#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SERPINE3	647174	genome.wustl.edu	37	13	51918390	51918390	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr13:51918390delA	ENST00000521255.1	+	2	319	c.259delA	c.(259-261)aaafs	p.K87fs	SERPINE3_ENST00000400389.4_Frame_Shift_Del_p.K87fs|SERPINE3_ENST00000524365.1_Frame_Shift_Del_p.K87fs	NM_001101320.1	NP_001094790.1	A8MV23	SERP3_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3	87					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(2)	2						TTTCACAGACAAAAGGGTGAA	0.488																																																	0								ENSG00000253309						58.0	59.0	58.0					13																	51918390		2022	4183	6205	SERPINE3	SO:0001589	frameshift_variant	0				HGNC	AX772926	CCDS53870.1	13q14.3	2014-02-18			ENSG00000253309	ENSG00000253309		"""Serine (or cysteine) peptidase inhibitors"""	24774	protein-coding gene	gene with protein product						24172014	Standard	NM_001101320		Approved		uc001vfh.2	A8MV23	OTTHUMG00000016943	ENST00000521255.1:c.259delA	13.37:g.51918390delA	ENSP00000428316:p.Lys87fs	Somatic	0	18	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	B1V8P3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.R88fs	ENST00000521255.1	37	c.259	CCDS53870.1	13																																																																																			-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.488	SERPINE3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SERPINE3	protein_coding	OTTHUMT00000045021.2	A	NM_001101320			51918390	+1	no_errors	ENST00000521255	ensembl	human	known	74_37	frame_shift_del	DEL	0.396	-
TMEM40	55287	genome.wustl.edu	37	3	12790156	12790158	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr3:12790156_12790158delGAG	ENST00000314124.7	-	3	563_565	c.207_209delCTC	c.(205-210)tcctca>tca	p.69_70SS>S	TMEM40_ENST00000431022.2_In_Frame_Del_p.85_86SS>S|TMEM40_ENST00000435575.1_Intron|TMEM40_ENST00000435218.2_In_Frame_Del_p.69_70SS>S|TMEM40_ENST00000264728.8_In_Frame_Del_p.69_70SS>S	NM_001284406.1|NM_018306.2	NP_001271335.1|NP_060776.2	Q8WWA1	TMM40_HUMAN	transmembrane protein 40	69	Ser-rich.					integral component of membrane (GO:0016021)				breast(1)|large_intestine(3)|lung(5)|urinary_tract(1)	10						TGCTATACCTgaggaggaggagg	0.394																																																	0								ENSG00000088726																																			TMEM40	SO:0001651	inframe_deletion	0				HGNC	BC020658	CCDS2613.1, CCDS68347.1, CCDS68348.1	3p25.2	2005-01-10			ENSG00000088726	ENSG00000088726			25620	protein-coding gene	gene with protein product						12477932	Standard	NM_018306		Approved	FLJ11036	uc003bxg.1	Q8WWA1	OTTHUMG00000129801	ENST00000314124.7:c.207_209delCTC	3.37:g.12790165_12790167delGAG	ENSP00000322837:p.Ser70del	Somatic	0	48	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	C9JID5|Q8NAL4|Q9NUZ4	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.S86in_frame_del	ENST00000314124.7	37	c.257_255	CCDS2613.1	3																																																																																			-	NULL		0.394	TMEM40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM40	protein_coding	OTTHUMT00000252029.2	GAG	NM_018306			12790158	-1	no_errors	ENST00000431022	ensembl	human	known	74_37	in_frame_del	DEL	1.000:0.999:0.996	-
TENM2	57451	genome.wustl.edu	37	5	167297559	167297560	+	Intron	INS	-	-	AT	rs60172043|rs371549205		TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr5:167297559_167297560insAT	ENST00000518659.1	+	3	541				TENM2_ENST00000519204.1_Intron|TENM2_ENST00000520393.1_Intron|AC093304.1_ENST00000408814.1_RNA|TENM2_ENST00000520394.1_Intron|TENM2_ENST00000545108.1_Intron	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2						axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										aatgtgtatacatatatatata	0.252																																																	0								ENSG00000221741																																			AC093304.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.503-5431->AT	5.37:g.167297568_167297569dupAT		Somatic	0	41	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q9ULU2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000518659.1	37	NULL		5																																																																																			-	-		0.252	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ENSG00000221741	protein_coding	OTTHUMT00000376096.1	-	NM_001122679			167297560	-1	no_errors	ENST00000408814	ensembl	human	novel	74_37	rna	INS	0.001:0.001	AT
OR52L1	338751	genome.wustl.edu	37	11	6007450	6007450	+	Silent	SNP	G	G	A			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr11:6007450G>A	ENST00000332249.4	-	1	765	c.711C>T	c.(709-711)gcC>gcT	p.A237A		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGATGTGGGCATAGGAAA	0.512																																					Melanoma(121;653 1666 10547 22796 51255)												0								ENSG00000183313						151.0	146.0	148.0					11																	6007450		2064	4200	6264	OR52L1	SO:0001819	synonymous_variant	0			-	HGNC	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.711C>T	11.37:g.6007450G>A		Somatic	0	25	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	B2RPA6|Q6IFK9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A237	ENST00000332249.4	37	c.711	CCDS44529.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.512	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52L1	protein_coding	OTTHUMT00000383754.1	G	NM_001005173	-		6007450	-1	no_errors	ENST00000332249	ensembl	human	known	74_37	silent	SNP	0.044	A
WDFY3	23001	genome.wustl.edu	37	4	85674951	85674951	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr4:85674951delG	ENST00000295888.4	-	35	6045	c.5638delC	c.(5638-5640)cacfs	p.H1880fs	WDFY3_ENST00000322366.6_Frame_Shift_Del_p.H1880fs	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	1880					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GGCACGTTGTGATACAAATAT	0.498																																																	0								ENSG00000163625						131.0	114.0	120.0					4																	85674951		2203	4300	6503	WDFY3	SO:0001589	frameshift_variant	0				HGNC	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.5638delC	4.37:g.85674951delG	ENSP00000295888:p.His1880fs	Somatic	0	44	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H1880fs	ENST00000295888.4	37	c.5638	CCDS3609.1	4																																																																																			-	NULL		0.498	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	protein_coding	OTTHUMT00000252811.2	G	NM_014991			85674951	-1	no_errors	ENST00000295888	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
TUBB8	347688	genome.wustl.edu	37	10	93505	93505	+	Missense_Mutation	SNP	C	C	T	rs147114528	byFrequency	TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr10:93505C>T	ENST00000309812.4	-	4	889	c.827G>A	c.(826-828)cGg>cAg	p.R276Q	TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000413237.3_5'Flank|TUBB8_ENST00000447903.2_Missense_Mutation_p.R204Q	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	276					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R276Q(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		CTGGCTGCCCCGGCTGGTCAG	0.627																																					Pancreas(192;2041 3010 9013 18103)												1	Substitution - Missense(1)	NS(1)						ENSG00000173876						21.0	26.0	24.0					10																	93505		1645	3246	4891	TUBB8	SO:0001583	missense	0			-	HGNC	AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.827G>A	10.37:g.93505C>T	ENSP00000311042:p.Arg276Gln	Somatic	0	80	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	50	10.71	Q5SQX9|Q8WZ78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.R276Q	ENST00000309812.4	37	c.827	CCDS7051.1	10	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301072	0.23650	.	.	ENSG00000173876	ENST00000447903;ENST00000272035;ENST00000440680;ENST00000328974	T	0.80994	-1.44	.	.	.	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.094074	0.38326	N	0.001737	T	0.77046	0.4073	M	0.66560	2.04	0.28122	N	0.930544	B;P	0.44776	0.06;0.843	B;P	0.45167	0.009;0.472	T	0.71020	-0.4713	9	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	239;276	C9JAA5;Q3ZCM7	.;TBB8_HUMAN	Q	204;242;239;276	ENSP00000403895:R204Q	ENSP00000272035:R242Q	R	-	2	0	RP11-631M21.2	83505	0.994000	0.37717	0.219000	0.23793	0.222000	0.24845	3.707000	0.54838	0.119000	0.18210	0.121000	0.15741	CGG	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Alpha_tubulin		0.627	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	protein_coding	OTTHUMT00000467795.1	C	NM_177987	rs147114528		93505	-1	no_errors	ENST00000309812	ensembl	human	known	74_37	missense	SNP	1.000	T
