D	0.69078	0.997;0.997	P;P	0.60236	0.794;0.871	T	0.64351	-0.6428	9	0.72032	D	0.01	.	11.1605	0.48512	0.0:0.0:0.6786:0.3214	.	599;599	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	T	599	ENSP00000381628:A599T	ENSP00000381628:A599T	A	+	1	0	PCDHA12	140237036	0.948000	0.32251	0.991000	0.47740	0.535000	0.34838	4.009000	0.57110	2.074000	0.62210	0.561000	0.74099	GCT	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.682	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	protein_coding	OTTHUMT00000372882.2	G	NM_018903	-		140256852	+1	no_errors	ENST00000398631	ensembl	human	known	74_37	missense	SNP	1.000	A
IDH1	3417	genome.wustl.edu	37	2	209110099	209110099	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr2:209110099G>C	ENST00000415913.1	-	5	845	c.464C>G	c.(463-465)aCc>aGc	p.T155S	IDH1_ENST00000345146.2_Missense_Mutation_p.T155S|IDH1_ENST00000446179.1_Missense_Mutation_p.T155S	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	155					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		TGGTGTGTAGGTTATCTCTAC	0.373			Mis		gliobastoma																																Pancreas(158;264 1958 3300 35450 36047)			Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	0								ENSG00000138413						152.0	139.0	144.0					2																	209110099		2203	4300	6503	IDH1	SO:0001583	missense	0			-	HGNC		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.464C>G	2.37:g.209110099G>C	ENSP00000390265:p.Thr155Ser	Somatic	0	56	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	27	47.06	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_NADP,tigrfam_Isocitrate_DH_NADP	p.T155S	ENST00000415913.1	37	c.464	CCDS2381.1	2	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318018	0.40996	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913;ENST00000415282	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	5.66	2.76	0.32466	Isopropylmalate dehydrogenase-like domain (2);	0.357409	0.34879	N	0.003620	T	0.66167	0.2762	L	0.42632	1.34	0.41368	D	0.987479	B	0.02656	0.0	B	0.06405	0.002	T	0.63005	-0.6733	10	0.41790	T	0.15	-6.2791	7.1387	0.25543	0.2024:0.1282:0.6694:0.0	.	155	O75874	IDHC_HUMAN	S	155	ENSP00000260985:T155S;ENSP00000410513:T155S;ENSP00000390265:T155S;ENSP00000391075:T155S	ENSP00000260985:T155S	T	-	2	0	IDH1	208818344	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	1.312000	0.33574	1.398000	0.46701	0.561000	0.74099	ACC	-	pfam_IsoPropMal-DH-like_dom,pirsf_Isocitrate_DH_NADP,tigrfam_Isocitrate_DH_NADP		0.373	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IDH1	protein_coding	OTTHUMT00000336672.1	G		-		209110099	-1	no_errors	ENST00000345146	ensembl	human	known	74_37	missense	SNP	1.000	C
ADAMTSL3	57188	genome.wustl.edu	37	15	84506902	84506902	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:84506902C>T	ENST00000286744.5	+	7	886	c.662C>T	c.(661-663)gCc>gTc	p.A221V	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.A221V	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	221						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			GGAGTCTGTGCCGGCGATGGC	0.522																																																	0								ENSG00000156218						82.0	76.0	78.0					15																	84506902		2203	4300	6503	ADAMTSL3	SO:0001583	missense	0			-	HGNC	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.662C>T	15.37:g.84506902C>T	ENSP00000286744:p.Ala221Val	Somatic	0	56	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.26	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom,prints_Peptidase_M12B_ADAM-TS	p.A221V	ENST00000286744.5	37	c.662	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897551	0.52121	.	.	ENSG00000156218	ENST00000286744	T	0.68331	-0.32	5.5	2.36	0.29203	.	1.444780	0.03742	N	0.255158	T	0.74489	0.3723	L	0.54323	1.7	0.37176	D	0.903251	P;P	0.50710	0.597;0.938	P;P	0.49853	0.624;0.601	T	0.64922	-0.6293	10	0.48119	T	0.1	.	16.3449	0.83120	0.0:0.6261:0.3739:0.0	.	221;221	P82987-2;P82987	.;ATL3_HUMAN	V	221	ENSP00000286744:A221V	ENSP00000286744:A221V	A	+	2	0	ADAMTSL3	82297906	0.905000	0.30787	0.010000	0.14722	0.540000	0.34992	1.707000	0.37888	0.283000	0.22279	0.650000	0.86243	GCC	-	prints_Peptidase_M12B_ADAM-TS		0.522	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	protein_coding	OTTHUMT00000304007.2	C	NM_207517	-		84506902	+1	no_errors	ENST00000286744	ensembl	human	known	74_37	missense	SNP	0.566	T
OR56A3	390083	genome.wustl.edu	37	11	5969152	5969152	+	Silent	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:5969152C>T	ENST00000329564.6	+	1	583	c.576C>T	c.(574-576)tcC>tcT	p.S192S	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCAGACTCTCCTGCGATGATG	0.468																																																	0								ENSG00000184478						116.0	116.0	116.0					11																	5969152		2159	4286	6445	OR56A3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.576C>T	11.37:g.5969152C>T		Somatic	0	53	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00	A6NN77|Q6IFF7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S192	ENST00000329564.6	37	c.576	CCDS41614.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.468	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	OR56A3	protein_coding	OTTHUMT00000383753.1	C	NM_001003443	-		5969152	+1	no_errors	ENST00000329564	ensembl	human	known	74_37	silent	SNP	0.998	T
WASH3P	374666	genome.wustl.edu	37	15	102513202	102513202	+	RNA	DEL	C	C	-			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:102513202delC	ENST00000557932.1	+	0	383							C4AMC7	WASH3_HUMAN	WAS protein family homolog 3 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)	p.H121fs*24(1)		central_nervous_system(1)|endometrium(6)|kidney(11)|prostate(5)|stomach(1)|urinary_tract(1)	25						GACGCCCCCGCCACAGGATCC	0.652																																																	1	Deletion - Frameshift(1)	central_nervous_system(1)						ENSG00000185596																																			WASH3P			0				HGNC			15q26.3	2014-03-20	2008-01-16	2008-01-16	ENSG00000185596	ENSG00000185596		"""WAS protein homologs"""	24362	pseudogene	pseudogene			"""family with sequence similarity 39, member D pseudogene"""	FAM39DP		11701968, 18159949	Standard	NR_003659		Approved	FLJ25222	uc002cdi.3	C4AMC7	OTTHUMG00000172275		15.37:g.102513202delC		Somatic	0	19	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	27.78		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557932.1	37	NULL		15																																																																																			-	-		0.652	WASH3P-001	KNOWN	basic	processed_transcript	WASH3P	pseudogene	OTTHUMT00000417608.1	C	NM_199163			102513202	+1	no_errors	ENST00000354296	ensembl	human	known	74_37	rna	DEL	0.994	-
CNTNAP5	129684	genome.wustl.edu	37	2	125547486	125547486	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr2:125547486G>A	ENST00000431078.1	+	18	3121	c.2757G>A	c.(2755-2757)acG>acA	p.T919T		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	919	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TAGGGGGAACGTCATCCAGAC	0.418																																																	0								ENSG00000155052						46.0	43.0	44.0					2																	125547486		1946	4157	6103	CNTNAP5	SO:0001819	synonymous_variant	0			-	HGNC	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.2757G>A	2.37:g.125547486G>A		Somatic	0	45	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	26	18.75	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.T919	ENST00000431078.1	37	c.2757	CCDS46401.1	2																																																																																			-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.418	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	protein_coding	OTTHUMT00000330864.3	G		-		125547486	+1	no_errors	ENST00000431078	ensembl	human	known	74_37	silent	SNP	1.000	A
OR10C1	442194	genome.wustl.edu	37	6	29407999	29407999	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr6:29407999G>C	ENST00000444197.2	+	1	917	c.207G>C	c.(205-207)gaG>gaC	p.E69D	OR11A1_ENST00000377149.1_Intron	NM_013941.3	NP_039229.3	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C, member 1 (gene/pseudogene)	69						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|kidney(1)|large_intestine(3)|liver(2)|lung(14)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						CGGCCTTGGAGATTGGCTATA	0.572																																																	0								ENSG00000206474						176.0	154.0	161.0					6																	29407999		1511	2708	4219	OR10C1	SO:0001583	missense	0			-	HGNC		CCDS34364.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000206474	ENSG00000206474		"""GPCR / Class A : Olfactory receptors"""	8165	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily C, member 2"", ""olfactory receptor, family 10, subfamily C, member 1"""	OR10C2			Standard	NM_013941		Approved	hs6M1-17, OR10C1P	uc011dlp.2	Q96KK4	OTTHUMG00000031207	ENST00000444197.2:c.207G>C	6.37:g.29407999G>C	ENSP00000419119:p.Glu69Asp	Somatic	0	56	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	42	12.50	Q5SUN7|Q96R18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.E69D	ENST00000444197.2	37	c.207	CCDS34364.1	6	.	.	.	.	.	.	.	.	.	.	G	3.194	-0.165267	0.06461	.	.	ENSG00000206474	ENST00000444197	T	0.00008	9.61	3.6	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39615	N	0.001313	T	0.00012	0.0000	N	0.21240	0.645	0.22975	N	0.998488	B	0.18461	0.028	B	0.24394	0.053	T	0.49835	-0.8897	10	0.15499	T	0.54	.	2.6706	0.05066	0.1058:0.1827:0.5232:0.1884	.	69	Q96KK4	O10C1_HUMAN	D	69	ENSP00000419119:E69D	ENSP00000419119:E69D	E	+	3	2	OR10C1	29515978	0.000000	0.05858	0.633000	0.29310	0.011000	0.07611	-0.801000	0.04550	2.008000	0.58898	0.430000	0.28490	GAG	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.572	OR10C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10C1	protein_coding	OTTHUMT00000076415.2	G		-		29407999	+1	no_errors	ENST00000444197	ensembl	human	known	74_37	missense	SNP	0.558	C
DHX37	57647	genome.wustl.edu	37	12	125436983	125436983	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:125436983G>A	ENST00000308736.2	-	21	2927	c.2829C>T	c.(2827-2829)agC>agT	p.S943S	DHX37_ENST00000544745.1_Silent_p.S730S	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	943							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GCATCTCCTCGCTCTGGACCC	0.687																																																	0								ENSG00000150990						48.0	39.0	42.0					12																	125436983		2203	4300	6503	DHX37	SO:0001819	synonymous_variant	0			-	HGNC	AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.2829C>T	12.37:g.125436983G>A		Somatic	0	35	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	19	34.48	Q9BUI7|Q9P211	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S943	ENST00000308736.2	37	c.2829	CCDS9261.1	12																																																																																			-	pfam_DUF1605,superfamily_P-loop_NTPase		0.687	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX37	protein_coding		G	NM_032656	-		125436983	-1	no_errors	ENST00000308736	ensembl	human	known	74_37	silent	SNP	0.290	A
TDRD15	100129278	genome.wustl.edu	37	2	21363630	21363630	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr2:21363630G>T	ENST00000405799.1	+	4	3621	c.3291G>T	c.(3289-3291)tgG>tgT	p.W1097C				B5MCY1	TDR15_HUMAN	tudor domain containing 15	1097							hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)										TCAGTAGTTGGTTTAAAGACA	0.368																																																	0								ENSG00000218819																																			TDRD15	SO:0001583	missense	0			-	HGNC			2p24.1	2013-01-23	2013-01-23	2013-01-23	ENSG00000218819	ENSG00000218819		"""Tudor domain containing"""	45037	protein-coding gene	gene with protein product							Standard	XR_425376		Approved			B5MCY1	OTTHUMG00000151795	ENST00000405799.1:c.3291G>T	2.37:g.21363630G>T	ENSP00000384376:p.Trp1097Cys	Somatic	0	72	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor,pfscan_Tudor	p.W1097C	ENST00000405799.1	37	c.3291		2	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593905	0.46214	.	.	ENSG00000218819	ENST00000405799	T	0.23552	1.9	5.39	4.52	0.55395	.	.	.	.	.	T	0.38054	0.1026	.	.	.	.	.	.	.	.	.	.	.	.	T	0.49041	-0.8980	5	0.38643	T	0.18	-0.8422	14.0954	0.65019	0.0726:0.0:0.9274:0.0	.	.	.	.	C	1097	ENSP00000384376:W1097C	ENSP00000384376:W1097C	W	+	3	0	AC010872.2	21217135	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	9.262000	0.95591	1.282000	0.44496	0.467000	0.42956	TGG	-	NULL		0.368	TDRD15-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TDRD15	protein_coding	OTTHUMT00000323948.1	G		-		21363630	+1	no_errors	ENST00000405799	ensembl	human	novel	74_37	missense	SNP	1.000	T
ATP13A5	344905	genome.wustl.edu	37	3	193081133	193081133	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:193081133G>T	ENST00000342358.4	-	3	393	c.276C>A	c.(274-276)tgC>tgA	p.C92*		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	92						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		ATAAGTAGAGGCAGAATACCT	0.418																																																	0								ENSG00000187527						92.0	91.0	91.0					3																	193081133		2203	4300	6503	ATP13A5	SO:0001587	stop_gained	0			-	HGNC	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.276C>A	3.37:g.193081133G>T	ENSP00000341942:p.Cys92*	Somatic	0	52	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q6UWS4|Q6ZWL0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.C92*	ENST00000342358.4	37	c.276	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577839	0.86645	.	.	ENSG00000187527	ENST00000342358;ENST00000446087	.	.	.	5.06	-1.05	0.10036	.	0.281157	0.32640	N	0.005837	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-7.2468	9.9906	0.41868	0.4497:0.0:0.5503:0.0	.	.	.	.	X	92;114	.	ENSP00000341942:C92X	C	-	3	2	ATP13A5	194563827	0.715000	0.27946	0.313000	0.25210	0.988000	0.76386	0.068000	0.14531	-0.329000	0.08527	0.655000	0.94253	TGC	-	pfam_ATPase_P-typ_Cation_typ_V,tigrfam_ATPase_P-typ_Cation_typ_V		0.418	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	protein_coding	OTTHUMT00000343012.1	G	NM_198505	-		193081133	-1	no_errors	ENST00000342358	ensembl	human	known	74_37	nonsense	SNP	0.886	T
PAQR4	124222	genome.wustl.edu	37	16	3022637	3022637	+	3'UTR	DEL	G	G	-	rs572756044		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr16:3022637delG	ENST00000318782.8	+	0	1940				PKMYT1_ENST00000571102.1_5'Flank|PKMYT1_ENST00000431515.2_Splice_Site_p.R503fs|PAQR4_ENST00000572687.1_3'UTR|PAQR4_ENST00000293978.8_3'UTR	NM_001284513.1|NM_152341.3	NP_001271442.1|NP_689554.2	Q8N4S7	PAQR4_HUMAN	progestin and adipoQ receptor family member IV							integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8						GGTACCCACCGGGGGATGTGC	0.647																																																	0								ENSG00000127564																																			PKMYT1	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS10485.1, CCDS66911.1, CCDS66912.1, CCDS73814.1	16p13	2008-05-02			ENSG00000162073	ENSG00000162073			26386	protein-coding gene	gene with protein product		614578				12477932	Standard	XM_005255112		Approved	FLJ30002	uc002csj.4	Q8N4S7	OTTHUMG00000128977	ENST00000318782.8:c.*688G>-	16.37:g.3022637delG		Somatic	0	44	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	A8K5Q8|D3DUA2|D3DUA3|Q8NAS6|Q96NW1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R503fs	ENST00000318782.8	37	c.1507	CCDS10485.1	16																																																																																			-	NULL		0.647	PAQR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKMYT1	protein_coding	OTTHUMT00000250966.1	G	NM_152341			3022637	-1	no_errors	ENST00000431515	ensembl	human	putative	74_37	frame_shift_del	DEL	0.000	-
