#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
GIGYF2	26058	genome.wustl.edu	37	2	233708804	233708806	+	In_Frame_Del	DEL	CAA	CAA	-	rs3816334	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	CAA	CAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:233708804_233708806delCAA	ENST00000409547.1	+	26	3249_3251	c.2938_2940delCAA	c.(2938-2940)caadel	p.Q984del	GIGYF2_ENST00000373563.4_In_Frame_Del_p.Q984del|GIGYF2_ENST00000373566.3_In_Frame_Del_p.Q1006del|GIGYF2_ENST00000409480.1_In_Frame_Del_p.Q1006del|GIGYF2_ENST00000409196.3_In_Frame_Del_p.Q978del|GIGYF2_ENST00000452341.2_In_Frame_Del_p.T823del|GIGYF2_ENST00000409451.3_In_Frame_Del_p.Q1005del	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	984	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		gcagcagcagcaacagcaacagc	0.483																																																	0								ENSG00000204120																																			GIGYF2	SO:0001651	inframe_deletion	0				HGNC	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2938_2940delCAA	2.37:g.233708804_233708806delCAA	ENSP00000386537:p.Gln984del	Somatic	0	57	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.Q1005in_frame_del	ENST00000409547.1	37	c.3004_3006	CCDS33401.1	2																																																																																			-	NULL		0.483	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	protein_coding	OTTHUMT00000330316.2	CAA	NM_001103146			233708806	+1	no_errors	ENST00000373566	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.998	-
KIAA1549L	25758	genome.wustl.edu	37	11	33569421	33569421	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:33569421C>T	ENST00000321505.4	+	3	2786	c.2606C>T	c.(2605-2607)gCt>gTt	p.A869V	KIAA1549L_ENST00000265654.5_Missense_Mutation_p.A875V|KIAA1549L_ENST00000389726.3_Missense_Mutation_p.A875V			Q6ZVL6	K154L_HUMAN	KIAA1549-like	869						integral component of membrane (GO:0016021)											GATGTCTCAGCTCACGTAAGT	0.458																																																	0								ENSG00000110427						108.0	103.0	105.0					11																	33569421		1990	4187	6177	KIAA1549L	SO:0001583	missense	0			-	HGNC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2606C>T	11.37:g.33569421C>T	ENSP00000315295:p.Ala869Val	Somatic	0	43	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	20	35.48	B0QYU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A875V	ENST00000321505.4	37	c.2624	CCDS44565.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.8|27.8	4.865130|4.865130	0.91511|0.91511	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568|ENST00000526400	.|.	.|.	.|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	0.186460|.	0.45606|.	D|.	0.000346|.	T|T	0.74458|0.74458	0.3719|0.3719	M|M	0.66939|0.66939	2.045|2.045	0.38399|0.38399	D|D	0.945624|0.945624	D;D|.	0.89917|.	0.991;1.0|.	P;D|.	0.79108|.	0.8;0.992|.	T|T	0.74259|0.74259	-0.3723|-0.3723	9|5	0.54805|.	T|.	0.06|.	-17.3161|-17.3161	18.197|18.197	0.89825|0.89825	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	875;875|.	E9PAT2;Q6ZVL6-2|.	.;.|.	V|F	869;875;875;708|267	.|.	ENSP00000265654:A875V|.	A|L	+|+	2|1	0|0	C11orf41|C11orf41	33525997|33525997	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.815000|0.815000	0.46073|0.46073	5.275000|5.275000	0.65575|0.65575	2.740000|2.740000	0.93945|0.93945	0.455000|0.455000	0.32223|0.32223	GCT|CTC	-	NULL		0.458	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	protein_coding	OTTHUMT00000317998.1	C	NM_012194	-		33569421	+1	no_errors	ENST00000389726	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF512B	57473	genome.wustl.edu	37	20	62614400	62614400	+	Intron	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr20:62614400C>T	ENST00000450537.1	-	2	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Splice_Site_p.G24G			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TCTCCTGCAGCGCCACTGGCT	0.562																																																	0								ENSG00000101161						35.0	33.0	34.0					20																	62614400		2203	4300	6503	PRPF6	SO:0001627	intron_variant	0			-	HGNC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-15092G>A	20.37:g.62614400C>T		Somatic	0	44	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	32	28.89	Q08AK9|Q9ULM4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.G24	ENST00000450537.1	37	c.72	CCDS13548.1	20																																																																																			-	pfam_PRP1_N		0.562	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	protein_coding	OTTHUMT00000080246.1	C	NM_020713	-		62614400	+1	no_errors	ENST00000266079	ensembl	human	known	74_37	silent	SNP	0.848	T
HIP1	3092	genome.wustl.edu	37	7	75228536	75228536	+	Silent	SNP	C	C	T	rs372317584		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:75228536C>T	ENST00000336926.6	-	2	176	c.150G>A	c.(148-150)acG>acA	p.T50T	HIP1_ENST00000434438.2_Silent_p.T50T	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	50	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CCACTTCCTGCGTATTAATGG	0.498			T	PDGFRB	CMML																																			Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0								ENSG00000127946	C		0,4406		0,0,2203	148.0	150.0	149.0		150	-5.0	0.9	7		149	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	HIP1	NM_005338.5		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		50/1038	75228536	1,13005	2203	4300	6503	HIP1	SO:0001819	synonymous_variant	0			-	HGNC	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.150G>A	7.37:g.75228536C>T		Somatic	0	43	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ANTH_dom,pfam_ILWEQ_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ_dom,pfscan_Epsin-like_N,pfscan_ILWEQ_dom	p.T50	ENST00000336926.6	37	c.150	CCDS34669.1	7																																																																																			-	pfam_ANTH_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N		0.498	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	protein_coding	OTTHUMT00000342863.2	C	NM_005338	-		75228536	-1	no_errors	ENST00000336926	ensembl	human	known	74_37	silent	SNP	0.695	T
KAT7	11143	genome.wustl.edu	37	17	47903425	47903426	+	Frame_Shift_Ins	INS	-	-	GC			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:47903425_47903426insGC	ENST00000259021.4	+	13	1824_1825	c.1544_1545insGC	c.(1543-1548)gggcttfs	p.L516fs	KAT7_ENST00000503935.2_Frame_Shift_Ins_p.L360fs|KAT7_ENST00000424009.2_Frame_Shift_Ins_p.L486fs|KAT7_ENST00000510819.1_Frame_Shift_Ins_p.L347fs|KAT7_ENST00000509773.1_Frame_Shift_Ins_p.L406fs|KAT7_ENST00000435742.2_Frame_Shift_Ins_p.L330fs|KAT7_ENST00000454930.2_Frame_Shift_Ins_p.L377fs|KAT7_ENST00000513980.1_3'UTR	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	516	MYST-type HAT.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TCAGATCTGGGGCTTATAAGCT	0.421																																																	0								ENSG00000136504																																			KAT7	SO:0001589	frameshift_variant	0				HGNC	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.1545_1546dupGC	17.37:g.47903426_47903427dupGC	ENSP00000259021:p.Leu516fs	Somatic	0	108	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	35	43.55	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.L516fs	ENST00000259021.4	37	c.1544_1545	CCDS11554.1	17																																																																																			-	pfam_MOZ_SAS,superfamily_Acyl_CoA_acyltransferase		0.421	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	protein_coding	OTTHUMT00000366032.1	-	NM_007067			47903426	+1	no_errors	ENST00000259021	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.989	GC
ALLC	55821	genome.wustl.edu	37	2	3750075	3750075	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:3750075C>T	ENST00000252505.3	+	12	1260	c.1098C>T	c.(1096-1098)ttC>ttT	p.F366F	AC010907.5_ENST00000441632.1_RNA	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	385					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		TCCGGGGCTTCCCCAGCTCCA	0.607										HNSCC(21;0.051)																																							0								ENSG00000151360						23.0	26.0	25.0					2																	3750075		1872	4089	5961	ALLC	SO:0001819	synonymous_variant	0			-	HGNC	AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.1098C>T	2.37:g.3750075C>T		Somatic	0	19	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	Q53T95|Q5RL81|Q96RE6|Q9NZA7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Allantoicase_dom,superfamily_Galactose-bd-like,tigrfam_Allantoicase	p.F366	ENST00000252505.3	37	c.1098	CCDS46223.1	2																																																																																			-	superfamily_Galactose-bd-like		0.607	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALLC	protein_coding	OTTHUMT00000322855.1	C		-		3750075	+1	no_errors	ENST00000252505	ensembl	human	known	74_37	silent	SNP	0.993	T
DNAJC6	9829	genome.wustl.edu	37	1	65871755	65871755	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:65871755C>T	ENST00000395325.3	+	16	2416	c.2259C>T	c.(2257-2259)aaC>aaT	p.N753N	DNAJC6_ENST00000263441.7_Silent_p.N740N|DNAJC6_ENST00000371069.4_Silent_p.N810N	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	753	Pro-rich.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						CCAACTACAACGTGAGCTTCT	0.587																																																	0								ENSG00000116675						115.0	108.0	111.0					1																	65871755		2203	4300	6503	DNAJC6	SO:0001819	synonymous_variant	0			-	HGNC	AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.2259C>T	1.37:g.65871755C>T		Somatic	0	62	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	28	31.71	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_C2_dom,smart_DnaJ_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.N810	ENST00000395325.3	37	c.2430	CCDS30739.1	1																																																																																			-	superfamily_DnaJ_domain		0.587	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	protein_coding	OTTHUMT00000025134.1	C		-		65871755	+1	no_errors	ENST00000371069	ensembl	human	known	74_37	silent	SNP	0.096	T
CSMD1	64478	genome.wustl.edu	37	8	3265506	3265506	+	Missense_Mutation	SNP	C	C	A	rs559348370		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:3265506C>A	ENST00000520002.1	-	15	2544	c.1989G>T	c.(1987-1989)caG>caT	p.Q663H	CSMD1_ENST00000542608.1_Missense_Mutation_p.Q662H|CSMD1_ENST00000539096.1_Missense_Mutation_p.Q662H|CSMD1_ENST00000537824.1_Missense_Mutation_p.Q662H|CSMD1_ENST00000602723.1_Missense_Mutation_p.Q663H|CSMD1_ENST00000400186.3_Missense_Mutation_p.Q663H|CSMD1_ENST00000602557.1_Missense_Mutation_p.Q663H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	663	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGCTGGCCAGCTGGGAAGGCA	0.483																																																	0								ENSG00000183117						77.0	71.0	73.0					8																	3265506		1945	4149	6094	CSMD1	SO:0001583	missense	0			-	HGNC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1989G>T	8.37:g.3265506C>A	ENSP00000430733:p.Gln663His	Somatic	0	30	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	37	21.28	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.Q663H	ENST00000520002.1	37	c.1989		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.915|1.915	-0.449748|-0.449748	0.04572|0.04572	.|.	.|.	ENSG00000183117|ENSG00000183117	ENST00000335551|ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	.|T;T;T;T;T	.|0.18657	.|2.2;2.2;2.2;2.2;2.2	5.23|5.23	2.42|2.42	0.29668|0.29668	.|CUB (5);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.16811|0.16811	0.0404|0.0404	N|N	0.04203|0.04203	-0.255|-0.255	0.34904|0.34904	D|D	0.746789|0.746789	.|D;B	.|0.67145	.|0.996;0.022	.|D;B	.|0.85130	.|0.997;0.036	T|T	0.29274|0.29274	-1.0017|-1.0017	5|10	.|0.14656	.|T	.|0.56	.|.	5.3656|5.3656	0.16111|0.16111	0.1359:0.5768:0.0:0.2873|0.1359:0.5768:0.0:0.2873	.|.	.|663;663	.|E5RIG2;Q96PZ7	.|.;CSMD1_HUMAN	S|H	143|663;663;525;662;662;662	.|ENSP00000383047:Q663H;ENSP00000430733:Q663H;ENSP00000441462:Q662H;ENSP00000446243:Q662H;ENSP00000441675:Q662H	.|ENSP00000320445:Q525H	A|Q	-|-	1|3	0|2	CSMD1|CSMD1	3252913|3252913	0.044000|0.044000	0.20184|0.20184	1.000000|1.000000	0.80357|0.80357	0.928000|0.928000	0.56348|0.56348	-0.338000|-0.338000	0.07842|0.07842	0.584000|0.584000	0.29591|0.29591	-0.444000|-0.444000	0.05651|0.05651	GCT|CAG	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	C	NM_033225	-		3265506	-1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	SNP	0.991	A
ASIP	434	genome.wustl.edu	37	20	32848194	32848194	+	Missense_Mutation	SNP	G	G	A	rs145074053		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr20:32848194G>A	ENST00000568305.1	+	2	216	c.14G>A	c.(13-15)cGc>cAc	p.R5H	ASIP_ENST00000374954.3_Missense_Mutation_p.R5H|RP4-785G19.5_ENST00000512005.1_RNA			P42127	ASIP_HUMAN	agouti signaling protein	5					adult feeding behavior (GO:0008343)|cell-cell signaling (GO:0007267)|generation of precursor metabolites and energy (GO:0006091)|genetic imprinting (GO:0071514)|hormone-mediated signaling pathway (GO:0009755)|melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|regulation of molecular function, epigenetic (GO:0040030)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	receptor binding (GO:0005102)			central_nervous_system(1)|lung(2)	3						GATGTCACCCGCTTACTCCTG	0.582																																																	0								ENSG00000101440	G	HIS/ARG	0,4406		0,0,2203	123.0	114.0	117.0		14	3.2	1.0	20	dbSNP_134	117	1,8599	1.2+/-3.3	0,1,4299	no	missense	ASIP	NM_001672.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	5/133	32848194	1,13005	2203	4300	6503	ASIP	SO:0001583	missense	0			-	HGNC		CCDS13232.1	20q11.2-q12	2010-06-24	2010-06-24		ENSG00000101440	ENSG00000101440			745	protein-coding gene	gene with protein product	"""nonagouti homolog (mouse)"""	600201	"""agouti (mouse)-signaling protein"", ""agouti signaling protein, nonagouti homolog (mouse)"""	AGTIL		7937887, 7757071	Standard	NM_001672		Approved	ASP	uc002xah.1	P42127	OTTHUMG00000032289	ENST00000568305.1:c.14G>A	20.37:g.32848194G>A	ENSP00000454804:p.Arg5His	Somatic	0	52	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	57	18.57	Q3SXL2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Agouti,superfamily_Agouti_dom,smart_Agouti,pfscan_Agouti_dom	p.R5H	ENST00000568305.1	37	c.14	CCDS13232.1	20	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760491	0.49468	0.0	1.16E-4	ENSG00000101440	ENST00000374954	T	0.33216	1.42	5.3	3.24	0.37175	.	0.616301	0.16629	N	0.206151	T	0.22936	0.0554	L	0.41415	1.275	0.23162	N	0.998198	B	0.15473	0.013	B	0.06405	0.002	T	0.15037	-1.0451	10	0.59425	D	0.04	-4.6937	6.5837	0.22609	0.2141:0.0:0.7859:0.0	.	5	P42127	ASIP_HUMAN	H	5	ENSP00000364092:R5H	ENSP00000364092:R5H	R	+	2	0	ASIP	32311855	0.058000	0.20735	0.966000	0.40874	0.928000	0.56348	0.839000	0.27586	1.482000	0.48325	0.650000	0.86243	CGC	-	NULL		0.582	ASIP-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ASIP	protein_coding	OTTHUMT00000430541.1	G		rs145074053		32848194	+1	no_errors	ENST00000374954	ensembl	human	known	74_37	missense	SNP	0.668	A
TMEM2	23670	genome.wustl.edu	37	9	74360217	74360217	+	Missense_Mutation	SNP	C	C	A	rs139832017		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:74360217C>A	ENST00000377044.4	-	4	1290	c.751G>T	c.(751-753)Ggc>Tgc	p.G251C	TMEM2_ENST00000377066.5_Missense_Mutation_p.G251C	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	251					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		AAGGGCAAGCCTGAGGAATTC	0.512																																																	0								ENSG00000135048	C	CYS/GLY,CYS/GLY	0,4406		0,0,2203	83.0	77.0	79.0		751,751	6.0	1.0	9	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	TMEM2	NM_001135820.1,NM_013390.2	159,159	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	251/1321,251/1384	74360217	1,13005	2203	4300	6503	TMEM2	SO:0001583	missense	0			-	HGNC		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.751G>T	9.37:g.74360217C>A	ENSP00000366243:p.Gly251Cys	Somatic	0	46	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	21.82	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.G251C	ENST00000377044.4	37	c.751	CCDS6638.1	9	.	.	.	.	.	.	.	.	.	.	C	20.7	4.026866	0.75390	0.0	1.16E-4	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.79845	-1.31;-1.24	6.03	6.03	0.97812	.	0.044877	0.85682	D	0.000000	D	0.91459	0.7304	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.91595	0.5290	10	0.87932	D	0	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	251;251	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	C	251	ENSP00000366243:G251C;ENSP00000366266:G251C	ENSP00000366243:G251C	G	-	1	0	TMEM2	73550037	1.000000	0.71417	0.998000	0.56505	0.447000	0.32167	7.263000	0.78421	2.861000	0.98227	0.655000	0.94253	GGC	-	NULL		0.512	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM2	protein_coding	OTTHUMT00000052618.2	C	NM_013390	rs139832017		74360217	-1	no_errors	ENST00000377044	ensembl	human	known	74_37	missense	SNP	1.000	A
PDZD2	23037	genome.wustl.edu	37	5	32074487	32074487	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:32074487G>A	ENST00000438447.1	+	18	3663	c.3275G>A	c.(3274-3276)cGt>cAt	p.R1092H	PDZD2_ENST00000282493.3_Missense_Mutation_p.R1092H			O15018	PDZD2_HUMAN	PDZ domain containing 2	1092					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						TACACAGTCCGTACAGACACC	0.597																																																	0								ENSG00000133401						107.0	120.0	115.0					5																	32074487		2203	4300	6503	PDZD2	SO:0001583	missense	0			-	HGNC	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.3275G>A	5.37:g.32074487G>A	ENSP00000402033:p.Arg1092His	Somatic	0	67	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q9BXD4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R1092H	ENST00000438447.1	37	c.3275	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	A	11.92	1.782932	0.31502	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.05786	3.39;3.39	5.67	-8.89	0.00785	.	2.946450	0.01064	N	0.004689	T	0.01523	0.0049	N	0.00926	-1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.43360	-0.9396	10	0.13853	T	0.58	.	1.4019	0.02273	0.286:0.2412:0.3336:0.1392	.	918;1092	B4E3P2;O15018	.;PDZD2_HUMAN	H	1092;894;1092	ENSP00000402033:R1092H;ENSP00000282493:R1092H	ENSP00000282493:R1092H	R	+	2	0	PDZD2	32110244	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.137000	0.10389	-1.706000	0.01404	-0.360000	0.07572	CGT	-	NULL		0.597	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	protein_coding	OTTHUMT00000366608.1	G		-		32074487	+1	no_errors	ENST00000282493	ensembl	human	known	74_37	missense	SNP	0.000	A
USH2A	7399	genome.wustl.edu	37	1	216591866	216591866	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:216591866A>T	ENST00000307340.3	-	3	1027	c.641T>A	c.(640-642)cTt>cAt	p.L214H	USH2A_ENST00000366943.2_Missense_Mutation_p.L214H|USH2A_ENST00000366942.3_Missense_Mutation_p.L214H	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	214					hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTGCACACTAAGATGAATCCA	0.333										HNSCC(13;0.011)																																							0								ENSG00000042781						94.0	94.0	94.0					1																	216591866		2203	4300	6503	USH2A	SO:0001583	missense	0			-	HGNC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.641T>A	1.37:g.216591866A>T	ENSP00000305941:p.Leu214His	Somatic	0	72	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L214H	ENST00000307340.3	37	c.641	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	A	16.15	3.042993	0.55003	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.77750	-1.12;-1.12;-1.12	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase (1);LamG-like jellyroll fold (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.38436	U	0.001684	D	0.84624	0.5513	L	0.48362	1.52	0.54753	D	0.999981	P;D	0.89917	0.635;1.0	B;D	0.77557	0.255;0.99	D	0.86234	0.1639	10	0.87932	D	0	.	15.809	0.78543	1.0:0.0:0.0:0.0	.	214;214	O75445-2;O75445	.;USH2A_HUMAN	H	214	ENSP00000305941:L214H;ENSP00000355910:L214H;ENSP00000355909:L214H	ENSP00000305941:L214H	L	-	2	0	USH2A	214658489	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	6.414000	0.73318	2.131000	0.65755	0.533000	0.62120	CTT	-	superfamily_ConA-like_lec_gl_sf,smart_LamG-like		0.333	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	A	NM_007123	-		216591866	-1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	SNP	1.000	T
PCDHGA2	56113	genome.wustl.edu	37	5	140718933	140718933	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:140718933G>T	ENST00000394576.2	+	1	395	c.395G>T	c.(394-396)cGc>cTc	p.R132L	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	132	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATGCCCCTCGCTTTGGAGTA	0.428																																																	0								ENSG00000081853						70.0	71.0	70.0					5																	140718933		2203	4300	6503	PCDHGA2	SO:0001583	missense	0			-	HGNC	AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.395G>T	5.37:g.140718933G>T	ENSP00000378077:p.Arg132Leu	Somatic	0	31	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R132L	ENST00000394576.2	37	c.395	CCDS47289.1	5	.	.	.	.	.	.	.	.	.	.	.	8.208	0.799631	0.16397	.	.	ENSG00000081853	ENST00000394576	T	0.19532	2.14	5.26	4.4	0.53042	Cadherin (2);Cadherin-like (1);	0.171454	0.27826	U	0.017699	T	0.22437	0.0541	M	0.63428	1.95	0.22710	N	0.99883	B;B	0.23854	0.092;0.057	B;B	0.33690	0.168;0.017	T	0.22452	-1.0216	10	0.20046	T	0.44	.	6.9587	0.24585	0.155:0.1443:0.7007:0.0	.	132;132	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	L	132	ENSP00000378077:R132L	ENSP00000378077:R132L	R	+	2	0	PCDHGA2	140699117	0.000000	0.05858	1.000000	0.80357	0.809000	0.45718	-0.630000	0.05502	1.365000	0.46057	-0.140000	0.14226	CGC	-	superfamily_Cadherin-like,pfscan_Cadherin		0.428	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	protein_coding	OTTHUMT00000374738.1	G	NM_018915	-		140718933	+1	no_errors	ENST00000394576	ensembl	human	known	74_37	missense	SNP	0.987	T
GRAMD1A	57655	genome.wustl.edu	37	19	35491326	35491327	+	5'UTR	INS	-	-	GCCCT	rs71165697|rs3072398|rs34397853	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:35491326_35491327insGCCCT	ENST00000317991.5	+	0	136_137				GRAMD1A_ENST00000599564.1_Intron|GRAMD1A_ENST00000424536.2_5'Flank|GRAMD1A_ENST00000411896.2_5'Flank|GRAMD1A_ENST00000504615.2_5'UTR|CTD-2527I21.7_ENST00000600959.1_RNA	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A							integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			cgcgcagcccagccctgccctg	0.782														4907	0.979832	0.9561	0.9885	5008	,	,		4111	0.998		0.994	False		,,,				2504	0.9724																0								ENSG00000089351		,	616,100		305,6,47					,	0.6	1.0		dbSNP_102	1	1569,189		780,9,90	no	utr-5,utr-5	GRAMD1A	NM_020895.3,NM_001136199.1	,	1085,15,137	A1A1,A1R,RR		10.7509,13.9665,11.6815	,	,		2185,289				GRAMD1A	SO:0001623	5_prime_UTR_variant	0				HGNC	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.-56->GCCCT	19.37:g.35491332_35491336dupGCCCT		Somatic	NA	NA	NA		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NKY7|Q8NC77|Q9P1Z5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000317991.5	37	NULL	CCDS42546.1	19																																																																																			-	-		0.782	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	GRAMD1A	protein_coding	OTTHUMT00000461557.1	-	NM_020895			35491327	+1	no_errors	ENST00000603669	ensembl	human	known	74_37	rna	INS	0.780:0.776	GCCCT
YRDC	79693	genome.wustl.edu	37	1	38270052	38270052	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:38270052T>C	ENST00000373044.2	-	4	693	c.689A>G	c.(688-690)cAg>cGg	p.Q230R	C1orf122_ENST00000373043.1_5'Flank	NM_024640.3	NP_078916.3	Q86U90	YRDC_HUMAN	yrdC N(6)-threonylcarbamoyltransferase domain containing	230	YrdC-like. {ECO:0000255|PROSITE- ProRule:PRU00518}.				negative regulation of transport (GO:0051051)	membrane (GO:0016020)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)			lung(2)|upper_aerodigestive_tract(1)	3	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTCGGGGCTCTGGCCATCCCC	0.527																																																	0								ENSG00000196449						85.0	87.0	86.0					1																	38270052		2203	4300	6503	YRDC	SO:0001583	missense	0			-	HGNC		CCDS30675.1	1p34.3	2013-09-12	2013-09-12		ENSG00000196449	ENSG00000196449			28905	protein-coding gene	gene with protein product	"""ischemia/reperfusion inducible protein"""	612276	"""yrdC domain containing (E.coli)"", ""yrdC domain containing (E. coli)"""			12730717	Standard	NM_024640		Approved	FLJ23476, IRIP, SUA5	uc001cca.1	Q86U90	OTTHUMG00000004318	ENST00000373044.2:c.689A>G	1.37:g.38270052T>C	ENSP00000362135:p.Gln230Arg	Somatic	0	45	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q4W4X8|Q6NVW3|Q7L4E4|Q7Z2I4|Q9H5F8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_YrdC-like_dom,superfamily_DHBP_synth_RibB-like_a/b_dom,pfscan_YrdC-like_dom,tigrfam_YrdC-like_dom	p.Q230R	ENST00000373044.2	37	c.689	CCDS30675.1	1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.560143	0.27827	.	.	ENSG00000196449	ENST00000373044	.	.	.	5.6	5.6	0.85130	DHBP synthase RibB-like alpha/beta domain (2);Sua5/YciO/YrdC, N-terminal (2);Sua5/YciO/YrdC/YwlC (1);	0.497994	0.20318	N	0.094696	T	0.31482	0.0798	L	0.28192	0.835	0.09310	N	1	B	0.13145	0.007	B	0.12837	0.008	T	0.19418	-1.0306	9	0.48119	T	0.1	-5.4105	11.7475	0.51828	0.0:0.0:0.1471:0.8529	.	230	Q86U90	YRDC_HUMAN	R	230	.	ENSP00000362135:Q230R	Q	-	2	0	YRDC	38042639	0.965000	0.33210	0.994000	0.49952	0.979000	0.70002	2.630000	0.46494	2.130000	0.65690	0.528000	0.53228	CAG	-	pfam_YrdC-like_dom,superfamily_DHBP_synth_RibB-like_a/b_dom,pfscan_YrdC-like_dom,tigrfam_YrdC-like_dom		0.527	YRDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YRDC	protein_coding	OTTHUMT00000012470.1	T	NM_024640	-		38270052	-1	no_errors	ENST00000373044	ensembl	human	known	74_37	missense	SNP	0.091	C
TAF1D	79101	genome.wustl.edu	37	11	93468208	93468208	+	IGR	SNP	T	T	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:93468208T>A	ENST00000448108.2	-	0	2082				TAF1D_ENST00000546088.1_5'UTR|SNORA8_ENST00000384574.1_RNA|MIR1304_ENST00000408243.1_RNA|SNORA40_ENST00000388090.1_RNA|SNORA18_ENST00000384416.1_RNA|SNORA1_ENST00000384107.1_RNA|SNORD5_ENST00000459342.1_RNA	NM_024116.3	NP_077021.1	Q9H5J8	TAF1D_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, D, 41kDa						gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(3)|prostate(1)|skin(2)	7						gcttgacccattgcacctggc	0.438																																																	0								ENSG00000166012																																			TAF1D	SO:0001628	intergenic_variant	0			-	HGNC		CCDS8293.1	11q21	2012-05-30	2008-09-30	2008-09-30	ENSG00000166012	ENSG00000166012			28759	protein-coding gene	gene with protein product		612823	"""Josephin domain containing 3"""	JOSD3		15520167, 17318177	Standard	NM_024116		Approved	MGC5306, TAF(I)41	uc001pec.3	Q9H5J8	OTTHUMG00000167451		11.37:g.93468208T>A		Somatic	0	32	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	Q6I9Y6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000448108.2	37	NULL	CCDS8293.1	11																																																																																			-	-		0.438	TAF1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1D	protein_coding	OTTHUMT00000394662.2	T	NM_024116	-		93468208	-1	no_errors	ENST00000530089	ensembl	human	known	74_37	rna	SNP	0.001	A