BLK	640	genome.wustl.edu	37	8	11403586	11403586	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr8:11403586C>T	ENST00000259089.4	+	3	741	c.149C>T	c.(148-150)cCa>cTa	p.P50L	BLK_ENST00000529894.1_5'UTR	NM_001715.2	NP_001706.2	P51451	BLK_HUMAN	BLK proto-oncogene, Src family tyrosine kinase	50					B cell receptor signaling pathway (GO:0050853)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of insulin secretion (GO:0032024)	plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			endometrium(1)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(4)|stomach(1)	27			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		CTTACTCCTCCACCGCCCGAT	0.547																																																	0								ENSG00000136573						191.0	174.0	180.0					8																	11403586		2203	4300	6503	BLK	SO:0001583	missense	0			-	HGNC	BC004473	CCDS5982.1	8p23-p22	2014-06-25	2014-06-25		ENSG00000136573	ENSG00000136573		"""SH2 domain containing"""	1057	protein-coding gene	gene with protein product		191305	"""B lymphoid tyrosine kinase"""			7845672	Standard	NM_001715		Approved	MGC10442	uc003wty.3	P51451	OTTHUMG00000090729	ENST00000259089.4:c.149C>T	8.37:g.11403586C>T	ENSP00000259089:p.Pro50Leu	Somatic	0	52	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q16291|Q96IN1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.P50L	ENST00000259089.4	37	c.149	CCDS5982.1	8	.	.	.	.	.	.	.	.	.	.	C	8.477	0.858841	0.17178	.	.	ENSG00000136573	ENST00000259089;ENST00000427279	T	0.39406	1.08	4.6	3.73	0.42828	Src homology-3 domain (1);	0.776356	0.10885	N	0.623342	T	0.23926	0.0579	N	0.08118	0	0.25261	N	0.989594	B	0.02656	0.0	B	0.04013	0.001	T	0.15407	-1.0438	10	0.51188	T	0.08	.	8.4656	0.32953	0.0:0.8952:0.0:0.1048	.	50	P51451	BLK_HUMAN	L	50	ENSP00000259089:P50L	ENSP00000259089:P50L	P	+	2	0	BLK	11440995	0.002000	0.14202	0.034000	0.17996	0.122000	0.20287	1.258000	0.32944	1.164000	0.42652	0.555000	0.69702	CCA	-	superfamily_SH3_domain		0.547	BLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLK	protein_coding	OTTHUMT00000207460.1	C		-		11403586	+1	no_errors	ENST00000259089	ensembl	human	known	74_37	missense	SNP	0.056	T
NAT10	55226	genome.wustl.edu	37	11	34167679	34167679	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr11:34167679G>T	ENST00000257829.3	+	29	3224	c.3018G>T	c.(3016-3018)aaG>aaT	p.K1006N	NAT10_ENST00000532555.1_3'UTR|NAT10_ENST00000531159.2_Missense_Mutation_p.K934N|NAT10_ENST00000527971.1_Missense_Mutation_p.K269N	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	1006	Lys-rich.|Required for localization to the nucleolus and midbody.					membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				AACAGAGCAAGAAGTTGAAGA	0.363																																																	0								ENSG00000135372						100.0	110.0	107.0					11																	34167679		2202	4298	6500	NAT10	SO:0001583	missense	0			-	HGNC	AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.3018G>T	11.37:g.34167679G>T	ENSP00000257829:p.Lys1006Asn	Somatic	0	91	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	8.89	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase_dom,pfam_DUF1726,superfamily_Acyl_CoA_acyltransferase,superfamily_P-loop_NTPase,pfscan_GNAT_dom	p.K1006N	ENST00000257829.3	37	c.3018	CCDS7889.1	11	.	.	.	.	.	.	.	.	.	.	G	11.46	1.645849	0.29246	.	.	ENSG00000135372	ENST00000257829;ENST00000531159;ENST00000527971	T;T	0.32023	1.47;1.47	4.42	0.858	0.19030	.	0.177425	0.50627	D	0.000105	T	0.17280	0.0415	L	0.36672	1.1	0.24444	N	0.99452	P	0.35328	0.495	B	0.25987	0.065	T	0.11641	-1.0579	10	0.33940	T	0.23	-18.722	7.2941	0.26383	0.3416:0.0:0.6584:0.0	.	1006	Q9H0A0	NAT10_HUMAN	N	1006;934;269	ENSP00000257829:K1006N;ENSP00000433011:K934N	ENSP00000257829:K1006N	K	+	3	2	NAT10	34124255	1.000000	0.71417	0.998000	0.56505	0.895000	0.52256	0.420000	0.21263	0.082000	0.17018	-0.258000	0.10820	AAG	-	NULL		0.363	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT10	protein_coding	OTTHUMT00000388693.1	G	NM_024662	-		34167679	+1	no_errors	ENST00000257829	ensembl	human	known	74_37	missense	SNP	1.000	T
CACNA1E	777	genome.wustl.edu	37	1	181680102	181680103	+	Frame_Shift_Del	DEL	AG	AG	-	rs147596634		TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr1:181680102_181680103delAG	ENST00000367573.2	+	8	1068_1069	c.1068_1069delAG	c.(1066-1071)aaagagfs	p.E357fs	CACNA1E_ENST00000367567.4_5'UTR|CACNA1E_ENST00000367570.1_Frame_Shift_Del_p.E357fs|CACNA1E_ENST00000526775.1_Frame_Shift_Del_p.E357fs|CACNA1E_ENST00000357570.5_Frame_Shift_Del_p.E308fs|CACNA1E_ENST00000360108.3_Frame_Shift_Del_p.E357fs|CACNA1E_ENST00000358338.5_Frame_Shift_Del_p.E308fs	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	357					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AATTTGCCAAAGAGAGAGAGAG	0.51																																																	0								ENSG00000198216		,,	161,3503		41,79,1712					,,	5.3	1.0		dbSNP_134	61	297,7585		52,193,3696	yes	frameshift,frameshift,frameshift	CACNA1E	NM_001205294.1,NM_001205293.1,NM_000721.3	,,	93,272,5408	A1A1,A1R,RR		3.7681,4.3941,3.9667	,,	,,		458,11088				CACNA1E	SO:0001589	frameshift_variant	0				HGNC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1068_1069delAG	1.37:g.181680112_181680113delAG	ENSP00000356545:p.Glu357fs	Somatic	0	28	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.R360fs	ENST00000367573.2	37	c.1068_1069	CCDS55664.1	1																																																																																			-	prints_VDCCAlpha1		0.510	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	protein_coding	OTTHUMT00000090793.2	AG	NM_000721			181680103	+1	no_errors	ENST00000367573	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
PRKRIP1	79706	genome.wustl.edu	37	7	102065517	102065519	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr7:102065517_102065519delGAG	ENST00000496391.1	+	10	1824_1826	c.514_516delGAG	c.(514-516)gagdel	p.E176del	PRKRIP1_ENST00000397912.3_In_Frame_Del_p.E176del|PRKRIP1_ENST00000482465.1_3'UTR|PRKRIP1_ENST00000354783.4_In_Frame_Del_p.G116del|PRKRIP1_ENST00000462601.1_In_Frame_Del_p.E119del|RP11-514P8.2_ENST00000468165.1_RNA			Q9H875	PKRI1_HUMAN	PRKR interacting protein 1 (IL11 inducible)	176	Poly-Glu.				negative regulation of phosphorylation (GO:0042326)|negative regulation of protein kinase activity (GO:0006469)|renal system process (GO:0003014)	extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)			endometrium(1)|lung(4)|ovary(1)	6						ATCTGGAACAGAGGAGGAGGAGG	0.567																																																	0								ENSG00000128563																																			PRKRIP1	SO:0001651	inframe_deletion	0				HGNC	AK023964	CCDS34714.1	7q22.1	2013-01-09			ENSG00000128563	ENSG00000128563		"""Zinc fingers, C2H2-type"", ""-"""	21894	protein-coding gene	gene with protein product	"""likely ortholog of mouse C114 dsRNA-binding protein"", ""KRAB box domain containing 3"""					12679338	Standard	NM_024653		Approved	C114, FLJ13902, KRBOX3	uc003uzh.2	Q9H875	OTTHUMG00000157717	ENST00000496391.1:c.514_516delGAG	7.37:g.102065526_102065528delGAG	ENSP00000419270:p.Glu176del	Somatic	0	29	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	B4DGM2|Q8NDM6|Q96CF8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF1168	p.E175in_frame_del	ENST00000496391.1	37	c.514_516	CCDS34714.1	7																																																																																			-	pfam_DUF1168		0.567	PRKRIP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRKRIP1	protein_coding	OTTHUMT00000349489.1	GAG	NM_024653			102065519	+1	no_errors	ENST00000397912	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.998	-
