#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SIGLEC6	946	genome.wustl.edu	37	19	52031508	52031508	+	Splice_Site	SNP	C	C	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr19:52031508C>T	ENST00000425629.3	-	6	1167		c.e6-1		SIGLEC6_ENST00000391797.3_Intron|SIGLEC6_ENST00000343300.4_Intron|SIGLEC6_ENST00000436458.1_Splice_Site|SIGLEC6_ENST00000474054.1_Splice_Site|SIGLEC6_ENST00000359982.4_Splice_Site|SIGLEC6_ENST00000346477.3_Splice_Site	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		TCTGGTTTCCCTATAATTTGA	0.502																																																	0								ENSG00000105492						63.0	69.0	67.0					19																	52031508		1939	4125	6064	SIGLEC6	SO:0001630	splice_region_variant	0			-	HGNC	D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.1013-1G>A	19.37:g.52031508C>T		Somatic	0	53	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	50	39.76	A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6-1	ENST00000425629.3	37	c.1013-1	CCDS12834.3	19	.	.	.	.	.	.	.	.	.	.	c	5.871	0.344803	0.11126	.	.	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000359982;ENST00000436458	.	.	.	2.81	2.81	0.32909	.	.	.	.	.	.	.	.	.	.	.	0.41740	D	0.989602	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2743	0.37690	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIGLEC6	56723320	0.066000	0.20996	0.014000	0.15608	0.039000	0.13416	2.260000	0.43267	1.879000	0.54435	0.404000	0.27445	.	-	-		0.502	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIGLEC6	protein_coding	OTTHUMT00000257670.3	C	NM_001245	-	Intron	52031508	-1	no_errors	ENST00000425629	ensembl	human	known	74_37	splice_site	SNP	0.015	T
VPS13B	157680	genome.wustl.edu	37	8	100711854	100711854	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr8:100711854A>G	ENST00000358544.2	+	36	6334	c.6223A>G	c.(6223-6225)Agt>Ggt	p.S2075G	VPS13B_ENST00000357162.2_Missense_Mutation_p.S2050G|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2075					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAATGCACACAGTTTGGCACA	0.378																																					Colon(161;2205 2542 7338 31318)												0								ENSG00000132549						78.0	79.0	79.0					8																	100711854		2203	4300	6503	VPS13B	SO:0001583	missense	0			-	HGNC	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.6223A>G	8.37:g.100711854A>G	ENSP00000351346:p.Ser2075Gly	Somatic	0	47	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	34	37.04	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Autophagy-rel_C	p.S2075G	ENST00000358544.2	37	c.6223	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	A	0.008	-1.906217	0.00512	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.69685	-0.42;-0.42	4.08	-0.139	0.13460	.	1.329930	0.04772	N	0.428236	T	0.48333	0.1494	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.12889	-1.0530	10	0.23302	T	0.38	.	3.6826	0.08316	0.4206:0.0:0.4167:0.1627	.	2050;2075	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	G	2050;2075	ENSP00000349685:S2050G;ENSP00000351346:S2075G	ENSP00000349685:S2050G	S	+	1	0	VPS13B	100781030	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.306000	0.08178	-0.520000	0.06435	-0.242000	0.12053	AGT	-	NULL		0.378	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	protein_coding	OTTHUMT00000277138.1	A	NM_184042	-		100711854	+1	no_errors	ENST00000358544	ensembl	human	known	74_37	missense	SNP	0.000	G
PNPLA6	10908	genome.wustl.edu	37	19	7622127	7622127	+	Silent	SNP	C	C	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr19:7622127C>T	ENST00000221249.6	+	30	3671	c.3240C>T	c.(3238-3240)gaC>gaT	p.D1080D	PNPLA6_ENST00000600737.1_Silent_p.D1118D|PNPLA6_ENST00000414982.3_Silent_p.D1128D|PNPLA6_ENST00000450331.3_Silent_p.D1080D|PNPLA6_ENST00000545201.2_Silent_p.D1053D	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1119	Patatin.				angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						ACCCCAAGGACGGGCACCTAC	0.667																																																	0								ENSG00000032444						55.0	48.0	50.0					19																	7622127		2203	4299	6502	PNPLA6	SO:0001819	synonymous_variant	0			-	HGNC	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.3240C>T	19.37:g.7622127C>T		Somatic	0	156	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	78	84	48.15	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.D1128	ENST00000221249.6	37	c.3384	CCDS32891.1	19																																																																																			-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase		0.667	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PNPLA6	protein_coding	OTTHUMT00000459275.1	C	NM_006702	-		7622127	+1	no_errors	ENST00000414982	ensembl	human	known	74_37	silent	SNP	0.970	T
PAIP1	10605	genome.wustl.edu	37	5	43535014	43535014	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr5:43535014C>G	ENST00000306846.3	-	8	1370	c.1138G>C	c.(1138-1140)Gtc>Ctc	p.V380L	PAIP1_ENST00000514514.1_Missense_Mutation_p.V301L|PAIP1_ENST00000436644.2_Missense_Mutation_p.V301L|PAIP1_ENST00000338972.4_Missense_Mutation_p.V268L	NM_006451.4|NM_182789.3	NP_006442.2|NP_877590.1	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1	380					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	RNA binding (GO:0003723)|translation activator activity (GO:0008494)			endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Lung NSC(6;2.07e-05)					GTTGCATGGACTCTGCCCCAG	0.368																																																	0								ENSG00000172239						107.0	102.0	104.0					5																	43535014		2203	4300	6503	PAIP1	SO:0001583	missense	0			-	HGNC	AF013758	CCDS3947.1, CCDS3948.1, CCDS47204.1	5p12	2008-02-05			ENSG00000172239	ENSG00000172239			16945	protein-coding gene	gene with protein product		605184				9548260, 11230166	Standard	NM_006451		Approved		uc003job.3	Q9H074	OTTHUMG00000096960	ENST00000306846.3:c.1138G>C	5.37:g.43535014C>G	ENSP00000302768:p.Val380Leu	Somatic	0	113	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	66	43.10	A6NKV8|O60455|Q96B61|Q9BS63	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MIF4G-like_typ-3,pfam_Ataxin-2_C,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.V380L	ENST00000306846.3	37	c.1138	CCDS3947.1	5	.	.	.	.	.	.	.	.	.	.	C	17.92	3.506808	0.64410	.	.	ENSG00000172239	ENST00000306846;ENST00000436644;ENST00000338972;ENST00000514514	T;T;T;T	0.30981	1.51;1.53;1.54;1.53	5.31	5.31	0.75309	.	0.058419	0.64402	N	0.000002	T	0.26448	0.0646	L	0.34521	1.04	0.51233	D	0.999913	B;B;B	0.12013	0.0;0.005;0.001	B;B;B	0.12837	0.002;0.008;0.005	T	0.02691	-1.1123	10	0.30078	T	0.28	-5.0293	17.1087	0.86669	0.0:1.0:0.0:0.0	.	301;380;301	D6REB4;Q9H074;Q9H074-2	.;PAIP1_HUMAN;.	L	380;301;268;301	ENSP00000302768:V380L;ENSP00000387729:V301L;ENSP00000339622:V268L;ENSP00000425084:V301L	ENSP00000302768:V380L	V	-	1	0	PAIP1	43570771	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.044000	0.76578	2.646000	0.89796	0.585000	0.79938	GTC	-	NULL		0.368	PAIP1-001	KNOWN	basic|CCDS	protein_coding	PAIP1	protein_coding	OTTHUMT00000214024.1	C	NM_006451	-		43535014	-1	no_errors	ENST00000306846	ensembl	human	known	74_37	missense	SNP	1.000	G
GRIK1	2897	genome.wustl.edu	37	21	30968611	30968611	+	Intron	SNP	G	G	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr21:30968611G>T	ENST00000399907.1	-	9	1663				BACH1_ENST00000462262.1_3'UTR|GRIK1-AS2_ENST00000333765.4_5'UTR|GRIK1_ENST00000535441.1_Intron|GRIK1_ENST00000472429.1_5'Flank|GRIK1_ENST00000399914.1_Intron|GRIK1_ENST00000389124.2_Intron|GRIK1_ENST00000309434.7_Intron|GRIK1_ENST00000389125.3_Intron|GRIK1_ENST00000327783.4_Intron|GRIK1_ENST00000399909.1_Intron|GRIK1_ENST00000399913.1_Intron	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1						adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	AATAATCTTGGGGGAAATATT	0.368																																																	0								ENSG00000156273																																			BACH1	SO:0001627	intron_variant	0			-	HGNC		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1251+234C>A	21.37:g.30968611G>T		Somatic	0	50	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q13001|Q86SU9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000399907.1	37	NULL	CCDS42913.1	21																																																																																			-	-		0.368	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BACH1	protein_coding	OTTHUMT00000171979.1	G		-		30968611	+1	no_errors	ENST00000462262	ensembl	human	known	74_37	rna	SNP	0.012	T
OBSL1	23363	genome.wustl.edu	37	2	220435173	220435173	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr2:220435173T>C	ENST00000404537.1	-	1	838	c.782A>G	c.(781-783)aAg>aGg	p.K261R	INHA_ENST00000489456.1_Intron|OBSL1_ENST00000491370.1_5'Flank|OBSL1_ENST00000373876.1_Missense_Mutation_p.K261R|OBSL1_ENST00000373873.4_Missense_Mutation_p.K261R|OBSL1_ENST00000603926.1_Missense_Mutation_p.K261R|OBSL1_ENST00000265318.4_Missense_Mutation_p.K261R|INHA_ENST00000243786.2_5'Flank|OBSL1_ENST00000289656.3_Intron	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	261	Ig-like 3.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CTTGGCGTGCTTGCCCTCGTT	0.726																																																	0								ENSG00000124006						35.0	42.0	39.0					2																	220435173		2048	4162	6210	OBSL1	SO:0001583	missense	0			-	HGNC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.782A>G	2.37:g.220435173T>C	ENSP00000385636:p.Lys261Arg	Somatic	0	31	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	21	53.33	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.K261R	ENST00000404537.1	37	c.782	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	T	27.9	4.876018	0.91664	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	4.25	4.25	0.50352	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71651	0.3365	L	0.31476	0.935	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.998	T	0.73062	-0.4101	9	0.46703	T	0.11	.	13.7818	0.63087	0.0:0.0:0.0:1.0	.	261;261	O75147;O75147-2	OBSL1_HUMAN;.	R	261	ENSP00000265318:K261R;ENSP00000385636:K261R;ENSP00000362983:K261R;ENSP00000362980:K261R	ENSP00000265318:K261R	K	-	2	0	OBSL1	220143417	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	7.672000	0.83956	1.899000	0.54978	0.334000	0.21626	AAG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.726	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	protein_coding	OTTHUMT00000322012.1	T		-		220435173	-1	no_errors	ENST00000404537	ensembl	human	known	74_37	missense	SNP	1.000	C