NXN	64359	genome.wustl.edu	37	17	708474	708474	+	Silent	SNP	G	G	A	rs193165884		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:708474G>A	ENST00000336868.3	-	6	925	c.834C>T	c.(832-834)ctC>ctT	p.L278L	NXN_ENST00000575801.1_Silent_p.L170L|NXN_ENST00000538650.1_Intron|NXN_ENST00000537628.2_Silent_p.L29L	NM_022463.4	NP_071908.2	Q6DKJ4	NXN_HUMAN	nucleoredoxin	278	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cardiovascular system development (GO:0072358)|cell differentiation (GO:0030154)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-disulfide reductase activity (GO:0047134)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		CCAGCATGATGAGCGTGGGGA	0.726													G|||	1	0.000199681	0.0	0.0	5008	,	,		11343	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000167693						21.0	19.0	19.0					17																	708474		2201	4297	6498	NXN	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC		CCDS10998.1, CCDS56013.1	17p13	2007-08-10			ENSG00000167693	ENSG00000167693			18008	protein-coding gene	gene with protein product		612895					Standard	NM_022463		Approved	FLJ12614, NRX	uc002fsa.3	Q6DKJ4	OTTHUMG00000090307	ENST00000336868.3:c.834C>T	17.37:g.708474G>A		Somatic	0	113	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	83	101	44.86	B4DXQ0|D3DTH2|Q3SWW6|Q6P3U6|Q7L4C6|Q9H9Q1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold	p.L278	ENST00000336868.3	37	c.834	CCDS10998.1	17																																																																																			-	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold		0.726	NXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXN	protein_coding	OTTHUMT00000206669.1	G		rs193165884		708474	-1	no_errors	ENST00000336868	ensembl	human	known	74_37	silent	SNP	1.000	A
PLEC	5339	genome.wustl.edu	37	8	144995433	144995433	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:144995433G>A	ENST00000322810.4	-	32	9136	c.8967C>T	c.(8965-8967)ggC>ggT	p.G2989G	PLEC_ENST00000357649.2_Silent_p.G2856G|PLEC_ENST00000356346.3_Silent_p.G2838G|PLEC_ENST00000354589.3_Silent_p.G2852G|PLEC_ENST00000345136.3_Silent_p.G2852G|PLEC_ENST00000398774.2_Silent_p.G2820G|PLEC_ENST00000436759.2_Silent_p.G2879G|PLEC_ENST00000527096.1_Silent_p.G2875G|PLEC_ENST00000354958.2_Silent_p.G2830G	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2989	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GGTCAAAGAAGCCCTTGGTGT	0.667																																																	0								ENSG00000178209						82.0	93.0	89.0					8																	144995433		2118	4240	6358	PLEC	SO:0001819	synonymous_variant	0			-	HGNC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8967C>T	8.37:g.144995433G>A		Somatic	0	60	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	58	22.67	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.G2989	ENST00000322810.4	37	c.8967	CCDS43772.1	8																																																																																			-	smart_Plectin_repeat		0.667	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	protein_coding	OTTHUMT00000383281.1	G	NM_000445	-		144995433	-1	no_errors	ENST00000322810	ensembl	human	known	74_37	silent	SNP	1.000	A
LINC01317	104355287	genome.wustl.edu	37	2	33951639	33951640	+	lincRNA	INS	-	-	GCTAGG	rs3217586|rs70940218	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:33951639_33951640insGCTAGG	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							ACTAAGGCACAGCTAGGGCGGG	0.619														1982	0.395767	0.3185	0.4856	5008	,	,		14411	0.3948		0.4245	False		,,,				2504	0.408																0								ENSG00000239649																																			MYADML			0				HGNC																													2.37:g.33951640_33951645dupGCTAGG		Somatic	NA	NA	NA		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			-	-		0.619	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	lincRNA	OTTHUMT00000325406.1	-				33951640	-1	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	INS	0.441:0.327	GCTAGG
HIST1H3E	8353	genome.wustl.edu	37	6	26225736	26225736	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr6:26225736G>A	ENST00000360408.1	+	1	354	c.354G>A	c.(352-354)gtG>gtA	p.V118V		NM_003532.2	NP_003523.1	P68431	H31_HUMAN	histone cluster 1, H3e	118					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(5)|skin(1)	8		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				CCAAACGCGTGACCATCATGC	0.552											OREG0017240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000196966						97.0	97.0	97.0					6																	26225736		2203	4300	6503	HIST1H3E	SO:0001819	synonymous_variant	0			-	HGNC	M60746	CCDS4596.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196966	ENSG00000274750		"""Histones / Replication-dependent"""	4769	protein-coding gene	gene with protein product		602813	"""H3 histone family, member D"", ""histone 1, H3e"""	H3FD		1916825, 12408966	Standard	NM_003532		Approved	H3/d, H3.1	uc003nhc.4	P68431	OTTHUMG00000014434	ENST00000360408.1:c.354G>A	6.37:g.26225736G>A		Somatic	0	91	0.00	785	0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	60	21.05	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.V118	ENST00000360408.1	37	c.354	CCDS4596.1	6																																																																																			-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3		0.552	HIST1H3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3E	protein_coding	OTTHUMT00000040097.1	G	NM_003532	-		26225736	+1	no_errors	ENST00000360408	ensembl	human	known	74_37	silent	SNP	1.000	A
FGF23	8074	genome.wustl.edu	37	12	4488550	4488550	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:4488550G>A	ENST00000237837.1	-	1	344	c.199C>T	c.(199-201)Cag>Tag	p.Q67*		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	67					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			TAGATGGTCTGATGGGGTGCG	0.587																																																	0								ENSG00000118972						162.0	125.0	137.0					12																	4488550		2203	4300	6503	FGF23	SO:0001587	stop_gained	0			-	HGNC	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.199C>T	12.37:g.4488550G>A	ENSP00000237837:p.Gln67*	Somatic	0	22	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	13	27.78	Q4V758	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam	p.Q67*	ENST00000237837.1	37	c.199	CCDS8526.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.485755	0.97607	.	.	ENSG00000118972	ENST00000237837	.	.	.	4.03	4.03	0.46877	.	0.175652	0.50627	D	0.000112	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-12.1447	17.4772	0.87662	0.0:0.0:1.0:0.0	.	.	.	.	X	67	.	ENSP00000237837:Q67X	Q	-	1	0	FGF23	4358811	1.000000	0.71417	0.941000	0.38009	0.980000	0.70556	6.429000	0.73387	2.532000	0.85374	0.655000	0.94253	CAG	-	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam		0.587	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF23	protein_coding	OTTHUMT00000398936.1	G		-		4488550	-1	no_errors	ENST00000237837	ensembl	human	known	74_37	nonsense	SNP	0.992	A
ZC2HC1A	51101	genome.wustl.edu	37	8	79609735	79609735	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:79609735G>T	ENST00000263849.4	+	6	700	c.598G>T	c.(598-600)Gtt>Ttt	p.V200F	ZC2HC1A_ENST00000521176.1_3'UTR	NM_016010.2	NP_057094.2	Q96GY0	ZC21A_HUMAN	zinc finger, C2HC-type containing 1A	200							metal ion binding (GO:0046872)										TGGCAAAACTGTTGTAGGTAA	0.398																																																	0								ENSG00000104427						59.0	57.0	58.0					8																	79609735		2203	4300	6503	ZC2HC1A	SO:0001583	missense	0			-	HGNC		CCDS6223.1	8q21.11	2013-01-10	2012-02-03	2012-02-03	ENSG00000104427	ENSG00000104427		"""Zinc fingers, C2HC-type containing"""	24277	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 70"", ""family with sequence similarity 164, member A"""	C8orf70, FAM164A		10810093	Standard	NM_016010		Approved	CGI-62	uc003ybd.3	Q96GY0	OTTHUMG00000164619	ENST00000263849.4:c.598G>T	8.37:g.79609735G>T	ENSP00000263849:p.Val200Phe	Somatic	0	76	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	85	11.46	Q9Y372	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V200F	ENST00000263849.4	37	c.598	CCDS6223.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.55|10.55	1.380638|1.380638	0.24944|0.24944	.|.	.|.	ENSG00000104427|ENSG00000104427	ENST00000519307|ENST00000263849	.|T	.|0.46819	.|0.86	5.48|5.48	3.66|3.66	0.41972|0.41972	.|.	.|0.538192	.|0.21184	.|N	.|0.078767	T|T	0.26955|0.26955	0.0660|0.0660	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|P	.|0.35923	.|0.528	.|B	.|0.26864	.|0.074	T|T	0.03957|0.03957	-1.0989|-1.0989	5|9	.|.	.|.	.|.	-8.6006|-8.6006	9.023|9.023	0.36211|0.36211	0.2287:0.0:0.7713:0.0|0.2287:0.0:0.7713:0.0	.|.	.|200	.|Q96GY0	.|F164A_HUMAN	F|F	32|200	.|ENSP00000263849:V200F	.|.	C|V	+|+	2|1	0|0	FAM164A|FAM164A	79772290|79772290	0.999000|0.999000	0.42202|0.42202	0.996000|0.996000	0.52242|0.52242	0.279000|0.279000	0.26890|0.26890	3.045000|3.045000	0.49838|0.49838	0.770000|0.770000	0.33336|0.33336	0.655000|0.655000	0.94253|0.94253	TGT|GTT	-	NULL		0.398	ZC2HC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC2HC1A	protein_coding	OTTHUMT00000379423.2	G	NM_016010	-		79609735	+1	no_errors	ENST00000263849	ensembl	human	known	74_37	missense	SNP	0.868	T
YWHAE	7531	genome.wustl.edu	37	17	1265304	1265305	+	Splice_Site	INS	-	-	A	rs543499657|rs34985093	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:1265304_1265305insA	ENST00000264335.8	-	3	532		c.e3-2		YWHAE_ENST00000573026.1_Intron|YWHAE_ENST00000575977.1_Intron|YWHAE_ENST00000571732.1_Splice_Site	NM_006761.4	NP_006752.1	P62258	1433E_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cerebral cortex development (GO:0021987)|G2/M transition of mitotic cell cycle (GO:0000086)|hippo signaling (GO:0035329)|hippocampus development (GO:0021766)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|mitotic cell cycle (GO:0000278)|negative regulation of peptidyl-serine dephosphorylation (GO:1902309)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|substantia nigra development (GO:0021762)|viral process (GO:0016032)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|membrane (GO:0016020)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|ion channel binding (GO:0044325)|MHC class II protein complex binding (GO:0023026)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|poly(A) RNA binding (GO:0044822)|potassium channel regulator activity (GO:0015459)|protein heterodimerization activity (GO:0046982)			kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		AGTCTCAACCtaaaaaaaaaaa	0.322			T	"""FAM22a, FAM22B"""	edometrial stromal sarcoma		Miller-Dieker lissencephaly syndrome						|||unknown(HR)	578	0.115415	0.3669	0.0346	5008	,	,		19509	0.0188		0.0099	False		,,,				2504	0.0409							Dom	yes		17	17p13.3	7531	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (14-3-3 epsilon)"""	yes	M	0								ENSG00000108953																																			YWHAE	SO:0001630	splice_region_variant	0				HGNC	U54778	CCDS11001.1	17p13.3	2013-12-03	2013-12-03		ENSG00000108953	ENSG00000108953			12851	protein-coding gene	gene with protein product	"""14-3-3 epsilon"""	605066	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide"""			9371399	Standard	NM_006761		Approved	FLJ45465	uc002fsj.3	P62258	OTTHUMG00000134316	ENST00000264335.8:c.265-2->T	17.37:g.1265315_1265315dupA		Somatic	0	35	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	B3KY71|D3DTH5|P29360|P42655|Q4VJB6|Q53XZ5|Q63631|Q7M4R4	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e3-2	ENST00000264335.8	37	c.265-3_265-2	CCDS11001.1	17																																																																																			-	-		0.322	YWHAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAE	protein_coding	OTTHUMT00000259354.3	-	NM_006761		Intron	1265305	-1	no_errors	ENST00000264335	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.895	A
ZNF80	7634	genome.wustl.edu	37	3	113955135	113955135	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:113955135G>T	ENST00000482457.2	-	1	1290	c.787C>A	c.(787-789)Cag>Aag	p.Q263K	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				ATCTTACTCTGTTGGGCAAAA	0.413																																					GBM(23;986 1114 21716)												0								ENSG00000174255						81.0	84.0	83.0					3																	113955135		2203	4300	6503	ZNF80	SO:0001583	missense	0			-	HGNC	X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.787C>A	3.37:g.113955135G>T	ENSP00000417192:p.Gln263Lys	Somatic	0	63	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	Q6NSW4|Q6NT14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q263K	ENST00000482457.2	37	c.787	CCDS2979.1	3	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636638	0.29068	.	.	ENSG00000174255	ENST00000482457	T	0.05199	3.48	2.94	2.06	0.26882	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06234	0.0161	L	0.38175	1.15	0.09310	N	1	B	0.16802	0.019	B	0.15052	0.012	T	0.30909	-0.9962	9	0.87932	D	0	.	8.1683	0.31239	0.1269:0.0:0.8731:0.0	.	263	P51504	ZNF80_HUMAN	K	263	ENSP00000417192:Q263K	ENSP00000309812:Q263K	Q	-	1	0	ZNF80	115437825	0.391000	0.25221	0.001000	0.08648	0.007000	0.05969	3.411000	0.52672	0.795000	0.33922	0.561000	0.74099	CAG	-	NULL		0.413	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF80	protein_coding	OTTHUMT00000354696.2	G	NM_007136	-		113955135	-1	no_errors	ENST00000308095	ensembl	human	known	74_37	missense	SNP	0.010	T
CHMP7	91782	genome.wustl.edu	37	8	23115855	23115855	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:23115855C>G	ENST00000397677.1	+	7	1501	c.853C>G	c.(853-855)Ctc>Gtc	p.L285V	CHMP7_ENST00000520102.1_3'UTR|CHMP7_ENST00000313219.7_Missense_Mutation_p.L285V	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	285					endosomal transport (GO:0016197)|late endosome to vacuole transport (GO:0045324)|membrane organization (GO:0061024)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|ESCRT III complex (GO:0000815)	protein transporter activity (GO:0008565)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		ACTGAGGTCTCTCAAGGCCAA	0.577																																																	0								ENSG00000147457						166.0	141.0	150.0					8																	23115855		2203	4300	6503	CHMP7	SO:0001583	missense	0			-	HGNC	BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457		"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""			16856878	Standard	NM_152272		Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.853C>G	8.37:g.23115855C>G	ENSP00000380794:p.Leu285Val	Somatic	0	23	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	23	34.29	B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Snf7	p.L285V	ENST00000397677.1	37	c.853	CCDS6040.1	8	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063444	0.76187	.	.	ENSG00000147457	ENST00000397677;ENST00000313219	D;D	0.83075	-1.68;-1.68	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.91720	0.7382	M	0.82323	2.585	0.58432	D	0.999992	D;D	0.89917	0.999;1.0	D;D	0.97110	0.998;1.0	D	0.91885	0.5519	10	0.59425	D	0.04	-10.7227	16.9982	0.86373	0.0:1.0:0.0:0.0	.	175;285	B3KRZ9;Q8WUX9	.;CHMP7_HUMAN	V	285	ENSP00000380794:L285V;ENSP00000324491:L285V	ENSP00000324491:L285V	L	+	1	0	CHMP7	23171800	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	1.388000	0.34442	2.801000	0.96364	0.655000	0.94253	CTC	-	pfam_Snf7		0.577	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP7	protein_coding	OTTHUMT00000254717.1	C	NM_152272	-		23115855	+1	no_errors	ENST00000313219	ensembl	human	known	74_37	missense	SNP	1.000	G
TERT	7015	genome.wustl.edu	37	5	1279444	1279444	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:1279444G>A	ENST00000310581.5	-	5	2149	c.2092C>T	c.(2092-2094)Cgg>Tgg	p.R698W	TERT_ENST00000508104.2_Missense_Mutation_p.R698W|TERT_ENST00000334602.6_Missense_Mutation_p.R698W|TERT_ENST00000296820.5_Missense_Mutation_p.R698W	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	698	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	TCCTGGGCCCGCACACGCAGC	0.706									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																																								0								ENSG00000164362						8.0	10.0	9.0					5																	1279444		2166	4258	6424	TERT	SO:0001583	missense	0	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	-	HGNC	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.2092C>T	5.37:g.1279444G>A	ENSP00000309572:p.Arg698Trp	Somatic	0	75	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	84	25.66	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Telomerase_RBD,pfam_RVT,smart_Telomerase_RBD,pfscan_RVT,prints_Telomerase_RT	p.R698W	ENST00000310581.5	37	c.2092	CCDS3861.2	5	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111362	0.37242	.	.	ENSG00000164362	ENST00000310581;ENST00000296820;ENST00000334602;ENST00000508104	D;D;D;D	0.97089	-4.24;-4.22;-4.16;-4.22	4.67	2.77	0.32553	Reverse transcriptase (1);	0.844839	0.10230	N	0.699742	D	0.97895	0.9308	M	0.70275	2.135	0.29857	N	0.827975	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.981;0.991;0.958	D	0.93144	0.6544	10	0.87932	D	0	-9.6631	9.8893	0.41281	0.0:0.0:0.6324:0.3676	.	698;698;698	O14746-3;O14746;Q8NG38	.;TERT_HUMAN;.	W	698	ENSP00000309572:R698W;ENSP00000296820:R698W;ENSP00000334346:R698W;ENSP00000426042:R698W	ENSP00000296820:R698W	R	-	1	2	TERT	1332444	0.002000	0.14202	0.977000	0.42913	0.085000	0.17905	0.777000	0.26718	0.945000	0.37605	0.313000	0.20887	CGG	-	pfscan_RVT		0.706	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERT	protein_coding	OTTHUMT00000206729.2	G		-		1279444	-1	no_errors	ENST00000310581	ensembl	human	known	74_37	missense	SNP	0.757	A
HOOK3	84376	genome.wustl.edu	37	8	42873625	42873625	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:42873625C>T	ENST00000307602.4	+	22	2341	c.2141C>T	c.(2140-2142)cCg>cTg	p.P714L	RP11-598P20.5_ENST00000534420.1_Missense_Mutation_p.P20L	NM_032410.3	NP_115786.1	Q86VS8	HOOK3_HUMAN	hook microtubule-tethering protein 3	714	Required for association with Golgi.|Required for interaction with MSR1.				cytoplasmic microtubule organization (GO:0031122)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|Golgi localization (GO:0051645)|interkinetic nuclear migration (GO:0022027)|lysosome organization (GO:0007040)|microtubule anchoring at centrosome (GO:0034454)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|protein localization to centrosome (GO:0071539)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|FHF complex (GO:0070695)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|pericentriolar material (GO:0000242)	identical protein binding (GO:0042802)|microtubule binding (GO:0008017)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	31	Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.000105)|Lung NSC(58;0.000419)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.048)|LUSC - Lung squamous cell carcinoma(45;0.114)			CACGTGCAGCCGGCCACAGCA	0.542			T	RET	papillary thyroid																																			Dom	yes		8	8p11.21	84376	hook homolog 3		E	0								ENSG00000168172						73.0	69.0	71.0					8																	42873625		2203	4300	6503	HOOK3	SO:0001583	missense	0			-	HGNC	AK090540	CCDS6139.1	8p11.21	2013-08-21	2013-08-21		ENSG00000168172	ENSG00000168172			23576	protein-coding gene	gene with protein product		607825	"""hook homolog 3 (Drosophila)"""			9927460	Standard	NM_032410		Approved	HK3	uc003xpr.3	Q86VS8	OTTHUMG00000165278	ENST00000307602.4:c.2141C>T	8.37:g.42873625C>T	ENSP00000305699:p.Pro714Leu	Somatic	0	43	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	27	40.00	D3DSY8|Q8NBH0|Q9BY13	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hook-related_fam,superfamily_t-SNARE	p.P714L	ENST00000307602.4	37	c.2141	CCDS6139.1	8	.	.	.	.	.	.	.	.	.	.	C	9.589	1.125731	0.20959	.	.	ENSG00000168172;ENSG00000254673	ENST00000307602;ENST00000534420	T	0.17054	2.3	5.96	5.96	0.96718	.	0.094893	0.85682	D	0.000000	T	0.21062	0.0507	L	0.52573	1.65	0.80722	D	1	P	0.35612	0.512	B	0.32090	0.14	T	0.01301	-1.1391	10	0.72032	D	0.01	-9.5408	20.422	0.99049	0.0:1.0:0.0:0.0	.	714	Q86VS8	HOOK3_HUMAN	L	714;20	ENSP00000305699:P714L	ENSP00000305699:P714L	P	+	2	0	RP11-598P20.5;HOOK3	42992782	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	5.618000	0.67722	2.832000	0.97577	0.655000	0.94253	CCG	-	pfam_Hook-related_fam		0.542	HOOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK3	protein_coding	OTTHUMT00000383172.2	C	NM_032410	-		42873625	+1	no_errors	ENST00000307602	ensembl	human	known	74_37	missense	SNP	1.000	T
TIGD7	91151	genome.wustl.edu	37	16	3350579	3350579	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:3350579C>A	ENST00000396862.1	-	2	1864	c.36G>T	c.(34-36)ttG>ttT	p.L12F	TIGD7_ENST00000268674.2_Missense_Mutation_p.L12F|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	12	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						TTTTCTCCTCCAAATTCAGTG	0.338																																																	0								ENSG00000140993						87.0	87.0	87.0					16																	3350579		2197	4300	6497	TIGD7	SO:0001583	missense	0			-	HGNC	AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.36G>T	16.37:g.3350579C>A	ENSP00000380071:p.Leu12Phe	Somatic	0	77	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	29	38.78	Q9BXZ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.L12F	ENST00000396862.1	37	c.36	CCDS10500.1	16	.	.	.	.	.	.	.	.	.	.	C	14.35	2.509809	0.44660	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.49720	0.77;0.77	4.38	3.35	0.38373	Homeodomain-related (1);Homeodomain-like (1);Helix-turn-helix, Psq-like (1);Centromere protein Cenp-B, DNA-binding domain 1 (1);	0.000000	0.29594	U	0.011720	T	0.54983	0.1892	L	0.48877	1.53	0.26733	N	0.970545	D	0.76494	0.999	D	0.91635	0.999	T	0.38779	-0.9645	10	0.44086	T	0.13	.	6.4231	0.21754	0.0:0.8646:0.0:0.1354	.	12	Q6NT04	TIGD7_HUMAN	F	12	ENSP00000380071:L12F;ENSP00000268674:L12F	ENSP00000268674:L12F	L	-	3	2	TIGD7	3290580	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	0.502000	0.22594	2.283000	0.76528	0.655000	0.94253	TTG	-	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq		0.338	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	protein_coding	OTTHUMT00000251465.1	C	NM_033208	-		3350579	-1	no_errors	ENST00000268674	ensembl	human	known	74_37	missense	SNP	1.000	A
GDF2	2658	genome.wustl.edu	37	10	48414171	48414171	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr10:48414171G>A	ENST00000249598.1	-	2	856	c.697C>T	c.(697-699)Cac>Tac	p.H233Y		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	233					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CCCTTCCTGTGGCTCTCCACA	0.577																																																	0								ENSG00000128802						79.0	79.0	79.0					10																	48414171		2203	4300	6503	GDF2	SO:0001583	missense	0			-	HGNC	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.697C>T	10.37:g.48414171G>A	ENSP00000249598:p.His233Tyr	Somatic	0	29	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	Q5VSQ9|Q9Y571	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.H233Y	ENST00000249598.1	37	c.697	CCDS7219.1	10	.	.	.	.	.	.	.	.	.	.	G	13.76	2.333593	0.41297	.	.	ENSG00000128802	ENST00000249598	T	0.64260	-0.09	5.84	3.98	0.46160	Transforming growth factor-beta, N-terminal (1);	0.564646	0.21860	N	0.068048	T	0.56247	0.1972	M	0.65975	2.015	0.21782	N	0.999549	B	0.14438	0.01	B	0.13407	0.009	T	0.54268	-0.8319	10	0.59425	D	0.04	.	5.9106	0.19027	0.1422:0.0:0.5846:0.2732	.	233	Q9UK05	GDF2_HUMAN	Y	233	ENSP00000249598:H233Y	ENSP00000249598:H233Y	H	-	1	0	GDF2	48034177	0.016000	0.18221	0.985000	0.45067	0.987000	0.75469	1.566000	0.36396	0.811000	0.34303	0.591000	0.81541	CAC	-	pfam_TGF-b_N		0.577	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF2	protein_coding	OTTHUMT00000047891.1	G	NM_016204	-		48414171	-1	no_errors	ENST00000249598	ensembl	human	known	74_37	missense	SNP	0.615	A
RAG1	5896	genome.wustl.edu	37	11	36596224	36596224	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:36596224T>C	ENST00000299440.5	+	2	1482	c.1370T>C	c.(1369-1371)aTc>aCc	p.I457T		NM_000448.2	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	457					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|DNA recombination (GO:0006310)|histone monoubiquitination (GO:0010390)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|pre-B cell allelic exclusion (GO:0002331)|protein autoubiquitination (GO:0051865)|regulation of T cell differentiation (GO:0045580)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	65	all_lung(20;0.226)	all_hematologic(20;0.107)				CTGGAGGCCATCATGCAGGGA	0.552									Familial Hemophagocytic Lymphohistiocytosis																												Pancreas(43;321 1249 3212 48200)|Esophageal Squamous(38;49 1003 17530 24363)												0								ENSG00000166349						71.0	65.0	67.0					11																	36596224		2202	4298	6500	RAG1	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	-	HGNC	M29474	CCDS7902.1	11p13	2014-09-17				ENSG00000166349		"""RING-type (C3HC4) zinc fingers"""	9831	protein-coding gene	gene with protein product	"""recombination activating protein 1"", ""RING finger protein 74"", ""V(D)J recombination-activating protein 1"""	179615				1612612, 1283330	Standard	NM_000448		Approved	RNF74, MGC43321	uc001mwu.4	P15918		ENST00000299440.5:c.1370T>C	11.37:g.36596224T>C	ENSP00000299440:p.Ile457Thr	Somatic	0	34	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	E9PPC4|Q8IY72|Q8NER2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_VDJ_recomb-activ_1,smart_Znf_RING,pfscan_Znf_RING	p.I457T	ENST00000299440.5	37	c.1370	CCDS7902.1	11	.	.	.	.	.	.	.	.	.	.	T	18.12	3.552772	0.65425	.	.	ENSG00000166349	ENST00000534663;ENST00000299440	T;T	0.71934	-0.61;-0.61	5.58	5.58	0.84498	RAG nonamer-binding domain (1);	0.219986	0.46442	D	0.000291	T	0.69504	0.3118	M	0.65975	2.015	0.80722	D	1	B	0.33583	0.418	B	0.30495	0.116	T	0.72975	-0.4128	10	0.87932	D	0	.	15.7965	0.78416	0.0:0.0:0.0:1.0	.	457	P15918	RAG1_HUMAN	T	457	ENSP00000434610:I457T;ENSP00000299440:I457T	ENSP00000299440:I457T	I	+	2	0	RAG1	36552800	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.698000	0.84413	2.140000	0.66376	0.529000	0.55759	ATC	-	NULL		0.552	RAG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RAG1	protein_coding	OTTHUMT00000389535.1	T	NM_000448	-		36596224	+1	no_errors	ENST00000299440	ensembl	human	known	74_37	missense	SNP	1.000	C
HCST	10870	genome.wustl.edu	37	19	36395051	36395051	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:36395051G>T	ENST00000246551.4	+	4	385	c.271G>T	c.(271-273)Ggc>Tgc	p.G91C	NFKBID_ENST00000352614.2_5'Flank|HCST_ENST00000437550.2_Missense_Mutation_p.G90C|NFKBID_ENST00000606253.1_5'Flank			Q9UBK5	HCST_HUMAN	hematopoietic cell signal transducer	91					positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of immune response (GO:0050776)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase binding (GO:0043548)|receptor binding (GO:0005102)			lung(4)	4	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAACATGCCAGGCAGGGGCTG	0.562																																																	0								ENSG00000126264						126.0	107.0	113.0					19																	36395051		2203	4300	6503	HCST	SO:0001583	missense	0			-	HGNC	AF072844	CCDS32998.1, CCDS46057.1	19q13.1	2009-05-07	2003-10-14	2003-10-15	ENSG00000126264	ENSG00000126264			16977	protein-coding gene	gene with protein product	"""DNAX-activation protein 10"", ""kinase assoc pro of ~10kDa"""	604089	"""phosphoinositide-3-kinase adaptor protein"""	PIK3AP		10426994	Standard	NM_014266		Approved	DAP10, DKFZP586C1522, KAP10	uc002ocl.1	Q9UBK5	OTTHUMG00000048132	ENST00000246551.4:c.271G>T	19.37:g.36395051G>T	ENSP00000246551:p.Gly91Cys	Somatic	0	32	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q9UBS1|Q9Y3Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DAP10	p.G91C	ENST00000246551.4	37	c.271	CCDS32998.1	19	.	.	.	.	.	.	.	.	.	.	G	15.35	2.808497	0.50421	.	.	ENSG00000126264	ENST00000246551;ENST00000437550	.	.	.	4.42	2.23	0.28157	.	0.167728	0.28766	N	0.014203	T	0.53706	0.1813	.	.	.	0.09310	N	1	D;D	0.71674	0.998;0.995	D;P	0.64144	0.922;0.785	T	0.37753	-0.9692	8	0.87932	D	0	-0.5889	6.8446	0.23980	0.2173:0.0:0.7827:0.0	.	91;90	Q9UBK5;Q9UBK5-2	HCST_HUMAN;.	C	91;90	.	ENSP00000246551:G91C	G	+	1	0	HCST	41086891	0.012000	0.17670	0.912000	0.35992	0.944000	0.59088	0.805000	0.27112	1.070000	0.40811	0.561000	0.74099	GGC	-	pfam_DAP10		0.562	HCST-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HCST	protein_coding	OTTHUMT00000109520.3	G	NM_014266	-		36395051	+1	no_errors	ENST00000246551	ensembl	human	known	74_37	missense	SNP	0.078	T
