#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
GSG2	83903	genome.wustl.edu	37	17	3628705	3628705	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr17:3628705A>T	ENST00000325418.4	+	1	1495	c.1476A>T	c.(1474-1476)gaA>gaT	p.E492D	CTD-3195I5.3_ENST00000571741.1_RNA|ITGAE_ENST00000263087.4_Intron|ITGAE_ENST00000571185.1_Intron	NM_031965.2	NP_114171.2	Q8TF76	HASP_HUMAN	germ cell associated 2 (haspin)	492	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				histone H3-T3 phosphorylation involved in chromosome passenger complex localization to kinetochore (GO:2000751)|intracellular signal transduction (GO:0035556)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|protein localization to chromosome, centromeric region (GO:0071459)|protein phosphorylation (GO:0006468)|regulation of spindle checkpoint (GO:0090231)	centrosome (GO:0005813)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|histone kinase activity (H3-T3 specific) (GO:0072354)|protein kinase activity (GO:0004672)										AGATTGGGGAAGGGGTGTTTG	0.458																																																	0								ENSG00000177602						59.0	57.0	57.0					17																	3628705		2203	4300	6503	GSG2	SO:0001583	missense	0			-	HGNC	AB039834	CCDS11036.1	17p13	2005-01-19			ENSG00000177602	ENSG00000177602			19682	protein-coding gene	gene with protein product		609240					Standard	NM_031965		Approved	haspin	uc002fwp.3	Q8TF76	OTTHUMG00000090703	ENST00000325418.4:c.1476A>T	17.37:g.3628705A>T	ENSP00000325290:p.Glu492Asp	Somatic	0	52	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	18	57.14	Q5U5K3|Q96MN1|Q9BXS7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3635,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.E492D	ENST00000325418.4	37	c.1476	CCDS11036.1	17	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138653	0.77775	.	.	ENSG00000177602	ENST00000325418	T	0.67523	-0.27	4.87	4.87	0.63330	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.193360	0.32081	N	0.006616	T	0.81479	0.4831	M	0.81341	2.54	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.84190	0.0444	10	0.87932	D	0	-26.2146	12.8971	0.58106	1.0:0.0:0.0:0.0	.	492	Q8TF76	HASP_HUMAN	D	492	ENSP00000325290:E492D	ENSP00000325290:E492D	E	+	3	2	GSG2	3575454	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.865000	0.48412	2.139000	0.66308	0.533000	0.62120	GAA	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.458	GSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSG2	protein_coding	OTTHUMT00000207391.1	A	NM_031965	-		3628705	+1	no_errors	ENST00000325418	ensembl	human	known	74_37	missense	SNP	1.000	T
KIAA1841	84542	genome.wustl.edu	37	2	61348536	61348536	+	Intron	SNP	A	A	G			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr2:61348536A>G	ENST00000402291.1	+	21	2361				KIAA1841_ENST00000453873.1_Intron|KIAA1841_ENST00000356719.2_Intron|KIAA1841_ENST00000295031.5_Intron	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841											breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			TTCAATGATTATATTATCAAG	0.254																																																	0								ENSG00000162929																																			KIAA1841	SO:0001627	intron_variant	0			-	HGNC	BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.2120+125A>G	2.37:g.61348536A>G		Somatic	0	19	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	5	54.55	Q49AF0|Q6ZND0|Q96JI6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402291.1	37	NULL	CCDS46296.1	2																																																																																			-	-		0.254	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1841	protein_coding	OTTHUMT00000325477.1	A	NM_032506	-		61348536	+1	no_errors	ENST00000488322	ensembl	human	known	74_37	rna	SNP	0.001	G
PTPN14	5784	genome.wustl.edu	37	1	214706552	214706552	+	Intron	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr1:214706552C>T	ENST00000366956.5	-	1	41				PTPN14_ENST00000491277.1_5'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14						lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		CCTGCTGCACCTGGCGTCAGG	0.612																																					Colon(92;557 1424 24372 34121 40073)												0								ENSG00000152104																																			PTPN14	SO:0001627	intron_variant	0			-	HGNC	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.153+17973G>A	1.37:g.214706552C>T		Somatic	0	34	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	14	36.36	Q5VSI0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366956.5	37	NULL	CCDS1514.1	1																																																																																			-	-		0.612	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	protein_coding	OTTHUMT00000089918.2	C	NM_005401	-		214706552	-1	no_errors	ENST00000491277	ensembl	human	putative	74_37	rna	SNP	0.984	T
AC079804.1	0	genome.wustl.edu	37	7	7034903	7034903	+	RNA	SNP	G	G	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr7:7034903G>T	ENST00000408084.2	+	0	58																											acttgaatgagttagagaaaa	0.522																																																	0								ENSG00000221011																																			AC079804.1			0			-	Clone_based_ensembl_gene																													7.37:g.7034903G>T		Somatic	0	186	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	137	13.29		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408084.2	37	NULL		7																																																																																			-	-		0.522	AC079804.1-201	NOVEL	basic	miRNA	ENSG00000221011	miRNA		G		-		7034903	+1	no_errors	ENST00000408084	ensembl	human	novel	74_37	rna	SNP	0.000	T
POC1B	282809	genome.wustl.edu	37	12	89819150	89819150	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr12:89819150C>T	ENST00000313546.3	-	11	1248	c.1120G>A	c.(1120-1122)Gaa>Aaa	p.E374K	POC1B_ENST00000378528.2_3'UTR|POC1B_ENST00000546740.1_5'UTR|POC1B_ENST00000549504.1_3'UTR|POC1B_ENST00000541909.1_3'UTR|POC1B_ENST00000549035.1_Missense_Mutation_p.E332K|POC1B_ENST00000393179.4_Missense_Mutation_p.E244K	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	374	Poly-Thr.				cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						CCACTGGTTTCTGTTGTCTTT	0.363																																																	0								ENSG00000139323						80.0	79.0	79.0					12																	89819150		2203	4300	6503	POC1B	SO:0001583	missense	0			-	HGNC	AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.1120G>A	12.37:g.89819150C>T	ENSP00000323302:p.Glu374Lys	Somatic	0	44	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	29	45.28	G3V1X0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E374K	ENST00000313546.3	37	c.1120	CCDS31869.1	12	.	.	.	.	.	.	.	.	.	.	C	1.546	-0.540378	0.04053	.	.	ENSG00000139323	ENST00000393179;ENST00000313546;ENST00000549035	T;T;T	0.48201	0.82;0.82;0.82	5.41	4.49	0.54785	.	0.732240	0.13445	N	0.387337	T	0.29749	0.0743	N	0.22421	0.69	0.25396	N	0.98849	B	0.17667	0.023	B	0.14023	0.01	T	0.13899	-1.0492	10	0.06365	T	0.9	.	11.2139	0.48815	0.0:0.801:0.199:0.0	.	374	Q8TC44	POC1B_HUMAN	K	244;374;332	ENSP00000376877:E244K;ENSP00000323302:E374K;ENSP00000447916:E332K	ENSP00000323302:E374K	E	-	1	0	POC1B	88343281	0.016000	0.18221	0.150000	0.22450	0.060000	0.15804	2.268000	0.43338	2.816000	0.96949	0.563000	0.77884	GAA	-	NULL		0.363	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC1B	protein_coding	OTTHUMT00000406637.1	C	NM_172240	-		89819150	-1	no_errors	ENST00000313546	ensembl	human	known	74_37	missense	SNP	0.027	T
ZAP70	7535	genome.wustl.edu	37	2	98354224	98354224	+	Missense_Mutation	SNP	G	G	A	rs150631046		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr2:98354224G>A	ENST00000264972.5	+	12	1702	c.1487G>A	c.(1486-1488)cGc>cAc	p.R496H	ZAP70_ENST00000451498.2_Missense_Mutation_p.R189H|ZAP70_ENST00000463643.1_3'UTR|ZAP70_ENST00000442208.1_Missense_Mutation_p.R370H	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa	496	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CCCCAGGCCCGCTCAGCAGGG	0.627																																																	0								ENSG00000115085	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	78.0	88.0	85.0		1487,566	5.2	1.0	2	dbSNP_134	85	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZAP70	NM_001079.3,NM_207519.1	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	496/620,189/313	98354224	1,13005	2203	4300	6503	ZAP70	SO:0001583	missense	0			-	HGNC	L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.1487G>A	2.37:g.98354224G>A	ENSP00000264972:p.Arg496His	Somatic	0	18	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	18	36.67	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.R496H	ENST00000264972.5	37	c.1487	CCDS33254.1	2	.	.	.	.	.	.	.	.	.	.	G	21.8	4.206886	0.79127	0.0	1.16E-4	ENSG00000115085	ENST00000264972;ENST00000442208;ENST00000451498	D;D;D	0.83250	-1.7;-1.7;-1.7	5.2	5.2	0.72013	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44902	D	0.000406	T	0.80839	0.4700	N	0.24115	0.695	0.51233	D	0.99991	D;D	0.76494	0.999;0.999	P;D	0.62955	0.864;0.909	T	0.75371	-0.3341	10	0.15952	T	0.53	.	10.1268	0.42654	0.0915:0.0:0.9085:0.0	.	370;496	P43403-3;P43403	.;ZAP70_HUMAN	H	496;370;189	ENSP00000264972:R496H;ENSP00000411141:R370H;ENSP00000400475:R189H	ENSP00000264972:R496H	R	+	2	0	ZAP70	97720656	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.334000	0.72944	2.610000	0.88304	0.655000	0.94253	CGC	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_Prot_kinase_dom		0.627	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAP70	protein_coding	OTTHUMT00000329278.1	G		rs150631046		98354224	+1	no_errors	ENST00000264972	ensembl	human	known	74_37	missense	SNP	1.000	A
PRPF8	10594	genome.wustl.edu	37	17	1584027	1584027	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr17:1584027G>A	ENST00000572621.1	-	7	1356	c.1091C>T	c.(1090-1092)tCa>tTa	p.S364L	PRPF8_ENST00000304992.6_Missense_Mutation_p.S364L			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	364					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CACCTTGACTGAGTGCCTATG	0.478																																																	0								ENSG00000174231						104.0	95.0	98.0					17																	1584027		2203	4300	6503	PRPF8	SO:0001583	missense	0			-	HGNC	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.1091C>T	17.37:g.1584027G>A	ENSP00000460348:p.Ser364Leu	Somatic	0	39	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	41	29.31	O14547|O75965	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_PRO8NT,pfam_Prp8_U5-snRNA-bd,pfam_PROCT,pfam_RRM_spliceosomal_PrP8,pfam_JAB_MPN_dom,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB_MPN_dom	p.S364L	ENST00000572621.1	37	c.1091	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	G	15.71	2.912569	0.52439	.	.	ENSG00000174231	ENST00000304992	T	0.80123	-1.34	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.69700	0.3140	N	0.17312	0.475	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.62886	-0.6759	10	0.20046	T	0.44	.	19.7207	0.96142	0.0:0.0:1.0:0.0	.	364	Q6P2Q9	PRP8_HUMAN	L	364	ENSP00000304350:S364L	ENSP00000304350:S364L	S	-	2	0	PRPF8	1530777	1.000000	0.71417	0.952000	0.39060	0.371000	0.29859	9.819000	0.99357	2.647000	0.89833	0.650000	0.86243	TCA	-	NULL		0.478	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	protein_coding	OTTHUMT00000438412.2	G		-		1584027	-1	no_errors	ENST00000304992	ensembl	human	known	74_37	missense	SNP	1.000	A
GPR37	2861	genome.wustl.edu	37	7	124387397	124387397	+	Splice_Site	SNP	C	C	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr7:124387397C>A	ENST00000303921.2	-	2	1674	c.1024G>T	c.(1024-1026)Gtc>Ttc	p.V342F		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	342					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AGAGAAGCGACCTGTGGGGGA	0.448																																																	0								ENSG00000170775						49.0	51.0	50.0					7																	124387397		2203	4300	6503	GPR37	SO:0001630	splice_region_variant	0			-	HGNC		CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1024-1G>T	7.37:g.124387397C>A		Somatic	0	48	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	17	61.36	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR37_orph,prints_GPCR_Rhodpsn	p.V342F	ENST00000303921.2	37	c.1024	CCDS5792.1	7	.	.	.	.	.	.	.	.	.	.	C	12.48	1.950996	0.34471	.	.	ENSG00000170775	ENST00000303921	T	0.74315	-0.83	5.77	4.88	0.63580	GPCR, rhodopsin-like superfamily (1);	0.098140	0.43260	D	0.000589	D	0.83885	0.5351	M	0.78916	2.43	0.54753	D	0.999986	D	0.71674	0.998	D	0.72982	0.979	D	0.84722	0.0740	10	0.66056	D	0.02	-18.798	8.8001	0.34903	0.1511:0.7746:0.0:0.0743	.	342	O15354	GPR37_HUMAN	F	342	ENSP00000306449:V342F	ENSP00000306449:V342F	V	-	1	0	GPR37	124174633	1.000000	0.71417	0.888000	0.34837	0.009000	0.06853	6.091000	0.71406	1.423000	0.47198	-0.182000	0.12963	GTC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.448	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	protein_coding	OTTHUMT00000347873.1	C	NM_005302	-	Missense_Mutation	124387397	-1	no_errors	ENST00000303921	ensembl	human	known	74_37	missense	SNP	1.000	A
SPTAN1	6709	genome.wustl.edu	37	9	131347005	131347019	+	In_Frame_Del	DEL	GATTTAATTGGGGTC	GATTTAATTGGGGTC	-			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	GATTTAATTGGGGTC	GATTTAATTGGGGTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr9:131347005_131347019delGATTTAATTGGGGTC	ENST00000372731.4	+	18	2553_2567	c.2443_2457delGATTTAATTGGGGTC	c.(2443-2457)gatttaattggggtcdel	p.DLIGV815del	SPTAN1_ENST00000372739.3_In_Frame_Del_p.DLIGV815del|SPTAN1_ENST00000358161.5_In_Frame_Del_p.DLIGV815del	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	815					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TTCAGGTAAGGATTTAATTGGGGTCCAGAATCTGC	0.447																																					NSCLC(120;833 1744 2558 35612 37579)												0								ENSG00000197694																																			SPTAN1	SO:0001651	inframe_deletion	0				HGNC	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.2443_2457delGATTTAATTGGGGTC	9.37:g.131347005_131347019delGATTTAATTGGGGTC	ENSP00000361816:p.Asp815_Val819del	Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.DLIGV815in_frame_del	ENST00000372731.4	37	c.2443_2457	CCDS6905.1	9																																																																																			-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.447	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	protein_coding	OTTHUMT00000054472.1	GATTTAATTGGGGTC	NM_003127			131347019	+1	no_errors	ENST00000358161	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:0.992:0.988:1.000:0.997:1.000:0.998:0.997:1.000:1.000:0.254:1.000:1.000:1.000	-
TSR1	55720	genome.wustl.edu	37	17	2235463	2235463	+	Splice_Site	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr17:2235463C>T	ENST00000301364.5	-	8	2575	c.1496G>A	c.(1495-1497)cGa>cAa	p.R499Q	SNORD91A_ENST00000390861.1_RNA|SNORD91B_ENST00000391250.1_RNA	NM_018128.4	NP_060598.3	Q2NL82	TSR1_HUMAN	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)	499					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	20						GTTGACTAACCGAATTCGAGC	0.398																																																	0								ENSG00000167721						99.0	99.0	99.0					17																	2235463		2203	4300	6503	TSR1	SO:0001630	splice_region_variant	0			-	HGNC	AK026565	CCDS32525.1	17p13.3	2006-04-20	2006-04-20			ENSG00000167721			25542	protein-coding gene	gene with protein product		611214	"""TSR1, 20S rRNA accumulation, homolog (yeast)"""			10718198	Standard	NM_018128		Approved	FLJ10534	uc002fuj.3	Q2NL82		ENST00000301364.5:c.1496+1G>A	17.37:g.2235463C>T		Somatic	0	114	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	64	14.67	Q8WUY5|Q9NVT0|Q9P2E6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BMS1_TSR1_C,pfam_AARP2CN,superfamily_Transl_B-barrel,smart_AARP2CN	p.R499Q	ENST00000301364.5	37	c.1496	CCDS32525.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.533709	0.96460	.	.	ENSG00000167721	ENST00000301364	T	0.19669	2.13	5.05	5.05	0.67936	Ribosome biogenesis protein BMS1/TSR1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.61527	0.2354	H	0.96398	3.815	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75961	-0.3133	9	.	.	.	-5.4581	17.3751	0.87390	0.0:1.0:0.0:0.0	.	499	Q2NL82	TSR1_HUMAN	Q	499	ENSP00000301364:R499Q	.	R	-	2	0	TSR1	2182213	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.900000	0.75687	2.370000	0.80446	0.555000	0.69702	CGA	-	pfam_BMS1_TSR1_C		0.398	TSR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSR1	protein_coding	OTTHUMT00000438180.2	C	NM_018128	-	Missense_Mutation	2235463	-1	no_errors	ENST00000301364	ensembl	human	known	74_37	missense	SNP	1.000	T
PCDHB4	56131	genome.wustl.edu	37	5	140503386	140503386	+	Silent	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr5:140503386G>A	ENST00000194152.1	+	1	1806	c.1806G>A	c.(1804-1806)tcG>tcA	p.S602S		NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	602	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGGCTGTCGTACCAGCTGC	0.726																																																	0								ENSG00000081818						16.0	16.0	16.0					5																	140503386		2010	4020	6030	PCDHB4	SO:0001819	synonymous_variant	0			-	HGNC	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.1806G>A	5.37:g.140503386G>A		Somatic	0	99	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	74	32.73	Q4V761	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S602	ENST00000194152.1	37	c.1806	CCDS4246.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.726	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	protein_coding	OTTHUMT00000251812.2	G	NM_018938	-		140503386	+1	no_errors	ENST00000194152	ensembl	human	known	74_37	silent	SNP	0.998	A
GNAS	2778	genome.wustl.edu	37	20	57464277	57464278	+	5'Flank	INS	-	-	CGGCG	rs370277950|rs143800311	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr20:57464277_57464278insCGGCG	ENST00000371085.3	+	0	0				RP1-309F20.3_ENST00000424434.1_RNA|GNAS_ENST00000371100.4_Intron|GNAS_ENST00000354359.7_5'Flank|GNAS_ENST00000371095.3_5'Flank|GNAS_ENST00000371081.1_5'Flank|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371102.4_Intron|GNAS_ENST00000265620.7_5'Flank|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371098.2_Intron|RP1-309F20.3_ENST00000441270.2_RNA|GNAS_ENST00000306090.10_5'Flank|GNAS_ENST00000464624.2_Intron	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus						activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			AGGTGGCTGGCCGGCGCGGCGC	0.792			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)				2796	0.558307	0.4145	0.5764	5008	,	,		4078	0.6994		0.5348	False		,,,				2504	0.6186				Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0								ENSG00000087460																																			GNAS	SO:0001631	upstream_gene_variant	0				HGNC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069		20.37:g.57464283_57464287dupCGGCG	Exception_encountered	Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371085.3	37	NULL	CCDS13472.1	20																																																																																			-	-		0.792	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	protein_coding	OTTHUMT00000080431.2	-	NM_000516			57464278	+1	no_errors	ENST00000469431	ensembl	human	known	74_37	rna	INS	0.949:0.921	CGGCG
PCNT	5116	genome.wustl.edu	37	21	47819574	47819574	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr21:47819574C>T	ENST00000359568.5	+	25	4762	c.4655C>T	c.(4654-4656)tCg>tTg	p.S1552L	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	1552					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					CAGAAAGAGTCGGCAGATAGA	0.378																																																	0								ENSG00000160299						99.0	106.0	104.0					21																	47819574		2203	4300	6503	PCNT	SO:0001583	missense	0			-	HGNC	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.4655C>T	21.37:g.47819574C>T	ENSP00000352572:p.Ser1552Leu	Somatic	0	72	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	4	85.19	O43152|Q7Z7C9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PACT_domain	p.S1552L	ENST00000359568.5	37	c.4655	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	C	0.936	-0.711223	0.03230	.	.	ENSG00000160299	ENST00000359568	T	0.53423	0.62	5.74	3.39	0.38822	.	1.856150	0.04108	N	0.314038	T	0.19967	0.0480	N	0.00690	-1.25	0.09310	N	0.999991	B;B	0.12630	0.006;0.003	B;B	0.01281	0.0;0.0	T	0.18555	-1.0333	10	0.26408	T	0.33	.	7.4418	0.27187	0.0:0.1963:0.0:0.8037	.	1434;1552	O95613-2;O95613	.;PCNT_HUMAN	L	1552	ENSP00000352572:S1552L	ENSP00000352572:S1552L	S	+	2	0	PCNT	46644002	0.126000	0.22350	0.015000	0.15790	0.738000	0.42128	0.775000	0.26689	0.444000	0.26612	-0.310000	0.09108	TCG	-	NULL		0.378	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	protein_coding	OTTHUMT00000207336.1	C	NM_006031	-		47819574	+1	no_errors	ENST00000359568	ensembl	human	known	74_37	missense	SNP	0.515	T