GGT7	2686	genome.wustl.edu	37	20	33432915	33432916	+	3'UTR	INS	-	-	CACCAC	rs143837915|rs372075951|rs79530197|rs369783775		TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr20:33432915_33432916insCACCAC	ENST00000336431.5	-	0	2248_2249				GGT7_ENST00000469018.1_5'UTR	NM_178026.2	NP_821158.2	Q9UJ14	GGT7_HUMAN	gamma-glutamyltransferase 7						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			NS(2)|breast(1)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)	20						ATGCTGACACTcaccaccacca	0.564																																																	0								ENSG00000131067																																			GGT7	SO:0001624	3_prime_UTR_variant	0				HGNC	AL049709	CCDS13242.2	20q11.22	2008-11-24	2008-03-10	2008-03-10	ENSG00000131067	ENSG00000131067		"""Gamma-glutamyltransferases"""	4259	protein-coding gene	gene with protein product		612342	"""gamma-glutamyltransferase-like 3"""	GGTL5, GGTL3		8104871, 18357469	Standard	NM_178026		Approved	D20S101, dJ18C9.2	uc002xay.3	Q9UJ14	OTTHUMG00000032314	ENST00000336431.5:c.*216->GTGGTG	20.37:g.33432916_33432921dupCACCAC		Somatic	NA	NA	NA		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8N899|Q8NF66|Q9BYP5|Q9BYP6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000336431.5	37	NULL	CCDS13242.2	20																																																																																			-	-		0.564	GGT7-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	GGT7	protein_coding	OTTHUMT00000078816.2	-	NM_178026			33432916	-1	no_errors	ENST00000469018	ensembl	human	known	74_37	rna	INS	0.062:0.008	CACCAC
CCDC157	550631	genome.wustl.edu	37	22	30769639	30769639	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr22:30769639G>T	ENST00000405659.1	+	8	2098	c.1389G>T	c.(1387-1389)caG>caT	p.Q463H	RP1-130H16.16_ENST00000332468.4_RNA|CCDC157_ENST00000338306.3_Missense_Mutation_p.Q463H			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	463										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						GCCTGGACCAGGAACGTGAGG	0.672																																																	0								ENSG00000187860						17.0	17.0	17.0					22																	30769639		2192	4277	6469	CCDC157	SO:0001583	missense	0			-	HGNC	BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.1389G>T	22.37:g.30769639G>T	ENSP00000385357:p.Gln463His	Somatic	0	46	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q0VD76|Q9BYA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin,superfamily_t-SNARE	p.Q463H	ENST00000405659.1	37	c.1389	CCDS33632.2	22	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531534	0.64972	.	.	ENSG00000187860	ENST00000405659;ENST00000338306	T;T	0.39056	1.1;1.1	4.49	2.29	0.28610	.	0.059605	0.64402	D	0.000002	T	0.57695	0.2071	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.61431	-0.7064	10	0.72032	D	0.01	-21.7751	11.374	0.49717	0.1663:0.0:0.8337:0.0	.	463	Q569K6	CC157_HUMAN	H	463	ENSP00000385357:Q463H;ENSP00000343087:Q463H	ENSP00000343087:Q463H	Q	+	3	2	CCDC157	29099639	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	2.330000	0.43885	1.112000	0.41740	0.561000	0.74099	CAG	-	NULL		0.672	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC157	protein_coding	OTTHUMT00000320936.1	G	NM_001017437	-		30769639	+1	no_errors	ENST00000338306	ensembl	human	known	74_37	missense	SNP	1.000	T
TCF12	6938	genome.wustl.edu	37	15	57258577	57258577	+	Intron	SNP	C	C	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr15:57258577C>T	ENST00000267811.5	+	3	452				AC010999.1_ENST00000410654.1_RNA|TCF12_ENST00000452095.2_Intron|TCF12_ENST00000438423.2_Intron|TCF12_ENST00000333725.5_Intron|TCF12_ENST00000557843.1_Intron	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12						immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		gttacttttgcaccaacctaa	0.363			T	TEC	extraskeletal myxoid chondrosarcoma																																			Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0								ENSG00000222586																																			AC010999.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.148+45281C>T	15.37:g.57258577C>T		Somatic	0	29	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q7Z3D9|Q86TC1|Q86VM2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000267811.5	37	NULL	CCDS10159.1	15																																																																																			-	-		0.363	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000222586	protein_coding	OTTHUMT00000255069.3	C	NM_003205	-		57258577	-1	no_errors	ENST00000410654	ensembl	human	novel	74_37	rna	SNP	0.001	T
C7	730	genome.wustl.edu	37	5	40958329	40958329	+	Silent	SNP	G	G	A			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr5:40958329G>A	ENST00000313164.9	+	11	1814	c.1455G>A	c.(1453-1455)gcG>gcA	p.A485A		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	485	EGF-like.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				TTGGTGCGGCGTGTGAGCAAG	0.512																																																	0								ENSG00000112936						118.0	118.0	118.0					5																	40958329		2031	4181	6212	C7	SO:0001819	synonymous_variant	0			-	HGNC	J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1455G>A	5.37:g.40958329G>A		Somatic	0	56	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q6P3T5|Q92489	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Sushi_SCR_CCP,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.A485	ENST00000313164.9	37	c.1455	CCDS47201.1	5																																																																																			-	NULL		0.512	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	protein_coding	OTTHUMT00000317680.1	G		-		40958329	+1	no_errors	ENST00000313164	ensembl	human	known	74_37	silent	SNP	0.005	A
WDR66	144406	genome.wustl.edu	37	12	122359385	122359385	+	Frame_Shift_Del	DEL	C	C	-	rs370060195		TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr12:122359385delC	ENST00000288912.4	+	2	1028	c.174delC	c.(172-174)ggcfs	p.G58fs	WDR66_ENST00000397454.2_Frame_Shift_Del_p.G58fs	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	58	Glu-rich.						calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		ggaaaacgggcgaggaggaag	0.463																																					Esophageal Squamous(85;849 1794 49757 52143)												0								ENSG00000158023						44.0	45.0	45.0					12																	122359385		1915	4116	6031	WDR66	SO:0001589	frameshift_variant	0				HGNC	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.174delC	12.37:g.122359385delC	ENSP00000288912:p.Gly58fs	Somatic	0	26	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E59fs	ENST00000288912.4	37	c.174	CCDS41853.1	12																																																																																			-	NULL		0.463	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	protein_coding	OTTHUMT00000401700.1	C	NM_144668			122359385	+1	no_errors	ENST00000288912	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
GUSB	2990	genome.wustl.edu	37	7	65445284	65445284	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr7:65445284G>A	ENST00000304895.4	-	2	453	c.323C>T	c.(322-324)cCg>cTg	p.P108L	GUSB_ENST00000421103.1_Missense_Mutation_p.P108L|GUSB_ENST00000345660.6_Missense_Mutation_p.P108L|GUSB_ENST00000476486.1_5'UTR	NM_000181.3	NP_000172.2	P08236	BGLR_HUMAN	glucuronidase, beta	108					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-glucuronidase activity (GO:0004566)			breast(1)|cervix(2)|kidney(2)|large_intestine(4)|lung(10)|skin(1)	20						CCATCGCTCCGGCAGGATCAC	0.617																																																	0								ENSG00000169919						70.0	52.0	58.0					7																	65445284		2203	4300	6503	GUSB	SO:0001583	missense	0			-	HGNC	M15182	CCDS5530.1, CCDS64665.1	7q11.21	2012-10-02			ENSG00000169919	ENSG00000169919	3.2.1.31		4696	protein-coding gene	gene with protein product		611499				3468507	Standard	NM_000181		Approved		uc003tun.3	P08236	OTTHUMG00000023735	ENST00000304895.4:c.323C>T	7.37:g.65445284G>A	ENSP00000302728:p.Pro108Leu	Somatic	0	73	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B4E1F6|E9PCV0|Q549U0|Q96CL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_2_TIM,pfam_Glyco_hydro_2_N,pfam_Glyco_hydro_2_Ig-like,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,superfamily_Glyco_hydro_2_Ig-like,prints_Glyco_hydro_2	p.P108L	ENST00000304895.4	37	c.323	CCDS5530.1	7	.	.	.	.	.	.	.	.	.	.	G	18.29	3.590412	0.66219	.	.	ENSG00000169919	ENST00000304895;ENST00000421103;ENST00000345660	D;D;D	0.96522	-4.04;-4.04;-4.04	5.22	5.22	0.72569	Galactose-binding domain-like (1);Glycoside hydrolase, family 2, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98015	0.9346	M	0.77712	2.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98994	1.0809	10	0.87932	D	0	.	17.7876	0.88542	0.0:0.0:1.0:0.0	.	108;108	E9PCV0;P08236	.;BGLR_HUMAN	L	108	ENSP00000302728:P108L;ENSP00000391390:P108L;ENSP00000340734:P108L	ENSP00000302728:P108L	P	-	2	0	GUSB	65082719	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	9.134000	0.94467	2.451000	0.82905	0.561000	0.74099	CCG	-	pfam_Glyco_hydro_2_N,superfamily_Galactose-bd-like		0.617	GUSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUSB	protein_coding	OTTHUMT00000251637.3	G	NM_000181	-		65445284	-1	no_errors	ENST00000304895	ensembl	human	known	74_37	missense	SNP	1.000	A