WNK2	65268	genome.wustl.edu	37	9	96021357	96021357	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:96021357C>G	ENST00000297954.4	+	11	2527	c.2527C>G	c.(2527-2529)Ctc>Gtc	p.L843V	WNK2_ENST00000427277.2_Missense_Mutation_p.L455V|WNK2_ENST00000349097.3_Missense_Mutation_p.L455V|WNK2_ENST00000395475.2_Missense_Mutation_p.L777V|WNK2_ENST00000356055.3_5'UTR|WNK2_ENST00000395477.2_Missense_Mutation_p.L843V	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	843					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						CTTGCCGAGCCTCGCTGCCCC	0.701																																																	0								ENSG00000165238						26.0	32.0	30.0					9																	96021357		2203	4296	6499	WNK2	SO:0001583	missense	0			-	HGNC	AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.2527C>G	9.37:g.96021357C>G	ENSP00000297954:p.Leu843Val	Somatic	0	167	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	178	23.61	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L843V	ENST00000297954.4	37	c.2527		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.78|11.78	1.739748|1.739748	0.30865|0.30865	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000297954;ENST00000395477;ENST00000395475;ENST00000349097;ENST00000427277|ENST00000411624	T;T;T;T;T|.	0.77620|.	-0.48;-0.49;-1.11;0.1;0.11|.	5.11|5.11	3.11|3.11	0.35812|0.35812	.|.	0.359359|.	0.26224|.	N|.	0.025618|.	T|T	0.36496|0.36496	0.0969|0.0969	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	B;B;B;B;B|.	0.24721|.	0.11;0.041;0.067;0.11;0.067|.	B;B;B;B;B|.	0.18871|.	0.016;0.016;0.023;0.016;0.012|.	T|T	0.21759|0.21759	-1.0236|-1.0236	10|5	0.26408|.	T|.	0.33|.	.|.	2.5745|2.5745	0.04803|0.04803	0.2426:0.4143:0.2483:0.0948|0.2426:0.4143:0.2483:0.0948	.|.	843;843;446;843;843|.	Q9Y3S1-2;Q9Y3S1-4;A6PVR4;F8W9F9;Q9Y3S1|.	.;.;.;.;WNK2_HUMAN|.	V|R	843;843;777;455;455|446	ENSP00000297954:L843V;ENSP00000378860:L843V;ENSP00000378858:L777V;ENSP00000297876:L455V;ENSP00000411181:L455V|.	ENSP00000297954:L843V|.	L|P	+|+	1|2	0|0	WNK2|WNK2	95061178|95061178	1.000000|1.000000	0.71417|0.71417	0.641000|0.641000	0.29422|0.29422	0.607000|0.607000	0.37147|0.37147	2.565000|2.565000	0.45939|0.45939	2.367000|2.367000	0.80283|0.80283	0.462000|0.462000	0.41574|0.41574	CTC|CCT	-	NULL		0.701	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	protein_coding	OTTHUMT00000317359.1	C	NM_006648	-		96021357	+1	no_errors	ENST00000297954	ensembl	human	known	74_37	missense	SNP	0.775	G
KAT7	11143	genome.wustl.edu	37	17	47903406	47903406	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:47903406C>T	ENST00000259021.4	+	13	1805	c.1525C>T	c.(1525-1527)Cgt>Tgt	p.R509C	KAT7_ENST00000503935.2_Missense_Mutation_p.R353C|KAT7_ENST00000424009.2_Missense_Mutation_p.R479C|KAT7_ENST00000510819.1_Missense_Mutation_p.R340C|KAT7_ENST00000509773.1_Missense_Mutation_p.R399C|KAT7_ENST00000435742.2_Missense_Mutation_p.R323C|KAT7_ENST00000454930.2_Missense_Mutation_p.R370C|KAT7_ENST00000513980.1_3'UTR	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	509	MYST-type HAT.				chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CTCCCCAGAACGTCCACTCTC	0.418																																																	0								ENSG00000136504						99.0	97.0	98.0					17																	47903406		2203	4300	6503	KAT7	SO:0001583	missense	0			-	HGNC	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.1525C>T	17.37:g.47903406C>T	ENSP00000259021:p.Arg509Cys	Somatic	1	110	0.90		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	37	37.29	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MOZ_SAS,pfam_Znf_C2HC,superfamily_Acyl_CoA_acyltransferase	p.R509C	ENST00000259021.4	37	c.1525	CCDS11554.1	17	.	.	.	.	.	.	.	.	.	.	C	19.68	3.873448	0.72180	.	.	ENSG00000136504	ENST00000259021;ENST00000454930;ENST00000509773;ENST00000510819;ENST00000424009;ENST00000503935;ENST00000435742	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.74107	0.3673	M	0.88450	2.955	0.80722	D	1	P;B;P;B;P	0.49090	0.838;0.211;0.719;0.424;0.919	B;B;B;B;P	0.45856	0.274;0.081;0.075;0.222;0.495	T	0.81118	-0.1078	9	0.87932	D	0	-12.4457	18.7204	0.91691	0.0:1.0:0.0:0.0	.	472;340;399;370;509	B4DGY4;B4DFE0;B4DFB4;E7ER15;O95251	.;.;.;.;KAT7_HUMAN	C	509;370;399;340;479;353;323	.	ENSP00000259021:R509C	R	+	1	0	KAT7	45258405	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.930000	0.48924	2.756000	0.94617	0.561000	0.74099	CGT	-	pfam_MOZ_SAS,superfamily_Acyl_CoA_acyltransferase		0.418	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT7	protein_coding	OTTHUMT00000366032.1	C	NM_007067	-		47903406	+1	no_errors	ENST00000259021	ensembl	human	known	74_37	missense	SNP	1.000	T
PRSS3	5646	genome.wustl.edu	37	9	33798916	33798916	+	Intron	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:33798916C>T	ENST00000361005.5	+	5	762				RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000342836.4_Intron|PRSS3_ENST00000429677.3_Intron|PRSS3_ENST00000495682.1_3'UTR|PRSS3_ENST00000379405.3_Intron	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3						cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			GTGGGAAGGACGTGGAGCCAC	0.532																																																	0								ENSG00000010438																																			PRSS3	SO:0001627	intron_variant	0			-	HGNC		CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.763-110C>T	9.37:g.33798916C>T		Somatic	0	37	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	43	12.24	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361005.5	37	NULL	CCDS47958.1	9																																																																																			-	-		0.532	PRSS3-003	KNOWN	basic|CCDS	protein_coding	PRSS3	protein_coding	OTTHUMT00000052121.1	C	NM_002771	-		33798916	+1	no_errors	ENST00000495682	ensembl	human	known	74_37	rna	SNP	0.000	T
DAB1	1600	genome.wustl.edu	37	1	57602303	57602303	+	Silent	SNP	A	A	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:57602303A>C	ENST00000371231.1	-	3	253	c.219T>G	c.(217-219)gcT>gcG	p.A73A	DAB1_ENST00000371234.4_Silent_p.A73A|DAB1_ENST00000420954.2_Silent_p.A73A|DAB1_ENST00000414851.2_Silent_p.A73A|DAB1_ENST00000371230.1_Silent_p.A73A|DAB1_ENST00000485760.1_5'UTR|DAB1_ENST00000371236.2_Silent_p.A73A|DAB1_ENST00000439789.2_Silent_p.A73A			O75553	DAB1_HUMAN	Dab, reelin signal transducer, homolog 1 (Drosophila)	73	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adult walking behavior (GO:0007628)|cell-cell adhesion involved in neuronal-glial interactions involved in cerebral cortex radial glia guided migration (GO:0021813)|cerebellum structural organization (GO:0021589)|dendrite development (GO:0016358)|Golgi localization (GO:0051645)|lateral motor column neuron migration (GO:0097477)|midgut development (GO:0007494)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|negative regulation of JAK-STAT cascade (GO:0046426)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein kinase activity (GO:0045860)|radial glia guided migration of Purkinje cell (GO:0021942)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|ventral spinal cord development (GO:0021517)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(5)	64						AACGAGCGCCAGCAACAACGC	0.398																																																	0								ENSG00000173406						70.0	68.0	69.0					1																	57602303		2203	4300	6503	DAB1	SO:0001819	synonymous_variant	0			-	HGNC	BC067445	CCDS607.1	1p32-p31	2013-10-03	2013-10-03		ENSG00000173406	ENSG00000173406			2661	protein-coding gene	gene with protein product		603448	"""disabled (Drosophila) homolog 1"", ""disabled homolog 1 (Drosophila)"", ""Dab, reelin signal transducer, homolog 1 (Drosophila)"", ""Dab reelin signal transducer 1"""			9790777	Standard	NM_021080		Approved		uc001cys.1	O75553	OTTHUMG00000008391	ENST00000371231.1:c.219T>G	1.37:g.57602303A>C		Somatic	0	39	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A4FU90|B3KTG3|Q4LE59|Q5T6M6|Q5T6M9|Q5T835|Q5T836|Q5T837|Q6NWS9|Q6NWT0|Q6NWT1|Q9NYA8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.A73	ENST00000371231.1	37	c.219		1																																																																																			-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.398	DAB1-010	KNOWN	basic	protein_coding	DAB1	protein_coding	OTTHUMT00000027962.1	A	NM_021080	-		57602303	-1	no_errors	ENST00000371231	ensembl	human	known	74_37	silent	SNP	0.993	C
MIP	4284	genome.wustl.edu	37	12	56847521	56847521	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:56847521C>T	ENST00000257979.4	-	2	407	c.379G>A	c.(379-381)Gtg>Atg	p.V127M	MIP_ENST00000555551.1_5'UTR	NM_012064.3	NP_036196.1	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	127					canalicular bile acid transport (GO:0015722)|lens development in camera-type eye (GO:0002088)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)|water transport (GO:0006833)	gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intracellular canaliculus (GO:0046691)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|structural constituent of eye lens (GO:0005212)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	16						GCCTGGCCCACGCTCACCGCA	0.582																																																	0								ENSG00000135517						54.0	38.0	43.0					12																	56847521		2203	4300	6503	MIP	SO:0001583	missense	0			-	HGNC		CCDS8919.1	12q13	2012-10-02				ENSG00000135517		"""Ion channels / Aquaporins"""	7103	protein-coding gene	gene with protein product	aquaporin 0	154050				1840563, 7536742	Standard	NM_012064		Approved	MP26, LIM1, AQP0	uc001slh.3	P30301		ENST00000257979.4:c.379G>A	12.37:g.56847521C>T	ENSP00000257979:p.Val127Met	Somatic	0	23	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	12	33.33	Q17R41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	p.V127M	ENST00000257979.4	37	c.379	CCDS8919.1	12	.	.	.	.	.	.	.	.	.	.	C	14.24	2.476509	0.44044	.	.	ENSG00000135517	ENST00000257979	D	0.93307	-3.2	4.98	3.1	0.35709	Aquaporin-like (2);	0.284770	0.35179	N	0.003387	D	0.83949	0.5365	N	0.13327	0.33	0.33720	D	0.6169	B	0.13594	0.008	B	0.15870	0.014	T	0.81011	-0.1126	10	0.56958	D	0.05	-4.9365	4.7305	0.12962	0.1565:0.6081:0.1516:0.0838	.	127	P30301	MIP_HUMAN	M	127	ENSP00000257979:V127M	ENSP00000257979:V127M	V	-	1	0	MIP	55133788	0.773000	0.28580	1.000000	0.80357	0.941000	0.58515	1.133000	0.31430	1.199000	0.43173	0.655000	0.94253	GTG	-	pfam_MIP,superfamily_Aquaporin-like,tigrfam_MIP		0.582	MIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIP	protein_coding	OTTHUMT00000409620.1	C	NM_012064	-		56847521	-1	no_errors	ENST00000257979	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF592	9640	genome.wustl.edu	37	15	85327615	85327615	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr15:85327615C>T	ENST00000560079.2	+	4	1997	c.1709C>T	c.(1708-1710)cCa>cTa	p.P570L	ZNF592_ENST00000299927.3_Missense_Mutation_p.P570L	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	570					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTCTATGCGCCAAATCTCAGC	0.602																																																	0								ENSG00000166716						93.0	97.0	96.0					15																	85327615		2203	4299	6502	ZNF592	SO:0001583	missense	0			-	HGNC	D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.1709C>T	15.37:g.85327615C>T	ENSP00000452877:p.Pro570Leu	Somatic	0	52	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	44	26.23	Q2M1T2|Q504Y9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P570L	ENST00000560079.2	37	c.1709	CCDS32317.1	15	.	.	.	.	.	.	.	.	.	.	C	19.26	3.793761	0.70452	.	.	ENSG00000166716	ENST00000299927	T	0.01113	5.32	4.85	4.85	0.62838	.	0.050975	0.85682	D	0.000000	T	0.04497	0.0123	L	0.43152	1.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.51748	-0.8666	10	0.59425	D	0.04	-10.3021	15.5092	0.75766	0.0:1.0:0.0:0.0	.	570	Q92610	ZN592_HUMAN	L	570	ENSP00000299927:P570L	ENSP00000299927:P570L	P	+	2	0	ZNF592	83128619	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	7.541000	0.82084	2.503000	0.84419	0.655000	0.94253	CCA	-	NULL		0.602	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	protein_coding	OTTHUMT00000418779.2	C	NM_014630	-		85327615	+1	no_errors	ENST00000299927	ensembl	human	known	74_37	missense	SNP	1.000	T
PYROXD1	79912	genome.wustl.edu	37	12	21590706	21590715	+	Frame_Shift_Del	DEL	GGTGGTCGGC	GGTGGTCGGC	-	rs140096937		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	GGTGGTCGGC	GGTGGTCGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:21590706_21590715delGGTGGTCGGC	ENST00000240651.9	+	1	96_105	c.42_51delGGTGGTCGGC	c.(40-51)gtggtggtcggcfs	p.VVVG14fs	PYROXD1_ENST00000538582.1_5'Flank|PYROXD1_ENST00000545178.1_Frame_Shift_Del_p.VVVG14fs	NM_024854.3	NP_079130.2	Q8WU10	PYRD1_HUMAN	pyridine nucleotide-disulphide oxidoreductase domain 1	14							oxidoreductase activity (GO:0016491)			endometrium(3)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|soft_tissue(1)	18						GGAAGTTCGTGGTGGTCGGCGGCGGCATCG	0.671																																																	0								ENSG00000121350																																			PYROXD1	SO:0001589	frameshift_variant	0				HGNC	AL832441	CCDS31755.1	12p12.1	2014-02-12			ENSG00000121350	ENSG00000121350			26162	protein-coding gene	gene with protein product						12477932	Standard	NM_024854		Approved	DKFZp762G094, FLJ22028	uc001rew.3	Q8WU10	OTTHUMG00000169129	ENST00000240651.9:c.42_51delGGTGGTCGGC	12.37:g.21590706_21590715delGGTGGTCGGC	ENSP00000240651:p.Val14fs	Somatic	NA	NA	NA		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NKI6|B3KWN8|Q9H6P1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase	p.V15fs	ENST00000240651.9	37	c.42_51	CCDS31755.1	12																																																																																			-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase		0.671	PYROXD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYROXD1	protein_coding	OTTHUMT00000402363.1	GGTGGTCGGC	NM_024854			21590715	+1	no_errors	ENST00000240651	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:0.995:0.789:0.996:0.998:0.978	-
MSLNL	401827	genome.wustl.edu	37	16	830748	830767	+	Intron	DEL	GTGTGCACGGGTAGGTGACG	GTGTGCACGGGTAGGTGACG	-	rs529120069|rs530021128|rs561671812|rs200325458|rs550446343|rs370853100	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	GTGTGCACGGGTAGGTGACG	GTGTGCACGGGTAGGTGACG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:830748_830767delGTGTGCACGGGTAGGTGACG	ENST00000442466.1	-	2	37				MSLNL_ENST00000293892.3_Frame_Shift_Del_p.VTYPCTQ79fs			Q96KJ4	MSLNL_HUMAN	mesothelin-like						cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						GGTGACAGCTGTGTGCACGGGTAGGTGACGGTGTGCACGG	0.591																																																	0								ENSG00000162006																																			MSLNL	SO:0001627	intron_variant	0				HGNC			16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.38-586CGTCACCTACCCGTGCACAC>-	16.37:g.830748_830767delGTGTGCACGGGTAGGTGACG		Somatic	NA	NA	NA		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Mesothelin	p.V79fs	ENST00000442466.1	37	c.253_234		16																																																																																			-	NULL		0.591	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	protein_coding		GTGTGCACGGGTAGGTGACG	NM_001025190			830767	-1	no_errors	ENST00000293892	ensembl	human	known	74_37	frame_shift_del	DEL	0.379:0.375:0.374:0.201:0.160:0.068:0.036:0.007:0.004:0.001:0.001:0.000:0.001:0.003:0.009:0.010:0.010:0.006:0.004:0.006	-
CPZ	8532	genome.wustl.edu	37	4	8609140	8609140	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr4:8609140G>A	ENST00000360986.4	+	7	1389	c.1215G>A	c.(1213-1215)acG>acA	p.T405T	CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000382480.2_Silent_p.T268T|CPZ_ENST00000315782.6_Silent_p.T394T	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	405					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						TTTCTCCCACGCCCGACGAGA	0.632											OREG0016100	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000109625						79.0	68.0	72.0					4																	8609140		2203	4300	6503	CPZ	SO:0001819	synonymous_variant	0			-	HGNC	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.1215G>A	4.37:g.8609140G>A		Somatic	0	55	0.00	650	0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	26	37.21	O00520|Q96MX2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M14,pfam_Frizzled_dom,superfamily_Frizzled_dom,superfamily_CarboxyPept-like_regulatory,smart_Frizzled_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Frizzled_dom	p.T405	ENST00000360986.4	37	c.1215	CCDS33953.1	4																																																																																			-	pfam_Peptidase_M14,smart_Peptidase_M14		0.632	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPZ	protein_coding	OTTHUMT00000207001.4	G	NM_003652	-		8609140	+1	no_errors	ENST00000360986	ensembl	human	known	74_37	silent	SNP	0.006	A
PDE10A	10846	genome.wustl.edu	37	6	166401082	166401082	+	5'Flank	SNP	A	A	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr6:166401082A>T	ENST00000535229.1	-	0	0				LINC00473_ENST00000584911.1_lincRNA			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	ATTTAAAAAGAGACAGTGAGA	0.438																																					Esophageal Squamous(22;308 615 5753 12038 40624)												0								ENSG00000223414																																			LINC00473	SO:0001631	upstream_gene_variant	0			-	HGNC	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986		6.37:g.166401082A>T	Exception_encountered	Somatic	0	25	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000535229.1	37	NULL		6																																																																																			-	-		0.438	PDE10A-004	KNOWN	mRNA_end_NF|basic	processed_transcript	LINC00473	protein_coding	OTTHUMT00000470299.1	A		-		166401082	-1	no_errors	ENST00000444465	ensembl	human	known	74_37	rna	SNP	0.000	T
CHD1	1105	genome.wustl.edu	37	5	98236658	98236658	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:98236658T>A	ENST00000284049.3	-	6	865	c.716A>T	c.(715-717)aAt>aTt	p.N239I		NM_001270.2	NP_001261.2	O14646	CHD1_HUMAN	chromodomain helicase DNA binding protein 1	239					chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	49		all_cancers(142;5.36e-08)|all_epithelial(76;6.97e-11)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|all_lung(232;0.00119)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0717)	Epirubicin(DB00445)	ATAGCTAACATTAACAGTTGC	0.383																																																	0								ENSG00000153922						160.0	156.0	157.0					5																	98236658		2203	4300	6503	CHD1	SO:0001583	missense	0			-	HGNC	AF006513	CCDS34204.1	5q15-q21	2008-07-18			ENSG00000153922	ENSG00000153922			1915	protein-coding gene	gene with protein product		602118				8460153, 9326634	Standard	XM_005271866		Approved		uc003knf.3	O14646	OTTHUMG00000162744	ENST00000284049.3:c.716A>T	5.37:g.98236658T>A	ENSP00000284049:p.Asn239Ile	Somatic	0	39	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	Q17RZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.N239I	ENST00000284049.3	37	c.716	CCDS34204.1	5	.	.	.	.	.	.	.	.	.	.	T	24.0	4.478494	0.84747	.	.	ENSG00000153922	ENST00000284049	D	0.90197	-2.63	5.51	5.51	0.81932	.	0.000000	0.35677	U	0.003051	D	0.93559	0.7944	M	0.76002	2.32	0.80722	D	1	D	0.58268	0.982	P	0.55455	0.776	D	0.93765	0.7070	10	0.52906	T	0.07	.	15.9157	0.79517	0.0:0.0:0.0:1.0	.	239	O14646	CHD1_HUMAN	I	239	ENSP00000284049:N239I	ENSP00000284049:N239I	N	-	2	0	CHD1	98264558	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.546000	0.82137	2.218000	0.71995	0.377000	0.23210	AAT	-	NULL		0.383	CHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1	protein_coding	OTTHUMT00000370295.1	T	NM_001270	-		98236658	-1	no_errors	ENST00000284049	ensembl	human	known	74_37	missense	SNP	1.000	A
TTC25	83538	genome.wustl.edu	37	17	40091496	40091496	+	RNA	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:40091496G>T	ENST00000591658.1	+	0	209							Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25							cytoplasm (GO:0005737)				endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	12		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)				ATGGAGACAAGAACTGCCTGG	0.532																																																	0								ENSG00000204815						62.0	58.0	60.0					17																	40091496		1920	4144	6064	TTC25			0			-	HGNC	AK055498	CCDS74063.1	17q21.2	2014-08-12			ENSG00000204815	ENSG00000204815		"""Tetratricopeptide (TTC) repeat domain containing"""	25280	protein-coding gene	gene with protein product							Standard	XM_006722129		Approved	DKFZP434H0115	uc002hyj.4	Q96NG3	OTTHUMG00000175837		17.37:g.40091496G>T		Somatic	0	42	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q6NX40|Q6PJ04|Q9H0K5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000591658.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499339	0.64298	.	.	ENSG00000204815	ENST00000377540	.	.	.	5.62	4.6	0.57074	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.208922	0.46442	D	0.000300	T	0.68879	0.3049	M	0.71296	2.17	0.37155	D	0.902320	B;D	0.52996	0.257;0.957	B;P	0.58577	0.145;0.841	T	0.77885	-0.2421	8	0.62326	D	0.03	-28.275	11.2559	0.49054	0.0705:0.1282:0.8013:0.0	.	47;47	C9JGW6;Q96NG3	.;TTC25_HUMAN	N	47	.	ENSP00000366763:K47N	K	+	3	2	AC091172.1	37345022	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.987000	0.49378	2.650000	0.89964	0.655000	0.94253	AAG	-	-		0.532	TTC25-001	KNOWN	basic	processed_transcript	TTC25	processed_transcript	OTTHUMT00000449237.1	G	NM_031421	-		40091496	+1	no_errors	ENST00000377540	ensembl	human	known	74_37	rna	SNP	1.000	T
SEMA5A	9037	genome.wustl.edu	37	5	9063189	9063189	+	Silent	SNP	C	C	A	rs142331748		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:9063189C>A	ENST00000382496.5	-	18	2993	c.2328G>T	c.(2326-2328)ggG>ggT	p.G776G		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	776					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CAGAGTATCTCCCAGCACGCA	0.557																																																	0								ENSG00000112902	C		1,4405	2.1+/-5.4	0,1,2202	46.0	41.0	42.0		2328	-5.8	0.0	5	dbSNP_134	42	0,8600		0,0,4300	no	coding-synonymous	SEMA5A	NM_003966.2		0,1,6502	AA,AC,CC		0.0,0.0227,0.0077		776/1075	9063189	1,13005	2203	4300	6503	SEMA5A	SO:0001819	synonymous_variant	0			-	HGNC	U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.2328G>T	5.37:g.9063189C>A		Somatic	0	27	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	D3DTC6|O60408|Q1RLL9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Thrombospondin_1_rpt,superfamily_Semap_dom,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Thrombospondin_1_rpt,pfscan_Semap_dom,pfscan_Thrombospondin_1_rpt	p.G776	ENST00000382496.5	37	c.2328	CCDS3875.1	5																																																																																			-	NULL		0.557	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	protein_coding	OTTHUMT00000206989.2	C		rs142331748		9063189	-1	no_errors	ENST00000382496	ensembl	human	known	74_37	silent	SNP	0.014	A
CAB39L	81617	genome.wustl.edu	37	13	49925039	49925039	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr13:49925039G>A	ENST00000355854.4	-	5	902	c.405C>T	c.(403-405)gcC>gcT	p.A135A	CAB39L_ENST00000409308.1_Silent_p.A135A|CAB39L_ENST00000410043.1_Silent_p.A135A|CAB39L_ENST00000409130.1_5'UTR|CAB39L_ENST00000347776.5_Silent_p.A135A	NM_030925.2	NP_112187.2	Q9H9S4	CB39L_HUMAN	calcium binding protein 39-like	135					cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|stomach(1)	12		Lung NSC(96;2.11e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.66e-09)|COAD - Colon adenocarcinoma(199;0.226)		CAATCTGTGGGGCTTCATATC	0.343																																																	0								ENSG00000102547						84.0	81.0	82.0					13																	49925039		2203	4300	6503	CAB39L	SO:0001819	synonymous_variant	0			-	HGNC	AK022639	CCDS9416.2	13q14.11	2008-02-05			ENSG00000102547	ENSG00000102547			20290	protein-coding gene	gene with protein product		612175					Standard	NM_030925		Approved	bA103J18.3, FLJ12577, MO2L	uc001vcw.3	Q9H9S4	OTTHUMG00000016914	ENST00000355854.4:c.405C>T	13.37:g.49925039G>A		Somatic	0	56	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	28	27.50	Q5TAW6|Q6WG71|Q96FG1|Q9BZ33	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Mo25,superfamily_ARM-type_fold	p.A135	ENST00000355854.4	37	c.405	CCDS9416.2	13																																																																																			-	pfam_Mo25,superfamily_ARM-type_fold		0.343	CAB39L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAB39L	protein_coding	OTTHUMT00000044908.3	G	NM_030925	-		49925039	-1	no_errors	ENST00000347776	ensembl	human	known	74_37	silent	SNP	1.000	A
LOC100190940	100190940	genome.wustl.edu	37	12	130521234	130521235	+	lincRNA	INS	-	-	AAA	rs386378253|rs386378254|rs34472041|rs200802994	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:130521234_130521235insAAA	ENST00000567788.1	-	0	1466_1467				RP11-474D1.4_ENST00000561864.1_lincRNA																							gactctgtctcaaaaaaaaaag	0.431														2691	0.53734	0.329	0.6556	5008	,	,		27040	0.5645		0.7167	False		,,,				2504	0.5225																0								ENSG00000214039																																			RP11-474D1.3			0				Clone_based_vega_gene																													12.37:g.130521241_130521243dupAAA		Somatic	0	9	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	23	36.11		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567788.1	37	NULL		12																																																																																			-	-		0.431	RP11-474D1.3-001	KNOWN	basic	lincRNA	LOC100190940	lincRNA	OTTHUMT00000399498.1	-				130521235	-1	no_errors	ENST00000291374	ensembl	human	known	74_37	rna	INS	0.029:0.046	AAA
CCM2	83605	genome.wustl.edu	37	7	45067387	45067387	+	Intron	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:45067387G>T	ENST00000258781.6	+	2	179				CCM2_ENST00000474617.1_Start_Codon_SNP_p.M1I|CCM2_ENST00000475551.1_Start_Codon_SNP_p.M1I|CCM2_ENST00000461377.1_Intron|CCM2_ENST00000381112.3_Missense_Mutation_p.M28I|CCM2_ENST00000544363.1_Intron|CCM2_ENST00000541586.1_Intron	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2						blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						GGTATTCCATGGAGAATGAGG	0.478																																																	0								ENSG00000136280						60.0	63.0	62.0					7																	45067387		2203	4300	6503	CCM2	SO:0001627	intron_variant	0			-	HGNC	BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.31-10465G>T	7.37:g.45067387G>T		Somatic	0	30	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfscan_PTB/PI_dom	p.M28I	ENST00000258781.6	37	c.84	CCDS5500.1	7	.	.	.	.	.	.	.	.	.	.	G	14.71	2.615484	0.46631	.	.	ENSG00000136280	ENST00000475551;ENST00000381112;ENST00000474617	T;T;T	0.39997	1.06;1.05;2.06	4.3	3.42	0.39159	.	1.213410	0.05985	N	0.644969	T	0.26702	0.0653	N	0.08118	0	0.27108	N	0.962443	B;B;B	0.34161	0.103;0.439;0.034	B;B;B	0.32762	0.04;0.152;0.015	T	0.27673	-1.0067	10	0.66056	D	0.02	-1.5084	9.3715	0.38256	0.101:0.0:0.899:0.0	.	28;28;28	B7Z5A6;B7Z8D5;E9PDJ3	.;.;.	I	1;28;1	ENSP00000417180:M1I;ENSP00000370503:M28I;ENSP00000419474:M1I	ENSP00000370503:M28I	M	+	3	0	CCM2	45033912	1.000000	0.71417	0.966000	0.40874	0.985000	0.73830	2.269000	0.43346	1.161000	0.42604	0.650000	0.86243	ATG	-	NULL		0.478	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCM2	protein_coding	OTTHUMT00000251348.1	G	NM_031443	-		45067387	+1	no_errors	ENST00000381112	ensembl	human	known	74_37	missense	SNP	0.996	T