CHKB	1120	genome.wustl.edu	37	22	51021601	51021601	+	5'Flank	SNP	G	G	A			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr22:51021601G>A	ENST00000406938.2	-	0	0				CHKB_ENST00000463053.1_Intron|CHKB-AS1_ENST00000380711.3_RNA	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta						CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	GAGAGGAGCTGCGTCTCTGCC	0.766																																																	0								ENSG00000205559																																			CHKB-AS1	SO:0001631	upstream_gene_variant	0			-	HGNC	AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275		22.37:g.51021601G>A	Exception_encountered	Somatic	0	26	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29	A0PJM6|Q13388	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406938.2	37	NULL	CCDS14099.1	22																																																																																			-	-		0.766	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHKB-AS1	protein_coding	OTTHUMT00000317267.3	G	NM_005198	-		51021601	+1	no_errors	ENST00000380711	ensembl	human	known	74_37	rna	SNP	0.000	A
FAM71E2	284418	genome.wustl.edu	37	19	55870230	55870230	+	Missense_Mutation	SNP	C	C	T	rs539283543		TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr19:55870230C>T	ENST00000424985.3	-	9	2199	c.2006G>A	c.(2005-2007)cGg>cAg	p.R669Q	CTD-2105E13.6_ENST00000591954.3_Missense_Mutation_p.G219R	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	669										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						CCATCTCTTCCGCTGCTCCAA	0.637													c|||	1	0.000199681	0.0008	0.0	5008	,	,		17885	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000180043						43.0	47.0	46.0					19																	55870230		692	1591	2283	FAM71E2	SO:0001583	missense	0			-	HGNC	AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.2006G>A	19.37:g.55870230C>T	ENSP00000398617:p.Arg669Gln	Somatic	0	37	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	34	42.37	Q8ND99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3699	p.R669Q	ENST00000424985.3	37	c.2006		19	.	.	.	.	.	.	.	.	.	.	N	4.867	0.161241	0.09287	.	.	ENSG00000180043	ENST00000424985	T	0.10573	2.86	3.7	-2.1	0.07210	.	.	.	.	.	T	0.03305	0.0096	N	0.02916	-0.46	0.09310	N	1	B	0.21753	0.06	B	0.10450	0.005	T	0.44817	-0.9303	9	0.06236	T	0.91	.	9.4783	0.38884	0.0:0.6506:0.0:0.3494	.	669	Q8N5Q1	F71E2_HUMAN	Q	669	ENSP00000398617:R669Q	ENSP00000398617:R669Q	R	-	2	0	FAM71E2	60562042	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-0.245000	0.08890	-0.411000	0.07530	-0.387000	0.06579	CGG	-	NULL		0.637	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	FAM71E2	protein_coding	OTTHUMT00000409063.4	C	NM_001145402	-		55870230	-1	no_errors	ENST00000424985	ensembl	human	novel	74_37	missense	SNP	0.001	T
GRIN1	2902	genome.wustl.edu	37	9	140036529	140036529	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr9:140036529C>T	ENST00000371561.3	+	2	1420	c.323C>T	c.(322-324)tCc>tTc	p.S108F	GRIN1_ENST00000371555.4_Missense_Mutation_p.S108F|GRIN1_ENST00000371546.4_Missense_Mutation_p.S108F|GRIN1_ENST00000371550.4_Missense_Mutation_p.S108F|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371559.4_Missense_Mutation_p.S108F|GRIN1_ENST00000371560.3_Missense_Mutation_p.S108F|GRIN1_ENST00000350902.5_Missense_Mutation_p.S108F|GRIN1_ENST00000371553.3_Missense_Mutation_p.S108F|GRIN1_ENST00000315048.3_Missense_Mutation_p.S108F	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	108					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	ACCCCTGTCTCCTACACAGCC	0.592																																					NSCLC(113;717 1653 2089 20474 37618)												0								ENSG00000176884						366.0	288.0	314.0					9																	140036529		2203	4300	6503	GRIN1	SO:0001583	missense	0			-	HGNC		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.323C>T	9.37:g.140036529C>T	ENSP00000360616:p.Ser108Phe	Somatic	0	72	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	41	36.92	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_CaM-bd_C0_NMDA_rcpt_NR1,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S108F	ENST00000371561.3	37	c.323	CCDS7031.1	9	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153912	0.78114	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	D;D;D;D;D;D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88;-1.88;-1.88;-1.88;-1.88;-1.88	3.37	3.37	0.38596	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.90896	0.7139	M	0.72118	2.19	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.997;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.987;0.986;0.999;0.999;1.0;1.0	D	0.92063	0.5658	10	0.87932	D	0	.	13.8091	0.63252	0.0:1.0:0.0:0.0	.	108;108;108;108;108;108	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	F	108	ENSP00000360616:S108F;ENSP00000316696:S108F;ENSP00000316915:S108F;ENSP00000360605:S108F;ENSP00000360601:S108F;ENSP00000360610:S108F;ENSP00000360608:S108F;ENSP00000360614:S108F;ENSP00000360615:S108F	ENSP00000316696:S108F	S	+	2	0	GRIN1	139156350	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.016000	0.76393	1.887000	0.54652	0.462000	0.41574	TCC	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.592	GRIN1-002	KNOWN	basic|CCDS	protein_coding	GRIN1	protein_coding	OTTHUMT00000055267.3	C	NM_007327	-		140036529	+1	no_errors	ENST00000371561	ensembl	human	known	74_37	missense	SNP	1.000	T
ADCK4	79934	genome.wustl.edu	37	19	41208580	41208580	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr19:41208580C>G	ENST00000324464.3	-	10	1119	c.818G>C	c.(817-819)aGc>aCc	p.S273T	ADCK4_ENST00000450541.1_Missense_Mutation_p.S232T|ADCK4_ENST00000243583.6_Missense_Mutation_p.S232T	NM_024876.3	NP_079152.3	Q96D53	ADCK4_HUMAN	aarF domain containing kinase 4	273	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(6)|stomach(2)|urinary_tract(1)	17			Lung(22;9.49e-05)|LUSC - Lung squamous cell carcinoma(20;0.000219)			GGCCTGCAGGCTCTGCTCGGC	0.642											OREG0025476	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000123815						72.0	62.0	66.0					19																	41208580		2203	4300	6503	ADCK4	SO:0001583	missense	0			-	HGNC	AK022291	CCDS12562.1, CCDS46081.1	19q13.2	2008-02-05				ENSG00000123815			19041	protein-coding gene	gene with protein product		615567					Standard	NM_024876		Approved	FLJ12229, COQ8	uc002oor.2	Q96D53		ENST00000324464.3:c.818G>C	19.37:g.41208580C>G	ENSP00000315118:p.Ser273Thr	Somatic	0	71	0.00	899	0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	42	44.00	Q8TAJ1|Q9HA52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.S273T	ENST00000324464.3	37	c.818	CCDS12562.1	19	.	.	.	.	.	.	.	.	.	.	C	3.201	-0.163628	0.06502	.	.	ENSG00000123815	ENST00000324464;ENST00000450541;ENST00000243583	T;T;T	0.53423	0.62;0.62;0.62	5.27	5.27	0.74061	ABC-1 (1);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.30324	0.0761	N	0.20401	0.57	0.36216	D	0.851663	B;B	0.18166	0.026;0.024	B;B	0.22386	0.036;0.039	T	0.30357	-0.9981	10	0.19590	T	0.45	-23.1851	9.2023	0.37265	0.1622:0.6808:0.157:0.0	.	273;232	Q96D53;Q96D53-2	ADCK4_HUMAN;.	T	273;232;232	ENSP00000315118:S273T;ENSP00000412839:S232T;ENSP00000243583:S232T	ENSP00000243583:S232T	S	-	2	0	ADCK4	45900420	0.965000	0.33210	1.000000	0.80357	0.963000	0.63663	2.425000	0.44723	2.465000	0.83290	0.555000	0.69702	AGC	-	pfam_UbiB_dom,superfamily_Kinase-like_dom		0.642	ADCK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADCK4	protein_coding	OTTHUMT00000462731.1	C	NM_024876	-		41208580	-1	no_errors	ENST00000324464	ensembl	human	known	74_37	missense	SNP	0.937	G
GAB1	2549	genome.wustl.edu	37	4	144387374	144387374	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr4:144387374G>A	ENST00000262994.4	+	9	2224	c.1922G>A	c.(1921-1923)cGt>cAt	p.R641H	GAB1_ENST00000505913.1_Missense_Mutation_p.R538H|GAB1_ENST00000262995.4_Missense_Mutation_p.R671H	NM_002039.3	NP_002030.2	Q13480	GAB1_HUMAN	GRB2-associated binding protein 1	641					activation of JUN kinase activity (GO:0007257)|cell proliferation (GO:0008283)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|interleukin-6-mediated signaling pathway (GO:0070102)|labyrinthine layer development (GO:0060711)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|regulation of cell migration (GO:0030334)|response to oxidative stress (GO:0006979)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	30	all_hematologic(180;0.158)					ACACCACCACGTAAGGTGAGT	0.398																																																	0								ENSG00000109458						123.0	109.0	114.0					4																	144387374		2203	4300	6503	GAB1	SO:0001583	missense	0			-	HGNC	U43885	CCDS3759.1, CCDS3760.1	4q31.1	2013-01-10			ENSG00000109458	ENSG00000109458		"""Pleckstrin homology (PH) domain containing"""	4066	protein-coding gene	gene with protein product		604439				8596638	Standard	NM_207123		Approved		uc003ijd.3	Q13480	OTTHUMG00000161432	ENST00000262994.4:c.1922G>A	4.37:g.144387374G>A	ENSP00000262994:p.Arg641His	Somatic	0	70	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	44	54.08	A8K152|Q4W5G2|Q6P1W2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R671H	ENST00000262994.4	37	c.2012	CCDS3759.1	4	.	.	.	.	.	.	.	.	.	.	G	27.1	4.799017	0.90538	.	.	ENSG00000109458	ENST00000262995;ENST00000262994;ENST00000505913	T;T;T	0.14640	2.49;2.49;2.49	5.54	4.7	0.59300	.	0.127697	0.56097	D	0.000035	T	0.38639	0.1048	M	0.77820	2.39	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.28964	-1.0027	10	0.59425	D	0.04	2.133	14.3306	0.66553	0.0715:0.0:0.9285:0.0	.	641;671	Q13480;Q13480-2	GAB1_HUMAN;.	H	671;641;538	ENSP00000262995:R671H;ENSP00000262994:R641H;ENSP00000424554:R538H	ENSP00000262994:R641H	R	+	2	0	GAB1	144606824	1.000000	0.71417	0.982000	0.44146	0.982000	0.71751	8.892000	0.92491	1.334000	0.45468	0.591000	0.81541	CGT	-	NULL		0.398	GAB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB1	protein_coding	OTTHUMT00000364998.1	G	NM_002039	-		144387374	+1	no_errors	ENST00000262995	ensembl	human	known	74_37	missense	SNP	0.999	A