LNX2	222484	genome.wustl.edu	37	13	28122567	28122567	+	Missense_Mutation	SNP	C	C	T	rs35562382	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr13:28122567C>T	ENST00000316334.3	-	10	2107	c.1978G>A	c.(1978-1980)Gtg>Atg	p.V660M		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	660	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		CTCATGCCCACGGTTGACAGC	0.443													C|||	9	0.00179712	0.0	0.0	5008	,	,		19586	0.001		0.0	False		,,,				2504	0.0082																0								ENSG00000139517						99.0	79.0	85.0					13																	28122567		2203	4300	6503	LNX2	SO:0001583	missense	0			-	HGNC	AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.1978G>A	13.37:g.28122567C>T	ENSP00000325929:p.Val660Met	Somatic	0	59	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	15	55.88	Q5W0P0|Q6ZMH2|Q96SH4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_Znf_C3HC4_RING-type,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.V660M	ENST00000316334.3	37	c.1978	CCDS9323.1	13	.	.	.	.	.	.	.	.	.	.	C	17.51	3.406687	0.62399	.	.	ENSG00000139517	ENST00000316334	T	0.29142	1.58	5.98	4.16	0.48862	PDZ/DHR/GLGF (4);	0.240031	0.42682	D	0.000674	T	0.28134	0.0694	L	0.52364	1.645	0.42593	D	0.993254	B	0.30236	0.274	B	0.26202	0.067	T	0.08889	-1.0700	10	0.39692	T	0.17	.	13.5367	0.61650	0.0:0.8115:0.1214:0.067	rs35562382	660	Q8N448	LNX2_HUMAN	M	660	ENSP00000325929:V660M	ENSP00000325929:V660M	V	-	1	0	LNX2	27020567	0.996000	0.38824	0.944000	0.38274	0.679000	0.39708	3.389000	0.52516	1.527000	0.49086	0.585000	0.79938	GTG	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.443	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX2	protein_coding	OTTHUMT00000044302.2	C		rs35562382		28122567	-1	no_errors	ENST00000316334	ensembl	human	known	74_37	missense	SNP	0.984	T
LINGO1	84894	genome.wustl.edu	37	15	77906434	77906434	+	Silent	SNP	G	G	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr15:77906434G>T	ENST00000355300.6	-	2	1989	c.1815C>A	c.(1813-1815)ggC>ggA	p.G605G	LINGO1_ENST00000561030.1_Silent_p.G599G	NM_032808.5	NP_116197.4	Q96FE5	LIGO1_HUMAN	leucine rich repeat and Ig domain containing 1	605					central nervous system neuron development (GO:0021954)|negative regulation of axonogenesis (GO:0050771)|negative regulation of oligodendrocyte differentiation (GO:0048715)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein kinase B signaling (GO:0043491)|regulation of axonogenesis (GO:0050770)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31						CGGAGCTGATGCCTGCGTCCG	0.652																																																	0								ENSG00000169783						50.0	53.0	52.0					15																	77906434		2041	4158	6199	LINGO1	SO:0001819	synonymous_variant	0			-	HGNC	AK027500	CCDS45313.1, CCDS73766.1	15q24	2013-01-11	2007-02-01	2007-02-01		ENSG00000169783		"""Immunoglobulin superfamily / I-set domain containing"""	21205	protein-coding gene	gene with protein product		609791	"""leucine rich repeat neuronal 6A"""	LRRN6A		14686891	Standard	XM_006720723		Approved	FLJ14594, LERN1	uc002bct.1	Q96FE5		ENST00000355300.6:c.1815C>A	15.37:g.77906434G>T		Somatic	0	29	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.86	D3DW80|Q6NUK3|Q6UXM3|Q6VVG0|Q6VVG1|Q6VVG2|Q8N3K5|Q96K52	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G605	ENST00000355300.6	37	c.1815	CCDS45313.1	15																																																																																			-	NULL		0.652	LINGO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO1	protein_coding	OTTHUMT00000419546.1	G	NM_032808	-		77906434	-1	no_errors	ENST00000355300	ensembl	human	known	74_37	silent	SNP	1.000	T
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147841	+	3'UTR	DEL	GTGTGT	GTGTGT	-	rs200264093|rs201814381|rs199597709|rs368179294|rs200969250|rs66612444		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	GTGTGT	GTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr2:50147836_50147841delGTGTGT	ENST00000406316.2	-	0	7151_7156				NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000401710.1_3'UTR|NRXN1_ENST00000404971.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgt	0.398																																																	0								ENSG00000179915																																			NRXN1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACAC>-	2.37:g.50147842_50147847delGTGTGT		Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.398	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	GTGTGT				50147841	-1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.005:0.106:0.113:0.127	-
ENAM	10117	genome.wustl.edu	37	4	71509959	71509959	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr4:71509959G>A	ENST00000396073.3	+	9	3097	c.2816G>A	c.(2815-2817)aGg>aAg	p.R939K	ENAM_ENST00000472903.1_Intron	NM_031889.2	NP_114095.2	Q9NRM1	ENAM_HUMAN	enamelin	939					amelogenesis (GO:0097186)|biomineral tissue development (GO:0031214)	proteinaceous extracellular matrix (GO:0005578)				haematopoietic_and_lymphoid_tissue(1)|ovary(3)|upper_aerodigestive_tract(2)	6			Lung(101;0.235)			TCAGAGAAGAGGGAAAGCCAA	0.453																																																	0								ENSG00000132464						107.0	101.0	103.0					4																	71509959		2203	4300	6503	ENAM	SO:0001583	missense	0			-	HGNC	AF125373	CCDS3544.2	4q13.3	2008-02-05			ENSG00000132464	ENSG00000132464			3344	protein-coding gene	gene with protein product		606585	"""amelogenesis imperfecta 2, hypocalcification (autosomal dominant)"""	AIH2		11978766	Standard	NM_031889		Approved		uc011caw.1	Q9NRM1	OTTHUMG00000129914	ENST00000396073.3:c.2816G>A	4.37:g.71509959G>A	ENSP00000379383:p.Arg939Lys	Somatic	0	79	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	Q17RI5|Q9H3D1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R939K	ENST00000396073.3	37	c.2816	CCDS3544.2	4	.	.	.	.	.	.	.	.	.	.	G	0.956	-0.704765	0.03255	.	.	ENSG00000132464	ENST00000396073	T	0.28454	1.61	5.97	-2.42	0.06542	.	0.550558	0.17770	N	0.162631	T	0.24122	0.0584	M	0.63428	1.95	0.09310	N	1	B	0.16802	0.019	B	0.23419	0.046	T	0.23048	-1.0199	10	0.27785	T	0.31	-0.5229	5.5611	0.17144	0.0725:0.4188:0.3012:0.2076	.	939	Q9NRM1	ENAM_HUMAN	K	939	ENSP00000379383:R939K	ENSP00000379383:R939K	R	+	2	0	ENAM	71728823	0.001000	0.12720	0.334000	0.25495	0.051000	0.14879	-0.405000	0.07196	-0.383000	0.07858	-0.808000	0.03180	AGG	-	NULL		0.453	ENAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENAM	protein_coding	OTTHUMT00000252166.3	G	NM_031889	-		71509959	+1	no_errors	ENST00000396073	ensembl	human	known	74_37	missense	SNP	0.031	A
MYH7	4625	genome.wustl.edu	37	14	23900812	23900812	+	Silent	SNP	G	G	A	rs202141819		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr14:23900812G>A	ENST00000355349.3	-	8	876	c.714C>T	c.(712-714)aaC>aaT	p.N238N		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	238	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.N238K(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		AGGAGTTGTCGTTCCGGACGG	0.597																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000092054	G		0,4406		0,0,2203	182.0	170.0	174.0		714	-3.8	1.0	14		174	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MYH7	NM_000257.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		238/1936	23900812	1,13005	2203	4300	6503	MYH7	SO:0001819	synonymous_variant	0			-	HGNC	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.714C>T	14.37:g.23900812G>A		Somatic	0	44	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	21	38.24	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.N238	ENST00000355349.3	37	c.714	CCDS9601.1	14																																																																																			-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	protein_coding	OTTHUMT00000071798.3	G	NM_000257	rs202141819		23900812	-1	no_errors	ENST00000355349	ensembl	human	known	74_37	silent	SNP	1.000	A
AKNAD1	254268	genome.wustl.edu	37	1	109400924	109400925	+	5'Flank	DEL	TT	TT	-			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr1:109400924_109400925delTT	ENST00000370001.3	-	0	0				SPATA42_ENST00000369989.2_RNA|AKNAD1_ENST00000369995.3_5'Flank|SPATA42_ENST00000417241.1_RNA|AKNAD1_ENST00000357393.4_Intron	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1							cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						AACTTTTGTCTTTTTTTTTTTT	0.361																																																	0								ENSG00000203897																																			SPATA42	SO:0001631	upstream_gene_variant	0				HGNC	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231		1.37:g.109400934_109400935delTT	Exception_encountered	Somatic	0	21	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	13	13.33	B9EK62|Q5T1N0|Q8N990|Q8NCN9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370001.3	37	NULL	CCDS791.2	1																																																																																			-	-		0.361	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA42	protein_coding	OTTHUMT00000030923.2	TT	NM_152763			109400925	+1	no_errors	ENST00000417241	ensembl	human	known	74_37	rna	DEL	0.000:0.001	-
NISCH	11188	genome.wustl.edu	37	3	52506402	52506407	+	In_Frame_Del	DEL	GCATCA	GCATCA	-			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	GCATCA	GCATCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr3:52506402_52506407delGCATCA	ENST00000479054.1	+	7	729_734	c.657_662delGCATCA	c.(655-663)ctgcatcag>ctg	p.HQ220del	NISCH_ENST00000488380.1_In_Frame_Del_p.HQ220del|NISCH_ENST00000420808.2_In_Frame_Del_p.HQ220del|NISCH_ENST00000345716.4_In_Frame_Del_p.HQ220del			Q9Y2I1	NISCH_HUMAN	nischarin	220	Necessary for homooligomerization and targeting to endosomes.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	TCAAGTCCCTGCATCAGGTGGAGGTA	0.505											OREG0015615	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000010322																																			NISCH	SO:0001651	inframe_deletion	0				HGNC	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.657_662delGCATCA	3.37:g.52506402_52506407delGCATCA	ENSP00000418232:p.His220_Gln221del	Somatic	NA	NA	NA	985	0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Phox,pfam_Leu-rich_rpt,superfamily_Phox,smart_Phox,pfscan_Phox	p.HQ220in_frame_del	ENST00000479054.1	37	c.657_662	CCDS33767.1	3																																																																																			-	NULL		0.505	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NISCH	protein_coding	OTTHUMT00000351357.1	GCATCA	NM_007184			52506407	+1	no_errors	ENST00000345716	ensembl	human	known	74_37	in_frame_del	DEL	0.940:0.998:0.990:0.987:1.000:1.000	-
GOLGA1	2800	genome.wustl.edu	37	9	127660878	127660878	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr9:127660878C>A	ENST00000373555.4	-	15	1690	c.1357G>T	c.(1357-1359)Gaa>Taa	p.E453*	AL354928.1_ENST00000580940.1_RNA	NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	453	Gln-rich.				protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						CGTTCATATTCATTCCTGCAT	0.338																																																	0								ENSG00000136935						171.0	169.0	170.0					9																	127660878		2203	4299	6502	GOLGA1	SO:0001587	stop_gained	0			-	HGNC	U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.1357G>T	9.37:g.127660878C>A	ENSP00000362656:p.Glu453*	Somatic	0	85	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	70	18.60	Q5T164|Q8IYZ9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GRIP,superfamily_Prefoldin,superfamily_GRIP,smart_GRIP,pfscan_GRIP	p.E453*	ENST00000373555.4	37	c.1357	CCDS6860.1	9	.	.	.	.	.	.	.	.	.	.	C	39	7.331978	0.98217	.	.	ENSG00000136935	ENST00000373555	.	.	.	5.44	5.44	0.79542	.	0.000000	0.47852	D	0.000201	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-17.1801	15.1232	0.72460	0.0:1.0:0.0:0.0	.	.	.	.	X	453	.	ENSP00000362656:E453X	E	-	1	0	GOLGA1	126700699	1.000000	0.71417	0.996000	0.52242	0.602000	0.36980	2.527000	0.45615	2.695000	0.91970	0.655000	0.94253	GAA	-	NULL		0.338	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA1	protein_coding	OTTHUMT00000054049.1	C	NM_002077	-		127660878	-1	no_errors	ENST00000373555	ensembl	human	known	74_37	nonsense	SNP	1.000	A
OSBP2	23762	genome.wustl.edu	37	22	31266576	31266576	+	Silent	SNP	C	C	T	rs149092338		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr22:31266576C>T	ENST00000332585.6	+	3	1118	c.1014C>T	c.(1012-1014)gaC>gaT	p.D338D	OSBP2_ENST00000407373.1_Silent_p.D165D|OSBP2_ENST00000401475.1_5'UTR|OSBP2_ENST00000403222.3_Silent_p.D173D|OSBP2_ENST00000446658.2_Silent_p.D338D|OSBP2_ENST00000382310.3_Silent_p.D338D|OSBP2_ENST00000437268.2_Silent_p.D80D	NM_001282739.1|NM_001282740.1|NM_001282741.1|NM_001282742.1|NM_030758.3	NP_001269668.1|NP_001269669.1|NP_001269670.1|NP_001269671.1|NP_110385.1	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2	338					lipid transport (GO:0006869)	membrane (GO:0016020)	cholesterol binding (GO:0015485)	p.D338D(1)		breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(6)|ovary(1)|skin(3)|urinary_tract(1)	19						CAGAGCTGGACGGCCTCAAGA	0.557																																																	1	Substitution - coding silent(1)	skin(1)						ENSG00000184792						55.0	63.0	61.0					22																	31266576		2143	4236	6379	OSBP2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS43002.1, CCDS63448.1, CCDS63449.1, CCDS63450.1, CCDS63451.1	22q12.2	2013-01-10			ENSG00000184792	ENSG00000184792		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8504	protein-coding gene	gene with protein product		606729		OSBPL1		10591208, 11278871, 11802775	Standard	NM_001282738		Approved	KIAA1664, ORP-4, ORP4	uc003aiy.1	Q969R2	OTTHUMG00000151153	ENST00000332585.6:c.1014C>T	22.37:g.31266576C>T		Somatic	0	34	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	20	33.33	B0QYG1|B4DK24|B4DKE4|B4DTR3|F5H2A3|O60396|Q0VF99|Q8NA37|Q9BY96|Q9BZF0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,superfamily_DNA-bd_dom_put,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D338	ENST00000332585.6	37	c.1014	CCDS43002.1	22																																																																																			-	NULL		0.557	OSBP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBP2	protein_coding	OTTHUMT00000321547.2	C	NM_030758	rs149092338		31266576	+1	no_errors	ENST00000332585	ensembl	human	known	74_37	silent	SNP	0.958	T
LRRC46	90506	genome.wustl.edu	37	17	45914249	45914249	+	Silent	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr17:45914249C>T	ENST00000269025.4	+	8	1092	c.729C>T	c.(727-729)ccC>ccT	p.P243P		NM_033413.3	NP_219481.1	Q96FV0	LRC46_HUMAN	leucine rich repeat containing 46	243										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	9						CTGGGGTGCCCATGGCTGGGG	0.667																																																	0								ENSG00000141294						62.0	64.0	63.0					17																	45914249		2203	4299	6502	LRRC46	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11518.1	17q21.32	2005-08-09				ENSG00000141294			25047	protein-coding gene	gene with protein product						12477932	Standard	NM_033413		Approved	MGC16309	uc002ima.3	Q96FV0		ENST00000269025.4:c.729C>T	17.37:g.45914249C>T		Somatic	0	67	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	15.22	A8K9Q0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P243	ENST00000269025.4	37	c.729	CCDS11518.1	17																																																																																			-	NULL		0.667	LRRC46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC46	protein_coding	OTTHUMT00000441377.1	C	NM_033413	-		45914249	+1	no_errors	ENST00000269025	ensembl	human	known	74_37	silent	SNP	0.012	T
MGAT5B	146664	genome.wustl.edu	37	17	74878347	74878347	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr17:74878347G>A	ENST00000569840.2	+	3	870	c.296G>A	c.(295-297)cGg>cAg	p.R99Q	MGAT5B_ENST00000374998.3_3'UTR|MGAT5B_ENST00000565675.1_Missense_Mutation_p.R99Q|MGAT5B_ENST00000428789.2_Missense_Mutation_p.R110Q|MGAT5B_ENST00000301618.4_Missense_Mutation_p.R99Q	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	99					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GAGCTGCACCGGGCCGGCGGC	0.687																																																	0								ENSG00000167889						25.0	23.0	24.0					17																	74878347		2202	4297	6499	MGAT5B	SO:0001583	missense	0			-	HGNC	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.296G>A	17.37:g.74878347G>A	ENSP00000456037:p.Arg99Gln	Somatic	0	62	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	24	61.90	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PyrdxlP-dep_Trfase	p.R110Q	ENST00000569840.2	37	c.329	CCDS59299.1	17	.	.	.	.	.	.	.	.	.	.	G	16.04	3.009171	0.54361	.	.	ENSG00000167889	ENST00000374998;ENST00000301618;ENST00000428789	T;T	0.52057	0.7;0.68	5.23	5.23	0.72850	.	0.221607	0.34178	N	0.004193	T	0.59115	0.2170	L	0.47716	1.5	0.49915	D	0.999835	D;D	0.89917	1.0;0.998	D;D	0.81914	0.995;0.986	T	0.51756	-0.8665	10	0.19590	T	0.45	-24.8568	14.2918	0.66284	0.0:0.0:1.0:0.0	.	110;99	Q3V5L5-2;Q3V5L5-5	.;.	Q	99;99;110	ENSP00000301618:R99Q;ENSP00000391227:R110Q	ENSP00000301618:R99Q	R	+	2	0	MGAT5B	72389942	0.925000	0.31364	0.945000	0.38365	0.053000	0.15095	2.707000	0.47143	2.428000	0.82296	0.561000	0.74099	CGG	-	NULL		0.687	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGAT5B	protein_coding	OTTHUMT00000460624.2	G	NM_144677	-		74878347	+1	no_errors	ENST00000428789	ensembl	human	known	74_37	missense	SNP	1.000	A
GATAD2A	54815	genome.wustl.edu	37	19	19612198	19612198	+	Silent	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr19:19612198C>T	ENST00000360315.3	+	9	1785	c.1473C>T	c.(1471-1473)acC>acT	p.T491T	GATAD2A_ENST00000358713.3_Silent_p.T491T|GATAD2A_ENST00000537887.1_Silent_p.T120T|GATAD2A_ENST00000252577.5_Silent_p.T491T|GATAD2A_ENST00000429563.2_Silent_p.T319T|GATAD2A_ENST00000404158.1_Silent_p.T492T	NM_017660.3	NP_060130.3	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A	491					anterior neuropore closure (GO:0021506)|blood vessel development (GO:0001568)|DNA methylation (GO:0006306)|embryonic body morphogenesis (GO:0010172)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|neural fold formation (GO:0001842)|programmed cell death (GO:0012501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|NuRD complex (GO:0016581)	protein binding, bridging (GO:0030674)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.T491T(1)|p.T348T(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13						CCGAGCCCACCGCTGCCCCAC	0.697																																																	2	Substitution - coding silent(2)	lung(2)						ENSG00000167491						9.0	9.0	9.0					19																	19612198		2183	4259	6442	GATAD2A	SO:0001819	synonymous_variant	0			-	HGNC	AL390164	CCDS12402.2	19p13.11	2013-01-25			ENSG00000167491	ENSG00000167491		"""GATA zinc finger domain containing"""	29989	protein-coding gene	gene with protein product	"""p66 alpha"""	614997				12183469	Standard	NM_017660		Approved	p66alpha	uc010xqt.2	Q86YP4	OTTHUMG00000152541	ENST00000360315.3:c.1473C>T	19.37:g.19612198C>T		Somatic	0	20	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58	B5MC40|Q7L3J2|Q96F28|Q9NPU2|Q9NXS1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_GATA,pfscan_Znf_GATA	p.T491	ENST00000360315.3	37	c.1473	CCDS12402.2	19	.	.	.	.	.	.	.	.	.	.	C	3.789	-0.044037	0.07452	.	.	ENSG00000167491	ENST00000418032	.	.	.	3.92	-4.03	0.04021	.	.	.	.	.	T	0.20129	0.0484	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.29518	-1.0009	4	.	.	.	-26.7577	3.8941	0.09131	0.2739:0.2804:0.0:0.4457	.	.	.	.	C	118	.	.	R	+	1	0	GATAD2A	19473198	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.812000	0.04496	-0.608000	0.05731	-0.148000	0.13756	CGC	-	NULL		0.697	GATAD2A-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATAD2A	protein_coding	OTTHUMT00000326671.4	C	NM_017660	-		19612198	+1	no_errors	ENST00000358713	ensembl	human	known	74_37	silent	SNP	0.000	T