MLLT3	4300	genome.wustl.edu	37	9	20414373	20414373	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr9:20414373G>A	ENST00000380338.4	-	5	757	c.471C>T	c.(469-471)agC>agT	p.S157S	MLLT3_ENST00000429426.2_Silent_p.S154S|MLLT3_ENST00000355930.6_5'UTR|MLLT3_ENST00000475957.1_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	157	Poly-Ser.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)		p.S157S(5)		central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		tgctgctgctgctactgctgc	0.527			T	MLL	ALL																																			Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	5	Substitution - coding silent(5)	endometrium(3)|urinary_tract(1)|prostate(1)						ENSG00000171843						9.0	14.0	12.0					9																	20414373		1757	3647	5404	MLLT3	SO:0001819	synonymous_variant	0			-	HGNC	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.471C>T	9.37:g.20414373G>A		Somatic	0	52	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	46	9.80	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_YEATS,pfscan_YEATS	p.S157	ENST00000380338.4	37	c.471	CCDS6494.1	9																																																																																			-	NULL		0.527	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT3	protein_coding	OTTHUMT00000051872.1	G	NM_004529	-		20414373	-1	no_errors	ENST00000380338	ensembl	human	known	74_37	silent	SNP	0.207	A
PCDHGA4	56111	genome.wustl.edu	37	5	140736262	140736262	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:140736262G>A	ENST00000571252.1	+	1	1495	c.1495G>A	c.(1495-1497)Gca>Aca	p.A499T	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	499	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTCCAGGGTGCACCTCTGTC	0.517																																																	0								ENSG00000262576						128.0	135.0	133.0					5																	140736262		2096	4256	6352	PCDHGA4	SO:0001583	missense	0			-	HGNC	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1495G>A	5.37:g.140736262G>A	ENSP00000458570:p.Ala499Thr	Somatic	0	39	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	19	44.12	Q9Y5D3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A499T	ENST00000571252.1	37	c.1495	CCDS58979.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.517	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	protein_coding	OTTHUMT00000437959.1	G	NM_018917	-		140736262	+1	no_errors	ENST00000571252	ensembl	human	known	74_37	missense	SNP	0.000	A
TSPYL4	23270	genome.wustl.edu	37	6	116574399	116574399	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr6:116574399A>T	ENST00000420283.1	-	1	862	c.773T>A	c.(772-774)tTt>tAt	p.F258Y	RP3-486I3.7_ENST00000448740.2_lincRNA|DSE_ENST00000540275.1_5'Flank	NM_021648.4	NP_067680.3	Q9UJ04	TSYL4_HUMAN	TSPY-like 4	258					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				endometrium(2)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(2)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.045)|OV - Ovarian serous cystadenocarcinoma(136;0.0666)|GBM - Glioblastoma multiforme(226;0.095)|Epithelial(106;0.125)		GTGGTTTCGAAAGGCAGTAAC	0.502																																																	0								ENSG00000187189						43.0	44.0	44.0					6																	116574399		1957	4177	6134	TSPYL4	SO:0001583	missense	0			-	HGNC		CCDS5106.1	6q22.1	2010-05-12			ENSG00000187189	ENSG00000187189			21559	protein-coding gene	gene with protein product							Standard	NM_021648		Approved	dJ486I3.2, KIAA0721	uc003pwn.3	Q9UJ04	OTTHUMG00000015429	ENST00000420283.1:c.773T>A	6.37:g.116574399A>T	ENSP00000410943:p.Phe258Tyr	Somatic	0	49	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B4DYQ2|O94828|Q96GW8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.F258Y	ENST00000420283.1	37	c.773	CCDS5106.1	6	.	.	.	.	.	.	.	.	.	.	A	22.5	4.304316	0.81136	.	.	ENSG00000187189	ENST00000420283	T	0.28895	1.59	3.98	3.98	0.46160	.	0.240961	0.21786	N	0.069136	T	0.55768	0.1941	M	0.93462	3.42	0.40339	D	0.979013	D	0.76494	0.999	D	0.77557	0.99	T	0.67325	-0.5699	10	0.87932	D	0	-5.9792	11.5154	0.50518	1.0:0.0:0.0:0.0	.	258	Q9UJ04	TSYL4_HUMAN	Y	258	ENSP00000410943:F258Y	ENSP00000410943:F258Y	F	-	2	0	TSPYL4	116681092	1.000000	0.71417	0.985000	0.45067	0.989000	0.77384	3.497000	0.53295	2.035000	0.60131	0.379000	0.24179	TTT	-	pfam_NAP_family		0.502	TSPYL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL4	protein_coding	OTTHUMT00000041934.2	A		-		116574399	-1	no_errors	ENST00000420283	ensembl	human	known	74_37	missense	SNP	0.991	T
LDHAL6CP	121498	genome.wustl.edu	37	12	63398447	63398447	+	lincRNA	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:63398447G>A	ENST00000552996.1	-	0	211				LDHAL6CP_ENST00000550738.1_RNA																							AAACACTTTGGGAAATTCAGA	0.358																																																	0								ENSG00000250517																																			LDHAL6CP			0			-	HGNC																													12.37:g.63398447G>A		Somatic	0	23	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000552996.1	37	NULL		12																																																																																			-	-		0.358	RP11-848D3.5-001	KNOWN	basic	lincRNA	LDHAL6CP	lincRNA	OTTHUMT00000406731.1	G		-		63398447	+1	no_errors	ENST00000550738	ensembl	human	known	74_37	rna	SNP	1.000	A
KRT12	3859	genome.wustl.edu	37	17	39023145	39023145	+	Silent	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:39023145C>T	ENST00000251643.4	-	1	317	c.294G>A	c.(292-294)ggG>ggA	p.G98G		NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	98	Gly-rich.|Head.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	CAAATCCCATCCCCAGCCCTC	0.562																																																	0								ENSG00000187242						99.0	120.0	113.0					17																	39023145		2203	4300	6503	KRT12	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.294G>A	17.37:g.39023145C>T		Somatic	0	75	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	35	36.84	B2R9E0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.G98	ENST00000251643.4	37	c.294	CCDS11378.1	17																																																																																			-	NULL		0.562	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT12	protein_coding	OTTHUMT00000257214.2	C	NM_000223	-		39023145	-1	no_errors	ENST00000251643	ensembl	human	known	74_37	silent	SNP	0.002	T
PCDHGA1	56114	genome.wustl.edu	37	5	140710512	140710512	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:140710512G>A	ENST00000517417.1	+	1	261	c.261G>A	c.(259-261)gcG>gcA	p.A87A	PCDHGA1_ENST00000378105.3_Silent_p.A87A|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	87	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATCACCGCGCGCAGGATAG	0.537																																																	0								ENSG00000204956						109.0	122.0	117.0					5																	140710512		2203	4300	6503	PCDHGA1	SO:0001819	synonymous_variant	0			-	HGNC	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.261G>A	5.37:g.140710512G>A		Somatic	0	28	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	Q2M273|Q9Y5D6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A87	ENST00000517417.1	37	c.261	CCDS54922.1	5																																																																																			-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.537	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	protein_coding	OTTHUMT00000374737.1	G	NM_018912	-		140710512	+1	no_errors	ENST00000517417	ensembl	human	known	74_37	silent	SNP	0.004	A
SLC25A19	60386	genome.wustl.edu	37	17	73269841	73269842	+	Intron	INS	-	-	TTATT	rs3082641|rs35986946|rs55758835	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:73269841_73269842insTTATT	ENST00000402418.3	-	6	1684				RP11-649A18.12_ENST00000585075.1_RNA|MIF4GD_ENST00000578305.1_5'Flank|SLC25A19_ENST00000442286.2_Intron|MIF4GD_ENST00000325102.8_5'Flank|SLC25A19_ENST00000375261.4_Intron|MIF4GD_ENST00000577542.1_5'Flank|SLC25A19_ENST00000580994.1_Intron|MIF4GD_ENST00000579297.1_5'Flank|SLC25A19_ENST00000320362.3_Intron|SLC25A19_ENST00000416858.2_Intron|MIF4GD_ENST00000580571.1_5'Flank|MIF4GD_ENST00000245551.5_5'Flank|RP11-649A18.12_ENST00000582668.1_RNA			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19						deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			AAAATAGCAAAttattttattt	0.465														4192	0.837061	0.7103	0.879	5008	,	,		24978	0.9256		0.7992	False		,,,				2504	0.9264																0								ENSG00000263843																																			RP11-649A18.12	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.775-121->AATAA	17.37:g.73269847_73269851dupTTATT		Somatic	NA	NA	NA		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PF74|Q6V9R7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402418.3	37	NULL	CCDS11720.1	17																																																																																			-	-		0.465	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100287042	protein_coding	OTTHUMT00000447282.1	-	NM_021734			73269842	+1	no_errors	ENST00000585075	ensembl	human	known	74_37	rna	INS	0.003:0.004	TTATT
KLRC3	3823	genome.wustl.edu	37	12	10588425	10588425	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:10588425C>T	ENST00000539033.1	-	1	175	c.161G>A	c.(160-162)gGg>gAg	p.G54E	KLRC2_ENST00000536833.2_Intron|KLRC2_ENST00000381902.2_Missense_Mutation_p.G54E|KLRC2_ENST00000381901.1_Missense_Mutation_p.G54E																							TTTATCAATCCCTTGATGATT	0.338																																																	0								ENSG00000255641						110.0	120.0	116.0					12																	10588425		2124	4212	6336	NKG2-E	SO:0001583	missense	0			-	Uniprot_gn																												ENST00000539033.1:c.161G>A	12.37:g.10588425C>T	ENSP00000437563:p.Gly54Glu	Somatic	0	109	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	60	17.81		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.G54E	ENST00000539033.1	37	c.161		12	.	.	.	.	.	.	.	.	.	.	C	5.455	0.268987	0.10349	.	.	ENSG00000255641;ENSG00000205809;ENSG00000205809	ENST00000539033;ENST00000381902;ENST00000381901	T;T;T	0.05717	3.4;3.4;3.4	1.91	0.998	0.19857	.	1.377710	0.04503	N	0.381643	T	0.16685	0.0401	M	0.82630	2.6	0.09310	N	1	B;B;B	0.30511	0.109;0.098;0.282	B;B;B	0.42798	0.163;0.144;0.398	T	0.40459	-0.9562	10	0.42905	T	0.14	.	4.344	0.11124	0.0:0.7932:0.0:0.2068	.	40;54;54	Q3KQS7;P26717;F5H6K3	.;NKG2C_HUMAN;.	E	54	ENSP00000437563:G54E;ENSP00000371327:G54E;ENSP00000371326:G54E	ENSP00000371326:G54E	G	-	2	0	KLRC2;RP11-277P12.6	10479692	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-1.324000	0.02690	0.388000	0.25054	0.184000	0.17185	GGG	-	NULL		0.338	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	ENSG00000255641	protein_coding	OTTHUMT00000400274.1	C		-		10588425	-1	no_errors	ENST00000539033	ensembl	human	known	74_37	missense	SNP	0.001	T
BNIP2	663	genome.wustl.edu	37	15	59955820	59955820	+	3'UTR	SNP	T	T	C	rs566176318		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:59955820T>C	ENST00000607373.1	-	0	1595				AC092755.4_ENST00000441746.1_RNA|BNIP2_ENST00000267859.3_3'UTR|BNIP2_ENST00000478981.1_5'UTR	NM_004330.2	NP_004321.2	Q12982	BNIP2_HUMAN	BCL2/adenovirus E1B 19kDa interacting protein 2						apoptotic process (GO:0006915)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|positive regulation of GTPase activity (GO:0043547)|positive regulation of muscle cell differentiation (GO:0051149)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)			NS(1)|large_intestine(2)|lung(5)|ovary(1)	9						AAAATTCTAATATGCACTTTA	0.274													T|||	1	0.000199681	0.0	0.0	5008	,	,		16807	0.0		0.0	False		,,,				2504	0.001				Ovarian(174;1936 1978 6671 8240 38212)												0								ENSG00000140299																																			BNIP2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U15173	CCDS10174.2	15q21.3	2008-07-18	2002-08-29		ENSG00000140299	ENSG00000140299			1083	protein-coding gene	gene with protein product		603292	"""BCL2/adenovirus E1B 19kD-interacting protein 2"""			7954800	Standard	NM_004330		Approved	Nip2, BNIP-2	uc010uhc.2	Q12982	OTTHUMG00000132727	ENST00000607373.1:c.*448A>G	15.37:g.59955820T>C		Somatic	0	56	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	22	51.11	B4DS94	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607373.1	37	NULL		15																																																																																			-	-		0.274	BNIP2-012	NOVEL	basic|appris_principal	protein_coding	BNIP2	protein_coding	OTTHUMT00000470740.1	T	NM_004330	-		59955820	-1	no_errors	ENST00000478981	ensembl	human	known	74_37	rna	SNP	0.931	C
TM7SF2	7108	genome.wustl.edu	37	11	64880999	64880999	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:64880999T>A	ENST00000279263.7	+	5	698	c.536T>A	c.(535-537)cTc>cAc	p.L179H	TM7SF2_ENST00000531029.1_Intron|TM7SF2_ENST00000540748.1_Missense_Mutation_p.L63H|TM7SF2_ENST00000345348.5_Missense_Mutation_p.L179H|AP003068.9_ENST00000528887.1_RNA	NM_003273.2	NP_003264.2	O76062	ERG24_HUMAN	transmembrane 7 superfamily member 2	179				L -> V (in Ref. 4; AAH12857). {ECO:0000305}.	cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	delta14-sterol reductase activity (GO:0050613)			lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGACGAGAGCTCAACCCTCGT	0.532											OREG0021072	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000149809						231.0	236.0	234.0					11																	64880999		1931	4115	6046	TM7SF2	SO:0001583	missense	0			-	HGNC	BC012857	CCDS41669.1, CCDS60846.1	11q13.1	2013-05-23			ENSG00000149809	ENSG00000149809	1.3.1.70		11863	protein-coding gene	gene with protein product	"""delta(14)-sterol reductase"""	603414				9615229, 9286704	Standard	NM_003273		Approved	ANG1, DHCR14A, NET47	uc001oct.4	O76062	OTTHUMG00000165603	ENST00000279263.7:c.536T>A	11.37:g.64880999T>A	ENSP00000279263:p.Leu179His	Somatic	0	59	0.00	134	0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	67	8.22	A8K4H0|O95982|Q8IY06|Q96E64|Q96GZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ergosterol_biosynth_ERG4_ERG24,pfam_DUF1295	p.L179H	ENST00000279263.7	37	c.536	CCDS41669.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.2|25.2	4.608965|4.608965	0.87258|0.87258	.|.	.|.	ENSG00000149809|ENSG00000149809	ENST00000279263;ENST00000524986;ENST00000534371;ENST00000540748;ENST00000525385;ENST00000345348;ENST00000531321;ENST00000529414;ENST00000526085;ENST00000530750;ENST00000527968|ENST00000528802	D;D;D;D;D;D;D;D;D;D;D|.	0.99292|.	-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-5.7;-2.29;-5.7|.	4.83|4.83	4.83|4.83	0.62350|0.62350	Sterol reductase, conserved site (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85084|0.85084	0.5616|0.5616	H|H	0.94698|0.94698	3.57|3.57	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;0.999;1.0|.	D|D	0.88864|0.88864	0.3328|0.3328	10|5	0.87932|.	D|.	0|.	-0.757|-0.757	12.3862|12.3862	0.55333|0.55333	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	63;179;179|.	F5GYV3;O76062-2;O76062|.	.;.;ERG24_HUMAN|.	H|T	179;150;111;63;150;179;85;168;30;114;11|7	ENSP00000279263:L179H;ENSP00000435972:L150H;ENSP00000432187:L111H;ENSP00000441215:L63H;ENSP00000433325:L150H;ENSP00000329520:L179H;ENSP00000431300:L85H;ENSP00000433275:L168H;ENSP00000434447:L30H;ENSP00000432413:L114H;ENSP00000431685:L11H|.	ENSP00000279263:L179H|.	L|S	+|+	2|1	0|0	TM7SF2|TM7SF2	64637575|64637575	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	7.441000|7.441000	0.80485|0.80485	2.039000|2.039000	0.60335|0.60335	0.402000|0.402000	0.26972|0.26972	CTC|TCA	-	pfam_Ergosterol_biosynth_ERG4_ERG24		0.532	TM7SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM7SF2	protein_coding	OTTHUMT00000385234.1	T	NM_003273	-		64880999	+1	no_errors	ENST00000279263	ensembl	human	known	74_37	missense	SNP	1.000	A