LRRC69	100130742	genome.wustl.edu	37	8	92136873	92136873	+	Intron	SNP	T	T	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:92136873T>G	ENST00000448384.2	+	2	310				LRRC69_ENST00000343709.3_Intron	NM_001129890.1	NP_001123362.1	Q6ZNQ3	LRC69_HUMAN	leucine rich repeat containing 69											endometrium(1)	1						AGGAACAACATTATAGCATCA	0.289																																																	0								ENSG00000214954						47.0	40.0	42.0					8																	92136873		692	1588	2280	LRRC69	SO:0001627	intron_variant	0			-	HGNC	AK130865		8q21.3	2010-07-14			ENSG00000214954	ENSG00000214954			34303	protein-coding gene	gene with protein product							Standard	NM_001129890		Approved		uc010mal.1	Q6ZNQ3	OTTHUMG00000164023	ENST00000448384.2:c.310+26T>G	8.37:g.92136873T>G		Somatic	0	62	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	42	33.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000448384.2	37	NULL		8																																																																																			-	-		0.289	LRRC69-007	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	LRRC69	protein_coding	OTTHUMT00000415207.1	T	NM_001129890	-		92136873	+1	no_errors	ENST00000522144	ensembl	human	putative	74_37	rna	SNP	0.003	G
PRKACG	5568	genome.wustl.edu	37	9	71628289	71628289	+	Silent	SNP	G	G	A	rs140133619		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:71628289G>A	ENST00000377276.2	-	1	750	c.720C>T	c.(718-720)taC>taT	p.Y240Y		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)	p.Y240Y(1)		central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GCTGGTCGGCGTAGAAGGGTG	0.602																																					Esophageal Squamous(110;2236 2623 32146)												1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)						ENSG00000165059						70.0	68.0	68.0					9																	71628289		2203	4300	6503	PRKACG	SO:0001819	synonymous_variant	0			-	HGNC	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.720C>T	9.37:g.71628289G>A		Somatic	0	36	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	O60850|Q5VZ02|Q86YI1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Y240	ENST00000377276.2	37	c.720	CCDS6625.1	9																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.602	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACG	protein_coding	OTTHUMT00000052559.1	G		-		71628289	-1	no_errors	ENST00000377276	ensembl	human	known	74_37	silent	SNP	0.998	A
LOC101927285	101927285	genome.wustl.edu	37	2	59504863	59504864	+	lincRNA	INS	-	-	TG	rs56011039|rs71394442|rs397932982|rs374492910	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:59504863_59504864insTG	ENST00000409590.1	+	0	364_365				RP11-444A22.1_ENST00000606382.1_lincRNA|AC007131.2_ENST00000444001.2_lincRNA																							GCATGCACGAAtgtgtgtgtgt	0.371														1616	0.322684	0.2799	0.2695	5008	,	,		22647	0.3393		0.3588	False		,,,				2504	0.364																0								ENSG00000222030																																			AC007131.1			0				Clone_based_vega_gene																													2.37:g.59504872_59504873dupTG		Somatic	0	10	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	4	55.56		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409590.1	37	NULL		2																																																																																			-	-		0.371	AC007131.1-001	KNOWN	basic	lincRNA	LOC101927285	lincRNA	OTTHUMT00000327020.2	-				59504864	+1	no_errors	ENST00000409590	ensembl	human	known	74_37	rna	INS	0.007:0.139	TG
NALCN	259232	genome.wustl.edu	37	13	101936334	101936334	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr13:101936334C>A	ENST00000251127.6	-	10	1165	c.1084G>T	c.(1084-1086)Gta>Tta	p.V362L	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Missense_Mutation_p.V362L	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	362					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TCCACAGCTACCAGCTGCCAA	0.468																																																	0								ENSG00000102452						43.0	43.0	43.0					13																	101936334		2203	4300	6503	NALCN	SO:0001583	missense	0			-	HGNC	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1084G>T	13.37:g.101936334C>A	ENSP00000251127:p.Val362Leu	Somatic	0	87	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	47	34.72	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom	p.V362L	ENST00000251127.6	37	c.1084	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779604	0.90195	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98296	-4.58;-4.85	5.6	5.6	0.85130	.	0.058479	0.64402	D	0.000002	D	0.97888	0.9306	L	0.60455	1.87	0.80722	D	1	P;P;P	0.49961	0.76;0.915;0.93	P;P;P	0.49887	0.505;0.542;0.625	D	0.98065	1.0395	10	0.49607	T	0.09	.	19.6044	0.95575	0.0:1.0:0.0:0.0	.	362;362;362	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	L	362	ENSP00000251127:V362L;ENSP00000365367:V362L	ENSP00000251127:V362L	V	-	1	0	NALCN	100734335	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.450000	0.80656	2.638000	0.89438	0.543000	0.68304	GTA	-	NULL		0.468	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	protein_coding	OTTHUMT00000045663.2	C	NM_052867	-		101936334	-1	no_errors	ENST00000251127	ensembl	human	known	74_37	missense	SNP	1.000	A
SCN8A	6334	genome.wustl.edu	37	12	52145167	52145167	+	Silent	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:52145167G>A	ENST00000354534.6	+	14	2338	c.2160G>A	c.(2158-2160)ccG>ccA	p.P720P	SCN8A_ENST00000545061.1_Silent_p.P720P|SCN8A_ENST00000550891.1_Silent_p.P720P	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	720					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	GAAAGTGCCCGCCATGCTGGT	0.458																																																	0								ENSG00000196876						142.0	130.0	134.0					12																	52145167		1891	4102	5993	SCN8A	SO:0001819	synonymous_variant	0			-	HGNC	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.2160G>A	12.37:g.52145167G>A		Somatic	0	67	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	35	20.45	B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.P720	ENST00000354534.6	37	c.2160	CCDS44891.1	12																																																																																			-	NULL		0.458	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	protein_coding	OTTHUMT00000404372.3	G	NM_014191	-		52145167	+1	no_errors	ENST00000354534	ensembl	human	known	74_37	silent	SNP	0.002	A
TRIOBP	11078	genome.wustl.edu	37	22	38120154	38120154	+	Missense_Mutation	SNP	G	G	A	rs201112075	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr22:38120154G>A	ENST00000406386.3	+	7	1846	c.1591G>A	c.(1591-1593)Gcc>Acc	p.A531T		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	531					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AACATCCTGCGCCCAGCGGGA	0.597													-|||	29	0.00579073	0.0008	0.0303	5008	,	,		29059	0.0069		0.0	False		,,,				2504	0.0																0								ENSG00000100106						76.0	121.0	106.0					22																	38120154		1942	4169	6111	TRIOBP	SO:0001583	missense	0			-	HGNC	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1591G>A	22.37:g.38120154G>A	ENSP00000384312:p.Ala531Thr	Somatic	0	165	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	129	20.12	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A531T	ENST00000406386.3	37	c.1591	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	-	2.979	-0.210711	0.06140	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.19250	2.16	3.17	-2.72	0.05968	.	.	.	.	.	T	0.12008	0.0292	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.30563	-0.9974	9	0.49607	T	0.09	.	6.7719	0.23598	0.6323:0.0:0.3677:0.0	.	531	Q9H2D6	TARA_HUMAN	T	531	ENSP00000384312:A531T	ENSP00000384312:A531T	A	+	1	0	TRIOBP	36450100	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-4.532000	0.00220	-0.265000	0.09352	-0.763000	0.03452	GCC	-	NULL		0.597	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	protein_coding	OTTHUMT00000319439.2	G		rs201112075		38120154	+1	no_errors	ENST00000406386	ensembl	human	known	74_37	missense	SNP	0.000	A
C2CD5	9847	genome.wustl.edu	37	12	22670939	22670939	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:22670939C>G	ENST00000333957.4	-	8	1188	c.933G>C	c.(931-933)ttG>ttC	p.L311F	C2CD5_ENST00000536386.1_Intron|C2CD5_ENST00000544930.1_Intron|C2CD5_ENST00000542676.1_Missense_Mutation_p.L311F|C2CD5_ENST00000396028.2_Intron|C2CD5_ENST00000545552.1_Intron|C2CD5_ENST00000446597.1_Missense_Mutation_p.L311F|C2CD5_ENST00000540703.1_5'Flank	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	311					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										GTGTCAAACTCAAATCTGTGT	0.388																																																	0								ENSG00000111731						195.0	191.0	193.0					12																	22670939		2203	4300	6503	C2CD5	SO:0001583	missense	0			-	HGNC	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.933G>C	12.37:g.22670939C>G	ENSP00000334229:p.Leu311Phe	Somatic	0	61	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	19	40.62	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L311F	ENST00000333957.4	37	c.933	CCDS31758.1	12	.	.	.	.	.	.	.	.	.	.	C	12.81	2.049558	0.36181	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000542676	T;T;T	0.58210	0.35;0.35;0.35	6.04	5.15	0.70609	.	.	.	.	.	T	0.69214	0.3086	M	0.65975	2.015	0.80722	D	1	P;D	0.65815	0.684;0.995	P;D	0.72982	0.453;0.979	T	0.68021	-0.5519	9	0.32370	T	0.25	-6.4076	15.1783	0.72934	0.0:0.9329:0.0:0.0671	.	311;311	B4DRN7;Q86YS7	.;K0528_HUMAN	F	311	ENSP00000334229:L311F;ENSP00000388756:L311F;ENSP00000441951:L311F	ENSP00000334229:L311F	L	-	3	2	KIAA0528	22562206	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.088000	0.71371	1.568000	0.49683	0.561000	0.74099	TTG	-	NULL		0.388	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD5	protein_coding	OTTHUMT00000402257.1	C	NM_014802	-		22670939	-1	no_errors	ENST00000333957	ensembl	human	known	74_37	missense	SNP	1.000	G
AGPS	8540	genome.wustl.edu	37	2	178257538	178257538	+	Silent	SNP	A	A	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:178257538A>G	ENST00000264167.4	+	1	167	c.21A>G	c.(19-21)gcA>gcG	p.A7A	NFE2L2_ENST00000464747.1_5'Flank|AGPS_ENST00000409888.1_Silent_p.A7A|AC074286.1_ENST00000397057.2_RNA	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	7	Poly-Ala.				cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			CGGCGGCTGCAGCGGGTGGGA	0.766																																																	0								ENSG00000018510						2.0	3.0	3.0					2																	178257538		1222	2857	4079	AGPS	SO:0001819	synonymous_variant	0			-	HGNC	Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.21A>G	2.37:g.178257538A>G		Somatic	0	27	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	A5D8U9|Q2TU35	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.A7	ENST00000264167.4	37	c.21	CCDS2275.1	2																																																																																			-	NULL		0.766	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPS	protein_coding	OTTHUMT00000255730.2	A		-		178257538	+1	no_errors	ENST00000264167	ensembl	human	known	74_37	silent	SNP	0.895	G
CTNND1	1500	genome.wustl.edu	37	11	57576781	57576781	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:57576781C>T	ENST00000399050.4	+	15	2814	c.2278C>T	c.(2278-2280)Cca>Tca	p.P760S	CTNND1_ENST00000358694.6_Missense_Mutation_p.P754S|CTNND1_ENST00000531014.1_Missense_Mutation_p.P431S|CTNND1_ENST00000526772.1_Missense_Mutation_p.P431S|CTNND1_ENST00000526938.1_Missense_Mutation_p.P760S|CTNND1_ENST00000526357.1_Missense_Mutation_p.P700S|CTNND1_ENST00000529919.1_Missense_Mutation_p.P760S|CTNND1_ENST00000525902.1_Missense_Mutation_p.P437S|CTNND1_ENST00000415361.2_Missense_Mutation_p.P659S|CTNND1_ENST00000360682.6_Missense_Mutation_p.P760S|CTNND1_ENST00000529873.1_Missense_Mutation_p.P700S|CTNND1_ENST00000361391.6_Missense_Mutation_p.P754S|CTNND1_ENST00000532844.1_Missense_Mutation_p.P706S|CTNND1_ENST00000532463.1_Missense_Mutation_p.P653S|CTNND1_ENST00000428599.2_Missense_Mutation_p.P754S|CTNND1_ENST00000528621.1_Missense_Mutation_p.P700S|CTNND1_ENST00000530748.1_Missense_Mutation_p.P706S|CTNND1_ENST00000533667.1_Missense_Mutation_p.P431S|CTNND1_ENST00000532649.1_Missense_Mutation_p.P700S|CTNND1_ENST00000529526.1_Missense_Mutation_p.P700S|CTNND1_ENST00000361796.4_Missense_Mutation_p.P754S|CTNND1_ENST00000399039.4_Missense_Mutation_p.P760S|CTNND1_ENST00000524630.1_Missense_Mutation_p.P754S|CTNND1_ENST00000529986.1_Missense_Mutation_p.P653S|CTNND1_ENST00000532245.1_Missense_Mutation_p.P653S|CTNND1_ENST00000426142.2_Missense_Mutation_p.P653S|CTNND1_ENST00000527467.1_Missense_Mutation_p.P437S|CTNND1_ENST00000528232.1_Missense_Mutation_p.P659S|CTNND1_ENST00000530094.1_Missense_Mutation_p.P653S|CTNND1_ENST00000532787.1_Missense_Mutation_p.P653S|CTNND1_ENST00000361332.4_Missense_Mutation_p.P754S|CTNND1_ENST00000534579.1_Missense_Mutation_p.P700S	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	760					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				AAAGAATCTGCCAGGAGGACA	0.418																																																	0								ENSG00000198561						102.0	101.0	101.0					11																	57576781		1883	4117	6000	CTNND1	SO:0001583	missense	0			-	HGNC	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.2278C>T	11.37:g.57576781C>T	ENSP00000382004:p.Pro760Ser	Somatic	0	62	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.P760S	ENST00000399050.4	37	c.2278	CCDS44604.1	11	.	.	.	.	.	.	.	.	.	.	C	23.4	4.415323	0.83449	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000533667;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000527467;ENST00000528232;ENST00000531014;ENST00000526772;ENST00000529873;ENST00000525902;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86;0.86	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.055116	0.85682	D	0.000000	T	0.61438	0.2347	L	0.45352	1.415	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.87578	0.998;0.998;0.996;0.998;0.998;0.998;0.994;0.998;0.996	T	0.62845	-0.6768	10	0.72032	D	0.01	-4.0681	14.7072	0.69200	0.0:0.8551:0.1449:0.0	.	760;754;760;653;700;700;754;760;760	O60716-3;O60716-2;O60716;O60716-18;O60716-14;O60716-10;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.;.;.;.	S	754;760;760;760;754;700;653;760;754;754;653;653;754;653;431;700;700;706;754;437;659;431;431;700;437;706;700;653;659;653;700;760	ENSP00000436543:P754S;ENSP00000434808:P760S;ENSP00000381996:P760S;ENSP00000353902:P760S;ENSP00000354907:P754S;ENSP00000436323:P700S;ENSP00000409930:P653S;ENSP00000382004:P760S;ENSP00000354785:P754S;ENSP00000354823:P754S;ENSP00000432075:P653S;ENSP00000437156:P653S;ENSP00000351527:P754S;ENSP00000434949:P653S;ENSP00000437051:P431S;ENSP00000435379:P700S;ENSP00000432243:P700S;ENSP00000436744:P706S;ENSP00000413586:P754S;ENSP00000434900:P437S;ENSP00000435266:P659S;ENSP00000432623:P431S;ENSP00000433158:P431S;ENSP00000435494:P700S;ENSP00000434672:P437S;ENSP00000433276:P706S;ENSP00000433334:P700S;ENSP00000437327:P653S;ENSP00000403518:P659S;ENSP00000434017:P653S;ENSP00000435789:P700S;ENSP00000432041:P760S	ENSP00000351527:P754S	P	+	1	0	CTNND1	57333357	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.782000	0.68973	2.605000	0.88082	0.655000	0.94253	CCA	-	superfamily_ARM-type_fold		0.418	CTNND1-006	KNOWN	basic|CCDS	protein_coding	CTNND1	protein_coding	OTTHUMT00000393944.1	C	NM_001331	-		57576781	+1	no_errors	ENST00000399050	ensembl	human	known	74_37	missense	SNP	1.000	T
SPATA6	54558	genome.wustl.edu	37	1	48865230	48865230	+	Silent	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:48865230G>T	ENST00000371847.3	-	7	737	c.573C>A	c.(571-573)tcC>tcA	p.S191S	SPATA6_ENST00000371843.3_Silent_p.S191S|SPATA6_ENST00000396199.3_Silent_p.S119S|SPATA6_ENST00000463938.1_5'UTR	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	191					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						CAGGTGACTTGGATTTTTTCT	0.333																																																	0								ENSG00000132122						164.0	168.0	166.0					1																	48865230		2203	4300	6503	SPATA6	SO:0001819	synonymous_variant	0			-	HGNC	AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.573C>A	1.37:g.48865230G>T		Somatic	0	60	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q5T3N7|Q8WUE6	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S191	ENST00000371847.3	37	c.573	CCDS551.1	1																																																																																			-	NULL		0.333	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA6	protein_coding	OTTHUMT00000021347.1	G	NM_019073	-		48865230	-1	no_errors	ENST00000371847	ensembl	human	known	74_37	silent	SNP	0.964	T
DYNC1I1	1780	genome.wustl.edu	37	7	95625320	95625320	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:95625320G>C	ENST00000324972.6	+	10	1148	c.955G>C	c.(955-957)Gga>Cga	p.G319R	DYNC1I1_ENST00000537881.1_Missense_Mutation_p.G282R|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.G282R|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.G302R|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.G299R|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.G302R	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	319					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TGAACCAGATGGAGTGGCCTT	0.428																																																	0								ENSG00000158560						226.0	201.0	210.0					7																	95625320		2203	4300	6503	DYNC1I1	SO:0001583	missense	0			-	HGNC	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.955G>C	7.37:g.95625320G>C	ENSP00000320130:p.Gly319Arg	Somatic	0	88	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	53	41.11	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.G319R	ENST00000324972.6	37	c.955	CCDS5644.1	7	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377713	0.82682	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.11063	2.81;2.81;2.81;2.81;2.81;2.81	4.89	4.89	0.63831	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.054422	0.64402	D	0.000001	T	0.45836	0.1362	M	0.93720	3.45	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	T	0.60037	-0.7341	10	0.87932	D	0	-1.2247	18.6224	0.91326	0.0:0.0:1.0:0.0	.	302;299;302;319;282	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	R	302;319;282;299;282;302	ENSP00000392337:G302R;ENSP00000320130:G319R;ENSP00000438377:G282R;ENSP00000398118:G299R;ENSP00000352348:G282R;ENSP00000412444:G302R	ENSP00000320130:G319R	G	+	1	0	DYNC1I1	95463256	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.717000	0.92951	0.655000	0.94253	GGA	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.428	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	protein_coding	OTTHUMT00000333432.1	G	NM_004411	-		95625320	+1	no_errors	ENST00000324972	ensembl	human	known	74_37	missense	SNP	1.000	C
ASTE1	28990	genome.wustl.edu	37	3	130733046	130733047	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:130733046_130733047insT	ENST00000264992.3	-	6	2335_2336	c.1894_1895insA	c.(1894-1896)aggfs	p.R632fs	ATP2C1_ENST00000507488.2_Intron|ATP2C1_ENST00000422190.2_Intron|ASTE1_ENST00000514044.1_Frame_Shift_Ins_p.R657fs|ATP2C1_ENST00000513801.1_Intron|ATP2C1_ENST00000393221.4_Intron|ATP2C1_ENST00000533801.2_Intron|ATP2C1_ENST00000504381.1_Intron|ATP2C1_ENST00000359644.3_Intron|ATP2C1_ENST00000328560.8_Intron	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	632					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.R632fs*33(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTTCTTCTGCCTTTTTTTTTTT	0.406																																																	2	Deletion - Frameshift(2)	ovary(2)						ENSG00000034533																																			ASTE1	SO:0001589	frameshift_variant	0				HGNC	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1895dupA	3.37:g.130733057_130733057dupT	ENSP00000264992:p.Arg632fs	Somatic	0	29	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	22	18.52	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_XPG_DNA_repair_N	p.R632fs	ENST00000264992.3	37	c.1895_1894	CCDS3068.1	3																																																																																			-	NULL		0.406	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	protein_coding	OTTHUMT00000356659.1	-	NM_014065			130733047	-1	no_errors	ENST00000264992	ensembl	human	known	74_37	frame_shift_ins	INS	0.003:0.014	T
MT-CO2	4513	genome.wustl.edu	37	M	7988	7988	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chrM:7988C>T	ENST00000361739.1	+	1	403	c.403C>T	c.(403-405)Ctc>Ttc	p.L135F	MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	135					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						GCGACCTGCGACTCCTTGACG	0.488																																																	0								ENSG00000198712																																			MT-CO2	SO:0001583	missense	0			-	HGNC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.403C>T	M.37:g.7988C>T	ENSP00000354876:p.Leu135Phe	Somatic	0	252	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	122	55	68.93	Q37526	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.L135F	ENST00000361739.1	37	c.403		MT																																																																																			-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2		0.488	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	protein_coding		C	YP_003024029	-		7988	+1	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	SNP	NULL	T
PANX1	24145	genome.wustl.edu	37	11	93914004	93914004	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:93914004C>T	ENST00000227638.3	+	5	1635	c.1250C>T	c.(1249-1251)gCc>gTc	p.A417V	PANX1_ENST00000436171.2_Missense_Mutation_p.A413V	NM_015368.3	NP_056183.2	Q96RD7	PANX1_HUMAN	pannexin 1	417					calcium ion transport (GO:0006816)|cation transport (GO:0006812)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 alpha secretion (GO:0050717)|positive regulation of interleukin-1 beta secretion (GO:0050718)|protein hexamerization (GO:0034214)|response to ATP (GO:0033198)|response to ischemia (GO:0002931)|synaptic transmission (GO:0007268)	bleb (GO:0032059)|endoplasmic reticulum (GO:0005783)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calcium channel activity (GO:0005262)|gap junction hemi-channel activity (GO:0055077)|leak channel activity (GO:0022840)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(2)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Probenecid(DB01032)	GAGAAGAATGCCCGACAGAGA	0.373																																																	0								ENSG00000110218						115.0	116.0	116.0					11																	93914004		2201	4298	6499	PANX1	SO:0001583	missense	0			-	HGNC	AF093239	CCDS8296.1	11q14-q21	2011-12-02			ENSG00000110218	ENSG00000110218		"""Ion channels / Pannexins"""	8599	protein-coding gene	gene with protein product	"""innexin"""	608420				14597722	Standard	NM_015368		Approved	MRS1, UNQ2529, PX1	uc001per.3	Q96RD7	OTTHUMG00000167757	ENST00000227638.3:c.1250C>T	11.37:g.93914004C>T	ENSP00000227638:p.Ala417Val	Somatic	0	50	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	O75968|Q543A0|Q6UW26|Q96AM9|Q96L77|Q96RS5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Innexin,pfscan_Innexin	p.A417V	ENST00000227638.3	37	c.1250	CCDS8296.1	11	.	.	.	.	.	.	.	.	.	.	C	0.029	-1.347565	0.01266	.	.	ENSG00000110218	ENST00000227638;ENST00000436171	T;T	0.16597	2.33;2.38	5.19	3.13	0.36017	.	0.839412	0.10706	N	0.643485	T	0.08802	0.0218	N	0.24115	0.695	0.20563	N	0.99989	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.42413	-0.9453	10	0.02654	T	1	-7.7129	5.1497	0.15004	0.0:0.2885:0.0:0.7115	.	417;413	Q96RD7;Q96RD7-2	PANX1_HUMAN;.	V	417;413	ENSP00000227638:A417V;ENSP00000411461:A413V	ENSP00000227638:A417V	A	+	2	0	PANX1	93553652	0.999000	0.42202	0.136000	0.22124	0.227000	0.25037	2.226000	0.42963	0.502000	0.28037	-0.140000	0.14226	GCC	-	NULL		0.373	PANX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PANX1	protein_coding	OTTHUMT00000396121.1	C	NM_015368	-		93914004	+1	no_errors	ENST00000227638	ensembl	human	known	74_37	missense	SNP	0.587	T
RHOT2	89941	genome.wustl.edu	37	16	720824	720824	+	Intron	SNP	C	C	A	rs546664930		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:720824C>A	ENST00000315082.4	+	9	753				RHOT2_ENST00000569943.2_3'UTR	NM_138769.2	NP_620124.1	Q8IXI1	MIRO2_HUMAN	ras homolog family member T2						cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|pancreas(2)|prostate(1)	13		Hepatocellular(780;0.0218)				CCTCCGCTGCCGTTAGTGACT	0.642																																																	0								ENSG00000140983						18.0	23.0	22.0					16																	720824		2193	4294	6487	RHOT2	SO:0001627	intron_variant	0			-	HGNC	BC014942	CCDS10417.1	16p13.3	2013-01-10	2012-02-27	2004-03-24	ENSG00000140983	ENSG00000140983		"""EF-hand domain containing"""	21169	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 2"""	613889	"""chromosome 16 open reading frame 39"", ""ras homolog gene family, member T2"""	C16orf39, ARHT2		12482879	Standard	NM_138769		Approved	MIRO-2	uc002cip.3	Q8IXI1	OTTHUMG00000121139	ENST00000315082.4:c.639+51C>A	16.37:g.720824C>A		Somatic	0	147	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	82	35.43	A2IDC2|Q8NF53|Q96C13|Q96S17|Q9BT60|Q9H7M8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000315082.4	37	NULL	CCDS10417.1	16																																																																																			-	-		0.642	RHOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOT2	protein_coding	OTTHUMT00000241617.1	C	NM_138769	-		720824	+1	no_errors	ENST00000569943	ensembl	human	known	74_37	rna	SNP	0.000	A
SNHG14	104472715	genome.wustl.edu	37	15	25287126	25287126	+	RNA	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr15:25287126G>T	ENST00000552781.1	+	0	328				SNORD109A_ENST00000459128.1_RNA																							TGTTTGGATCGATGATGAGAA	0.433																																																	0								ENSG00000270246						69.0	66.0	67.0					15																	25287126		876	1991	2867	SNORD109A			0			-	HGNC																													15.37:g.25287126G>T		Somatic	0	98	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	43	29.51		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000552781.1	37	NULL		15																																																																																			-	-		0.433	RP11-701H24.10-001	KNOWN	basic|readthrough_transcript	processed_transcript	SNORD109A	processed_transcript	OTTHUMT00000473258.1	G		-		25287126	+1	no_errors	ENST00000459128	ensembl	human	known	74_37	rna	SNP	0.983	T
DST	667	genome.wustl.edu	37	6	56489356	56489356	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr6:56489356T>G	ENST00000361203.3	-	32	4275	c.4268A>C	c.(4267-4269)gAt>gCt	p.D1423A	DST_ENST00000370765.6_Missense_Mutation_p.D1097A|DST_ENST00000421834.2_Missense_Mutation_p.D1423A|DST_ENST00000370788.2_Missense_Mutation_p.D1423A|DST_ENST00000518935.1_Missense_Mutation_p.D1097A|DST_ENST00000446842.2_Missense_Mutation_p.D1097A|DST_ENST00000370754.5_Missense_Mutation_p.D1601A|DST_ENST00000244364.6_Missense_Mutation_p.D1097A|DST_ENST00000370769.4_Missense_Mutation_p.D1423A|DST_ENST00000312431.6_Missense_Mutation_p.D1423A			Q03001	DYST_HUMAN	dystonin	1423					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CTTCAATGAATCACCAGCAAA	0.393																																																	0								ENSG00000151914						82.0	77.0	79.0					6																	56489356		2203	4300	6503	DST	SO:0001583	missense	0			-	HGNC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.4268A>C	6.37:g.56489356T>G	ENSP00000354508:p.Asp1423Ala	Somatic	0	32	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	19	29.63	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.D1601A	ENST00000361203.3	37	c.4802		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.16|18.16	3.562977|3.562977	0.65538|0.65538	.|.	.|.	ENSG00000151914|ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935|ENST00000522360	T;T;T;T;T;T;T;T;T;T;T;T|.	0.26957|.	1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.000000|.	0.56097|.	D|.	0.000028|.	T|T	0.52980|0.52980	0.1768|0.1768	L|L	0.52126|0.52126	1.63|1.63	0.19300|.	N|.	0.999977|.	P;D;D;P;D;D;P;D|.	0.89917|.	0.734;0.983;0.979;0.672;0.992;0.999;0.734;1.0|.	B;P;P;B;D;D;B;D|.	0.78314|.	0.196;0.68;0.549;0.217;0.915;0.991;0.196;0.981|.	T|T	0.54918|0.54918	-0.8221|-0.8221	9|4	0.52906|.	T|.	0.07|.	.|.	15.1167|15.1167	0.72407|0.72407	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1423;1423;1601;1097;1097;1097;1423;1097|.	Q5TBT1;E7ERU2;E9PEB9;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8|.	.;.;.;.;.;.;DYST_HUMAN;.|.	A|L	1097;1601;1423;1423;1097;1423;1423;1423;1097;1463;1097;1097|95	ENSP00000244364:D1097A;ENSP00000359790:D1601A;ENSP00000359805:D1423A;ENSP00000400883:D1423A;ENSP00000393645:D1097A;ENSP00000307959:D1423A;ENSP00000359824:D1423A;ENSP00000354508:D1423A;ENSP00000404924:D1097A;ENSP00000431030:D1463A;ENSP00000359801:D1097A;ENSP00000431003:D1097A|.	ENSP00000244364:D1097A|.	D|I	-|-	2|1	0|0	DST|DST	56597315|56597315	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.995000|0.995000	0.86356|0.86356	7.997000|7.997000	0.88414|0.88414	2.222000|2.222000	0.72286|0.72286	0.528000|0.528000	0.53228|0.53228	GAT|ATT	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.393	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	T	NM_001723	-		56489356	-1	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	SNP	1.000	G