MUC17	140453	genome.wustl.edu	37	7	100681044	100681044	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr7:100681044G>T	ENST00000306151.4	+	3	6411	c.6347G>T	c.(6346-6348)aGt>aTt	p.S2116I		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2116	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CCGGTGGCCAGTCCTGAGGCT	0.498																																																	0								ENSG00000169876						215.0	219.0	217.0					7																	100681044		2203	4300	6503	MUC17	SO:0001583	missense	0			-	HGNC	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6347G>T	7.37:g.100681044G>T	ENSP00000302716:p.Ser2116Ile	Somatic	0	67	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	46	19.30	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.S2116I	ENST00000306151.4	37	c.6347	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	0.474	-0.883070	0.02530	.	.	ENSG00000169876	ENST00000306151	T	0.02631	4.22	0.942	-1.88	0.07713	.	.	.	.	.	T	0.01387	0.0045	N	0.14661	0.345	0.09310	N	1	P	0.36222	0.544	B	0.25884	0.064	T	0.44877	-0.9299	9	0.40728	T	0.16	.	3.702	0.08386	0.0:0.3847:0.3909:0.2244	.	2116	Q685J3	MUC17_HUMAN	I	2116	ENSP00000302716:S2116I	ENSP00000302716:S2116I	S	+	2	0	MUC17	100467764	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.783000	0.01770	-0.987000	0.03494	0.134000	0.15878	AGT	-	NULL		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	protein_coding	OTTHUMT00000347161.1	G	NM_001040105	-		100681044	+1	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	SNP	0.000	T
HMGB3	3149	genome.wustl.edu	37	X	150155663	150155663	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chrX:150155663T>G	ENST00000325307.7	+	4	449	c.353T>G	c.(352-354)aTc>aGc	p.I118S	HMGB3_ENST00000448905.2_Missense_Mutation_p.I118S	NM_005342.2	NP_005333.2	O15347	HMGB3_HUMAN	high mobility group box 3	118					DNA recombination (GO:0006310)|multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)	8	Acute lymphoblastic leukemia(192;6.56e-05)					AACCCCGGCATCTCTATTGGA	0.433																																																	0								ENSG00000029993						45.0	44.0	45.0					X																	150155663		2199	4296	6495	HMGB3	SO:0001583	missense	0			-	HGNC	AF274572	CCDS35428.1	Xq28	2011-07-01	2011-04-05	2002-08-16	ENSG00000029993	ENSG00000029993		"""High-mobility group / Canonical"""	5004	protein-coding gene	gene with protein product	"""non-histone chromosomal protein"""	300193	"""high-mobility group (nonhistone chromosomal) protein 4"", ""high-mobility group box 3"""	HMG4		9598312	Standard	XM_005274665		Approved	HMG2A, MGC90319	uc004fep.3	O15347	OTTHUMG00000024162	ENST00000325307.7:c.353T>G	X.37:g.150155663T>G	ENSP00000359393:p.Ile118Ser	Somatic	0	58	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	20	47.37	O95556|Q6NS40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.I118S	ENST00000325307.7	37	c.353	CCDS35428.1	X	.	.	.	.	.	.	.	.	.	.	t	23.5	4.421537	0.83559	.	.	ENSG00000029993	ENST00000419110;ENST00000325307;ENST00000455596;ENST00000448905;ENST00000430118	D;D;D;D;D	0.98249	-4.82;-4.82;-4.82;-4.82;-4.82	4.95	4.95	0.65309	High mobility group, HMG1/HMG2, subgroup (1);High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.141454	0.47852	D	0.000217	D	0.97917	0.9315	L	0.47716	1.5	0.49389	D	0.999782	D	0.64830	0.994	P	0.60886	0.88	D	0.98395	1.0565	10	0.66056	D	0.02	.	12.8894	0.58064	0.0:0.0:0.0:1.0	.	118	O15347	HMGB3_HUMAN	S	118	ENSP00000410354:I118S;ENSP00000359393:I118S;ENSP00000405601:I118S;ENSP00000442758:I118S;ENSP00000417027:I118S	ENSP00000359393:I118S	I	+	2	0	HMGB3	149906321	1.000000	0.71417	0.995000	0.50966	0.977000	0.68977	7.884000	0.87274	1.633000	0.50488	0.430000	0.28490	ATC	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom		0.433	HMGB3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HMGB3	protein_coding	OTTHUMT00000060867.1	T	NM_005342	-		150155663	+1	no_errors	ENST00000325307	ensembl	human	known	74_37	missense	SNP	1.000	G
SPTAN1	6709	genome.wustl.edu	37	9	131347022	131347027	+	In_Frame_Del	DEL	GAATCT	GAATCT	-			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	GAATCT	GAATCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr9:131347022_131347027delGAATCT	ENST00000372731.4	+	18	2570_2575	c.2460_2465delGAATCT	c.(2458-2466)cagaatctg>cag	p.NL821del	SPTAN1_ENST00000372739.3_In_Frame_Del_p.NL821del|SPTAN1_ENST00000358161.5_In_Frame_Del_p.NL821del	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	821					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						TTGGGGTCCAGAATCTGCTAAAGAAA	0.451																																					NSCLC(120;833 1744 2558 35612 37579)												0								ENSG00000197694																																			SPTAN1	SO:0001651	inframe_deletion	0				HGNC	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.2460_2465delGAATCT	9.37:g.131347022_131347027delGAATCT	ENSP00000361816:p.Asn821_Leu822del	Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.NL821in_frame_del	ENST00000372731.4	37	c.2460_2465	CCDS6905.1	9																																																																																			-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.451	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	protein_coding	OTTHUMT00000054472.1	GAATCT	NM_003127			131347027	+1	no_errors	ENST00000358161	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:0.994:0.998:0.995	-
GATA2	2624	genome.wustl.edu	37	3	128199922	128199922	+	Silent	SNP	G	G	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr3:128199922G>C	ENST00000341105.2	-	6	1714	c.1383C>G	c.(1381-1383)ccC>ccG	p.P461P	GATA2_ENST00000489987.1_5'UTR|GATA2_ENST00000487848.1_Silent_p.P461P|GATA2_ENST00000430265.2_Silent_p.P447P	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2	461					blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		GGCTGGAGGAGGGGTGGATGG	0.682			Mis		AML(CML blast transformation)																																			Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	0								ENSG00000179348						51.0	50.0	51.0					3																	128199922		2203	4300	6503	GATA2	SO:0001819	synonymous_variant	0			-	HGNC	AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.1383C>G	3.37:g.128199922G>C		Somatic	0	27	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	26	21.21	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.P461	ENST00000341105.2	37	c.1383	CCDS3049.1	3																																																																																			-	pirsf_TF_GATA-1/2/3		0.682	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA2	protein_coding	OTTHUMT00000356925.1	G	NM_032638	-		128199922	-1	no_errors	ENST00000341105	ensembl	human	known	74_37	silent	SNP	0.967	C
CCNYL2	414194	genome.wustl.edu	37	10	42924563	42924564	+	RNA	INS	-	-	A	rs74262004|rs6143878	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr10:42924563_42924564insA	ENST00000483242.3	-	0	834_835					NR_103829.1		Q5T2Q4	CCYL2_HUMAN	cyclin Y-like 2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)			p.?(4)		breast(2)|endometrium(1)|lung(3)|ovary(1)	7						AAAAAGCTCACCTTTGCTTGAT	0.322																																																	4	Unknown(4)	breast(4)						ENSG00000182632																																			CCNYL2			0				HGNC	BC039000		10q11.21	2007-02-09	2007-02-09	2007-02-09	ENSG00000182632	ENSG00000182632			23495	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 21"""	C10orf21			Standard	NR_103829		Approved	bA178A10.2		Q5T2Q4	OTTHUMG00000018009		10.37:g.42924563_42924564insA		Somatic	0	213	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00		Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000483242.3	37	c.NULL		10																																																																																			-	-		0.322	CCNYL2-002	KNOWN	basic	processed_transcript	CCNYL2	pseudogene	OTTHUMT00000047670.5	-	XM_936368			42924564	-1	no_errors	ENST00000483242	ensembl	human	known	74_37	splice_site_ins	INS	1.000:1.000	A
KIAA0556	23247	genome.wustl.edu	37	16	27777745	27777745	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr16:27777745G>A	ENST00000261588.4	+	20	3944	c.3925G>A	c.(3925-3927)Ggc>Agc	p.G1309S		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1309						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AAGCATCGCAGGCCTGCGCTT	0.597																																																	0								ENSG00000047578						82.0	75.0	77.0					16																	27777745		2197	4300	6497	KIAA0556	SO:0001583	missense	0			-	HGNC	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3925G>A	16.37:g.27777745G>A	ENSP00000261588:p.Gly1309Ser	Somatic	0	30	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51	A7E2C2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Thaumatin	p.G1309S	ENST00000261588.4	37	c.3925	CCDS32415.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.756397	0.96898	.	.	ENSG00000047578	ENST00000261588	T	0.15256	2.44	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.44705	0.1306	M	0.75447	2.3	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.38650	-0.9651	10	0.66056	D	0.02	-10.3887	18.8967	0.92426	0.0:0.0:1.0:0.0	.	1309	O60303	K0556_HUMAN	S	1309	ENSP00000261588:G1309S	ENSP00000261588:G1309S	G	+	1	0	KIAA0556	27685246	1.000000	0.71417	0.979000	0.43373	0.976000	0.68499	9.669000	0.98622	2.558000	0.86282	0.591000	0.81541	GGC	-	NULL		0.597	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0556	protein_coding	OTTHUMT00000433724.1	G	NM_015202	-		27777745	+1	no_errors	ENST00000261588	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF850	342892	genome.wustl.edu	37	19	37266347	37266347	+	5'Flank	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr19:37266347G>A	ENST00000591344.1	-	0	0				ZNF850_ENST00000589390.1_5'Flank|CTD-2162K18.4_ENST00000590750.1_Missense_Mutation_p.A65T|CTD-2162K18.3_ENST00000588717.1_lincRNA	NM_001193552.1|NM_001267779.1	NP_001180481.1|NP_001254708.1	A8MQ14	ZN850_HUMAN	zinc finger protein 850						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										GAATTACTGTGCAAACACCCG	0.448																																																	0								ENSG00000267260																																			CTD-2162K18.4	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	BC052603	CCDS59379.1, CCDS74350.1	19q13.12	2013-01-08	2010-08-02	2010-08-02		ENSG00000267041		"""Zinc fingers, C2H2-type"", ""-"""	27994	protein-coding gene	gene with protein product			"""zinc finger protein 850 pseudogene"", ""zinc finger protein 850 (pseudogene)"""	ZNF850P		12477932	Standard	NM_001193552		Approved		uc010efc.3	A8MQ14			19.37:g.37266347G>A	Exception_encountered	Somatic	0	58	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	36	28.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A65T	ENST00000591344.1	37	c.193	CCDS59379.1	19																																																																																			-	NULL		0.448	ZNF850-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267260	protein_coding	OTTHUMT00000453557.1	G	XM_001720258	-		37266347	+1	no_errors	ENST00000590750	ensembl	human	putative	74_37	missense	SNP	0.013	A
SOX8	30812	genome.wustl.edu	37	16	1033836	1033836	+	Silent	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr16:1033836G>A	ENST00000293894.3	+	2	646	c.531G>A	c.(529-531)aaG>aaA	p.K177K	RP11-161M6.2_ENST00000565467.1_lincRNA	NM_014587.3	NP_055402.2	P57073	SOX8_HUMAN	SRY (sex determining region Y)-box 8	177					adipose tissue development (GO:0060612)|astrocyte fate commitment (GO:0060018)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|enteric nervous system development (GO:0048484)|fat cell differentiation (GO:0045444)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|metanephric nephron tubule formation (GO:0072289)|morphogenesis of a branching epithelium (GO:0061138)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|oligodendrocyte differentiation (GO:0048709)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of gliogenesis (GO:0014015)|positive regulation of kidney development (GO:0090184)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone levels (GO:0010817)|renal vesicle induction (GO:0072034)|retina development in camera-type eye (GO:0060041)|retinal rod cell differentiation (GO:0060221)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|spermatogenesis (GO:0007283)|ureter morphogenesis (GO:0072197)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|kidney(1)|lung(5)|prostate(2)|skin(1)	10		Hepatocellular(780;0.00308)				GGCGCAGGAAGAGCGCCAAAG	0.677																																																	0								ENSG00000005513						40.0	38.0	39.0					16																	1033836		2198	4294	6492	SOX8	SO:0001819	synonymous_variant	0			-	HGNC	AF164104	CCDS10428.1	16p13.3	2008-05-23			ENSG00000005513	ENSG00000005513		"""SRY (sex determining region Y)-boxes"""	11203	protein-coding gene	gene with protein product		605923				10662550, 10684944	Standard	NM_014587		Approved		uc002ckn.3	P57073	OTTHUMG00000122101	ENST00000293894.3:c.531G>A	16.37:g.1033836G>A		Somatic	0	72	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	90	12.62	Q9NZW2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,pfam_Sox_N,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.K177	ENST00000293894.3	37	c.531	CCDS10428.1	16																																																																																			-	NULL		0.677	SOX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX8	protein_coding	OTTHUMT00000242867.1	G		-		1033836	+1	no_errors	ENST00000293894	ensembl	human	known	74_37	silent	SNP	0.552	A
DNMT3A	1788	genome.wustl.edu	37	2	25469969	25469976	+	Frame_Shift_Del	DEL	GTGGCCTG	GTGGCCTG	-			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	GTGGCCTG	GTGGCCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr2:25469969_25469976delGTGGCCTG	ENST00000264709.3	-	9	1403_1410	c.1066_1073delCAGGCCAC	c.(1066-1074)caggccacgfs	p.QAT356fs	DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000380746.4_Frame_Shift_Del_p.QAT167fs|DNMT3A_ENST00000402667.1_Frame_Shift_Del_p.QAT133fs|DNMT3A_ENST00000321117.5_Frame_Shift_Del_p.QAT356fs	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	356	Interaction with DNMT1 and DNMT3B.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTTGTTGTACGTGGCCTGGTGGAACGCA	0.591			"""Mis, F, N, S"""		AML																																			Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0								ENSG00000119772																																			DNMT3A	SO:0001589	frameshift_variant	0				HGNC		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1066_1073delCAGGCCAC	2.37:g.25469969_25469976delGTGGCCTG	ENSP00000264709:p.Gln356fs	Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PWWP_dom,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,pfscan_PWWP_dom	p.Q356fs	ENST00000264709.3	37	c.1073_1066	CCDS33157.1	2																																																																																			-	pfam_PWWP_dom		0.591	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	protein_coding	OTTHUMT00000211587.1	GTGGCCTG	NM_022552			25469976	-1	no_errors	ENST00000264709	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
SPHKAP	80309	genome.wustl.edu	37	2	228973608	228973608	+	Silent	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr2:228973608C>T	ENST00000392056.3	-	3	232	c.186G>A	c.(184-186)caG>caA	p.Q62Q	SPHKAP_ENST00000344657.5_Silent_p.Q62Q	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	62						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCCTCTGATTCTGCAACCAGT	0.428																																																	0								ENSG00000153820						85.0	86.0	86.0					2																	228973608		2203	4300	6503	SPHKAP	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.186G>A	2.37:g.228973608C>T		Somatic	0	64	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	35	12.50	Q68DA3|Q68DR8|Q9C0I5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AKAP_110_C	p.Q62	ENST00000392056.3	37	c.186	CCDS46537.1	2																																																																																			-	NULL		0.428	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	C	NM_030623	-		228973608	-1	no_errors	ENST00000392056	ensembl	human	known	74_37	silent	SNP	1.000	T
ZNF705A	440077	genome.wustl.edu	37	12	8329703	8329703	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr12:8329703C>T	ENST00000359286.4	+	5	516	c.427C>T	c.(427-429)Ccc>Tcc	p.P143S		NM_001004328.2|NM_001278713.1	NP_001004328.1|NP_001265642.1	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	143					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|skin(3)|stomach(4)	18				Kidney(36;0.0877)		TGGAAAGAAACCCTATGTCAG	0.368																																																	0								ENSG00000196946						129.0	132.0	131.0					12																	8329703		2203	4300	6503	ZNF705A	SO:0001583	missense	0			-	HGNC	AK131339	CCDS31737.1	12p13.31	2014-02-12	2005-09-22		ENSG00000196946	ENSG00000196946		"""Zinc fingers, C2H2-type"", ""-"""	32281	protein-coding gene	gene with protein product							Standard	NM_001004328		Approved	FLJ16353	uc001qud.1	Q6ZN79	OTTHUMG00000168635	ENST00000359286.4:c.427C>T	12.37:g.8329703C>T	ENSP00000352233:p.Pro143Ser	Somatic	0	343	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	414	10.39		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P143S	ENST00000359286.4	37	c.427	CCDS31737.1	12	.	.	.	.	.	.	.	.	.	.	.	8.775	0.926768	0.18056	.	.	ENSG00000196946	ENST00000396570;ENST00000359286	T;T	0.06933	3.24;3.24	1.35	0.277	0.15668	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09468	0.0233	L	0.60904	1.88	0.22240	N	0.999269	B	0.28552	0.215	B	0.29440	0.102	T	0.26815	-1.0092	9	0.54805	T	0.06	.	6.9809	0.24702	0.0:0.7101:0.2899:0.0	.	143	Q6ZN79	Z705A_HUMAN	S	143	ENSP00000379816:P143S;ENSP00000352233:P143S	ENSP00000352233:P143S	P	+	1	0	ZNF705A	8220970	0.007000	0.16637	0.050000	0.19076	0.309000	0.27889	1.225000	0.32551	0.100000	0.17581	0.400000	0.26472	CCC	-	pfscan_Znf_C2H2		0.368	ZNF705A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF705A	protein_coding	OTTHUMT00000400449.1	C	NM_001004328	-		8329703	+1	no_errors	ENST00000359286	ensembl	human	known	74_37	missense	SNP	0.911	T
HELZ2	85441	genome.wustl.edu	37	20	62202614	62202614	+	Intron	SNP	C	C	T	rs76623277|rs111600442	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr20:62202614C>T	ENST00000467148.1	-	2	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GCTCCTGCCCCGCTCCAAGCT	0.692																																																	0								ENSG00000130589																																			HELZ2	SO:0001627	intron_variant	0			-	HGNC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.279-393G>A	20.37:g.62202614C>T		Somatic	0	16	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			-	-		0.692	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	C	NM_001037335	rs111600442		62202614	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	SNP	0.429	T
NOTCH1	4851	genome.wustl.edu	37	9	139401405	139401405	+	Missense_Mutation	SNP	C	C	T	rs112900950		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr9:139401405C>T	ENST00000277541.6	-	23	3739	c.3664G>A	c.(3664-3666)Gtg>Atg	p.V1222M		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1222	EGF-like 32; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CAGTCGTCCACGTTGATCTCA	0.672			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0								ENSG00000148400						12.0	15.0	14.0					9																	139401405		2022	4167	6189	NOTCH1	SO:0001583	missense	0			-	HGNC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.3664G>A	9.37:g.139401405C>T	ENSP00000277541:p.Val1222Met	Somatic	0	33	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	27	27.03	Q59ED8|Q5SXM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.V1222M	ENST00000277541.6	37	c.3664	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	C	10.40	1.340037	0.24339	.	.	ENSG00000148400	ENST00000277541	D	0.87650	-2.28	5.23	2.4	0.29515	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);	0.260386	0.36002	N	0.002857	T	0.81264	0.4786	L	0.43152	1.355	0.46849	D	0.999224	B	0.15719	0.014	B	0.19946	0.027	T	0.73219	-0.4052	10	0.54805	T	0.06	.	9.4627	0.38794	0.0:0.7703:0.0:0.2297	.	1222	P46531	NOTC1_HUMAN	M	1222	ENSP00000277541:V1222M	ENSP00000277541:V1222M	V	-	1	0	NOTCH1	138521226	0.749000	0.28305	0.849000	0.33467	0.077000	0.17291	0.091000	0.15046	0.226000	0.20979	0.655000	0.94253	GTG	-	smart_EGF-like_Ca-bd_dom,pirsf_Notch		0.672	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	protein_coding	OTTHUMT00000055087.1	C	NM_017617	rs112900950		139401405	-1	no_errors	ENST00000277541	ensembl	human	known	74_37	missense	SNP	1.000	T