TRABD	80305	genome.wustl.edu	37	22	50635954	50635954	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr22:50635954C>T	ENST00000303434.4	+	7	727	c.608C>T	c.(607-609)gCg>gTg	p.A203V	TRABD_ENST00000395827.1_Missense_Mutation_p.A203V|TRABD_ENST00000380909.4_Missense_Mutation_p.A203V|RP3-402G11.26_ENST00000608025.1_RNA|TRABD_ENST00000395829.1_Missense_Mutation_p.A203V	NM_025204.2	NP_079480.2	Q9H4I3	TRABD_HUMAN	TraB domain containing	203										breast(1)|central_nervous_system(1)|large_intestine(1)|liver(2)|lung(1)|upper_aerodigestive_tract(1)	7		all_cancers(38;1.07e-07)|all_epithelial(38;9.6e-07)|all_lung(38;0.00141)|Breast(42;0.00387)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		LUAD - Lung adenocarcinoma(64;0.105)		GCCATCGCAGCGCTCTCCTTC	0.662																																																	0								ENSG00000170638						73.0	72.0	73.0					22																	50635954		2203	4300	6503	TRABD	SO:0001583	missense	0			-	HGNC	AL449244	CCDS14086.1	22q13.33	2006-07-06			ENSG00000170638	ENSG00000170638			28805	protein-coding gene	gene with protein product						12477932	Standard	NM_025204		Approved	PP2447	uc003bjs.1	Q9H4I3	OTTHUMG00000044644	ENST00000303434.4:c.608C>T	22.37:g.50635954C>T	ENSP00000305664:p.Ala203Val	Somatic	0	64	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q19CC5|Q96ED8|Q9H7N1|Q9UGX6|Q9UGX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pheromone_shutdown_TraB	p.A203V	ENST00000303434.4	37	c.608	CCDS14086.1	22	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965936	0.74131	.	.	ENSG00000170638	ENST00000380909;ENST00000303434;ENST00000395827;ENST00000395829	.	.	.	5.21	5.21	0.72293	.	0.051129	0.85682	D	0.000000	D	0.82747	0.5104	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	0.989;1.0	P;D	0.77004	0.862;0.989	T	0.82908	-0.0224	9	0.41790	T	0.15	-41.0883	18.7472	0.91797	0.0:1.0:0.0:0.0	.	157;203	Q9H4I3-2;Q9H4I3	.;TRABD_HUMAN	V	203	.	ENSP00000305664:A203V	A	+	2	0	TRABD	48978081	1.000000	0.71417	0.025000	0.17156	0.002000	0.02628	7.135000	0.77276	2.427000	0.82271	0.561000	0.74099	GCG	-	pfam_Pheromone_shutdown_TraB		0.662	TRABD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRABD	protein_coding	OTTHUMT00000316987.1	C	NM_025204	-		50635954	+1	no_errors	ENST00000303434	ensembl	human	known	74_37	missense	SNP	0.998	T
ZKSCAN8	7745	genome.wustl.edu	37	6	28121013	28121013	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr6:28121013G>T	ENST00000330236.6	+	6	1139	c.955G>T	c.(955-957)Gag>Tag	p.E319*	ZKSCAN8_ENST00000457389.2_Nonsense_Mutation_p.E319*	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	319					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TCCCACACAAGAGAGACGACA	0.517																																																	0								ENSG00000198315						98.0	97.0	97.0					6																	28121013		2203	4300	6503	ZKSCAN8	SO:0001587	stop_gained	0			-	HGNC		CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.955G>T	6.37:g.28121013G>T	ENSP00000332750:p.Glu319*	Somatic	0	43	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E319*	ENST00000330236.6	37	c.955	CCDS4645.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.001486	0.97189	.	.	ENSG00000198315	ENST00000330236;ENST00000457389	.	.	.	6.09	6.09	0.99107	.	0.000000	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	19.4664	0.94945	0.0:0.0:1.0:0.0	.	.	.	.	X	319	.	ENSP00000332750:E319X	E	+	1	0	ZNF192	28228992	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.357000	0.52277	2.899000	0.99337	0.655000	0.94253	GAG	-	NULL		0.517	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN8	protein_coding	OTTHUMT00000040178.2	G		-		28121013	+1	no_errors	ENST00000330236	ensembl	human	known	74_37	nonsense	SNP	1.000	T
CDK19	23097	genome.wustl.edu	37	6	110943300	110943300	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr6:110943300delT	ENST00000368911.3	-	11	1280	c.1101delA	c.(1099-1101)aaafs	p.K367fs	CDK19_ENST00000323817.3_Frame_Shift_Del_p.K307fs|CDK19_ENST00000413605.2_Frame_Shift_Del_p.K243fs	NM_015076.3	NP_055891.1	Q9BWU1	CDK19_HUMAN	cyclin-dependent kinase 19	367							ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)	22						CCTTGTCACCTTTTTCTTCAG	0.358																																																	0								ENSG00000155111						167.0	169.0	168.0					6																	110943300		2203	4300	6503	CDK19	SO:0001589	frameshift_variant	0				HGNC	AL122055	CCDS5085.1, CCDS75503.1	6q21	2011-10-25	2009-12-16	2009-12-16	ENSG00000155111	ENSG00000155111		"""Cyclin-dependent kinases"""	19338	protein-coding gene	gene with protein product		614720	"""cyclin-dependent kinase (CDC2-like) 11"", ""cell division cycle 2-like 6 (CDK8-like)"""	CDK11, CDC2L6		10470851, 19884882	Standard	XM_005266871		Approved	KIAA1028, bA346C16.3	uc003puh.1	Q9BWU1	OTTHUMG00000015365	ENST00000368911.3:c.1101delA	6.37:g.110943300delT	ENSP00000357907:p.Lys367fs	Somatic	0	33	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	Q5JQZ7|Q5JR00|Q8TC78|Q9UPX2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G368fs	ENST00000368911.3	37	c.1101	CCDS5085.1	6																																																																																			-	NULL		0.358	CDK19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK19	protein_coding	OTTHUMT00000041804.1	T	NM_015076			110943300	-1	no_errors	ENST00000368911	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SUZ12	23512	genome.wustl.edu	37	17	30264519	30264519	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr17:30264519delT	ENST00000322652.5	+	1	483	c.254delT	c.(253-255)cttfs	p.L85fs	SUZ12_ENST00000580398.1_Frame_Shift_Del_p.L85fs	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	85					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				GACCACGAGCTTTTCCTCCAG	0.642			T	JAZF1	endometrial stromal tumours																																			Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	0								ENSG00000178691			1,3545		0,1,1772	13.0	7.0	9.0			5.1	1.0	17		9	2,7072		0,2,3535	no	frameshift	SUZ12	NM_015355.2		0,3,5307	A1A1,A1R,RR		0.0283,0.0282,0.0282			30264519	3,10617	1870	3748	5618	SUZ12	SO:0001589	frameshift_variant	0				HGNC	D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.254delT	17.37:g.30264519delT	ENSP00000316578:p.Leu85fs	Somatic	0	36	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	Q96BD9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Polycomb_protein_VEFS-Box	p.F86fs	ENST00000322652.5	37	c.254	CCDS11270.1	17																																																																																			-	NULL		0.642	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	protein_coding	OTTHUMT00000256260.2	T	NM_015355			30264519	+1	no_errors	ENST00000322652	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
KIAA0907	22889	genome.wustl.edu	37	1	155893477	155893477	+	Splice_Site	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr1:155893477G>T	ENST00000368321.3	-	8	918	c.895C>A	c.(895-897)Cac>Aac	p.H299N	KIAA0907_ENST00000368320.3_Splice_Site_p.H299N|KIAA0907_ENST00000482337.1_5'UTR|SCARNA4_ENST00000516999.1_RNA|KIAA0907_ENST00000368319.3_Splice_Site_p.H299N	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	299							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			GGTTTGGGGTGACTGCAAAGA	0.363																																																	0								ENSG00000132680						75.0	76.0	76.0					1																	155893477		2203	4300	6503	KIAA0907	SO:0001630	splice_region_variant	0			-	HGNC	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.894-1C>A	1.37:g.155893477G>T		Somatic	0	32	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H299N	ENST00000368321.3	37	c.895	CCDS30885.1	1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547167	0.86022	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	T;T;T	0.41758	0.99;0.99;0.99	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.62085	0.2399	M	0.77820	2.39	0.80722	D	1	D;D;D	0.89917	1.0;0.994;0.986	D;D;D	0.87578	0.998;0.997;0.98	T	0.60637	-0.7224	10	0.46703	T	0.11	-10.5885	19.6068	0.95584	0.0:0.0:1.0:0.0	.	299;299;299	Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;K0907_HUMAN	N	299	ENSP00000357304:H299N;ENSP00000357303:H299N;ENSP00000357302:H299N	ENSP00000357302:H299N	H	-	1	0	KIAA0907	154160101	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.447000	0.97595	2.742000	0.94016	0.650000	0.86243	CAC	-	NULL		0.363	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0907	protein_coding	OTTHUMT00000039583.1	G	NM_014949	-	Missense_Mutation	155893477	-1	no_errors	ENST00000368321	ensembl	human	known	74_37	missense	SNP	1.000	T
