#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
FRMPD3	84443	genome.wustl.edu	37	X	106846480	106846480	+	Silent	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chrX:106846480G>A	ENST00000276185.4	+	16	5310	c.5310G>A	c.(5308-5310)caG>caA	p.Q1770Q				Q5JV73	FRPD3_HUMAN	FERM and PDZ domain containing 3	1770	Gln-rich.					cytoskeleton (GO:0005856)				breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(16)|ovary(2)|urinary_tract(1)	28						aacaacaacagcagcagcagc	0.582																																																	0								ENSG00000147234						3.0	2.0	2.0					X																	106846480		690	1560	2250	FRMPD3	SO:0001819	synonymous_variant	0			-	HGNC	AB058720	CCDS76006.1	Xq22	2008-02-05			ENSG00000147234	ENSG00000147234			29382	protein-coding gene	gene with protein product						11347906	Standard	NM_032428		Approved	RP5-1070B1.1, KIAA1817		Q5JV73	OTTHUMG00000022165	ENST00000276185.4:c.5310G>A	X.37:g.106846480G>A		Somatic	0	29	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q96JK8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_PDZ,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.Q1770	ENST00000276185.4	37	c.5310		X																																																																																			-	NULL		0.582	FRMPD3-201	KNOWN	basic|appris_principal	protein_coding	FRMPD3	protein_coding		G	XM_042978	-		106846480	+1	no_errors	ENST00000276185	ensembl	human	known	74_37	silent	SNP	0.516	A
TLL2	7093	genome.wustl.edu	37	10	98240208	98240208	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr10:98240208delA	ENST00000357947.3	-	2	409	c.184delT	c.(184-186)tggfs	p.W62fs	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	62					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		ATGTCTCCCCAAAAGACAGCT	0.473																																																	0								ENSG00000095587						179.0	156.0	163.0					10																	98240208		2203	4300	6503	TLL2	SO:0001589	frameshift_variant	0				HGNC	AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.184delT	10.37:g.98240208delA	ENSP00000350630:p.Trp62fs	Somatic	0	84	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	52	31.58	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pirsf_BMP_1/tolloid-like,pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,prints_Peptidase_M12A,pfscan_CUB_dom,pfscan_EG-like_dom	p.W62fs	ENST00000357947.3	37	c.184	CCDS7449.1	10																																																																																			-	pirsf_BMP_1/tolloid-like		0.473	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	protein_coding	OTTHUMT00000049608.1	A				98240208	-1	no_errors	ENST00000357947	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
AOX2P	344454	genome.wustl.edu	37	2	201619758	201619759	+	IGR	DEL	TG	TG	-	rs563268698	byFrequency	TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr2:201619758_201619759delTG								AC007163.3 (19858 upstream) : AOX2P (7271 downstream)																							CCTTTCAAATtgtgtgtgtgtg	0.406														2052	0.409744	0.2262	0.3775	5008	,	,		16703	0.4236		0.4254	False		,,,				2504	0.6503																0								ENSG00000243478																																			AOX2P	SO:0001628	intergenic_variant	0				HGNC																													2.37:g.201619768_201619769delTG		Somatic	0	19	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		2																																																																																			-	-	0	0.406					AOX2P			TG				201619759	+1	no_errors	ENST00000472376	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
FHOD3	80206	genome.wustl.edu	37	18	34229330	34229331	+	Intron	DEL	AG	AG	-	rs534901959	byFrequency	TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr18:34229330_34229331delAG	ENST00000359247.4	+	11	1196				FHOD3_ENST00000591635.1_Intron|FHOD3_ENST00000590592.1_Frame_Shift_Del_p.EE416fs|FHOD3_ENST00000257209.4_Intron|FHOD3_ENST00000445677.1_Intron	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3						actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				GTTCCGAAGAAGAGAGAGAGGA	0.515																																																	0								ENSG00000134775																																			FHOD3	SO:0001627	intron_variant	0				HGNC	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.1197-8707AG>-	18.37:g.34229338_34229339delAG		Somatic	0	32	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.E419fs	ENST00000359247.4	37	c.1248_1249		18																																																																																			-	NULL		0.515	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	protein_coding	OTTHUMT00000460884.1	AG	XM_371114			34229331	+1	no_errors	ENST00000590592	ensembl	human	putative	74_37	frame_shift_del	DEL	0.997:1.000	-
LIF	3976	genome.wustl.edu	37	22	30636480	30636480	+	3'UTR	DEL	A	A	-			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr22:30636480delA	ENST00000249075.3	-	0	3924				RP1-102K2.6_ENST00000447565.1_RNA	NM_002309.4	NP_002300.1	P15018	LIF_HUMAN	leukemia inhibitory factor						blood vessel remodeling (GO:0001974)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|immune response (GO:0006955)|leukemia inhibitory factor signaling pathway (GO:0048861)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|multicellular organismal development (GO:0007275)|muscle organ morphogenesis (GO:0048644)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|neuron development (GO:0048666)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cell proliferation (GO:0008284)|positive regulation of histone H3-K27 acetylation (GO:1901676)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|spongiotrophoblast differentiation (GO:0060708)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|leukemia inhibitory factor receptor binding (GO:0005146)|receptor binding (GO:0005102)|RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001135)			breast(1)|lung(3)|skin(3)	7			Epithelial(10;0.171)			TTTTTTTCTTAAAAAAAAAAG	0.348																																																	0								ENSG00000232530																																			RP1-102K2.6	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene		CCDS13872.1, CCDS58799.1	22q12.2	2012-02-09	2012-02-09		ENSG00000128342	ENSG00000128342			6596	protein-coding gene	gene with protein product	"""differentiation inhibitory activity"", ""differentiation-inducing factor"", ""hepatocyte-stimulating factor III"", ""cholinergic differentiation factor"", ""human interleukin in DA cells"""	159540				1714745, 8058719	Standard	NM_002309		Approved	CDF, DIA, HILDA	uc003agz.3	P15018	OTTHUMG00000150910	ENST00000249075.3:c.*3160T>-	22.37:g.30636480delA		Somatic	0	15	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	B2RCW7|B5MC23|Q52LZ2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000249075.3	37	NULL	CCDS13872.1	22																																																																																			-	-		0.348	LIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232530	protein_coding	OTTHUMT00000320508.1	A	NM_002309			30636480	+1	no_errors	ENST00000447565	ensembl	human	known	74_37	rna	DEL	0.602	-