CLN6	54982	genome.wustl.edu	37	15	68510864	68510864	+	Intron	SNP	T	T	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:68510864T>C	ENST00000249806.5	-	2	356				CLN6_ENST00000564752.1_Intron|RP11-315D16.2_ENST00000562767.1_Intron|CLN6_ENST00000566347.1_Intron|CLN6_ENST00000538696.1_Intron|CLN6_ENST00000418702.2_Intron|CLN6_ENST00000569336.1_5'UTR|CLN6_ENST00000565471.1_Intron	NM_017882.2	NP_060352.1	Q9NWW5	CLN6_HUMAN	ceroid-lipofuscinosis, neuronal 6, late infantile, variant						cell death (GO:0008219)|cellular macromolecule catabolic process (GO:0044265)|cholesterol metabolic process (GO:0008203)|ganglioside metabolic process (GO:0001573)|glycosaminoglycan metabolic process (GO:0030203)|locomotion involved in locomotory behavior (GO:0031987)|lysosomal lumen acidification (GO:0007042)|positive regulation of proteolysis (GO:0045862)|protein catabolic process (GO:0030163)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						gtgcaccatttcacactcacc	0.532																																																	0								ENSG00000128973						103.0	95.0	97.0					15																	68510864		2200	4298	6498	CLN6	SO:0001627	intron_variant	0			-	HGNC	AK000568	CCDS10227.1	15q23	2014-09-17			ENSG00000128973	ENSG00000128973			2077	protein-coding gene	gene with protein product		606725				9097964, 11727201	Standard	NM_017882		Approved	FLJ20561, HsT18960, nclf	uc002arf.3	Q9NWW5	OTTHUMG00000133286	ENST00000249806.5:c.198+9A>G	15.37:g.68510864T>C		Somatic	0	39	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A8K560|B4DDH6|Q6IAB1|Q96SR0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000249806.5	37	NULL	CCDS10227.1	15																																																																																			-	-		0.532	CLN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN6	protein_coding	OTTHUMT00000257066.1	T	NM_017882	-		68510864	-1	no_errors	ENST00000569336	ensembl	human	known	74_37	rna	SNP	0.000	C
TRIM41	90933	genome.wustl.edu	37	5	180651182	180651184	+	In_Frame_Del	DEL	GGA	GGA	-	rs539435490|rs73365903	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:180651182_180651184delGGA	ENST00000315073.5	+	1	893_895	c.183_185delGGA	c.(181-186)cgggag>cgg	p.E66del	CTC-338M12.7_ENST00000499096.2_RNA|TRIM41_ENST00000351937.5_In_Frame_Del_p.E66del|MIR4638_ENST00000581158.1_RNA	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	66	Glu-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTTAGATCGggaggaggaggag	0.631																																																	0								ENSG00000146063																																			TRIM41	SO:0001651	inframe_deletion	0				HGNC	AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.183_185delGGA	5.37:g.180651191_180651193delGGA	ENSP00000320869:p.Glu66del	Somatic	0	36	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,pfam_DUF3631,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E65in_frame_del	ENST00000315073.5	37	c.183_185	CCDS4466.1	5																																																																																			-	smart_Znf_RING		0.631	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM41	protein_coding	OTTHUMT00000253574.3	GGA	NM_201627			180651184	+1	no_errors	ENST00000315073	ensembl	human	known	74_37	in_frame_del	DEL	0.999:1.000:1.000	-
NRIP1	8204	genome.wustl.edu	37	21	16338470	16338470	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr21:16338470C>T	ENST00000400202.1	-	3	2756	c.2044G>A	c.(2044-2046)Gaa>Aaa	p.E682K	NRIP1_ENST00000400199.1_Missense_Mutation_p.E682K|NRIP1_ENST00000318948.4_Missense_Mutation_p.E682K|AF127577.10_ENST00000446301.1_RNA			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	682	Repression domain 2.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TTATTTTCTTCAACTGCATTT	0.388																																																	0								ENSG00000180530						106.0	104.0	105.0					21																	16338470		2203	4300	6503	NRIP1	SO:0001583	missense	0			-	HGNC	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.2044G>A	21.37:g.16338470C>T	ENSP00000383063:p.Glu682Lys	Somatic	0	46	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	38	30.91	Q8IWE8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E682K	ENST00000400202.1	37	c.2044	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	C	16.28	3.078887	0.55753	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.23147	1.92;1.92;1.92	5.69	5.69	0.88448	.	0.154328	0.43416	D	0.000575	T	0.34337	0.0894	L	0.53249	1.67	0.46222	D	0.998935	P	0.50272	0.933	P	0.44811	0.461	T	0.08289	-1.0729	10	0.72032	D	0.01	-5.898	20.2085	0.98285	0.0:1.0:0.0:0.0	.	682	P48552	NRIP1_HUMAN	K	682	ENSP00000383060:E682K;ENSP00000383063:E682K;ENSP00000327213:E682K	ENSP00000327213:E682K	E	-	1	0	NRIP1	15260341	0.999000	0.42202	0.973000	0.42090	0.020000	0.10135	5.255000	0.65462	2.865000	0.98341	0.655000	0.94253	GAA	-	NULL		0.388	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	protein_coding	OTTHUMT00000157926.1	C	NM_003489	-		16338470	-1	no_errors	ENST00000318948	ensembl	human	known	74_37	missense	SNP	0.997	T
KCNA5	3741	genome.wustl.edu	37	12	5153679	5153679	+	Silent	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:5153679C>T	ENST00000252321.3	+	1	595	c.366C>T	c.(364-366)gtC>gtT	p.V122V		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	122					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	ACCAGCGCGTCCACATCAACA	0.697																																																	0								ENSG00000130037						29.0	29.0	29.0					12																	5153679		2200	4299	6499	KCNA5	SO:0001819	synonymous_variant	0			-	HGNC	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.366C>T	12.37:g.5153679C>T		Somatic	0	86	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	57	21.92	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.V122	ENST00000252321.3	37	c.366	CCDS8536.1	12																																																																																			-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like		0.697	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	protein_coding	OTTHUMT00000398925.2	C	NM_002234	-		5153679	+1	no_errors	ENST00000252321	ensembl	human	known	74_37	silent	SNP	0.966	T
POU1F1	5449	genome.wustl.edu	37	3	87309205	87309205	+	Missense_Mutation	SNP	G	G	T	rs104893762		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:87309205G>T	ENST00000350375.2	-	6	839	c.715C>A	c.(715-717)Cct>Act	p.P239T	POU1F1_ENST00000560656.1_Missense_Mutation_p.N163K|POU1F1_ENST00000344265.3_Missense_Mutation_p.P265T	NM_000306.2	NP_000297.1	P28069	PIT1_HUMAN	POU class 1 homeobox 1	239			P -> S (in CPHD1; loss of function). {ECO:0000269|PubMed:9626142}.		B cell differentiation (GO:0030183)|cell fate specification (GO:0001708)|determination of adult lifespan (GO:0008340)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear transport (GO:0051169)|positive regulation of cell proliferation (GO:0008284)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin-like growth factor receptor signaling pathway (GO:0043567)|somatotropin secreting cell development (GO:0060133)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(2)	18	all_cancers(8;0.104)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00229)|Lung(72;0.00677)		TGAGAAGAAGGTTTATTCTGT	0.443																																																	0			GRCh37	CM981613	POU1F1	M	rs104893762	ENSG00000064835						65.0	64.0	64.0					3																	87309205		2203	4300	6503	POU1F1	SO:0001583	missense	0			-	HGNC	D10216	CCDS2919.1, CCDS46873.1	3p11.2	2011-06-20	2007-07-13		ENSG00000064835	ENSG00000064835		"""Homeoboxes / POU class"""	9210	protein-coding gene	gene with protein product	"""growth hormone factor 1"""	173110	"""POU domain class 1, transcription factor 1"""	PIT1		1956794	Standard	NM_001122757		Approved	GHF-1, POU1F1a	uc010hoj.1	P28069	OTTHUMG00000158992	ENST00000350375.2:c.715C>A	3.37:g.87309205G>T	ENSP00000263781:p.Pro239Thr	Somatic	0	38	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	O75757|Q15132|Q15133|Q9UD34|Q9UEL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.P265T	ENST00000350375.2	37	c.793	CCDS2919.1	3	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876364	0.72180	.	.	ENSG00000064835	ENST00000350375;ENST00000344265	D;D	0.98234	-4.81;-4.81	6.07	6.07	0.98685	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99420	0.9795	H	0.96970	3.915	0.44500	D	0.997445	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98485	1.0607	10	0.87932	D	0	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	265;239	P28069-2;P28069	.;PIT1_HUMAN	T	239;265	ENSP00000263781:P239T;ENSP00000342931:P265T	ENSP00000342931:P265T	P	-	1	0	POU1F1	87391895	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	9.441000	0.97557	2.885000	0.99019	0.655000	0.94253	CCT	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.443	POU1F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU1F1	protein_coding	OTTHUMT00000352827.1	G	NM_000306	-		87309205	-1	no_errors	ENST00000344265	ensembl	human	known	74_37	missense	SNP	1.000	T
HNRNPA0	10949	genome.wustl.edu	37	5	137089075	137089076	+	In_Frame_Ins	INS	-	-	CCG			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:137089075_137089076insCCG	ENST00000314940.4	-	1	963_964	c.680_681insCGG	c.(679-681)gga>ggCGGa	p.227_227G>GG		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	227	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			agccgccgcctccgccgccgcc	0.723																																																	0								ENSG00000177733			19,2353		7,5,1174						-4.0	0.0			5	59,5139		13,33,2553	no	coding	HNRNPA0	NM_006805.3		20,38,3727	A1A1,A1R,RR		1.1351,0.801,1.0304				78,7492				HNRNPA0	SO:0001652	inframe_insertion	0				HGNC	U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.678_680dupCGG	5.37:g.137089082_137089084dupCCG	ENSP00000316042:p.Gly230dup	Somatic	0	12	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	Q6IB18	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.231in_frame_insG	ENST00000314940.4	37	c.681_680	CCDS4193.1	5																																																																																			-	NULL		0.723	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPA0	protein_coding	OTTHUMT00000251221.1	-	NM_006805			137089076	-1	no_errors	ENST00000314940	ensembl	human	known	74_37	in_frame_ins	INS	0.019:0.578	CCG
IGF2BP3	10643	genome.wustl.edu	37	7	23509681	23509681	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr7:23509681C>A	ENST00000258729.3	-	1	405	c.49G>T	c.(49-51)Gac>Tac	p.D17Y	IGF2BP3_ENST00000491719.1_5'Flank	NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	17	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						CTTTCTAGGTCCGAGGGGGCG	0.493																																																	0								ENSG00000136231						79.0	91.0	87.0					7																	23509681		2203	4300	6503	IGF2BP3	SO:0001583	missense	0			-	HGNC	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.49G>T	7.37:g.23509681C>A	ENSP00000258729:p.Asp17Tyr	Somatic	0	91	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.D17Y	ENST00000258729.3	37	c.49	CCDS5382.1	7	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341423	0.81911	.	.	ENSG00000136231	ENST00000258729	T	0.12774	2.65	4.09	4.09	0.47781	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	U	0.000000	T	0.44993	0.1320	M	0.93375	3.41	0.80722	D	1	P	0.51240	0.943	P	0.59424	0.857	T	0.63051	-0.6723	10	0.72032	D	0.01	-12.1306	16.2899	0.82742	0.0:1.0:0.0:0.0	.	17	O00425	IF2B3_HUMAN	Y	17	ENSP00000258729:D17Y	ENSP00000258729:D17Y	D	-	1	0	IGF2BP3	23476206	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.403000	0.79983	1.800000	0.52685	0.557000	0.71058	GAC	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.493	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP3	protein_coding	OTTHUMT00000250243.2	C	NM_006547	-		23509681	-1	no_errors	ENST00000258729	ensembl	human	known	74_37	missense	SNP	1.000	A
TAS2R38	5726	genome.wustl.edu	37	7	141672786	141672786	+	Missense_Mutation	SNP	C	C	T	rs144212167	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr7:141672786C>T	ENST00000547270.1	-	1	787	c.704G>A	c.(703-705)cGt>cAt	p.R235H		NM_176817.4	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	235					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			NS(2)|breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|skin(1)|stomach(1)	21	Melanoma(164;0.0171)					GCTGGGGTCACGAGAGTTTCT	0.498																																																	0								ENSG00000257138	C	HIS/ARG	4,4402	8.1+/-20.4	0,4,2199	69.0	71.0	71.0		704	-0.3	0.0	7	dbSNP_134	71	0,8600		0,0,4300	yes	missense	TAS2R38	NM_176817.4	29	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	probably-damaging	235/334	141672786	4,13002	2203	4300	6503	TAS2R38	SO:0001583	missense	0			-	HGNC	AF494231	CCDS34765.1	7q34	2012-10-03	2003-05-29	2003-05-30	ENSG00000257138	ENSG00000257138		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	9584	protein-coding gene	gene with protein product		607751	"""phenylthiocarbamide tasting"""	PTC		12624758, 12584440	Standard	NM_176817		Approved	T2R61	uc003vwx.1	P59533	OTTHUMG00000158374	ENST00000547270.1:c.704G>A	7.37:g.141672786C>T	ENSP00000448219:p.Arg235His	Somatic	0	71	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A4D1U6|P59552|Q2M3E8|Q645W3|Q86UK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TAS2_rcpt	p.R235H	ENST00000547270.1	37	c.704	CCDS34765.1	7	.	.	.	.	.	.	.	.	.	.	C	9.681	1.149189	0.21288	9.08E-4	0.0	ENSG00000257138	ENST00000547270	T	0.01005	5.45	5.06	-0.291	0.12843	.	1.245380	0.06020	N	0.651109	T	0.01695	0.0054	M	0.66297	2.02	0.09310	N	1	P	0.37398	0.593	B	0.36464	0.225	T	0.45440	-0.9261	10	0.62326	D	0.03	.	8.0574	0.30612	0.0:0.5193:0.0:0.4807	.	235	P59533	T2R38_HUMAN	H	235	ENSP00000448219:R235H	ENSP00000331291:R235H	R	-	2	0	TAS2R38	141319255	0.000000	0.05858	0.000000	0.03702	0.372000	0.29890	-0.985000	0.03751	-0.238000	0.09724	-0.150000	0.13652	CGT	-	pfam_TAS2_rcpt		0.498	TAS2R38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R38	protein_coding	OTTHUMT00000350810.2	C	NM_176817	rs144212167		141672786	-1	no_errors	ENST00000547270	ensembl	human	known	74_37	missense	SNP	0.000	T
NRIP1	8204	genome.wustl.edu	37	21	16337345	16337345	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr21:16337345C>G	ENST00000400202.1	-	3	3881	c.3169G>C	c.(3169-3171)Gac>Cac	p.D1057H	NRIP1_ENST00000400199.1_Missense_Mutation_p.D1057H|NRIP1_ENST00000318948.4_Missense_Mutation_p.D1057H|AF127577.10_ENST00000446301.1_RNA			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	1057	Interaction with ZNF366.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		CTTGGAGAGTCTTTTTCATAC	0.418																																																	0								ENSG00000180530						155.0	149.0	151.0					21																	16337345		2203	4300	6503	NRIP1	SO:0001583	missense	0			-	HGNC	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.3169G>C	21.37:g.16337345C>G	ENSP00000383063:p.Asp1057His	Somatic	0	77	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	77	23.76	Q8IWE8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D1057H	ENST00000400202.1	37	c.3169	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	C	20.2	3.948701	0.73787	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.27402	1.67;1.67;1.67	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52719	-0.8538	10	0.72032	D	0.01	-17.5931	20.4375	0.99097	0.0:1.0:0.0:0.0	.	1057	P48552	NRIP1_HUMAN	H	1057	ENSP00000383060:D1057H;ENSP00000383063:D1057H;ENSP00000327213:D1057H	ENSP00000327213:D1057H	D	-	1	0	NRIP1	15259216	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.356000	0.79445	2.906000	0.99361	0.655000	0.94253	GAC	-	NULL		0.418	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	protein_coding	OTTHUMT00000157926.1	C	NM_003489	-		16337345	-1	no_errors	ENST00000318948	ensembl	human	known	74_37	missense	SNP	1.000	G