UHRF1	29128	genome.wustl.edu	37	19	4941605	4941605	+	RNA	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr19:4941605G>T	ENST00000592666.1	+	0	1427							Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains 1						cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|histone monoubiquitination (GO:0010390)|histone ubiquitination (GO:0016574)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|replication fork (GO:0005657)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|hemi-methylated DNA-binding (GO:0044729)|histone binding (GO:0042393)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)|nucleosomal histone binding (GO:0031493)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(2)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)		GAGCGGCCGGGTGAAGGGAGC	0.592																																																	0								ENSG00000034063						55.0	61.0	59.0					19																	4941605		1932	4148	6080	UHRF1			0			-	HGNC	AF129507	CCDS74262.1, CCDS74263.1	19p13.3	2012-04-20	2008-08-14		ENSG00000034063	ENSG00000276043		"""RING-type (C3HC4) zinc fingers"""	12556	protein-coding gene	gene with protein product		607990				10646863	Standard	NM_001048201		Approved	ICBP90, Np95, FLJ21925, RNF106	uc002mbo.3	Q96T88			19.37:g.4941605G>T		Somatic	0	82	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A0JBR2|A8K024|B2RBA9|Q2HIX7|Q8J022|Q9H6S6|Q9P115|Q9P1U7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000592666.1	37	NULL		19	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087448	0.55968	.	.	ENSG00000034063	ENST00000262952;ENST00000455180;ENST00000543616;ENST00000398240	.	.	.	4.58	3.54	0.40534	.	0.243627	0.42548	D	0.000684	T	0.61476	0.2350	M	0.73217	2.22	0.43683	D	0.996123	D;P	0.57899	0.981;0.866	P;P	0.52758	0.708;0.598	T	0.74850	-0.3524	8	0.66056	D	0.02	-16.1128	11.8356	0.52321	0.0868:0.0:0.9132:0.0	.	297;284	Q2HIX7;Q96T88	.;UHRF1_HUMAN	V	284;284;284;297	.	ENSP00000262952:G284V	G	+	2	0	UHRF1	4892605	1.000000	0.71417	0.008000	0.14137	0.059000	0.15707	5.472000	0.66768	1.110000	0.41699	0.561000	0.74099	GGT	-	-		0.592	UHRF1-006	KNOWN	sequence_error|basic	processed_transcript	UHRF1	processed_transcript	OTTHUMT00000450444.1	G	NM_001048201	-		4941605	+1	no_errors	ENST00000262952	ensembl	human	known	74_37	rna	SNP	0.980	T
FAM188B2	646951	genome.wustl.edu	37	3	150608765	150608765	+	Missense_Mutation	SNP	G	G	T	rs564883638	byFrequency	TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr3:150608765G>T	ENST00000397891.3	-	3	334	c.335C>A	c.(334-336)gCg>gAg	p.A112E	RP11-166N6.2_ENST00000469268.1_RNA|RP11-166N6.3_ENST00000569170.1_3'UTR|CLRN1-AS1_ENST00000476886.1_RNA			A8MYZ0	F1882_HUMAN	family with sequence similarity 188, member B2	116																	CGGAGTCGACGCAACGTAAAT	0.557																																																	0								ENSG00000214237																																			FAM188B2	SO:0001583	missense	0			-	HGNC			3q25.1	2009-07-14	2009-07-14	2009-07-14		ENSG00000214237			35475	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 76"""	C3orf76			Standard			Approved			A8MYZ0		ENST00000397891.3:c.335C>A	3.37:g.150608765G>T	ENSP00000454591:p.Ala112Glu	Somatic	0	27	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A112E	ENST00000397891.3	37	c.335		3																																																																																			-	NULL		0.557	FAM188B2-201	KNOWN	basic|appris_candidate_longest	protein_coding	FAM188B2	protein_coding		G	XM_001717355	-		150608765	-1	no_errors	ENST00000397891	ensembl	human	known	74_37	missense	SNP	0.054	T
PLG	5340	genome.wustl.edu	37	6	161134305	161134306	+	Intron	INS	-	-	T	rs113752311|rs140653624|rs528521448	byFrequency	TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr6:161134305_161134306insT	ENST00000308192.9	+	5	610				PLG_ENST00000462918.1_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	ATTAACCTGAAttttttttttt	0.436																																																	0								ENSG00000122194																																			PLG	SO:0001627	intron_variant	0				HGNC	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.547+148->T	6.37:g.161134316_161134316dupT		Somatic	0	13	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	40.00	Q15146|Q5TEH4|Q6PA00	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308192.9	37	NULL	CCDS5279.1	6																																																																																			-	-		0.436	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLG	protein_coding	OTTHUMT00000042959.2	-	NM_000301			161134306	+1	no_errors	ENST00000462918	ensembl	human	known	74_37	rna	INS	0.002:0.003	T
SF3B1	23451	genome.wustl.edu	37	2	198257908	198257908	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr2:198257908G>T	ENST00000335508.6	-	24	3635	c.3544C>A	c.(3544-3546)Ctt>Att	p.L1182I		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1182					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CTGTGTACAAGGTCTCTACAA	0.403			Mis		myelodysplastic syndrome																																			Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	0								ENSG00000115524						79.0	71.0	74.0					2																	198257908		2203	4300	6503	SF3B1	SO:0001583	missense	0			-	HGNC	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3544C>A	2.37:g.198257908G>T	ENSP00000335321:p.Leu1182Ile	Somatic	0	37	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	E9PCH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SF3b_su1,superfamily_ARM-type_fold	p.L1182I	ENST00000335508.6	37	c.3544	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	G	10.91	1.485467	0.26686	.	.	ENSG00000115524	ENST00000335508	T	0.65549	-0.16	4.83	4.83	0.62350	Armadillo-type fold (1);	0.065565	0.64402	D	0.000006	T	0.67534	0.2903	M	0.80028	2.48	0.80722	D	1	B	0.23854	0.092	B	0.27170	0.077	T	0.68112	-0.5495	10	0.44086	T	0.13	.	17.9272	0.88987	0.0:0.0:1.0:0.0	.	1182	O75533	SF3B1_HUMAN	I	1182	ENSP00000335321:L1182I	ENSP00000335321:L1182I	L	-	1	0	SF3B1	197966153	1.000000	0.71417	1.000000	0.80357	0.372000	0.29890	5.604000	0.67626	2.245000	0.73994	0.313000	0.20887	CTT	-	superfamily_ARM-type_fold		0.403	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	protein_coding	OTTHUMT00000335245.2	G		-		198257908	-1	no_errors	ENST00000335508	ensembl	human	known	74_37	missense	SNP	1.000	T
SOX5	6660	genome.wustl.edu	37	12	23908624	23908624	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr12:23908624G>T	ENST00000451604.2	-	4	617	c.516C>A	c.(514-516)gaC>gaA	p.D172E	SOX5_ENST00000541847.1_Missense_Mutation_p.D162E|SOX5_ENST00000537393.1_Missense_Mutation_p.D137E|SOX5_ENST00000541536.1_Missense_Mutation_p.D159E|SOX5_ENST00000546136.1_Missense_Mutation_p.D159E|SOX5_ENST00000309359.1_Missense_Mutation_p.D159E|SOX5_ENST00000381381.2_Missense_Mutation_p.D159E|SOX5_ENST00000545921.1_Missense_Mutation_p.D162E			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	172					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						TGTCTTTCCAGTCCTTTGAGA	0.363																																																	0								ENSG00000134532						129.0	123.0	125.0					12																	23908624		2203	4299	6502	SOX5	SO:0001583	missense	0			-	HGNC	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.516C>A	12.37:g.23908624G>T	ENSP00000398273:p.Asp172Glu	Somatic	0	60	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.D172E	ENST00000451604.2	37	c.516	CCDS8699.1	12	.	.	.	.	.	.	.	.	.	.	G	20.8	4.048570	0.75846	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921;ENST00000541847	D;D;D;D;D;D;D	0.98400	-4.85;-4.85;-4.91;-4.85;-4.88;-4.91;-4.85	5.67	4.77	0.60923	.	0.049719	0.85682	D	0.000000	D	0.98642	0.9545	M	0.81497	2.545	0.45390	D	0.998379	D;D;D	0.89917	1.0;0.972;1.0	D;P;D	0.91635	0.999;0.866;0.997	D	0.98254	1.0495	10	0.87932	D	0	.	10.0696	0.42325	0.1453:0.0:0.8547:0.0	.	137;159;172	F5H0I3;P35711-4;P35711	.;.;SOX5_HUMAN	E	159;159;159;172;124;137;159;162;162	ENSP00000437487:D159E;ENSP00000308927:D159E;ENSP00000370788:D159E;ENSP00000398273:D172E;ENSP00000439832:D137E;ENSP00000441973:D159E;ENSP00000443520:D162E	ENSP00000308927:D159E	D	-	3	2	SOX5	23799891	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.827000	0.62723	2.834000	0.97654	0.650000	0.86243	GAC	-	NULL		0.363	SOX5-002	KNOWN	basic|CCDS	protein_coding	SOX5	protein_coding	OTTHUMT00000402006.2	G	NM_006940	-		23908624	-1	no_errors	ENST00000451604	ensembl	human	known	74_37	missense	SNP	1.000	T