TGFBR1	7046	genome.wustl.edu	37	9	101894898	101894898	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr9:101894898C>G	ENST00000374994.4	+	3	568	c.451C>G	c.(451-453)Cgc>Ggc	p.R151G	TGFBR1_ENST00000552516.1_Missense_Mutation_p.R155G|TGFBR1_ENST00000550253.1_Missense_Mutation_p.R82G|TGFBR1_ENST00000374990.2_Intron	NM_004612.2	NP_004603.1	P36897	TGFR1_HUMAN	transforming growth factor, beta receptor 1	151					activation of MAPKK activity (GO:0000186)|angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|artery morphogenesis (GO:0048844)|blastocyst development (GO:0001824)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen fibril organization (GO:0030199)|embryonic cranial skeleton morphogenesis (GO:0048701)|endothelial cell migration (GO:0043542)|epithelial to mesenchymal transition (GO:0001837)|extracellular structure organization (GO:0043062)|germ cell migration (GO:0008354)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|mesenchymal cell differentiation (GO:0048762)|negative regulation of apoptotic process (GO:0043066)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|parathyroid gland development (GO:0060017)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|pharyngeal system development (GO:0060037)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|regulation of protein binding (GO:0043393)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|response to cholesterol (GO:0070723)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|thymus development (GO:0048538)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	endosome (GO:0005768)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	27		Acute lymphoblastic leukemia(62;0.0559)				CTGCCACAACCGCACTGTCAT	0.463																																																	0								ENSG00000106799						174.0	145.0	154.0					9																	101894898		2203	4300	6503	TGFBR1	SO:0001583	missense	0			-	HGNC		CCDS6738.1, CCDS47998.1	9q22	2014-01-30	2008-07-31		ENSG00000106799	ENSG00000106799			11772	protein-coding gene	gene with protein product	"""activin A receptor type II-like kinase, 53kDa"""	190181	"""transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kD)"", ""multiple self-healing squamous epithelioma"""	MSSE, ESS1		1319842, 8530052, 21358634	Standard	NM_001130916		Approved	ALK-5, ACVRLK4	uc004azc.3	P36897	OTTHUMG00000020353	ENST00000374994.4:c.451C>G	9.37:g.101894898C>G	ENSP00000364133:p.Arg151Gly	Somatic	0	49	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	22	37.14	Q6IR47|Q706C0|Q706C1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,superfamily_Quinolinate_PRibosylTrfase_C,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R151G	ENST00000374994.4	37	c.451	CCDS6738.1	9	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960322	0.74016	.	.	ENSG00000106799	ENST00000547314;ENST00000552573;ENST00000374994;ENST00000540092;ENST00000552516;ENST00000548365;ENST00000550253;ENST00000546584	T;T;T;T;T;T;T	0.62105	0.05;0.05;0.05;0.05;0.05;0.05;0.05	6.02	6.02	0.97574	.	0.095446	0.85682	D	0.000000	T	0.78610	0.4310	M	0.73217	2.22	0.80722	D	1	D;P	0.67145	0.996;0.843	D;B	0.65573	0.936;0.415	T	0.78043	-0.2358	10	0.56958	D	0.05	.	19.3122	0.94192	0.0:1.0:0.0:0.0	.	86;151	F8VRH6;P36897	.;TGFR1_HUMAN	G	82;86;151;151;155;86;82;148	ENSP00000449934:R82G;ENSP00000447182:R86G;ENSP00000364133:R151G;ENSP00000447297:R155G;ENSP00000448518:R86G;ENSP00000450052:R82G;ENSP00000447707:R148G	ENSP00000364133:R151G	R	+	1	0	TGFBR1	100934719	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.003000	0.70701	2.865000	0.98341	0.655000	0.94253	CGC	-	superfamily_Quinolinate_PRibosylTrfase_C		0.463	TGFBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR1	protein_coding	OTTHUMT00000053390.3	C		-		101894898	+1	no_errors	ENST00000374994	ensembl	human	known	74_37	missense	SNP	1.000	G
VPS13D	55187	genome.wustl.edu	37	1	12382770	12382770	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:12382770G>A	ENST00000358136.3	+	34	8012	c.7882G>A	c.(7882-7884)Gaa>Aaa	p.E2628K	VPS13D_ENST00000356315.4_Missense_Mutation_p.E2628K	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GGAAATCAGAGAAGGGACAAG	0.468																																																	0								ENSG00000048707						87.0	88.0	88.0					1																	12382770		2203	4300	6503	VPS13D	SO:0001583	missense	0			-	HGNC	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7882G>A	1.37:g.12382770G>A	ENSP00000350854:p.Glu2628Lys	Somatic	0	30	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	29	45.28		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.E2628K	ENST00000358136.3	37	c.7882	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070425	0.76301	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.53640	0.63;0.61	5.86	5.86	0.93980	UBA-like (1);	0.292909	0.31312	N	0.007866	T	0.35307	0.0927	N	0.22421	0.69	0.80722	D	1	B;B;B	0.27559	0.181;0.015;0.09	B;B;B	0.24541	0.054;0.019;0.024	T	0.17776	-1.0358	10	0.09590	T	0.72	.	20.1802	0.98196	0.0:0.0:1.0:0.0	.	535;2628;2628	B1AJZ2;Q5THJ4-2;Q5THJ4	.;.;VP13D_HUMAN	K	2628	ENSP00000348666:E2628K;ENSP00000350854:E2628K	ENSP00000348666:E2628K	E	+	1	0	VPS13D	12305357	1.000000	0.71417	0.986000	0.45419	0.910000	0.53928	4.395000	0.59678	2.777000	0.95525	0.655000	0.94253	GAA	-	superfamily_UBA-like		0.468	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	protein_coding	OTTHUMT00000036897.2	G	NM_015378	-		12382770	+1	no_errors	ENST00000358136	ensembl	human	known	74_37	missense	SNP	0.993	A
PTPRC	5788	genome.wustl.edu	37	1	198608430	198608430	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:198608430C>G	ENST00000367376.2	+	2	197	c.26C>G	c.(25-27)gCa>gGa	p.A9G	PTPRC_ENST00000391970.3_3'UTR|PTPRC_ENST00000367364.1_Missense_Mutation_p.A11G|PTPRC_ENST00000352140.3_Missense_Mutation_p.A9G|PTPRC_ENST00000442510.2_Missense_Mutation_p.A11G|PTPRC_ENST00000348564.6_Missense_Mutation_p.A11G|PTPRC_ENST00000598951.1_Missense_Mutation_p.A9G|PTPRC_ENST00000413409.2_Missense_Mutation_p.A11G|PTPRC_ENST00000594404.1_Missense_Mutation_p.A9G	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	9					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						AAACTCTTGGCATTTGGCTTT	0.358																																																	0								ENSG00000081237						123.0	118.0	120.0					1																	198608430		2203	4300	6503	PTPRC	SO:0001583	missense	0			-	HGNC	Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.26C>G	1.37:g.198608430C>G	ENSP00000356346:p.Ala9Gly	Somatic	0	81	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	45	45.78	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.A11G	ENST00000367376.2	37	c.32		1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588034	0.86851	.	.	ENSG00000081237	ENST00000367379;ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000271610;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000348564;ENST00000367364;ENST00000413409;ENST00000418674	T	0.03272	3.99	6.02	6.02	0.97574	Protein tyrosine phosphatase, receptor type, N terminal (1);	0.173638	0.27720	N	0.018139	T	0.15305	0.0369	L	0.52573	1.65	0.35103	D	0.765449	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.83275	0.984;0.996;0.991;0.994;0.962;0.977;0.977;0.991	T	0.00443	-1.1736	10	0.87932	D	0	.	17.703	0.88301	0.0:1.0:0.0:0.0	.	11;11;11;9;11;9;9;9	F5GXZ3;B4DSZ5;Q5T9M4;Q6Q1P2;B1ALS3;E9PC28;P08575;Q0VAE8	.;.;.;.;.;.;PTPRC_HUMAN;.	G	9;11;11;9;9;9;9;9;9;9;9;9;9	ENSP00000193532:A9G	ENSP00000271610:A9G	A	+	2	0	PTPRC	196875053	0.992000	0.36948	0.964000	0.40570	0.937000	0.57800	3.238000	0.51352	2.850000	0.98022	0.650000	0.86243	GCA	-	pirsf_Leukocyte_common_ag,pfam_PTP_recept_N		0.358	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	protein_coding		C		-		198608430	+1	no_errors	ENST00000442510	ensembl	human	known	74_37	missense	SNP	0.992	G
ERH	2079	genome.wustl.edu	37	14	69847207	69847207	+	3'UTR	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr14:69847207C>A	ENST00000557016.1	-	0	756				ERH_ENST00000216520.6_5'UTR	NM_004450.2	NP_004441.1	P84090	ERH_HUMAN	enhancer of rudimentary homolog (Drosophila)						cell cycle (GO:0007049)|nucleobase-containing compound metabolic process (GO:0006139)|osteoblast differentiation (GO:0001649)|pyrimidine nucleoside metabolic process (GO:0006213)	membrane (GO:0016020)|midbody (GO:0030496)	poly(A) RNA binding (GO:0044822)								all cancers(60;0.00365)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0507)		ACGCTGTACACACCTGTGTTC	0.468																																																	0								ENSG00000100632						80.0	81.0	81.0					14																	69847207		2203	4300	6503	ERH	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC014301	CCDS9794.1	14q24.1	2011-05-18	2001-11-28		ENSG00000100632	ENSG00000100632			3447	protein-coding gene	gene with protein product		601191	"""enhancer of rudimentary (Drosophila) homolog"""			8786099, 9074495	Standard	NM_004450		Approved	DROER	uc001xlc.2	P84090		ENST00000557016.1:c.*48G>T	14.37:g.69847207C>A		Somatic	0	41	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	21	44.74	B2R5H2|P70659|Q14259	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000557016.1	37	NULL	CCDS9794.1	14																																																																																			-	-		0.468	ERH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERH	protein_coding	OTTHUMT00000412990.1	C	NM_004450	-		69847207	-1	no_errors	ENST00000216520	ensembl	human	putative	74_37	rna	SNP	1.000	A