SARDH	1757	genome.wustl.edu	37	9	136573521	136573521	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr9:136573521G>C	ENST00000371872.4	-	11	1615	c.1358C>G	c.(1357-1359)cCc>cGc	p.P453R	SARDH_ENST00000439388.1_Missense_Mutation_p.P453R|SARDH_ENST00000422262.2_Missense_Mutation_p.P285R	NM_007101.3	NP_009032.2	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase	453					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	aminomethyltransferase activity (GO:0004047)|sarcosine dehydrogenase activity (GO:0008480)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(13)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	44				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		GATCCAGCGGGGGTGGTCCGT	0.652																																																	0								ENSG00000123453						68.0	75.0	73.0					9																	136573521		2203	4300	6503	SARDH	SO:0001583	missense	0			-	HGNC		CCDS6978.1	9q33-q34	2008-02-05			ENSG00000123453	ENSG00000123453	1.5.99.2		10536	protein-coding gene	gene with protein product		604455		DMGDHL1		10444331	Standard	NM_007101		Approved	SDH	uc004cep.4	Q9UL12	OTTHUMG00000020879	ENST00000371872.4:c.1358C>G	9.37:g.136573521G>C	ENSP00000360938:p.Pro453Arg	Somatic	0	73	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	64	18.99	B2RMR5|B4DPI2|B7ZLT6|Q5SYV0|Q9Y280|Q9Y2Y3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C	p.P453R	ENST00000371872.4	37	c.1358	CCDS6978.1	9	.	.	.	.	.	.	.	.	.	.	G	0.166	-1.075873	0.01903	.	.	ENSG00000123453	ENST00000371872;ENST00000439388;ENST00000422262;ENST00000427237;ENST00000539227	D;D;D	0.84146	-1.81;-1.81;-1.81	5.16	-1.43	0.08884	.	1.820710	0.02193	N	0.061576	T	0.69797	0.3151	N	0.17312	0.475	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.54622	-0.8266	10	0.14656	T	0.56	-0.0244	1.8921	0.03250	0.1119:0.2797:0.3205:0.2879	.	453	Q9UL12	SARDH_HUMAN	R	453;453;285;453;453	ENSP00000360938:P453R;ENSP00000403084:P453R;ENSP00000415537:P285R	ENSP00000360938:P453R	P	-	2	0	SARDH	135563342	0.005000	0.15991	0.025000	0.17156	0.060000	0.15804	0.025000	0.13577	-0.149000	0.11215	-1.097000	0.02148	CCC	-	NULL		0.652	SARDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SARDH	protein_coding	OTTHUMT00000054931.1	G		-		136573521	-1	no_errors	ENST00000371872	ensembl	human	known	74_37	missense	SNP	0.040	C
RPH3A	22895	genome.wustl.edu	37	12	113316949	113316949	+	Silent	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:113316949C>T	ENST00000389385.4	+	14	1694	c.1197C>T	c.(1195-1197)agC>agT	p.S399S	RPH3A_ENST00000420983.2_Silent_p.S399S|RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000415485.3_Silent_p.S399S|RPH3A_ENST00000548866.1_Silent_p.S350S|RPH3A_ENST00000551052.1_Silent_p.S395S|RPH3A_ENST00000447659.2_Silent_p.S350S|RPH3A_ENST00000543106.2_Silent_p.S399S	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	399	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		TGGAATTCAGCCTTCTCTACG	0.527																																																	0								ENSG00000089169						174.0	157.0	163.0					12																	113316949		2203	4300	6503	RPH3A	SO:0001819	synonymous_variant	0			-	HGNC	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.1197C>T	12.37:g.113316949C>T		Somatic	0	51	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B7Z3C3|Q96AE0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_Znf_FYVE-typ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel,prints_Synaptotagmin,prints_C2_dom	p.S399	ENST00000389385.4	37	c.1197	CCDS44979.1	12																																																																																			-	superfamily_C2_dom		0.527	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	protein_coding	OTTHUMT00000405561.1	C	NM_014954	-		113316949	+1	no_errors	ENST00000389385	ensembl	human	known	74_37	silent	SNP	1.000	T
HEMGN	55363	genome.wustl.edu	37	9	100693452	100693452	+	Silent	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr9:100693452G>T	ENST00000259456.3	-	4	368	c.225C>A	c.(223-225)ggC>ggA	p.G75G		NM_018437.3|NM_197978.2	NP_060907.2|NP_932095.1	Q9BXL5	HEMGN_HUMAN	hemogen	75	Necessary for nuclear localization.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				NS(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|skin(2)|urinary_tract(1)	27		Acute lymphoblastic leukemia(62;0.0559)				GTCTCTTTCTGCCTCTTCGAT	0.413																																																	0								ENSG00000136929						157.0	155.0	155.0					9																	100693452		2203	4300	6503	HEMGN	SO:0001819	synonymous_variant	0			-	HGNC	AF228713	CCDS6731.1	9q22.33	2014-01-21			ENSG00000136929	ENSG00000136929			17509	protein-coding gene	gene with protein product		610715					Standard	NM_018437		Approved	EDAG, CT155, NDR	uc004axy.4	Q9BXL5	OTTHUMG00000020336	ENST00000259456.3:c.225C>A	9.37:g.100693452G>T		Somatic	0	53	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q6XAR3|Q86XY5|Q9NPC0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G75	ENST00000259456.3	37	c.225	CCDS6731.1	9																																																																																			-	NULL		0.413	HEMGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEMGN	protein_coding	OTTHUMT00000053344.2	G	NM_197978	-		100693452	-1	no_errors	ENST00000259456	ensembl	human	known	74_37	silent	SNP	0.984	T
CHAT	1103	genome.wustl.edu	37	10	50830148	50830148	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr10:50830148C>T	ENST00000337653.2	+	5	857	c.704C>T	c.(703-705)gCa>gTa	p.A235V	CHAT_ENST00000395562.2_Missense_Mutation_p.A153V|CHAT_ENST00000460699.1_3'UTR|CHAT_ENST00000395559.2_Missense_Mutation_p.A117V|CHAT_ENST00000351556.3_Missense_Mutation_p.A117V|CHAT_ENST00000339797.1_Missense_Mutation_p.A117V|CHAT_ENST00000455728.2_Missense_Mutation_p.A117V	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	235					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	TGCAGGTTTGCAGCCAGCCTC	0.632																																																	0								ENSG00000070748						193.0	145.0	161.0					10																	50830148		2203	4300	6503	CHAT	SO:0001583	missense	0			-	HGNC	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.704C>T	10.37:g.50830148C>T	ENSP00000337103:p.Ala235Val	Somatic	0	49	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Carn_acyl_trans	p.A235V	ENST00000337653.2	37	c.704	CCDS7232.1	10	.	.	.	.	.	.	.	.	.	.	C	21.4	4.138476	0.77775	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	D;D;D;D;D;D	0.88818	-2.43;-2.43;-2.43;-2.43;-2.43;-2.43	4.74	4.74	0.60224	.	0.306413	0.34725	N	0.003733	D	0.94437	0.8210	M	0.82433	2.59	0.58432	D	0.999998	P;D	0.76494	0.905;0.999	B;D	0.66602	0.284;0.945	D	0.95316	0.8416	10	0.72032	D	0.01	-12.3744	17.7116	0.88323	0.0:1.0:0.0:0.0	.	117;235	F8W8I2;P28329	.;CLAT_HUMAN	V	117;117;117;235;153;117	ENSP00000343486:A117V;ENSP00000345878:A117V;ENSP00000378926:A117V;ENSP00000337103:A235V;ENSP00000378929:A153V;ENSP00000390521:A117V	ENSP00000337103:A235V	A	+	2	0	CHAT	50500154	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.712000	0.74681	2.161000	0.67846	0.561000	0.74099	GCA	-	pfam_Carn_acyl_trans		0.632	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHAT	protein_coding	OTTHUMT00000047997.1	C	NM_020549	-		50830148	+1	no_errors	ENST00000337653	ensembl	human	known	74_37	missense	SNP	1.000	T
OR14K1	343170	genome.wustl.edu	37	1	247902370	247902370	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:247902370G>C	ENST00000283225.2	+	1	454	c.454G>C	c.(454-456)Gcc>Ccc	p.A152P	RP11-634B7.4_ENST00000449298.1_RNA			Q8NGZ2	O14K1_HUMAN	olfactory receptor, family 14, subfamily K, member 1	152						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|lung(18)|ovary(1)|urinary_tract(1)	27						CAACAGAGGGGCCTTGGGACT	0.527																																																	0								ENSG00000153230						90.0	94.0	93.0					1																	247902370		2120	4239	6359	OR14K1	SO:0001583	missense	0			-	HGNC	BK004377		1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000153230	ENSG00000153230		"""GPCR / Class A : Olfactory receptors"""	15025	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AY, member 1"""	OR5AY1			Standard	NG_007559		Approved			Q8NGZ2	OTTHUMG00000040211	ENST00000283225.2:c.454G>C	1.37:g.247902370G>C	ENSP00000283225:p.Ala152Pro	Somatic	0	50	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	38	25.49	A8MPV5|Q6IF85|Q96R53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A152P	ENST00000283225.2	37	c.454		1	.	.	.	.	.	.	.	.	.	.	G	10.75	1.439172	0.25900	.	.	ENSG00000153230	ENST00000283225	T	0.00137	8.68	3.81	-3.26	0.05064	.	0.971136	0.08316	U	0.964600	T	0.00144	0.0004	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.09640	-1.0665	7	0.87932	D	0	.	3.1117	0.06361	0.0873:0.3504:0.2119:0.3505	.	.	.	.	P	152	ENSP00000283225:A152P	ENSP00000283225:A152P	A	+	1	0	OR14K1	245968993	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.156000	0.10100	-0.426000	0.07360	-0.324000	0.08512	GCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.527	OR14K1-001	KNOWN	basic|appris_principal	protein_coding	OR14K1	protein_coding	OTTHUMT00000096868.1	G	NM_001004732	-		247902370	+1	no_errors	ENST00000283225	ensembl	human	known	74_37	missense	SNP	0.000	C
ANKRD19P	138649	genome.wustl.edu	37	9	95599683	95599683	+	RNA	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr9:95599683C>T	ENST00000473204.1	+	0	1764							Q9H560	ANR19_HUMAN	ankyrin repeat domain 19, pseudogene							extracellular vesicular exosome (GO:0070062)											CTCTGGTTCTCCACTTTCAGA	0.647																																																	0								ENSG00000187984																																			ANKRD19P			0			-	HGNC	BC038951		9q22.32	2011-04-27	2011-04-27	2011-04-27	ENSG00000187984	ENSG00000187984			22567	pseudogene	pseudogene			"""ankyrin repeat domain 19"", ""ankyrin repeat domain 19 pseudogene"""	ANKRD19			Standard	NR_026868		Approved	FLJ36178	uc011lua.1	Q9H560	OTTHUMG00000020237		9.37:g.95599683C>T		Somatic	0	74	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	67	18.29	A8K853|Q17RD3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000473204.1	37	NULL		9																																																																																			-	-		0.647	ANKRD19P-004	KNOWN	basic	processed_transcript	ANKRD19P	pseudogene	OTTHUMT00000053116.3	C	NR_026868	-		95599683	+1	no_errors	ENST00000464387	ensembl	human	known	74_37	rna	SNP	0.997	T
ZNF718	255403	genome.wustl.edu	37	4	155020	155020	+	lincRNA	SNP	T	T	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:155020T>C	ENST00000510175.1	+	0	455							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		TCATTTCACGTGCTCTCACGC	0.338																																																	0								ENSG00000250312						28.0	31.0	30.0					4																	155020		2083	4221	6304	ZNF718			0			-	HGNC	AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155020T>C		Somatic	0	39	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	Q3SXZ4|Q3SXZ5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000510175.1	37	NULL		4																																																																																			-	-		0.338	ZNF718-002	KNOWN	basic	lincRNA	ZNF718	lincRNA	OTTHUMT00000357865.3	T	NM_001039127	-		155020	+1	no_errors	ENST00000400172	ensembl	human	known	74_37	rna	SNP	0.001	C
CCDC17	149483	genome.wustl.edu	37	1	46086576	46086576	+	Splice_Site	SNP	T	T	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:46086576T>C	ENST00000528266.1	-	11	1745	c.1598A>G	c.(1597-1599)cAg>cGg	p.Q533R	CCDC17_ENST00000421127.2_Splice_Site_p.Q524R|CCDC17_ENST00000464739.1_5'Flank|CCDC17_ENST00000343901.2_Splice_Site_p.Q501R|CCDC17_ENST00000445048.2_Intron			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	533										kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					CACACTCACCTGAGGAATCCC	0.592																																																	0								ENSG00000159588						52.0	45.0	48.0					1																	46086576		2203	4300	6503	CCDC17	SO:0001630	splice_region_variant	0			-	HGNC		CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.1599+1A>G	1.37:g.46086576T>C		Somatic	0	42	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q501R	ENST00000528266.1	37	c.1502	CCDS44131.2	1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.764164	0.89932	.	.	ENSG00000159588	ENST00000421127;ENST00000343901;ENST00000528266	T;T;T	0.20738	2.05;2.05;2.05	5.92	5.92	0.95590	.	0.085707	0.51477	D	0.000093	T	0.47135	0.1429	M	0.71581	2.175	0.43480	D	0.995709	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.46898	-0.9158	10	0.87932	D	0	-26.7439	15.3474	0.74350	0.0:0.0:0.0:1.0	.	533;524;501	Q96LX7;Q96LX7-5;F2Z395	CCD17_HUMAN;.;.	R	524;501;533	ENSP00000389415:Q524R;ENSP00000341451:Q501R;ENSP00000432172:Q533R	ENSP00000341451:Q501R	Q	-	2	0	CCDC17	45859163	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	5.444000	0.66587	2.263000	0.75096	0.533000	0.62120	CAG	-	NULL		0.592	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CCDC17	protein_coding	OTTHUMT00000386833.1	T	NM_152500	-	Missense_Mutation	46086576	-1	no_errors	ENST00000343901	ensembl	human	known	74_37	missense	SNP	1.000	C
EEF1D	1936	genome.wustl.edu	37	8	144671766	144671766	+	Intron	DEL	C	C	-			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr8:144671766delC	ENST00000529272.1	-	2	397				EEF1D_ENST00000526838.1_Intron|EEF1D_ENST00000524624.1_Intron|EEF1D_ENST00000532741.1_Frame_Shift_Del_p.G212fs|EEF1D_ENST00000528610.1_Intron|EEF1D_ENST00000423316.2_Frame_Shift_Del_p.G162fs|EEF1D_ENST00000442189.2_Frame_Shift_Del_p.G162fs|EEF1D_ENST00000317198.6_Intron|EEF1D_ENST00000419152.2_Intron|EEF1D_ENST00000532400.1_Intron|EEF1D_ENST00000531621.1_Intron|EEF1D_ENST00000395119.3_Intron			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			TGACCCAGATCCCCCAGGTCA	0.677																																																	0								ENSG00000104529						35.0	31.0	32.0					8																	144671766		2201	4298	6499	EEF1D	SO:0001627	intron_variant	0				HGNC	AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.4-2747G>-	8.37:g.144671766delC		Somatic	0	28	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Transl_elong_fac_EF1B_bsu/dsu,pfam_EF-1_beta_acid_region_euk,superfamily_Transl_elong_fac_EF1B_bsu/dsu,smart_Transl_elong_fac_EF1B_bsu/dsu	p.I163fs	ENST00000529272.1	37	c.486	CCDS6405.1	8																																																																																			-	NULL		0.677	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	EEF1D	protein_coding	OTTHUMT00000382592.2	C	NM_032378			144671766	-1	no_errors	ENST00000423316	ensembl	human	known	74_37	frame_shift_del	DEL	0.017	-
ERICH3	127254	genome.wustl.edu	37	1	75038857	75038857	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:75038857T>A	ENST00000326665.5	-	14	2755	c.2537A>T	c.(2536-2538)gAa>gTa	p.E846V	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		846	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TCTGACCCCTTCTGCTTCTGC	0.532																																																	0								ENSG00000178965						117.0	111.0	113.0					1																	75038857		2203	4300	6503	C1orf173	SO:0001583	missense	0			-	HGNC																												ENST00000326665.5:c.2537A>T	1.37:g.75038857T>A	ENSP00000322609:p.Glu846Val	Somatic	0	61	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E846V	ENST00000326665.5	37	c.2537	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701652	0.68501	.	.	ENSG00000178965	ENST00000326665	T	0.18657	2.2	4.95	1.22	0.21188	.	.	.	.	.	T	0.17323	0.0416	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.03750	-1.1007	9	0.56958	D	0.05	-0.0045	6.8518	0.24018	0.0:0.0776:0.2861:0.6364	.	846	Q5RHP9	CA173_HUMAN	V	846	ENSP00000322609:E846V	ENSP00000322609:E846V	E	-	2	0	C1orf173	74811445	0.002000	0.14202	0.658000	0.29665	0.177000	0.22998	0.402000	0.20965	-0.042000	0.13535	0.460000	0.39030	GAA	-	NULL		0.532	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	protein_coding	OTTHUMT00000026516.1	T		-		75038857	-1	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	SNP	0.966	A