IFT172	26160	genome.wustl.edu	37	2	27684174	27684174	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr2:27684174T>C	ENST00000260570.3	-	22	2507	c.2404A>G	c.(2404-2406)Atc>Gtc	p.I802V		NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	802					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					GCTGCAGTGATGTGTTCTACC	0.557																																																	0								ENSG00000138002						128.0	112.0	117.0					2																	27684174		2203	4300	6503	IFT172	SO:0001583	missense	0			-	HGNC	AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.2404A>G	2.37:g.27684174T>C	ENSP00000260570:p.Ile802Val	Somatic	0	73	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	40	44.44	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat	p.I802V	ENST00000260570.3	37	c.2404	CCDS1755.1	2	.	.	.	.	.	.	.	.	.	.	T	5.719	0.317205	0.10845	.	.	ENSG00000138002	ENST00000260570	T	0.63096	-0.02	5.57	5.57	0.84162	Tetratricopeptide-like helical (1);	0.045766	0.85682	D	0.000000	T	0.38931	0.1059	N	0.13235	0.315	0.80722	D	1	B	0.23891	0.093	B	0.26202	0.067	T	0.32241	-0.9914	10	0.02654	T	1	-13.7921	9.1209	0.36786	0.0:0.0826:0.0:0.9174	.	802	Q9UG01	IF172_HUMAN	V	802	ENSP00000260570:I802V	ENSP00000260570:I802V	I	-	1	0	IFT172	27537678	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.356000	0.52269	2.119000	0.64992	0.477000	0.44152	ATC	-	superfamily_ARM-type_fold		0.557	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	protein_coding	OTTHUMT00000250213.2	T	NM_015662	-		27684174	-1	no_errors	ENST00000260570	ensembl	human	known	74_37	missense	SNP	1.000	C
SMAD3	4088	genome.wustl.edu	37	15	67473711	67473711	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr15:67473711C>T	ENST00000327367.4	+	6	1101	c.791C>T	c.(790-792)tCc>tTc	p.S264F	SMAD3_ENST00000439724.3_Missense_Mutation_p.S220F|SMAD3_ENST00000537194.2_Missense_Mutation_p.S69F|SMAD3_ENST00000540846.2_Missense_Mutation_p.S159F	NM_005902.3	NP_005893.1	P84022	SMAD3_HUMAN	SMAD family member 3	264	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097296)|activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell-cell junction organization (GO:0045216)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|embryonic pattern specification (GO:0009880)|endoderm development (GO:0007492)|evasion or tolerance of host defenses by virus (GO:0019049)|extrinsic apoptotic signaling pathway (GO:0097191)|gene expression (GO:0010467)|heart looping (GO:0001947)|immune response (GO:0006955)|immune system development (GO:0002520)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|lens fiber cell differentiation (GO:0070306)|liver development (GO:0001889)|mesoderm formation (GO:0001707)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)|nodal signaling pathway (GO:0038092)|osteoblast development (GO:0002076)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta3 production (GO:0032916)|primary miRNA processing (GO:0031053)|protein stabilization (GO:0050821)|regulation of binding (GO:0051098)|regulation of epithelial cell proliferation (GO:0050678)|regulation of immune response (GO:0050776)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|somitogenesis (GO:0001756)|T cell activation (GO:0042110)|thyroid gland development (GO:0030878)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transdifferentiation (GO:0060290)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transport (GO:0006810)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|bHLH transcription factor binding (GO:0043425)|chromatin DNA binding (GO:0031490)|co-SMAD binding (GO:0070410)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(11)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		ACCGACCCCTCCAATTCGGAG	0.587																																																	0								ENSG00000166949						67.0	63.0	64.0					15																	67473711		2201	4299	6500	SMAD3	SO:0001583	missense	0			-	HGNC	BC050743	CCDS10222.1, CCDS45288.1, CCDS53950.1, CCDS53951.1	15q21-q22	2006-11-06	2006-11-06	2004-05-26	ENSG00000166949	ENSG00000166949		"""SMADs"""	6769	protein-coding gene	gene with protein product		603109	"""MAD, mothers against decapentaplegic homolog 3 (Drosophila)"", ""SMAD, mothers against DPP homolog 3 (Drosophila)"""	MADH3		8774881, 8673135	Standard	NM_001145102		Approved	JV15-2, HsT17436	uc002aqj.3	P84022	OTTHUMG00000133230	ENST00000327367.4:c.791C>T	15.37:g.67473711C>T	ENSP00000332973:p.Ser264Phe	Somatic	0	66	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	31	40.38	A8K4B6|B7Z4Z5|B7Z6M9|B7Z9Q2|F5H383|O09064|O09144|O14510|O35273|Q92940|Q93002|Q9GKR4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.S264F	ENST00000327367.4	37	c.791	CCDS10222.1	15	.	.	.	.	.	.	.	.	.	.	C	29.7	5.029499	0.93518	.	.	ENSG00000166949	ENST00000327367;ENST00000535241;ENST00000540846;ENST00000439724;ENST00000537194	D;D;D;D	0.97352	-4.35;-4.35;-4.35;-4.35	5.1	5.1	0.69264	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98695	0.9562	M	0.88181	2.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	D	0.99744	1.1016	10	0.87932	D	0	.	18.8753	0.92332	0.0:1.0:0.0:0.0	.	220;264	B7Z4Z5;P84022	.;SMAD3_HUMAN	F	264;264;159;220;69	ENSP00000332973:S264F;ENSP00000437757:S159F;ENSP00000401133:S220F;ENSP00000445348:S69F	ENSP00000332973:S264F	S	+	2	0	SMAD3	65260765	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.675000	0.84002	2.515000	0.84797	0.555000	0.69702	TCC	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type		0.587	SMAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD3	protein_coding	OTTHUMT00000256967.2	C	NM_005902	-		67473711	+1	no_errors	ENST00000327367	ensembl	human	known	74_37	missense	SNP	1.000	T
CHKB	1120	genome.wustl.edu	37	22	51021602	51021602	+	5'Flank	SNP	C	C	A			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr22:51021602C>A	ENST00000406938.2	-	0	0				CHKB_ENST00000463053.1_Intron|CHKB-AS1_ENST00000380711.3_RNA	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta						CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	AGAGGAGCTGCGTCTCTGCCC	0.766																																																	0								ENSG00000205559																																			CHKB-AS1	SO:0001631	upstream_gene_variant	0			-	HGNC	AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275		22.37:g.51021602C>A	Exception_encountered	Somatic	0	26	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29	A0PJM6|Q13388	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406938.2	37	NULL	CCDS14099.1	22																																																																																			-	-		0.766	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHKB-AS1	protein_coding	OTTHUMT00000317267.3	C	NM_005198	-		51021602	+1	no_errors	ENST00000380711	ensembl	human	known	74_37	rna	SNP	0.000	A
CREBBP	1387	genome.wustl.edu	37	16	3900553	3900553	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr16:3900553delA	ENST00000262367.5	-	2	1352	c.543delT	c.(541-543)tttfs	p.F181fs	CREBBP_ENST00000382070.3_Frame_Shift_Del_p.F181fs	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	181					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		GGGTCTGGTTAAAGTTAGCAT	0.527			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0								ENSG00000005339						85.0	82.0	83.0					16																	3900553		2197	4300	6497	CREBBP	SO:0001589	frameshift_variant	0				HGNC	U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.543delT	16.37:g.3900553delA	ENSP00000262367:p.Phe181fs	Somatic	0	60	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	44	45.00	D3DUC9|O00147|Q16376|Q4LE28	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.F181fs	ENST00000262367.5	37	c.543	CCDS10509.1	16																																																																																			-	NULL		0.527	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	protein_coding	OTTHUMT00000251591.2	A	NM_004380			3900553	-1	no_errors	ENST00000262367	ensembl	human	known	74_37	frame_shift_del	DEL	0.764	-
NAA25	80018	genome.wustl.edu	37	12	112512476	112512477	+	Intron	INS	-	-	A			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr12:112512476_112512477insA	ENST00000261745.4	-	9	1115					NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit							cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						GAAGACAACTTACTGTTCACCT	0.361																																																	0								ENSG00000111300																																			NAA25	SO:0001627	intron_variant	0				HGNC	AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.866+1->T	12.37:g.112512477_112512477dupA		Somatic	0	22	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	37	19.57	A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e9+2	ENST00000261745.4	37	c.866+2_866+1	CCDS9159.1	12																																																																																			-	-		0.361	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA25	protein_coding	OTTHUMT00000405205.1	-	NM_024953			112512477	-1	no_errors	ENST00000261745	ensembl	human	known	74_37	splice_site_ins	INS	1.000:1.000	A