TMEM180	79847	genome.wustl.edu	37	10	104233692	104233692	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr10:104233692G>T	ENST00000238936.4	+	9	1451	c.1214G>T	c.(1213-1215)gGc>gTc	p.G405V	TMEM180_ENST00000366277.2_Missense_Mutation_p.G134V	NM_024789.3	NP_079065.2	Q14CX5	TM180_HUMAN	transmembrane protein 180	405						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|large_intestine(3)|lung(1)|ovary(3)|skin(1)	13		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CTCCTCTTTGGCATGGTTGCC	0.617																																																	0								ENSG00000138111						80.0	61.0	67.0					10																	104233692		2203	4300	6503	TMEM180	SO:0001583	missense	0			-	HGNC	AK026182	CCDS7535.1	10q24.32	2011-02-09	2006-10-12	2006-10-12	ENSG00000138111	ENSG00000138111			26196	protein-coding gene	gene with protein product				C10orf77		12477932	Standard	XM_006717971		Approved	FLJ22529, bA18I14.8	uc001kvt.3	Q14CX5	OTTHUMG00000018961	ENST00000238936.4:c.1214G>T	10.37:g.104233692G>T	ENSP00000238936:p.Gly405Val	Somatic	0	30	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q6NWM8|Q6NWM9|Q6PEZ7|Q9H679	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_MFS_dom_general_subst_transpt	p.G405V	ENST00000238936.4	37	c.1214	CCDS7535.1	10	.	.	.	.	.	.	.	.	.	.	G	31	5.090040	0.94149	.	.	ENSG00000138111	ENST00000366277;ENST00000447593;ENST00000238936;ENST00000369930	D;D;D	0.89270	-2.17;-2.49;-2.17	5.6	5.6	0.85130	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	D	0.95468	0.8528	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95717	0.8763	10	0.87932	D	0	.	19.6116	0.95608	0.0:0.0:1.0:0.0	.	254;405	B4DWN6;Q14CX5	.;TM180_HUMAN	V	134;254;405;134	ENSP00000437572:G134V;ENSP00000238936:G405V;ENSP00000358946:G134V	ENSP00000238936:G405V	G	+	2	0	TMEM180	104223682	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.605000	0.98321	2.651000	0.90000	0.561000	0.74099	GGC	-	superfamily_MFS_dom_general_subst_transpt		0.617	TMEM180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM180	protein_coding	OTTHUMT00000050075.2	G	NM_024789	-		104233692	+1	no_errors	ENST00000238936	ensembl	human	known	74_37	missense	SNP	1.000	T
RBM3	5935	genome.wustl.edu	37	X	48434476	48434476	+	Intron	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chrX:48434476G>T	ENST00000376759.3	+	4	273				RBM3_ENST00000376755.1_Intron|AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000354480.2_5'UTR|RBM3_ENST00000430348.2_5'UTR|RBM3_ENST00000466764.1_Intron	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3						positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						CAAGATGTAAGTAGTAGCAAG	0.488																																																	0								ENSG00000102317																																			RBM3	SO:0001627	intron_variant	0			-	HGNC	BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.211-226G>T	X.37:g.48434476G>T		Somatic	0	23	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376759.3	37	NULL	CCDS14301.1	X																																																																																			-	-		0.488	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM3	protein_coding	OTTHUMT00000060755.1	G	NM_006743	-		48434476	+1	no_errors	ENST00000485213	ensembl	human	known	74_37	rna	SNP	1.000	T
SLC13A3	64849	genome.wustl.edu	37	20	45228619	45228619	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr20:45228619C>T	ENST00000279027.4	-	4	617	c.599G>A	c.(598-600)aGc>aAc	p.S200N	SLC13A3_ENST00000372121.1_Intron|SLC13A3_ENST00000413164.2_Intron|SLC13A3_ENST00000396360.1_Missense_Mutation_p.S153N|SLC13A3_ENST00000435032.1_5'UTR|SLC13A3_ENST00000472148.1_Missense_Mutation_p.S153N|SLC13A3_ENST00000290317.5_Missense_Mutation_p.S153N|SLC13A3_ENST00000495082.1_Missense_Mutation_p.S153N	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	200					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)			breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	CGCTTCTGTGCTGGCGAGAAA	0.463																																																	0								ENSG00000158296						159.0	145.0	150.0					20																	45228619		2203	4300	6503	SLC13A3	SO:0001583	missense	0			-	HGNC	AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.599G>A	20.37:g.45228619C>T	ENSP00000279027:p.Ser200Asn	Somatic	0	33	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.S200N	ENST00000279027.4	37	c.599	CCDS13400.1	20	.	.	.	.	.	.	.	.	.	.	C	4.977	0.181534	0.09495	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000279027;ENST00000472148;ENST00000495082;ENST00000468915	T;T;T;T;T;T	0.06608	3.86;3.85;4.12;3.85;3.86;3.28	5.34	3.42	0.39159	.	1.005140	0.07997	N	0.988174	T	0.05181	0.0138	N	0.25286	0.73	0.80722	D	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.002;0.004;0.004	T	0.28267	-1.0049	10	0.18276	T	0.48	-5.8184	8.3273	0.32165	0.0:0.7594:0.0:0.2406	.	153;153;200	Q8WWT9-3;F6WI18;Q8WWT9	.;.;S13A3_HUMAN	N	153;153;200;153;153;153	ENSP00000290317:S153N;ENSP00000379648:S153N;ENSP00000279027:S200N;ENSP00000420177:S153N;ENSP00000419621:S153N;ENSP00000417784:S153N	ENSP00000279027:S200N	S	-	2	0	SLC13A3	44662026	1.000000	0.71417	0.931000	0.37212	0.462000	0.32619	2.276000	0.43408	0.641000	0.30601	-0.277000	0.10078	AGC	-	pfam_Na/sul_symport		0.463	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A3	protein_coding	OTTHUMT00000080329.2	C		-		45228619	-1	no_errors	ENST00000279027	ensembl	human	known	74_37	missense	SNP	0.988	T
RNF144B	255488	genome.wustl.edu	37	6	18399888	18399888	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr6:18399888G>T	ENST00000259939.3	+	2	440	c.123G>T	c.(121-123)aaG>aaT	p.K41N	RNF144B_ENST00000486622.1_3'UTR|snoU13_ENST00000459328.1_RNA|RNF144B_ENST00000429054.2_Intron	NM_182757.3	NP_877434.2	Q7Z419	R144B_HUMAN	ring finger protein 144B	41					apoptotic process (GO:0006915)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)	11	Ovarian(93;0.00365)|Breast(50;0.0145)	all_hematologic(90;0.0536)	OV - Ovarian serous cystadenocarcinoma(7;0.00165)|all cancers(50;0.0102)|Epithelial(50;0.0105)			CTCTGGACAAGATGACCACAC	0.478																																																	0								ENSG00000137393						81.0	73.0	76.0					6																	18399888		2203	4300	6503	RNF144B	SO:0001583	missense	0			-	HGNC	AK096832	CCDS34345.1	6p22.3	2011-05-23	2009-01-05	2007-08-20	ENSG00000137393	ENSG00000137393		"""RING-type (C3HC4) zinc fingers"""	21578	protein-coding gene	gene with protein product			"""IBR domain containing 2"""	IBRDC2			Standard	NM_182757		Approved	bA528A10.3	uc003ncs.3	Q7Z419	OTTHUMG00000014322	ENST00000259939.3:c.123G>T	6.37:g.18399888G>T	ENSP00000259939:p.Lys41Asn	Somatic	0	22	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	B3KUA8|B4DZI2|Q5TB85|Q6P4Q0|Q8N3R7|Q9BX38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC	p.K41N	ENST00000259939.3	37	c.123	CCDS34345.1	6	.	.	.	.	.	.	.	.	.	.	G	12.54	1.968439	0.34754	.	.	ENSG00000137393	ENST00000259939	T	0.30981	1.51	5.74	5.74	0.90152	Zinc finger, RING-type (1);	0.139081	0.64402	D	0.000004	T	0.13798	0.0334	L	0.36672	1.1	0.80722	D	1	B	0.12013	0.005	B	0.16722	0.016	T	0.03587	-1.1022	10	0.28530	T	0.3	.	13.7978	0.63182	0.0738:0.0:0.9262:0.0	.	41	Q7Z419	R144B_HUMAN	N	41	ENSP00000259939:K41N	ENSP00000259939:K41N	K	+	3	2	RNF144B	18507867	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.841000	0.55850	2.715000	0.92844	0.655000	0.94253	AAG	-	smart_Znf_RING		0.478	RNF144B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF144B	protein_coding	OTTHUMT00000039965.2	G	XM_172581	-		18399888	+1	no_errors	ENST00000259939	ensembl	human	known	74_37	missense	SNP	1.000	T
SAP130	79595	genome.wustl.edu	37	2	128753978	128753978	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr2:128753978G>T	ENST00000259235.3	-	11	1508	c.1379C>A	c.(1378-1380)tCc>tAc	p.S460Y	SAP130_ENST00000259234.6_Missense_Mutation_p.S434Y|SAP130_ENST00000357702.5_Missense_Mutation_p.S460Y	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	460					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		CCGATGTCCGGAGATGGGAAT	0.552																																																	0								ENSG00000136715						111.0	97.0	102.0					2																	128753978		2203	4300	6503	SAP130	SO:0001583	missense	0			-	HGNC	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1379C>A	2.37:g.128753978G>T	ENSP00000259235:p.Ser460Tyr	Somatic	0	46	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S460Y	ENST00000259235.3	37	c.1379	CCDS2153.1	2	.	.	.	.	.	.	.	.	.	.	G	18.63	3.664835	0.67700	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.25	5.25	0.73442	.	0.226336	0.47455	D	0.000221	T	0.65688	0.2715	L	0.27053	0.805	0.58432	D	0.999998	D;D;D;P	0.71674	0.998;0.978;0.978;0.763	D;P;P;B	0.65443	0.935;0.804;0.804;0.444	T	0.69202	-0.5207	9	0.66056	D	0.02	-21.1838	19.2215	0.93799	0.0:0.0:1.0:0.0	.	460;433;460;98	B7ZLM3;Q96DP1;Q9H0E3;B3KRT9	.;.;SP130_HUMAN;.	Y	460;460;434	.	ENSP00000259234:S434Y	S	-	2	0	SAP130	128470448	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	9.153000	0.94687	2.603000	0.88011	0.655000	0.94253	TCC	-	NULL		0.552	SAP130-001	KNOWN	basic|CCDS	protein_coding	SAP130	protein_coding	OTTHUMT00000254436.3	G	NM_024545	-		128753978	-1	no_errors	ENST00000357702	ensembl	human	known	74_37	missense	SNP	1.000	T