PLCXD3	345557	genome.wustl.edu	37	5	41313778	41313778	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:41313778A>T	ENST00000377801.3	-	3	981	c.907T>A	c.(907-909)Ttt>Att	p.F303I	PLCXD3_ENST00000328457.3_Missense_Mutation_p.F303I			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	303					lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GTGCTGATAAAGTCACCAAGT	0.453																																																	0								ENSG00000182836						125.0	111.0	116.0					5																	41313778		2203	4300	6503	PLCXD3	SO:0001583	missense	0			-	HGNC		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.907T>A	5.37:g.41313778A>T	ENSP00000367032:p.Phe303Ile	Somatic	0	34	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	33	26.67	A6NL04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	p.F303I	ENST00000377801.3	37	c.907	CCDS34150.1	5	.	.	.	.	.	.	.	.	.	.	A	34	5.302475	0.95601	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	.	.	.	5.65	5.65	0.86999	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.046906	0.85682	D	0.000000	T	0.73969	0.3655	M	0.72894	2.215	0.80722	D	1	D	0.54601	0.967	P	0.60789	0.879	T	0.70615	-0.4823	9	0.15952	T	0.53	-11.6682	15.8879	0.79264	1.0:0.0:0.0:0.0	.	303	Q63HM9	PLCX3_HUMAN	I	303	.	ENSP00000333751:F303I	F	-	1	0	PLCXD3	41349535	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.886000	0.92447	2.163000	0.67991	0.533000	0.62120	TTT	-	superfamily_PLC-like_Pdiesterase_TIM-brl		0.453	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCXD3	protein_coding	OTTHUMT00000367109.1	A	XM_293875	-		41313778	-1	no_errors	ENST00000328457	ensembl	human	known	74_37	missense	SNP	1.000	T
HSF2BP	11077	genome.wustl.edu	37	21	44949728	44949728	+	Missense_Mutation	SNP	C	C	T	rs145814386		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr21:44949728C>T	ENST00000291560.2	-	9	1242	c.911G>A	c.(910-912)cGc>cAc	p.R304H	HSF2BP_ENST00000542962.1_Missense_Mutation_p.R229H	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	304					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		TGCCAGGATGCGTTGCAGGGG	0.587																																																	0								ENSG00000160207	C	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	69.0	70.0	69.0		911	3.4	1.0	21	dbSNP_134	69	0,8600		0,0,4300	no	missense	HSF2BP	NM_007031.1	29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	304/335	44949728	1,13005	2203	4300	6503	HSF2BP	SO:0001583	missense	0			-	HGNC	AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.911G>A	21.37:g.44949728C>T	ENSP00000291560:p.Arg304His	Somatic	0	84	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	73	17.98	B4DX36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.R304H	ENST00000291560.2	37	c.911	CCDS13697.1	21	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489271	0.44249	2.27E-4	0.0	ENSG00000160207	ENST00000291560;ENST00000542962	T;T	0.68331	-0.32;0.75	5.57	3.43	0.39272	Armadillo-like helical (1);Armadillo-type fold (1);	0.201479	0.53938	N	0.000050	T	0.50171	0.1600	N	0.25426	0.745	0.47214	D	0.999359	B	0.24651	0.108	B	0.17098	0.017	T	0.49041	-0.8980	10	0.41790	T	0.15	.	10.4185	0.44335	0.0:0.7628:0.0:0.2372	.	304	O75031	HSF2B_HUMAN	H	304;229	ENSP00000291560:R304H;ENSP00000443367:R229H	ENSP00000291560:R304H	R	-	2	0	HSF2BP	43774156	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	1.912000	0.39946	1.369000	0.46134	0.563000	0.77884	CGC	-	superfamily_ARM-type_fold		0.587	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2BP	protein_coding	OTTHUMT00000195620.1	C	NM_007031	rs145814386		44949728	-1	no_errors	ENST00000291560	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC4A2	6522	genome.wustl.edu	37	7	150772280	150772280	+	Intron	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr7:150772280G>C	ENST00000485713.1	+	20	4087				FASTK_ENST00000489884.1_5'Flank|SLC4A2_ENST00000392826.2_Intron|SLC4A2_ENST00000413384.2_Intron|RP11-148K1.12_ENST00000485974.1_RNA|SLC4A2_ENST00000461735.1_Intron|SLC4A2_ENST00000310317.5_Intron	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2						anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATTCTGGAAAGACCCTGTGGT	0.592																																																	0								ENSG00000244151																																			RP11-148K1.12	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.3048-62G>C	7.37:g.150772280G>C		Somatic	0	50	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	21	34.38	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000485713.1	37	NULL	CCDS5917.1	7																																																																																			-	-		0.592	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000244151	protein_coding	OTTHUMT00000351039.1	G	NM_003040	-		150772280	-1	no_errors	ENST00000485974	ensembl	human	known	74_37	rna	SNP	0.056	C
SFT2D2	375035	genome.wustl.edu	37	1	168216218	168216218	+	3'UTR	SNP	A	A	G	rs573236357		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:168216218A>G	ENST00000271375.4	+	0	4995				ANKRD36BP1_ENST00000358576.4_RNA	NM_199344.2	NP_955376.1			SFT2 domain containing 2											lung(3)|skin(1)	4	all_hematologic(923;0.215)					AATGGTTTTTATGCAACAGGT	0.318																																																	0								ENSG00000214262																																			ANKRD36BP1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AL035297	CCDS1271.1	1q24.2	2008-02-05			ENSG00000213064	ENSG00000213064			25140	protein-coding gene	gene with protein product							Standard	NM_199344		Approved	UNQ512, dJ747L4.C1.2	uc001gfi.4	O95562	OTTHUMG00000034650	ENST00000271375.4:c.*4440A>G	1.37:g.168216218A>G		Somatic	0	86	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	132	8.97		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000271375.4	37	NULL	CCDS1271.1	1																																																																																			-	-		0.318	SFT2D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36BP1	protein_coding	OTTHUMT00000083827.2	A	NM_199344	-		168216218	-1	no_errors	ENST00000358576	ensembl	human	known	74_37	rna	SNP	0.294	G
TP53	7157	genome.wustl.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	G	A	rs397516436		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:7578212G>A	ENST00000269305.4	-	6	826	c.637C>T	c.(637-639)Cga>Tga	p.R213*	TP53_ENST00000420246.2_Nonsense_Mutation_p.R213*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R213*|TP53_ENST00000413465.2_Nonsense_Mutation_p.R213*|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Nonsense_Mutation_p.R213*|TP53_ENST00000445888.2_Nonsense_Mutation_p.R213*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	213	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R213*(250)|p.R81*(21)|p.R120*(21)|p.0?(8)|p.?(5)|p.R213G(5)|p.R213fs*35(3)|p.R213fs*34(3)|p.D208_V216delDRNTFRHSV(1)|p.R120G(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R81fs*>11(1)|p.D208fs*1(1)|p.R120fs*35(1)|p.R81G(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACACTATGTCGAAAAGTGTTT	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	333	Substitution - Nonsense(292)|Deletion - Frameshift(8)|Whole gene deletion(8)|Substitution - Missense(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Complex - deletion inframe(1)|Substitution - coding silent(1)	large_intestine(89)|breast(45)|lung(37)|upper_aerodigestive_tract(30)|central_nervous_system(18)|skin(16)|oesophagus(15)|stomach(14)|ovary(14)|haematopoietic_and_lymphoid_tissue(10)|urinary_tract(9)|biliary_tract(8)|liver(8)|soft_tissue(5)|endometrium(5)|bone(4)|prostate(3)|thyroid(1)|pancreas(1)|autonomic_ganglia(1)	GRCh37	CM951226	TP53	M		ENSG00000141510						132.0	118.0	123.0					17																	7578212		2203	4300	6503	TP53	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.637C>T	17.37:g.7578212G>A	ENSP00000269305:p.Arg213*	Somatic	0	85	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	21	69.57	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R213*	ENST00000269305.4	37	c.637	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.039727	0.97226	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	3.25	0.37280	.	0.057335	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5444	12.7263	0.57173	0.0:0.0:0.701:0.299	.	.	.	.	X	213;213;213;213;213;213;202;120;81;120;81	.	ENSP00000269305:R213X	R	-	1	2	TP53	7518937	0.971000	0.33674	0.123000	0.21794	0.957000	0.61999	1.659000	0.37387	0.702000	0.31825	0.563000	0.77884	CGA	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546	-		7578212	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	SNP	0.893	A
SPATA31E1	286234	genome.wustl.edu	37	9	90500141	90500141	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr9:90500141C>A	ENST00000325643.5	+	4	805	c.739C>A	c.(739-741)Cag>Aag	p.Q247K		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	247	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TCCTTCACCACAGCCGCATGG	0.632																																																	0								ENSG00000177992						87.0	94.0	92.0					9																	90500141		2203	4300	6503	SPATA31E1	SO:0001583	missense	0			-	HGNC	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.739C>A	9.37:g.90500141C>A	ENSP00000322640:p.Gln247Lys	Somatic	0	49	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q247K	ENST00000325643.5	37	c.739	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	.	0.005	-2.189199	0.00302	.	.	ENSG00000177992	ENST00000325643	T	0.03242	4.0	0.781	-0.641	0.11490	.	.	.	.	.	T	0.02455	0.0075	L	0.36672	1.1	0.09310	N	1	B	0.26975	0.165	B	0.26969	0.075	T	0.46925	-0.9156	9	0.05833	T	0.94	.	4.5156	0.11934	0.0:0.5858:0.4142:0.0	.	247	Q6ZUB1	CI079_HUMAN	K	247	ENSP00000322640:Q247K	ENSP00000322640:Q247K	Q	+	1	0	C9orf79	89689961	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.907000	0.28531	-0.217000	0.10033	-0.519000	0.04390	CAG	-	NULL		0.632	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	protein_coding	OTTHUMT00000052954.2	C	NM_178828	-		90500141	+1	no_errors	ENST00000325643	ensembl	human	known	74_37	missense	SNP	0.001	A
PABPC4L	132430	genome.wustl.edu	37	4	135121102	135121102	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:135121102C>A	ENST00000421491.3	-	2	1329	c.1073G>T	c.(1072-1074)gGc>gTc	p.G358V	PABPC4L_ENST00000529122.2_Missense_Mutation_p.G416V			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	358	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						AGGTTTGGAGCCCAAGATGCG	0.493																																																	0								ENSG00000254535						58.0	49.0	52.0					4																	135121102		692	1591	2283	PABPC4L	SO:0001583	missense	0			-	HGNC	AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.1073G>T	4.37:g.135121102C>A	ENSP00000463233:p.Gly358Val	Somatic	0	36	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	12	40.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_PABP_1234	p.G416V	ENST00000421491.3	37	c.1247		4																																																																																			-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234		0.493	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	PABPC4L	protein_coding	OTTHUMT00000364399.2	C	NM_001114734	-		135121102	-1	no_errors	ENST00000529122	ensembl	human	known	74_37	missense	SNP	1.000	A
LRP5	4041	genome.wustl.edu	37	11	68115452	68115452	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:68115452G>T	ENST00000294304.7	+	2	335	c.229G>T	c.(229-231)Gtg>Ttg	p.V77L		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	77	Beta-propeller 1.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CAAGGGAGCCGTGTACTGGAC	0.647																																																	0								ENSG00000162337						83.0	77.0	79.0					11																	68115452		2200	4294	6494	LRP5	SO:0001583	missense	0			-	HGNC	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.229G>T	11.37:g.68115452G>T	ENSP00000294304:p.Val77Leu	Somatic	0	56	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	38	19.15	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.V77L	ENST00000294304.7	37	c.229	CCDS8181.1	11	.	.	.	.	.	.	.	.	.	.	G	15.12	2.738118	0.49045	.	.	ENSG00000162337	ENST00000294304	D	0.88586	-2.4	4.58	3.65	0.41850	Six-bladed beta-propeller, TolB-like (1);	0.193343	0.24345	U	0.039323	T	0.79639	0.4480	N	0.22421	0.69	0.34616	D	0.7181	B	0.19200	0.034	B	0.22152	0.038	T	0.78188	-0.2301	10	0.31617	T	0.26	.	8.5473	0.33429	0.2388:0.0:0.7612:0.0	.	77	O75197	LRP5_HUMAN	L	77	ENSP00000294304:V77L	ENSP00000294304:V77L	V	+	1	0	LRP5	67872028	0.997000	0.39634	1.000000	0.80357	0.952000	0.60782	2.955000	0.49121	2.245000	0.73994	0.561000	0.74099	GTG	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,smart_LDLR_classB_rpt		0.647	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5	protein_coding	OTTHUMT00000395088.1	G	NM_002335	-		68115452	+1	no_errors	ENST00000294304	ensembl	human	known	74_37	missense	SNP	0.989	T
TYRO3	7301	genome.wustl.edu	37	15	41859567	41859567	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:41859567G>T	ENST00000263798.3	+	7	1017	c.793G>T	c.(793-795)Gcc>Tcc	p.A265S	TYRO3_ENST00000559066.1_Missense_Mutation_p.A220S	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	265	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GGTGACACAGGCCCCAGGAGG	0.557																																																	0								ENSG00000092445						66.0	71.0	69.0					15																	41859567		2203	4300	6503	TYRO3	SO:0001583	missense	0			-	HGNC	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.793G>T	15.37:g.41859567G>T	ENSP00000263798:p.Ala265Ser	Somatic	0	58	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	O14953|Q86VR3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A265S	ENST00000263798.3	37	c.793	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	G	9.229	1.035347	0.19590	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.56941	0.43	4.64	3.72	0.42706	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.42294	D	0.000740	T	0.24890	0.0604	N	0.05534	-0.03	0.32565	N	0.530637	B	0.17038	0.02	B	0.18263	0.021	T	0.23013	-1.0200	10	0.08599	T	0.76	-9.6909	5.5949	0.17321	0.1:0.0:0.7052:0.1948	.	265	Q06418	TYRO3_HUMAN	S	197;265	ENSP00000263798:A265S	ENSP00000263798:A265S	A	+	1	0	TYRO3	39646859	0.982000	0.34865	0.989000	0.46669	0.977000	0.68977	1.148000	0.31614	1.185000	0.42971	0.655000	0.94253	GCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.557	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	protein_coding	OTTHUMT00000252693.2	G		-		41859567	+1	no_errors	ENST00000263798	ensembl	human	known	74_37	missense	SNP	0.937	T
CDK8	1024	genome.wustl.edu	37	13	26975611	26975611	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr13:26975611G>C	ENST00000381527.3	+	12	1622	c.1119G>C	c.(1117-1119)caG>caC	p.Q373H	CDK8_ENST00000480323.1_3'UTR|CDK8_ENST00000536792.1_3'UTR	NM_001260.1	NP_001251.1	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	373	Poly-Gln.				gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	25	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		AGAAGAACCAGCAGCAGCAGC	0.458																																																	0								ENSG00000132964						51.0	51.0	51.0					13																	26975611		2203	4300	6503	CDK8	SO:0001583	missense	0			-	HGNC	X85753	CCDS9317.1	13q12	2011-11-08			ENSG00000132964	ENSG00000132964		"""Cyclin-dependent kinases"""	1779	protein-coding gene	gene with protein product		603184				7568034	Standard	NM_001260		Approved	K35	uc001uqr.1	P49336	OTTHUMG00000016617	ENST00000381527.3:c.1119G>C	13.37:g.26975611G>C	ENSP00000370938:p.Gln373His	Somatic	0	74	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q5VUF3|Q6ISB5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q373H	ENST00000381527.3	37	c.1119	CCDS9317.1	13	.	.	.	.	.	.	.	.	.	.	G	16.84	3.235234	0.58886	.	.	ENSG00000132964	ENST00000381527	T	0.70045	-0.45	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.65554	0.2702	M	0.63843	1.955	0.80722	D	1	P;P	0.41848	0.763;0.65	B;B	0.41202	0.35;0.19	T	0.66822	-0.5826	10	0.44086	T	0.13	-8.6083	13.3154	0.60405	0.0722:0.0:0.9278:0.0	.	372;373	P49336-2;P49336	.;CDK8_HUMAN	H	373	ENSP00000370938:Q373H	ENSP00000370938:Q373H	Q	+	3	2	CDK8	25873611	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.185000	0.72013	2.757000	0.94681	0.655000	0.94253	CAG	-	NULL		0.458	CDK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK8	protein_coding	OTTHUMT00000044250.1	G		-		26975611	+1	no_errors	ENST00000381527	ensembl	human	known	74_37	missense	SNP	1.000	C