NFE2L3	9603	genome.wustl.edu	37	7	26224911	26224914	+	Frame_Shift_Del	DEL	AGAT	AGAT	-	rs371060821|rs367544069		TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	AGAT	AGAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr7:26224911_26224914delAGAT	ENST00000056233.3	+	4	1852_1855	c.1593_1596delAGAT	c.(1591-1596)acagatfs	p.TD531fs		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	531					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						TTGAAGACACAGATAGAAACTTGA	0.431																																																	0								ENSG00000050344																																			NFE2L3	SO:0001589	frameshift_variant	0				HGNC	AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.1593_1596delAGAT	7.37:g.26224911_26224914delAGAT	ENSP00000056233:p.Thr531fs	Somatic	0	112	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	62	28.74	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_bZIP,pfam_bZIP_Maf,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.D532fs	ENST00000056233.3	37	c.1593_1596	CCDS5396.1	7																																																																																			-	NULL		0.431	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	protein_coding	OTTHUMT00000214088.1	AGAT				26224914	+1	no_errors	ENST00000056233	ensembl	human	known	74_37	frame_shift_del	DEL	0.001:0.001:0.000:0.000	-
MAP7D1	55700	genome.wustl.edu	37	1	36643568	36643568	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr1:36643568C>A	ENST00000373151.2	+	9	1690	c.1474C>A	c.(1474-1476)Cca>Aca	p.P492T	MAP7D1_ENST00000373150.4_Missense_Mutation_p.P460T|MAP7D1_ENST00000373148.4_Missense_Mutation_p.P38T|MAP7D1_ENST00000316156.4_Missense_Mutation_p.P455T	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	492	Pro-rich.				microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)				breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				CACTCTGCCTCCAAAGCCACC	0.692																																																	0								ENSG00000116871						69.0	67.0	68.0					1																	36643568		2203	4299	6502	MAP7D1	SO:0001583	missense	0			-	HGNC	AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.1474C>A	1.37:g.36643568C>A	ENSP00000362244:p.Pro492Thr	Somatic	0	38	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	23	45.24	D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP7	p.P492T	ENST00000373151.2	37	c.1474	CCDS30673.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.67|17.67	3.446921|3.446921	0.63178|0.63178	.|.	.|.	ENSG00000116871|ENSG00000116871	ENST00000316156;ENST00000373150;ENST00000373151;ENST00000373148|ENST00000530975	T;T;T;T|.	0.61627|.	0.09;0.09;0.09;0.09|.	4.95|4.95	4.95|4.95	0.65309|0.65309	.|.	0.000000|.	0.40222|.	N|.	0.001158|.	T|T	0.63558|0.63558	0.2521|0.2521	L|L	0.54323|0.54323	1.7|1.7	0.47407|0.47407	D|D	0.999415|0.999415	D;D;D;D;D|.	0.89917|.	0.999;1.0;0.999;0.999;1.0|.	D;D;D;D;D|.	0.83275|.	0.976;0.996;0.976;0.964;0.996|.	T|T	0.60924|0.60924	-0.7166|-0.7166	10|5	0.54805|.	T|.	0.06|.	-10.1624|-10.1624	13.5449|13.5449	0.61697|0.61697	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	38;492;455;460;492|.	Q3KQU3-3;D3DPS3;Q3KQU3-2;Q3KQU3-4;Q3KQU3|.	.;.;.;.;MA7D1_HUMAN|.	T|Y	455;460;492;38|74	ENSP00000320228:P455T;ENSP00000362243:P460T;ENSP00000362244:P492T;ENSP00000362241:P38T|.	ENSP00000320228:P455T|.	P|S	+|+	1|2	0|0	MAP7D1|MAP7D1	36416155|36416155	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	2.926000|2.926000	0.48892|0.48892	2.576000|2.576000	0.86940|0.86940	0.591000|0.591000	0.81541|0.81541	CCA|TCC	-	NULL		0.692	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D1	protein_coding	OTTHUMT00000382095.1	C	NM_018067	-		36643568	+1	no_errors	ENST00000373151	ensembl	human	known	74_37	missense	SNP	1.000	A
TG	7038	genome.wustl.edu	37	8	134042071	134042071	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr8:134042071G>A	ENST00000220616.4	+	41	7082	c.7042G>A	c.(7042-7044)Gga>Aga	p.G2348R	TG_ENST00000542445.1_Missense_Mutation_p.G718R|TG_ENST00000519543.1_Missense_Mutation_p.G481R|TG_ENST00000377869.1_Missense_Mutation_p.G2291R	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2348					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		TGAAGGGTCCGGAGAGGTGAG	0.567																																																	0								ENSG00000042832						41.0	46.0	44.0					8																	134042071		2203	4300	6503	TG	SO:0001583	missense	0			-	HGNC	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.7042G>A	8.37:g.134042071G>A	ENSP00000220616:p.Gly2348Arg	Somatic	0	97	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	41	50.60	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.G2348R	ENST00000220616.4	37	c.7042	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.02|13.02	2.111414|2.111414	0.37242|0.37242	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543|ENST00000519178;ENST00000518108	T;T;T;T|.	0.58797|.	0.31;0.31;0.31;0.31|.	5.13|5.13	-3.91|-3.91	0.04168|0.04168	Carboxylesterase, type B (1);|.	1.485330|.	0.04072|.	N|.	0.308170|.	T|T	0.30198|0.30198	0.0757|0.0757	N|N	0.25144|0.25144	0.715|0.715	0.09310|0.09310	N|N	1|1	P;P;P|.	0.46706|.	0.883;0.669;0.822|.	B;B;B|.	0.34652|.	0.187;0.164;0.131|.	T|T	0.32534|0.32534	-0.9903|-0.9903	10|5	0.44086|.	T|.	0.13|.	.|.	13.4171|13.4171	0.60974|0.60974	0.6175:0.0:0.3825:0.0|0.6175:0.0:0.3825:0.0	.|.	481;718;2348|.	E7EVM0;F5GWW5;P01266|.	.;.;THYG_HUMAN|.	R|Q	2291;1154;2348;718;481|803;143	ENSP00000367100:G2291R;ENSP00000220616:G2348R;ENSP00000441693:G718R;ENSP00000430430:G481R|.	ENSP00000220616:G2348R|.	G|R	+|+	1|2	0|0	TG|TG	134111253|134111253	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.262000|0.262000	0.26303|0.26303	-1.395000|-1.395000	0.02516|0.02516	-0.711000|-0.711000	0.04995|0.04995	0.462000|0.462000	0.41574|0.41574	GGA|CGG	-	pfam_CarbesteraseB,pirsf_Thyroglobulin		0.567	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	protein_coding	OTTHUMT00000379606.1	G	NM_003235	-		134042071	+1	no_errors	ENST00000220616	ensembl	human	known	74_37	missense	SNP	0.000	A
MFSD5	84975	genome.wustl.edu	37	12	53647129	53647129	+	Silent	SNP	C	C	G			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr12:53647129C>G	ENST00000329548.4	+	2	701	c.510C>G	c.(508-510)acC>acG	p.T170T	MFSD5_ENST00000534842.1_Silent_p.T277T	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	170					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						TCCCAGCTACCTTTGCTCGAG	0.607																																																	0								ENSG00000182544						174.0	170.0	172.0					12																	53647129		2203	4300	6503	MFSD5	SO:0001819	synonymous_variant	0			-	HGNC	AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.510C>G	12.37:g.53647129C>G		Somatic	0	42	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	82	18.81	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF791,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.T277	ENST00000329548.4	37	c.831	CCDS8851.1	12																																																																																			-	pfam_DUF791,pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.607	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD5	protein_coding	OTTHUMT00000406896.1	C	NM_032889	-		53647129	+1	no_errors	ENST00000534842	ensembl	human	known	74_37	silent	SNP	0.988	G
BAZ2A	11176	genome.wustl.edu	37	12	56993005	56993005	+	Silent	SNP	T	T	G			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr12:56993005T>G	ENST00000551812.1	-	27	5509	c.5316A>C	c.(5314-5316)gcA>gcC	p.A1772A	BAZ2A_ENST00000179765.5_Silent_p.A1740A|BAZ2A_ENST00000549884.1_Silent_p.A1770A|BAZ2A_ENST00000379441.3_Silent_p.A1742A|BAZ2A_ENST00000553222.1_5'Flank	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1772					chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GAGGCCCTGCTGCTGGGCTTT	0.597																																																	0								ENSG00000076108						26.0	27.0	27.0					12																	56993005		1987	4164	6151	BAZ2A	SO:0001819	synonymous_variant	0			-	HGNC	AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.5316A>C	12.37:g.56993005T>G		Somatic	0	47	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	54	28.00	B3KN66|O00536|O15030|Q68DI8|Q96H26	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_dom,superfamily_Znf_FYVE_PHD,smart_Methyl_CpG_DNA-bd,smart_AT_hook_DNA-bd_motif,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.A1772	ENST00000551812.1	37	c.5316	CCDS44924.1	12																																																																																			-	superfamily_Bromodomain		0.597	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	protein_coding	OTTHUMT00000408561.1	T	NM_013449	-		56993005	-1	no_errors	ENST00000551812	ensembl	human	known	74_37	silent	SNP	0.000	G