IGF2BP1	10642	genome.wustl.edu	37	17	47121383	47121383	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr17:47121383G>T	ENST00000290341.3	+	11	1589	c.1255G>T	c.(1255-1257)Gcc>Tcc	p.A419S	IGF2BP1_ENST00000431824.2_Missense_Mutation_p.A280S	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	419	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.|Necessary for interaction with ELAVL4 and binding to TAU mRNA. {ECO:0000250}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						GGCAGTGGGCGCCATCATCGG	0.597																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)												0								ENSG00000159217						101.0	90.0	94.0					17																	47121383		2203	4300	6503	IGF2BP1	SO:0001583	missense	0			-	HGNC	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.1255G>T	17.37:g.47121383G>T	ENSP00000290341:p.Ala419Ser	Somatic	0	38	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	C9JT33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.A419S	ENST00000290341.3	37	c.1255	CCDS11543.1	17	.	.	.	.	.	.	.	.	.	.	G	34	5.355216	0.95854	.	.	ENSG00000159217	ENST00000290341;ENST00000431824	T;T	0.29142	1.58;1.58	6.17	5.19	0.71726	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.165440	0.53938	N	0.000051	T	0.47154	0.1430	L	0.41356	1.27	0.80722	D	1	B;P	0.52692	0.076;0.955	B;D	0.72625	0.147;0.978	T	0.38265	-0.9669	10	0.44086	T	0.13	-19.6597	15.662	0.77193	0.0:0.0:0.8616:0.1384	.	280;419	C9JT33;Q9NZI8	.;IF2B1_HUMAN	S	419;280	ENSP00000290341:A419S;ENSP00000389135:A280S	ENSP00000290341:A419S	A	+	1	0	IGF2BP1	44476382	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.835000	0.99442	1.582000	0.49881	0.655000	0.94253	GCC	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.597	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP1	protein_coding	OTTHUMT00000364046.1	G	NM_006546	-		47121383	+1	no_errors	ENST00000290341	ensembl	human	known	74_37	missense	SNP	1.000	T
LINC00238	440184	genome.wustl.edu	37	14	66965126	66965126	+	lincRNA	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr14:66965126T>C	ENST00000556874.1	-	0	498				LINC00238_ENST00000389594.3_RNA																							ggaagtcagcttgataataca	0.393																																																	0								ENSG00000196553																																			LINC00238			0			-	HGNC																													14.37:g.66965126T>C		Somatic	0	29	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000556874.1	37	NULL		14																																																																																			-	-		0.393	RP11-72M17.1-001	KNOWN	basic	lincRNA	LINC00238	lincRNA	OTTHUMT00000412209.1	T		-		66965126	+1	no_errors	ENST00000359454	ensembl	human	known	74_37	rna	SNP	0.745	C
ZNF695	57116	genome.wustl.edu	37	1	247150681	247150681	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:247150681G>T	ENST00000339986.7	-	4	1283	c.1136C>A	c.(1135-1137)cCa>cAa	p.P379Q	ZNF695_ENST00000498046.2_Intron|ZNF695_ENST00000487338.2_Intron	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	379					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ACATTTGTATGGTTTCTCACC	0.408																																																	0								ENSG00000197472						50.0	54.0	53.0					1																	247150681		2161	4274	6435	ZNF695	SO:0001583	missense	0			-	HGNC		CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.1136C>A	1.37:g.247150681G>T	ENSP00000341236:p.Pro379Gln	Somatic	0	42	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	23	50.00	Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P379Q	ENST00000339986.7	37	c.1136	CCDS44344.1	1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875128	0.51695	.	.	ENSG00000197472	ENST00000339986	T	0.17213	2.29	0.642	-0.575	0.11734	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20941	0.0504	M	0.87038	2.855	0.29547	N	0.851655	B	0.28971	0.229	B	0.21546	0.035	T	0.18587	-1.0332	9	0.87932	D	0	.	5.0372	0.14440	0.2669:0.0:0.7331:0.0	.	379	Q8IW36	ZN695_HUMAN	Q	379	ENSP00000341236:P379Q	ENSP00000341236:P379Q	P	-	2	0	ZNF695	245217304	0.992000	0.36948	0.002000	0.10522	0.793000	0.44817	2.118000	0.41949	-0.247000	0.09597	0.205000	0.17691	CCA	-	pfscan_Znf_C2H2		0.408	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF695	protein_coding	OTTHUMT00000097823.5	G	NM_020394	-		247150681	-1	no_errors	ENST00000339986	ensembl	human	known	74_37	missense	SNP	0.990	T
DMXL2	23312	genome.wustl.edu	37	15	51791871	51791871	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr15:51791871T>A	ENST00000251076.5	-	18	3837	c.3550A>T	c.(3550-3552)Aca>Tca	p.T1184S	DMXL2_ENST00000449909.3_Intron|RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.T1184S	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1184						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ACTCCCACTGTAAGAATGTGG	0.418																																																	0								ENSG00000104093						67.0	63.0	64.0					15																	51791871		2195	4292	6487	DMXL2	SO:0001583	missense	0			-	HGNC	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.3550A>T	15.37:g.51791871T>A	ENSP00000251076:p.Thr1184Ser	Somatic	0	28	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T1184S	ENST00000251076.5	37	c.3550	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	T	19.55	3.847967	0.71603	.	.	ENSG00000104093	ENST00000251076;ENST00000543779	T;T	0.35048	1.33;1.33	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.62696	0.2449	M	0.79805	2.47	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.978	T	0.68428	-0.5411	10	0.72032	D	0.01	.	15.1326	0.72536	0.0:0.0:0.0:1.0	.	1184;1184	F5GWF1;Q8TDJ6	.;DMXL2_HUMAN	S	1184	ENSP00000251076:T1184S;ENSP00000441858:T1184S	ENSP00000251076:T1184S	T	-	1	0	DMXL2	49579163	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.671000	0.83941	1.973000	0.57446	0.482000	0.46254	ACA	-	NULL		0.418	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	protein_coding	OTTHUMT00000254671.2	T	NM_015263	-		51791871	-1	no_errors	ENST00000543779	ensembl	human	known	74_37	missense	SNP	1.000	A
SH2D7	646892	genome.wustl.edu	37	15	78393658	78393658	+	Missense_Mutation	SNP	G	G	A	rs202061655		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr15:78393658G>A	ENST00000328828.5	+	5	1063	c.1063G>A	c.(1063-1065)Ggg>Agg	p.G355R	SH2D7_ENST00000409568.2_Missense_Mutation_p.G219R	NM_001101404.1	NP_001094874.1	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7	355										endometrium(2)|kidney(2)|lung(3)	7						TGAGTTCATCGGGACAGAAGG	0.622																																																	0								ENSG00000183476						20.0	21.0	21.0					15																	78393658		1923	4123	6046	SH2D7	SO:0001583	missense	0			-	HGNC		CCDS45315.1	15q25.1	2013-02-14			ENSG00000183476	ENSG00000183476		"""SH2 domain containing"""	34549	protein-coding gene	gene with protein product							Standard	NM_001101404		Approved	LOC646892	uc010blb.1	A6NKC9	OTTHUMG00000154271	ENST00000328828.5:c.1063G>A	15.37:g.78393658G>A	ENSP00000327846:p.Gly355Arg	Somatic	0	32	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G219R	ENST00000328828.5	37	c.655	CCDS45315.1	15	.	.	.	.	.	.	.	.	.	.	G	2.423	-0.332678	0.05314	.	.	ENSG00000183476	ENST00000409568;ENST00000328828	T;T	0.29655	1.56;1.72	4.86	-2.43	0.06522	.	2.867590	0.01057	N	0.004566	T	0.12305	0.0299	N	0.08118	0	0.09310	N	1	B	0.15473	0.013	B	0.06405	0.002	T	0.14868	-1.0457	10	0.06757	T	0.87	-0.0103	2.6451	0.04982	0.1876:0.4385:0.2359:0.138	.	355	A6NKC9	SH2D7_HUMAN	R	219;355	ENSP00000386676:G219R;ENSP00000327846:G355R	ENSP00000327846:G355R	G	+	1	0	SH2D7	76180713	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.214000	0.17541	-0.073000	0.12842	-0.150000	0.13652	GGG	-	NULL		0.622	SH2D7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SH2D7	protein_coding	OTTHUMT00000334660.2	G	NM_001101404	rs202061655		78393658	+1	no_errors	ENST00000409568	ensembl	human	putative	74_37	missense	SNP	0.000	A