C9	735	genome.wustl.edu	37	5	39342252	39342252	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:39342252C>G	ENST00000263408.4	-	2	219	c.124G>C	c.(124-126)Gac>Cac	p.D42H	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	42	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			ATTCTGCAGTCTATGTGTGAT	0.453																																																	0								ENSG00000113600						169.0	141.0	150.0					5																	39342252		2203	4300	6503	C9	SO:0001583	missense	0			-	HGNC		CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.124G>C	5.37:g.39342252C>G	ENSP00000263408:p.Asp42His	Somatic	0	58	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	93	9.71		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,prints_MAC_perforin,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt	p.D42H	ENST00000263408.4	37	c.124	CCDS3929.1	5	.	.	.	.	.	.	.	.	.	.	C	17.11	3.305721	0.60305	.	.	ENSG00000113600	ENST00000263408	T	0.21031	2.03	5.51	5.51	0.81932	.	0.099071	0.64402	D	0.000003	T	0.46776	0.1410	M	0.75777	2.31	0.51233	D	0.999915	D	0.89917	1.0	D	0.73380	0.98	T	0.44802	-0.9304	10	0.72032	D	0.01	-25.6663	14.9066	0.70724	0.0:1.0:0.0:0.0	.	42	P02748	CO9_HUMAN	H	42	ENSP00000263408:D42H	ENSP00000263408:D42H	D	-	1	0	C9	39378009	0.998000	0.40836	1.000000	0.80357	0.304000	0.27724	2.667000	0.46808	2.582000	0.87167	0.655000	0.94253	GAC	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.453	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9	protein_coding	OTTHUMT00000211576.3	C		-		39342252	-1	no_errors	ENST00000263408	ensembl	human	known	74_37	missense	SNP	1.000	G
LINC01000	402483	genome.wustl.edu	37	1	133414	133414	+	IGR	SNP	T	T	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:133414T>G	ENST00000423372.3	-	0	2661																											GCCCCACCAGTGCTTCTGCCC	0.672																																																	0								ENSG00000238009																																			RP11-34P13.7	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene																													1.37:g.133414T>G		Somatic	0	73	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	80	17.53		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423372.3	37	NULL		1																																																																																			-	-		0.672	AL627309.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000238009	protein_coding		T		-		133414	-1	no_errors	ENST00000453576	ensembl	human	known	74_37	rna	SNP	0.955	G
TMEM199	147007	genome.wustl.edu	37	17	26685947	26685947	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:26685947C>G	ENST00000292114.3	+	2	310	c.220C>G	c.(220-222)Cta>Gta	p.L74V	TMEM199_ENST00000581386.1_3'UTR|CTB-96E2.7_ENST00000577850.1_RNA|TMEM199_ENST00000395404.3_Intron|POLDIP2_ENST00000003607.4_5'Flank|POLDIP2_ENST00000540200.1_5'Flank|MIR4723_ENST00000585070.1_RNA|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000509083.1_Missense_Mutation_p.L74V	NM_152464.1	NP_689677.1	Q8N511	TM199_HUMAN	transmembrane protein 199	74						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6	all_lung(13;0.000354)|Lung NSC(42;0.00115)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)		AGATTCCAAACTATACCTCCA	0.443																																																	0								ENSG00000244045						129.0	117.0	121.0					17																	26685947		2203	4300	6503	TMEM199	SO:0001583	missense	0			-	HGNC	AY074907	CCDS11228.1	17q11.2	2007-12-17	2007-12-17	2007-12-17	ENSG00000244045	ENSG00000244045			18085	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 32"""	C17orf32			Standard	NM_152464		Approved	MGC45714	uc002hba.3	Q8N511	OTTHUMG00000132498	ENST00000292114.3:c.220C>G	17.37:g.26685947C>G	ENSP00000292114:p.Leu74Val	Somatic	0	55	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	32	23.81		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_Vma12	p.L74V	ENST00000292114.3	37	c.220	CCDS11228.1	17	.	.	.	.	.	.	.	.	.	.	C	7.854	0.724680	0.15439	.	.	ENSG00000244045	ENST00000292114;ENST00000509083	T;T	0.30714	1.63;1.52	5.63	-0.0502	0.13831	.	0.318769	0.32836	N	0.005583	T	0.08403	0.0209	N	0.02916	-0.46	0.09310	N	1	B;B	0.21520	0.057;0.001	B;B	0.22753	0.041;0.001	T	0.25187	-1.0139	10	0.09338	T	0.73	-3.149	2.2108	0.03947	0.1216:0.4359:0.2365:0.206	.	74;74	E9PBQ3;Q8N511	.;TM199_HUMAN	V	74	ENSP00000292114:L74V;ENSP00000427614:L74V	ENSP00000292114:L74V	L	+	1	2	TMEM199	23710074	0.001000	0.12720	0.063000	0.19743	0.850000	0.48378	-0.112000	0.10791	0.066000	0.16515	-0.830000	0.03078	CTA	-	NULL		0.443	TMEM199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM199	protein_coding	OTTHUMT00000255676.2	C	NM_152464	-		26685947	+1	no_errors	ENST00000509083	ensembl	human	known	74_37	missense	SNP	0.018	G
KCNA5	3741	genome.wustl.edu	37	12	5153524	5153524	+	Missense_Mutation	SNP	C	C	A	rs144879674|rs71581015	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr12:5153524C>A	ENST00000252321.3	+	1	440	c.211C>A	c.(211-213)Ccg>Acg	p.P71T		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	71	2 X 11 AA tandem repeat of D-[SP]-G-V-R- P-L-P-P-L-P.				atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GCCTCCGCTGCCGGACCCGGG	0.751																																																	0								ENSG00000130037						4.0	6.0	5.0					12																	5153524		1958	3858	5816	KCNA5	SO:0001583	missense	0			-	HGNC	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.211C>A	12.37:g.5153524C>A	ENSP00000252321:p.Pro71Thr	Somatic	0	29	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.P71T	ENST00000252321.3	37	c.211	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	-	16.92	3.255131	0.59321	.	.	ENSG00000130037	ENST00000252321	D	0.97455	-4.39	3.13	1.07	0.20283	.	2.810250	0.02044	N	0.049486	D	0.92763	0.7699	N	0.24115	0.695	0.09310	N	1	.	.	.	.	.	.	D	0.86007	0.1498	8	0.14656	T	0.56	.	6.5869	0.22626	0.2037:0.5984:0.1979:0.0	.	71	P22460	KCNA5_HUMAN	T	71	ENSP00000252321:P71T	ENSP00000252321:P71T	P	+	1	0	KCNA5	5023785	0.037000	0.19845	0.438000	0.26821	0.832000	0.47134	0.116000	0.15561	0.123000	0.18342	0.511000	0.50034	CCG	-	NULL		0.751	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	protein_coding	OTTHUMT00000398925.2	C	NM_002234	-		5153524	+1	no_errors	ENST00000252321	ensembl	human	known	74_37	missense	SNP	0.043	A
MUC4	4585	genome.wustl.edu	37	3	195508545	195508546	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:195508545_195508546insG	ENST00000463781.3	-	2	10364_10365	c.9905_9906insC	c.(9904-9906)actfs	p.T3302fs	MUC4_ENST00000475231.1_Frame_Shift_Ins_p.T3302fs|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ATACTGAGGAAGTCTCGGTGAC	0.559																																																	0								ENSG00000145113																																			MUC4	SO:0001589	frameshift_variant	0				HGNC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9906dupC	3.37:g.195508546_195508546dupG	ENSP00000417498:p.Thr3302fs	Somatic	0	44	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S3303fs	ENST00000463781.3	37	c.9906_9905	CCDS54700.1	3																																																																																			-	NULL		0.559	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	-	NM_018406			195508546	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	frame_shift_ins	INS	0.002:0.002	G
ANKUB1	389161	genome.wustl.edu	37	3	149485707	149485707	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:149485707C>T	ENST00000383050.3	-	5	1198	c.742G>A	c.(742-744)Gca>Aca	p.A248T	ANKUB1_ENST00000462519.2_Missense_Mutation_p.A248T|ANKUB1_ENST00000446160.1_Missense_Mutation_p.A248T			A6NFN9	ANKUB_HUMAN	ankyrin repeat and ubiquitin domain containing 1	248										breast(1)|kidney(1)|lung(1)|skin(1)	4						CCTGCTTCTGCGGCTGCATGA	0.547																																																	0								ENSG00000206199						80.0	68.0	72.0					3																	149485707		692	1591	2283	ANKUB1	SO:0001583	missense	0			-	HGNC	AK027233		3q25.1	2013-01-11	2011-05-10	2011-05-10	ENSG00000206199	ENSG00000206199		"""Ankyrin repeat domain containing"""	29642	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 16"""	C3orf16			Standard	NM_001144960		Approved		uc003exl.3	A6NFN9	OTTHUMG00000159615	ENST00000383050.3:c.742G>A	3.37:g.149485707C>T	ENSP00000372522:p.Ala248Thr	Somatic	0	45	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B4E2N8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ubiquitin_supergroup	p.A248T	ENST00000383050.3	37	c.742		3	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902288	0.92035	.	.	ENSG00000206199	ENST00000446160;ENST00000383050;ENST00000462519	T;T;T	0.71817	-0.6;-0.6;-0.6	5.44	5.44	0.79542	Ankyrin repeat-containing domain (3);	.	.	.	.	T	0.81602	0.4857	L	0.56396	1.775	0.32030	N	0.599663	D;D	0.76494	0.999;0.999	D;P	0.64595	0.927;0.9	D	0.84082	0.0385	9	0.87932	D	0	.	18.0541	0.89358	0.0:1.0:0.0:0.0	.	248;248	A6NFN9;E9PHT4	ANKUB_HUMAN;.	T	248	ENSP00000387907:A248T;ENSP00000372522:A248T;ENSP00000417635:A248T	ENSP00000372522:A248T	A	-	1	0	ANKUB1	150968397	1.000000	0.71417	0.845000	0.33349	0.955000	0.61496	3.916000	0.56416	2.551000	0.86045	0.650000	0.86243	GCA	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt		0.547	ANKUB1-201	KNOWN	basic	protein_coding	ANKUB1	protein_coding		C	NM_001144960	-		149485707	-1	no_errors	ENST00000446160	ensembl	human	known	74_37	missense	SNP	1.000	T
SULT1E1	6783	genome.wustl.edu	37	4	70715166	70715166	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr4:70715166A>T	ENST00000226444.3	-	5	597	c.485T>A	c.(484-486)aTg>aAg	p.M162K		NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1	162					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	CTGTCCTTGCATGAATTTCTC	0.378																																																	0								ENSG00000109193						67.0	72.0	70.0					4																	70715166		2203	4300	6503	SULT1E1	SO:0001583	missense	0			-	HGNC	BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.485T>A	4.37:g.70715166A>T	ENSP00000226444:p.Met162Lys	Somatic	0	96	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	82	18.00	Q8N6X5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.M162K	ENST00000226444.3	37	c.485	CCDS3531.1	4	.	.	.	.	.	.	.	.	.	.	A	15.20	2.763618	0.49574	.	.	ENSG00000109193	ENST00000226444	D	0.82433	-1.61	3.85	3.85	0.44370	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.91300	0.7257	M	0.90309	3.105	0.58432	D	0.999994	D;D	0.65815	0.995;0.995	D;D	0.72625	0.978;0.978	D	0.91857	0.5496	10	0.52906	T	0.07	.	11.287	0.49228	1.0:0.0:0.0:0.0	.	162;162	Q53X91;P49888	.;ST1E1_HUMAN	K	162	ENSP00000226444:M162K	ENSP00000226444:M162K	M	-	2	0	SULT1E1	70749755	1.000000	0.71417	1.000000	0.80357	0.411000	0.31082	7.371000	0.79600	1.986000	0.57962	0.528000	0.53228	ATG	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.378	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1E1	protein_coding	OTTHUMT00000251559.1	A	NM_005420	-		70715166	-1	no_errors	ENST00000226444	ensembl	human	known	74_37	missense	SNP	1.000	T
NUP210	23225	genome.wustl.edu	37	3	13413491	13413491	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:13413491G>A	ENST00000254508.5	-	13	1711	c.1629C>T	c.(1627-1629)tgC>tgT	p.C543C		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	543					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					CCTCCACCTGGCACGGGGCAA	0.662																																																	0								ENSG00000132182						26.0	21.0	23.0					3																	13413491		2202	4299	6501	NUP210	SO:0001819	synonymous_variant	0			-	HGNC	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.1629C>T	3.37:g.13413491G>A		Somatic	0	32	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,superfamily_Cadherin-like,smart_Big_2	p.C543	ENST00000254508.5	37	c.1629	CCDS33704.1	3																																																																																			-	NULL		0.662	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	protein_coding	OTTHUMT00000340085.1	G	NM_024923	-		13413491	-1	no_errors	ENST00000254508	ensembl	human	known	74_37	silent	SNP	1.000	A
C1orf21	81563	genome.wustl.edu	37	1	184588751	184588751	+	3'UTR	SNP	A	A	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:184588751A>G	ENST00000235307.6	+	0	862				C1orf21_ENST00000367514.3_3'UTR	NM_030806.3	NP_110433.1	Q9H246	CA021_HUMAN	chromosome 1 open reading frame 21											breast(1)|lung(1)	2		Breast(1374;0.00262)		Colorectal(1306;4.8e-08)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)		ACCCCAGTTGAAATCTTTGCA	0.408																																																	0								ENSG00000116667						110.0	95.0	99.0					1																	184588751		692	1591	2283	C1orf21	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF312864	CCDS1362.1	1q25	2008-07-18			ENSG00000116667	ENSG00000116667			15494	protein-coding gene	gene with protein product	"""proliferation-inducing protein 13"""					11318611	Standard	NM_030806		Approved	PIG13	uc001gqv.1	Q9H246	OTTHUMG00000035386	ENST00000235307.6:c.*61A>G	1.37:g.184588751A>G		Somatic	0	54	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	34	39.66	B2R551	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000235307.6	37	NULL	CCDS1362.1	1																																																																																			-	-		0.408	C1orf21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf21	protein_coding	OTTHUMT00000085784.2	A	NM_030806	-		184588751	+1	no_errors	ENST00000367514	ensembl	human	known	74_37	rna	SNP	1.000	G
TGFBI	7045	genome.wustl.edu	37	5	135382982	135382982	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr5:135382982C>T	ENST00000442011.2	+	6	805	c.644C>T	c.(643-645)gCc>gTc	p.A215V	TGFBI_ENST00000305126.8_Missense_Mutation_p.A215V	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	215	FAS1 1. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GTGAACTGTGCCCGGCTGCTG	0.527																																																	0								ENSG00000120708						108.0	104.0	105.0					5																	135382982		2068	4213	6281	TGFBI	SO:0001583	missense	0			-	HGNC	M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.644C>T	5.37:g.135382982C>T	ENSP00000416330:p.Ala215Val	Somatic	0	49	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_EMI_domain,pfscan_FAS1_domain	p.A215V	ENST00000442011.2	37	c.644	CCDS47266.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.296708	0.95574	.	.	ENSG00000120708	ENST00000442011;ENST00000305126	D;D	0.92397	-3.03;-3.03	6.04	6.04	0.98038	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.96787	0.8951	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95855	0.8878	10	0.48119	T	0.1	-27.5502	20.5792	0.99380	0.0:1.0:0.0:0.0	.	215	Q15582	BGH3_HUMAN	V	215	ENSP00000416330:A215V;ENSP00000306306:A215V	ENSP00000306306:A215V	A	+	2	0	TGFBI	135410881	1.000000	0.71417	0.955000	0.39395	0.713000	0.41058	7.818000	0.86416	2.873000	0.98535	0.561000	0.74099	GCC	-	pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pfscan_FAS1_domain		0.527	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBI	protein_coding	OTTHUMT00000372108.1	C		-		135382982	+1	no_errors	ENST00000305126	ensembl	human	known	74_37	missense	SNP	1.000	T
LILRB5	10990	genome.wustl.edu	37	19	54758267	54758267	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr19:54758267C>A	ENST00000316219.5	-	7	1374	c.1267G>T	c.(1267-1269)Gat>Tat	p.D423Y	LILRB5_ENST00000345866.6_Missense_Mutation_p.D323Y|LILRB5_ENST00000450632.1_Missense_Mutation_p.D414Y|LILRB5_ENST00000449561.2_Missense_Mutation_p.D423Y	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	423					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGGCTGGGATCCCCAGAGGGT	0.637																																																	0								ENSG00000105609						27.0	30.0	29.0					19																	54758267		2196	4296	6492	LILRB5	SO:0001583	missense	0			-	HGNC	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1267G>T	19.37:g.54758267C>A	ENSP00000320390:p.Asp423Tyr	Somatic	0	61	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	40	16.67	Q8N760	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D414Y	ENST00000316219.5	37	c.1240	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	C	8.966	0.971728	0.18736	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00491	7.07;7.02;7.07;7.1	1.96	-3.93	0.04143	.	.	.	.	.	T	0.00724	0.0024	M	0.66939	2.045	0.09310	N	1	D;D;B;P	0.57257	0.966;0.979;0.251;0.93	P;P;B;P	0.53593	0.73;0.62;0.159;0.454	T	0.15292	-1.0442	9	0.62326	D	0.03	.	3.0058	0.06028	0.1405:0.2536:0.475:0.1309	.	414;323;423;423	C9JMK7;O75023-2;O75023-3;O75023	.;.;.;LIRB5_HUMAN	Y	423;414;423;323	ENSP00000320390:D423Y;ENSP00000414225:D414Y;ENSP00000406478:D423Y;ENSP00000263430:D323Y	ENSP00000320390:D423Y	D	-	1	0	LILRB5	59450079	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.303000	0.08210	-2.004000	0.00961	-1.548000	0.00902	GAT	-	NULL		0.637	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	protein_coding	OTTHUMT00000142877.2	C		-		54758267	-1	no_errors	ENST00000450632	ensembl	human	known	74_37	missense	SNP	0.000	A