ATP5O	539	genome.wustl.edu	37	21	35284619	35284619	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr21:35284619C>A	ENST00000290299.2	-	3	388	c.172G>T	c.(172-174)Gta>Tta	p.V58L	ATP5O_ENST00000496044.1_5'Flank|AP000304.12_ENST00000429238.1_Missense_Mutation_p.S6I	NM_001697.2	NP_001688.1	P48047	ATPO_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit	58					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|transmembrane transporter activity (GO:0022857)|transporter activity (GO:0005215)			large_intestine(2)|lung(1)|ovary(1)|urinary_tract(1)	5						TCCTTTTCTACTTGCTCCAGC	0.383																																																	0								ENSG00000241837						110.0	101.0	104.0					21																	35284619		2203	4300	6503	ATP5O	SO:0001583	missense	0			-	HGNC	AF088071	CCDS13634.1	21q22	2012-10-12	2008-07-31		ENSG00000241837	ENSG00000241837	3.6.3.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	850	protein-coding gene	gene with protein product	"""oligomycin sensitivity conferring protein"""	600828				7490082	Standard	NM_001697		Approved	OSCP, ATPO		P48047	OTTHUMG00000065186	ENST00000290299.2:c.172G>T	21.37:g.35284619C>A	ENSP00000290299:p.Val58Leu	Somatic	0	76	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	45	35.71	B2R4E2|Q5U042|Q6IBI2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_F1-cplx_OSCP/dsu,superfamily_ATPase_OSCP/delta_N,prints_ATPase_F1-cplx_OSCP/dsu,tigrfam_ATPase_F1-cplx_OSCP/dsu	p.V58L	ENST00000290299.2	37	c.172	CCDS13634.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	29.2|29.2	4.987220|4.987220	0.93106|0.93106	.|.	.|.	ENSG00000249209|ENSG00000241837	ENST00000429238|ENST00000290299	.|T	.|0.48836	.|0.8	5.62|5.62	4.74|4.74	0.60224|0.60224	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71467|0.71467	0.3343|0.3343	M|M	0.85945|0.85945	2.785|2.785	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.91635	.|0.999	T|T	0.77453|0.77453	-0.2582|-0.2582	5|10	.|0.87932	.|D	.|0	-16.0137|-16.0137	14.4701|14.4701	0.67512|0.67512	0.0:0.9285:0.0:0.0715|0.0:0.9285:0.0:0.0715	.|.	.|58	.|P48047	.|ATPO_HUMAN	I|L	6|58	.|ENSP00000290299:V58L	.|ENSP00000290299:V58L	S|V	-|-	2|1	0|0	AP000304.12|ATP5O	34206489|34206489	1.000000|1.000000	0.71417|0.71417	0.957000|0.957000	0.39632|0.39632	0.983000|0.983000	0.72400|0.72400	4.595000|4.595000	0.61048|0.61048	1.521000|1.521000	0.48983|0.48983	0.557000|0.557000	0.71058|0.71058	AGT|GTA	-	pfam_ATPase_F1-cplx_OSCP/dsu,superfamily_ATPase_OSCP/delta_N,tigrfam_ATPase_F1-cplx_OSCP/dsu		0.383	ATP5O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5O	protein_coding	OTTHUMT00000139907.1	C	NM_001697	-		35284619	-1	no_errors	ENST00000290299	ensembl	human	known	74_37	missense	SNP	1.000	A
DZIP3	9666	genome.wustl.edu	37	3	108361310	108361310	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr3:108361310A>G	ENST00000361582.3	+	13	1320	c.1090A>G	c.(1090-1092)Ata>Gta	p.I364V	DZIP3_ENST00000463306.1_Missense_Mutation_p.I364V	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	364					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						ATCTCTGAAAATAACTGATAC	0.244																																																	0								ENSG00000198919						20.0	20.0	20.0					3																	108361310		2114	4123	6237	DZIP3	SO:0001583	missense	0			-	HGNC	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.1090A>G	3.37:g.108361310A>G	ENSP00000355028:p.Ile364Val	Somatic	0	59	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	31	46.67	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I364V	ENST00000361582.3	37	c.1090	CCDS2952.1	3	.	.	.	.	.	.	.	.	.	.	A	9.077	0.998351	0.19121	.	.	ENSG00000198919	ENST00000361582;ENST00000479138;ENST00000463306	T;T;T	0.38887	1.11;1.11;1.11	4.93	1.27	0.21489	.	0.848979	0.10231	N	0.699677	T	0.22085	0.0532	N	0.19112	0.55	0.19945	N	0.999944	B;B	0.11235	0.003;0.004	B;B	0.10450	0.005;0.004	T	0.22695	-1.0209	10	0.23891	T	0.37	-0.9959	1.4543	0.02382	0.5407:0.1852:0.0966:0.1776	.	364;364	C9J9M8;Q86Y13	.;DZIP3_HUMAN	V	364	ENSP00000355028:I364V;ENSP00000418115:I364V;ENSP00000419981:I364V	ENSP00000355028:I364V	I	+	1	0	DZIP3	109844000	0.928000	0.31464	0.723000	0.30687	0.978000	0.69477	0.337000	0.19841	0.432000	0.26286	0.533000	0.62120	ATA	-	NULL		0.244	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP3	protein_coding	OTTHUMT00000353968.1	A	NM_014648	-		108361310	+1	no_errors	ENST00000361582	ensembl	human	known	74_37	missense	SNP	0.597	G
SPAG11B	10407	genome.wustl.edu	37	8	7320316	7320316	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr8:7320316C>A	ENST00000297498.2	-	2	293	c.127G>T	c.(127-129)Gcc>Tcc	p.A43S	SPAG11B_ENST00000398462.2_Missense_Mutation_p.A43S|SPAG11B_ENST00000317900.5_Missense_Mutation_p.A43S|SPAG11B_ENST00000361111.2_Missense_Mutation_p.A43S|SPAG11B_ENST00000359758.5_Missense_Mutation_p.A43S	NM_016512.3	NP_057596.1	Q08648	SG11B_HUMAN	sperm associated antigen 11B	43					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				large_intestine(2)|lung(3)|urinary_tract(1)	6				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)		TGCCCAGGGGCTCTTTCCCTG	0.577																																																	0								ENSG00000164871						14.0	19.0	17.0					8																	7320316		2142	4164	6306	SPAG11B	SO:0001583	missense	0			-	HGNC	AF168616	CCDS5964.1, CCDS5965.1, CCDS5966.1, CCDS5967.1, CCDS47774.1	8p23.1	2014-02-21	2007-03-15	2007-03-15	ENSG00000164871	ENSG00000164871			14534	protein-coding gene	gene with protein product	"""epididymal protein 2B"""	606560				8167223, 1693137	Standard	NM_058200		Approved	HE2, EP2, EP2C, EP2D, EDDM2B	uc003wrl.3	Q08648	OTTHUMG00000129219	ENST00000297498.2:c.127G>T	8.37:g.7320316C>A	ENSP00000297498:p.Ala43Ser	Somatic	0	86	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	85	18.27	E9PFH0|Q546A0|Q6ZYB2|Q9H4P8|Q9H4P9|Q9H4Q0|Q9H4Q1|Q9H4Q2|Q9NRT3|Q9NRV4|Q9NRV5|Q9NRV6|Q9NRV7|Q9NRV8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sperm_Ag_HE2,pfam_Defensin_beta-typ	p.A43S	ENST00000297498.2	37	c.127	CCDS5966.1	8	.	.	.	.	.	.	.	.	.	.	C	9.492	1.100892	0.20552	.	.	ENSG00000164871	ENST00000528943;ENST00000359758;ENST00000361111;ENST00000297498;ENST00000398462;ENST00000317900	T;T;T	0.47528	1.42;0.84;1.44	2.59	-1.37	0.09056	.	.	.	.	.	T	0.41305	0.1153	N	0.13098	0.295	0.09310	N	1	B;B;D;D;D	0.76494	0.003;0.004;0.992;0.99;0.999	B;B;D;D;D	0.83275	0.004;0.012;0.983;0.971;0.996	T	0.33523	-0.9865	9	0.19590	T	0.45	.	4.1753	0.10349	0.3852:0.4725:0.1423:0.0	.	43;43;43;43;43	Q08648-3;A8MZA0;Q08648;Q6PDA7-3;E9PAK7	.;.;SG11B_HUMAN;.;.	S	26;43;43;43;43;43	ENSP00000437154:A26S;ENSP00000354411:A43S;ENSP00000297498:A43S	ENSP00000297498:A43S	A	-	1	0	SPAG11B	7307726	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.160000	0.03147	-0.288000	0.09051	-0.534000	0.04291	GCC	-	pfam_Sperm_Ag_HE2		0.577	SPAG11B-003	KNOWN	basic|CCDS	protein_coding	SPAG11B	protein_coding	OTTHUMT00000251390.2	C	NM_058202, NM_058200, NM_058201, NM_016512, NM_058203, NM_058206, NM_058207	-		7320316	-1	no_errors	ENST00000398462	ensembl	human	known	74_37	missense	SNP	0.000	A
DCAF12L1	139170	genome.wustl.edu	37	X	125686013	125686013	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chrX:125686013G>T	ENST00000371126.1	-	1	821	c.579C>A	c.(577-579)caC>caA	p.H193Q		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	193										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						TCCAGTCCTTGTGGCCATGGC	0.677																																																	0								ENSG00000198889						35.0	38.0	37.0					X																	125686013		2203	4299	6502	DCAF12L1	SO:0001583	missense	0			-	HGNC	BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.579C>A	X.37:g.125686013G>T	ENSP00000360167:p.His193Gln	Somatic	0	238	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	92	101	47.67	Q8IYK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H193Q	ENST00000371126.1	37	c.579	CCDS14610.1	X	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676401	0.67928	.	.	ENSG00000198889	ENST00000371126	T	0.81415	-1.49	3.89	2.99	0.34606	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.34802	N	0.003667	D	0.89574	0.6754	M	0.88105	2.93	0.38862	D	0.956517	D	0.89917	1.0	D	0.91635	0.999	D	0.90525	0.4491	10	0.87932	D	0	.	9.903	0.41359	0.0:0.0:0.795:0.205	.	193	Q5VU92	DC121_HUMAN	Q	193	ENSP00000360167:H193Q	ENSP00000360167:H193Q	H	-	3	2	DCAF12L1	125513694	1.000000	0.71417	0.042000	0.18584	0.986000	0.74619	2.984000	0.49353	0.976000	0.38417	0.429000	0.28392	CAC	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.677	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	protein_coding	OTTHUMT00000058186.1	G	NM_178470	-		125686013	-1	no_errors	ENST00000371126	ensembl	human	known	74_37	missense	SNP	0.994	T
RPL11	6135	genome.wustl.edu	37	1	24018316	24018331	+	Start_Codon_Del	DEL	GGCGGTGAGTAGCTGG	GGCGGTGAGTAGCTGG	-	rs201469553		TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	GGCGGTGAGTAGCTGG	GGCGGTGAGTAGCTGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr1:24018316_24018331delGGCGGTGAGTAGCTGG	ENST00000374550.3	+	0	48_51					NM_000975.3|NM_001199802.1	NP_000966.2|NP_001186731.1	P62913	RL11_HUMAN	ribosomal protein L11						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein localization to nucleus (GO:0034504)|protein targeting (GO:0006605)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.13e-24)|Colorectal(126;5.06e-08)|COAD - Colon adenocarcinoma(152;2.92e-06)|GBM - Glioblastoma multiforme(114;4.4e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|KIRC - Kidney renal clear cell carcinoma(1967;0.00322)|STAD - Stomach adenocarcinoma(196;0.0124)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0837)|LUSC - Lung squamous cell carcinoma(448;0.185)		TCTCCATCATGGCGGTGAGTAGCTGGGACCTGGATT	0.616											OREG0013231	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0			GRCh37	CS086171	RPL11	S		ENSG00000142676																																			RPL11	SO:0001582	initiator_codon_variant	0				HGNC	L05092	CCDS238.1	1p36.1-p35	2011-04-06			ENSG00000142676	ENSG00000142676		"""L ribosomal proteins"""	10301	protein-coding gene	gene with protein product		604175				9582194, 10343117	Standard	NM_000975		Approved	L11	uc001bhk.3	P62913	OTTHUMG00000002926		1.37:g.24018316_24018331delGGCGGTGAGTAGCTGG		Somatic	NA	NA	NA	768	0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	P25121|P39026|Q8TDH2|Q9Y674	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L5,superfamily_Ribosomal_L5_domain,pirsf_Ribosomal_L5	p.M1fs	ENST00000374550.3	37	c.3_6	CCDS238.1	1																																																																																			-	pirsf_Ribosomal_L5		0.616	RPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL11	protein_coding	OTTHUMT00000008168.1	GGCGGTGAGTAGCTGG	NM_000975			24018331	+1	no_errors	ENST00000374550	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