CDRT15L2	256223	genome.wustl.edu	37	17	20483754	20483754	+	Silent	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr17:20483754C>T	ENST00000399044.1	+	2	578	c.558C>T	c.(556-558)ggC>ggT	p.G186G	RP11-434D2.12_ENST00000580931.1_lincRNA	NM_001190790.1	NP_001177719.1	A8MXV6	CD15L_HUMAN	CMT1A duplicated region transcript 15-like 2	186						integral component of membrane (GO:0016021)				central_nervous_system(1)	1						AACATGGAGGCGGAGACCAGG	0.612																																																	0								ENSG00000214819																																			CDRT15L2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS54096.1	17p11.2	2008-10-30			ENSG00000214819	ENSG00000214819			34075	protein-coding gene	gene with protein product							Standard	NM_001190790		Approved		uc021tsn.1	A8MXV6	OTTHUMG00000059557	ENST00000399044.1:c.558C>T	17.37:g.20483754C>T		Somatic	0	13	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	30	26.83		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G186	ENST00000399044.1	37	c.558	CCDS54096.1	17																																																																																			-	NULL		0.612	CDRT15L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT15L2	protein_coding	OTTHUMT00000132432.3	C	XM_170840	-		20483754	+1	no_errors	ENST00000399044	ensembl	human	known	74_37	silent	SNP	0.007	T
DROSHA	29102	genome.wustl.edu	37	5	31526229	31526229	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr5:31526229G>A	ENST00000511367.2	-	4	1055	c.811C>T	c.(811-813)Cga>Tga	p.R271*	DROSHA_ENST00000513349.1_Nonsense_Mutation_p.R271*|DROSHA_ENST00000344624.3_Nonsense_Mutation_p.R271*|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000442743.1_Nonsense_Mutation_p.R271*	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	271	Arg-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						GTTCTCCCTCGGTCATAATCA	0.582																																																	0								ENSG00000113360						101.0	103.0	102.0					5																	31526229		2082	4211	6293	DROSHA	SO:0001587	stop_gained	0			-	HGNC	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.811C>T	5.37:g.31526229G>A	ENSP00000425979:p.Arg271*	Somatic	0	39	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_III_dom,pfam_dsRNA-bd_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.R271*	ENST00000511367.2	37	c.811	CCDS47195.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.43|13.43	2.233697|2.233697	0.39498|0.39498	.|.	.|.	ENSG00000113360|ENSG00000113360	ENST00000512076|ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000512302	.|.	.|.	.|.	4.55|4.55	3.6|3.6	0.41247|0.41247	.|.	.|0.185968	.|0.36338	.|N	.|0.002655	T|.	0.26484|.	0.0647|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.24799|.	-1.0150|.	3|.	.|0.02654	.|T	.|1	-9.5588|-9.5588	12.0614|12.0614	0.53564|0.53564	0.0:0.0:0.7578:0.2422|0.0:0.0:0.7578:0.2422	.|.	.|.	.|.	.|.	L|X	100|271;271;271;271;264;264;69	.|.	.|ENSP00000265075:R264X	P|R	-|-	2|1	0|2	DROSHA|DROSHA	31561986|31561986	1.000000|1.000000	0.71417|0.71417	0.292000|0.292000	0.24919|0.24919	0.251000|0.251000	0.25915|0.25915	2.416000|2.416000	0.44644|0.44644	2.348000|2.348000	0.79779|0.79779	0.650000|0.650000	0.86243|0.86243	CCG|CGA	-	NULL		0.582	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	protein_coding	OTTHUMT00000366561.3	G	NM_013235	-		31526229	-1	no_errors	ENST00000344624	ensembl	human	known	74_37	nonsense	SNP	0.881	A
PITPNM1	9600	genome.wustl.edu	37	11	67263036	67263036	+	Silent	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr11:67263036C>T	ENST00000534749.1	-	15	2543	c.2355G>A	c.(2353-2355)gaG>gaA	p.E785E	PITPNM1_ENST00000526450.1_5'Flank|PITPNM1_ENST00000436757.2_Silent_p.E784E|PITPNM1_ENST00000356404.3_Silent_p.E785E			O00562	PITM1_HUMAN	phosphatidylinositol transfer protein, membrane-associated 1	785	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				brain development (GO:0007420)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|phototransduction (GO:0007602)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol transporter activity (GO:0008526)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|liver(1)|lung(4)|ovary(1)|prostate(1)|skin(3)	18						TCTCCAGCTCCTCCAGAAAGA	0.662																																					GBM(28;144 709 4607 5525)												0								ENSG00000110697						23.0	23.0	23.0					11																	67263036		2198	4289	6487	PITPNM1	SO:0001819	synonymous_variant	0			-	HGNC	X98654	CCDS31620.1, CCDS44659.1	11q13	2008-07-21		2003-05-16	ENSG00000110697	ENSG00000110697			9003	protein-coding gene	gene with protein product	"""PYK2 N-terminal domain-interacting receptor 2"", ""retinal degeneration B alpha 1"""	608794		PITPNM		9680295	Standard	NM_004910		Approved	DRES9, NIR2, RDGB1, RDGBA1, Rd9, RDGB	uc001oly.3	O00562	OTTHUMG00000167675	ENST00000534749.1:c.2355G>A	11.37:g.67263036C>T		Somatic	0	59	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	45	53.61	A6NME4|Q6T7X3|Q8TBN3|Q9BZ73	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.E785	ENST00000534749.1	37	c.2355	CCDS31620.1	11																																																																																			-	pfam_DDHD,pfscan_DDHD		0.662	PITPNM1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PITPNM1	protein_coding	OTTHUMT00000395520.1	C	NM_004910	-		67263036	-1	no_errors	ENST00000356404	ensembl	human	known	74_37	silent	SNP	0.996	T
ADAD2	161931	genome.wustl.edu	37	16	84230349	84230349	+	Silent	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr16:84230349C>T	ENST00000315906.5	+	9	1675	c.1623C>T	c.(1621-1623)gcC>gcT	p.A541A	RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA|ADAD2_ENST00000268624.3_Silent_p.A623A|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	541	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						ACCTCCTGGCCTTGAAGACCT	0.692																																																	0								ENSG00000140955						52.0	52.0	52.0					16																	84230349		2200	4300	6500	ADAD2	SO:0001819	synonymous_variant	0			-	HGNC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1623C>T	16.37:g.84230349C>T		Somatic	0	23	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	8	72.41	B2RCL6|Q8NA94	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.A623	ENST00000315906.5	37	c.1869	CCDS45536.1	16																																																																																			-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.692	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD2	protein_coding	OTTHUMT00000433385.1	C	NM_139174	-		84230349	+1	no_errors	ENST00000268624	ensembl	human	known	74_37	silent	SNP	0.996	T
FSCN3	29999	genome.wustl.edu	37	7	127238588	127238589	+	Frame_Shift_Ins	INS	-	-	G	rs139747555		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr7:127238588_127238589insG	ENST00000265825.5	+	4	1279_1280	c.1060_1061insG	c.(1060-1062)aggfs	p.R354fs	FSCN3_ENST00000420086.2_Frame_Shift_Ins_p.R220fs	NM_020369.2	NP_065102.1	Q9NQT6	FSCN3_HUMAN	fascin actin-bundling protein 3, testicular	354						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(2)|large_intestine(3)|liver(2)|lung(17)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30						GCAGTCCTGCAGGGGGCGCTTC	0.594																																																	0								ENSG00000106328																																			FSCN3	SO:0001589	frameshift_variant	0				HGNC		CCDS34746.1	7q31.3	2014-02-03	2014-02-03		ENSG00000106328	ENSG00000106328		"""Fascins"""	3961	protein-coding gene	gene with protein product		615800	"""fascin (Strongylocentrotus purpuratus) homolog 3 (actin-bundling protein, testicular)"", ""fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus)"""			11925108	Standard	NM_020369		Approved		uc003vmd.2	Q9NQT6	OTTHUMG00000022935	ENST00000265825.5:c.1065dupG	7.37:g.127238593_127238593dupG	ENSP00000265825:p.Arg354fs	Somatic	0	25	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A4D0Z2|A6NLL7|B2RA62|B4DU68	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Fascin-domain,superfamily_Actin_cross-linking	p.R356fs	ENST00000265825.5	37	c.1060_1061	CCDS34746.1	7																																																																																			-	pfam_Fascin-domain,superfamily_Actin_cross-linking		0.594	FSCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCN3	protein_coding	OTTHUMT00000059256.2	-	NM_020369			127238589	+1	no_errors	ENST00000265825	ensembl	human	known	74_37	frame_shift_ins	INS	0.039:0.000	G