FAM171A1	221061	genome.wustl.edu	37	10	15263009	15263009	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr10:15263009G>A	ENST00000378116.4	-	6	811	c.805C>T	c.(805-807)Ctg>Ttg	p.L269L	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	269						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						GTCCACGTCAGCTGGCTGCCT	0.572																																																	0								ENSG00000148468						103.0	90.0	95.0					10																	15263009		2203	4300	6503	FAM171A1	SO:0001819	synonymous_variant	0			-	HGNC	AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.805C>T	10.37:g.15263009G>A		Somatic	0	38	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	D3DRT9|Q32M49|Q8N4I0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Uncharacterised_FAM171	p.L269	ENST00000378116.4	37	c.805	CCDS31154.1	10																																																																																			-	pfam_Uncharacterised_FAM171		0.572	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	protein_coding	OTTHUMT00000046984.1	G	XM_167709	-		15263009	-1	no_errors	ENST00000378116	ensembl	human	known	74_37	silent	SNP	1.000	A
ZDBF2	57683	genome.wustl.edu	37	2	207162097	207162097	+	Splice_Site	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr2:207162097G>T	ENST00000374423.3	+	4	574	c.188G>T	c.(187-189)aGt>aTt	p.S63I		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	63							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						CAAGAGAGCAGGTAAAGTAGT	0.368																																																	0								ENSG00000204186						134.0	126.0	129.0					2																	207162097		1910	4120	6030	ZDBF2	SO:0001630	splice_region_variant	0			-	HGNC	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.188+1G>T	2.37:g.207162097G>T		Somatic	0	36	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DBF,smart_Znf_DBF	p.S63I	ENST00000374423.3	37	c.188	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959685	0.34565	.	.	ENSG00000204186	ENST00000374423	T	0.17528	2.27	4.81	4.81	0.61882	.	.	.	.	.	T	0.13157	0.0319	L	0.36672	1.1	0.32449	N	0.545654	P	0.42078	0.77	B	0.29598	0.104	T	0.15464	-1.0436	9	0.66056	D	0.02	.	15.1494	0.72684	0.0:0.0:1.0:0.0	.	63	Q9HCK1	ZDBF2_HUMAN	I	63	ENSP00000363545:S63I	ENSP00000363545:S63I	S	+	2	0	ZDBF2	206870342	1.000000	0.71417	0.966000	0.40874	0.094000	0.18550	6.075000	0.71261	2.383000	0.81215	0.484000	0.47621	AGT	-	NULL		0.368	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	protein_coding	OTTHUMT00000336458.1	G	NM_020923	-	Missense_Mutation	207162097	+1	no_errors	ENST00000374423	ensembl	human	known	74_37	missense	SNP	1.000	T
KCNN3	3782	genome.wustl.edu	37	1	154680586	154680588	+	In_Frame_Del	DEL	GCT	GCT	-	rs149440400		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:154680586_154680588delGCT	ENST00000271915.4	-	8	2375_2377	c.2060_2062delAGC	c.(2059-2064)cagctc>ctc	p.Q687del	KCNN3_ENST00000515643.1_5'UTR|KCNN3_ENST00000361147.4_In_Frame_Del_p.Q382del|KCNN3_ENST00000358505.2_In_Frame_Del_p.Q374del	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	692					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GCAGACAGGAGCTGCTGCTGCTG	0.64																																																	0								ENSG00000143603																																			KCNN3	SO:0001651	inframe_deletion	0				HGNC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.2060_2062delAGC	1.37:g.154680595_154680597delGCT	ENSP00000271915:p.Gln687del	Somatic	0	47	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	51	8.93	B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.Q687in_frame_del	ENST00000271915.4	37	c.2062_2060	CCDS30880.1	1																																																																																			-	NULL		0.640	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	protein_coding	OTTHUMT00000090688.3	GCT	NM_002249			154680588	-1	no_errors	ENST00000271915	ensembl	human	novel	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
ZRSR2	8233	genome.wustl.edu	37	X	15836747	15836747	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chrX:15836747T>A	ENST00000307771.7	+	9	833	c.809T>A	c.(808-810)gTa>gAa	p.V270E		NM_005089.3	NP_005080.1	Q15696	U2AFM_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2	270	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	U12-type spliceosomal complex (GO:0005689)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|pre-mRNA 3'-splice site binding (GO:0030628)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(38)|kidney(1)|large_intestine(2)|ovary(2)	48	Hepatocellular(33;0.183)					AGGGGCAATGTATATGTTCAG	0.403			"""F, S, Mis"""		"""MDS, CLL"""																																NSCLC(197;1631 3042 5741 31152)			Rec	yes		X	Xp22.1	8233	"""zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 2"""		L	0								ENSG00000169249						255.0	189.0	211.0					X																	15836747		2203	4300	6503	ZRSR2	SO:0001583	missense	0			-	HGNC	BC050451	CCDS14172.1	Xp22.1	2014-09-17	2006-09-26	2006-09-26	ENSG00000169249	ENSG00000169249		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	23019	protein-coding gene	gene with protein product		300028	"""U2(RNU2) small nuclear RNA auxiliary factor 1-like 2"", ""U2 small nuclear RNA auxiliary factor 1-like 2"""	U2AF1L2		8586425, 9237760, 15146077	Standard	NM_005089		Approved	U2AF1-RS2, URP	uc004cxg.4	Q15696	OTTHUMG00000021184	ENST00000307771.7:c.809T>A	X.37:g.15836747T>A	ENSP00000303015:p.Val270Glu	Somatic	0	31	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.51	Q14D69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.V270E	ENST00000307771.7	37	c.809	CCDS14172.1	X	.	.	.	.	.	.	.	.	.	.	T	21.8	4.197565	0.79015	.	.	ENSG00000169249	ENST00000307771	.	.	.	5.44	5.44	0.79542	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.86892	0.6042	H	0.95574	3.69	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90768	0.4670	9	0.87932	D	0	.	14.6192	0.68572	0.0:0.0:0.0:1.0	.	270	Q15696	U2AFM_HUMAN	E	270	.	ENSP00000303015:V270E	V	+	2	0	ZRSR2	15746668	1.000000	0.71417	0.976000	0.42696	0.856000	0.48823	7.806000	0.86020	1.833000	0.53350	0.425000	0.28330	GTA	-	pfam_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small		0.403	ZRSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZRSR2	protein_coding	OTTHUMT00000055889.1	T	NM_005089	-		15836747	+1	no_errors	ENST00000307771	ensembl	human	known	74_37	missense	SNP	1.000	A
PRX	57716	genome.wustl.edu	37	19	40900931	40900931	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr19:40900931C>A	ENST00000324001.7	-	7	3598	c.3328G>T	c.(3328-3330)Ggg>Tgg	p.G1110W	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	1110	Glu-rich (acidic).				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCTGCCCTCCCTTCCTCCTGG	0.662																																																	0								ENSG00000105227						56.0	54.0	55.0					19																	40900931		2203	4300	6503	PRX	SO:0001583	missense	0			-	HGNC	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.3328G>T	19.37:g.40900931C>A	ENSP00000326018:p.Gly1110Trp	Somatic	0	39	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G1110W	ENST00000324001.7	37	c.3328	CCDS33028.1	19	.	.	.	.	.	.	.	.	.	.	C	9.311	1.055691	0.19907	.	.	ENSG00000105227	ENST00000324001	T	0.01076	5.37	4.9	4.9	0.64082	.	0.547049	0.16639	N	0.205718	T	0.04003	0.0112	L	0.53249	1.67	0.24293	N	0.995153	D	0.61697	0.99	P	0.62014	0.897	T	0.30707	-0.9969	10	0.72032	D	0.01	-7.0052	10.6333	0.45549	0.1913:0.8087:0.0:0.0	.	1110	Q9BXM0	PRAX_HUMAN	W	1110	ENSP00000326018:G1110W	ENSP00000326018:G1110W	G	-	1	0	PRX	45592771	0.004000	0.15560	0.323000	0.25347	0.062000	0.15995	1.899000	0.39818	2.558000	0.86282	0.491000	0.48974	GGG	-	NULL		0.662	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	protein_coding	OTTHUMT00000462582.1	C	NM_020956	-		40900931	-1	no_errors	ENST00000324001	ensembl	human	known	74_37	missense	SNP	0.200	A
TCF20	6942	genome.wustl.edu	37	22	42610573	42610575	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	AGG	AGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr22:42610573_42610575delAGG	ENST00000359486.3	-	1	873_875	c.737_739delCCT	c.(736-741)tccttc>ttc	p.S246del	TCF20_ENST00000335626.4_In_Frame_Del_p.S246del	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	246	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GGTGAAGGGAaggaggaggagga	0.507																																																	0								ENSG00000100207																																			TCF20	SO:0001651	inframe_deletion	0				HGNC	U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.737_739delCCT	22.37:g.42610582_42610584delAGG	ENSP00000352463:p.Ser246del	Somatic	0	43	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Znf_PHD	p.S246in_frame_del	ENST00000359486.3	37	c.739_737	CCDS14033.1	22																																																																																			-	NULL		0.507	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	protein_coding	OTTHUMT00000320531.1	AGG	NM_181492			42610575	-1	no_errors	ENST00000359486	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
PIF1	80119	genome.wustl.edu	37	15	65108804	65108804	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:65108804G>A	ENST00000268043.4	-	12	1929	c.1835C>T	c.(1834-1836)gCc>gTc	p.A612V	PIF1_ENST00000333425.6_Missense_Mutation_p.A612V|PIF1_ENST00000559239.1_Missense_Mutation_p.A612V					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						CCGCAGGGTGGCATAGAAGTG	0.662																																																	0								ENSG00000140451						52.0	61.0	58.0					15																	65108804		2202	4299	6501	PIF1	SO:0001583	missense	0			-	HGNC	AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.1835C>T	15.37:g.65108804G>A	ENSP00000268043:p.Ala612Val	Somatic	0	41	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_helicase_Pif1,pfam_DNA_helicase,superfamily_P-loop_NTPase	p.A612V	ENST00000268043.4	37	c.1835	CCDS10195.2	15	.	.	.	.	.	.	.	.	.	.	G	19.50	3.839961	0.71488	.	.	ENSG00000140451	ENST00000268043;ENST00000333425	T;T	0.77877	-0.11;-1.13	5.88	5.88	0.94601	.	0.232564	0.44688	D	0.000425	T	0.61060	0.2317	N	0.08118	0	0.39015	D	0.95963	B	0.28258	0.205	B	0.15484	0.013	T	0.61451	-0.7060	10	0.40728	T	0.16	-14.7332	17.7361	0.88394	0.0:0.0:1.0:0.0	.	612	Q9H611	PIF1_HUMAN	V	612	ENSP00000268043:A612V;ENSP00000328174:A612V	ENSP00000268043:A612V	A	-	2	0	PIF1	62895857	0.919000	0.31177	0.998000	0.56505	0.997000	0.91878	0.826000	0.27407	2.782000	0.95742	0.655000	0.94253	GCC	-	superfamily_P-loop_NTPase		0.662	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIF1	protein_coding	OTTHUMT00000256533.1	G	NM_025049	-		65108804	-1	no_errors	ENST00000333425	ensembl	human	known	74_37	missense	SNP	0.996	A
HMCN1	83872	genome.wustl.edu	37	1	186089277	186089277	+	Splice_Site	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:186089277G>A	ENST00000271588.4	+	80	12458	c.12229G>A	c.(12229-12231)Gtt>Att	p.V4077I	HMCN1_ENST00000367492.2_Splice_Site_p.V4077I	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4077					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AAATGTCCAAGGTACCTAAAT	0.408																																																	0								ENSG00000143341						43.0	45.0	44.0					1																	186089277		2203	4300	6503	HMCN1	SO:0001630	splice_region_variant	0			-	HGNC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12229+1G>A	1.37:g.186089277G>A		Somatic	0	71	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	48	38.46	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.V4077I	ENST00000271588.4	37	c.12229	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.922398	0.92319	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.36157	1.27;1.27	6.05	6.05	0.98169	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.57315	0.2045	L	0.53617	1.68	0.80722	D	1	D	0.56035	0.974	D	0.66716	0.946	T	0.44236	-0.9341	10	0.38643	T	0.18	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	4077	Q96RW7	HMCN1_HUMAN	I	4077	ENSP00000271588:V4077I;ENSP00000356462:V4077I	ENSP00000271588:V4077I	V	+	1	0	HMCN1	184355900	1.000000	0.71417	1.000000	0.80357	0.523000	0.34469	7.883000	0.87264	2.878000	0.98634	0.650000	0.86243	GTT	-	NULL		0.408	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	protein_coding	OTTHUMT00000131848.1	G	NM_031935	-	Missense_Mutation	186089277	+1	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	SNP	1.000	A
ANKRD11	29123	genome.wustl.edu	37	16	89348444	89348444	+	Silent	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr16:89348444G>T	ENST00000301030.4	-	9	4966	c.4506C>A	c.(4504-4506)ccC>ccA	p.P1502P	ANKRD11_ENST00000378330.2_Silent_p.P1502P	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1502	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CCCTGGTGGCGGGCTTCTGCT	0.647																																																	0								ENSG00000167522						57.0	48.0	51.0					16																	89348444		2198	4300	6498	ANKRD11	SO:0001819	synonymous_variant	0			-	HGNC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.4506C>A	16.37:g.89348444G>T		Somatic	0	54	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q6NTG1|Q6QMF8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P1502	ENST00000301030.4	37	c.4506	CCDS32513.1	16																																																																																			-	NULL		0.647	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	protein_coding	OTTHUMT00000430462.3	G	NM_013275	-		89348444	-1	no_errors	ENST00000301030	ensembl	human	known	74_37	silent	SNP	0.008	T
MAPKBP1	23005	genome.wustl.edu	37	15	42106769	42106769	+	Silent	SNP	G	G	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr15:42106769G>A	ENST00000456763.2	+	11	1216	c.1020G>A	c.(1018-1020)gcG>gcA	p.A340A	MAPKBP1_ENST00000221214.6_Intron|MAPKBP1_ENST00000260357.7_Silent_p.A222A|MAPKBP1_ENST00000514566.1_Silent_p.A334A|MAPKBP1_ENST00000457542.2_Silent_p.A334A	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	340										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CTGGAGTGGCGAATGCCAGGT	0.488																																																	0								ENSG00000137802						212.0	177.0	189.0					15																	42106769		2203	4300	6503	MAPKBP1	SO:0001819	synonymous_variant	0			-	HGNC	AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1020G>A	15.37:g.42106769G>A		Somatic	0	71	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	39	20.41	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A340	ENST00000456763.2	37	c.1020	CCDS45239.1	15																																																																																			-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.488	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	protein_coding	OTTHUMT00000359745.1	G	NM_014994	-		42106769	+1	no_errors	ENST00000456763	ensembl	human	known	74_37	silent	SNP	0.547	A