GPRIN3	285513	genome.wustl.edu	37	4	90169766	90169766	+	Missense_Mutation	SNP	G	G	A	rs374437786		TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr4:90169766G>A	ENST00000609438.1	-	2	2014	c.1496C>T	c.(1495-1497)aCg>aTg	p.T499M	GPRIN3_ENST00000333209.4_Missense_Mutation_p.T499M	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	499										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		GCCGTTTGTCGTTTTCTCTGC	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		19497	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000185477	G	MET/THR	1,4405	2.1+/-5.4	0,1,2202	97.0	105.0	103.0		1496	1.5	0.0	4		103	0,8600		0,0,4300	no	missense	GPRIN3	NM_198281.2	81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	499/777	90169766	1,13005	2203	4300	6503	GPRIN3	SO:0001583	missense	0			-	HGNC	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.1496C>T	4.37:g.90169766G>A	ENSP00000476603:p.Thr499Met	Somatic	0	28	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	19	50.00	Q8IVE4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T499M	ENST00000609438.1	37	c.1496	CCDS34030.1	4	.	.	.	.	.	.	.	.	.	.	G	15.53	2.861345	0.51482	2.27E-4	0.0	ENSG00000185477	ENST00000333209	T	0.12879	2.64	5.23	1.51	0.23008	.	0.808429	0.10111	N	0.714779	T	0.17195	0.0413	L	0.27053	0.805	0.09310	N	1	D	0.76494	0.999	P	0.59288	0.855	T	0.20075	-1.0286	10	0.45353	T	0.12	-1.5604	5.65	0.17610	0.2194:0.265:0.5156:0.0	.	499	Q6ZVF9	GRIN3_HUMAN	M	499	ENSP00000328672:T499M	ENSP00000328672:T499M	T	-	2	0	GPRIN3	90388789	0.013000	0.17824	0.000000	0.03702	0.007000	0.05969	0.944000	0.29043	0.058000	0.16222	0.655000	0.94253	ACG	-	NULL		0.443	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN3	protein_coding	OTTHUMT00000363540.2	G	NM_198281	-		90169766	-1	no_errors	ENST00000333209	ensembl	human	known	74_37	missense	SNP	0.000	A
COL19A1	1310	genome.wustl.edu	37	6	70637883	70637883	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr6:70637883T>C	ENST00000322773.4	+	5	451	c.349T>C	c.(349-351)Tgg>Cgg	p.W117R		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	117	Laminin G-like.			FRVRRNAKKERWFL -> ETTVPFWRFFVLET (in Ref. 6; AAA36358). {ECO:0000305}.	cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						AAAGGAACGGTGGTTTCTGTG	0.423																																																	0								ENSG00000082293						115.0	116.0	115.0					6																	70637883		2203	4300	6503	COL19A1	SO:0001583	missense	0			-	HGNC		CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.349T>C	6.37:g.70637883T>C	ENSP00000316030:p.Trp117Arg	Somatic	1	102	0.97		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	91	8.82	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.W117R	ENST00000322773.4	37	c.349	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	T	13.90	2.376247	0.42105	.	.	ENSG00000082293	ENST00000322773	T	0.44083	0.93	5.71	5.71	0.89125	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.64402	D	0.000001	T	0.60919	0.2306	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.67829	-0.5569	10	0.87932	D	0	.	15.9886	0.80183	0.0:0.0:0.0:1.0	.	117	Q14993	COJA1_HUMAN	R	117	ENSP00000316030:W117R	ENSP00000316030:W117R	W	+	1	0	COL19A1	70694604	1.000000	0.71417	0.994000	0.49952	0.868000	0.49771	7.500000	0.81588	2.173000	0.68751	0.533000	0.62120	TGG	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.423	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	protein_coding	OTTHUMT00000041127.1	T		-		70637883	+1	no_errors	ENST00000322773	ensembl	human	known	74_37	missense	SNP	1.000	C
ADRM1	11047	genome.wustl.edu	37	20	60878005	60878005	+	5'Flank	SNP	C	C	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr20:60878005C>T	ENST00000253003.2	+	0	0				RP11-157P1.4_ENST00000414042.1_RNA	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1						positive regulation of endopeptidase activity (GO:0010950)|proteasome assembly (GO:0043248)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|protease binding (GO:0002020)|proteasome binding (GO:0070628)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|urinary_tract(1)	5	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			GAGCGGCAGGCGGGGCGGGCC	0.741																																																	0								ENSG00000130706																																			ADRM1	SO:0001631	upstream_gene_variant	0			-	HGNC	D64154	CCDS13496.1, CCDS74747.1	20q13.33	2008-05-22			ENSG00000130706	ENSG00000130706			15759	protein-coding gene	gene with protein product		610650				8033103	Standard	NM_007002		Approved	GP110, Rpn13, ARM1	uc002yco.3	Q16186	OTTHUMG00000032904		20.37:g.60878005C>T	Exception_encountered	Somatic	0	26	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	12	37.50	A0PKB1|Q96FJ7|Q9H1P2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000253003.2	37	NULL	CCDS13496.1	20																																																																																			-	-		0.741	ADRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRM1	protein_coding	OTTHUMT00000080007.1	C		-		60878005	+1	no_errors	ENST00000491935	ensembl	human	known	74_37	rna	SNP	0.016	T
CORO1B	57175	genome.wustl.edu	37	11	67209168	67209168	+	Intron	DEL	G	G	-	rs540646391	byFrequency	TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr11:67209168delG	ENST00000341356.5	-	4	565				CORO1B_ENST00000393893.1_Intron|CORO1B_ENST00000539724.1_5'Flank|CORO1B_ENST00000453768.2_Intron|CORO1B_ENST00000545016.1_Frame_Shift_Del_p.H164fs	NM_020441.2	NP_065174.1	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B						actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|endothelial cell chemotaxis (GO:0035767)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|positive regulation of lamellipodium morphogenesis (GO:2000394)|protein localization to cell leading edge (GO:1902463)|ruffle organization (GO:0031529)|wound healing (GO:0042060)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|identical protein binding (GO:0042802)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			AGGGGTCCGTGGGGGGGGGGA	0.657													|||unknown(HR)	9	0.00179712	0.0061	0.0014	5008	,	,		10135	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000172725		,	246,718,2802		22,17,185,55,591,1013					,	-0.5	0.0			7	285,1558,5707		17,8,243,90,1370,2047	no	intron,intron	CORO1B	NM_020441.2,NM_001018070.2	,	39,25,428,145,1961,3060	A1A1,A1A2,A1R,A2A2,A2R,RR		24.4106,25.5975,24.8056	,	,		531,2276,8509				CORO1B	SO:0001627	intron_variant	0				HGNC	AK000860	CCDS8164.1	11q13.1	2013-01-10	2001-11-28		ENSG00000172725	ENSG00000172725		"""Coronins"", ""WD repeat domain containing"""	2253	protein-coding gene	gene with protein product		609849	"""coronin, actin-binding protein, 1B"""			9778037	Standard	NM_001018070		Approved	coronin-2	uc001olk.1	Q9BR76	OTTHUMG00000167775	ENST00000341356.5:c.454+35C>-	11.37:g.67209168delG		Somatic	0	43	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B2RD45	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF1899,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H164fs	ENST00000341356.5	37	c.490	CCDS8164.1	11																																																																																			-	NULL		0.657	CORO1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO1B	protein_coding	OTTHUMT00000396220.1	G	NM_020441			67209168	-1	no_errors	ENST00000545016	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
CCDC129	223075	genome.wustl.edu	37	7	31683280	31683280	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr7:31683280G>T	ENST00000407970.3	+	11	2334	c.2296G>T	c.(2296-2298)Gct>Tct	p.A766S	CCDC129_ENST00000409210.1_Missense_Mutation_p.A674S|CCDC129_ENST00000319386.3_Missense_Mutation_p.A618S|CCDC129_ENST00000451887.2_Missense_Mutation_p.A792S	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	766										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						TCAGACTTCAGCTCTAAGCAA	0.483																																																	0								ENSG00000180347						108.0	96.0	100.0					7																	31683280		2203	4300	6503	CCDC129	SO:0001583	missense	0			-	HGNC	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2296G>T	7.37:g.31683280G>T	ENSP00000384416:p.Ala766Ser	Somatic	0	46	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A792S	ENST00000407970.3	37	c.2374	CCDS5435.2	7	.	.	.	.	.	.	.	.	.	.	G	12.33	1.905639	0.33628	.	.	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T	0.20463	2.07;2.34;2.34;2.08	5.25	1.03	0.20045	.	1.697860	0.02988	N	0.146511	T	0.14184	0.0343	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.17465	0.022;0.008;0.008;0.004	B;B;B;B	0.18263	0.021;0.021;0.021;0.011	T	0.23368	-1.0190	10	0.37606	T	0.19	-11.1102	3.9479	0.09356	0.1904:0.0:0.4257:0.3838	.	792;776;766;618	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	S	618;766;792;776;674	ENSP00000313062:A618S;ENSP00000384416:A766S;ENSP00000395835:A792S;ENSP00000387214:A674S	ENSP00000313062:A618S	A	+	1	0	CCDC129	31649805	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	0.138000	0.16016	0.539000	0.28788	0.655000	0.94253	GCT	-	NULL		0.483	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC129	protein_coding	OTTHUMT00000318975.1	G	NM_194300	-		31683280	+1	no_errors	ENST00000451887	ensembl	human	known	74_37	missense	SNP	0.000	T