OR51D1	390038	genome.wustl.edu	37	11	4661964	4661964	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr11:4661964T>C	ENST00000357605.2	+	1	1020	c.944T>C	c.(943-945)gTc>gCc	p.V315A	OR51E1_ENST00000396952.5_5'Flank	NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	315						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTTCAAGGGTCCTCTGTATG	0.463																																																	0								ENSG00000197428						73.0	72.0	72.0					11																	4661964		2201	4298	6499	OR51D1	SO:0001583	missense	0			-	HGNC	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.944T>C	11.37:g.4661964T>C	ENSP00000350222:p.Val315Ala	Somatic	0	49	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	54	9.84	B9EIK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V315A	ENST00000357605.2	37	c.944	CCDS31357.1	11	.	.	.	.	.	.	.	.	.	.	T	5.831	0.337477	0.11013	.	.	ENSG00000197428	ENST00000357605	T	0.39056	1.1	4.7	3.55	0.40652	.	0.176010	0.27302	N	0.019987	T	0.40522	0.1120	M	0.66439	2.03	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.41502	-0.9505	10	0.66056	D	0.02	.	9.6765	0.40043	0.0:0.0:0.1747:0.8253	.	315	Q8NGF3	O51D1_HUMAN	A	315	ENSP00000350222:V315A	ENSP00000350222:V315A	V	+	2	0	OR51D1	4618540	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	0.118000	0.15605	0.905000	0.36596	0.460000	0.39030	GTC	-	NULL		0.463	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51D1	protein_coding	OTTHUMT00000385956.1	T	NM_001004751	-		4661964	+1	no_errors	ENST00000357605	ensembl	human	known	74_37	missense	SNP	0.008	C
SENP3	26168	genome.wustl.edu	37	17	7474945	7474945	+	3'UTR	DEL	T	T	-			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr17:7474945delT	ENST00000429205.2	+	0	1918				SENP3-EIF4A1_ENST00000579777.1_RNA|SENP3_ENST00000321337.7_3'UTR|EIF4A1_ENST00000380512.5_5'Flank|EIF4A1_ENST00000577269.1_5'Flank|EIF4A1_ENST00000582746.1_5'Flank|SENP3_ENST00000578868.1_3'UTR|EIF4A1_ENST00000293831.8_5'Flank			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3							cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				AATTTCTGTATTTTTTTTTCT	0.433																																																	0								ENSG00000161956																																			SENP3	SO:0001624	3_prime_UTR_variant	0				HGNC	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.*144T>-	17.37:g.7474945delT		Somatic	0	31	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000429205.2	37	NULL		17																																																																																			-	-		0.433	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	SENP3	protein_coding		T	NM_015670			7474945	+1	no_errors	ENST00000578868	ensembl	human	known	74_37	rna	DEL	0.999	-
COL5A3	50509	genome.wustl.edu	37	19	10079110	10079110	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr19:10079110T>C	ENST00000264828.3	-	59	4350	c.4265A>G	c.(4264-4266)gAt>gGt	p.D1422G		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1422	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CAACCCCTGATCTCCTTTCTC	0.607																																																	0								ENSG00000080573						106.0	119.0	115.0					19																	10079110		2203	4300	6503	COL5A3	SO:0001583	missense	0			-	HGNC	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.4265A>G	19.37:g.10079110T>C	ENSP00000264828:p.Asp1422Gly	Somatic	0	29	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	34	30.61	Q9NZQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.D1422G	ENST00000264828.3	37	c.4265	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	T	11.13	1.547765	0.27652	.	.	ENSG00000080573	ENST00000264828	D	0.93426	-3.22	4.13	3.08	0.35506	.	0.000000	0.64402	D	0.000001	D	0.95781	0.8627	M	0.89287	3.02	0.49582	D	0.999807	D	0.67145	0.996	P	0.60609	0.877	D	0.94226	0.7472	10	0.52906	T	0.07	.	7.9718	0.30132	0.1829:0.0:0.0:0.8171	.	1422	P25940	CO5A3_HUMAN	G	1422	ENSP00000264828:D1422G	ENSP00000264828:D1422G	D	-	2	0	COL5A3	9940110	1.000000	0.71417	0.895000	0.35142	0.103000	0.19146	5.557000	0.67313	0.596000	0.29794	0.482000	0.46254	GAT	-	NULL		0.607	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	protein_coding	OTTHUMT00000315788.1	T	NM_015719	-		10079110	-1	no_errors	ENST00000264828	ensembl	human	known	74_37	missense	SNP	1.000	C
WDYHV1	55093	genome.wustl.edu	37	8	124453718	124453718	+	3'UTR	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr8:124453718C>A	ENST00000287387.2	+	0	806				WDYHV1_ENST00000523356.1_3'UTR|WDYHV1_ENST00000517609.1_3'UTR|WDYHV1_ENST00000518125.1_3'UTR|WDYHV1_ENST00000523984.1_3'UTR	NM_018024.1	NP_060494.1	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1						cellular protein modification process (GO:0006464)	cytosol (GO:0005829)|nucleus (GO:0005634)	protein-N-terminal glutamine amidohydrolase activity (GO:0070773)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(3)	17						ATCCTTTCATCGAGGACAGCA	0.368																																																	0								ENSG00000156795																																			WDYHV1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK001066	CCDS6344.1, CCDS64965.1	8q24.13	2008-10-01	2008-10-01	2008-10-01		ENSG00000156795			25490	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 32"""	C8orf32		12477932	Standard	NM_018024		Approved	FLJ10204	uc003yqn.1	Q96HA8		ENST00000287387.2:c.*63C>A	8.37:g.124453718C>A		Somatic	0	32	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	B4DE68|Q9NW95	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000287387.2	37	NULL	CCDS6344.1	8																																																																																			-	-		0.368	WDYHV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDYHV1	protein_coding	OTTHUMT00000381772.1	C	NM_018024	-		124453718	+1	no_errors	ENST00000517609	ensembl	human	known	74_37	rna	SNP	0.000	A
PAPSS1	9061	genome.wustl.edu	37	4	108641363	108641364	+	5'UTR	INS	-	-	TTCTCTGCGCCGGGA	rs577715513	byFrequency	TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr4:108641363_108641364insTTCTCTGCGCCGGGA	ENST00000265174.4	-	0	244_245				PAPSS1_ENST00000511304.1_5'UTR	NM_005443.4	NP_005434.4	O43252	PAPS1_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 1						3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			NS(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(5)|ovary(1)	16		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.49e-05)		AGCAGCCGGGGTTCTCTGCGCC	0.688														7	0.00139776	0.0	0.0043	5008	,	,		13478	0.0		0.004	False		,,,				2504	0.0																0								ENSG00000138801																																			PAPSS1	SO:0001623	5_prime_UTR_variant	0				HGNC	Y10387	CCDS3676.1	4q24	2012-07-13			ENSG00000138801	ENSG00000138801	2.7.7.4, 2.7.1.25		8603	protein-coding gene	gene with protein product		603262				9576487, 9771708	Standard	NM_005443		Approved	ATPSK1, PAPSS	uc003hyk.3	O43252	OTTHUMG00000131210	ENST00000265174.4:c.-29->TCCCGGCGCAGAGAA	4.37:g.108641363_108641364insTTCTCTGCGCCGGGA		Somatic	NA	NA	NA		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O43841|O75332|Q96FB1|Q96TF4|Q9P1P9|Q9UE98	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000265174.4	37	NULL	CCDS3676.1	4																																																																																			-	-		0.688	PAPSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPSS1	protein_coding	OTTHUMT00000253946.2	-				108641364	-1	no_errors	ENST00000504987	ensembl	human	known	74_37	rna	INS	0.000:0.000	TTCTCTGCGCCGGGA
SDK2	54549	genome.wustl.edu	37	17	71426651	71426651	+	Splice_Site	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr17:71426651T>C	ENST00000392650.3	-	12	1582	c.1582A>G	c.(1582-1584)Agg>Ggg	p.R528G	SDK2_ENST00000388726.3_Splice_Site_p.R528G	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	528	Ig-like C2-type 6.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						AGCCAGTACCTGATGGTTACT	0.612																																																	0								ENSG00000069188						43.0	32.0	36.0					17																	71426651		2203	4299	6502	SDK2	SO:0001630	splice_region_variant	0			-	HGNC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1583+1A>G	17.37:g.71426651T>C		Somatic	0	27	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R528G	ENST00000392650.3	37	c.1582	CCDS45769.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.907|9.907	1.208453|1.208453	0.22205|0.22205	.|.	.|.	ENSG00000069188|ENSG00000069188	ENST00000416616|ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	.|T;T	.|0.67345	.|-0.26;-0.26	3.89|3.89	3.89|3.89	0.44902|0.44902	.|Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|0.109437	.|0.64402	.|D	.|0.000008	T|T	0.66336|0.66336	0.2779|0.2779	M|M	0.84326|0.84326	2.69|2.69	0.46396|0.46396	D|D	0.999029|0.999029	.|B;B	.|0.10296	.|0.002;0.003	.|B;B	.|0.15052	.|0.012;0.008	T|T	0.65463|0.65463	-0.6162|-0.6162	5|10	.|0.39692	.|T	.|0.17	.|.	9.6852|9.6852	0.40094|0.40094	0.0:0.0:0.1748:0.8252|0.0:0.0:0.1748:0.8252	.|.	.|528;528	.|Q58EX2-2;Q58EX2	.|.;SDK2_HUMAN	R|G	432|152;528;528;528	.|ENSP00000376421:R528G;ENSP00000373378:R528G	.|ENSP00000324967:R528G	Q|R	-|-	2|1	0|2	SDK2|SDK2	68938246|68938246	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.160000|0.160000	0.22226|0.22226	4.482000|4.482000	0.60257|0.60257	1.538000|1.538000	0.49270|0.49270	0.379000|0.379000	0.24179|0.24179	CAG|AGG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.612	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	T	NM_019064	-	Missense_Mutation	71426651	-1	no_errors	ENST00000392650	ensembl	human	known	74_37	missense	SNP	1.000	C