SPHKAP	80309	genome.wustl.edu	37	2	228883699	228883699	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr2:228883699G>T	ENST00000392056.3	-	7	1917	c.1871C>A	c.(1870-1872)gCt>gAt	p.A624D	SPHKAP_ENST00000344657.5_Missense_Mutation_p.A624D	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	624						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TAAAACCAGAGCAGCCTCCTT	0.507																																																	0								ENSG00000153820						56.0	54.0	55.0					2																	228883699		2203	4300	6503	SPHKAP	SO:0001583	missense	0			-	HGNC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1871C>A	2.37:g.228883699G>T	ENSP00000375909:p.Ala624Asp	Somatic	0	48	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AKAP_110_C	p.A624D	ENST00000392056.3	37	c.1871	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	16.95	3.262196	0.59431	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.49432	0.78;0.78	5.84	3.07	0.35406	.	0.435366	0.26995	N	0.021448	T	0.52322	0.1727	L	0.56769	1.78	0.09310	N	1	P;D	0.54964	0.868;0.969	B;P	0.54499	0.312;0.754	T	0.40831	-0.9542	10	0.46703	T	0.11	.	8.2238	0.31558	0.1412:0.1308:0.7281:0.0	.	624;624	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	D	624	ENSP00000375909:A624D;ENSP00000339886:A624D	ENSP00000339886:A624D	A	-	2	0	SPHKAP	228591943	0.818000	0.29161	0.001000	0.08648	0.881000	0.50899	4.311000	0.59147	0.806000	0.34183	0.655000	0.94253	GCT	-	NULL		0.507	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	G	NM_030623	-		228883699	-1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	SNP	0.006	T
NKIRAS2	28511	genome.wustl.edu	37	17	40175789	40175789	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr17:40175789G>T	ENST00000307641.5	+	4	1075	c.454G>T	c.(454-456)Gcg>Tcg	p.A152S	NKIRAS2_ENST00000462043.2_3'UTR|NKIRAS2_ENST00000393880.1_Missense_Mutation_p.A152S|NKIRAS2_ENST00000316082.4_Missense_Mutation_p.A190S|NKIRAS2_ENST00000479407.1_3'UTR|NKIRAS2_ENST00000393884.2_Missense_Mutation_p.A150S|NKIRAS2_ENST00000393885.4_Missense_Mutation_p.A152S|NKIRAS2_ENST00000449471.4_Missense_Mutation_p.A96S|ZNF385C_ENST00000461831.1_5'Flank|NKIRAS2_ENST00000393881.3_Missense_Mutation_p.A152S	NM_001001349.2	NP_001001349.1	Q9NYR9	KBRS2_HUMAN	NFKB inhibitor interacting Ras-like 2	152	Small GTPase-like.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	9		all_cancers(22;1.1e-05)|Breast(137;0.000143)|all_epithelial(22;0.000319)				GGTGTCAGTGGCGGACCGGCG	0.602																																																	0								ENSG00000168256						109.0	101.0	104.0					17																	40175789		2203	4300	6503	NKIRAS2	SO:0001583	missense	0			-	HGNC	AF229840	CCDS11415.1, CCDS45679.1, CCDS45680.1	17q21.31	2014-05-09	2004-05-20		ENSG00000168256	ENSG00000168256			17898	protein-coding gene	gene with protein product		604497	"""NFKB inhibitor interacting Ras-like protein 2"""			10657303	Standard	NM_001001349		Approved	KBRAS2, DKFZP434N1526, kappaB-Ras2	uc002hys.3	Q9NYR9	OTTHUMG00000133503	ENST00000307641.5:c.454G>T	17.37:g.40175789G>T	ENSP00000303580:p.Ala152Ser	Somatic	0	74	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A6NCZ5|B3KNN0|B4DNM3|Q6PK52|Q96KC7|Q9NSX1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A152S	ENST00000307641.5	37	c.454	CCDS11415.1	17	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511381	0.44660	.	.	ENSG00000168256	ENST00000307641;ENST00000393884;ENST00000393880;ENST00000393881;ENST00000393885;ENST00000462043;ENST00000316082	T;T;T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04;-1.04;-1.04	5.65	4.68	0.58851	Small GTP-binding protein domain (1);	0.423368	0.28093	N	0.016629	T	0.67069	0.2854	L	0.33339	1.005	0.34313	D	0.685719	B;B	0.02656	0.0;0.0	B;B	0.10450	0.001;0.005	T	0.71738	-0.4502	10	0.66056	D	0.02	-24.7822	10.2524	0.43377	0.1465:0.0:0.8535:0.0	.	96;152	B4DNM3;Q9NYR9	.;KBRS2_HUMAN	S	152;150;152;152;152;96;190	ENSP00000303580:A152S;ENSP00000377462:A150S;ENSP00000377458:A152S;ENSP00000377459:A152S;ENSP00000377463:A152S;ENSP00000312773:A190S	ENSP00000303580:A152S	A	+	1	0	NKIRAS2	37429315	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.399000	0.52586	2.660000	0.90430	0.467000	0.42956	GCG	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.602	NKIRAS2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NKIRAS2	protein_coding	OTTHUMT00000257457.1	G	NM_017595	-		40175789	+1	no_errors	ENST00000307641	ensembl	human	known	74_37	missense	SNP	0.999	T
FUT10	84750	genome.wustl.edu	37	8	33246610	33246610	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr8:33246610G>T	ENST00000327671.5	-	4	1714	c.1083C>A	c.(1081-1083)aaC>aaA	p.N361K	FUT10_ENST00000518672.1_Missense_Mutation_p.N333K|FUT10_ENST00000524021.1_Missense_Mutation_p.N333K|FUT10_ENST00000518076.1_5'UTR|FUT10_ENST00000335589.3_Missense_Mutation_p.N299K	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	361					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		GAAGTCGCTGGTTAGAGATCT	0.493																																																	0								ENSG00000172728						188.0	161.0	170.0					8																	33246610		2203	4300	6503	FUT10	SO:0001583	missense	0			-	HGNC	AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.1083C>A	8.37:g.33246610G>T	ENSP00000332757:p.Asn361Lys	Somatic	0	22	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_10,pirsf_Alpha-1_3-FUT_met	p.N361K	ENST00000327671.5	37	c.1083	CCDS6088.1	8	.	.	.	.	.	.	.	.	.	.	G	18.28	3.590170	0.66105	.	.	ENSG00000172728	ENST00000327671;ENST00000380081;ENST00000518672;ENST00000524021;ENST00000335589	T;T;T;T	0.25414	1.8;1.8;1.8;1.93	5.04	-0.78	0.10969	.	0.000000	0.85682	D	0.000000	T	0.45276	0.1334	M	0.76938	2.355	0.58432	D	0.999995	D;D;D;D;D;D	0.89917	1.0;0.984;1.0;1.0;1.0;0.965	D;P;D;D;D;D	0.97110	1.0;0.882;1.0;0.998;0.999;0.957	T	0.36672	-0.9738	10	0.59425	D	0.04	-0.2477	9.141	0.36903	0.5576:0.0:0.4424:0.0	.	411;361;333;299;361;403	B4E056;Q6P4F1-5;Q6P4F1-4;Q6P4F1-3;Q6P4F1;E7EU36	.;.;.;.;FUT10_HUMAN;.	K	361;403;333;333;299	ENSP00000332757:N361K;ENSP00000430428:N333K;ENSP00000429870:N333K;ENSP00000334997:N299K	ENSP00000332757:N361K	N	-	3	2	FUT10	33366152	0.930000	0.31532	0.957000	0.39632	0.993000	0.82548	0.578000	0.23773	-0.136000	0.11475	0.557000	0.71058	AAC	-	pfam_Glyco_trans_10,pirsf_Alpha-1_3-FUT_met		0.493	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT10	protein_coding	OTTHUMT00000376540.1	G	NM_032664	-		33246610	-1	no_errors	ENST00000327671	ensembl	human	known	74_37	missense	SNP	0.991	T
RPN2	6185	genome.wustl.edu	37	20	35807790	35807791	+	Intron	INS	-	-	CTTATAGACAGGGCCCCGCGGCCGGCACT	rs57415986|rs11467214	byFrequency	TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr20:35807790_35807791insCTTATAGACAGGGCCCCGCGGCCGGCACT	ENST00000237530.6	+	1	324				RPN2_ENST00000373622.5_Intron|MROH8_ENST00000441008.2_Frame_Shift_Ins_p.S17fs|MROH8_ENST00000400441.3_Splice_Site	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II						aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				GTTGCGCGTGGCTTTGGGGAGA	0.708														3247	0.648363	0.7753	0.6556	5008	,	,		16123	0.4673		0.6829	False		,,,				2504	0.6227																0								ENSG00000101353																																			MROH8	SO:0001627	intron_variant	0				HGNC	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.13+18->CTTATAGACAGGGCCCCGCGGCCGGCACT	20.37:g.35807790_35807791insCTTATAGACAGGGCCCCGCGGCCGGCACT		Somatic	NA	NA	NA		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.H31fs	ENST00000237530.6	37	c.94_93	CCDS13291.1	20																																																																																			-	NULL		0.708	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH8	protein_coding	OTTHUMT00000079076.2	-	NM_002951			35807791	-1	no_errors	ENST00000400441	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.052	CTTATAGACAGGGCCCCGCGGCCGGCACT