PDE3B	5140	genome.wustl.edu	37	11	14891131	14891131	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr11:14891131A>T	ENST00000282096.4	+	16	3617	c.3264A>T	c.(3262-3264)aaA>aaT	p.K1088N	PDE3B_ENST00000455098.2_Missense_Mutation_p.K1037N	NM_000922.3	NP_000913.2	Q13370	PDE3B_HUMAN	phosphodiesterase 3B, cGMP-inhibited	1088					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of lipid catabolic process (GO:0050995)|regulation of insulin secretion (GO:0050796)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)|protein kinase B binding (GO:0043422)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39					Caffeine(DB00201)	ATGGGAATAAACTGCAGGTGG	0.408																																																	0								ENSG00000152270						113.0	114.0	113.0					11																	14891131		2200	4294	6494	PDE3B	SO:0001583	missense	0			-	HGNC	U38178	CCDS7817.1	11p15.2	2008-03-18			ENSG00000152270	ENSG00000152270	3.1.4.17	"""Phosphodiesterases"""	8779	protein-coding gene	gene with protein product		602047				8884271, 16395595	Standard	NM_000922		Approved	HcGIP1	uc001mln.3	Q13370	OTTHUMG00000165898	ENST00000282096.4:c.3264A>T	11.37:g.14891131A>T	ENSP00000282096:p.Lys1088Asn	Somatic	0	70	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	36	41.94	B7ZM37|O00639|Q14408|Q6SEI4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.K1088N	ENST00000282096.4	37	c.3264	CCDS7817.1	11	.	.	.	.	.	.	.	.	.	.	A	18.88	3.716544	0.68844	.	.	ENSG00000152270	ENST00000282096;ENST00000455098	T;T	0.63913	-0.07;-0.05	6.03	0.695	0.18070	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	2.879540	0.00616	N	0.000437	T	0.72145	0.3424	L	0.46157	1.445	0.39730	D	0.971595	D;D	0.69078	0.997;0.997	P;P	0.60789	0.879;0.84	T	0.59461	-0.7450	10	0.48119	T	0.1	.	10.6001	0.45362	0.6561:0.0:0.3439:0.0	.	1037;1088	B7ZM37;Q13370	.;PDE3B_HUMAN	N	1088;1037	ENSP00000282096:K1088N;ENSP00000388644:K1037N	ENSP00000282096:K1088N	K	+	3	2	PDE3B	14847707	1.000000	0.71417	0.998000	0.56505	0.815000	0.46073	1.510000	0.35790	0.175000	0.19841	-0.385000	0.06624	AAA	-	NULL		0.408	PDE3B-001	KNOWN	basic|CCDS	protein_coding	PDE3B	protein_coding	OTTHUMT00000386974.1	A	NM_000922	-		14891131	+1	no_errors	ENST00000282096	ensembl	human	known	74_37	missense	SNP	0.998	T
CUL4B	8450	genome.wustl.edu	37	X	119681082	119681082	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chrX:119681082G>T	ENST00000404115.3	-	5	1140	c.739C>A	c.(739-741)Ctc>Atc	p.L247I	CUL4B_ENST00000336592.6_Missense_Mutation_p.L234I|CUL4B_ENST00000371322.5_Missense_Mutation_p.L229I|snoU13_ENST00000605987.1_RNA	NM_003588.3	NP_003579.3	Q13620	CUL4B_HUMAN	cullin 4B	247					cell cycle (GO:0007049)|histone H2A monoubiquitination (GO:0035518)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of protein catabolic process (GO:0045732)|ubiquitin-dependent protein catabolic process (GO:0006511)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TAAGAACAGAGATTTTCTACA	0.338																																																	0								ENSG00000158290						76.0	67.0	70.0					X																	119681082		2203	4300	6503	CUL4B	SO:0001583	missense	0			-	HGNC	U58091	CCDS35379.1, CCDS43987.1	Xq23	2011-05-24			ENSG00000158290	ENSG00000158290			2555	protein-coding gene	gene with protein product		300304				8681378	Standard	NM_003588		Approved		uc004esw.3	Q13620	OTTHUMG00000022302	ENST00000404115.3:c.739C>A	X.37:g.119681082G>T	ENSP00000384109:p.Leu247Ile	Somatic	0	45	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B1APK5|B3KVX4|B7Z5K8|Q6PIE4|Q6UP07|Q7Z673|Q9BY37|Q9UEB7|Q9UED7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.L247I	ENST00000404115.3	37	c.739	CCDS35379.1	X	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359709	0.82353	.	.	ENSG00000158290	ENST00000371322;ENST00000336592;ENST00000404115;ENST00000371323	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	6.07	6.07	0.98685	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.117044	0.56097	D	0.000024	T	0.77598	0.4154	L	0.41632	1.29	0.80722	D	1	D;P	0.53151	0.958;0.948	P;P	0.61328	0.887;0.819	T	0.74799	-0.3542	9	.	.	.	-6.7012	18.371	0.90407	0.0:0.0:1.0:0.0	.	247;229	Q13620;Q13620-1	CUL4B_HUMAN;.	I	229;234;247;51	ENSP00000360373:L229I;ENSP00000338919:L234I;ENSP00000384109:L247I;ENSP00000360374:L51I	.	L	-	1	0	CUL4B	119565110	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.984000	0.88150	2.565000	0.86533	0.600000	0.82982	CTC	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom		0.338	CUL4B-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	CUL4B	protein_coding	OTTHUMT00000058103.1	G	NM_003588	-		119681082	-1	no_errors	ENST00000404115	ensembl	human	known	74_37	missense	SNP	1.000	T
SF3B1	23451	genome.wustl.edu	37	2	198266834	198266834	+	Missense_Mutation	SNP	T	T	C	rs559063155		TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr2:198266834T>C	ENST00000335508.6	-	15	2189	c.2098A>G	c.(2098-2100)Aaa>Gaa	p.K700E	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'UTR	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	700					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K700E(179)|p.Q699_K700del(2)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTCCGAACTTTCTGCTGCTCA	0.408			Mis		myelodysplastic syndrome								T|||	1	0.000199681	0.0	0.0	5008	,	,		17946	0.0		0.0	False		,,,				2504	0.001							Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	181	Substitution - Missense(179)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(153)|NS(20)|breast(5)|pancreas(2)|central_nervous_system(1)						ENSG00000115524																																			SF3B1	SO:0001583	missense	0			-	HGNC	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2098A>G	2.37:g.198266834T>C	ENSP00000335321:p.Lys700Glu	Somatic	0	31	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	20	39.39	E9PCH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SF3b_su1,superfamily_ARM-type_fold	p.K700E	ENST00000335508.6	37	c.2098	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.243295	0.95272	.	.	ENSG00000115524	ENST00000335508	T	0.63580	-0.05	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85609	0.5736	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89820	0.3988	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	700	O75533	SF3B1_HUMAN	E	700	ENSP00000335321:K700E	ENSP00000335321:K700E	K	-	1	0	SF3B1	197975079	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.555000	0.82223	2.304000	0.77564	0.528000	0.53228	AAA	-	superfamily_ARM-type_fold		0.408	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	protein_coding	OTTHUMT00000335245.2	T		-		198266834	-1	no_errors	ENST00000335508	ensembl	human	known	74_37	missense	SNP	1.000	C
TPTEP1	387590	genome.wustl.edu	37	22	17131536	17131537	+	lincRNA	INS	-	-	CTG	rs34452519|rs145731851	byFrequency	TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr22:17131536_17131537insCTG	ENST00000426585.1	+	0	2562_2563									transmembrane phosphatase with tensin homology pseudogene 1																		TGCCCACTCTTCTGGTCTCATG	0.54														912	0.182109	0.0265	0.0865	5008	,	,		18499	0.2569		0.2256	False		,,,				2504	0.3384																0								ENSG00000100181																																			TPTEP1			0				HGNC			22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17131537_17131539dupCTG		Somatic	0	18	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000426585.1	37	NULL		22																																																																																			-	-		0.540	TPTEP1-002	KNOWN	basic	lincRNA	TPTEP1	lincRNA	OTTHUMT00000280575.1	-	NR_001591			17131537	+1	no_errors	ENST00000426585	ensembl	human	known	74_37	rna	INS	0.999:0.999	CTG
TMEM255A	55026	genome.wustl.edu	37	X	119425116	119425116	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chrX:119425116G>A	ENST00000309720.5	-	4	467	c.344C>T	c.(343-345)gCc>gTc	p.A115V	TMEM255A_ENST00000371369.4_Missense_Mutation_p.A115V|TMEM255A_ENST00000440464.1_Missense_Mutation_p.A115V	NM_017938.3	NP_060408.3	Q5JRV8	T255A_HUMAN	transmembrane protein 255A	115						integral component of membrane (GO:0016021)											AATGTGTCTGGCAGCAAAGAC	0.443																																																	0								ENSG00000125355						81.0	59.0	67.0					X																	119425116		2203	4300	6503	TMEM255A	SO:0001583	missense	0			-	HGNC	BC047054	CCDS14597.1, CCDS43986.1, CCDS48157.1	Xq24	2012-11-30	2012-11-30	2012-11-30	ENSG00000125355	ENSG00000125355			26086	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member A"""	FAM70A		12477932	Standard	NM_017938		Approved	FLJ20716	uc004eso.4	Q5JRV8	OTTHUMG00000022298	ENST00000309720.5:c.344C>T	X.37:g.119425116G>A	ENSP00000310110:p.Ala115Val	Somatic	0	68	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	39	40.00	A8K0W9|B1APR4|B3KPI6|E9PAR3|Q86Y72|Q9NWN8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A115V	ENST00000309720.5	37	c.344	CCDS14597.1	X	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856889	0.91433	.	.	ENSG00000125355	ENST00000309720;ENST00000371369;ENST00000440464;ENST00000519908	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.73079	0.3541	M	0.62209	1.925	0.80722	D	1	D;D;D	0.89917	0.998;0.996;1.0	D;D;D	0.91635	0.994;0.986;0.999	T	0.74426	-0.3669	10	0.51188	T	0.08	-15.7364	15.2437	0.73490	0.0:0.0:1.0:0.0	.	115;115;115	E9PAR3;B1APR4;Q5JRV8	.;.;FA70A_HUMAN	V	115	ENSP00000310110:A115V;ENSP00000360420:A115V;ENSP00000405781:A115V;ENSP00000428013:A115V	ENSP00000310110:A115V	A	-	2	0	FAM70A	119309144	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.998000	0.93550	2.189000	0.69895	0.513000	0.50165	GCC	-	NULL		0.443	TMEM255A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM255A	protein_coding	OTTHUMT00000058091.1	G	NM_017938	-		119425116	-1	no_errors	ENST00000309720	ensembl	human	known	74_37	missense	SNP	1.000	A
MMGT1	93380	genome.wustl.edu	37	X	135047288	135047288	+	Silent	SNP	A	A	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chrX:135047288A>T	ENST00000305963.2	-	4	678	c.291T>A	c.(289-291)ggT>ggA	p.G97G	MMGT1_ENST00000433339.2_Silent_p.G162G	NM_173470.1	NP_775741.1	Q8N4V1	MMGT1_HUMAN	membrane magnesium transporter 1	97					magnesium ion transport (GO:0015693)	early endosome (GO:0005769)|ER membrane protein complex (GO:0072546)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)			cervix(1)|endometrium(1)|kidney(1)	3						AAAGTACTCGACCACGATGAT	0.358																																																	0								ENSG00000169446						184.0	169.0	174.0					X																	135047288		2203	4300	6503	MMGT1	SO:0001819	synonymous_variant	0			-	HGNC	AL157477	CCDS14653.1	Xq26.3	2012-05-23	2008-11-21	2008-11-21	ENSG00000169446	ENSG00000169446			28100	protein-coding gene	gene with protein product	"""ER membrane protein complex subunit 5"""		"""transmembrane protein 32"""	TMEM32		18057121, 22119785	Standard	NM_173470		Approved	EMC5	uc004ezi.1	Q8N4V1	OTTHUMG00000022499	ENST00000305963.2:c.291T>A	X.37:g.135047288A>T		Somatic	0	35	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	34	42.37	B2R625|B4DIY3|D3DWG7|Q5JPP7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Magnesium_transport	p.G162	ENST00000305963.2	37	c.486	CCDS14653.1	X																																																																																			-	pfam_Magnesium_transport		0.358	MMGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMGT1	protein_coding	OTTHUMT00000058453.3	A	NM_173470	-		135047288	-1	no_errors	ENST00000433339	ensembl	human	known	74_37	silent	SNP	1.000	T