DIAPH1	1729	genome.wustl.edu	37	5	140914027	140914027	+	Intron	SNP	T	T	C	rs559271636		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr5:140914027T>C	ENST00000398557.4	-	19	2623				DIAPH1_ENST00000518047.1_Intron|DIAPH1_ENST00000253811.6_Intron|DIAPH1_ENST00000398566.3_Intron|DIAPH1_ENST00000398562.2_Intron|DIAPH1_ENST00000389057.5_Intron|DIAPH1_ENST00000494967.1_5'UTR|DIAPH1_ENST00000520569.1_Intron|DIAPH1_ENST00000389054.3_Intron	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1						actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGAAAAGCATGATTAAAAGT	0.388													T|||	1	0.000199681	0.0008	0.0	5008	,	,		18686	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000131504						103.0	93.0	96.0					5																	140914027		1845	4104	5949	DIAPH1	SO:0001627	intron_variant	0			-	HGNC	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.2483-27A>G	5.37:g.140914027T>C		Somatic	0	62	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	30	53.12	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000398557.4	37	NULL	CCDS43374.1	5																																																																																			-	-		0.388	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	protein_coding		T	NM_005219	-		140914027	-1	no_errors	ENST00000494967	ensembl	human	putative	74_37	rna	SNP	0.000	C
C18orf54	162681	genome.wustl.edu	37	18	51887076	51887076	+	Missense_Mutation	SNP	A	A	G	rs199598871		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr18:51887076A>G	ENST00000300091.5	+	2	466	c.134A>G	c.(133-135)tAc>tGc	p.Y45C	STARD6_ENST00000581310.1_5'Flank|STARD6_ENST00000577499.1_5'Flank|C18orf54_ENST00000382911.4_Missense_Mutation_p.Y45C|C18orf54_ENST00000578138.1_Intron|STARD6_ENST00000584040.1_5'Flank	NM_173529.4	NP_775800.3	Q8IYD9	LAS2_HUMAN	chromosome 18 open reading frame 54	45						extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		GATAAGCTGTACAGATCTGCT	0.413																																																	0								ENSG00000166845						132.0	125.0	127.0					18																	51887076		2203	4300	6503	C18orf54	SO:0001583	missense	0			-	HGNC	AK126503	CCDS11956.1, CCDS74223.1	18q21	2012-10-24			ENSG00000166845	ENSG00000166845			13796	protein-coding gene	gene with protein product	"""lung adenoma susceptibility protein 2"""	613258					Standard	XM_005258201		Approved	MGC33382, LAS2	uc031rij.1	Q8IYD9	OTTHUMG00000132703	ENST00000300091.5:c.134A>G	18.37:g.51887076A>G	ENSP00000300091:p.Tyr45Cys	Somatic	0	62	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	78	17.02	I7HFJ6|Q6MZU3|Q6ZTL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Y45C	ENST00000300091.5	37	c.134	CCDS11956.1	18	.	.	.	.	.	.	.	.	.	.	A	15.43	2.832763	0.50845	.	.	ENSG00000166845	ENST00000300091;ENST00000382911	D;D	0.97404	-4.37;-4.37	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000001	D	0.98248	0.9420	M	0.78049	2.395	0.36377	D	0.86165	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99971	1.2023	10	0.87932	D	0	-1.7147	14.8058	0.69956	1.0:0.0:0.0:0.0	.	45;45	Q8IYD9-2;Q8IYD9	.;CR054_HUMAN	C	45	ENSP00000300091:Y45C;ENSP00000372368:Y45C	ENSP00000300091:Y45C	Y	+	2	0	C18orf54	50141074	1.000000	0.71417	0.925000	0.36789	0.261000	0.26267	6.174000	0.71943	2.145000	0.66743	0.533000	0.62120	TAC	-	NULL		0.413	C18orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf54	protein_coding	OTTHUMT00000256001.1	A	NM_173529	rs199598871		51887076	+1	no_errors	ENST00000300091	ensembl	human	known	74_37	missense	SNP	0.985	G
KLK8	11202	genome.wustl.edu	37	19	51504392	51504392	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr19:51504392G>A	ENST00000600767.1	-	3	521	c.32C>T	c.(31-33)aCg>aTg	p.T11M	KLK8_ENST00000593490.1_Missense_Mutation_p.T11M|KLK8_ENST00000391806.2_Missense_Mutation_p.T11M|KLK8_ENST00000291726.7_Missense_Mutation_p.T11M|KLK8_ENST00000320838.5_Missense_Mutation_p.T11M|CTB-147C22.9_ENST00000594512.1_RNA|KLK9_ENST00000376832.4_3'UTR|KLK9_ENST00000250366.6_3'UTR|KLK8_ENST00000347619.4_Missense_Mutation_p.T11M|KLK8_ENST00000598195.1_5'Flank			O60259	KLK8_HUMAN	kallikrein-related peptidase 8	11					cell death (GO:0008219)|keratinocyte proliferation (GO:0043616)|memory (GO:0007613)|negative regulation of axon regeneration (GO:0048681)|negative regulation of myelination (GO:0031642)|neuron projection morphogenesis (GO:0048812)|regulation of synapse organization (GO:0050807)|response to wounding (GO:0009611)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|prostate(1)	15		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.0033)|GBM - Glioblastoma multiforme(134;0.00888)		GAACATCCACGTCTTGGCCGC	0.667																																																	0								ENSG00000129455						44.0	36.0	39.0					19																	51504392		2203	4300	6503	KLK8	SO:0001583	missense	0			-	HGNC	AB008390	CCDS12813.1, CCDS12814.1, CCDS12815.1, CCDS42600.1, CCDS74433.1	19q13	2011-09-07	2006-10-27			ENSG00000129455		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6369	protein-coding gene	gene with protein product		605644	"""kallikrein 8 (neuropsin/ovasin)"""	PRSS19		10102990, 9714609, 16800724, 16800723	Standard	NM_144505		Approved	HNP, TADG14, neuropsin, ovasin	uc002pur.1	O60259		ENST00000600767.1:c.32C>T	19.37:g.51504392G>A	ENSP00000472016:p.Thr11Met	Somatic	0	65	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	33	32.65	Q5V9X1|Q5V9X2|Q8IW69|Q9HCB3|Q9NR68|Q9NR69|Q9UIL9|Q9UQ47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.T11M	ENST00000600767.1	37	c.32	CCDS12813.1	19	.	.	.	.	.	.	.	.	.	.	G	12.82	2.053694	0.36277	.	.	ENSG00000129455	ENST00000391806;ENST00000291726;ENST00000347619;ENST00000320838	D;D;D	0.90844	-2.67;-2.38;-2.74	4.96	-7.08	0.01558	.	0.580895	0.14483	N	0.316836	T	0.68072	0.2961	N	0.08118	0	0.09310	N	0.999999	B;B;B;B	0.33022	0.394;0.079;0.021;0.164	B;B;B;B	0.21917	0.037;0.011;0.001;0.01	T	0.67421	-0.5675	10	0.16896	T	0.51	.	4.9786	0.14153	0.2614:0.0:0.1888:0.5498	.	11;11;11;11	O60259-4;O60259-3;O60259;O60259-2	.;.;KLK8_HUMAN;.	M	11	ENSP00000375682:T11M;ENSP00000291726:T11M;ENSP00000341555:T11M	ENSP00000291726:T11M	T	-	2	0	KLK8	56196204	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.546000	0.06062	-0.643000	0.05473	-0.475000	0.04921	ACG	-	NULL		0.667	KLK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK8	protein_coding	OTTHUMT00000465032.2	G	NM_007196	-		51504392	-1	no_errors	ENST00000391806	ensembl	human	known	74_37	missense	SNP	0.000	A
YEATS2	55689	genome.wustl.edu	37	3	183493803	183493805	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	AGG	AGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr3:183493803_183493805delAGG	ENST00000305135.5	+	18	2664_2666	c.2469_2471delAGG	c.(2467-2472)acagga>aca	p.G828del		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	828	Gly-rich.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			gcggcagcacaggaggaggagga	0.601																																																	0								ENSG00000163872			11,3931		1,9,1961						1.8	0.0			64	13,8041		0,13,4014	no	coding	YEATS2	NM_018023.4		1,22,5975	A1A1,A1R,RR		0.1614,0.279,0.2001				24,11972				YEATS2	SO:0001651	inframe_deletion	0				HGNC	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.2469_2471delAGG	3.37:g.183493812_183493814delAGG	ENSP00000306983:p.Gly828del	Somatic	0	51	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	A7E2B9|D3DNS9|Q641P6|Q9NW96	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_YEATS,pfscan_YEATS	p.G827in_frame_del	ENST00000305135.5	37	c.2469_2471	CCDS43175.1	3																																																																																			-	NULL		0.601	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	protein_coding	OTTHUMT00000346507.2	AGG	NM_018023			183493805	+1	no_errors	ENST00000305135	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.003:0.002	-
MT-CO2	4513	genome.wustl.edu	37	M	8083	8083	+	Silent	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chrM:8083C>T	ENST00000361739.1	+	1	498	c.498C>T	c.(496-498)ccC>ccT	p.P166P	MT-TW_ENST00000387382.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TD_ENST00000387419.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-ND4L_ENST00000361335.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	166					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						TGAGCTGTCCCCACATTAGGC	0.473																																																	0								ENSG00000198712																																			MT-CO2	SO:0001819	synonymous_variant	0			-	HGNC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.498C>T	M.37:g.8083C>T		Somatic	0	92	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	16	38.46	Q37526	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.P166	ENST00000361739.1	37	c.498		MT																																																																																			-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2		0.473	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	protein_coding		C	YP_003024029	-		8083	+1	no_errors	ENST00000361739	ensembl	human	known	74_37	silent	SNP	NULL	T
LOC100240735	100240735	genome.wustl.edu	37	9	44870104	44870104	+	Nonstop_Mutation	SNP	A	A	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr9:44870104A>C	ENST00000377548.2	+	3	482	c.240A>C	c.(238-240)tgA>tgC	p.*80C	RP11-160N1.10_ENST00000448436.2_Nonstop_Mutation_p.*80C																							CTGTTATATGACTGGGCTTGC	0.478																																																	0								ENSG00000204814																																			RP11-160N1.10	SO:0001578	stop_lost	0			-	Clone_based_vega_gene																												ENST00000377548.2:c.240A>C	9.37:g.44870104A>C	ENSP00000366771:p.*80Cysext*71	Somatic	0	261	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	147	203	41.88		Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.*80C	ENST00000377548.2	37	c.240		9	.	.	.	.	.	.	.	.	.	.	.	0.156	-1.086017	0.01873	.	.	ENSG00000204814	ENST00000377548;ENST00000448436	.	.	.	1.58	0.405	0.16361	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.0567	0.06187	0.7132:0.0:0.2868:0.0	.	.	.	.	C	80	.	.	X	+	3	0	RP11-160N1.10	44810100	0.000000	0.05858	0.001000	0.08648	0.072000	0.16883	-0.055000	0.11807	0.108000	0.17862	0.163000	0.16589	TGA	-	NULL		0.478	RP11-160N1.10-002	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	LOC101928102	protein_coding	OTTHUMT00000192591.2	A		-		44870104	+1	no_errors	ENST00000448436	ensembl	human	putative	74_37	nonstop	SNP	0.001	C
IQCF6	440956	genome.wustl.edu	37	3	51812869	51812869	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr3:51812869G>A	ENST00000398780.3	-	1	140	c.94C>T	c.(94-96)Cgg>Tgg	p.R32W		NM_001143833.3	NP_001137305.2	A8MYZ5	IQCF6_HUMAN	IQ motif containing F6	32										breast(1)	1						GCCAGGCGCCGTCTTTGCTCC	0.612																																																	0								ENSG00000214686						23.0	23.0	23.0					3																	51812869		692	1591	2283	IQCF6	SO:0001583	missense	0			-	HGNC		CCDS54590.1	3p21.1	2008-10-16			ENSG00000214686	ENSG00000214686			35158	protein-coding gene	gene with protein product							Standard	NM_001143833		Approved		uc021wyv.1	A8MYZ5		ENST00000398780.3:c.94C>T	3.37:g.51812869G>A	ENSP00000381760:p.Arg32Trp	Somatic	0	29	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	25	30.56		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.R32W	ENST00000398780.3	37	c.94	CCDS54590.1	3	.	.	.	.	.	.	.	.	.	.	G	19.38	3.816981	0.70912	.	.	ENSG00000214686	ENST00000398780	T	0.52295	0.67	4.9	3.04	0.35103	.	.	.	.	.	T	0.55321	0.1913	M	0.64997	1.995	0.28788	N	0.899446	D	0.65815	0.995	P	0.53062	0.717	T	0.52653	-0.8547	9	0.87932	D	0	-11.0184	10.1765	0.42941	0.0:0.0:0.6514:0.3486	.	55	A8MYZ5	IQCF6_HUMAN	W	32	ENSP00000381760:R32W	ENSP00000381760:R32W	R	-	1	2	IQCF6	51787909	0.977000	0.34250	0.994000	0.49952	0.998000	0.95712	1.281000	0.33214	0.620000	0.30215	0.655000	0.94253	CGG	-	superfamily_P-loop_NTPase		0.612	IQCF6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF6	protein_coding		G	XM_496643	-		51812869	-1	no_errors	ENST00000398780	ensembl	human	known	74_37	missense	SNP	0.964	A
TMEM132C	92293	genome.wustl.edu	37	12	129181946	129181946	+	Missense_Mutation	SNP	C	C	T	rs201956806		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr12:129181946C>T	ENST00000435159.2	+	8	2107	c.2107C>T	c.(2107-2109)Cgg>Tgg	p.R703W	TMEM132C_ENST00000537538.1_Missense_Mutation_p.R88W|TMEM132C_ENST00000315208.8_Missense_Mutation_p.R319W	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	703						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						GGAGGTGCTGCGGACCCCCAA	0.602													C|||	1	0.000199681	0.0	0.0	5008	,	,		19414	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000181234	C	TRP/ARG	0,1384		0,0,692	10.0	10.0	10.0		2107	3.2	0.8	12		10	15,3167		0,15,1576	yes	missense	TMEM132C	NM_001136103.2	101	0,15,2268	TT,TC,CC		0.4714,0.0,0.3285	probably-damaging	703/1109	129181946	15,4551	692	1591	2283	TMEM132C	SO:0001583	missense	0			-	HGNC	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2107C>T	12.37:g.129181946C>T	ENSP00000410852:p.Arg703Trp	Somatic	0	27	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09	Q69YX8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R703W	ENST00000435159.2	37	c.2107		12	.	.	.	.	.	.	.	.	.	.	C	19.58	3.854453	0.71719	0.0	0.004714	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.47528	0.84;0.84;0.84	4.12	3.2	0.36748	.	0.103605	0.40728	N	0.001040	T	0.55305	0.1912	L	0.40543	1.245	0.40366	D	0.979291	D	0.76494	0.999	P	0.62184	0.899	T	0.59209	-0.7497	10	0.66056	D	0.02	.	13.1808	0.59653	0.1612:0.8388:0.0:0.0	.	703	Q8N3T6	T132C_HUMAN	W	703;319;88	ENSP00000410852:R703W;ENSP00000324458:R319W;ENSP00000438477:R88W	ENSP00000324458:R319W	R	+	1	2	TMEM132C	127747899	1.000000	0.71417	0.774000	0.31636	0.853000	0.48598	5.574000	0.67424	0.803000	0.34113	0.313000	0.20887	CGG	-	NULL		0.602	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	protein_coding		C	XM_044062	rs201956806		129181946	+1	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	SNP	0.998	T
OTOP1	133060	genome.wustl.edu	37	4	4204225	4204229	+	Frame_Shift_Del	DEL	TTGAG	TTGAG	-	rs369956607		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	TTGAG	TTGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr4:4204225_4204229delTTGAG	ENST00000296358.4	-	4	700_704	c.676_680delCTCAA	c.(676-681)ctcaatfs	p.LN226fs		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	226					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L226fs*1(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTTGTGCTCATTGAGTTGGTGCTTT	0.502																																																	1	Deletion - Frameshift(1)	liver(1)						ENSG00000163982																																			OTOP1	SO:0001589	frameshift_variant	0				HGNC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.676_680delCTCAA	4.37:g.4204225_4204229delTTGAG	ENSP00000296358:p.Leu226fs	Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L476	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Otopetrin	p.L226fs	ENST00000296358.4	37	c.680_676	CCDS3372.1	4																																																																																			-	pfam_Otopetrin		0.502	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP1	protein_coding	OTTHUMT00000206661.2	TTGAG	NM_177998			4204229	-1	no_errors	ENST00000296358	ensembl	human	known	74_37	frame_shift_del	DEL	0.998:0.995:0.417:0.986:0.987	-
SESTD1	91404	genome.wustl.edu	37	2	180056558	180056558	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr2:180056558G>A	ENST00000428443.3	-	2	327	c.11C>T	c.(10-12)tCa>tTa	p.S4L	SESTD1_ENST00000486468.1_5'UTR	NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	4	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TAATATTACTGAGGCCTCCAT	0.308																																																	0								ENSG00000187231						74.0	73.0	73.0					2																	180056558		2203	4297	6500	SESTD1	SO:0001583	missense	0			-	HGNC	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.11C>T	2.37:g.180056558G>A	ENSP00000415332:p.Ser4Leu	Somatic	1	140	0.71		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	1802	185	90.55	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.S4L	ENST00000428443.3	37	c.11	CCDS33338.1	2	.	.	.	.	.	.	.	.	.	.	G	16.87	3.242876	0.58995	.	.	ENSG00000187231	ENST00000428443;ENST00000440010;ENST00000435047	T;T;T	0.13420	3.48;2.59;2.59	5.83	5.83	0.93111	Cellular retinaldehyde-binding/triple function, C-terminal (1);	0.195368	0.45126	D	0.000398	T	0.08403	0.0209	N	0.08118	0	0.49051	D	0.999742	B	0.24186	0.099	B	0.18871	0.023	T	0.37502	-0.9703	9	.	.	.	-13.6034	18.2945	0.90140	0.0:0.0:1.0:0.0	.	4	Q86VW0	SESD1_HUMAN	L	4	ENSP00000415332:S4L;ENSP00000416164:S4L;ENSP00000410286:S4L	.	S	-	2	0	SESTD1	179764803	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	5.720000	0.68470	2.763000	0.94921	0.585000	0.79938	TCA	-	pfscan_CRAL-TRIO_dom		0.308	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESTD1	protein_coding	OTTHUMT00000335916.2	G	NM_178123	-		180056558	-1	no_errors	ENST00000428443	ensembl	human	known	74_37	missense	SNP	0.998	A
LPHN3	23284	genome.wustl.edu	37	4	62383050	62383050	+	Silent	SNP	C	C	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr4:62383050C>A	ENST00000506720.1	+	2	73	c.73C>A	c.(73-75)Cga>Aga	p.R25R	LPHN3_ENST00000514591.1_Intron|LPHN3_ENST00000545650.1_Intron|LPHN3_ENST00000509896.1_Silent_p.R25R|LPHN3_ENST00000506746.1_Silent_p.R25R|LPHN3_ENST00000507164.1_Silent_p.R25R|LPHN3_ENST00000506700.1_Intron|LPHN3_ENST00000507625.1_Silent_p.R25R|LPHN3_ENST00000508946.1_Intron|LPHN3_ENST00000511324.1_Silent_p.R25R|LPHN3_ENST00000514996.1_Intron|LPHN3_ENST00000508693.1_Silent_p.R25R|LPHN3_ENST00000504896.1_Intron|LPHN3_ENST00000514157.1_Intron|LPHN3_ENST00000512091.2_Intron			Q9HAR2	LPHN3_HUMAN	latrophilin 3	0					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						GCACAGTGAACGACATCCTGC	0.647																																																	0								ENSG00000150471																																			LPHN3	SO:0001819	synonymous_variant	0			-	HGNC	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000506720.1:c.73C>A	4.37:g.62383050C>A		Somatic	0	38	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	8	60.00	E9PE04|O94867|Q9NWK5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like	p.R25	ENST00000506720.1	37	c.73		4																																																																																			-	NULL		0.647	LPHN3-008	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LPHN3	protein_coding	OTTHUMT00000361770.1	C		-		62383050	+1	no_errors	ENST00000507625	ensembl	human	known	74_37	silent	SNP	0.998	A
ADAMTSL1	92949	genome.wustl.edu	37	9	18826261	18826262	+	Intron	INS	-	-	T	rs552133431|rs35525189|rs75054093|rs562486347	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr9:18826261_18826262insT	ENST00000380548.4	+	22	4273				ADAMTSL1_ENST00000380545.5_Frame_Shift_Ins_p.CF6fs	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1							proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GGGGTTTTTTGTTTTTTTTTTT	0.485																																																	0								ENSG00000178031																																			ADAMTSL1	SO:0001627	intron_variant	0				HGNC	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.3935-20->T	9.37:g.18826272_18826272dupT		Somatic	0	34	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F10fs	ENST00000380548.4	37	c.17_18	CCDS47954.1	9																																																																																			-	smart_Ig_sub,pfscan_Ig-like_dom		0.485	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	protein_coding	OTTHUMT00000401206.1	-				18826262	+1	no_errors	ENST00000388710	ensembl	human	known	74_37	frame_shift_ins	INS	0.004:0.005	T