NNT	23530	genome.wustl.edu	37	5	43702778	43702778	+	Silent	SNP	A	A	G			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr5:43702778A>G	ENST00000264663.5	+	21	3272	c.3051A>G	c.(3049-3051)caA>caG	p.Q1017Q	NNT_ENST00000512996.2_Silent_p.Q886Q|NNT_ENST00000344920.4_Silent_p.Q1017Q	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	1017					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					CAGCAGCTCAAGAAGATCCCA	0.348																																																	0								ENSG00000112992						81.0	77.0	79.0					5																	43702778		2203	4300	6503	NNT	SO:0001819	synonymous_variant	0			-	HGNC	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.3051A>G	5.37:g.43702778A>G		Somatic	0	88	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	58	47.75	Q16796|Q2TB60|Q8N3V4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NADH_DH_b,pfam_AlaDH/PNT_NAD(H)-bd,pfam_AlaDH/PNT_N,tigrfam_NADP_transhyd_a	p.Q1017	ENST00000264663.5	37	c.3051	CCDS3949.1	5																																																																																			-	pfam_NADH_DH_b		0.348	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNT	protein_coding	OTTHUMT00000214026.1	A	NM_182977	-		43702778	+1	no_errors	ENST00000264663	ensembl	human	known	74_37	silent	SNP	0.944	G
GRIK3	2899	genome.wustl.edu	37	1	37271869	37271869	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:37271869G>A	ENST00000373091.3	-	14	2166	c.2150C>T	c.(2149-2151)gCg>gTg	p.A717V	GRIK3_ENST00000373093.4_Missense_Mutation_p.A717V	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	717					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CTTCACCAGCGCCGATGGCTT	0.592																																																	0								ENSG00000163873						106.0	92.0	97.0					1																	37271869		2203	4300	6503	GRIK3	SO:0001583	missense	0			-	HGNC	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2150C>T	1.37:g.37271869G>A	ENSP00000362183:p.Ala717Val	Somatic	0	26	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	13	70.21	A9Z1Z8|B1AMS6|Q13004|Q16136	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A717V	ENST00000373091.3	37	c.2150	CCDS416.1	1	.	.	.	.	.	.	.	.	.	.	G	9.624	1.134634	0.21123	.	.	ENSG00000163873	ENST00000373091;ENST00000373093	T;T	0.09073	3.02;3.02	5.48	5.48	0.80851	Ionotropic glutamate receptor (2);	0.069574	0.64402	D	0.000013	T	0.03095	0.0091	N	0.00966	-1.09	0.49130	D	0.999752	B;B	0.15473	0.002;0.013	B;B	0.09377	0.003;0.004	T	0.38802	-0.9644	10	0.02654	T	1	.	19.3336	0.94306	0.0:0.0:1.0:0.0	.	717;717	A9Z1Z8;Q13003	.;GRIK3_HUMAN	V	717	ENSP00000362183:A717V;ENSP00000362185:A717V	ENSP00000362183:A717V	A	-	2	0	GRIK3	37044456	0.999000	0.42202	0.999000	0.59377	0.979000	0.70002	6.604000	0.74150	2.566000	0.86566	0.549000	0.68633	GCG	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.592	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	protein_coding	OTTHUMT00000012053.1	G	NM_000831	-		37271869	-1	no_errors	ENST00000373091	ensembl	human	known	74_37	missense	SNP	1.000	A
DOT1L	84444	genome.wustl.edu	37	19	2214468	2214468	+	Splice_Site	SNP	A	A	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr19:2214468A>T	ENST00000398665.3	+	19	1833		c.e19-1		AC004490.1_ENST00000585593.1_RNA|DOT1L_ENST00000608122.1_Splice_Site	NM_032482.2	NP_115871.1	Q8TEK3	DOT1L_HUMAN	DOT1-like histone H3K79 methyltransferase						histone lysine methylation (GO:0034968)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription regulatory region DNA binding (GO:2000677)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription factor binding (GO:0008134)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(2)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(9)	42		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTATCCCCTCAGCTCAAGGCT	0.642																																																	0								ENSG00000104885						31.0	34.0	33.0					19																	2214468		2112	4242	6354	DOT1L	SO:0001630	splice_region_variant	0			-	HGNC	AF509504	CCDS42460.1	19p13.3	2013-05-21	2013-05-21		ENSG00000104885	ENSG00000104885	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"""	24948	protein-coding gene	gene with protein product	"""histone methyltransferase DOT1L"""	607375	"""DOT1-like, histone H3 methyltransferase (S. cerevisiae)"""			11347906, 12123582	Standard	NM_032482		Approved	KIAA1814, DOT1, KMT4	uc002lvb.4	Q8TEK3	OTTHUMG00000150431	ENST00000398665.3:c.1798-1A>T	19.37:g.2214468A>T		Somatic	0	85	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	118	8.53	O60379|Q96JL1	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e19-2	ENST00000398665.3	37	c.1798-2	CCDS42460.1	19	.	.	.	.	.	.	.	.	.	.	A	12.56	1.973506	0.34848	.	.	ENSG00000104885	ENST00000398665;ENST00000221482;ENST00000440640	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.637	0.62227	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOT1L	2165468	1.000000	0.71417	0.884000	0.34674	0.224000	0.24922	8.539000	0.90637	1.873000	0.54277	0.459000	0.35465	.	-	-		0.642	DOT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOT1L	protein_coding	OTTHUMT00000318066.1	A	NM_032482	-	Intron	2214468	+1	no_errors	ENST00000398665	ensembl	human	known	74_37	splice_site	SNP	0.997	T
WARS	7453	genome.wustl.edu	37	14	100828076	100828076	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr14:100828076A>C	ENST00000355338.2	-	3	900	c.282T>G	c.(280-282)agT>agG	p.S94R	WARS_ENST00000358655.4_Missense_Mutation_p.S53R|WARS_ENST00000344102.5_Missense_Mutation_p.S53R|WARS_ENST00000554084.1_5'UTR|WARS_ENST00000392882.2_Missense_Mutation_p.S94R|WARS_ENST00000556645.1_Missense_Mutation_p.S53R|WARS_ENST00000557135.1_Missense_Mutation_p.S94R	NM_173701.1	NP_776049.1	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase	94					angiogenesis (GO:0001525)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|regulation of angiogenesis (GO:0045765)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)|tryptophanyl-tRNA aminoacylation (GO:0006436)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|tryptophan-tRNA ligase activity (GO:0004830)			breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	20		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	TGCCTTTTGCACTGCTTGTCT	0.478																																																	0								ENSG00000140105						326.0	292.0	303.0					14																	100828076		2203	4300	6503	WARS	SO:0001583	missense	0			-	HGNC	M61715	CCDS9960.1, CCDS9961.1	14q32.2	2014-03-19			ENSG00000140105	ENSG00000140105	6.1.1.2	"""Aminoacyl tRNA synthetases / Class I"""	12729	protein-coding gene	gene with protein product	"""tryptophan tRNA ligase 1, cytoplasmic"""	191050		IFI53		1537332, 1763065	Standard	NM_004184		Approved	IFP53	uc001yhl.1	P23381	OTTHUMG00000171572	ENST00000355338.2:c.282T>G	14.37:g.100828076A>C	ENSP00000347495:p.Ser94Arg	Somatic	0	72	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	36	34.55	A6NGN1|A6NID3|P78535|Q502Y0|Q53XB6|Q9UDI5|Q9UDL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synth_Ic,pfam_WHEP-TRS,superfamily_S15_NS1_RNA-bd,pfscan_WHEP-TRS,prints_Trp-tRNA-ligase,tigrfam_Trp-tRNA-ligase	p.S94R	ENST00000355338.2	37	c.282	CCDS9960.1	14	.	.	.	.	.	.	.	.	.	.	A	11.48	1.650593	0.29336	.	.	