NCOA1	8648	genome.wustl.edu	37	2	24985627	24985627	+	Silent	SNP	A	A	C			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr2:24985627A>C	ENST00000406961.1	+	22	4789	c.4137A>C	c.(4135-4137)acA>acC	p.T1379T	NCOA1_ENST00000405141.1_Silent_p.T1379T|NCOA1_ENST00000348332.3_Silent_p.T1379T|NCOA1_ENST00000407230.1_Silent_p.T1228T|NCOA1_ENST00000395856.3_Silent_p.T1379T|NCOA1_ENST00000538539.1_Silent_p.T1379T|NCOA1_ENST00000288599.5_Silent_p.T1379T			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	1379					androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCTCAAAACAGAAGCAGATG	0.423			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0								ENSG00000084676						140.0	148.0	145.0					2																	24985627		2203	4300	6503	NCOA1	SO:0001819	synonymous_variant	0			-	HGNC	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.4137A>C	2.37:g.24985627A>C		Somatic	0	42	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	34	48.48	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.T1379	ENST00000406961.1	37	c.4137	CCDS1712.1	2																																																																																			-	pirsf_Nuclear_rcpt_coactivator		0.423	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	protein_coding	OTTHUMT00000246852.3	A	NM_147223	-		24985627	+1	no_errors	ENST00000348332	ensembl	human	known	74_37	silent	SNP	1.000	C
YWHAE	7531	genome.wustl.edu	37	17	1265304	1265305	+	Splice_Site	INS	-	-	A	rs543499657|rs34985093	byFrequency	TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr17:1265304_1265305insA	ENST00000264335.8	-	3	532		c.e3-2		YWHAE_ENST00000575977.1_Intron|YWHAE_ENST00000571732.1_Splice_Site|YWHAE_ENST00000573026.1_Intron	NM_006761.4	NP_006752.1	P62258	1433E_HUMAN	tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cerebral cortex development (GO:0021987)|G2/M transition of mitotic cell cycle (GO:0000086)|hippo signaling (GO:0035329)|hippocampus development (GO:0021766)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|membrane organization (GO:0061024)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|mitotic cell cycle (GO:0000278)|negative regulation of peptidyl-serine dephosphorylation (GO:1902309)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein targeting (GO:0006605)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|substantia nigra development (GO:0021762)|viral process (GO:0016032)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|membrane (GO:0016020)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|ion channel binding (GO:0044325)|MHC class II protein complex binding (GO:0023026)|phosphoprotein binding (GO:0051219)|phosphoserine binding (GO:0050815)|poly(A) RNA binding (GO:0044822)|potassium channel regulator activity (GO:0015459)|protein heterodimerization activity (GO:0046982)			kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(18;0.203)	UCEC - Uterine corpus endometrioid carcinoma (25;0.0887)		AGTCTCAACCtaaaaaaaaaaa	0.322			T	"""FAM22a, FAM22B"""	edometrial stromal sarcoma		Miller-Dieker lissencephaly syndrome						|||unknown(HR)	578	0.115415	0.3669	0.0346	5008	,	,		19509	0.0188		0.0099	False		,,,				2504	0.0409							Dom	yes		17	17p13.3	7531	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide (14-3-3 epsilon)"""	yes	M	0								ENSG00000108953																																			YWHAE	SO:0001630	splice_region_variant	0				HGNC	U54778	CCDS11001.1	17p13.3	2013-12-03	2013-12-03		ENSG00000108953	ENSG00000108953			12851	protein-coding gene	gene with protein product	"""14-3-3 epsilon"""	605066	"""tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide"""			9371399	Standard	NM_006761		Approved	FLJ45465	uc002fsj.3	P62258	OTTHUMG00000134316	ENST00000264335.8:c.265-2->T	17.37:g.1265315_1265315dupA		Somatic	0	58	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B3KY71|D3DTH5|P29360|P42655|Q4VJB6|Q53XZ5|Q63631|Q7M4R4	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e3-2	ENST00000264335.8	37	c.265-3_265-2	CCDS11001.1	17																																																																																			-	-		0.322	YWHAE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YWHAE	protein_coding	OTTHUMT00000259354.3	-	NM_006761		Intron	1265305	-1	no_errors	ENST00000264335	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.895	A
CABP1	9478	genome.wustl.edu	37	12	121093654	121093655	+	Intron	DEL	GC	GC	-	rs55819450	byFrequency	TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr12:121093654_121093655delGC	ENST00000316803.3	+	2	788				CABP1_ENST00000453000.1_Frame_Shift_Del_p.C14fs|CABP1_ENST00000351200.2_Intron|CABP1_ENST00000288616.3_Intron	NM_001033677.1	NP_001028849.1	Q9NZU7	CABP1_HUMAN	calcium binding protein 1						negative regulation of catalytic activity (GO:0043086)|negative regulation of cell communication by electrical coupling (GO:0010651)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of voltage-gated calcium channel activity (GO:1901386)	cell junction (GO:0030054)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|enzyme inhibitor activity (GO:0004857)|nuclear localization sequence binding (GO:0008139)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					gtgtgtgtgtgcgcatgtgCCA	0.55																																																	0								ENSG00000157782																																			CABP1	SO:0001627	intron_variant	0				HGNC	AF169148	CCDS9204.1, CCDS9205.1, CCDS31913.1	12q24.31	2013-01-10	2007-03-12		ENSG00000157782	ENSG00000157782		"""EF-hand domain containing"""	1384	protein-coding gene	gene with protein product	"""calbrain"", ""caldendrin"""	605563				9920909, 10625670	Standard	NM_004276		Approved		uc001tyu.3	Q9NZU7	OTTHUMG00000156794	ENST00000316803.3:c.655-4026GC>-	12.37:g.121093656_121093657delGC		Somatic	0	50	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	88	12.87	O95663|Q8N6H5|Q9NZU8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.A15fs	ENST00000316803.3	37	c.41_42	CCDS31913.1	12																																																																																			-	NULL		0.550	CABP1-001	KNOWN	basic|CCDS	protein_coding	CABP1	protein_coding	OTTHUMT00000345822.1	GC	NM_001033677			121093655	+1	no_errors	ENST00000453000	ensembl	human	putative	74_37	frame_shift_del	DEL	0.000:0.000	-
EXOSC2	23404	genome.wustl.edu	37	9	133576449	133576449	+	Intron	SNP	C	C	T			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr9:133576449C>T	ENST00000372358.5	+	6	566				EXOSC2_ENST00000372352.3_Intron|EXOSC2_ENST00000546165.1_Intron|EXOSC2_ENST00000467138.1_3'UTR|EXOSC2_ENST00000372351.3_Intron			Q13868	EXOS2_HUMAN	exosome component 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|7S RNA binding (GO:0008312)			breast(1)|endometrium(1)|large_intestine(3)|ovary(1)	6		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(13;0.0588)		OV - Ovarian serous cystadenocarcinoma(145;0.000324)		GGCTGGCATCCCACAAACTGA	0.443											OREG0019548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(134;1683 1824 10118 27928 31640)												0								ENSG00000130713																																			EXOSC2	SO:0001627	intron_variant	0			-	HGNC	AK001916	CCDS6935.1, CCDS65160.1, CCDS65161.1	9q34	2008-02-05			ENSG00000130713	ENSG00000130713			17097	protein-coding gene	gene with protein product	"""homolog of yeast RRP4 (ribosomal RNA processing 4), 3' 5' exoribonuclease (RRP4)"""	602238				8600032, 1538749	Standard	XM_005272176		Approved	hRrp4p, Rrp4p, RRP4, p7	uc004bzu.2	Q13868	OTTHUMG00000020811	ENST00000372358.5:c.495+127C>T	9.37:g.133576449C>T		Somatic	0	19	0.00	1604	0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	14	33.33	A3KFL3|B4DKK6|Q9NUY4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372358.5	37	NULL	CCDS6935.1	9																																																																																			-	-		0.443	EXOSC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC2	protein_coding	OTTHUMT00000054673.1	C	NM_014285	-		133576449	+1	no_errors	ENST00000467138	ensembl	human	known	74_37	rna	SNP	0.000	T
PAFAH1B1	5048	genome.wustl.edu	37	17	2584923	2584923	+	Intron	DEL	T	T	-			TCGA-DX-AB2J-01A-11D-A387-09	TCGA-DX-AB2J-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	99dea98b-737e-44b4-a5fb-a73056d907f0	41d65688-6a36-465c-956a-66bfbb244ba2	g.chr17:2584923delT	ENST00000397195.5	+	11	1610				RN7SL608P_ENST00000492377.2_RNA|RP11-74E22.5_ENST00000610120.1_RNA|PAFAH1B1_ENST00000451360.2_Intron|PAFAH1B1_ENST00000572915.2_Intron	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)											endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						gcccggctaatttttttttta	0.438																																																	0								ENSG00000007168																																			PAFAH1B1	SO:0001627	intron_variant	0				HGNC	L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.1160-100T>-	17.37:g.2584923delT		Somatic	0	17	0.00		0.5193527823804491	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397195.5	37	NULL	CCDS32528.1	17																																																																																			-	-		0.438	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAFAH1B1	protein_coding	OTTHUMT00000437797.2	T	NM_000430			2584923	+1	no_errors	ENST00000574213	ensembl	human	putative	74_37	rna	DEL	0.125	-