KRTAP5-5	439915	genome.wustl.edu	37	11	1651191	1651199	+	In_Frame_Del	DEL	GGCTGTGGA	GGCTGTGGA	-	rs71025763|rs144216147	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	GGCTGTGGA	GGCTGTGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr11:1651191_1651199delGGCTGTGGA	ENST00000399676.2	+	1	159_167	c.121_129delGGCTGTGGA	c.(121-129)ggctgtggadel	p.GCG47del		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	47						keratin filament (GO:0045095)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ctgtggctccggctgtggaggctgtgggg	0.713																																																	0								ENSG00000185940			727,2515		74,579,968						1.8	0.6		dbSNP_130	24	1587,5219		143,1301,1959	no	coding	KRTAP5-5	NM_001001480.2		217,1880,2927	A1A1,A1R,RR		23.3177,22.4244,23.0295				2314,7734				KRTAP5-5	SO:0001651	inframe_deletion	0				HGNC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.121_129delGGCTGTGGA	11.37:g.1651191_1651199delGGCTGTGGA	ENSP00000382584:p.Gly47_Gly49del	Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MWN2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.GCG44in_frame_del	ENST00000399676.2	37	c.121_129	CCDS41592.1	11																																																																																			-	NULL		0.713	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	GGCTGTGGA				1651199	+1	no_errors	ENST00000399676	ensembl	human	known	74_37	in_frame_del	DEL	0.036:0.152:0.136:0.093:0.018:0.001:0.874:0.883:0.301	-
CABP1	9478	genome.wustl.edu	37	12	121093630	121093635	+	Intron	DEL	GTGCGT	GTGCGT	-	rs74906883|rs200201544|rs10588566|rs112935060	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	GTGCGT	GTGCGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr12:121093630_121093635delGTGCGT	ENST00000316803.3	+	2	788				CABP1_ENST00000453000.1_In_Frame_Del_p.AC7del|CABP1_ENST00000351200.2_Intron|CABP1_ENST00000288616.3_Intron	NM_001033677.1	NP_001028849.1	Q9NZU7	CABP1_HUMAN	calcium binding protein 1						negative regulation of catalytic activity (GO:0043086)|negative regulation of cell communication by electrical coupling (GO:0010651)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of voltage-gated calcium channel activity (GO:1901386)	cell junction (GO:0030054)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|enzyme inhibitor activity (GO:0004857)|nuclear localization sequence binding (GO:0008139)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)	9	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CAgtgcgtgcgtgcgtgtgtgtgtgt	0.539																																																	0								ENSG00000157782																																			CABP1	SO:0001627	intron_variant	0				HGNC	AF169148	CCDS9204.1, CCDS9205.1, CCDS31913.1	12q24.31	2013-01-10	2007-03-12		ENSG00000157782	ENSG00000157782		"""EF-hand domain containing"""	1384	protein-coding gene	gene with protein product	"""calbrain"", ""caldendrin"""	605563				9920909, 10625670	Standard	NM_004276		Approved		uc001tyu.3	Q9NZU7	OTTHUMG00000156794	ENST00000316803.3:c.655-4046GTGCGT>-	12.37:g.121093630_121093635delGTGCGT		Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O95663|Q8N6H5|Q9NZU8	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.AC7in_frame_del	ENST00000316803.3	37	c.17_22	CCDS31913.1	12																																																																																			-	NULL		0.539	CABP1-001	KNOWN	basic|CCDS	protein_coding	CABP1	protein_coding	OTTHUMT00000345822.1	GTGCGT	NM_001033677			121093635	+1	no_errors	ENST00000453000	ensembl	human	putative	74_37	in_frame_del	DEL	0.940:0.982:0.991:0.991:0.991:0.982	-
ZNF689	115509	genome.wustl.edu	37	16	30620882	30620882	+	Missense_Mutation	SNP	G	G	A	rs146699442		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr16:30620882G>A	ENST00000287461.3	-	2	620	c.283C>T	c.(283-285)Ccg>Tcg	p.P95S	RP11-146F11.5_ENST00000563540.1_RNA|ZNF689_ENST00000566673.1_5'UTR	NM_138447.1	NP_612456.1	Q96CS4	ZN689_HUMAN	zinc finger protein 689	95	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(1)	14			Colorectal(24;0.198)			TACTCCTGCGGATCTAGAGCA	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		15892	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000156853	G	SER/PRO	0,4394		0,0,2197	108.0	103.0	105.0		283	4.3	1.0	16	dbSNP_134	105	3,8597	3.0+/-9.4	0,3,4297	yes	missense	ZNF689	NM_138447.1	74	0,3,6494	AA,AG,GG		0.0349,0.0,0.0231	probably-damaging	95/501	30620882	3,12991	2197	4300	6497	ZNF689	SO:0001583	missense	0			-	HGNC	BC014000	CCDS10686.1	16p11.2	2013-01-08			ENSG00000156853	ENSG00000156853		"""Zinc fingers, C2H2-type"", ""-"""	25173	protein-coding gene	gene with protein product							Standard	NM_138447		Approved	FLJ90415	uc031qvq.1	Q96CS4	OTTHUMG00000132415	ENST00000287461.3:c.283C>T	16.37:g.30620882G>A	ENSP00000287461:p.Pro95Ser	Somatic	0	47	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	42	23.64	Q658J5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P95S	ENST00000287461.3	37	c.283	CCDS10686.1	16	.	.	.	.	.	.	.	.	.	.	g	16.12	3.033283	0.54896	0.0	3.49E-4	ENSG00000156853	ENST00000287461;ENST00000443190	T	0.06849	3.25	4.31	4.31	0.51392	Krueppel-associated box (1);	0.000000	0.37483	N	0.002073	T	0.13500	0.0327	N	0.20986	0.625	0.43118	D	0.994839	D	0.89917	1.0	D	0.79108	0.992	T	0.10177	-1.0641	10	0.07325	T	0.83	-23.6398	14.6545	0.68823	0.0:0.0:1.0:0.0	.	95	Q96CS4	ZN689_HUMAN	S	95	ENSP00000287461:P95S	ENSP00000287461:P95S	P	-	1	0	ZNF689	30528383	0.996000	0.38824	1.000000	0.80357	0.803000	0.45373	2.677000	0.46892	2.403000	0.81681	0.561000	0.74099	CCG	-	pfscan_Krueppel-associated_box		0.547	ZNF689-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF689	protein_coding	OTTHUMT00000255552.1	G	NM_138447	rs146699442		30620882	-1	no_errors	ENST00000287461	ensembl	human	known	74_37	missense	SNP	0.999	A
POLD1	5424	genome.wustl.edu	37	19	50912024	50912024	+	Intron	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr19:50912024C>T	ENST00000440232.2	+	15	1828				POLD1_ENST00000599857.1_Intron|POLD1_ENST00000595904.1_Silent_p.R612R	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit						base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		CTCCCGGCCGCGGCTGCTCCC	0.592								DNA polymerases (catalytic subunits)																																									0								ENSG00000062822						60.0	56.0	57.0					19																	50912024		2203	4300	6503	POLD1	SO:0001627	intron_variant	0			-	HGNC		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.1776-18C>T	19.37:g.50912024C>T		Somatic	0	33	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	15	37.50	Q8NER3|Q96H98	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.R612	ENST00000440232.2	37	c.1836	CCDS12795.1	19																																																																																			-	smart_DNA-dir_DNA_pol_B		0.592	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	POLD1	protein_coding	OTTHUMT00000464732.1	C		-		50912024	+1	no_errors	ENST00000595904	ensembl	human	novel	74_37	silent	SNP	0.000	T
OR10J3	441911	genome.wustl.edu	37	1	159283694	159283694	+	Silent	SNP	G	G	A	rs532378990		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr1:159283694G>A	ENST00000332217.5	-	1	755	c.756C>T	c.(754-756)caC>caT	p.H252H		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	252						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					CACAGCCATAGTGGATGATGA	0.527													G|||	1	0.000199681	0.0	0.0	5008	,	,		21806	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000196266						132.0	114.0	120.0					1																	159283694		2203	4300	6503	OR10J3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.756C>T	1.37:g.159283694G>A		Somatic	0	25	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	18	53.85		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.H252	ENST00000332217.5	37	c.756	CCDS30909.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.527	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J3	protein_coding	OTTHUMT00000090629.1	G		-		159283694	-1	no_errors	ENST00000332217	ensembl	human	known	74_37	silent	SNP	0.996	A
ADAM6	8755	genome.wustl.edu	37	14	106436914	106436914	+	lincRNA	SNP	G	G	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr14:106436914G>C	ENST00000452053.1	-	0	746					NR_002224.2				ADAM metallopeptidase domain 6, pseudogene																		CTATATGGCAGATGCTCCCCG	0.502																																																	0								ENSG00000233988																																			ADAM6			0			-	HGNC	AI024595		14q32.33	2013-09-05	2012-08-22		ENSG00000233988	ENSG00000271968		"""ADAM metallopeptidase domain containing"""	213	pseudogene	pseudogene			"""chromosome 14 open reading frame 96"", ""a disintegrin and metalloproteinase domain 6"", ""ADAM metallopeptidase domain 6"""	C14orf96			Standard	NR_002224		Approved	tMDCIV	uc001ysu.1		OTTHUMG00000152319		14.37:g.106436914G>C		Somatic	0	34	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	56	11.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000452053.1	37	NULL		14																																																																																			-	-		0.502	ADAM6-001	KNOWN	basic	lincRNA	ADAM6	lincRNA	OTTHUMT00000325881.1	G	NR_002224	-		106436914	-1	no_errors	ENST00000452053	ensembl	human	known	74_37	rna	SNP	0.000	C
RP11-423O2.5	0	genome.wustl.edu	37	1	142803228	142803228	+	lincRNA	SNP	T	T	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr1:142803228T>C	ENST00000423385.1	-	0	1737																											AAGGAATGCTTTGTAACAAAG	0.353																																																	0								ENSG00000234978																																			RP11-423O2.5			0			-	Clone_based_vega_gene																													1.37:g.142803228T>C		Somatic	0	88	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	49	14.04		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			-	-		0.353	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	lincRNA	OTTHUMT00000193203.1	T		-		142803228	-1	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	SNP	0.004	C
SHOX2	6474	genome.wustl.edu	37	3	157820521	157820521	+	Silent	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr3:157820521G>A	ENST00000425436.3	-	2	526	c.501C>T	c.(499-501)gcC>gcT	p.A167A	SHOX2_ENST00000441443.2_Silent_p.A38A|SHOX2_ENST00000554685.1_5'UTR|SHOX2_ENST00000389589.4_Silent_p.A191A|SHOX2_ENST00000490689.2_Silent_p.A38A|SHOX2_ENST00000483851.2_Silent_p.A167A	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	167					cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CTCGCATGAAGGCGTCGGGAT	0.602																																																	0								ENSG00000168779						124.0	106.0	112.0					3																	157820521		2203	4300	6503	SHOX2	SO:0001819	synonymous_variant	0			-	HGNC	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.501C>T	3.37:g.157820521G>A		Somatic	0	44	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	24	29.41	O60465|O60467|O60903	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.A191	ENST00000425436.3	37	c.573	CCDS43164.1	3	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595299	0.28445	.	.	ENSG00000168779	ENST00000555977	.	.	.	5.49	0.283	0.15696	.	.	.	.	.	T	0.53384	0.1793	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42085	-0.9472	4	.	.	.	.	6.8386	0.23951	0.3457:0.1088:0.5455:0.0	.	.	.	.	F	71	.	.	L	-	1	0	SHOX2	159303215	0.998000	0.40836	0.997000	0.53966	0.985000	0.73830	0.404000	0.20999	-0.009000	0.14296	0.655000	0.94253	CTT	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.602	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHOX2	protein_coding	OTTHUMT00000352057.2	G		-		157820521	-1	no_errors	ENST00000389589	ensembl	human	known	74_37	silent	SNP	1.000	A
DHCR7	1717	genome.wustl.edu	37	11	71146576	71146576	+	Missense_Mutation	SNP	C	C	A	rs760242	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr11:71146576C>A	ENST00000355527.3	-	9	1549	c.1273G>T	c.(1273-1275)Ggc>Tgc	p.G425C	DHCR7_ENST00000407721.2_Missense_Mutation_p.G425C	NM_001163817.1|NM_001360.2	NP_001157289.1|NP_001351.2	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	425			G -> S (in dbSNP:rs760242).		blood vessel development (GO:0001568)|cell differentiation (GO:0030154)|cholesterol biosynthetic process (GO:0006695)|lung development (GO:0030324)|multicellular organism growth (GO:0035264)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|regulation of cholesterol biosynthetic process (GO:0045540)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear outer membrane (GO:0005640)	7-dehydrocholesterol reductase activity (GO:0047598)			endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(1)|skin(1)	19						AGCAGGTGGCCGCCGCCACAG	0.672									Smith-Lemli-Opitz syndrome																																								0								ENSG00000172893						23.0	26.0	25.0					11																	71146576		2197	4290	6487	DHCR7	SO:0001583	missense	0	Familial Cancer Database	SLOS type I & II	-	HGNC	AF034544	CCDS8200.1	11q13.4	2014-09-17	2004-02-13				1.3.1.21		2860	protein-coding gene	gene with protein product		602858	"""Smith-Lemli-Opitz syndrome"""	SLOS		9465114, 9634533	Standard	NM_001360		Approved		uc001oql.3	Q9UBM7		ENST00000355527.3:c.1273G>T	11.37:g.71146576C>A	ENSP00000347717:p.Gly425Cys	Somatic	0	76	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	20	44.44	B2R6Z2|O60492|O60717	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ergosterol_biosynth_ERG4_ERG24	p.G425C	ENST00000355527.3	37	c.1273	CCDS8200.1	11	.	.	.	.	.	.	.	.	.	.	T	17.06	3.293161	0.60086	.	.	ENSG00000172893	ENST00000407721;ENST00000355527;ENST00000533800	D;D;D	0.97976	-4.64;-4.64;-4.64	5.12	0.914	0.19360	.	0.534254	0.22761	N	0.055950	D	0.97629	0.9223	M	0.73962	2.25	0.30645	N	0.756068	D	0.69078	0.997	P	0.62014	0.897	D	0.94799	0.7969	10	0.56958	D	0.05	-30.4097	7.0163	0.24890	0.127:0.6367:0.0:0.2363	.	425	Q9UBM7	DHCR7_HUMAN	C	425;425;175	ENSP00000384739:G425C;ENSP00000347717:G425C;ENSP00000435011:G175C	ENSP00000347717:G425C	G	-	1	0	DHCR7	70824224	0.009000	0.17119	0.978000	0.43139	0.895000	0.52256	0.259000	0.18405	0.207000	0.20607	-0.940000	0.02684	GGC	-	pfam_Ergosterol_biosynth_ERG4_ERG24		0.672	DHCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHCR7	protein_coding	OTTHUMT00000394243.1	C	NM_001360	-		71146576	-1	no_errors	ENST00000355527	ensembl	human	known	74_37	missense	SNP	0.873	A
HYDIN	54768	genome.wustl.edu	37	16	70908403	70908403	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr16:70908403T>C	ENST00000393567.2	-	64	10903	c.10753A>G	c.(10753-10755)Aga>Gga	p.R3585G	AC027281.1_ENST00000411384.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3585					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ATGATACCTCTCATCCTCCCA	0.478																																																	0								ENSG00000157423						7.0	7.0	7.0					16																	70908403		1743	3993	5736	HYDIN	SO:0001583	missense	0			-	HGNC	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.10753A>G	16.37:g.70908403T>C	ENSP00000377197:p.Arg3585Gly	Somatic	0	32	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	55	17.91	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,superfamily_PapD-like	p.R3585G	ENST00000393567.2	37	c.10753	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	T	3.193	-0.165363	0.06461	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00856	5.61	4.71	-2.0	0.07433	.	1.250580	0.06324	U	0.704919	T	0.00875	0.0029	N	0.14661	0.345	0.18873	N	0.999985	B	0.06786	0.001	B	0.16722	0.016	T	0.47497	-0.9113	10	0.29301	T	0.29	.	11.7582	0.51888	0.0:0.5756:0.0:0.4244	.	3584	F8WD23	.	G	3585;3584	ENSP00000377197:R3585G	ENSP00000313052:R3584G	R	-	1	2	HYDIN	69465904	0.001000	0.12720	0.382000	0.26119	0.150000	0.21749	-0.338000	0.07842	-0.399000	0.07668	0.418000	0.28097	AGA	-	NULL		0.478	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	T		-		70908403	-1	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	SNP	0.015	C
NTM	50863	genome.wustl.edu	37	11	132206309	132206309	+	3'UTR	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr11:132206309G>A	ENST00000374786.1	+	0	2783				NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						AACTAATACCGGGCGCAGCAT	0.453																																																	0								ENSG00000182667																																			NTM	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*1269G>A	11.37:g.132206309G>A		Somatic	0	12	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00	A0MTT2|Q6UXJ3|Q86VJ9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			-	-		0.453	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	protein_coding	OTTHUMT00000141937.1	G	NM_016522	-		132206309	+1	no_errors	ENST00000474900	ensembl	human	known	74_37	rna	SNP	0.891	A
ST18	9705	genome.wustl.edu	37	8	53073948	53073948	+	Silent	SNP	T	T	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr8:53073948T>C	ENST00000276480.7	-	14	2264	c.1581A>G	c.(1579-1581)ccA>ccG	p.P527P		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	527					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CAGGAAATGGTGGTGTTTTTC	0.443																																																	0								ENSG00000147488						180.0	175.0	176.0					8																	53073948		2203	4300	6503	ST18	SO:0001819	synonymous_variant	0			-	HGNC	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.1581A>G	8.37:g.53073948T>C		Somatic	0	64	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	60	25.00	Q17RY1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myelin_TF,pfam_Znf_C2HC	p.P527	ENST00000276480.7	37	c.1581	CCDS6149.1	8																																																																																			-	pfam_Myelin_TF		0.443	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	protein_coding	OTTHUMT00000377867.1	T		-		53073948	-1	no_errors	ENST00000276480	ensembl	human	known	74_37	silent	SNP	0.999	C
XPC	7508	genome.wustl.edu	37	3	14219966	14219968	+	Splice_Site	DEL	CCT	CCT	-	rs72561774	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr3:14219966_14219968delCCT	ENST00000285021.7	-	1	315_317	c.101_103delAGG	c.(100-105)gaggat>gat	p.E34del	LSM3_ENST00000306024.3_5'UTR|XPC_ENST00000449060.2_Splice_Site_p.E34del	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	34	Glu-rich (acidic).|Poly-Glu.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)	p.E34delE(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCGCTCTCACCCTCCTCCTCCTC	0.734			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)						ENSG00000154767		,	315,1,3348		29,0,257,0,1,1545					,	5.2	1.0			23	706,1,7113		33,0,640,0,1,3236	no	codingComplex-near-splice,codingComplex-near-splice	XPC	NM_004628.4,NM_001145769.1	,	62,0,897,0,2,4781	A1A1,A1A2,A1R,A2A2,A2R,RR		9.0409,8.6245,8.908	,	,		1021,2,10461				XPC	SO:0001630	splice_region_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		HGNC		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.103+1AGG>-	3.37:g.14219975_14219977delCCT		Somatic	0	11	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Rad4/PNGase_transGLS-fold,pfam_Rad4_beta-hairpin_dom3,pfam_Rad4_beta-hairpin_dom2,pfam_Rad4_beta-hairpin_dom1,tigrfam_DNA_repair_Rad4_subgr	p.E34in_frame_del	ENST00000285021.7	37	c.103_101	CCDS46763.1	3																																																																																			-	NULL		0.734	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XPC	protein_coding	OTTHUMT00000340517.3	CCT	NM_004628		In_Frame_Del	14219968	-1	no_errors	ENST00000285021	ensembl	human	known	74_37	in_frame_del	DEL	0.927:0.902:0.864	-