KLHDC4	54758	genome.wustl.edu	37	16	87745030	87745030	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:87745030C>T	ENST00000270583.5	-	9	913	c.855G>A	c.(853-855)cgG>cgA	p.R285R	KLHDC4_ENST00000353170.5_Silent_p.R228R|KLHDC4_ENST00000566349.1_5'UTR|KLHDC4_ENST00000347925.5_Silent_p.R254R	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	285										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		AAGGGTTCATCCGAGTCCAAA	0.582																																																	0								ENSG00000104731						35.0	35.0	35.0					16																	87745030		2198	4300	6498	KLHDC4	SO:0001819	synonymous_variant	0			-	HGNC	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.855G>A	16.37:g.87745030C>T		Somatic	0	46	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_2,pfam_Kelch_1	p.R285	ENST00000270583.5	37	c.855	CCDS10963.1	16																																																																																			-	pfam_Kelch_2		0.582	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLHDC4	protein_coding	OTTHUMT00000269109.2	C	NM_017566	-		87745030	-1	no_errors	ENST00000270583	ensembl	human	known	74_37	silent	SNP	0.004	T
ETV6	2120	genome.wustl.edu	37	12	12006459	12006459	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:12006459C>T	ENST00000396373.4	+	4	701	c.427C>T	c.(427-429)Cag>Tag	p.Q143*		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	143					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				TATACACACACAGCCGGAGGT	0.428			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																			Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	0								ENSG00000139083						143.0	140.0	141.0					12																	12006459		2203	4300	6503	ETV6	SO:0001587	stop_gained	0			-	HGNC	BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.427C>T	12.37:g.12006459C>T	ENSP00000379658:p.Gln143*	Somatic	0	36	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.Q143*	ENST00000396373.4	37	c.427	CCDS8643.1	12	.	.	.	.	.	.	.	.	.	.	C	38	7.199880	0.98132	.	.	ENSG00000139083	ENST00000396373	.	.	.	5.52	4.61	0.57282	.	0.129126	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	14.929	0.70900	0.1486:0.8514:0.0:0.0	.	.	.	.	X	143	.	ENSP00000379658:Q143X	Q	+	1	0	ETV6	11897726	0.999000	0.42202	0.975000	0.42487	0.985000	0.73830	4.404000	0.59735	1.265000	0.44215	0.655000	0.94253	CAG	-	NULL		0.428	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV6	protein_coding	OTTHUMT00000400130.2	C	NM_001987	-		12006459	+1	no_errors	ENST00000396373	ensembl	human	known	74_37	nonsense	SNP	0.992	T
AKIP1	56672	genome.wustl.edu	37	11	8932989	8932989	+	Splice_Site	SNP	A	A	G	rs111610807		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:8932989A>G	ENST00000309377.4	+	2	84		c.e2-1		ST5_ENST00000534127.1_5'Flank|AKIP1_ENST00000396648.2_5'UTR|AKIP1_ENST00000529876.1_5'UTR|AKIP1_ENST00000309357.4_Splice_Site|AKIP1_ENST00000534506.1_Splice_Site|AKIP1_ENST00000534147.1_5'Flank|AKIP1_ENST00000525005.1_5'UTR|AKIP1_ENST00000299576.5_Splice_Site	NM_020642.3	NP_065693.2	Q9NQ31	AKIP1_HUMAN	A kinase (PRKA) interacting protein 1						substrate adhesion-dependent cell spreading (GO:0034446)	nucleus (GO:0005634)				kidney(1)|large_intestine(2)|lung(2)	5						GTGCCCACTCAGGGAGCCATG	0.662																																																	0								ENSG00000166452						21.0	21.0	21.0					11																	8932989		2200	4289	6489	AKIP1	SO:0001630	splice_region_variant	0			-	HGNC	AF512007	CCDS7793.1, CCDS55743.1, CCDS55744.1	11p15.3	2011-04-18	2011-04-18	2011-04-18	ENSG00000166452	ENSG00000166452			1170	protein-coding gene	gene with protein product		609191	"""chromosome 11 open reading frame 17"""	C11orf17		20562110, 18178962, 15630084	Standard	NM_020642		Approved	BCA3	uc001mgx.3	Q9NQ31	OTTHUMG00000165653	ENST00000309377.4:c.-6-1A>G	11.37:g.8932989A>G		Somatic	0	62	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	Q8NBS2|Q8TAC6|Q8TAD3|Q8TAE0	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e1-2	ENST00000309377.4	37	c.1-2	CCDS7793.1	11																																																																																			-	-		0.662	AKIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKIP1	protein_coding	OTTHUMT00000385615.1	A	NM_020642	rs111610807	Intron	8932989	+1	no_errors	ENST00000309377	ensembl	human	known	74_37	splice_site	SNP	0.827	G
PCLO	27445	genome.wustl.edu	37	7	82544714	82544714	+	Silent	SNP	A	A	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:82544714A>G	ENST00000333891.9	-	7	12925	c.12588T>C	c.(12586-12588)atT>atC	p.I4196I	PCLO_ENST00000423517.2_Silent_p.I4196I|PCLO_ENST00000437081.1_Silent_p.I916I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTTAGGGTCAATTAGTGATT	0.363																																																	0								ENSG00000186472						82.0	73.0	76.0					7																	82544714		1870	4101	5971	PCLO	SO:0001819	synonymous_variant	0			-	HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.12588T>C	7.37:g.82544714A>G		Somatic	0	46	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	47	12.96		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.I4196	ENST00000333891.9	37	c.12588	CCDS47630.1	7																																																																																			-	NULL		0.363	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	A	NM_014510	-		82544714	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	silent	SNP	1.000	G
DYNC1H1	1778	genome.wustl.edu	37	14	102505858	102505858	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:102505858C>G	ENST00000360184.4	+	61	11734	c.11570C>G	c.(11569-11571)tCc>tGc	p.S3857C	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3857					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CAGCGCCTGTCCATTATAACA	0.532																																																	0								ENSG00000197102						98.0	91.0	94.0					14																	102505858		2203	4300	6503	DYNC1H1	SO:0001583	missense	0			-	HGNC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.11570C>G	14.37:g.102505858C>G	ENSP00000348965:p.Ser3857Cys	Somatic	0	33	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	19	40.62	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.S3857C	ENST00000360184.4	37	c.11570	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	C	14.21	2.467064	0.43839	.	.	ENSG00000197102	ENST00000360184	T	0.62364	0.03	5.42	3.51	0.40186	.	0.299368	0.37261	N	0.002170	T	0.59004	0.2162	L	0.50333	1.59	0.41158	D	0.986071	B	0.32939	0.391	B	0.35240	0.198	T	0.59563	-0.7431	10	0.52906	T	0.07	.	15.4934	0.75629	0.0:0.737:0.263:0.0	.	3857	Q14204	DYHC1_HUMAN	C	3857	ENSP00000348965:S3857C	ENSP00000348965:S3857C	S	+	2	0	DYNC1H1	101575611	0.753000	0.28349	0.634000	0.29324	0.786000	0.44442	1.506000	0.35747	0.589000	0.29677	0.591000	0.81541	TCC	-	NULL		0.532	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	C	NM_001376	-		102505858	+1	no_errors	ENST00000360184	ensembl	human	known	74_37	missense	SNP	0.902	G
SFMBT1	51460	genome.wustl.edu	37	3	52940182	52940182	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:52940182G>A	ENST00000394752.3	-	20	2789	c.2407C>T	c.(2407-2409)Cgg>Tgg	p.R803W	SFMBT1_ENST00000394750.1_Missense_Mutation_p.R803W|SFMBT1_ENST00000296295.6_Intron|SFMBT1_ENST00000358080.2_Missense_Mutation_p.R803W	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	803	SAM.				cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		CTGATGAACCGCACAACGTCT	0.418																																																	0								ENSG00000163935						149.0	129.0	136.0					3																	52940182		2203	4300	6503	SFMBT1	SO:0001583	missense	0			-	HGNC	AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.2407C>T	3.37:g.52940182G>A	ENSP00000378235:p.Arg803Trp	Somatic	0	56	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.09	Q402F7|Q96C73|Q9Y4Q9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.R803W	ENST00000394752.3	37	c.2407	CCDS2867.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.412970	0.96072	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000394750	T;T;T	0.50813	0.73;0.73;0.73	5.85	5.85	0.93711	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.000000	0.85682	D	0.000000	T	0.64549	0.2608	L	0.45352	1.415	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.64816	-0.6318	10	0.87932	D	0	.	20.1649	0.98147	0.0:0.0:1.0:0.0	.	803	Q9UHJ3	SMBT1_HUMAN	W	803	ENSP00000378235:R803W;ENSP00000350789:R803W;ENSP00000378233:R803W	ENSP00000350789:R803W	R	-	1	2	SFMBT1	52915222	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	6.624000	0.74243	2.753000	0.94483	0.655000	0.94253	CGG	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM		0.418	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT1	protein_coding	OTTHUMT00000353040.3	G	NM_016329	-		52940182	-1	no_errors	ENST00000358080	ensembl	human	known	74_37	missense	SNP	1.000	A
ARMC10	83787	genome.wustl.edu	37	7	102738973	102738973	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:102738973G>T	ENST00000323716.3	+	7	1397	c.1005G>T	c.(1003-1005)aaG>aaT	p.K335N	ARMC10_ENST00000425331.1_Missense_Mutation_p.K276N|ARMC10_ENST00000441711.2_Missense_Mutation_p.K300N|ARMC10_ENST00000454559.1_Missense_Mutation_p.K241N|ARMC10_ENST00000541300.1_Missense_Mutation_p.K217N|ARMC10_ENST00000428183.2_Missense_Mutation_p.K276N	NM_031905.4	NP_114111.2	Q8N2F6	ARM10_HUMAN	armadillo repeat containing 10	335					regulation of growth (GO:0040008)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				NS(1)|breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	11						TGAAGGAAAAGGTTGTAACAA	0.363																																																	0								ENSG00000170632						47.0	49.0	48.0					7																	102738973		2195	4272	6467	ARMC10	SO:0001583	missense	0			-	HGNC	AY150853	CCDS5728.1, CCDS55145.1, CCDS55146.1, CCDS55147.1, CCDS55148.1, CCDS55149.1	7q22.1	2013-02-14			ENSG00000170632	ENSG00000170632		"""Armadillo repeat containing"""	21706	protein-coding gene	gene with protein product	"""specific Splicing Variant involved in Hepatocarcinogenesis"""	611864				12839973	Standard	NM_031905		Approved	MGC3195, SVH	uc003vaw.2	Q8N2F6	OTTHUMG00000157201	ENST00000323716.3:c.1005G>T	7.37:g.102738973G>T	ENSP00000319412:p.Lys335Asn	Somatic	0	127	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	69	15.85	A8K703|B4DWJ8|F5GX65|Q75K91|Q75MG6|Q75ML8|Q8IZC1|Q8IZC2|Q8IZC3|Q9BTM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.K335N	ENST00000323716.3	37	c.1005	CCDS5728.1	7	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501148	0.64298	.	.	ENSG00000170632	ENST00000323716;ENST00000428183;ENST00000441711;ENST00000454559;ENST00000425331;ENST00000541300;ENST00000431642	T;T;T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.49;1.49;1.49	5.68	2.56	0.30785	Armadillo-type fold (1);	0.096550	0.64402	D	0.000001	T	0.53769	0.1817	M	0.75264	2.295	0.22940	N	0.998537	D;D;D;D;D;D	0.89917	0.998;0.996;0.997;1.0;1.0;0.999	D;D;P;D;D;D	0.87578	0.982;0.99;0.892;0.998;0.983;0.984	T	0.42932	-0.9422	10	0.87932	D	0	-31.9836	6.2663	0.20928	0.6404:0.0:0.3596:0.0	.	276;217;241;276;300;335	B4DWJ8;F5GX65;Q8N2F6-4;Q8N2F6-3;Q8N2F6-2;Q8N2F6	.;.;.;.;.;ARM10_HUMAN	N	335;276;300;241;276;217;177	ENSP00000319412:K335N;ENSP00000396654:K276N;ENSP00000413619:K300N;ENSP00000405612:K241N;ENSP00000397969:K276N;ENSP00000440463:K217N;ENSP00000406840:K177N	ENSP00000319412:K335N	K	+	3	2	ARMC10	102526209	1.000000	0.71417	0.968000	0.41197	0.900000	0.52787	2.355000	0.44107	0.346000	0.23899	0.591000	0.81541	AAG	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold		0.363	ARMC10-001	KNOWN	basic|CCDS	protein_coding	ARMC10	protein_coding	OTTHUMT00000347882.1	G	NM_031905	-		102738973	+1	no_errors	ENST00000323716	ensembl	human	known	74_37	missense	SNP	0.996	T
ZIC4	84107	genome.wustl.edu	37	3	147124452	147124453	+	5'UTR	INS	-	-	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:147124452_147124453insT	ENST00000383075.3	-	0	194_195				ZIC1_ENST00000282928.4_5'Flank|ZIC4_ENST00000484399.1_5'Flank|ZIC4_ENST00000473123.1_5'Flank|ZIC4_ENST00000525172.2_5'Flank|ZIC4_ENST00000425731.3_5'Flank|ZIC4_ENST00000491672.1_5'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CAACCCACAACTTTTTTTTTTC	0.45																																																	0								ENSG00000174963																																			ZIC4	SO:0001623	5_prime_UTR_variant	0				HGNC	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.-319->A	3.37:g.147124462_147124462dupT		Somatic	0	39	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			-	-		0.450	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	protein_coding	OTTHUMT00000355504.1	-				147124453	-1	no_errors	ENST00000464144	ensembl	human	putative	74_37	rna	INS	1.000:1.000	T
SRPX2	27286	genome.wustl.edu	37	X	99905881	99905881	+	Intron	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chrX:99905881C>G	ENST00000373004.3	+	3	591				SRPX2_ENST00000481988.1_3'UTR	NM_014467.2	NP_055282.1	O60687	SRPX2_HUMAN	sushi-repeat containing protein, X-linked 2						angiogenesis (GO:0001525)|cell motility (GO:0048870)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of synapse assembly (GO:0051965)|regulation of phosphorylation (GO:0042325)|single organismal cell-cell adhesion (GO:0016337)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|excitatory synapse (GO:0060076)|extracellular space (GO:0005615)|synaptic membrane (GO:0097060)	hepatocyte growth factor binding (GO:0036458)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)	19						CCCTGCTTCTCAAGCCCAGAA	0.517																																																	0								ENSG00000102359						70.0	65.0	67.0					X																	99905881		2203	4300	6503	SRPX2	SO:0001627	intron_variant	0			-	HGNC	AF393649	CCDS14471.1	Xq21.33-q23	2011-01-25	2011-01-25		ENSG00000102359	ENSG00000102359			30668	protein-coding gene	gene with protein product		300642	"""sushi-repeat-containing protein, X-linked 2"""			9864177	Standard	NM_014467		Approved	SRPUL	uc004egb.3	O60687	OTTHUMG00000022003	ENST00000373004.3:c.163+19C>G	X.37:g.99905881C>G		Somatic	0	23	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	21.74	B3KQT3|Q8WW85	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373004.3	37	NULL	CCDS14471.1	X																																																																																			-	-		0.517	SRPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX2	protein_coding	OTTHUMT00000057486.1	C	NM_014467	-		99905881	+1	no_errors	ENST00000481988	ensembl	human	known	74_37	rna	SNP	0.000	G
CLDN10	9071	genome.wustl.edu	37	13	96212707	96212707	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr13:96212707G>A	ENST00000299339.2	+	3	483	c.454G>A	c.(454-456)Gtt>Att	p.V152I	CLDN10_ENST00000376873.3_Missense_Mutation_p.V150I|CLDN10_ENST00000376855.1_Missense_Mutation_p.V70I	NM_006984.4	NP_008915.1	P78369	CLD10_HUMAN	claudin 10	152					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|ion transport (GO:0006811)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.18)			TCCTCTCTTTGTTGAGCAAAA	0.368																																																	0								ENSG00000134873						150.0	138.0	142.0					13																	96212707		2203	4300	6503	CLDN10	SO:0001583	missense	0			-	HGNC	U89916	CCDS9475.1, CCDS9476.1	13q31-q34	2008-07-18			ENSG00000134873	ENSG00000134873		"""Claudins"""	2033	protein-coding gene	gene with protein product						18025272	Standard	NM_182848		Approved	OSP-L, CPETRL3	uc001vmh.2	P78369	OTTHUMG00000017217	ENST00000299339.2:c.454G>A	13.37:g.96212707G>A	ENSP00000299339:p.Val152Ile	Somatic	0	39	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	33	35.29	Q6IBF9|Q96N78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin10,prints_Claudin	p.V152I	ENST00000299339.2	37	c.454	CCDS9476.1	13	.	.	.	.	.	.	.	.	.	.	G	7.957	0.746236	0.15710	.	.	ENSG00000134873	ENST00000376873;ENST00000299339;ENST00000376855	D;D;D	0.88975	-2.45;-2.45;-2.45	5.75	2.93	0.34026	.	0.818386	0.11238	N	0.584893	D	0.83580	0.5285	L	0.52011	1.625	0.33863	D	0.634069	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.15052	0.005;0.005;0.012	T	0.78076	-0.2345	10	0.28530	T	0.3	.	5.9064	0.19004	0.2186:0.0:0.6458:0.1357	.	152;152;150	Q6IBF9;P78369;Q96N78	.;CLD10_HUMAN;.	I	150;152;70	ENSP00000366069:V150I;ENSP00000299339:V152I;ENSP00000366051:V70I	ENSP00000299339:V152I	V	+	1	0	CLDN10	95010708	0.037000	0.19845	0.403000	0.26384	0.845000	0.48019	0.316000	0.19469	0.760000	0.33108	0.650000	0.86243	GTT	-	pfam_PMP22/EMP/MP20/Claudin		0.368	CLDN10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN10	protein_coding	OTTHUMT00000045484.1	G	NM_006984	-		96212707	+1	no_errors	ENST00000299339	ensembl	human	known	74_37	missense	SNP	0.700	A
MISP	126353	genome.wustl.edu	37	19	758081	758081	+	Missense_Mutation	SNP	G	G	A	rs372474785		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:758081G>A	ENST00000215582.6	+	2	1238	c.1135G>A	c.(1135-1137)Gac>Aac	p.D379N		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	379					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											GTCCACACCCGACTGGGTCTC	0.706													G|||	1	0.000199681	0.0	0.0	5008	,	,		12358	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000099812	G	ASN/ASP	1,4353		0,1,2176	9.0	11.0	11.0		1135	-0.6	0.0	19		11	1,8549		0,1,4274	no	missense	C19orf21	NM_173481.2	23	0,2,6450	AA,AG,GG		0.0117,0.023,0.0155	probably-damaging	379/680	758081	2,12902	2177	4275	6452	MISP	SO:0001583	missense	0			-	HGNC	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.1135G>A	19.37:g.758081G>A	ENSP00000215582:p.Asp379Asn	Somatic	0	37	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	23.26		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D379N	ENST00000215582.6	37	c.1135	CCDS12042.1	19	.	.	.	.	.	.	.	.	.	.	G	10.41	1.342716	0.24339	2.3E-4	1.17E-4	ENSG00000099812	ENST00000215582	T	0.32023	1.47	4.54	-0.563	0.11778	.	2.041910	0.02376	N	0.078335	T	0.26738	0.0654	M	0.64997	1.995	0.09310	N	1	P	0.37276	0.589	B	0.29663	0.105	T	0.35176	-0.9799	10	0.72032	D	0.01	-7.7437	2.6482	0.04991	0.1759:0.1453:0.5299:0.149	.	379	Q8IVT2	CS021_HUMAN	N	379	ENSP00000215582:D379N	ENSP00000215582:D379N	D	+	1	0	C19orf21	709081	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	0.069000	0.14552	0.437000	0.26423	-0.500000	0.04577	GAC	-	NULL		0.706	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MISP	protein_coding	OTTHUMT00000457600.2	G	NM_173481	-		758081	+1	no_errors	ENST00000215582	ensembl	human	known	74_37	missense	SNP	0.000	A
ZNF658	26149	genome.wustl.edu	37	9	40772275	40772275	+	Silent	SNP	T	T	C	rs1064200	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:40772275T>C	ENST00000602553.1	-	5	3294	c.3000A>G	c.(2998-3000)ggA>ggG	p.G1000G	ZNF658_ENST00000441795.1_Intron|ZNF658_ENST00000377626.3_Silent_p.G1000G			Q5TYW1	ZN658_HUMAN	zinc finger protein 658	1000					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(21)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	46				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CAAAAGCTTTTCCGCATTCAT	0.423													C|||	1300	0.259585	0.4622	0.2305	5008	,	,		12108	0.2391		0.2048	False		,,,				2504	0.0838																0								ENSG00000196409						39.0	58.0	53.0					9																	40772275		1407	3690	5097	ZNF658	SO:0001819	synonymous_variant	0			-	HGNC	AA482262	CCDS75846.1	9p13.1	2013-01-08			ENSG00000196409	ENSG00000274349		"""Zinc fingers, C2H2-type"", ""-"""	25226	protein-coding gene	gene with protein product							Standard	NM_033160		Approved	MGC35232, DKFZp572C163, FLJ32813	uc004abs.2	Q5TYW1	OTTHUMG00000013392	ENST00000602553.1:c.3000A>G	9.37:g.40772275T>C		Somatic	1	122	0.81		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	24	27.27	Q6PIP3|Q96M55|Q9H9S6|Q9UG02	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G1000	ENST00000602553.1	37	c.3000	CCDS35023.1	9																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.423	ZNF658-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF658	protein_coding	OTTHUMT00000467800.1	T	NM_033160	rs139779674		40772275	-1	no_errors	ENST00000377626	ensembl	human	known	74_37	silent	SNP	0.979	C
CDH11	1009	genome.wustl.edu	37	16	65016106	65016106	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:65016106G>T	ENST00000268603.4	-	8	1713	c.1098C>A	c.(1096-1098)gaC>gaA	p.D366E	CDH11_ENST00000566827.1_Missense_Mutation_p.D240E|CDH11_ENST00000394156.3_Missense_Mutation_p.D366E	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	366	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CGGTCACAGTGTCCTTGAAAG	0.488			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0								ENSG00000140937						163.0	131.0	142.0					16																	65016106		2203	4300	6503	CDH11	SO:0001583	missense	0			-	HGNC	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1098C>A	16.37:g.65016106G>T	ENSP00000268603:p.Asp366Glu	Somatic	0	103	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	40	31.03	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D366E	ENST00000268603.4	37	c.1098	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991260	0.74703	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.01705	4.68;4.68	5.61	4.62	0.57501	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.11110	0.0271	M	0.89904	3.07	0.45930	D	0.998766	D;D	0.76494	0.992;0.999	P;D	0.69479	0.639;0.964	T	0.00135	-1.2007	10	0.87932	D	0	.	9.0595	0.36425	0.1743:0.0:0.8257:0.0	.	366;366	P55287-2;P55287	.;CAD11_HUMAN	E	366;366;349	ENSP00000268603:D366E;ENSP00000377711:D366E	ENSP00000268603:D366E	D	-	3	2	CDH11	63573607	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	0.954000	0.29175	1.433000	0.47394	0.655000	0.94253	GAC	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.488	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	protein_coding	OTTHUMT00000268755.1	G	NM_033664	-		65016106	-1	no_errors	ENST00000268603	ensembl	human	known	74_37	missense	SNP	1.000	T
DGKQ	1609	genome.wustl.edu	37	4	961378	961378	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr4:961378G>T	ENST00000273814.3	-	8	1019	c.946C>A	c.(946-948)Ctc>Atc	p.L316I	DGKQ_ENST00000502309.1_5'Flank	NM_001347.3	NP_001338.2	P52824	DGKQ_HUMAN	diacylglycerol kinase, theta 110kDa	316					blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to ATP (GO:0033198)|thrombin receptor signaling pathway (GO:0070493)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|phospholipase binding (GO:0043274)			breast(1)|endometrium(2)|kidney(2)|lung(2)|prostate(2)	9			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			ACCGTGACGAGGCGGAACTGG	0.687																																					Esophageal Squamous(17;537 645 4447 26373)												0								ENSG00000145214						56.0	54.0	54.0					4																	961378		2201	4300	6501	DGKQ	SO:0001583	missense	0			-	HGNC	L38707	CCDS3342.1	4p16.3	2008-08-29	2002-08-29		ENSG00000145214	ENSG00000145214			2856	protein-coding gene	gene with protein product		601207	"""diacylglycerol kinase, theta (110kD)"""	DAGK4		8617502, 9099683	Standard	NM_001347		Approved	DAGK, DAGK7	uc003gbw.4	P52824	OTTHUMG00000088629	ENST00000273814.3:c.946C>A	4.37:g.961378G>T	ENSP00000273814:p.Leu316Ile	Somatic	0	48	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q6P3W4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ras-assoc,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ras-assoc,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.L316I	ENST00000273814.3	37	c.946	CCDS3342.1	4	.	.	.	.	.	.	.	.	.	.	g	2.655	-0.280981	0.05642	.	.	ENSG00000145214	ENST00000273814	T	0.80653	-1.4	4.97	2.24	0.28232	.	0.793230	0.11281	N	0.580373	T	0.65354	0.2683	N	0.20986	0.625	0.09310	N	1	B;B	0.19331	0.017;0.035	B;B	0.17722	0.012;0.019	T	0.47156	-0.9139	10	0.17832	T	0.49	.	7.508	0.27555	0.1022:0.4191:0.4787:0.0	.	316;316	E9KL49;P52824	.;DGKQ_HUMAN	I	316	ENSP00000273814:L316I	ENSP00000273814:L316I	L	-	1	0	DGKQ	951378	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	0.133000	0.15912	0.118000	0.18165	-0.341000	0.08007	CTC	-	NULL		0.687	DGKQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKQ	protein_coding	OTTHUMT00000200888.1	G		-		961378	-1	no_errors	ENST00000273814	ensembl	human	known	74_37	missense	SNP	0.037	T
DYNC1H1	1778	genome.wustl.edu	37	14	102505775	102505775	+	Silent	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:102505775C>G	ENST00000360184.4	+	61	11651	c.11487C>G	c.(11485-11487)ctC>ctG	p.L3829L	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3829					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AGTACTCCCTCCAGTTTTTCC	0.542																																																	0								ENSG00000197102						94.0	87.0	89.0					14																	102505775		2203	4300	6503	DYNC1H1	SO:0001819	synonymous_variant	0			-	HGNC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.11487C>G	14.37:g.102505775C>G		Somatic	0	61	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	48	22.58	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.L3829	ENST00000360184.4	37	c.11487	CCDS9966.1	14																																																																																			-	NULL		0.542	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	C	NM_001376	-		102505775	+1	no_errors	ENST00000360184	ensembl	human	known	74_37	silent	SNP	0.620	G
C16orf86	388284	genome.wustl.edu	37	16	67700794	67700794	+	5'UTR	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:67700794G>A	ENST00000403458.4	+	0	76				ENKD1_ENST00000243878.4_5'Flank|ENKD1_ENST00000602409.1_5'Flank|ENKD1_ENST00000602644.1_5'Flank|C16orf86_ENST00000602974.1_3'UTR	NM_001012984.2	NP_001013002.2	Q6ZW13	CP086_HUMAN	chromosome 16 open reading frame 86											endometrium(2)|lung(4)	6		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		GCCGGTCTCCGGGGTCAGCGC	0.721																																																	0								ENSG00000159761																																			C16orf86	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS32468.2	16q22.1	2008-10-30			ENSG00000159761	ENSG00000159761			33755	protein-coding gene	gene with protein product							Standard	NM_001012984		Approved	FLJ41802	uc002ety.3	Q6ZW13	OTTHUMG00000150527	ENST00000403458.4:c.-80G>A	16.37:g.67700794G>A		Somatic	0	8	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	16	40.74	B5MCW6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000403458.4	37	NULL	CCDS32468.2	16																																																																																			-	-		0.721	C16orf86-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf86	protein_coding	OTTHUMT00000318767.2	G	NM_001012984	-		67700794	+1	no_errors	ENST00000602974	ensembl	human	known	74_37	rna	SNP	0.000	A
PCDHA8	56140	genome.wustl.edu	37	5	140222280	140222280	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:140222280C>T	ENST00000531613.1	+	1	1374	c.1374C>T	c.(1372-1374)ccC>ccT	p.P458P	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.P458P	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	458	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCGCGCAGCCCGAGTACACGG	0.672																																																	0								ENSG00000204962						56.0	57.0	57.0					5																	140222280		2194	4267	6461	PCDHA8	SO:0001819	synonymous_variant	0			-	HGNC	AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1374C>T	5.37:g.140222280C>T		Somatic	0	103	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	136	19.41	B9EGT7|O75281	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P458	ENST00000531613.1	37	c.1374	CCDS54919.1	5																																																																																			-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin		0.672	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	protein_coding	OTTHUMT00000372830.2	C	NM_018911	-		140222280	+1	no_errors	ENST00000531613	ensembl	human	known	74_37	silent	SNP	0.001	T