ENSG00000140105	ENST00000392882;ENST00000358655;ENST00000355338;ENST00000344102;ENST00000557135;ENST00000556645;ENST00000553395;ENST00000556504;ENST00000557722;ENST00000557297;ENST00000556435;ENST00000556338;ENST00000556698;ENST00000553524;ENST00000555410;ENST00000554772;ENST00000556660;ENST00000553413;ENST00000553769;ENST00000553545	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;-0.64;1.84;1.78;1.82;1.8	5.91	-3.3	0.05003	.	0.102621	0.85682	D	0.000000	T	0.63010	0.2475	L	0.61387	1.9	0.47441	D	0.999426	B	0.13145	0.007	B	0.04013	0.001	T	0.51718	-0.8670	10	0.31617	T	0.26	-0.3145	15.3044	0.73982	0.4038:0.0:0.5962:0.0	.	94	P23381	SYWC_HUMAN	R	94;53;94;53;94;53;53;53;94;53;53;53;94;94;128;94;94;94;94;94	ENSP00000376620:S94R;ENSP00000351481:S53R;ENSP00000347495:S94R;ENSP00000339485:S53R;ENSP00000451460:S94R;ENSP00000451887:S53R;ENSP00000451490:S53R;ENSP00000451251:S53R;ENSP00000450500:S94R;ENSP00000451599:S53R;ENSP00000452519:S53R;ENSP00000451544:S53R;ENSP00000450427:S94R;ENSP00000451349:S94R;ENSP00000450934:S128R;ENSP00000451469:S94R;ENSP00000451402:S94R;ENSP00000452550:S94R;ENSP00000451906:S94R;ENSP00000451716:S94R	ENSP00000339485:S53R	S	-	3	2	WARS	99897829	0.486000	0.25980	0.918000	0.36340	0.345000	0.29048	-0.137000	0.10389	-0.626000	0.05596	-0.290000	0.09829	AGT	-	NULL		0.478	WARS-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WARS	protein_coding	OTTHUMT00000414236.1	A	NM_004184	-		100828076	-1	no_errors	ENST00000355338	ensembl	human	known	74_37	missense	SNP	0.939	C
UNC13A	23025	genome.wustl.edu	37	19	17753760	17753760	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr19:17753760G>T	ENST00000519716.2	-	20	2365	c.2366C>A	c.(2365-2367)aCt>aAt	p.T789N	UNC13A_ENST00000550896.1_Missense_Mutation_p.T787N|UNC13A_ENST00000552293.1_Missense_Mutation_p.T789N|UNC13A_ENST00000551649.1_Missense_Mutation_p.T789N|UNC13A_ENST00000252773.7_Missense_Mutation_p.T789N|UNC13A_ENST00000428389.2_Missense_Mutation_p.T877N	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	789					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						AGATTTGTCAGTTCGCTTGTC	0.502																																																	0								ENSG00000130477						43.0	43.0	43.0					19																	17753760		1958	4130	6088	UNC13A	SO:0001583	missense	0			-	HGNC	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2366C>A	19.37:g.17753760G>T	ENSP00000429562:p.Thr789Asn	Somatic	0	39	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	E5RHY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Munc13_subgr_dom-2,pfam_C2_dom,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T877N	ENST00000519716.2	37	c.2630	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	G	16.97	3.268926	0.59540	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54;-0.54	3.29	3.29	0.37713	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	U	0.000000	D	0.82591	0.5070	M	0.82630	2.6	0.58432	D	0.999996	D	0.59357	0.985	D	0.64687	0.928	D	0.85526	0.1206	10	0.87932	D	0	-12.011	12.4149	0.55488	0.0:0.0:1.0:0.0	.	789	Q9UPW8	UN13A_HUMAN	N	789;877;789;789;789;787	ENSP00000429562:T789N;ENSP00000400409:T877N;ENSP00000252773:T789N;ENSP00000447236:T789N;ENSP00000447572:T789N;ENSP00000446831:T787N	ENSP00000252773:T789N	T	-	2	0	UNC13A	17614760	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	9.512000	0.98008	1.570000	0.49709	0.313000	0.20887	ACT	-	superfamily_C2_dom		0.502	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	protein_coding	OTTHUMT00000376169.2	G	XM_038604	-		17753760	-1	no_errors	ENST00000428389	ensembl	human	known	74_37	missense	SNP	1.000	T
MYO18B	84700	genome.wustl.edu	37	22	26286800	26286800	+	Silent	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr22:26286800G>A	ENST00000407587.2	+	26	4564	c.4395G>A	c.(4393-4395)cgG>cgA	p.R1465R	MYO18B_ENST00000335473.7_Silent_p.R1464R|CTA-125H2.2_ENST00000597548.1_RNA|CTA-125H2.2_ENST00000596813.1_RNA|CTA-125H2.2_ENST00000609570.1_RNA|CTA-125H2.2_ENST00000597284.1_RNA|CTA-125H2.2_ENST00000608257.1_RNA|CTA-125H2.2_ENST00000608115.1_RNA|CTA-125H2.2_ENST00000609809.1_RNA|CTA-125H2.2_ENST00000453457.3_RNA|CTA-125H2.2_ENST00000597614.2_RNA|CTA-125H2.2_ENST00000593715.1_RNA|CTA-125H2.2_ENST00000607895.1_RNA|CTA-125H2.2_ENST00000595102.1_RNA|CTA-125H2.2_ENST00000609820.1_RNA|CTA-125H2.2_ENST00000609275.1_RNA|CTA-125H2.2_ENST00000609889.1_RNA|CTA-125H2.2_ENST00000609157.1_RNA|CTA-125H2.2_ENST00000609823.1_RNA|CTA-125H2.2_ENST00000600211.1_RNA|MYO18B_ENST00000536101.1_Silent_p.R1464R|CTA-125H2.2_ENST00000594542.1_RNA|CTA-125H2.2_ENST00000594585.1_RNA|CTA-125H2.2_ENST00000608921.1_RNA|CTA-125H2.2_ENST00000599080.1_RNA|CTA-125H2.2_ENST00000608507.1_RNA			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1464	Tail.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AGAGTGAGCGGGCAGAGCGGC	0.602																																																	0								ENSG00000133454						57.0	63.0	61.0					22																	26286800		2110	4235	6345	MYO18B	SO:0001819	synonymous_variant	0			-	HGNC	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.4395G>A	22.37:g.26286800G>A		Somatic	0	48	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	26	51.85	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1464	ENST00000407587.2	37	c.4392		22																																																																																			-	superfamily_tRNA-bd_arm		0.602	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	protein_coding	OTTHUMT00000400691.1	G	NM_032608	-		26286800	+1	no_errors	ENST00000335473	ensembl	human	known	74_37	silent	SNP	0.998	A
KMT2A	4297	genome.wustl.edu	37	11	118352703	118352709	+	Frame_Shift_Del	DEL	TGGTCAT	TGGTCAT	-			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	TGGTCAT	TGGTCAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr11:118352703_118352709delTGGTCAT	ENST00000389506.5	+	7	3908_3914	c.3908_3914delTGGTCAT	c.(3907-3915)ctggtcatcfs	p.LVI1303fs	KMT2A_ENST00000354520.4_Frame_Shift_Del_p.LVI1303fs|KMT2A_ENST00000420751.2_3'UTR|KMT2A_ENST00000534358.1_Frame_Shift_Del_p.LVI1303fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1303					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CAGCCAGCACTGGTCATCCCGCCTCAG	0.556																																																	0								ENSG00000118058																																			KMT2A	SO:0001589	frameshift_variant	0				HGNC	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3908_3914delTGGTCAT	11.37:g.118352703_118352709delTGGTCAT	ENSP00000374157:p.Leu1303fs	Somatic	NA	NA	NA		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_Bromodomain,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pirsf_MeTrfase_trithorax,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC,pfscan_Bromodomain	p.L1303fs	ENST00000389506.5	37	c.3908_3914	CCDS31686.1	11																																																																																			-	pirsf_MeTrfase_trithorax		0.556	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2A	protein_coding	OTTHUMT00000399085.2	TGGTCAT	NM_005933			118352709	+1	no_errors	ENST00000389506	ensembl	human	known	74_37	frame_shift_del	DEL	0.014:0.002:0.006:0.000:0.001:0.000:0.001	-
CRB1	23418	genome.wustl.edu	37	1	197398635	197398635	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:197398635T>A	ENST00000367400.3	+	8	2868	c.2733T>A	c.(2731-2733)tgT>tgA	p.C911*	CRB1_ENST00000535699.1_Nonsense_Mutation_p.C887*|CRB1_ENST00000544212.1_Nonsense_Mutation_p.C392*|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367399.2_Nonsense_Mutation_p.C799*|CRB1_ENST00000367397.1_Nonsense_Mutation_p.C292*	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	911	EGF-like 13. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ACTTCTCCTGTTCCTGTCCTG	0.537																																																	0								ENSG00000134376						177.0	158.0	165.0					1																	197398635		2203	4300	6503	CRB1	SO:0001587	stop_gained	0			-	HGNC		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2733T>A	1.37:g.197398635T>A	ENSP00000356370:p.Cys911*	Somatic	0	47	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	45	42.31	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.C911*	ENST00000367400.3	37	c.2733	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	T	38	6.745526	0.97809	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	.	.	.	5.55	0.493	0.16878	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8936	0.63755	0.0:0.8558:0.0:0.1442	.	