AQP4	361	genome.wustl.edu	37	18	24436335	24436335	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr18:24436335T>C	ENST00000383168.4	-	5	940	c.812A>G	c.(811-813)cAg>cGg	p.Q271R	AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|AQP4_ENST00000583022.1_5'UTR|AQP4_ENST00000440832.3_Missense_Mutation_p.Q249R|AQP4_ENST00000581374.1_Missense_Mutation_p.Q249R	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	P55087	AQP4_HUMAN	aquaporin 4	271					carbon dioxide transport (GO:0015670)|cellular response to estradiol stimulus (GO:0071392)|cellular response to interferon-gamma (GO:0071346)|female pregnancy (GO:0007565)|hyperosmotic salinity response (GO:0042538)|multicellular organismal water homeostasis (GO:0050891)|protein homooligomerization (GO:0051260)|renal water absorption (GO:0070295)|response to glucocorticoid (GO:0051384)|response to radiation (GO:0009314)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)	porin activity (GO:0015288)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.Q271R(1)		kidney(2)|large_intestine(3)|lung(5)|skin(1)	11	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					TTTTGTTTGCTGGGCAGCTTT	0.468																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000171885						245.0	215.0	225.0					18																	24436335		2203	4300	6503	AQP4	SO:0001583	missense	0			-	HGNC	U63622	CCDS11889.1, CCDS58617.1	18q11.2-q12.1	2005-09-20			ENSG00000171885	ENSG00000171885		"""Ion channels / Aquaporins"""	637	protein-coding gene	gene with protein product		600308				7528931	Standard	NM_001650		Approved	MIWC	uc002kwa.3	P55087	OTTHUMG00000131955	ENST00000383168.4:c.812A>G	18.37:g.24436335T>C	ENSP00000372654:p.Gln271Arg	Somatic	0	48	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	38	42.42	P78564	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	p.Q271R	ENST00000383168.4	37	c.812	CCDS11889.1	18	.	.	.	.	.	.	.	.	.	.	T	14.88	2.668727	0.47677	.	.	ENSG00000171885	ENST00000383168;ENST00000440832;ENST00000383170	D	0.86097	-2.07	5.75	5.75	0.90469	.	0.000000	0.32952	N	0.005444	T	0.78259	0.4255	L	0.27053	0.805	0.46416	D	0.999039	B	0.16802	0.019	B	0.17098	0.017	T	0.72620	-0.4238	10	0.32370	T	0.25	.	16.0475	0.80731	0.0:0.0:0.0:1.0	.	271	P55087	AQP4_HUMAN	R	271;251;167	ENSP00000372654:Q271R	ENSP00000372654:Q271R	Q	-	2	0	AQP4	22690333	0.975000	0.34042	1.000000	0.80357	0.998000	0.95712	2.725000	0.47294	2.193000	0.70182	0.528000	0.53228	CAG	-	NULL		0.468	AQP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP4	protein_coding	OTTHUMT00000254914.2	T	NM_001650, NM_004028	-		24436335	-1	no_errors	ENST00000383168	ensembl	human	known	74_37	missense	SNP	1.000	C
MKI67	4288	genome.wustl.edu	37	10	129904025	129904025	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr10:129904025G>T	ENST00000368654.3	-	13	6454	c.6079C>A	c.(6079-6081)Cag>Aag	p.Q2027K	MKI67_ENST00000368653.3_Missense_Mutation_p.Q1667K	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2027	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTGTGTGTCTGTGTGGTCTTC	0.498																																																	0								ENSG00000148773						335.0	312.0	319.0					10																	129904025		2203	4300	6503	MKI67	SO:0001583	missense	0			-	HGNC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6079C>A	10.37:g.129904025G>T	ENSP00000357643:p.Gln2027Lys	Somatic	0	53	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.29	Q5VWH2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.Q2027K	ENST00000368654.3	37	c.6079	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	G	0.031	-1.334308	0.01287	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.02121	4.44;4.44	4.03	-5.44	0.02624	.	2.673800	0.01526	N	0.018591	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	B;B;B	0.09022	0.001;0.001;0.002	B;B;B	0.08055	0.002;0.002;0.003	T	0.44065	-0.9352	10	0.06494	T	0.89	.	3.7517	0.08569	0.1635:0.4886:0.1471:0.2008	.	2026;1667;2027	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	K	2027;1667;2026	ENSP00000357643:Q2027K;ENSP00000357642:Q1667K	ENSP00000357642:Q1667K	Q	-	1	0	MKI67	129794015	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.650000	0.01991	-0.852000	0.04141	-1.862000	0.00560	CAG	-	pfam_K167R		0.498	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	protein_coding	OTTHUMT00000050999.1	G	NM_002417	-		129904025	-1	no_errors	ENST00000368654	ensembl	human	known	74_37	missense	SNP	0.000	T
VMO1	284013	genome.wustl.edu	37	17	4688744	4688744	+	Silent	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr17:4688744G>A	ENST00000328739.5	-	3	601	c.522C>T	c.(520-522)tgC>tgT	p.C174C	VMO1_ENST00000354194.4_3'UTR|VMO1_ENST00000416307.2_3'UTR|VMO1_ENST00000441199.2_3'UTR	NM_182566.2	NP_872372.1	Q7Z5L0	VMO1_HUMAN	vitelline membrane outer layer 1 homolog (chicken)	174						extracellular vesicular exosome (GO:0070062)				kidney(2)|large_intestine(3)|liver(1)|lung(3)|ovary(1)|pancreas(1)	11						TCTGCAGGCCGCACGCGCCCT	0.657																																																	0								ENSG00000182853						69.0	65.0	66.0					17																	4688744		2203	4300	6503	VMO1	SO:0001819	synonymous_variant	0			-	HGNC	AF521892	CCDS11055.1, CCDS45585.1, CCDS45586.1, CCDS45587.1	17p13.2	2013-03-07	2005-11-14						30387	protein-coding gene	gene with protein product						22025569	Standard	NM_182566		Approved		uc002fyx.3	Q7Z5L0		ENST00000328739.5:c.522C>T	17.37:g.4688744G>A		Somatic	0	75	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	44	26.67	C9JQ15|E9PAU9|E9PGP4|Q3SXP1|Q8IUY1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VOMI,superfamily_VOMI	p.C174	ENST00000328739.5	37	c.522	CCDS11055.1	17																																																																																			-	pfam_VOMI,superfamily_VOMI		0.657	VMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VMO1	protein_coding	OTTHUMT00000439587.1	G	NM_182566	-		4688744	-1	no_errors	ENST00000328739	ensembl	human	known	74_37	silent	SNP	0.918	A
CTDSPL2	51496	genome.wustl.edu	37	15	44816508	44816508	+	3'UTR	SNP	A	A	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr15:44816508A>T	ENST00000260327.4	+	0	2100				CTDSPL2_ENST00000396780.1_3'UTR|CTDSPL2_ENST00000558373.1_3'UTR|CTDSPL2_ENST00000558966.1_3'UTR	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2								phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		GGTGCCCAATAATAATTAAGG	0.363																																																	0								ENSG00000137770																																			CTDSPL2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.*136A>T	15.37:g.44816508A>T		Somatic	0	59	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	33	34.00	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000260327.4	37	NULL	CCDS10110.1	15																																																																																			-	-		0.363	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSPL2	protein_coding	OTTHUMT00000253851.1	A	NM_016396	-		44816508	+1	no_errors	ENST00000559738	ensembl	human	putative	74_37	rna	SNP	1.000	T
THSD7A	221981	genome.wustl.edu	37	7	11446546	11446546	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr7:11446546G>T	ENST00000423059.4	-	21	4304	c.4053C>A	c.(4051-4053)tgC>tgA	p.C1351*	AC004160.4_ENST00000425837.1_RNA|AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1351	TSP type-1 14. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CCTGCACTTGGCATGGAGACC	0.448										HNSCC(18;0.044)																																							0								ENSG00000005108						72.0	71.0	71.0					7																	11446546		1941	4156	6097	THSD7A	SO:0001587	stop_gained	0			-	HGNC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4053C>A	7.37:g.11446546G>T	ENSP00000406482:p.Cys1351*	Somatic	0	41	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	47	20.34		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.C1351*	ENST00000423059.4	37	c.4053	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	G	46	12.749061	0.99693	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	.	.	.	6.14	3.09	0.35607	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.138	0.42719	0.2357:0.0:0.7643:0.0	.	.	.	.	X	1351	.	ENSP00000262042:C1351X	C	-	3	2	THSD7A	11413071	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.271000	0.43364	0.346000	0.23899	-0.142000	0.14014	TGC	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt		0.448	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	protein_coding	OTTHUMT00000325944.4	G	XM_928187.2	-		11446546	-1	no_errors	ENST00000423059	ensembl	human	known	74_37	nonsense	SNP	1.000	T
SPATA31E1	286234	genome.wustl.edu	37	9	90502475	90502475	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr9:90502475C>A	ENST00000325643.5	+	4	3139	c.3073C>A	c.(3073-3075)Cag>Aag	p.Q1025K		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1025					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CATAGGGTCCCAGTGGGCAAG	0.592																																																	0								ENSG00000177992						42.0	45.0	44.0					9																	90502475		2203	4300	6503	SPATA31E1	SO:0001583	missense	0			-	HGNC	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.3073C>A	9.37:g.90502475C>A	ENSP00000322640:p.Gln1025Lys	Somatic	0	59	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	53	26.39	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q1025K	ENST00000325643.5	37	c.3073	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	c	12.26	1.883688	0.33255	.	.	ENSG00000177992	ENST00000325643	T	0.03441	3.93	2.26	1.32	0.21799	.	2.705830	0.01639	N	0.023933	T	0.04003	0.0112	L	0.27053	0.805	0.09310	N	1	P	0.36837	0.571	B	0.42522	0.39	T	0.42548	-0.9445	10	0.05351	T	0.99	.	6.1184	0.20139	0.3018:0.6982:0.0:0.0	.	1025	Q6ZUB1	CI079_HUMAN	K	1025	ENSP00000322640:Q1025K	ENSP00000322640:Q1025K	Q	+	1	0	C9orf79	89692295	0.002000	0.14202	0.008000	0.14137	0.007000	0.05969	-0.626000	0.05527	0.500000	0.27991	0.557000	0.71058	CAG	-	NULL		0.592	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	protein_coding	OTTHUMT00000052954.2	C	NM_178828	-		90502475	+1	no_errors	ENST00000325643	ensembl	human	known	74_37	missense	SNP	0.007	A
THSD7A	221981	genome.wustl.edu	37	7	11446555	11446555	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr7:11446555C>G	ENST00000423059.4	-	21	4295	c.4044G>C	c.(4042-4044)tgG>tgC	p.W1348C	AC004160.4_ENST00000425837.1_RNA|AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1348	TSP type-1 14. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GGCATGGAGACCACTGGCCAT	0.478										HNSCC(18;0.044)																																							0								ENSG00000005108						76.0	75.0	75.0					7																	11446555		1954	4162	6116	THSD7A	SO:0001583	missense	0			-	HGNC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4044G>C	7.37:g.11446555C>G	ENSP00000406482:p.Trp1348Cys	Somatic	0	43	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	49	18.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.W1348C	ENST00000423059.4	37	c.4044	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	C	21.7	4.187762	0.78789	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.77489	-1.1	6.14	6.14	0.99180	.	0.104231	0.64402	D	0.000001	D	0.89491	0.6730	M	0.79926	2.475	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.89243	0.3585	10	0.87932	D	0	.	20.8597	0.99761	0.0:1.0:0.0:0.0	.	1348	Q9UPZ6	THS7A_HUMAN	C	1348	ENSP00000406482:W1348C	ENSP00000262042:W1348C	W	-	3	0	THSD7A	11413080	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.809000	0.86057	2.937000	0.99478	0.650000	0.86243	TGG	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt		0.478	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	protein_coding	OTTHUMT00000325944.4	C	XM_928187.2	-		11446555	-1	no_errors	ENST00000423059	ensembl	human	known	74_37	missense	SNP	1.000	G
FBXO18	84893	genome.wustl.edu	37	10	5979192	5979192	+	Silent	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr10:5979192G>A	ENST00000362091.4	+	21	3196	c.3081G>A	c.(3079-3081)gtG>gtA	p.V1027V	RP11-536K7.3_ENST00000397264.4_RNA|FBXO18_ENST00000379999.5_Silent_p.V1078V|FBXO18_ENST00000397269.3_Silent_p.V531V	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	1027					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						AGCGCACTGTGGAGAACATCG	0.672																																																	0								ENSG00000134452						32.0	32.0	32.0					10																	5979192		2203	4300	6503	FBXO18	SO:0001819	synonymous_variant	0			-	HGNC	AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.3081G>A	10.37:g.5979192G>A		Somatic	0	33	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	54	20.59	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UvrD-like_ATP-bd,pfam_F-box_dom,superfamily_P-loop_NTPase,superfamily_F-box_dom,pfscan_F-box_dom	p.V1078	ENST00000362091.4	37	c.3234	CCDS7072.1	10	.	.	.	.	.	.	.	.	.	.	.	12.68	2.010596	0.35511	.	.	ENSG00000134452	ENST00000544954;ENST00000379994	.	.	.	5.24	-2.8	0.05823	.	.	.	.	.	T	0.55673	0.1935	.	.	.	0.44515	D	0.997464	.	.	.	.	.	.	T	0.58205	-0.7677	5	0.87932	D	0	-2.5723	4.6537	0.12606	0.235:0.0996:0.5468:0.1186	.	.	.	.	R	397	.	ENSP00000369330:G397R	G	+	1	0	FBXO18	6019198	0.012000	0.17670	0.002000	0.10522	0.965000	0.64279	-0.814000	0.04486	-0.394000	0.07727	0.536000	0.68110	GGA	-	NULL		0.672	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	protein_coding	OTTHUMT00000046596.1	G	NM_032807	-		5979192	+1	no_errors	ENST00000379999	ensembl	human	known	74_37	silent	SNP	0.011	A
SPTAN1	6709	genome.wustl.edu	37	9	131347012	131347032	+	In_Frame_Del	DEL	TTGGGGTCCAGAATCTGCTAA	TTGGGGTCCAGAATCTGCTAA	-			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	TTGGGGTCCAGAATCTGCTAA	TTGGGGTCCAGAATCTGCTAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr9:131347012_131347032delTTGGGGTCCAGAATCTGCTAA	ENST00000372731.4	+	18	2560_2580	c.2450_2470delTTGGGGTCCAGAATCTGCTAA	c.(2449-2472)attggggtccagaatctgctaaag>aag	p.IGVQNLL817del	SPTAN1_ENST00000372739.3_In_Frame_Del_p.IGVQNLL817del|SPTAN1_ENST00000358161.5_In_Frame_Del_p.IGVQNLL817del	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	817					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						AAGGATTTAATTGGGGTCCAGAATCTGCTAAAGAAACATCA	0.448																																					NSCLC(120;833 1744 2558 35612 37579)												0								ENSG00000197694																																			SPTAN1	SO:0001651	inframe_deletion	0				HGNC	M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.2450_2470delTTGGGGTCCAGAATCTGCTAA	9.37:g.131347012_131347032delTTGGGGTCCAGAATCTGCTAA	ENSP00000361816:p.Ile817_Leu823del	Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.IGVQNLL817in_frame_del	ENST00000372731.4	37	c.2450_2470	CCDS6905.1	9																																																																																			-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.448	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	protein_coding	OTTHUMT00000054472.1	TTGGGGTCCAGAATCTGCTAA	NM_003127			131347032	+1	no_errors	ENST00000358161	ensembl	human	known	74_37	in_frame_del	DEL	0.998:0.997:1.000:1.000:0.254:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.994:0.998:0.995:0.162:0.306:0.323:0.133:1.000	-
STK33	65975	genome.wustl.edu	37	11	8476292	8476292	+	Splice_Site	SNP	T	T	G			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr11:8476292T>G	ENST00000447869.1	-	6	1703	c.785A>C	c.(784-786)aAg>aCg	p.K262T	STK33_ENST00000396673.1_Splice_Site_p.K262T|STK33_ENST00000396672.1_Splice_Site_p.K262T|STK33_ENST00000358872.3_Splice_Site_p.K75T|STK33_ENST00000473980.1_5'Flank|STK33_ENST00000315204.1_Splice_Site_p.K262T|STK33_ENST00000534493.1_Splice_Site_p.K221T			Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	262	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|skin(3)	23				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		TAATCTTACCTTTATGTTTAA	0.308																																																	0								ENSG00000130413						138.0	128.0	131.0					11																	8476292		2191	4292	6483	STK33	SO:0001630	splice_region_variant	0			-	HGNC	AJ303380	CCDS7789.1, CCDS73253.1, CCDS73254.1	11p15.3	2010-03-10			ENSG00000130413	ENSG00000130413			14568	protein-coding gene	gene with protein product		607670				11738831	Standard	NM_030906		Approved		uc001mgj.1	Q9BYT3	OTTHUMG00000140275	ENST00000447869.1:c.786+1A>C	11.37:g.8476292T>G		Somatic	0	70	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	38	40.62	Q658S6|Q8NEF5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K262T	ENST00000447869.1	37	c.785	CCDS7789.1	11	.	.	.	.	.	.	.	.	.	.	T	19.55	3.849332	0.71603	.	.	ENSG00000130413	ENST00000447869;ENST00000315204;ENST00000396672;ENST00000358872;ENST00000396673;ENST00000444064;ENST00000534493;ENST00000524760	T;T;T;T;T;T;T;T	0.39056	1.26;1.26;1.26;1.26;1.26;1.26;1.26;1.1	5.92	5.92	0.95590	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.74313	0.3700	H	0.94886	3.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81064	-0.1102	10	0.52906	T	0.07	.	16.0516	0.80765	0.0:0.0:0.0:1.0	.	262	Q9BYT3	STK33_HUMAN	T	262;262;262;75;262;17;221;174	ENSP00000416750:K262T;ENSP00000320754:K262T;ENSP00000379905:K262T;ENSP00000351743:K75T;ENSP00000379906:K262T;ENSP00000415688:K17T;ENSP00000436418:K221T;ENSP00000436905:K174T	ENSP00000320754:K262T	K	-	2	0	STK33	8432868	1.000000	0.71417	1.000000	0.80357	0.690000	0.40134	6.507000	0.73717	2.277000	0.76020	0.528000	0.53228	AAG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.308	STK33-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STK33	protein_coding	OTTHUMT00000276819.2	T	NM_030906	-	Missense_Mutation	8476292	-1	no_errors	ENST00000315204	ensembl	human	known	74_37	missense	SNP	1.000	G
FLNC	2318	genome.wustl.edu	37	7	128490892	128490892	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr7:128490892C>G	ENST00000325888.8	+	33	5695	c.5434C>G	c.(5434-5436)Ccc>Gcc	p.P1812A	FLNC_ENST00000346177.6_Missense_Mutation_p.P1779A|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1812					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GACGGCACGGCCCAACATCAC	0.602																																																	0								ENSG00000128591						105.0	112.0	109.0					7																	128490892		2166	4233	6399	FLNC	SO:0001583	missense	0			-	HGNC	AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5434C>G	7.37:g.128490892C>G	ENSP00000327145:p.Pro1812Ala	Somatic	0	20	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	9	50.00	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.P1812A	ENST00000325888.8	37	c.5434	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	C	16.49	3.137117	0.56936	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.83837	-1.77;-1.77	5.34	5.34	0.76211	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.78246	0.4253	N	0.17594	0.5	0.80722	D	1	P;B	0.35481	0.504;0.019	B;B	0.43950	0.437;0.206	T	0.74318	-0.3704	10	0.19590	T	0.45	.	19.0452	0.93016	0.0:1.0:0.0:0.0	.	1779;1812	Q14315-2;Q14315	.;FLNC_HUMAN	A	1812;1779	ENSP00000327145:P1812A;ENSP00000344002:P1779A	ENSP00000327145:P1812A	P	+	1	0	FLNC	128278128	1.000000	0.71417	0.974000	0.42286	0.778000	0.44026	6.049000	0.71053	2.479000	0.83701	0.655000	0.94253	CCC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.602	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	protein_coding	OTTHUMT00000059948.3	C		-		128490892	+1	no_errors	ENST00000325888	ensembl	human	known	74_37	missense	SNP	1.000	G
CYBB	1536	genome.wustl.edu	37	X	37642769	37642769	+	Silent	SNP	T	T	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chrX:37642769T>C	ENST00000378588.4	+	3	235	c.168T>C	c.(166-168)ccT>ccC	p.P56P	CYBB_ENST00000536160.1_5'UTR|TM4SF2_ENST00000465127.1_Intron|CYBB_ENST00000545017.1_Silent_p.P24P	NM_000397.3	NP_000388.2	P04839	CY24B_HUMAN	cytochrome b-245, beta polypeptide	56	Ferric oxidoreductase.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|hydrogen peroxide biosynthetic process (GO:0050665)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|respiratory burst (GO:0045730)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|neuronal cell body (GO:0043025)|phagocytic vesicle membrane (GO:0030670)|rough endoplasmic reticulum (GO:0005791)	flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|prostate(2)|skin(2)	32					Dextromethorphan(DB00514)	CCAGGGCCCCTGCAGCCTGCC	0.532																																																	0								ENSG00000165168						75.0	61.0	65.0					X																	37642769		2202	4300	6502	CYBB	SO:0001819	synonymous_variant	0			-	HGNC	X04011	CCDS14242.1	Xp21.1	2014-09-17	2008-07-29		ENSG00000165168	ENSG00000165168		"""Cytochrome b genes"""	2578	protein-coding gene	gene with protein product		300481	"""chronic granulomatous disease"""	CGD			Standard	NM_000397		Approved	GP91-PHOX, NOX2	uc004ddr.2	P04839	OTTHUMG00000033175	ENST00000378588.4:c.168T>C	X.37:g.37642769T>C		Somatic	0	42	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	A8K138|Q2PP16	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.P56	ENST00000378588.4	37	c.168	CCDS14242.1	X																																																																																			-	NULL		0.532	CYBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBB	protein_coding	OTTHUMT00000080881.1	T		-		37642769	+1	no_errors	ENST00000378588	ensembl	human	known	74_37	silent	SNP	1.000	C