RIN2	54453	genome.wustl.edu	37	20	19970901	19970901	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr20:19970901A>G	ENST00000255006.6	+	9	2310	c.2161A>G	c.(2161-2163)Atg>Gtg	p.M721V	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Missense_Mutation_p.M239V	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	672	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AAAGAAGGTCATGCTGCTGCT	0.557																																																	0								ENSG00000132669						45.0	46.0	46.0					20																	19970901		2056	4207	6263	RIN2	SO:0001583	missense	0			-	HGNC	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.2161A>G	20.37:g.19970901A>G	ENSP00000255006:p.Met721Val	Somatic	0	40	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	Q00425|Q5TFT8|Q9BQL3|Q9H071	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.M721V	ENST00000255006.6	37	c.2161	CCDS56182.1	20	.	.	.	.	.	.	.	.	.	.	A	10.92	1.486371	0.26686	.	.	ENSG00000132669	ENST00000255006;ENST00000440354	T;T	0.28255	1.62;1.62	5.83	4.67	0.58626	Vacuolar sorting protein 9, subgroup (1);Vacuolar sorting protein 9 (2);	0.272590	0.45606	D	0.000342	T	0.15869	0.0382	N	0.11201	0.11	0.37198	D	0.904223	B;P	0.40144	0.028;0.704	B;B	0.36608	0.039;0.229	T	0.17167	-1.0378	9	.	.	.	-37.1052	12.4251	0.55542	0.8599:0.1401:0.0:0.0	.	239;672	E7EPJ1;Q8WYP3	.;RIN2_HUMAN	V	721;239	ENSP00000255006:M721V;ENSP00000391239:M239V	.	M	+	1	0	RIN2	19918901	0.989000	0.36119	1.000000	0.80357	0.991000	0.79684	1.054000	0.30455	2.225000	0.72522	0.482000	0.46254	ATG	-	pfam_VPS9,smart_VPS9_subgr,pfscan_VPS9		0.557	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	protein_coding	OTTHUMT00000078212.1	A		-		19970901	+1	no_errors	ENST00000255006	ensembl	human	known	74_37	missense	SNP	1.000	G
SCN2A	6326	genome.wustl.edu	37	2	166223861	166223861	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr2:166223861C>A	ENST00000375437.2	+	19	3945	c.3655C>A	c.(3655-3657)Ctg>Atg	p.L1219M	SCN2A_ENST00000283256.6_Missense_Mutation_p.L1219M|SCN2A_ENST00000357398.3_Missense_Mutation_p.L1219M|SCN2A_ENST00000375427.2_Missense_Mutation_p.L1219M	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1219					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTCATGATTCTGCTGAGCAG	0.428																																																	0								ENSG00000136531						157.0	140.0	146.0					2																	166223861		2203	4300	6503	SCN2A	SO:0001583	missense	0			-	HGNC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.3655C>A	2.37:g.166223861C>A	ENSP00000364586:p.Leu1219Met	Somatic	0	61	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.L1219M	ENST00000375437.2	37	c.3655	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.172573	0.78452	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98090	-4.71;-4.71;-4.71;-4.71	6.07	6.07	0.98685	.	0.000000	0.56097	D	0.000034	D	0.98676	0.9556	M	0.78285	2.405	0.51767	D	0.999939	D;D	0.69078	0.995;0.997	D;D	0.66979	0.948;0.944	D	0.99274	1.0894	10	0.87932	D	0	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1219;1219	Q99250-2;Q99250	.;SCN2A_HUMAN	M	1219	ENSP00000364586:L1219M;ENSP00000349973:L1219M;ENSP00000283256:L1219M;ENSP00000364576:L1219M	ENSP00000283256:L1219M	L	+	1	2	SCN2A	165932107	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.300000	0.51834	2.885000	0.99019	0.655000	0.94253	CTG	-	NULL		0.428	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	protein_coding	OTTHUMT00000102659.2	C	NM_021007	-		166223861	+1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	SNP	1.000	A
TMEM11	8834	genome.wustl.edu	37	17	21101707	21101707	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr17:21101707A>T	ENST00000317635.5	-	2	980	c.509T>A	c.(508-510)cTg>cAg	p.L170Q	TMEM11_ENST00000584432.1_5'UTR	NM_003876.2	NP_003867.1	P17152	TMM11_HUMAN	transmembrane protein 11	170					mitochondrion organization (GO:0007005)	integral component of mitochondrial inner membrane (GO:0031305)|integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						CGTGTTGTGCAGTCTCTTTCT	0.542																																																	0								ENSG00000178307						182.0	151.0	161.0					17																	21101707		2203	4300	6503	TMEM11	SO:0001583	missense	0			-	HGNC	BC002819	CCDS11216.1	17p11.1	2011-08-12	2005-09-08	2005-09-08		ENSG00000178307			16823	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 35"""	C17orf35		2110658, 21274005	Standard	NM_003876		Approved	PMI, PM1	uc002gyp.2	P17152		ENST00000317635.5:c.509T>A	17.37:g.21101707A>T	ENSP00000319992:p.Leu170Gln	Somatic	0	64	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	64	8.57	Q53YB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L170Q	ENST00000317635.5	37	c.509	CCDS11216.1	17	.	.	.	.	.	.	.	.	.	.	A	24.9	4.580136	0.86645	.	.	ENSG00000178307	ENST00000317635	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.78742	0.4331	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.81127	-0.1074	9	0.87932	D	0	-15.958	16.1063	0.81225	1.0:0.0:0.0:0.0	.	170	P17152	TMM11_HUMAN	Q	170	.	ENSP00000319992:L170Q	L	-	2	0	TMEM11	21042299	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.788000	0.91834	2.205000	0.71048	0.528000	0.53228	CTG	-	NULL		0.542	TMEM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM11	protein_coding	OTTHUMT00000444150.2	A	NM_003876	-		21101707	-1	no_errors	ENST00000317635	ensembl	human	known	74_37	missense	SNP	1.000	T
GRIK2	2898	genome.wustl.edu	37	6	102307208	102307208	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr6:102307208G>T	ENST00000421544.1	+	10	1854	c.1364G>T	c.(1363-1365)gGt>gTt	p.G455V	GRIK2_ENST00000369138.1_Missense_Mutation_p.G455V|GRIK2_ENST00000318991.6_Missense_Mutation_p.G455V|GRIK2_ENST00000369137.3_Missense_Mutation_p.G455V|GRIK2_ENST00000369134.4_Missense_Mutation_p.G406V|GRIK2_ENST00000413795.1_Missense_Mutation_p.G455V	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	455					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CCTCTCTATGGTAATGATCGA	0.348																																																	0								ENSG00000164418						133.0	125.0	128.0					6																	102307208		2203	4300	6503	GRIK2	SO:0001583	missense	0			-	HGNC		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1364G>T	6.37:g.102307208G>T	ENSP00000397026:p.Gly455Val	Somatic	0	32	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G455V	ENST00000421544.1	37	c.1364	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	G	26.2	4.718954	0.89205	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076;ENST00000455610;ENST00000436862	T;T;T;T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36;-1.36	4.91	4.91	0.64330	Glutamate receptor, L-glutamate/glycine-binding (2);Ionotropic glutamate receptor (1);	0.117912	0.64402	D	0.000019	D	0.91466	0.7306	M	0.92738	3.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93428	0.6783	10	0.87932	D	0	.	18.456	0.90721	0.0:0.0:1.0:0.0	.	455;455;455	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	V	455;455;455;455;455;455;406;417;168;54	ENSP00000397026:G455V;ENSP00000405596:G455V;ENSP00000358134:G455V;ENSP00000358133:G455V;ENSP00000313276:G455V;ENSP00000358130:G406V;ENSP00000391988:G168V;ENSP00000407140:G54V	ENSP00000313276:G455V	G	+	2	0	GRIK2	102413901	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.332000	0.96446	2.401000	0.81631	0.591000	0.81541	GGT	-	pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd		0.348	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	protein_coding	OTTHUMT00000043718.1	G		-		102307208	+1	no_errors	ENST00000421544	ensembl	human	known	74_37	missense	SNP	1.000	T
GABRD	2563	genome.wustl.edu	37	1	1957077	1957077	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr1:1957077A>C	ENST00000378585.4	+	4	453	c.370A>C	c.(370-372)Acc>Ccc	p.T124P		NM_000815.4	NP_000806.2	O14764	GBRD_HUMAN	gamma-aminobutyric acid (GABA) A receptor, delta	124					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			central_nervous_system(2)|endometrium(3)|kidney(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;2.7e-19)|all_lung(118;1.22e-08)|Lung NSC(185;1.24e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;2.19e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.17e-24)|GBM - Glioblastoma multiforme(42;9.56e-08)|Colorectal(212;4.12e-05)|COAD - Colon adenocarcinoma(227;0.000194)|Kidney(185;0.00231)|BRCA - Breast invasive adenocarcinoma(365;0.00441)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0344)|Lung(427;0.2)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GCTGCCCGACACCTTCATCGT	0.632																																																	0								ENSG00000187730						102.0	98.0	99.0					1																	1957077		2203	4300	6503	GABRD	SO:0001583	missense	0			-	HGNC	BC033801	CCDS36.1	1p36.3	2012-06-22			ENSG00000187730	ENSG00000187730		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4084	protein-coding gene	gene with protein product	"""GABA(A) receptor, delta"""	137163				2176788, 10965146	Standard	NM_000815		Approved		uc001aip.2	O14764	OTTHUMG00000041064	ENST00000378585.4:c.370A>C	1.37:g.1957077A>C	ENSP00000367848:p.Thr124Pro	Somatic	0	52	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	53	25.35	Q8N4N9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAd_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.T124P	ENST00000378585.4	37	c.370	CCDS36.1	1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.691640	0.88735	.	.	ENSG00000187730	ENST00000378585	T	0.80824	-1.42	4.54	4.54	0.55810	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.87826	0.6275	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89027	0.3439	10	0.72032	D	0.01	-2.7808	13.517	0.61545	1.0:0.0:0.0:0.0	.	124	O14764	GBRD_HUMAN	P	124	ENSP00000367848:T124P	ENSP00000367848:T124P	T	+	1	0	GABRD	1946937	1.000000	0.71417	1.000000	0.80357	0.797000	0.45037	8.864000	0.92294	2.042000	0.60477	0.459000	0.35465	ACC	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel		0.632	GABRD-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	GABRD	protein_coding	OTTHUMT00000098493.1	A	NM_000815	-		1957077	+1	no_errors	ENST00000378585	ensembl	human	known	74_37	missense	SNP	1.000	C
RCE1	9986	genome.wustl.edu	37	11	66612684	66612684	+	Missense_Mutation	SNP	G	G	A	rs371258472		TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr11:66612684G>A	ENST00000309657.3	+	6	711	c.667G>A	c.(667-669)Gtg>Atg	p.V223M	RCE1_ENST00000524506.1_Missense_Mutation_p.V223M|RCE1_ENST00000525356.1_Missense_Mutation_p.V100M	NM_001032279.1|NM_005133.2	NP_001027450.1|NP_005124.1	Q9Y256	FACE2_HUMAN	Ras converting CAAX endopeptidase 1	223					CAAX-box protein processing (GO:0071586)|proteolysis (GO:0006508)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|metalloendopeptidase activity (GO:0004222)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10						CCAGAGCAGCGTGGGGAACAT	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		22525	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000173653						152.0	123.0	133.0					11																	66612684		2200	4295	6495	RCE1	SO:0001583	missense	0			-	HGNC	AF121951	CCDS8151.1	11q13	2013-10-18	2013-10-18	2001-06-29	ENSG00000173653	ENSG00000173653			13721	protein-coding gene	gene with protein product	"""farnesylated protein-converting enzyme 2"", ""prenyl protein-specific endoprotease 2"", ""RCE1 homolog, prenyl protein protease"", ""CAAX prenyl protease 2"""	605385	"""RCE1 (S. Cerevisiae) homolog, prenyl protein protease"", ""RCE1 homolog, prenyl protein peptidase (S. cerevisiae)"", ""RCE1 homolog, prenyl protein protease (S. cerevisiae)"""	RCE1A, RCE1B		10085068, 10373325	Standard	NM_005133		Approved	hRCE1, FACE-2, FACE2	uc001ojk.1	Q9Y256	OTTHUMG00000167098	ENST00000309657.3:c.667G>A	11.37:g.66612684G>A	ENSP00000309163:p.Val223Met	Somatic	0	58	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q52LZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CAAX_protease	p.V223M	ENST00000309657.3	37	c.667	CCDS8151.1	11	.	.	.	.	.	.	.	.	.	.	G	11.96	1.793793	0.31777	.	.	ENSG00000173653	ENST00000309657;ENST00000524506;ENST00000525356	.	.	.	4.43	3.35	0.38373	.	0.156942	0.40640	N	0.001052	T	0.44746	0.1308	L	0.39514	1.22	0.46823	D	0.999219	B	0.28584	0.216	B	0.25405	0.06	T	0.41484	-0.9506	9	0.54805	T	0.06	-11.5375	8.4126	0.32653	0.1488:0.0:0.8512:0.0	.	223	Q9Y256	FACE2_HUMAN	M	223;223;100	.	ENSP00000309163:V223M	V	+	1	0	RCE1	66369260	0.119000	0.22226	0.999000	0.59377	0.992000	0.81027	0.359000	0.20233	0.961000	0.38030	0.655000	0.94253	GTG	-	pfam_CAAX_protease		0.517	RCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCE1	protein_coding	OTTHUMT00000393105.1	G	NM_005133	-		66612684	+1	no_errors	ENST00000309657	ensembl	human	known	74_37	missense	SNP	0.996	A
SETD1A	9739	genome.wustl.edu	37	16	30982809	30982811	+	In_Frame_Del	DEL	TCC	TCC	-	rs531337171|rs569719496	byFrequency	TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr16:30982809_30982811delTCC	ENST00000262519.8	+	13	3813_3815	c.3127_3129delTCC	c.(3127-3129)tccdel	p.S1058del		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1058	Ser-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CAGctcctcatcctcctcctcct	0.547																																																	0								ENSG00000099381																																			SETD1A	SO:0001651	inframe_deletion	0				HGNC	AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3127_3129delTCC	16.37:g.30982818_30982820delTCC	ENSP00000262519:p.Ser1058del	Somatic	0	58	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A6NP62|Q6PIF3|Q8TAJ6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.S1046in_frame_del	ENST00000262519.8	37	c.3127_3129	CCDS32435.1	16																																																																																			-	NULL		0.547	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	protein_coding	OTTHUMT00000318244.2	TCC	NM_014712			30982811	+1	no_errors	ENST00000262519	ensembl	human	known	74_37	in_frame_del	DEL	0.734:0.781:0.676	-
ALG1L	200810	genome.wustl.edu	37	3	125648532	125648532	+	Intron	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr3:125648532C>T	ENST00000340333.3	-	6	512				FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like								transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						CTAACTCTCTCACTTGGACTC	0.577																																																	0								ENSG00000171084																																			FAM86JP	SO:0001627	intron_variant	0			-	HGNC	BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588	ENST00000340333.3:c.349-122G>A	3.37:g.125648532C>T		Somatic	0	43	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	36	30.77	D3DNA5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000340333.3	37	NULL	CCDS33840.1	3																																																																																			-	-		0.577	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86JP	protein_coding	OTTHUMT00000356347.1	C	NM_001015050	-		125648532	+1	no_errors	ENST00000467239	ensembl	human	known	74_37	rna	SNP	0.001	T
NRIP1	8204	genome.wustl.edu	37	21	16333666	16333666	+	3'UTR	SNP	C	C	T			TCGA-DX-A8BV-01A-11D-A37C-09	TCGA-DX-A8BV-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0853cc02-3315-40eb-8997-db4b02d27661	8533ae18-96d9-4fd5-b003-3dd8024121d2	g.chr21:16333666C>T	ENST00000400202.1	-	0	7560				NRIP1_ENST00000400199.1_3'UTR|NRIP1_ENST00000318948.4_3'UTR|AF127577.10_ENST00000446301.1_RNA			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1						androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TTCATGACATCACATGAAGAA	0.279																																																	0								ENSG00000229047																																			AF127577.10	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.*3371G>A	21.37:g.16333666C>T		Somatic	0	41	0.00		0.665074021194338	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	Q8IWE8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000400202.1	37	NULL	CCDS13568.1	21																																																																																			-	-		0.279	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ENSG00000229047	protein_coding	OTTHUMT00000157926.1	C	NM_003489	-		16333666	+1	no_errors	ENST00000446301	ensembl	human	known	74_37	rna	SNP	1.000	T