CHST11	50515	genome.wustl.edu	37	12	105151192	105151192	+	Missense_Mutation	SNP	G	G	A	rs148230565	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:105151192G>A	ENST00000303694.5	+	3	1109	c.670G>A	c.(670-672)Gcc>Acc	p.A224T	CHST11_ENST00000549260.1_Missense_Mutation_p.A219T	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	224					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						GCGGAAGAACGCCACCCAGGA	0.567																																																	0								ENSG00000171310						125.0	106.0	113.0					12																	105151192		2203	4300	6503	CHST11	SO:0001583	missense	0			-	HGNC	AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.670G>A	12.37:g.105151192G>A	ENSP00000305725:p.Ala224Thr	Somatic	0	54	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	76	9.52	A8K4F8|Q9NXY6|Q9NY36	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase	p.A224T	ENST00000303694.5	37	c.670	CCDS9099.1	12	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074232	0.76415	.	.	ENSG00000171310	ENST00000549260;ENST00000303694	T;T	0.74209	-0.82;-0.82	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.84234	0.5427	M	0.72118	2.19	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.65443	0.774;0.935	T	0.80443	-0.1380	10	0.20046	T	0.44	-9.1307	19.2155	0.93776	0.0:0.0:1.0:0.0	.	219;224	Q9NPF2-2;Q9NPF2	.;CHSTB_HUMAN	T	219;224	ENSP00000450004:A219T;ENSP00000305725:A224T	ENSP00000305725:A224T	A	+	1	0	CHST11	103675322	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.573000	0.74009	2.553000	0.86117	0.655000	0.94253	GCC	-	pfam_Sulfotransferase		0.567	CHST11-001	KNOWN	basic|CCDS	protein_coding	CHST11	protein_coding	OTTHUMT00000405960.2	G	NM_018413	-		105151192	+1	no_errors	ENST00000303694	ensembl	human	known	74_37	missense	SNP	1.000	A
IL17B	27190	genome.wustl.edu	37	5	148753976	148753976	+	Missense_Mutation	SNP	C	C	T	rs528081511		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:148753976C>T	ENST00000261796.3	-	3	549	c.499G>A	c.(499-501)Gca>Aca	p.A167T	IL17B_ENST00000505432.1_5'UTR|RP11-394O4.3_ENST00000521756.1_RNA	NM_014443.2	NP_055258.1	Q9UHF5	IL17B_HUMAN	interleukin 17B	167					cell-cell signaling (GO:0007267)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|urinary_tract(1)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCATGACTGCGCGCTGGCGG	0.677													C|||	1	0.000199681	0.0	0.0014	5008	,	,		15617	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000127743						28.0	30.0	29.0					5																	148753976		2199	4291	6490	IL17B	SO:0001583	missense	0			-	HGNC	AF184969	CCDS4297.1	5q33.1	2011-07-14			ENSG00000127743	ENSG00000127743		"""Interleukins and interleukin receptors"""	5982	protein-coding gene	gene with protein product	"""neuronal interleukin-17-related factor"""	604627				10639155	Standard	NM_014443		Approved	IL-17B, ZCYTO7, IL-20, MGC138900, MGC138901, NIRF	uc003lqo.3	Q9UHF5	OTTHUMG00000130051	ENST00000261796.3:c.499G>A	5.37:g.148753976C>T	ENSP00000261796:p.Ala167Thr	Somatic	0	28	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	33	32.65	Q14CE5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IL-17_fam,prints_IL-17_chr	p.A167T	ENST00000261796.3	37	c.499	CCDS4297.1	5	.	.	.	.	.	.	.	.	.	.	C	3.164	-0.171532	0.06421	.	.	ENSG00000127743	ENST00000261796	T	0.54866	0.55	5.2	-0.66	0.11421	.	0.559855	0.17855	N	0.159740	T	0.22244	0.0536	N	0.04686	-0.185	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.20207	-1.0282	10	0.11485	T	0.65	-23.0732	5.8117	0.18469	0.0:0.3046:0.3798:0.3156	.	167	Q9UHF5	IL17B_HUMAN	T	167	ENSP00000261796:A167T	ENSP00000261796:A167T	A	-	1	0	IL17B	148734169	0.000000	0.05858	0.049000	0.19019	0.037000	0.13140	0.288000	0.18939	0.205000	0.20568	-0.305000	0.09177	GCA	-	pfam_IL-17_fam,prints_IL-17_chr		0.677	IL17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17B	protein_coding	OTTHUMT00000252330.1	C	NM_014443	-		148753976	-1	no_errors	ENST00000261796	ensembl	human	known	74_37	missense	SNP	0.002	T
TMEM8A	58986	genome.wustl.edu	37	16	436824	436824	+	Intron	SNP	C	C	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:436824C>A	ENST00000476735.1	-	1	217				Z97634.3_ENST00000412293.1_RNA			Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A						cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						AAAGCGAAGGCTTTAAAGGCC	0.488																																																	0								ENSG00000236829																																			Z97634.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000476735.1:c.584+72G>T	16.37:g.436824C>A		Somatic	0	45	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000476735.1	37	NULL		16																																																																																			-	-		0.488	TMEM8A-007	KNOWN	basic	processed_transcript	LOC100134368	protein_coding	OTTHUMT00000313680.1	C	NM_021259	-		436824	+1	no_errors	ENST00000457760	ensembl	human	known	74_37	rna	SNP	1.000	A
BLNK	29760	genome.wustl.edu	37	10	98031113	98031113	+	Silent	SNP	A	A	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr10:98031113A>G	ENST00000224337.5	-	1	184	c.43T>C	c.(43-45)Ttg>Ctg	p.L15L	BLNK_ENST00000413476.2_Silent_p.L15L|BLNK_ENST00000495266.1_Silent_p.L15L|BLNK_ENST00000371176.2_Silent_p.L15L|BLNK_ENST00000427367.2_Silent_p.L15L	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	15					B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		TCTTACCTCAACTTCTGACTG	0.438																																																	0								ENSG00000095585						108.0	104.0	105.0					10																	98031113		2203	4300	6503	BLNK	SO:0001819	synonymous_variant	0			-	HGNC	AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.43T>C	10.37:g.98031113A>G		Somatic	0	77	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	34	27.08	O75498|O75499|Q2MD49	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2	p.L15	ENST00000224337.5	37	c.43	CCDS7446.1	10																																																																																			-	NULL		0.438	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLNK	protein_coding	OTTHUMT00000049593.1	A	NM_013314	-		98031113	-1	no_errors	ENST00000224337	ensembl	human	known	74_37	silent	SNP	0.987	G
IQCG	84223	genome.wustl.edu	37	3	197639636	197639636	+	Intron	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:197639636G>T	ENST00000265239.6	-	9	1313				IQCG_ENST00000455191.1_Intron	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G							extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		AGAACAATCAGATACCAGTAC	0.522																																																	0								ENSG00000114473						129.0	137.0	134.0					3																	197639636		2203	4300	6503	IQCG	SO:0001627	intron_variant	0			-	HGNC	AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.889-16C>A	3.37:g.197639636G>T		Somatic	0	71	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	40	28.57	Q9BST2|Q9HAG8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000265239.6	37	NULL	CCDS3331.1	3																																																																																			-	-		0.522	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	protein_coding	OTTHUMT00000339730.1	G	NM_032263	-		197639636	-1	no_errors	ENST00000469822	ensembl	human	putative	74_37	rna	SNP	0.001	T
EVI2A	2123	genome.wustl.edu	37	17	29645499	29645499	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:29645499C>G	ENST00000462804.2	-	2	932	c.533G>C	c.(532-534)aGa>aCa	p.R178T	NF1_ENST00000581113.2_3'UTR|CTD-2370N5.3_ENST00000578584.1_Nonstop_Mutation_p.*117Y|EVI2A_ENST00000461237.1_Missense_Mutation_p.R178T|EVI2A_ENST00000247270.3_Missense_Mutation_p.R201T|NF1_ENST00000358273.4_Intron|NF1_ENST00000356175.3_Intron	NM_014210.3	NP_055025.2	P22794	EVI2A_HUMAN	ecotropic viral integration site 2A	178					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.0?(8)|p.?(3)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;5.94e-13)|Epithelial(4;7.98e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.4e-12)|GBM - Glioblastoma multiforme(4;0.18)		GCCATTGCTTCTAGGCTGACG	0.438																																																	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)						ENSG00000126860						90.0	79.0	83.0					17																	29645499		2203	4300	6503	EVI2A	SO:0001583	missense	0			-	HGNC	M55267	CCDS32608.1, CCDS42293.1	17q11.2	2008-07-18			ENSG00000126860	ENSG00000126860			3499	protein-coding gene	gene with protein product		158380		EVI2		2117566	Standard	NM_014210		Approved	EVDA	uc002hgm.3	P22794	OTTHUMG00000159306	ENST00000462804.2:c.533G>C	17.37:g.29645499C>G	ENSP00000420557:p.Arg178Thr	Somatic	0	37	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	27	38.64	B2R5X2|B4DHX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ectropic_vir_integratn_site_2A,pirsf_Ectropic_vir_integratn_site_2A	p.R201T	ENST00000462804.2	37	c.602	CCDS42293.1	17	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516696	0.85495	.	.	ENSG00000126860	ENST00000394755;ENST00000462804;ENST00000461237;ENST00000247270	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.79034	0.4378	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80139	-0.1507	9	0.87932	D	0	.	18.8387	0.92172	0.0:1.0:0.0:0.0	.	178;201	P22794;P22794-2	EVI2A_HUMAN;.	T	178;174;178;201	.	ENSP00000247270:R201T	R	-	2	0	EVI2A	26669625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.167000	0.64972	2.688000	0.91661	0.655000	0.94253	AGA	-	pfam_Ectropic_vir_integratn_site_2A,pirsf_Ectropic_vir_integratn_site_2A		0.438	EVI2A-001	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	EVI2A	protein_coding	OTTHUMT00000354491.3	C	NM_014210	-		29645499	-1	no_errors	ENST00000247270	ensembl	human	known	74_37	missense	SNP	1.000	G
DYNC1H1	1778	genome.wustl.edu	37	14	102504807	102504807	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:102504807G>C	ENST00000360184.4	+	58	11083	c.10919G>C	c.(10918-10920)aGc>aCc	p.S3640T	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3640	AAA 5. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GATGTGGAAAGCTACGATCCA	0.527																																																	0								ENSG00000197102						79.0	77.0	78.0					14																	102504807		2203	4300	6503	DYNC1H1	SO:0001583	missense	0			-	HGNC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10919G>C	14.37:g.102504807G>C	ENSP00000348965:p.Ser3640Thr	Somatic	0	49	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	22.22	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.S3640T	ENST00000360184.4	37	c.10919	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	18.72	3.684860	0.68157	.	.	ENSG00000197102	ENST00000360184	T	0.24350	1.86	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.18467	0.0443	N	0.13168	0.305	0.80722	D	1	B	0.32283	0.362	B	0.30029	0.11	T	0.05178	-1.0901	10	0.27082	T	0.32	.	20.1184	0.97949	0.0:0.0:1.0:0.0	.	3640	Q14204	DYHC1_HUMAN	T	3640	ENSP00000348965:S3640T	ENSP00000348965:S3640T	S	+	2	0	DYNC1H1	101574560	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.869000	0.99810	2.769000	0.95229	0.655000	0.94253	AGC	-	NULL		0.527	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	G	NM_001376	-		102504807	+1	no_errors	ENST00000360184	ensembl	human	known	74_37	missense	SNP	1.000	C
DYNC1H1	1778	genome.wustl.edu	37	14	102505585	102505585	+	Silent	SNP	C	C	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:102505585C>G	ENST00000360184.4	+	60	11618	c.11454C>G	c.(11452-11454)ctC>ctG	p.L3818L	RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557551.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3818					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGGAGTCCCTCAAGCAGGTGG	0.642																																																	0								ENSG00000197102						55.0	56.0	55.0					14																	102505585		2203	4299	6502	DYNC1H1	SO:0001819	synonymous_variant	0			-	HGNC	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.11454C>G	14.37:g.102505585C>G		Somatic	0	90	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	58	24.68	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.L3818	ENST00000360184.4	37	c.11454	CCDS9966.1	14																																																																																			-	NULL		0.642	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	protein_coding	OTTHUMT00000414574.1	C	NM_001376	-		102505585	+1	no_errors	ENST00000360184	ensembl	human	known	74_37	silent	SNP	1.000	G
OR52A5	390054	genome.wustl.edu	37	11	5153475	5153475	+	Missense_Mutation	SNP	C	C	T	rs538295981	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr11:5153475C>T	ENST00000307388.1	-	1	397	c.398G>A	c.(397-399)aGa>aAa	p.R133K		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	133					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		GGTGGCATGTCTCAAGGGGAT	0.463																																																	0								ENSG00000171944						71.0	62.0	65.0					11																	5153475		2201	4298	6499	OR52A5	SO:0001583	missense	0			-	HGNC	BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.398G>A	11.37:g.5153475C>T	ENSP00000303469:p.Arg133Lys	Somatic	0	48	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R133K	ENST00000307388.1	37	c.398	CCDS31373.1	11	.	.	.	.	.	.	.	.	.	.	C	18.04	3.534595	0.64972	.	.	ENSG00000171944	ENST00000307388	T	0.00416	7.51	5.22	5.22	0.72569	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000068	T	0.01029	0.0034	M	0.89353	3.025	0.36194	D	0.850262	P	0.50943	0.94	P	0.49853	0.624	T	0.58509	-0.7624	10	0.72032	D	0.01	.	17.5151	0.87771	0.0:1.0:0.0:0.0	.	133	Q9H2C5	O52A5_HUMAN	K	133	ENSP00000303469:R133K	ENSP00000303469:R133K	R	-	2	0	OR52A5	5110051	0.005000	0.15991	1.000000	0.80357	0.298000	0.27526	2.136000	0.42121	2.707000	0.92482	0.655000	0.94253	AGA	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.463	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52A5	protein_coding	OTTHUMT00000142823.1	C	NM_001005160	-		5153475	-1	no_errors	ENST00000307388	ensembl	human	known	74_37	missense	SNP	1.000	T
KRTAP13-3	337960	genome.wustl.edu	37	21	31797893	31797893	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr21:31797893C>T	ENST00000390690.2	-	1	393	c.338G>A	c.(337-339)gGa>gAa	p.G113E		NM_181622.1	NP_853653.1	Q3SY46	KR133_HUMAN	keratin associated protein 13-3	113						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	14						GCTCCTGGATCCACAGCTCAG	0.502																																																	0								ENSG00000240432						44.0	48.0	47.0					21																	31797893		2136	4283	6419	KRTAP13-3	SO:0001583	missense	0			-	HGNC	AP001708	CCDS13591.1	21q22.1	2006-03-13			ENSG00000240432	ENSG00000240432		"""Keratin associated proteins"""	18925	protein-coding gene	gene with protein product						12359730	Standard	NM_181622		Approved	KAP13.3	uc002yob.1	Q3SY46	OTTHUMG00000057776	ENST00000390690.2:c.338G>A	21.37:g.31797893C>T	ENSP00000375109:p.Gly113Glu	Somatic	0	34	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	15	44.44	Q3LI78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KRTAP_PMG	p.G113E	ENST00000390690.2	37	c.338	CCDS13591.1	21	.	.	.	.	.	.	.	.	.	.	c	15.28	2.787835	0.49997	.	.	ENSG00000240432	ENST00000390690;ENST00000448917	T	0.03386	3.95	4.54	3.65	0.41850	.	0.175712	0.26293	U	0.025203	T	0.13970	0.0338	M	0.83774	2.66	0.09310	N	1	P	0.49447	0.924	P	0.57468	0.821	T	0.02037	-1.1225	10	0.72032	D	0.01	-5.4913	9.1497	0.36955	0.0:0.8944:0.0:0.1056	.	113	Q3SY46	KR133_HUMAN	E	113;103	ENSP00000375109:G113E	ENSP00000375109:G113E	G	-	2	0	KRTAP13-3	30719764	0.021000	0.18746	0.052000	0.19188	0.002000	0.02628	3.191000	0.50981	1.206000	0.43276	-0.237000	0.12165	GGA	-	pfam_KRTAP_PMG		0.502	KRTAP13-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP13-3	protein_coding	OTTHUMT00000128228.2	C		-		31797893	-1	no_errors	ENST00000390690	ensembl	human	known	74_37	missense	SNP	0.026	T
CFHR5	81494	genome.wustl.edu	37	1	196963259	196963259	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:196963259delA	ENST00000256785.4	+	4	589	c.480delA	c.(478-480)ccafs	p.P160fs	CFHR5_ENST00000367414.5_Frame_Shift_Del_p.P184fs			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	160	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						ATGCTCAGCCAAAAAAAGAAA	0.323																																																	0								ENSG00000134389						86.0	98.0	94.0					1																	196963259		2203	4300	6503	CFHR5	SO:0001589	frameshift_variant	0				HGNC	AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.480delA	1.37:g.196963259delA	ENSP00000256785:p.Pro160fs	Somatic	0	31	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	Q2NKK2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.E187fs	ENST00000256785.4	37	c.552	CCDS1387.1	1																																																																																			-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.323	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR5	protein_coding	OTTHUMT00000088814.2	A	NM_030787			196963259	+1	no_errors	ENST00000367414	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
AAK1	22848	genome.wustl.edu	37	2	69685840	69685841	+	IGR	DEL	CA	CA	-	rs550880792|rs542320825|rs142247580		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:69685840_69685841delCA	ENST00000409068.1	-	0	2606				RP11-427H3.3_ENST00000606389.2_lincRNA			Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1						endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						GATGAATGAGcacacacacaca	0.421																																																	0								ENSG00000188971																																			RP11-427H3.3	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648		2.37:g.69685850_69685851delCA		Somatic	0	32	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	Q4ZFZ3|Q53RX6|Q9UPV4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409068.1	37	NULL		2																																																																																			-	-		0.421	AAK1-011	PUTATIVE	basic	protein_coding	ENSG00000188971	protein_coding	OTTHUMT00000333994.1	CA	NM_014911			69685841	-1	no_errors	ENST00000606389	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
SRP14-AS1	100131089	genome.wustl.edu	37	15	40357969	40357970	+	lincRNA	INS	-	-	A	rs573414881|rs112859598	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr15:40357969_40357970insA	ENST00000504245.1	+	0	795_796					NR_040060.1				SRP14 antisense RNA1 (head to head)																		atggtgtcttCAAAAAAAAAAa	0.366																																																	0								ENSG00000248508																																			SRP14-AS1			0				HGNC			15q15.1	2013-05-24			ENSG00000248508	ENSG00000248508		"""Long non-coding RNAs"""	48619	non-coding RNA	RNA, long non-coding							Standard	NR_040059		Approved				OTTHUMG00000172392		15.37:g.40357980_40357980dupA		Somatic	0	35	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000504245.1	37	NULL		15																																																																																			-	-		0.366	SRP14-AS1-001	KNOWN	basic	lincRNA	SRP14-AS1	lincRNA	OTTHUMT00000418269.1	-				40357970	+1	no_errors	ENST00000504245	ensembl	human	known	74_37	rna	INS	0.002:0.001	A
PIK3CA	5290	genome.wustl.edu	37	3	178936094	178936094	+	Missense_Mutation	SNP	C	C	A	rs121913286		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:178936094C>A	ENST00000263967.3	+	10	1793	c.1636C>A	c.(1636-1638)Cag>Aag	p.Q546K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	546	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		Q -> E (in BC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> K (in OC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> P (found in an anaplastic astrocytoma sample; unknown pathological significance). {ECO:0000269|PubMed:15289301}.|Q -> R (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.Q546K(89)|p.Q546E(12)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATCACTGAGCAGGAGAAAGA	0.358		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	101	Substitution - Missense(101)	large_intestine(55)|breast(17)|endometrium(15)|central_nervous_system(3)|lung(3)|ovary(3)|skin(2)|cervix(1)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)						ENSG00000121879						61.0	61.0	61.0					3																	178936094		1814	4072	5886	PIK3CA	SO:0001583	missense	0			-	HGNC		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1636C>A	3.37:g.178936094C>A	ENSP00000263967:p.Gln546Lys	Somatic	0	55	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	35	33.96	Q14CW1|Q99762	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.Q546K	ENST00000263967.3	37	c.1636	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838482	0.91117	.	.	ENSG00000121879	ENST00000263967	T	0.62232	0.04	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75191	0.3816	M	0.64404	1.975	0.80722	D	1	D	0.58970	0.984	P	0.58660	0.843	T	0.73833	-0.3858	10	0.46703	T	0.11	-14.2064	20.0024	0.97423	0.0:1.0:0.0:0.0	.	546	P42336	PK3CA_HUMAN	K	546	ENSP00000263967:Q546K	ENSP00000263967:Q546K	Q	+	1	0	PIK3CA	180418788	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.487000	0.81328	2.722000	0.93159	0.467000	0.42956	CAG	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.358	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	protein_coding	OTTHUMT00000348409.2	C		rs121913286		178936094	+1	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	SNP	1.000	A
IL18RAP	8807	genome.wustl.edu	37	2	103068444	103068444	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:103068444C>T	ENST00000264260.2	+	12	2192	c.1603C>T	c.(1603-1605)Ccc>Tcc	p.P535S	IL18RAP_ENST00000409369.1_Missense_Mutation_p.P393S	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	535	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						CAGGGTTTTGCCCACAGTTAC	0.433																																																	0								ENSG00000115607						119.0	129.0	126.0					2																	103068444		2203	4300	6503	IL18RAP	SO:0001583	missense	0			-	HGNC	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.1603C>T	2.37:g.103068444C>T	ENSP00000264260:p.Pro535Ser	Somatic	0	29	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.P535S	ENST00000264260.2	37	c.1603	CCDS2061.1	2	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168811	0.78339	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.07114	3.22;3.22	6.02	6.02	0.97574	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.000000	0.64402	D	0.000002	T	0.19967	0.0480	L	0.39147	1.195	0.52501	D	0.999957	D	0.89917	1.0	D	0.91635	0.999	T	0.02378	-1.1168	10	0.05959	T	0.93	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	535	O95256	I18RA_HUMAN	S	535;393	ENSP00000264260:P535S;ENSP00000387201:P393S	ENSP00000264260:P535S	P	+	1	0	IL18RAP	102434876	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.677000	0.68142	2.857000	0.98124	0.650000	0.86243	CCC	-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom		0.433	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL18RAP	protein_coding	OTTHUMT00000253291.2	C	NM_003853	-		103068444	+1	no_errors	ENST00000264260	ensembl	human	known	74_37	missense	SNP	1.000	T
RBM5	10181	genome.wustl.edu	37	3	50155888	50155889	+	Stop_Codon_Del	DEL	GA	GA	-	rs112672304		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:50155888_50155889delGA	ENST00000347869.3	+	0	2622_2623				RP11-493K19.3_ENST00000425674.1_RNA|RP11-493K19.3_ENST00000437204.1_RNA	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.*816fs?(1)		breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GAGATGgagtgagagagagaga	0.535																																																	1	Deletion - Frameshift(1)	breast(1)						ENSG00000003756																																			RBM5	SO:0001567	stop_retained_variant	0				HGNC	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	Exception_encountered	3.37:g.50155898_50155899delGA		Somatic	0	36	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.*816fs	ENST00000347869.3	37	c.2447_2448	CCDS2810.1	3																																																																																			-	NULL		0.535	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	protein_coding	OTTHUMT00000345797.3	GA	NM_005778			50155889	+1	no_errors	ENST00000347869	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:0.999	-
SCN2A	6326	genome.wustl.edu	37	2	166188073	166188073	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:166188073A>T	ENST00000375437.2	+	14	2673	c.2383A>T	c.(2383-2385)Aac>Tac	p.N795Y	SCN2A_ENST00000283256.6_Missense_Mutation_p.N795Y|SCN2A_ENST00000357398.3_Missense_Mutation_p.N795Y|SCN2A_ENST00000375427.2_Missense_Mutation_p.N795Y	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	795					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GTCTGTTGGAAACCTGGTAAG	0.398																																																	0								ENSG00000136531						80.0	70.0	74.0					2																	166188073		2203	4299	6502	SCN2A	SO:0001583	missense	0			-	HGNC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.2383A>T	2.37:g.166188073A>T	ENSP00000364586:p.Asn795Tyr	Somatic	0	57	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.N795Y	ENST00000375437.2	37	c.2383	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443187	0.83993	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.97791	-4.54;-4.54;-4.54;-4.54	5.55	5.55	0.83447	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99327	0.9764	H	0.99273	4.495	0.80722	D	1	P;P	0.47106	0.89;0.869	P;D	0.65140	0.652;0.932	D	0.98227	1.0481	10	0.87932	D	0	.	15.6948	0.77488	1.0:0.0:0.0:0.0	.	795;795	Q99250-2;Q99250	.;SCN2A_HUMAN	Y	795	ENSP00000364586:N795Y;ENSP00000349973:N795Y;ENSP00000283256:N795Y;ENSP00000364576:N795Y	ENSP00000283256:N795Y	N	+	1	0	SCN2A	165896319	1.000000	0.71417	0.992000	0.48379	0.911000	0.54048	9.339000	0.96797	2.114000	0.64651	0.477000	0.44152	AAC	-	pfam_Ion_trans_dom		0.398	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	protein_coding	OTTHUMT00000102659.2	A	NM_021007	-		166188073	+1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	SNP	1.000	T
KDM5A	5927	genome.wustl.edu	37	12	464396	464397	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:464396_464397delTC	ENST00000399788.2	-	7	1159_1160	c.797_798delGA	c.(796-798)cgafs	p.R266fs	KDM5A_ENST00000382815.4_Frame_Shift_Del_p.R266fs	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	266					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)	p.R266Q(2)		NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						TGGTAACTTTTCGTCTTCGGGT	0.376			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	2	Substitution - Missense(2)	cervix(2)						ENSG00000073614																																			KDM5A	SO:0001589	frameshift_variant	0				HGNC		CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.797_798delGA	12.37:g.464396_464397delTC	ENSP00000382688:p.Arg266fs	Somatic	0	47	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	A8MV76|Q4LE72|Q86XZ1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.R266fs	ENST00000399788.2	37	c.798_797	CCDS41736.1	12																																																																																			-	NULL		0.376	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	protein_coding	OTTHUMT00000397812.1	TC	NM_005056			464397	-1	no_errors	ENST00000399788	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