C16orf62	57020	genome.wustl.edu	37	16	19659138	19659138	+	Silent	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr16:19659138G>A	ENST00000251143.5	+	24	1974	c.1962G>A	c.(1960-1962)ctG>ctA	p.L654L	C16orf62_ENST00000448695.1_Silent_p.L504L|C16orf62_ENST00000543152.1_Silent_p.L403L|C16orf62_ENST00000542263.1_Silent_p.L676L|C16orf62_ENST00000438132.3_Silent_p.L743L|C16orf62_ENST00000417362.2_Silent_p.L587L			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	654						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						AACAACAGCTGAGTTTTTATG	0.408																																																	0								ENSG00000103544						262.0	232.0	242.0					16																	19659138		2197	4300	6497	C16orf62	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.1962G>A	16.37:g.19659138G>A		Somatic	0	95	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	103	13.45	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L743	ENST00000251143.5	37	c.2229		16																																																																																			-	NULL		0.408	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	protein_coding		G	NM_020314	-		19659138	+1	no_errors	ENST00000438132	ensembl	human	known	74_37	silent	SNP	0.976	A
SH3PXD2B	285590	genome.wustl.edu	37	5	171866683	171866688	+	Intron	DEL	CGCGCA	CGCGCA	-	rs62387191|rs112300779|rs376203422|rs143250033|rs202158269|rs113620669|rs140085322|rs111591179	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	CGCGCA	CGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr5:171866683_171866688delCGCGCA	ENST00000311601.5	-	1	246				SH3PXD2B_ENST00000519643.1_Intron|AC011407.1_ENST00000401308.1_RNA	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B						adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			TGCGTGCGTGCGCGcacgcgcgcgca	0.524																																																	0								ENSG00000216127																																			AC011407.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.75+14593TGCGCG>-	5.37:g.171866683_171866688delCGCGCA		Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B6F0V2|Q9P2Q1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000311601.5	37	NULL	CCDS34291.1	5																																																																																			-	-		0.524	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216127	protein_coding	OTTHUMT00000372449.1	CGCGCA	NM_017963			171866688	-1	no_errors	ENST00000401308	ensembl	human	novel	74_37	rna	DEL	0.012:0.048:0.041:0.034:0.026:0.017	-
NTRK1	4914	genome.wustl.edu	37	1	156837905	156837905	+	Silent	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr1:156837905G>A	ENST00000524377.1	+	5	479	c.438G>A	c.(436-438)tcG>tcA	p.S146S	NTRK1_ENST00000358660.3_Silent_p.S146S|NTRK1_ENST00000368196.3_Silent_p.S146S|NTRK1_ENST00000392302.2_Silent_p.S116S	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	146					activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	GGGTCCTGTCGGGGAACCCTC	0.632			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																														Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	0								ENSG00000198400						64.0	71.0	68.0					1																	156837905		2203	4300	6503	NTRK1	SO:0001819	synonymous_variant	0			-	HGNC	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.438G>A	1.37:g.156837905G>A		Somatic	0	18	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	19	42.42	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Cys-rich_flank_reg_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_neurotrophic_rcpt_1,prints_Tyr_kinase_NGF_rcpt	p.S146	ENST00000524377.1	37	c.438	CCDS1161.1	1																																																																																			-	NULL		0.632	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTRK1	protein_coding	OTTHUMT00000392279.1	G	NM_002529	-		156837905	+1	no_errors	ENST00000524377	ensembl	human	known	74_37	silent	SNP	0.018	A
AXL	558	genome.wustl.edu	37	19	41758777	41758777	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr19:41758777G>A	ENST00000301178.4	+	16	2021	c.1831G>A	c.(1831-1833)Gag>Aag	p.E611K	AXL_ENST00000359092.3_Missense_Mutation_p.E602K|AXL_ENST00000593513.1_Missense_Mutation_p.E343K	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	611	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						TTCTGAACGAGAGAGCTTCCC	0.592																																																	0								ENSG00000167601						93.0	95.0	94.0					19																	41758777		2203	4300	6503	AXL	SO:0001583	missense	0			-	HGNC	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.1831G>A	19.37:g.41758777G>A	ENSP00000301178:p.Glu611Lys	Somatic	0	94	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	108	26.53	Q8N5L2|Q9UD27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E611K	ENST00000301178.4	37	c.1831	CCDS12575.1	19	.	.	.	.	.	.	.	.	.	.	G	19.89	3.911266	0.72983	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	T;T	0.76448	-1.02;-0.95	4.81	4.81	0.61882	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.062965	0.64402	D	0.000010	T	0.75635	0.3876	L	0.28694	0.88	0.52501	D	0.999957	P;P	0.49783	0.911;0.928	P;P	0.50378	0.506;0.639	T	0.76782	-0.2832	10	0.44086	T	0.13	-15.7764	16.8155	0.85733	0.0:0.0:1.0:0.0	.	602;611	P30530-2;P30530	.;UFO_HUMAN	K	611;602	ENSP00000301178:E611K;ENSP00000351995:E602K	ENSP00000301178:E611K	E	+	1	0	AXL	46450617	1.000000	0.71417	0.981000	0.43875	0.907000	0.53573	5.257000	0.65473	2.506000	0.84524	0.655000	0.94253	GAG	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.592	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXL	protein_coding	OTTHUMT00000463323.2	G		-		41758777	+1	no_errors	ENST00000301178	ensembl	human	known	74_37	missense	SNP	1.000	A
MCPH1	79648	genome.wustl.edu	37	8	6302980	6302980	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr8:6302980G>T	ENST00000344683.5	+	8	1813	c.1737G>T	c.(1735-1737)caG>caT	p.Q579H	MCPH1_ENST00000519480.1_Missense_Mutation_p.Q579H|MCPH1_ENST00000522905.1_Missense_Mutation_p.Q531H	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	579					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		GCGAAGCCCAGAGTGAACATG	0.428																																					Colon(95;1448 1467 8277 34473 35819)												0								ENSG00000147316						64.0	58.0	60.0					8																	6302980		1880	4108	5988	MCPH1	SO:0001583	missense	0			-	HGNC	AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1737G>T	8.37:g.6302980G>T	ENSP00000342924:p.Gln579His	Somatic	0	67	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Microcephalin,pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom,prints_BRCA1	p.Q579H	ENST00000344683.5	37	c.1737	CCDS43689.1	8	.	.	.	.	.	.	.	.	.	.	G	9.314	1.056436	0.19907	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	T;T;T	0.10763	2.84;2.84;2.84	4.74	-9.48	0.00591	.	1.693500	0.02992	N	0.146939	T	0.13841	0.0335	L	0.38531	1.155	0.09310	N	1	P;B;D	0.54207	0.773;0.001;0.965	P;B;P	0.58013	0.739;0.012;0.831	T	0.37526	-0.9702	10	0.17369	T	0.5	-0.0119	9.157	0.36998	0.1648:0.3206:0.5145:0.0	.	531;579;579	E9PH63;Q8NEM0;E9PGU5	.;MCPH1_HUMAN;.	H	579;579;531	ENSP00000342924:Q579H;ENSP00000430962:Q579H;ENSP00000430768:Q531H	ENSP00000342924:Q579H	Q	+	3	2	MCPH1	6290388	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-0.720000	0.04969	-1.586000	0.01632	-0.302000	0.09304	CAG	-	pfam_Microcephalin		0.428	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCPH1	protein_coding	OTTHUMT00000374532.2	G	NM_024596	-		6302980	+1	no_errors	ENST00000344683	ensembl	human	known	74_37	missense	SNP	0.000	T
PRPF8	10594	genome.wustl.edu	37	17	1584068	1584068	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr17:1584068G>C	ENST00000572621.1	-	7	1315	c.1050C>G	c.(1048-1050)ttC>ttG	p.F350L	PRPF8_ENST00000304992.6_Missense_Mutation_p.F350L			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	350					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GGTCAAAGTAGAAAGCTGGCA	0.473																																																	0								ENSG00000174231						125.0	118.0	120.0					17																	1584068		2203	4300	6503	PRPF8	SO:0001583	missense	0			-	HGNC	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.1050C>G	17.37:g.1584068G>C	ENSP00000460348:p.Phe350Leu	Somatic	0	49	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	52	20.00	O14547|O75965	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_PRO8NT,pfam_Prp8_U5-snRNA-bd,pfam_PROCT,pfam_RRM_spliceosomal_PrP8,pfam_JAB_MPN_dom,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB_MPN_dom	p.F350L	ENST00000572621.1	37	c.1050	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787988	0.70337	.	.	ENSG00000174231	ENST00000304992	D	0.83673	-1.75	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.84284	0.5438	M	0.76838	2.35	0.80722	D	1	B	0.26512	0.151	B	0.32677	0.15	T	0.82824	-0.0266	10	0.56958	D	0.05	-4.501	13.4112	0.60944	0.081:0.0:0.919:0.0	.	350	Q6P2Q9	PRP8_HUMAN	L	350	ENSP00000304350:F350L	ENSP00000304350:F350L	F	-	3	2	PRPF8	1530818	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.971000	0.56831	2.647000	0.89833	0.650000	0.86243	TTC	-	NULL		0.473	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	protein_coding	OTTHUMT00000438412.2	G		-		1584068	-1	no_errors	ENST00000304992	ensembl	human	known	74_37	missense	SNP	1.000	C
DNAH11	8701	genome.wustl.edu	37	7	21600753	21600753	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr7:21600753C>A	ENST00000409508.3	+	5	978	c.947C>A	c.(946-948)cCt>cAt	p.P316H	DNAH11_ENST00000328843.6_Missense_Mutation_p.P316H	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	316	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AGCTATTTTCCTACTCTGAAG	0.408									Kartagener syndrome																																								0								ENSG00000105877						62.0	60.0	61.0					7																	21600753		1904	4138	6042	DNAH11	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.947C>A	7.37:g.21600753C>A	ENSP00000475939:p.Pro316His	Somatic	0	107	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	68	49.63	Q9UJ82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P316H	ENST00000409508.3	37	c.947		7	.	.	.	.	.	.	.	.	.	.	C	19.63	3.863579	0.71949	.	.	ENSG00000105877	ENST00000328843	T	0.55930	0.49	5.22	5.22	0.72569	Dynein heavy chain, domain-1 (1);	0.217157	0.38897	N	0.001522	T	0.76407	0.3983	M	0.86502	2.82	0.46954	D	0.999262	D	0.89917	1.0	D	0.72982	0.979	T	0.79557	-0.1754	10	0.52906	T	0.07	.	17.9201	0.88963	0.0:1.0:0.0:0.0	.	316	Q96DT5	DYH11_HUMAN	H	316	ENSP00000330671:P316H	ENSP00000330671:P316H	P	+	2	0	DNAH11	21567278	0.997000	0.39634	0.976000	0.42696	0.919000	0.55068	3.022000	0.49659	2.558000	0.86282	0.655000	0.94253	CCT	-	pfam_Dynein_heavy_dom-1		0.408	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	C	NM_003777	-		21600753	+1	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	SNP	1.000	A
ENGASE	64772	genome.wustl.edu	37	17	77082213	77082213	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr17:77082213G>T	ENST00000579016.1	+	14	2014	c.2014G>T	c.(2014-2016)Gac>Tac	p.D672Y		NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase	672						cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						GATGAGTGATGACTCTCCGGG	0.627																																																	0								ENSG00000167280						53.0	63.0	59.0					17																	77082213		2115	4228	6343	ENGASE	SO:0001583	missense	0			-	HGNC	AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.2014G>T	17.37:g.77082213G>T	ENSP00000462333:p.Asp672Tyr	Somatic	0	69	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	Q659F0|Q8TB86|Q9H6U4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_85,pfscan_BRCT_dom	p.D672Y	ENST00000579016.1	37	c.2014	CCDS42394.1	17	.	.	.	.	.	.	.	.	.	.	G	10.50	1.368665	0.24771	.	.	ENSG00000167280	ENST00000545583	.	.	.	3.85	-7.7	0.01259	.	0.908172	0.09569	N	0.784462	T	0.11879	0.0289	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16808	-1.0390	9	0.46703	T	0.11	-5.6932	0.0943	0.00042	0.2991:0.247:0.1806:0.2734	.	672	Q8NFI3	ENASE_HUMAN	Y	672	.	ENSP00000438577:D672Y	D	+	1	0	ENGASE	74593808	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.848000	0.04326	-1.252000	0.02491	-0.444000	0.05651	GAC	-	NULL		0.627	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENGASE	protein_coding	OTTHUMT00000395807.1	G	NM_022759	-		77082213	+1	no_errors	ENST00000579016	ensembl	human	known	74_37	missense	SNP	0.000	T
DCAF8L2	347442	genome.wustl.edu	37	X	27765824	27765824	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chrX:27765824C>A	ENST00000451261.2	+	5	1211	c.812C>A	c.(811-813)aCa>aAa	p.T271K		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	271										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						AGTGGTCACACAAATAATGTC	0.532																																																	0								ENSG00000189186						202.0	151.0	166.0					X																	27765824		692	1591	2283	DCAF8L2	SO:0001583	missense	0			-	HGNC		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.812C>A	X.37:g.27765824C>A	ENSP00000462745:p.Thr271Lys	Somatic	0	46	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	51	17.74	B2RXH9|J3KT06	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T271K	ENST00000451261.2	37	c.812	CCDS59162.1	X																																																																																			-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.532	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	protein_coding	OTTHUMT00000056143.4	C	XM_293354	-		27765824	+1	no_errors	ENST00000451261	ensembl	human	known	74_37	missense	SNP	0.069	A
NOS3	4846	genome.wustl.edu	37	7	150698651	150698651	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr7:150698651G>A	ENST00000484524.1	+	11	1448	c.1448G>A	c.(1447-1449)aGt>aAt	p.S483N	NOS3_ENST00000297494.3_Missense_Mutation_p.S483N|NOS3_ENST00000467517.1_Missense_Mutation_p.S483N|NOS3_ENST00000461406.1_Missense_Mutation_p.S277N	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGAAGGGGAGTGCCGCCAAG	0.602																																																	0								ENSG00000164867						124.0	149.0	141.0					7																	150698651		2203	4300	6503	NOS3	SO:0001583	missense	0			-	HGNC		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1448G>A	7.37:g.150698651G>A	ENSP00000420215:p.Ser483Asn	Somatic	0	68	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q495E5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.S483N	ENST00000484524.1	37	c.1448	CCDS55182.1	7	.	.	.	.	.	.	.	.	.	.	G	10.83	1.461558	0.26248	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.22743	1.94;1.94;1.94;1.94	5.19	2.23	0.28157	Nitric oxide synthase, oxygenase domain (2);	0.549920	0.17463	N	0.173377	T	0.08223	0.0205	N	0.03608	-0.345	0.20489	N	0.999894	B;B;B;B;B	0.09022	0.0;0.002;0.001;0.001;0.002	B;B;B;B;B	0.16722	0.004;0.006;0.008;0.01;0.016	T	0.19321	-1.0309	10	0.72032	D	0.01	0.4377	3.9498	0.09364	0.2905:0.1986:0.5109:0.0	.	483;483;483;277;483	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	N	483;277;483;483	ENSP00000297494:S483N;ENSP00000417143:S277N;ENSP00000420215:S483N;ENSP00000420551:S483N	ENSP00000297494:S483N	S	+	2	0	NOS3	150329584	0.463000	0.25799	0.183000	0.23137	0.697000	0.40408	3.439000	0.52878	1.184000	0.42957	-0.140000	0.14226	AGT	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk		0.602	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS3	protein_coding	OTTHUMT00000351550.1	G	NM_000603	-		150698651	+1	no_errors	ENST00000297494	ensembl	human	known	74_37	missense	SNP	0.424	A
BRINP2	57795	genome.wustl.edu	37	1	177247899	177247899	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr1:177247899C>T	ENST00000361539.4	+	7	1525	c.1213C>T	c.(1213-1215)Cgc>Tgc	p.R405C	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	405					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											TCGCCAGCCTCGCTTCCGCCT	0.617																																																	0								ENSG00000198797						48.0	49.0	49.0					1																	177247899		2203	4300	6503	BRINP2	SO:0001583	missense	0			-	HGNC		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1213C>T	1.37:g.177247899C>T	ENSP00000354481:p.Arg405Cys	Somatic	0	39	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	18	25.00	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,smart_MACPF	p.R405C	ENST00000361539.4	37	c.1213	CCDS1320.1	1	.	.	.	.	.	.	.	.	.	.	C	17.86	3.491448	0.64074	.	.	ENSG00000198797	ENST00000536589;ENST00000361539	T	0.15017	2.46	5.39	5.39	0.77823	.	0.234993	0.44285	D	0.000461	T	0.29389	0.0732	L	0.40543	1.245	0.50813	D	0.999896	D;D;D	0.71674	0.998;0.998;0.979	P;P;B	0.55785	0.731;0.784;0.252	T	0.01015	-1.1480	10	0.62326	D	0.03	-20.273	18.7504	0.91812	0.0:1.0:0.0:0.0	.	155;300;405	F5H8E0;Q9C0B6-2;Q9C0B6	.;.;FAM5B_HUMAN	C	155;405	ENSP00000354481:R405C	ENSP00000354481:R405C	R	+	1	0	FAM5B	175514522	0.991000	0.36638	1.000000	0.80357	0.998000	0.95712	2.930000	0.48924	2.528000	0.85240	0.655000	0.94253	CGC	-	NULL		0.617	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP2	protein_coding	OTTHUMT00000084599.1	C	NM_021165	-		177247899	+1	no_errors	ENST00000361539	ensembl	human	known	74_37	missense	SNP	0.997	T
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
SESTD1	91404	genome.wustl.edu	37	2	180056580	180056580	+	5'UTR	SNP	G	G	A			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr2:180056580G>A	ENST00000428443.3	-	0	305				SESTD1_ENST00000486468.1_5'UTR	NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1								phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TTACTCCAGTGAACTTCCTTA	0.333																																																	0								ENSG00000187231						62.0	62.0	62.0					2																	180056580		2203	4297	6500	SESTD1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.-12C>T	2.37:g.180056580G>A		Somatic	0	135	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	1580	178	89.82	Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000428443.3	37	NULL	CCDS33338.1	2																																																																																			-	-		0.333	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESTD1	protein_coding	OTTHUMT00000335916.2	G	NM_178123	-		180056580	-1	no_errors	ENST00000486468	ensembl	human	known	74_37	rna	SNP	0.155	A
TRIM46	80128	genome.wustl.edu	37	1	155150521	155150521	+	Frame_Shift_Del	DEL	G	G	-	rs369659260		TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr1:155150521delG	ENST00000334634.4	+	6	953	c.953delG	c.(952-954)cggfs	p.R318fs	TRIM46_ENST00000368385.4_Frame_Shift_Del_p.R318fs|TRIM46_ENST00000543729.1_Frame_Shift_Del_p.R325fs|RP11-201K10.3_ENST00000473363.2_Intron|TRIM46_ENST00000368383.3_Frame_Shift_Del_p.R318fs|TRIM46_ENST00000392451.2_Frame_Shift_Del_p.R318fs|TRIM46_ENST00000545012.1_Frame_Shift_Del_p.R192fs|TRIM46_ENST00000368382.1_Frame_Shift_Del_p.R295fs|TRIM46_ENST00000468878.1_3'UTR	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46	318						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CAGCTGGTGCGGGGGCTGGGG	0.617																																																	0								ENSG00000163462						34.0	35.0	34.0					1																	155150521		2203	4300	6503	TRIM46	SO:0001589	frameshift_variant	0				HGNC		CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680	ENST00000334634.4:c.953delG	1.37:g.155150521delG	ENSP00000334657:p.Arg318fs	Somatic	0	38	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	20	56.52	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.L320fs	ENST00000334634.4	37	c.953	CCDS1097.1	1																																																																																			-	NULL		0.617	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM46	protein_coding	OTTHUMT00000086728.1	G	NM_025058			155150521	+1	no_errors	ENST00000334634	ensembl	human	known	74_37	frame_shift_del	DEL	0.999	-