HELZ2	85441	genome.wustl.edu	37	20	62202920	62202920	+	Intron	DEL	T	T	-	rs368918542		TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr20:62202920delT	ENST00000467148.1	-	1	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCTCCTGCCCTGCTCCAAGCT	0.677																																																	0								ENSG00000130589																																			HELZ2	SO:0001627	intron_variant	0				HGNC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.278+540A>-	20.37:g.62202920delT		Somatic	0	32	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			-	-		0.677	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	T	NM_001037335			62202920	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	DEL	0.891	-
GARNL3	84253	genome.wustl.edu	37	9	130095397	130095397	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr9:130095397delA	ENST00000373387.4	+	9	1118	c.766delA	c.(766-768)aaafs	p.K256fs	GARNL3_ENST00000314904.5_Frame_Shift_Del_p.K256fs|GARNL3_ENST00000435213.2_Frame_Shift_Del_p.K234fs	NM_032293.4	NP_115669.3	Q5VVW2	GARL3_HUMAN	GTPase activating Rap/RanGAP domain-like 3	256	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)|small GTPase regulator activity (GO:0005083)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(24)|ovary(1)|skin(1)|urinary_tract(2)	41						TCTGGATACCAAAAGTAAGCC	0.443																																																	0								ENSG00000136895						66.0	68.0	68.0					9																	130095397		2203	4300	6503	GARNL3	SO:0001589	frameshift_variant	0				HGNC	BC034983	CCDS6869.2, CCDS69663.1	9q34.13	2009-09-14	2004-08-09		ENSG00000136895	ENSG00000136895			25425	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 3"""			11230166	Standard	NM_032293		Approved	DKFZp761J1523, bA356B19.1	uc011mae.2	Q5VVW2	OTTHUMG00000020700	ENST00000373387.4:c.766delA	9.37:g.130095397delA	ENSP00000362485:p.Lys256fs	Somatic	0	34	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	19	9.52	B4DEP7|B7Z3Q6|Q8IYU1|Q8N951|Q8ND89|Q9BQH6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Citron,pfam_Rap_GAP_dom,smart_Citron,pfscan_Rap_GAP_dom	p.N257fs	ENST00000373387.4	37	c.766	CCDS6869.2	9																																																																																			-	pfam_Rap_GAP_dom,pfscan_Rap_GAP_dom		0.443	GARNL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GARNL3	protein_coding	OTTHUMT00000054151.3	A	NM_032293			130095397	+1	no_errors	ENST00000373387	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ETHE1	23474	genome.wustl.edu	37	19	44031264	44031264	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr19:44031264delG	ENST00000292147.2	-	1	132	c.66delC	c.(64-66)cccfs	p.P22fs	ETHE1_ENST00000600651.1_Frame_Shift_Del_p.P22fs|ZNF575_ENST00000458714.2_Intron	NM_014297.3	NP_055112.2	O95571	ETHE1_HUMAN	ethylmalonic encephalopathy 1	22					cellular nitrogen compound metabolic process (GO:0034641)|glutathione metabolic process (GO:0006749)|hydrogen sulfide metabolic process (GO:0070813)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|sulfur dioxygenase activity (GO:0050313)			central_nervous_system(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	5		Prostate(69;0.0153)				GCAGGAGGATGGGGGCTCCAG	0.697																																																	0			GRCh37	CD068235	ETHE1	D		ENSG00000105755						4.0	5.0	5.0					19																	44031264		1934	3928	5862	ETHE1	SO:0001589	frameshift_variant	0				HGNC		CCDS12622.1	19q13.32	2014-06-20				ENSG00000105755	1.13.11.18		23287	protein-coding gene	gene with protein product		608451				19136963	Standard	NM_014297		Approved	YF13H12, HSCO	uc002owp.3	O95571		ENST00000292147.2:c.66delC	19.37:g.44031264delG	ENSP00000292147:p.Pro22fs	Somatic	0	22	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	Q96HR0|Q9H001	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.I23fs	ENST00000292147.2	37	c.66	CCDS12622.1	19																																																																																			-	NULL		0.697	ETHE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETHE1	protein_coding	OTTHUMT00000463184.1	G	NM_014297			44031264	-1	no_errors	ENST00000292147	ensembl	human	known	74_37	frame_shift_del	DEL	0.785	-
SFMBT1	51460	genome.wustl.edu	37	3	52941739	52941739	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr3:52941739G>T	ENST00000394752.3	-	18	2299	c.1917C>A	c.(1915-1917)taC>taA	p.Y639*	SFMBT1_ENST00000394750.1_Nonsense_Mutation_p.Y639*|SFMBT1_ENST00000296295.6_Nonsense_Mutation_p.Y639*|SFMBT1_ENST00000358080.2_Nonsense_Mutation_p.Y639*	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	639					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		TCTTCTTTCCGTAATAGTGTG	0.373																																																	0								ENSG00000163935						101.0	103.0	102.0					3																	52941739		2202	4300	6502	SFMBT1	SO:0001587	stop_gained	0			-	HGNC	AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.1917C>A	3.37:g.52941739G>T	ENSP00000378235:p.Tyr639*	Somatic	0	82	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	Q402F7|Q96C73|Q9Y4Q9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.Y639*	ENST00000394752.3	37	c.1917	CCDS2867.1	3	.	.	.	.	.	.	.	.	.	.	G	41	8.788393	0.98954	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000296295;ENST00000394750	.	.	.	5.39	-1.13	0.09775	.	0.064498	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9215	0.47167	0.5897:0.0:0.4103:0.0	.	.	.	.	X	639	.	ENSP00000296295:Y639X	Y	-	3	2	SFMBT1	52916779	0.989000	0.36119	0.997000	0.53966	0.991000	0.79684	0.537000	0.23144	-0.111000	0.12001	-0.238000	0.12139	TAC	-	NULL		0.373	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT1	protein_coding	OTTHUMT00000353040.3	G	NM_016329	-		52941739	-1	no_errors	ENST00000358080	ensembl	human	known	74_37	nonsense	SNP	1.000	T
KCNN3	3782	genome.wustl.edu	37	1	154680586	154680588	+	In_Frame_Del	DEL	GCT	GCT	-	rs149440400		TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr1:154680586_154680588delGCT	ENST00000271915.4	-	8	2375_2377	c.2060_2062delAGC	c.(2059-2064)cagctc>ctc	p.Q687del	KCNN3_ENST00000515643.1_5'UTR|KCNN3_ENST00000358505.2_In_Frame_Del_p.Q374del|KCNN3_ENST00000361147.4_In_Frame_Del_p.Q382del	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	692					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	GCAGACAGGAGCTGCTGCTGCTG	0.64																																																	0								ENSG00000143603																																			KCNN3	SO:0001651	inframe_deletion	0				HGNC	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.2060_2062delAGC	1.37:g.154680595_154680597delGCT	ENSP00000271915:p.Gln687del	Somatic	0	37	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	B1ANX0|O43517|Q86VF9|Q8WXG7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.Q687in_frame_del	ENST00000271915.4	37	c.2062_2060	CCDS30880.1	1																																																																																			-	NULL		0.640	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	KCNN3	protein_coding	OTTHUMT00000090688.3	GCT	NM_002249			154680588	-1	no_errors	ENST00000271915	ensembl	human	novel	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
WDR66	144406	genome.wustl.edu	37	12	122359379	122359381	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-DX-AB2L-01A-32D-A417-09	TCGA-DX-AB2L-10A-01D-A41A-09	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	51b936bb-a69b-4ab5-81d6-542886686ed7	95900dfa-7dfd-4dfb-b86d-6d47974ffa61	g.chr12:122359379_122359381delAAC	ENST00000288912.4	+	2	1022_1024	c.168_170delAAC	c.(166-171)aaaacg>aag	p.T57del	WDR66_ENST00000397454.2_In_Frame_Del_p.T57del	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	57	Glu-rich.						calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		aggagaggaaaacgggcgaggag	0.468																																					Esophageal Squamous(85;849 1794 49757 52143)												0								ENSG00000158023																																			WDR66	SO:0001651	inframe_deletion	0				HGNC	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.168_170delAAC	12.37:g.122359379_122359381delAAC	ENSP00000288912:p.Thr57del	Somatic	0	27	0.00		0.5650593424010593	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.T57in_frame_del	ENST00000288912.4	37	c.168_170	CCDS41853.1	12																																																																																			-	NULL		0.468	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	protein_coding	OTTHUMT00000401700.1	AAC	NM_144668			122359381	+1	no_errors	ENST00000288912	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.000:0.000	-