WRAP73	49856	genome.wustl.edu	37	1	3553581	3553581	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:3553581C>T	ENST00000270708.7	-	5	567	c.494G>A	c.(493-495)tGc>tAc	p.C165Y	WRAP73_ENST00000378322.3_Missense_Mutation_p.C165Y	NM_017818.3	NP_060288.3	Q9P2S5	WRP73_HUMAN	WD repeat containing, antisense to TP73	165						centrosome (GO:0005813)|cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|pancreas(1)	12						CCAATCACTGCAGACGAAGAT	0.557																																																	0								ENSG00000116213						76.0	63.0	67.0					1																	3553581		2203	4298	6501	WRAP73	SO:0001583	missense	0			-	HGNC	AB034912, EF494669	CCDS48.1	1p36.3	2013-05-21	2011-04-13	2011-04-13	ENSG00000116213	ENSG00000116213		"""WD repeat domain containing"""	12759	protein-coding gene	gene with protein product		606040	"""WD repeat domain 8"""	WDR8			Standard	NM_017818		Approved		uc001ako.3	Q9P2S5	OTTHUMG00000000612	ENST00000270708.7:c.494G>A	1.37:g.3553581C>T	ENSP00000270708:p.Cys165Tyr	Somatic	0	53	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q5T0D6|Q9BUH7|Q9NTK7|Q9NX56	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.C165Y	ENST00000270708.7	37	c.494	CCDS48.1	1	.	.	.	.	.	.	.	.	.	.	C	16.94	3.261244	0.59431	.	.	ENSG00000116213	ENST00000270708;ENST00000378322;ENST00000424367;ENST00000419924	T;T;T	0.78924	3.48;3.66;-1.22	4.47	4.47	0.54385	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.86912	0.6047	M	0.80746	2.51	0.80722	D	1	D;B;P	0.71674	0.998;0.23;0.691	D;B;P	0.68192	0.956;0.203;0.447	D	0.85308	0.1077	10	0.22109	T	0.4	-43.1247	16.4881	0.84190	0.0:1.0:0.0:0.0	.	165;165;165	B4DYE9;Q9P2S5;Q5T0D5	.;WRP73_HUMAN;.	Y	165	ENSP00000270708:C165Y;ENSP00000367573:C165Y;ENSP00000416192:C165Y	ENSP00000270708:C165Y	C	-	2	0	WRAP73	3543441	1.000000	0.71417	0.961000	0.40146	0.816000	0.46133	7.350000	0.79385	2.191000	0.70037	0.655000	0.94253	TGC	-	NULL		0.557	WRAP73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRAP73	protein_coding	OTTHUMT00000001470.1	C		-		3553581	-1	no_errors	ENST00000270708	ensembl	human	known	74_37	missense	SNP	1.000	T
VN1R4	317703	genome.wustl.edu	37	19	53770511	53770511	+	Silent	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:53770511G>T	ENST00000311170.4	-	1	461	c.408C>A	c.(406-408)atC>atA	p.I136I	CTD-2245F17.9_ENST00000599803.1_lincRNA	NM_173857.2	NP_776256.2	Q7Z5H5	VN1R4_HUMAN	vomeronasal 1 receptor 4	136					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	22				GBM - Glioblastoma multiforme(134;0.00294)		ACATGCACACGATCCAGCACA	0.473										HNSCC(26;0.072)																																							0								ENSG00000228567						26.0	20.0	22.0					19																	53770511		2203	4297	6500	VN1R4	SO:0001819	synonymous_variant	0			-	HGNC	AY114733	CCDS33099.1	19q13.42	2012-08-22			ENSG00000228567	ENSG00000228567		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19871	protein-coding gene	gene with protein product						12123587	Standard	NM_173857		Approved	V1RL4	uc010ydu.2	Q7Z5H5		ENST00000311170.4:c.408C>A	19.37:g.53770511G>T		Somatic	0	133	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	140	22.22	Q2M3E2|Q7Z5H6|Q7Z5H7|Q8TDU2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.I136	ENST00000311170.4	37	c.408	CCDS33099.1	19																																																																																			-	pfam_Vmron_rcpt_1,pfam_TAS2_rcpt,pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.473	VN1R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R4	protein_coding	OTTHUMT00000464287.1	G	NM_173857	-		53770511	-1	no_errors	ENST00000311170	ensembl	human	known	74_37	silent	SNP	0.003	T
WDR7	23335	genome.wustl.edu	37	18	54424260	54424260	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr18:54424260G>C	ENST00000254442.3	+	15	2647	c.2436G>C	c.(2434-2436)ttG>ttC	p.L812F	WDR7_ENST00000357574.3_Missense_Mutation_p.L812F|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	812					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		CCTGGGGTTTGAATGAAGTAC	0.458																																																	0								ENSG00000091157						176.0	167.0	170.0					18																	54424260		2203	4300	6503	WDR7	SO:0001583	missense	0			-	HGNC	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2436G>C	18.37:g.54424260G>C	ENSP00000254442:p.Leu812Phe	Somatic	0	65	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	27	18.18	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L812F	ENST00000254442.3	37	c.2436	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	G	16.80	3.222298	0.58560	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.72282	-0.64;-0.56	5.83	2.01	0.26516	.	0.000000	0.64402	D	0.000001	T	0.77870	0.4195	M	0.61703	1.905	0.54753	D	0.999982	D;D	0.89917	1.0;0.998	D;D	0.78314	0.988;0.991	T	0.73678	-0.3907	10	0.51188	T	0.08	.	7.4927	0.27471	0.2014:0.1203:0.6783:0.0	.	812;812	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	F	812;812;137;812	ENSP00000254442:L812F;ENSP00000350187:L812F	ENSP00000254442:L812F	L	+	3	2	WDR7	52575258	1.000000	0.71417	0.996000	0.52242	0.999000	0.98932	0.584000	0.23864	0.081000	0.16988	0.655000	0.94253	TTG	-	NULL		0.458	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	protein_coding	OTTHUMT00000256062.1	G		-		54424260	+1	no_errors	ENST00000254442	ensembl	human	known	74_37	missense	SNP	1.000	C
CCDC103	388389	genome.wustl.edu	37	17	42978925	42978925	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:42978925C>T	ENST00000417826.2	+	3	276	c.181C>T	c.(181-183)Cgg>Tgg	p.R61W	EFTUD2_ENST00000592576.1_5'Flank|CCDC103_ENST00000410027.1_Missense_Mutation_p.R61W|AC015936.3_ENST00000441312.1_RNA|EFTUD2_ENST00000591382.1_5'Flank|FAM187A_ENST00000331733.4_5'UTR|EFTUD2_ENST00000426333.2_5'Flank|EFTUD2_ENST00000402521.3_5'Flank|CCDC103_ENST00000410006.2_Missense_Mutation_p.R61W|FAM187A_ENST00000412523.2_Intron	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	61					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				GCCACTGGAGCGGAAGGATAA	0.517																																																	0								ENSG00000167131						150.0	127.0	135.0					17																	42978925		2203	4300	6503	CCDC103	SO:0001583	missense	0			-	HGNC	AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.181C>T	17.37:g.42978925C>T	ENSP00000391692:p.Arg61Trp	Somatic	0	67	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	22	29.03	A8K145|B8ZZU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R61W	ENST00000417826.2	37	c.181	CCDS11490.1	17	.	.	.	.	.	.	.	.	.	.	C	21.5	4.164605	0.78339	.	.	ENSG00000167131	ENST00000357776;ENST00000410027;ENST00000417826;ENST00000410006	T;T;T	0.79033	-1.23;-1.23;-1.23	5.63	3.41	0.39046	.	0.652152	0.12226	U	0.487882	T	0.76018	0.3929	L	0.58810	1.83	0.35278	D	0.781083	D	0.67145	0.996	B	0.43623	0.425	T	0.82244	-0.0553	10	0.87932	D	0	-2.8181	13.5562	0.61761	0.4575:0.5425:0.0:0.0	.	61	Q8IW40	CC103_HUMAN	W	61	ENSP00000350420:R61W;ENSP00000391692:R61W;ENSP00000387252:R61W	ENSP00000350420:R61W	R	+	1	2	CCDC103	40334451	0.606000	0.26949	0.798000	0.32154	0.977000	0.68977	0.665000	0.25083	1.224000	0.43551	0.555000	0.69702	CGG	-	NULL		0.517	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC103	protein_coding	OTTHUMT00000334578.1	C	NM_213607	-		42978925	+1	no_errors	ENST00000410006	ensembl	human	known	74_37	missense	SNP	0.742	T
KIAA1109	84162	genome.wustl.edu	37	4	123150375	123150375	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr4:123150375G>C	ENST00000264501.4	+	25	3395	c.3022G>C	c.(3022-3024)Ggt>Cgt	p.G1008R	KIAA1109_ENST00000455637.1_Missense_Mutation_p.G1008R|KIAA1109_ENST00000388738.3_Missense_Mutation_p.G1008R|KIAA1109_ENST00000495260.1_3'UTR			Q2LD37	K1109_HUMAN	KIAA1109	1008					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						TGTTGAGCATGGTTGTGCTAC	0.358																																																	0								ENSG00000138688						224.0	204.0	210.0					4																	123150375		1879	4118	5997	KIAA1109	SO:0001583	missense	0			-	HGNC	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.3022G>C	4.37:g.123150375G>C	ENSP00000264501:p.Gly1008Arg	Somatic	0	65	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	32	30.43	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fragile_site-assoc_C	p.G1008R	ENST00000264501.4	37	c.3022	CCDS43267.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.852284|4.852284	0.91355|0.91355	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637|ENST00000424425	T;T;T|.	0.53423|.	0.62;0.62;0.62|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.179586|.	0.35096|.	U|.	0.003441|.	T|T	0.69205|0.69205	0.3085|0.3085	L|L	0.47016|0.47016	1.485|1.485	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.65413|0.65413	-0.6174|-0.6174	10|5	0.36615|.	T|.	0.2|.	.|.	19.0697|19.0697	0.93127|0.93127	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1008|.	Q2LD37|.	K1109_HUMAN|.	R|S	1008|839	ENSP00000264501:G1008R;ENSP00000373390:G1008R;ENSP00000389925:G1008R|.	ENSP00000264501:G1008R|.	G|W	+|+	1|2	0|0	KIAA1109|KIAA1109	123369825|123369825	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	9.585000|9.585000	0.98223|0.98223	2.545000|2.545000	0.85829|0.85829	0.561000|0.561000	0.74099|0.74099	GGT|TGG	-	NULL		0.358	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	protein_coding	OTTHUMT00000316415.1	G	NM_020797	-		123150375	+1	no_errors	ENST00000264501	ensembl	human	known	74_37	missense	SNP	1.000	C
FAM60A	58516	genome.wustl.edu	37	12	31448178	31448178	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:31448178delT	ENST00000337682.4	-	3	586	c.218delA	c.(217-219)aacfs	p.N73fs	FAM60A_ENST00000395766.1_5'UTR|FAM60A_ENST00000454658.2_Frame_Shift_Del_p.N73fs|FAM60A_ENST00000542983.1_5'UTR|FAM60A_ENST00000539409.1_Intron	NM_001135812.1	NP_001129284.1	Q9NP50	FA60A_HUMAN	family with sequence similarity 60, member A	73					negative regulation of cell migration (GO:0030336)	Sin3 complex (GO:0016580)				large_intestine(1)|lung(2)	3	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)					ATGATTCCAGTTTTTTTTTGA	0.358																																																	0								ENSG00000139146						82.0	76.0	78.0					12																	31448178		2203	4300	6503	FAM60A	SO:0001589	frameshift_variant	0				HGNC	AF212220	CCDS8723.1	12p11.21	2012-11-30	2005-04-07	2005-04-07	ENSG00000139146	ENSG00000139146			30702	protein-coding gene	gene with protein product		615027	"""chromosome 12 open reading frame 14"""	C12orf14		11042152, 22984288, 22865885	Standard	NM_021238		Approved	TERA	uc001rke.3	Q9NP50	OTTHUMG00000168586	ENST00000337682.4:c.218delA	12.37:g.31448178delT	ENSP00000337477:p.Asn73fs	Somatic	0	64	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	D3DUV8|Q9BSZ8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.N73fs	ENST00000337682.4	37	c.218	CCDS8723.1	12																																																																																			-	NULL		0.358	FAM60A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM60A	protein_coding	OTTHUMT00000400347.1	T	NM_021238			31448178	-1	no_errors	ENST00000337682	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SPTA1	6708	genome.wustl.edu	37	1	158648297	158648297	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:158648297G>C	ENST00000368147.4	-	6	886	c.706C>G	c.(706-708)Cag>Gag	p.Q236E		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	236					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGCTTAGACTGAATTAAGGGT	0.403																																																	0								ENSG00000163554						72.0	68.0	69.0					1																	158648297		1871	4104	5975	SPTA1	SO:0001583	missense	0			-	HGNC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.706C>G	1.37:g.158648297G>C	ENSP00000357129:p.Gln236Glu	Somatic	0	67	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	32	28.26	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.Q236E	ENST00000368147.4	37	c.706	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	7.679	0.688677	0.14973	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.48836	0.8;0.8	4.66	-2.9	0.05648	.	0.956614	0.08483	N	0.939112	T	0.10035	0.0246	N	0.21282	0.65	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37337	-0.9710	10	0.09084	T	0.74	.	9.8126	0.40833	0.0:0.0709:0.5401:0.3891	.	236	P02549	SPTA1_HUMAN	E	236	ENSP00000357130:Q236E;ENSP00000357129:Q236E	ENSP00000357129:Q236E	Q	-	1	0	SPTA1	156914921	0.563000	0.26594	0.002000	0.10522	0.004000	0.04260	0.370000	0.20433	-0.573000	0.05998	-1.496000	0.00964	CAG	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.403	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	G	NM_003126	-		158648297	-1	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	SNP	0.011	C
OR2B11	127623	genome.wustl.edu	37	1	247614903	247614903	+	Missense_Mutation	SNP	C	C	T	rs375546848		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:247614903C>T	ENST00000318749.6	-	1	405	c.382G>A	c.(382-384)Gtg>Atg	p.V128M		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V128M(1)		endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CAGATGGCCACGTAGCGGTCC	0.612																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)						ENSG00000177535	C	MET/VAL	0,4406		0,0,2203	84.0	69.0	74.0		382	3.0	0.6	1		74	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR2B11	NM_001004492.1	21	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	128/318	247614903	1,13005	2203	4300	6503	OR2B11	SO:0001583	missense	0			-	HGNC		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.382G>A	1.37:g.247614903C>T	ENSP00000325682:p.Val128Met	Somatic	0	32	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	14	39.13	B2RP03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V128M	ENST00000318749.6	37	c.382	CCDS31090.1	1	.	.	.	.	.	.	.	.	.	.	C	13.39	2.221795	0.39300	0.0	1.16E-4	ENSG00000177535	ENST00000318749	T	0.01455	4.87	4.96	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	0.420814	0.19979	N	0.101813	T	0.02455	0.0075	L	0.55743	1.74	0.24069	N	0.995989	B	0.23735	0.09	B	0.17979	0.02	T	0.35574	-0.9783	10	0.62326	D	0.03	.	9.1849	0.37165	0.0:0.814:0.0:0.186	.	128	Q5JQS5	OR2BB_HUMAN	M	128	ENSP00000325682:V128M	ENSP00000325682:V128M	V	-	1	0	OR2B11	245681526	0.000000	0.05858	0.645000	0.29479	0.706000	0.40770	-0.524000	0.06222	0.766000	0.33244	-0.234000	0.12200	GTG	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.612	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B11	protein_coding	OTTHUMT00000097620.1	C	NM_001004492	-		247614903	-1	no_errors	ENST00000318749	ensembl	human	known	74_37	missense	SNP	0.666	T
TSTD3	100130890	genome.wustl.edu	37	6	99968898	99968899	+	RNA	INS	-	-	GCGCC			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr6:99968898_99968899insGCGCC	ENST00000452647.2	+	0	330_331							H0UI37	TSTD3_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 3																		GCCGGAGCAGGAGGAGAAGGAG	0.683											OREG0017579	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000228439																																			TSTD3			0				HGNC			6q16.2	2012-07-04			ENSG00000228439	ENSG00000228439			40910	protein-coding gene	gene with protein product							Standard	NM_001195131		Approved		uc021zde.1	H0UI37	OTTHUMG00000015265		6.37:g.99968898_99968899insGCGCC		Somatic	NA	NA	NA	1347	0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000452647.2	37	NULL		6																																																																																			-	-		0.683	TSTD3-001	KNOWN	basic	antisense	TSTD3	antisense	OTTHUMT00000041605.2	-	NM_001195131			99968899	+1	no_errors	ENST00000452647	ensembl	human	known	74_37	rna	INS	0.000:0.000	GCGCC
PMEL	6490	genome.wustl.edu	37	12	56355132	56355132	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:56355132C>T	ENST00000548747.1	-	3	965	c.303G>A	c.(301-303)caG>caA	p.Q101Q	PMEL_ENST00000550447.1_Silent_p.Q64Q|PMEL_ENST00000548689.1_5'UTR|PMEL_ENST00000550464.1_Intron|PMEL_ENST00000449260.2_Silent_p.Q101Q|PMEL_ENST00000360714.4_Silent_p.Q101Q|PMEL_ENST00000548493.1_Silent_p.Q101Q|PMEL_ENST00000539511.1_Intron|PMEL_ENST00000552882.1_Silent_p.Q101Q|PMEL_ENST00000536427.1_Silent_p.Q101Q			P40967	PMEL_HUMAN	premelanosome protein	101					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CCCAGATAACCTGCCCATCTG	0.478																																																	0								ENSG00000185664						192.0	169.0	177.0					12																	56355132		2203	4300	6503	PMEL	SO:0001819	synonymous_variant	0			-	HGNC	AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.303G>A	12.37:g.56355132C>T		Somatic	0	27	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	35	18.60	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.Q101	ENST00000548747.1	37	c.303	CCDS8897.1	12																																																																																			-	NULL		0.478	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEL	protein_coding	OTTHUMT00000409626.1	C	NM_006928	-		56355132	-1	no_errors	ENST00000360714	ensembl	human	known	74_37	silent	SNP	0.999	T
AXL	558	genome.wustl.edu	37	19	41748828	41748828	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:41748828G>C	ENST00000301178.4	+	11	1543	c.1353G>C	c.(1351-1353)tgG>tgC	p.W451C	AXL_ENST00000359092.3_Missense_Mutation_p.W442C|AXL_ENST00000593513.1_Missense_Mutation_p.W183C	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	451					apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						GGCCCTGGTGGTATGTACTGC	0.562																																																	0								ENSG00000167601						154.0	122.0	132.0					19																	41748828		2203	4300	6503	AXL	SO:0001583	missense	0			-	HGNC	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.1353G>C	19.37:g.41748828G>C	ENSP00000301178:p.Trp451Cys	Somatic	0	41	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	45	21.05	Q8N5L2|Q9UD27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.W451C	ENST00000301178.4	37	c.1353	CCDS12575.1	19	.	.	.	.	.	.	.	.	.	.	g	17.46	3.394679	0.62066	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.75154	-0.91;-0.85	4.49	4.49	0.54785	.	0.000000	0.85682	D	0.000000	T	0.81654	0.4868	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.979	T	0.81050	-0.1108	10	0.38643	T	0.18	-13.5429	16.3138	0.82906	0.0:0.0:1.0:0.0	.	442;451	P30530-2;P30530	.;UFO_HUMAN	C	451;442	ENSP00000301178:W451C;ENSP00000351995:W442C	ENSP00000301178:W451C	W	+	3	0	AXL	46440668	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	6.161000	0.71868	2.198000	0.70561	0.650000	0.86243	TGG	-	NULL		0.562	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	protein_coding	OTTHUMT00000463323.2	G		-		41748828	+1	no_errors	ENST00000301178	ensembl	human	known	74_37	missense	SNP	1.000	C
KIR3DX1	90011	genome.wustl.edu	37	19	55045167	55045167	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:55045167G>A	ENST00000335056.3	+	3	325	c.287G>A	c.(286-288)gGa>gAa	p.G96E				Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1	96	Ig-like C2-type 1.					extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		AGATGTGTTGGAATTTACAAG	0.547																																					Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)												0								ENSG00000104970						83.0	86.0	85.0					19																	55045167		2113	4245	6358	KIR3DX1	SO:0001583	missense	0			-	HGNC	BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000335056.3:c.287G>A	19.37:g.55045167G>A	ENSP00000335388:p.Gly96Glu	Somatic	0	77	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	77	18.95	B7WNL0|Q8N0S4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like_dom	p.G96E	ENST00000335056.3	37	c.287		19	.	.	.	.	.	.	.	.	.	.	G	9.053	0.992520	0.18966	.	.	ENSG00000104970	ENST00000335056	T	0.13778	2.56	2.74	0.485	0.16830	.	.	.	.	.	T	0.13200	0.0320	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30031	-0.9992	6	0.87932	D	0	.	3.1897	0.06613	0.1489:0.0:0.5907:0.2604	.	.	.	.	E	96	ENSP00000335388:G96E	ENSP00000221567:G96E	G	+	2	0	KIR3DX1	59736979	0.020000	0.18652	0.001000	0.08648	0.012000	0.07955	0.966000	0.29331	0.211000	0.20683	0.655000	0.94253	GGA	-	smart_Ig_sub		0.547	KIR3DX1-002	KNOWN	basic|appris_principal	protein_coding	KIR3DX1	protein_coding	OTTHUMT00000140800.2	G	NR_026716	-		55045167	+1	no_errors	ENST00000335056	ensembl	human	known	74_37	missense	SNP	0.001	A
VDAC1	7416	genome.wustl.edu	37	5	133316708	133316708	+	Intron	DEL	T	T	-	rs76032174|rs76341281		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:133316708delT	ENST00000265333.3	-	6	568				VDAC1_ENST00000395044.3_Intron|VDAC1_ENST00000395047.2_Intron	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1						anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	GCAAGTTGTCTTTTTTTTTTT	0.413																																					NSCLC(127;1776 1806 35523 41489 48154)												0								ENSG00000213585																																			VDAC1	SO:0001627	intron_variant	0				HGNC		CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.324-61A>-	5.37:g.133316708delT		Somatic	0	22	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000265333.3	37	NULL	CCDS4168.1	5																																																																																			-	-		0.413	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VDAC1	protein_coding	OTTHUMT00000259208.1	T				133316708	-1	no_errors	ENST00000492324	ensembl	human	known	74_37	rna	DEL	0.001	-
ZNF398	57541	genome.wustl.edu	37	7	148851394	148851394	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:148851394C>T	ENST00000475153.1	+	2	649	c.382C>T	c.(382-384)Ctg>Ttg	p.L128L	ZNF398_ENST00000491174.1_5'UTR|ZNF398_ENST00000483892.1_5'UTR|ZNF398_ENST00000426851.2_5'UTR|ZNF398_ENST00000485111.1_3'UTR|ZNF398_ENST00000335901.4_5'UTR|ZNF398_ENST00000420008.2_5'UTR|ZNF398_ENST00000540950.1_Silent_p.L133L			Q8TD17	ZN398_HUMAN	zinc finger protein 398	128					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(1)	25	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00143)			CTTCTGGATCCTGCGGCTCCC	0.517																																																	0								ENSG00000197024						50.0	53.0	52.0					7																	148851394		2203	4300	6503	ZNF398	SO:0001819	synonymous_variant	0			-	HGNC	AB037760	CCDS5894.1, CCDS47739.1	7q35	2013-01-08			ENSG00000197024	ENSG00000197024		"""Zinc fingers, C2H2-type"", ""-"""	18373	protein-coding gene	gene with protein product						11779858	Standard	NM_170686		Approved	ZER6, KIAA1339, P51, P71	uc003wfl.3	Q8TD17	OTTHUMG00000158970	ENST00000475153.1:c.382C>T	7.37:g.148851394C>T		Somatic	0	87	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	36	32.08	A8K384|B4E377|Q8TD18|Q9P2K7|Q9UDV8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_DUF3669_Znf,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.L133	ENST00000475153.1	37	c.397	CCDS5894.1	7																																																																																			-	NULL		0.517	ZNF398-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF398	protein_coding	OTTHUMT00000352722.2	C		-		148851394	+1	no_errors	ENST00000540950	ensembl	human	known	74_37	silent	SNP	1.000	T
KIR3DX1	90011	genome.wustl.edu	37	19	55054687	55054687	+	3'UTR	SNP	C	C	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:55054687C>A	ENST00000482404.1	+	0	2042				KIR3DX1_ENST00000335056.3_Intron			Q9H7L2	KI3X1_HUMAN	killer cell immunoglobulin-like receptor, three domains, X1							extracellular region (GO:0005576)				endometrium(1)|kidney(2)|large_intestine(4)|lung(14)|ovary(1)|pancreas(1)|skin(1)	24				GBM - Glioblastoma multiforme(193;0.099)		CCCTCCCATTCCCAGTGCCCC	0.547																																					Colon(183;529 2002 28270 32358 35845)|Esophageal Squamous(50;443 1006 2278 10294 37938)												0								ENSG00000104970																																			KIR3DX1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC033195		19q13.42	2013-03-26	2006-09-12	2006-09-12	ENSG00000104970	ENSG00000104970		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	25043	other	unknown			"""leukocyte receptor cluster (LRC) member 12"""	LENG12		11441184	Standard	NR_026716		Approved	FLJ00060	uc010erm.2	Q9H7L2	OTTHUMG00000065696	ENST00000482404.1:c.*2039C>A	19.37:g.55054687C>A		Somatic	0	72	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	77	18.95	B7WNL0|Q8N0S4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000482404.1	37	NULL		19																																																																																			-	-		0.547	KIR3DX1-001	KNOWN	basic	processed_transcript	KIR3DX1	protein_coding	OTTHUMT00000140799.1	C	NR_026716	-		55054687	+1	no_errors	ENST00000482404	ensembl	human	known	74_37	rna	SNP	0.000	A
MMP17	4326	genome.wustl.edu	37	12	132313098	132313099	+	In_Frame_Ins	INS	-	-	GCTGCCGCT	rs559842978|rs201578983|rs71072797	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:132313098_132313099insGCTGCCGCT	ENST00000360564.1	+	1	161_162	c.59_60insGCTGCCGCT	c.(58-63)cggctg>cgGCTGCCGCTgctg	p.21_22insPLL		NM_016155.4	NP_057239.4	Q9ULZ9	MMP17_HUMAN	matrix metallopeptidase 17 (membrane-inserted)	21					positive regulation of catalytic activity (GO:0043085)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)	5	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.82e-07)|Epithelial(86;1.51e-06)|all cancers(50;2.35e-05)	Marimastat(DB00786)	ggactctcgcggctgccgctgc	0.837														4777	0.953874	0.8797	0.9741	5008	,	,		2816	0.999		0.9702	False		,,,				2504	0.9765																0								ENSG00000198598																																			MMP17	SO:0001652	inframe_insertion	0				HGNC	X89576	CCDS31927.1	12q24.3	2005-08-08	2005-08-08		ENSG00000198598	ENSG00000198598			7163	protein-coding gene	gene with protein product		602285	"""matrix metalloproteinase 17 (membrane-inserted)"""			9878265	Standard	NM_016155		Approved	MT4-MMP	uc001ujc.1	Q9ULZ9	OTTHUMG00000168050	ENST00000360564.1:c.60_68dupGCTGCCGCT	12.37:g.132313099_132313107dupGCTGCCGCT	ENSP00000353767:p.Leu21_Pro22insProLeuLeu	Somatic	NA	NA	NA		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q14850	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.24in_frame_insLPL	ENST00000360564.1	37	c.59_60	CCDS31927.1	12																																																																																			-	pirsf_Pept_M10A_Metazoans		0.837	MMP17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP17	protein_coding	OTTHUMT00000397757.1	-	NM_016155			132313099	+1	no_errors	ENST00000360564	ensembl	human	known	74_37	in_frame_ins	INS	0.023:0.052	GCTGCCGCT
MSTO1	55154	genome.wustl.edu	37	1	155584433	155584433	+	3'UTR	SNP	C	C	T	rs141805415		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr1:155584433C>T	ENST00000245564.2	+	0	2106				MSTO1_ENST00000452804.2_Intron|MSTO1_ENST00000483734.1_3'UTR|MSTO1_ENST00000368341.4_3'UTR|MSTO1_ENST00000538143.1_Intron	NM_001256532.1|NM_001256533.1|NM_018116.3	NP_001243461.1|NP_001243462.1|NP_060586.2	Q9BUK6	MSTO1_HUMAN	misato 1, mitochondrial distribution and morphology regulator						mitochondrion distribution (GO:0048311)|mitochondrion organization (GO:0007005)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)				breast(2)|endometrium(1)|lung(3)|skin(1)	7	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)					AAGGACTGTACAAGCAGAGTA	0.567													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18167	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000125459																																			MSTO1	SO:0001624	3_prime_UTR_variant	0			GMAF=0.0005	HGNC	BX537684	CCDS1114.1	1q22	2013-08-21	2013-08-21		ENSG00000125459	ENSG00000125459			29678	protein-coding gene	gene with protein product			"""misato homolog 1 (Drosophila)"""			16545939, 17349998	Standard	NM_018116		Approved	FLJ10504, LST005, MST, misato	uc001fky.4	Q9BUK6	OTTHUMG00000014014	ENST00000245564.2:c.*369C>T	1.37:g.155584433C>T		Somatic	0	43	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q53GR8|Q5CZ69|Q5T717|Q68CT6|Q7LBZ8|Q7Z3M7|Q7Z558|Q8TE05|Q9NQX2|Q9NVU4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000245564.2	37	NULL	CCDS1114.1	1																																																																																			-	-		0.567	MSTO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSTO1	protein_coding	OTTHUMT00000039408.1	C	NM_018116	rs141805415		155584433	+1	no_errors	ENST00000483734	ensembl	human	known	74_37	rna	SNP	0.000	T