YEATS2	55689	genome.wustl.edu	37	3	183520323	183520324	+	Intron	INS	-	-	TA	rs11276625|rs74710373	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr3:183520323_183520324insTA	ENST00000305135.5	+	26	3697				AC131160.1_ENST00000401347.1_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			atatacacgtgtatatacacac	0.332														2148	0.428914	0.2602	0.4568	5008	,	,		21295	0.5228		0.4642	False		,,,				2504	0.5041																0								ENSG00000216166																																			AC131160.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3503-720->TA	3.37:g.183520328_183520329dupTA		Somatic	0	9	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	8	38.46	A7E2B9|D3DNS9|Q641P6|Q9NW96	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305135.5	37	NULL	CCDS43175.1	3																																																																																			-	-		0.332	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216166	protein_coding	OTTHUMT00000346507.2	-	NM_018023			183520324	-1	no_errors	ENST00000401347	ensembl	human	novel	74_37	rna	INS	0.000:0.000	TA
KRTAP5-8	57830	genome.wustl.edu	37	11	71249117	71249118	+	In_Frame_Ins	INS	-	-	CCG			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr11:71249117_71249118insCCG	ENST00000398534.3	+	1	47_48	c.16_17insCCG	c.(16-18)tgc>tCCGgc	p.6_6C>SG		NM_021046.2	NP_066384.2	O75690	KRA58_HUMAN	keratin associated protein 5-8	6						keratin filament (GO:0045095)	structural constituent of epidermis (GO:0030280)			cervix(1)|endometrium(1)|lung(2)|skin(1)|stomach(1)	6						CTGCTGTGGCTGCTCTGGAGGC	0.658																																																	0								ENSG00000241233																																			KRTAP5-8	SO:0001652	inframe_insertion	0				HGNC	AB126077	CCDS41683.1	11q13.4	2008-02-05			ENSG00000241233	ENSG00000241233		"""Keratin associated proteins"""	23603	protein-coding gene	gene with protein product						15144888	Standard	NM_021046		Approved	KRTAP5.8, UHSKerB, KRTAP5-2	uc001oqr.1	O75690	OTTHUMG00000057571	Exception_encountered	11.37:g.71249117_71249118insCCG	ENSP00000420723:p.Cys6delinsSerGly	Somatic	1	129	0.77		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	61	8.96	Q6L8G7|Q6UTX6	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.C6in_frame_insSG	ENST00000398534.3	37	c.16_17	CCDS41683.1	11																																																																																			-	NULL		0.658	KRTAP5-8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-8	protein_coding	OTTHUMT00000127954.1	-	NM_021046			71249118	+1	no_errors	ENST00000398534	ensembl	human	known	74_37	in_frame_ins	INS	0.913:0.882	CCG
TMEM237	65062	genome.wustl.edu	37	2	202488979	202488979	+	Silent	SNP	T	T	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr2:202488979T>C	ENST00000409883.2	-	13	1342	c.1226A>G	c.(1225-1227)tAa>tGa	p.*409*	TMEM237_ENST00000409444.2_Silent_p.*401*	NM_001044385.2	NP_001037850.1	Q96Q45	TM237_HUMAN	transmembrane protein 237	0					cilium assembly (GO:0042384)|regulation of Wnt signaling pathway (GO:0030111)	ciliary transition zone (GO:0035869)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(2)|kidney(1)|large_intestine(1)|lung(3)	7						GAGCTGGTATTATGAAGAGGC	0.313																																																	0								ENSG00000155755						118.0	113.0	115.0					2																	202488979		1803	4075	5878	TMEM237	SO:0001819	synonymous_variant	0			-	HGNC	AB053301	CCDS46489.1, CCDS46490.1	2q33	2012-05-08	2011-05-20	2011-05-20	ENSG00000155755	ENSG00000155755			14432	protein-coding gene	gene with protein product		614423	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 4"""	ALS2CR4		11586298, 20375344	Standard	NM_001044385		Approved	JBTS14	uc021vvg.2	Q96Q45	OTTHUMG00000154526	ENST00000409883.2:c.1226A>G	2.37:g.202488979T>C		Somatic	0	71	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	18	57.14	B4E1R8|B4E2R8|E9PAR8|E9PBF8|E9PG24|E9PGX0|Q53TS9|Q53TT2|Q7Z3B6|Q8IZ18|Q8NBF8|Q96CY1	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.*409	ENST00000409883.2	37	c.1226	CCDS46489.1	2																																																																																			-	NULL		0.313	TMEM237-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM237	protein_coding	OTTHUMT00000335753.1	T	NM_152388	-		202488979	-1	no_errors	ENST00000409883	ensembl	human	known	74_37	silent	SNP	0.373	C
LRRC16B	90668	genome.wustl.edu	37	14	24532356	24532356	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr14:24532356C>T	ENST00000342740.5	+	30	2888	c.2734C>T	c.(2734-2736)Cgc>Tgc	p.R912C	LRRC16B_ENST00000334420.7_Missense_Mutation_p.R8C	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	912						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		AAAGCAGAAACGCTGCCGCAA	0.562																																																	0								ENSG00000186648						74.0	70.0	71.0					14																	24532356		2203	4300	6503	LRRC16B	SO:0001583	missense	0			-	HGNC	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.2734C>T	14.37:g.24532356C>T	ENSP00000340467:p.Arg912Cys	Somatic	0	28	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	12	45.45	Q8TEF7|Q96HS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.R912C	ENST00000342740.5	37	c.2734	CCDS32054.1	14	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979508	0.74360	.	.	ENSG00000186648	ENST00000342740;ENST00000334420	T;T	0.52983	2.24;0.64	5.27	5.27	0.74061	.	0.000000	0.49916	D	0.000137	T	0.59101	0.2169	L	0.38175	1.15	0.54753	D	0.999987	D;D	0.89917	1.0;0.999	D;P	0.67548	0.952;0.635	T	0.61724	-0.7004	10	0.87932	D	0	-20.7069	16.7393	0.85455	0.0:1.0:0.0:0.0	.	8;912	Q8ND23-2;Q8ND23	.;LR16B_HUMAN	C	912;8	ENSP00000340467:R912C;ENSP00000334701:R8C	ENSP00000334701:R8C	R	+	1	0	LRRC16B	23602196	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.216000	0.51176	2.619000	0.88677	0.561000	0.74099	CGC	-	NULL		0.562	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC16B	protein_coding	OTTHUMT00000416527.1	C	NM_138360	-		24532356	+1	no_errors	ENST00000342740	ensembl	human	known	74_37	missense	SNP	1.000	T
NAP1L2	4674	genome.wustl.edu	37	X	72433974	72433974	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chrX:72433974G>T	ENST00000373517.3	-	1	710	c.355C>A	c.(355-357)Caa>Aaa	p.Q119K	NAP1L2_ENST00000536638.1_5'UTR	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	119					nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					GCTCTAGTTTGAAGCTTTTTA	0.383																																																	0								ENSG00000186462						123.0	115.0	118.0					X																	72433974		2203	4300	6503	NAP1L2	SO:0001583	missense	0			-	HGNC	AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.355C>A	X.37:g.72433974G>T	ENSP00000362616:p.Gln119Lys	Somatic	0	53	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	34	8.11	B2RE61|B4E161|Q8TAN6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.Q119K	ENST00000373517.3	37	c.355	CCDS14423.1	X	.	.	.	.	.	.	.	.	.	.	g	18.96	3.734541	0.69189	.	.	ENSG00000186462	ENST00000373517	T	0.54866	0.55	3.31	3.31	0.37934	.	0.000000	0.85682	U	0.000000	T	0.77916	0.4202	H	0.95645	3.7	0.80722	D	1	D	0.62365	0.991	D	0.71414	0.973	D	0.83994	0.0339	10	0.87932	D	0	-0.3618	11.7224	0.51689	0.0:0.0:1.0:0.0	.	119	Q9ULW6	NP1L2_HUMAN	K	119	ENSP00000362616:Q119K	ENSP00000362616:Q119K	Q	-	1	0	NAP1L2	72350699	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.795000	0.75140	1.903000	0.55091	0.600000	0.82982	CAA	-	pfam_NAP_family		0.383	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L2	protein_coding	OTTHUMT00000057225.1	G	NM_021963	-		72433974	-1	no_errors	ENST00000373517	ensembl	human	known	74_37	missense	SNP	1.000	T
NPSR1	387129	genome.wustl.edu	37	7	34873934	34873934	+	Intron	SNP	T	T	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr7:34873934T>C	ENST00000360581.1	+	6	808				NPSR1_ENST00000381539.3_Intron|NPSR1_ENST00000359791.1_Intron|NPSR1_ENST00000531252.1_Intron|NPSR1_ENST00000381542.1_Intron	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	AGTGGTCTTCTCTGTGTCCTC	0.453																																																	0								ENSG00000197085						107.0	91.0	96.0					7																	34873934		692	1591	2283	NPSR1-AS1	SO:0001627	intron_variant	0			-	HGNC	AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.681-62T>C	7.37:g.34873934T>C		Somatic	0	30	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000360581.1	37	NULL	CCDS5444.1	7																																																																																			-	-		0.453	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPSR1-AS1	protein_coding	OTTHUMT00000216837.1	T	NM_207173	-		34873934	-1	no_errors	ENST00000436945	ensembl	human	known	74_37	rna	SNP	0.000	C
ABRA	137735	genome.wustl.edu	37	8	107781809	107781809	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr8:107781809G>C	ENST00000311955.3	-	1	664	c.610C>G	c.(610-612)Ccc>Gcc	p.P204A		NM_139166.4	NP_631905.1			actin-binding Rho activating protein											breast(1)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)	27			OV - Ovarian serous cystadenocarcinoma(57;3.83e-09)			TCCTGCTCGGGCCTCTCCTCA	0.587																																																	0								ENSG00000174429						181.0	183.0	182.0					8																	107781809		2203	4300	6503	ABRA	SO:0001583	missense	0			-	HGNC	AF503617	CCDS6305.1	8q23.1	2012-02-06			ENSG00000174429	ENSG00000174429			30655	protein-coding gene	gene with protein product	"""striated muscle activator of Rho-dependent signaling"""	609747				11983702	Standard	NM_139166		Approved	STARS	uc003ymm.4	Q8N0Z2	OTTHUMG00000164809	ENST00000311955.3:c.610C>G	8.37:g.107781809G>C	ENSP00000311436:p.Pro204Ala	Somatic	0	24	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	23	48.89		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P204A	ENST00000311955.3	37	c.610	CCDS6305.1	8	.	.	.	.	.	.	.	.	.	.	G	0.414	-0.911875	0.02434	.	.	ENSG00000174429	ENST00000311955	.	.	.	6.07	3.09	0.35607	.	0.599517	0.18720	N	0.133032	T	0.39489	0.1080	L	0.57536	1.79	0.30029	N	0.813625	B	0.02656	0.0	B	0.04013	0.001	T	0.34850	-0.9812	9	0.14656	T	0.56	-11.1857	9.6094	0.39654	0.0722:0.3224:0.6054:0.0	.	204	Q8N0Z2	ABRA_HUMAN	A	204	.	ENSP00000311436:P204A	P	-	1	0	ABRA	107850985	0.008000	0.16893	0.893000	0.35052	0.270000	0.26580	0.496000	0.22499	0.811000	0.34303	0.655000	0.94253	CCC	-	NULL		0.587	ABRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABRA	protein_coding	OTTHUMT00000380416.1	G	NM_139166	-		107781809	-1	no_errors	ENST00000311955	ensembl	human	known	74_37	missense	SNP	0.853	C
CROCCP3	114819	genome.wustl.edu	37	1	16810805	16810822	+	RNA	DEL	GGCCTCGGCGGGGTGAAC	GGCCTCGGCGGGGTGAAC	-	rs374658434|rs148540984	byFrequency	TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	GGCCTCGGCGGGGTGAAC	GGCCTCGGCGGGGTGAAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr1:16810805_16810822delGGCCTCGGCGGGGTGAAC	ENST00000263511.4	-	0	1709_1726					NR_023386.1		Q8IVE0	CROL2_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 3						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GCCGGGGAGGGGCCTCGGCGGGGTGAACGGCCTCGGCC	0.716														2731	0.545327	0.2821	0.4294	5008	,	,		9595	0.9395		0.5268	False		,,,				2504	0.5961																0								ENSG00000080947																																			CROCCP3			0				HGNC	AB067509		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000080947	ENSG00000080947			29405	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 2"""	CROCCL2		11572484	Standard	NR_023386		Approved	KIAA1922	uc001ayt.2	Q8IVE0	OTTHUMG00000037885		1.37:g.16810805_16810822delGGCCTCGGCGGGGTGAAC		Somatic	NA	NA	NA		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96PW6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000263511.4	37	NULL		1																																																																																			-	-		0.716	CROCCP3-002	KNOWN	basic	processed_transcript	CROCCP3	pseudogene	OTTHUMT00000458172.1	GGCCTCGGCGGGGTGAAC	XM_057040			16810822	-1	no_errors	ENST00000263511	ensembl	human	known	74_37	rna	DEL	0.994:0.998:0.998:0.998:0.998:1.000:1.000:1.000:1.000:0.996:0.986:0.999:1.000:0.996:1.000:1.000:1.000:1.000	-
ZNF331	55422	genome.wustl.edu	37	19	54080308	54080308	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr19:54080308A>T	ENST00000253144.9	+	7	1827	c.494A>T	c.(493-495)aAg>aTg	p.K165M	ZNF331_ENST00000411977.2_Missense_Mutation_p.K165M|ZNF331_ENST00000511154.1_Missense_Mutation_p.K165M|ZNF331_ENST00000513265.1_Intron|ZNF331_ENST00000449416.1_Missense_Mutation_p.K165M|ZNF331_ENST00000511593.2_Missense_Mutation_p.K165M|ZNF331_ENST00000513999.1_Missense_Mutation_p.K165M|ZNF331_ENST00000512387.1_Missense_Mutation_p.K165M	NM_001253801.1|NM_018555.5	NP_001240730.1|NP_061025.5	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	165					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	10				GBM - Glioblastoma multiforme(134;0.00555)		AAAGAATGTAAGAAGGCCTTC	0.428			T	?	follicular thyroid adenoma																																			Dom	yes		19	19q13.3-q13.4	55422	zinc finger protein 331		E	0								ENSG00000130844						94.0	101.0	99.0					19																	54080308		2203	4300	6503	ZNF331	SO:0001583	missense	0			-	HGNC	AF251515	CCDS33102.1	19q13	2013-12-10				ENSG00000130844		"""Zinc fingers, C2H2-type"", ""-"""	15489	protein-coding gene	gene with protein product	"""rearranged in thyroid adenomas"""	606043					Standard	NM_001079906		Approved	RITA, ZNF463, ZNF361	uc021uzh.1	Q9NQX6		ENST00000253144.9:c.494A>T	19.37:g.54080308A>T	ENSP00000253144:p.Lys165Met	Somatic	0	68	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	33	31.25	Q96GJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K165M	ENST00000253144.9	37	c.494	CCDS33102.1	19	.	.	.	.	.	.	.	.	.	.	A	13.59	2.283359	0.40394	.	.	ENSG00000130844	ENST00000253144;ENST00000511593;ENST00000449416;ENST00000411977;ENST00000511154;ENST00000513999;ENST00000512387;ENST00000514022;ENST00000505949	T;T;T;T;T;T;T;T;T	0.61158	3.05;3.05;3.05;3.05;3.05;3.05;3.05;2.4;0.13	3.68	2.65	0.31530	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36628	N	0.002495	T	0.65883	0.2734	M	0.70595	2.14	0.24711	N	0.993203	D	0.69078	0.997	P	0.62813	0.907	T	0.56092	-0.8036	10	0.87932	D	0	.	4.3866	0.11319	0.7543:0.0:0.2457:0.0	.	165	Q9NQX6	ZN331_HUMAN	M	165	ENSP00000253144:K165M;ENSP00000427439:K165M;ENSP00000393817:K165M;ENSP00000393336:K165M;ENSP00000421014:K165M;ENSP00000423156:K165M;ENSP00000421728:K165M;ENSP00000422471:K165M;ENSP00000427532:K165M	ENSP00000253144:K165M	K	+	2	0	ZNF331	58772120	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	1.243000	0.32767	1.665000	0.50811	0.460000	0.39030	AAG	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.428	ZNF331-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF331	protein_coding	OTTHUMT00000371366.1	A	NM_018555	-		54080308	+1	no_errors	ENST00000253144	ensembl	human	known	74_37	missense	SNP	0.996	T
PRPF8	10594	genome.wustl.edu	37	17	1577107	1577107	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr17:1577107C>T	ENST00000572621.1	-	21	3644	c.3379G>A	c.(3379-3381)Ggc>Agc	p.G1127S	PRPF8_ENST00000304992.6_Missense_Mutation_p.G1127S			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	1127	Reverse transcriptase homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TTATTATAGCCAACGATGTTT	0.507																																																	0								ENSG00000174231						207.0	187.0	194.0					17																	1577107		2203	4300	6503	PRPF8	SO:0001583	missense	0			-	HGNC	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.3379G>A	17.37:g.1577107C>T	ENSP00000460348:p.Gly1127Ser	Somatic	0	67	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	41	26.79	O14547|O75965	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_PRO8NT,pfam_Prp8_U5-snRNA-bd,pfam_PROCT,pfam_RRM_spliceosomal_PrP8,pfam_JAB_MPN_dom,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB_MPN_dom	p.G1127S	ENST00000572621.1	37	c.3379	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	C	29.1	4.978345	0.92982	.	.	ENSG00000174231	ENST00000304992	D	0.83250	-1.7	5.45	4.47	0.54385	.	0.000000	0.85682	D	0.000000	D	0.93403	0.7896	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95246	0.8355	10	0.72032	D	0.01	.	15.763	0.78101	0.1374:0.8626:0.0:0.0	.	1127	Q6P2Q9	PRP8_HUMAN	S	1127	ENSP00000304350:G1127S	ENSP00000304350:G1127S	G	-	1	0	PRPF8	1523857	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.647000	0.83462	1.520000	0.48965	0.585000	0.79938	GGC	-	superfamily_Cupredoxin		0.507	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	protein_coding	OTTHUMT00000438412.2	C		-		1577107	-1	no_errors	ENST00000304992	ensembl	human	known	74_37	missense	SNP	1.000	T
POC1B	282809	genome.wustl.edu	37	12	89818973	89818973	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr12:89818973C>G	ENST00000313546.3	-	11	1425	c.1297G>C	c.(1297-1299)Gag>Cag	p.E433Q	POC1B_ENST00000378528.2_3'UTR|POC1B_ENST00000546740.1_5'UTR|POC1B_ENST00000541909.1_3'UTR|POC1B_ENST00000549035.1_Missense_Mutation_p.E391Q|POC1B_ENST00000393179.4_Missense_Mutation_p.E303Q	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	433					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)		p.E433*(1)		endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						ATAATATGCTCTAAAGCATCA	0.428																																																	1	Substitution - Nonsense(1)	lung(1)						ENSG00000139323						227.0	178.0	195.0					12																	89818973		2203	4300	6503	POC1B	SO:0001583	missense	0			-	HGNC	AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.1297G>C	12.37:g.89818973C>G	ENSP00000323302:p.Glu433Gln	Somatic	0	52	0.00		0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	25	44.44	G3V1X0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E433Q	ENST00000313546.3	37	c.1297	CCDS31869.1	12	.	.	.	.	.	.	.	.	.	.	C	15.16	2.750052	0.49257	.	.	ENSG00000139323	ENST00000393179;ENST00000313546;ENST00000549035	T;T;T	0.59224	0.28;0.28;0.28	5.8	5.8	0.92144	.	0.117717	0.56097	D	0.000027	T	0.58878	0.2153	L	0.45744	1.44	0.80722	D	1	D	0.57257	0.979	P	0.49140	0.601	T	0.55736	-0.8094	10	0.33940	T	0.23	.	15.5467	0.76108	0.0:1.0:0.0:0.0	.	433	Q8TC44	POC1B_HUMAN	Q	303;433;391	ENSP00000376877:E303Q;ENSP00000323302:E433Q;ENSP00000447916:E391Q	ENSP00000323302:E433Q	E	-	1	0	POC1B	88343104	1.000000	0.71417	0.960000	0.40013	0.167000	0.22549	4.420000	0.59841	2.729000	0.93468	0.563000	0.77884	GAG	-	NULL		0.428	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC1B	protein_coding	OTTHUMT00000406637.1	C	NM_172240	-		89818973	-1	no_errors	ENST00000313546	ensembl	human	known	74_37	missense	SNP	0.988	G
NISCH	11188	genome.wustl.edu	37	3	52506398	52506398	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-AB2O-01A-12D-A38Z-09	TCGA-DX-AB2O-10A-01D-A38Z-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	896a657f-b6ac-4dc4-95da-4dc85bee201b	7f1a23c3-6312-405e-bcd0-42890136bd2b	g.chr3:52506398delC	ENST00000479054.1	+	7	725	c.653delC	c.(652-654)tccfs	p.S218fs	NISCH_ENST00000488380.1_Frame_Shift_Del_p.S218fs|NISCH_ENST00000420808.2_Frame_Shift_Del_p.S218fs|NISCH_ENST00000345716.4_Frame_Shift_Del_p.S218fs			Q9Y2I1	NISCH_HUMAN	nischarin	218	Necessary for homooligomerization and targeting to endosomes.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	ATATTCAAGTCCCTGCATCAG	0.507											OREG0015615	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000010322						105.0	98.0	101.0					3																	52506398		2203	4300	6503	NISCH	SO:0001589	frameshift_variant	0				HGNC	AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.653delC	3.37:g.52506398delC	ENSP00000418232:p.Ser218fs	Somatic	0	55	0.00	985	0.6622202244241029	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Phox,pfam_Leu-rich_rpt,superfamily_Phox,smart_Phox,pfscan_Phox	p.L219fs	ENST00000479054.1	37	c.653	CCDS33767.1	3																																																																																			-	NULL		0.507	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NISCH	protein_coding	OTTHUMT00000351357.1	C	NM_007184			52506398	+1	no_errors	ENST00000345716	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