ELL2	22936	genome.wustl.edu	37	5	95236448	95236448	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr5:95236448G>T	ENST00000237853.4	-	7	1252	c.903C>A	c.(901-903)agC>agA	p.S301R	ELL2_ENST00000431061.2_Intron	NM_012081.5	NP_036213.2	O00472	ELL2_HUMAN	elongation factor, RNA polymerase II, 2	301					regulation of transcription, DNA-templated (GO:0006355)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|transcription elongation from RNA polymerase II promoter (GO:0006368)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	24		all_cancers(142;2.04e-06)|all_epithelial(76;3.1e-09)|all_lung(232;0.00309)|Lung NSC(167;0.00454)|Ovarian(225;0.0165)|Colorectal(57;0.0343)|Breast(839;0.198)		all cancers(79;2.16e-15)		ATTCTGAACGGCTGGTGCCTG	0.388																																																	0								ENSG00000118985						70.0	70.0	70.0					5																	95236448		2203	4300	6503	ELL2	SO:0001583	missense	0			-	HGNC	U88629	CCDS4080.1	5q15	2010-11-29			ENSG00000118985	ENSG00000118985			17064	protein-coding gene	gene with protein product		601874				9108030	Standard	NM_012081		Approved		uc003klr.4	O00472	OTTHUMG00000122085	ENST00000237853.4:c.903C>A	5.37:g.95236448G>T	ENSP00000237853:p.Ser301Arg	Somatic	0	35	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B4DNK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.S301R	ENST00000237853.4	37	c.903	CCDS4080.1	5	.	.	.	.	.	.	.	.	.	.	G	10.17	1.277179	0.23307	.	.	ENSG00000118985	ENST00000237853;ENST00000513343	T;T	0.32753	1.73;1.44	5.7	4.83	0.62350	.	0.187965	0.64402	D	0.000002	T	0.26991	0.0661	L	0.51422	1.61	0.80722	D	1	P	0.38195	0.622	B	0.38803	0.282	T	0.04386	-1.0955	10	0.51188	T	0.08	.	6.8086	0.23792	0.1883:0.0:0.8117:0.0	.	301	O00472	ELL2_HUMAN	R	301;119	ENSP00000237853:S301R;ENSP00000423915:S119R	ENSP00000237853:S301R	S	-	3	2	ELL2	95262204	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	1.659000	0.37387	2.682000	0.91365	0.561000	0.74099	AGC	-	NULL		0.388	ELL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL2	protein_coding	OTTHUMT00000242846.1	G	NM_012081	-		95236448	-1	no_errors	ENST00000237853	ensembl	human	known	74_37	missense	SNP	1.000	T
TBX3	6926	genome.wustl.edu	37	12	115109883	115109883	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:115109883C>T	ENST00000257566.3	-	8	2384	c.1995G>A	c.(1993-1995)gcG>gcA	p.A665A	TBX3_ENST00000349155.2_Silent_p.A645A	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3	665	Transcription repression.				anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		GCCCCGCGGCCGCCGCCATGG	0.741																																																	0								ENSG00000135111						5.0	6.0	6.0					12																	115109883		2045	3934	5979	TBX3	SO:0001819	synonymous_variant	0			-	HGNC	BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.1995G>A	12.37:g.115109883C>T		Somatic	0	33	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	37	13.95	Q8TB20|Q9UKF8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,pfam_TBX,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.A665	ENST00000257566.3	37	c.1995	CCDS9176.1	12																																																																																			-	NULL		0.741	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	protein_coding	OTTHUMT00000404947.2	C	NM_016569, NM_005996	-		115109883	-1	no_errors	ENST00000257566	ensembl	human	known	74_37	silent	SNP	0.509	T
DDX5	1655	genome.wustl.edu	37	17	62500099	62500102	+	Splice_Site	DEL	ACAG	ACAG	-			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	ACAG	ACAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr17:62500099_62500102delACAG	ENST00000225792.5	-	4	841_843	c.440_442delCTGT	c.(439-444)tctgta>tta	p.SV147fs	DDX5_ENST00000580026.1_5'Flank|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000578804.1_Splice_Site_p.SV147fs|CEP95_ENST00000556440.2_5'Flank|DDX5_ENST00000450599.2_Intron	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	147	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			TCCCAAACTTACAGACAATGTTTT	0.397			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)			Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0								ENSG00000108654																																			DDX5	SO:0001630	splice_region_variant	0				HGNC	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.441+1CTGT>-	17.37:g.62500099_62500102delACAG		Somatic	0	30	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_P68HR,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S147fs	ENST00000225792.5	37	c.443_440	CCDS11659.1	17																																																																																			-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.397	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	protein_coding	OTTHUMT00000444030.1	ACAG	NM_004396		Frame_Shift_Del	62500102	-1	no_errors	ENST00000225792	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
MGEA5	10724	genome.wustl.edu	37	10	103557826	103557826	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr10:103557826G>C	ENST00000361464.3	-	10	2290	c.1895C>G	c.(1894-1896)gCc>gGc	p.A632G	MGEA5_ENST00000439817.1_Missense_Mutation_p.A579G|MGEA5_ENST00000482611.1_5'UTR|MGEA5_ENST00000370094.3_Missense_Mutation_p.A632G|MGEA5_ENST00000357797.5_Missense_Mutation_p.A579G	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	632					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		TGTCCTGTTGGCACAATTGGA	0.423																																																	0								ENSG00000198408						141.0	127.0	131.0					10																	103557826		2203	4300	6503	MGEA5	SO:0001583	missense	0			-	HGNC	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.1895C>G	10.37:g.103557826G>C	ENSP00000354850:p.Ala632Gly	Somatic	0	33	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.00	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Beta-N-acetylglucosaminidase,superfamily_Glycoside_hydrolase_SF,superfamily_Acyl_CoA_acyltransferase	p.A632G	ENST00000361464.3	37	c.1895	CCDS7520.1	10	.	.	.	.	.	.	.	.	.	.	G	16.69	3.191939	0.58017	.	.	ENSG00000198408	ENST00000439817;ENST00000361464;ENST00000357797;ENST00000370094	T;T;T;T	0.35421	1.34;1.34;1.32;1.31	5.76	4.85	0.62838	.	0.108030	0.64402	D	0.000006	T	0.39937	0.1097	L	0.50333	1.59	0.80722	D	1	P;P;P;B	0.40970	0.501;0.688;0.734;0.411	B;B;P;B	0.45232	0.073;0.2;0.474;0.145	T	0.12656	-1.0539	10	0.28530	T	0.3	-3.3769	14.8909	0.70609	0.0688:0.0:0.9312:0.0	.	579;579;632;632	E9PGF9;O60502-2;O60502-3;O60502	.;.;.;NCOAT_HUMAN	G	579;632;579;632	ENSP00000409973:A579G;ENSP00000354850:A632G;ENSP00000350445:A579G;ENSP00000359112:A632G	ENSP00000350445:A579G	A	-	2	0	MGEA5	103547816	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.864000	0.99589	1.441000	0.47550	0.655000	0.94253	GCC	-	NULL		0.423	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MGEA5	protein_coding	OTTHUMT00000049987.1	G	NM_012215	-		103557826	-1	no_errors	ENST00000361464	ensembl	human	known	74_37	missense	SNP	1.000	C
SNX16	64089	genome.wustl.edu	37	8	82727640	82727641	+	Intron	INS	-	-	A	rs55997432	byFrequency	TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr8:82727640_82727641insA	ENST00000345957.4	-	5	890				SNX16_ENST00000396330.2_Intron|RP13-923O23.6_ENST00000524337.1_RNA|SNX16_ENST00000353788.4_Intron	NM_152836.2	NP_690049.1	P57768	SNX16_HUMAN	sorting nexin 16						early endosome to late endosome transport (GO:0045022)|endosome to lysosome transport (GO:0008333)|protein targeting to lysosome (GO:0006622)	early endosome (GO:0005769)|extrinsic component of endosome membrane (GO:0031313)|late endosome (GO:0005770)|lysosome (GO:0005764)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			large_intestine(1)|ovary(1)|pancreas(1)|skin(2)	5						CTTTTCAAAGGAAAAAAAAAAT	0.347																																																	0								ENSG00000253334																																			RP13-923O23.6	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF305779	CCDS6234.1, CCDS6235.1	8q21.13	2011-05-03			ENSG00000104497	ENSG00000104497		"""Sorting nexins"""	14980	protein-coding gene	gene with protein product		614903				12461558, 12813048	Standard	NM_152837		Approved		uc003ycn.3	P57768	OTTHUMG00000164727	ENST00000345957.4:c.612-11->T	8.37:g.82727650_82727650dupA		Somatic	0	20	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A8K4D8|Q658L0|Q8N4U3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000345957.4	37	NULL	CCDS6234.1	8																																																																																			-	-		0.347	SNX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000253334	protein_coding	OTTHUMT00000379929.1	-	NM_022133			82727641	+1	no_errors	ENST00000524337	ensembl	human	known	74_37	rna	INS	0.000:0.496	A
CCDC60	160777	genome.wustl.edu	37	12	119943003	119943003	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr12:119943003G>A	ENST00000327554.2	+	7	1243	c.778G>A	c.(778-780)Ggc>Agc	p.G260S	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	260										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TGTGAACCCTGGCTCGGATGA	0.572																																																	0								ENSG00000183273						144.0	147.0	146.0					12																	119943003		2203	4300	6503	CCDC60	SO:0001583	missense	0			-	HGNC	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.778G>A	12.37:g.119943003G>A	ENSP00000333374:p.Gly260Ser	Somatic	0	57	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	68	17.07		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G260S	ENST00000327554.2	37	c.778	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	G	8.887	0.952968	0.18431	.	.	ENSG00000183273	ENST00000327554	T	0.24723	1.84	5.07	0.915	0.19366	.	0.414382	0.20472	N	0.091680	T	0.16342	0.0393	L	0.44542	1.39	0.48696	D	0.999693	P	0.44627	0.839	B	0.38985	0.287	T	0.06661	-1.0814	9	.	.	.	-18.4495	3.9123	0.09209	0.3204:0.1784:0.5012:0.0	.	260	Q8IWA6	CCD60_HUMAN	S	260	ENSP00000333374:G260S	.	G	+	1	0	CCDC60	118427386	0.830000	0.29337	0.366000	0.25914	0.325000	0.28411	0.983000	0.29552	0.101000	0.17610	-0.182000	0.12963	GGC	-	NULL		0.572	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	protein_coding	OTTHUMT00000401680.1	G	NM_178499	-		119943003	+1	no_errors	ENST00000327554	ensembl	human	known	74_37	missense	SNP	0.246	A
SSNA1	8636	genome.wustl.edu	37	9	140083505	140083505	+	Intron	SNP	T	T	G			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr9:140083505T>G	ENST00000322310.5	+	2	132				SSNA1_ENST00000459860.1_3'UTR|ANAPC2_ENST00000323927.2_5'Flank	NM_003731.2	NP_003722.2	O43805	SSNA1_HUMAN	Sjogren syndrome nuclear autoantigen 1						ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport (GO:0042073)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(1)|lung(2)	6	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.43e-05)|Epithelial(140;0.00087)		GCGCCGCCCCTCCCGGCCCCC	0.726																																																	0								ENSG00000176101						4.0	5.0	5.0					9																	140083505		2040	4054	6094	SSNA1	SO:0001627	intron_variant	0			-	HGNC	Z96932	CCDS7034.1	9q34.3	2008-02-05	2007-10-04		ENSG00000176101	ENSG00000176101			11321	protein-coding gene	gene with protein product		610882	"""Sjogren's syndrome nuclear autoantigen 1"""			9430706	Standard	NM_003731		Approved	NA14, N14	uc004cls.2	O43805	OTTHUMG00000020982	ENST00000322310.5:c.53-13T>G	9.37:g.140083505T>G		Somatic	0	31	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	35	23.91	Q5VSG0|Q6FG70|Q9BVW8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000322310.5	37	NULL	CCDS7034.1	9																																																																																			-	-		0.726	SSNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSNA1	protein_coding	OTTHUMT00000055311.1	T	NM_003731	-		140083505	+1	no_errors	ENST00000459860	ensembl	human	known	74_37	rna	SNP	0.000	G
IFT52	51098	genome.wustl.edu	37	20	42275584	42275584	+	Silent	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr20:42275584C>T	ENST00000373030.3	+	14	1405	c.1275C>T	c.(1273-1275)gaC>gaT	p.D425D	IFT52_ENST00000471199.1_3'UTR|IFT52_ENST00000373039.4_Silent_p.D425D	NM_016004.2	NP_057088.2	Q9Y366	IFT52_HUMAN	intraflagellar transport 52	425					cilium morphogenesis (GO:0060271)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube formation (GO:0001841)|regulation of protein processing (GO:0070613)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary base (GO:0097546)|ciliary tip (GO:0097542)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|photoreceptor connecting cilium (GO:0032391)	protein C-terminus binding (GO:0008022)			endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGGAACATGACATCGATACAA	0.358																																																	0								ENSG00000101052						163.0	153.0	157.0					20																	42275584		2203	4300	6503	IFT52	SO:0001819	synonymous_variant	0			-	HGNC	AF151811	CCDS33470.1	20q12-q13.1	2014-07-03	2014-07-03	2005-11-02	ENSG00000101052	ENSG00000101052		"""Intraflagellar transport homologs"""	15901	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 9"", ""intraflagellar transport 52 homolog (Chlamydomonas)"""	C20orf9		10810093	Standard	NM_016004		Approved	CGI-53, NGD5, dJ1028D15.1, NGD2	uc002xkw.3	Q9Y366	OTTHUMG00000032513	ENST00000373030.3:c.1275C>T	20.37:g.42275584C>T		Somatic	0	81	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	60	26.83	B3KMA1|E1P5W9|Q5H8Z0|Q9H1G3|Q9H1G4|Q9H1H2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transp_unknown	p.D425	ENST00000373030.3	37	c.1275	CCDS33470.1	20																																																																																			-	NULL		0.358	IFT52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT52	protein_coding	OTTHUMT00000079317.1	C	NM_016004	-		42275584	+1	no_errors	ENST00000373030	ensembl	human	known	74_37	silent	SNP	0.349	T
LRRC16B	90668	genome.wustl.edu	37	14	24538444	24538444	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr14:24538444C>T	ENST00000342740.5	+	39	4235	c.4081C>T	c.(4081-4083)Cct>Tct	p.P1361S	CPNE6_ENST00000216775.2_5'Flank|LRRC16B_ENST00000334420.7_Missense_Mutation_p.P414S|CPNE6_ENST00000397016.2_5'Flank|CPNE6_ENST00000537691.1_5'Flank	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	1361						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		AAGACGGCCTCCTGACCCCAC	0.657																																																	0								ENSG00000186648						44.0	48.0	47.0					14																	24538444		2203	4300	6503	LRRC16B	SO:0001583	missense	0			-	HGNC	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.4081C>T	14.37:g.24538444C>T	ENSP00000340467:p.Pro1361Ser	Somatic	0	31	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	21	43.24	Q8TEF7|Q96HS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.P1361S	ENST00000342740.5	37	c.4081	CCDS32054.1	14	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382455	0.61845	.	.	ENSG00000186648	ENST00000342740;ENST00000334420	T;T	0.60299	0.2;0.2	4.85	4.85	0.62838	.	0.000000	0.41396	D	0.000887	T	0.61299	0.2336	N	0.19112	0.55	0.33138	D	0.544025	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.994	T	0.68853	-0.5299	10	0.45353	T	0.12	-2.2147	13.3355	0.60515	0.0:1.0:0.0:0.0	.	414;1361	Q8ND23-2;Q8ND23	.;LR16B_HUMAN	S	1361;414	ENSP00000340467:P1361S;ENSP00000334701:P414S	ENSP00000334701:P414S	P	+	1	0	LRRC16B	23608284	0.893000	0.30496	1.000000	0.80357	0.894000	0.52154	2.391000	0.44424	2.513000	0.84729	0.563000	0.77884	CCT	-	NULL		0.657	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC16B	protein_coding	OTTHUMT00000416527.1	C	NM_138360	-		24538444	+1	no_errors	ENST00000342740	ensembl	human	known	74_37	missense	SNP	1.000	T
ITGAL	3683	genome.wustl.edu	37	16	30528400	30528400	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr16:30528400T>C	ENST00000356798.6	+	26	3149	c.2969T>C	c.(2968-2970)gTg>gCg	p.V990A	ITGAL_ENST00000433423.2_Missense_Mutation_p.V224A|ITGAL_ENST00000358164.5_Missense_Mutation_p.V906A	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	990					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CAGTGGAGCGTGCAGATGGTG	0.627																																					NSCLC(110;1462 1641 3311 33990 49495)												0								ENSG00000005844						86.0	85.0	85.0					16																	30528400		2197	4300	6497	ITGAL	SO:0001583	missense	0			-	HGNC		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2969T>C	16.37:g.30528400T>C	ENSP00000349252:p.Val990Ala	Somatic	0	36	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	35	12.50	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.V990A	ENST00000356798.6	37	c.2969	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	T	22.7	4.324396	0.81580	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	T;T;T	0.55413	0.52;0.52;0.52	4.67	4.67	0.58626	Integrin alpha-2 (1);	0.309846	0.23692	N	0.045506	T	0.65344	0.2682	M	0.72118	2.19	0.50039	D	0.99984	D;D;D	0.76494	0.999;0.985;0.985	D;P;P	0.70487	0.969;0.906;0.906	T	0.62272	-0.6889	10	0.13470	T	0.59	.	10.6833	0.45828	0.0:0.0:0.0:1.0	.	224;906;990	B4E021;Q96HB1;P20701	.;.;ITAL_HUMAN	A	990;906;224	ENSP00000349252:V990A;ENSP00000350886:V906A;ENSP00000409377:V224A	ENSP00000349252:V990A	V	+	2	0	ITGAL	30435901	0.887000	0.30362	0.282000	0.24776	0.697000	0.40408	2.519000	0.45546	2.080000	0.62538	0.455000	0.32223	GTG	-	pfam_Integrin_alpha-2		0.627	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	protein_coding	OTTHUMT00000434508.2	T		-		30528400	+1	no_errors	ENST00000356798	ensembl	human	known	74_37	missense	SNP	0.296	C
APC2	10297	genome.wustl.edu	37	19	1457894	1457895	+	Intron	INS	-	-	GGGGGGGGG	rs374378343|rs113990038|rs71174372		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr19:1457894_1457895insGGGGGGGGG	ENST00000535453.1	+	9	2920				CTB-25B13.12_ENST00000588225.1_RNA|APC2_ENST00000238483.4_Intron|APC2_ENST00000233607.2_Intron			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2						cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCGGGTTGCGGGACCTTCGG	0.619																																																	0								ENSG00000267317																																			CTB-25B13.12	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.1208-69->GGGGGGGGG	19.37:g.1457894_1457895insGGGGGGGGG		Somatic	NA	NA	NA		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000535453.1	37	NULL	CCDS12068.1	19																																																																																			-	-		0.619	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	ENSG00000267317	protein_coding	OTTHUMT00000449539.2	-	NM_005883			1457895	-1	no_errors	ENST00000588225	ensembl	human	known	74_37	rna	INS	0.000:0.000	GGGGGGGGG
FMNL2	114793	genome.wustl.edu	37	2	153481908	153481908	+	3'UTR	SNP	G	G	T	rs563618808		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr2:153481908G>T	ENST00000497192.1	+	0	247				FMNL2_ENST00000475377.2_Intron|FMNL2_ENST00000288670.9_Intron			Q96PY5	FMNL2_HUMAN	formin-like 2						cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						GAGGGTCGTAGGCTTTTGGTG	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		21667	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000157827						60.0	56.0	57.0					2																	153481908		1919	4122	6041	FMNL2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000497192.1:c.*244G>T	2.37:g.153481908G>T		Somatic	0	39	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000497192.1	37	NULL		2																																																																																			-	-		0.443	FMNL2-009	PUTATIVE	basic	processed_transcript	FMNL2	protein_coding	OTTHUMT00000333588.1	G	NM_052905	-		153481908	+1	no_errors	ENST00000497192	ensembl	human	putative	74_37	rna	SNP	0.000	T
FERD3L	222894	genome.wustl.edu	37	7	19184676	19184676	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:19184676G>A	ENST00000275461.3	-	1	368	c.310C>T	c.(310-312)Cag>Tag	p.Q104*	AC003986.5_ENST00000452700.1_RNA	NM_152898.2	NP_690862.1	Q96RJ6	FER3L_HUMAN	Fer3-like bHLH transcription factor	104	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell development (GO:0048468)|floor plate development (GO:0033504)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurogenesis (GO:0050767)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(4)|large_intestine(8)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	35						TTGGCGGCCTGGCGCTGGGCG	0.602																																																	0								ENSG00000146618						83.0	71.0	75.0					7																	19184676		2203	4300	6503	FERD3L	SO:0001587	stop_gained	0			-	HGNC	AF369897	CCDS5368.1	7p21.3	2013-10-17	2013-10-17		ENSG00000146618	ENSG00000146618		"""Basic helix-loop-helix proteins"""	16660	protein-coding gene	gene with protein product			"""Fer3-like (Drosophila)"""			11472856, 12217327	Standard	NM_152898		Approved	NATO3, N-TWIST, bHLHa31	uc003suo.1	Q96RJ6	OTTHUMG00000090823	ENST00000275461.3:c.310C>T	7.37:g.19184676G>A	ENSP00000275461:p.Gln104*	Somatic	0	32	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	Q495K0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.Q104*	ENST00000275461.3	37	c.310	CCDS5368.1	7	.	.	.	.	.	.	.	.	.	.	G	34	5.390681	0.95988	.	.	ENSG00000146618	ENST00000275461	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-2.4945	19.751	0.96268	0.0:0.0:1.0:0.0	.	.	.	.	X	104	.	ENSP00000275461:Q104X	Q	-	1	0	FERD3L	19151201	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.529000	0.73812	2.693000	0.91896	0.650000	0.86243	CAG	-	pfam_bHLH_dom,superfamily_bHLH_dom,pfscan_bHLH_dom		0.602	FERD3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FERD3L	protein_coding	OTTHUMT00000207627.1	G		-		19184676	-1	no_errors	ENST00000275461	ensembl	human	known	74_37	nonsense	SNP	1.000	A
DCC	1630	genome.wustl.edu	37	18	51056781	51056781	+	Intron	SNP	C	C	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr18:51056781C>T	ENST00000442544.2	+	29	4870				DCC_ENST00000581580.1_Missense_Mutation_p.S1073L|RP11-671P2.1_ENST00000582064.1_RNA	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CCAGCATCTTCATTCAGTGAG	0.458																																																	0								ENSG00000187323																																			DCC	SO:0001627	intron_variant	0			-	HGNC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.4255-153C>T	18.37:g.51056781C>T		Somatic	0	68	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	30	25.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S1073L	ENST00000442544.2	37	c.3218	CCDS11952.1	18																																																																																			-	NULL		0.458	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	protein_coding	OTTHUMT00000255996.3	C	NM_005215	-		51056781	+1	no_errors	ENST00000581580	ensembl	human	putative	74_37	missense	SNP	0.080	T
SSPO	23145	genome.wustl.edu	37	7	149509072	149509072	+	RNA	SNP	G	G	A			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:149509072G>A	ENST00000378016.2	+	0	9618							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGTGCCATCGGCACCGGTTCT	0.697																																																	0								ENSG00000197558						27.0	32.0	31.0					7																	149509072		1998	4153	6151	SSPO			0			-	HGNC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149509072G>A		Somatic	0	32	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q76B61	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	-		0.697	SSPO-202	KNOWN	basic	processed_transcript	SSPO	processed_transcript		G		-		149509072	+1	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	SNP	0.998	A
ZNF662	389114	genome.wustl.edu	37	3	42955859	42955859	+	Missense_Mutation	SNP	G	G	T	rs563797609		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr3:42955859G>T	ENST00000541208.1	+	5	663	c.294G>T	c.(292-294)aaG>aaT	p.K98N	ZNF662_ENST00000328199.6_Missense_Mutation_p.K124N|ZNF662_ENST00000440367.2_Missense_Mutation_p.K98N|ZNF662_ENST00000422021.1_Intron|KRBOX1_ENST00000426937.1_Intron			Q6ZS27	ZN662_HUMAN	zinc finger protein 662	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|large_intestine(6)|lung(5)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.217)		TTATTCTGAAGGAGGAAATTA	0.428																																																	0								ENSG00000182983						76.0	80.0	79.0					3																	42955859		2203	4300	6503	ZNF662	SO:0001583	missense	0			-	HGNC	AK127779	CCDS2708.1, CCDS46807.1	3p22.1	2013-01-08			ENSG00000182983	ENSG00000182983		"""Zinc fingers, C2H2-type"", ""-"""	31930	protein-coding gene	gene with protein product							Standard	NM_207404		Approved	FLJ45880	uc003cmk.2	Q6ZS27	OTTHUMG00000133041	ENST00000541208.1:c.294G>T	3.37:g.42955859G>T	ENSP00000446208:p.Lys98Asn	Somatic	0	45	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.00	A1A4T9|F8W7S8|Q6ZNF8|Q6ZQW8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K124N	ENST00000541208.1	37	c.372	CCDS2708.1	3	.	.	.	.	.	.	.	.	.	.	G	6.619	0.482604	0.12581	.	.	ENSG00000182983	ENST00000440367;ENST00000328199;ENST00000541208	T;T;T	0.54675	0.56;0.56;0.56	2.83	-0.0627	0.13780	.	.	.	.	.	T	0.48537	0.1505	L	0.33485	1.01	0.09310	N	1	D;D	0.62365	0.991;0.985	P;P	0.56514	0.8;0.636	T	0.39121	-0.9629	9	0.25751	T	0.34	.	6.5595	0.22479	0.3893:0.0:0.6107:0.0	.	124;98	F8W7S8;Q6ZS27	.;ZN662_HUMAN	N	98;124;98	ENSP00000405047:K98N;ENSP00000329264:K124N;ENSP00000446208:K98N	ENSP00000329264:K124N	K	+	3	2	ZNF662	42930863	0.010000	0.17322	0.440000	0.26846	0.115000	0.19883	0.046000	0.14035	0.098000	0.17522	-0.266000	0.10368	AAG	-	NULL		0.428	ZNF662-201	KNOWN	basic|CCDS	protein_coding	ZNF662	protein_coding	OTTHUMT00000256646.4	G	NM_207404	-		42955859	+1	no_errors	ENST00000328199	ensembl	human	known	74_37	missense	SNP	0.006	T
HTT	3064	genome.wustl.edu	37	4	3208620	3208620	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr4:3208620G>T	ENST00000355072.5	+	44	6130	c.5985G>T	c.(5983-5985)agG>agT	p.R1995S		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1995					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		ATGTGGACAGGCTTCTGTGCA	0.532																																																	0								ENSG00000197386						73.0	71.0	72.0					4																	3208620		1998	4170	6168	HTT	SO:0001583	missense	0			-	HGNC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.5985G>T	4.37:g.3208620G>T	ENSP00000347184:p.Arg1995Ser	Somatic	0	33	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	Q9UQB7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.R1995S	ENST00000355072.5	37	c.5985	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	17.55	3.416773	0.62511	.	.	ENSG00000197386	ENST00000355072	T	0.06371	3.31	5.45	4.59	0.56863	.	0.097789	0.64402	D	0.000002	T	0.05686	0.0149	N	0.14661	0.345	0.36512	D	0.869623	B	0.21381	0.055	B	0.21151	0.033	T	0.28170	-1.0052	10	0.87932	D	0	.	16.316	0.82928	0.0:0.1326:0.8674:0.0	.	1995	P42858	HD_HUMAN	S	1995	ENSP00000347184:R1995S	ENSP00000347184:R1995S	R	+	3	2	HTT	3178418	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.584000	0.67490	1.396000	0.46663	0.655000	0.94253	AGG	-	NULL		0.532	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	protein_coding	OTTHUMT00000358234.2	G	NM_002111	-		3208620	+1	no_errors	ENST00000355072	ensembl	human	known	74_37	missense	SNP	1.000	T
SRPK2	6733	genome.wustl.edu	37	7	104946931	104946932	+	Intron	INS	-	-	A	rs532607805|rs376513804		TCGA-DX-A8BX-01A-11D-A37C-09	TCGA-DX-A8BX-10A-01D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c6670f59-bd1e-4405-98f5-351e9e4ddf11	fc8335fb-7cb7-4553-8701-b16e1bfc3a14	g.chr7:104946931_104946932insA	ENST00000393651.3	-	2	159				RP4-778K6.3_ENST00000476569.1_RNA	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						TTGAACCAGGCAAAAAAAAAAC	0.386																																																	0								ENSG00000135250																																			SRPK2	SO:0001627	intron_variant	0				HGNC	U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.71+82162->T	7.37:g.104946941_104946941dupA		Somatic	0	72	0.00		0.5603658908453018	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11		Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.L53fs	ENST00000393651.3	37	c.159_158	CCDS34724.1	7																																																																																			-	NULL		0.386	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	protein_coding	OTTHUMT00000348723.1	-	NM_182691			104946932	-1	no_errors	ENST00000465112	ensembl	human	known	74_37	frame_shift_ins	INS	0.028:0.035	A