.	.	.	X	887;911;799;392;292;560	.	ENSP00000356367:C292X	C	+	3	2	CRB1	195665258	0.996000	0.38824	0.854000	0.33618	0.737000	0.42083	0.447000	0.21710	0.087000	0.17167	0.533000	0.62120	TGT	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.537	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	protein_coding	OTTHUMT00000086565.2	T	NM_201253	-		197398635	+1	no_errors	ENST00000367400	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ADAM21P1	145241	genome.wustl.edu	37	14	70713103	70713103	+	RNA	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr14:70713103T>C	ENST00000530196.1	-	0	1415					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		CACACTGCTGTACGGATCCAC	0.483																																																	0								ENSG00000235812																																			ADAM21P1			0			-	HGNC			14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713103T>C		Somatic	0	69	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	40	31.03		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			-	-		0.483	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	pseudogene	OTTHUMT00000390451.1	T	NG_002467	-		70713103	-1	no_errors	ENST00000530196	ensembl	human	known	74_37	rna	SNP	0.002	C
C9orf62	157927	genome.wustl.edu	37	9	138235877	138235877	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr9:138235877T>C	ENST00000320778.2	+	2	233	c.83T>C	c.(82-84)cTc>cCc	p.L28P		NM_173520.2	NP_775791.1	Q8N4C0	CI062_HUMAN	chromosome 9 open reading frame 62	28																	GGGAGGGGACTCGTCCCCGCC	0.647											OREG0019607	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000178243																																			C9orf62	SO:0001583	missense	0			-	HGNC	BC034752	CCDS59154.1	9q34.3	2008-02-05			ENSG00000178243	ENSG00000178243			28581	protein-coding gene	gene with protein product						12477932	Standard	NM_173520		Approved	MGC35463	uc004cfo.3	Q8N4C0	OTTHUMG00000020900	ENST00000320778.2:c.83T>C	9.37:g.138235877T>C	ENSP00000326574:p.Leu28Pro	Somatic	0	31	0.00	1639	0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	21	36.36	Q5T7E2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L28P	ENST00000320778.2	37	c.83	CCDS59154.1	9	.	.	.	.	.	.	.	.	.	.	T	8.414	0.844940	0.16963	.	.	ENSG00000178243	ENST00000320778	.	.	.	2.58	0.49	0.16861	.	.	.	.	.	T	0.28896	0.0717	.	.	.	0.09310	N	0.999999	B	0.28713	0.22	B	0.26310	0.068	T	0.26643	-1.0097	7	0.87932	D	0	.	4.6375	0.12531	0.0:0.6609:0.0:0.3391	.	28	Q8N4C0	CI062_HUMAN	P	28	.	ENSP00000326574:L28P	L	+	2	0	C9orf62	137375698	0.001000	0.12720	0.001000	0.08648	0.036000	0.12997	0.318000	0.19504	0.101000	0.17610	0.459000	0.35465	CTC	-	NULL		0.647	C9orf62-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C9orf62	protein_coding	OTTHUMT00000054980.2	T	NM_173520	-		138235877	+1	no_errors	ENST00000320778	ensembl	human	putative	74_37	missense	SNP	0.001	C
KLC2	64837	genome.wustl.edu	37	11	66031830	66031830	+	Silent	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr11:66031830G>T	ENST00000417856.1	+	9	1374	c.1131G>T	c.(1129-1131)ctG>ctT	p.L377L	KLC2_ENST00000316924.5_Silent_p.L377L|RP11-867G23.1_ENST00000530805.1_RNA|RP11-755F10.3_ENST00000533576.1_RNA|KLC2_ENST00000421552.1_Silent_p.L300L|KLC2_ENST00000394067.2_Silent_p.L377L|KLC2_ENST00000394066.2_Silent_p.L300L|KLC2_ENST00000394078.1_Intron|KLC2_ENST00000394065.2_Silent_p.L238L	NM_001134775.1	NP_001128247.1	Q9H0B6	KLC2_HUMAN	kinesin light chain 2	377					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon cargo transport (GO:0008088)|blood coagulation (GO:0007596)|microtubule-based movement (GO:0007018)	ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinesin I complex (GO:0016938)|membrane (GO:0016020)|microtubule (GO:0005874)|neuron projection (GO:0043005)|protein complex (GO:0043234)	kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	24						CCTGCTACCTGAAGCAGGGCA	0.567																																																	0								ENSG00000174996						82.0	67.0	72.0					11																	66031830		2200	4295	6495	KLC2	SO:0001819	synonymous_variant	0			-	HGNC	AK022449	CCDS8130.1, CCDS44653.1	11q13.1	2013-01-10			ENSG00000174996	ENSG00000174996		"""Tetratricopeptide (TTC) repeat domain containing"""	20716	protein-coding gene	gene with protein product		611729				9624122	Standard	NM_022822		Approved	FLJ12387	uc001ohb.2	Q9H0B6	OTTHUMG00000133757	ENST00000417856.1:c.1131G>T	11.37:g.66031830G>T		Somatic	0	49	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A8MXL7|B2RDY4|Q9H9C8|Q9HA20	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR_1,smart_TPR_repeat,prints_Kinesin_light,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L377	ENST00000417856.1	37	c.1131	CCDS8130.1	11																																																																																			-	pfam_TPR_1,smart_TPR_repeat,prints_Kinesin_light,pfscan_TPR-contain_dom		0.567	KLC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KLC2	protein_coding	OTTHUMT00000258200.1	G	NM_022822	-		66031830	+1	no_errors	ENST00000316924	ensembl	human	known	74_37	silent	SNP	1.000	T
FAR2P1	440905	genome.wustl.edu	37	2	130792055	130792055	+	RNA	SNP	T	T	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr2:130792055T>C	ENST00000325390.3	-	0	2743					NR_026758.1																						ATAATTCATCTGATTAAAGCA	0.299																																																	0								ENSG00000180178																																			AC018865.8			0			-	Clone_based_vega_gene																													2.37:g.130792055T>C		Somatic	0	52	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	42	27.59		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000325390.3	37	NULL		2																																																																																			-	-		0.299	AC018865.8-002	KNOWN	basic	processed_transcript	LOC440905	pseudogene	OTTHUMT00000331630.3	T		-		130792055	-1	no_errors	ENST00000444030	ensembl	human	known	74_37	rna	SNP	0.298	C
BCLAF1	9774	genome.wustl.edu	37	6	136599135	136599135	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr6:136599135A>T	ENST00000531224.1	-	4	1136	c.884T>A	c.(883-885)aTc>aAc	p.I295N	BCLAF1_ENST00000353331.4_Missense_Mutation_p.I293N|BCLAF1_ENST00000527536.1_Missense_Mutation_p.I295N|BCLAF1_ENST00000530767.1_Missense_Mutation_p.I295N|BCLAF1_ENST00000527759.1_Missense_Mutation_p.I293N|BCLAF1_ENST00000392348.2_Missense_Mutation_p.I293N	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	295					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCGTGAAGGGATGTGATGAAT	0.468																																					Colon(142;1534 1789 5427 7063 28491)												0								ENSG00000029363						95.0	83.0	87.0					6																	136599135		2203	4300	6503	BCLAF1	SO:0001583	missense	0			-	HGNC	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.884T>A	6.37:g.136599135A>T	ENSP00000435210:p.Ile295Asn	Somatic	0	227	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	153	16.76	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I295N	ENST00000531224.1	37	c.884	CCDS5177.1	6	.	.	.	.	.	.	.	.	.	.	A	15.57	2.873082	0.51695	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.14640	2.94;2.94;2.94;2.49;2.94;2.94;2.75	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000002	T	0.09202	0.0227	N	0.08118	0	0.80722	D	1	D;D;D;D	0.64830	0.987;0.994;0.987;0.987	P;P;P;P	0.56960	0.696;0.81;0.696;0.696	T	0.34925	-0.9809	10	0.49607	T	0.09	-1.3166	16.182	0.81915	1.0:0.0:0.0:0.0	.	293;293;295;295	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	N	295;293;295;295;293;293;295	ENSP00000435210:I295N;ENSP00000229446:I293N;ENSP00000435441:I295N;ENSP00000436501:I295N;ENSP00000434826:I293N;ENSP00000376159:I293N;ENSP00000431734:I295N	ENSP00000229446:I293N	I	-	2	0	BCLAF1	136640828	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.067000	0.64357	2.222000	0.72286	0.528000	0.53228	ATC	-	NULL		0.468	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	protein_coding	OTTHUMT00000042375.2	A	NM_014739	-		136599135	-1	no_errors	ENST00000531224	ensembl	human	known	74_37	missense	SNP	1.000	T
NUP210	23225	genome.wustl.edu	37	3	13359266	13359266	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr3:13359266G>T	ENST00000254508.5	-	40	5661	c.5579C>A	c.(5578-5580)tCa>tAa	p.S1860*		NM_024923.2	NP_079199.2	Q8TEM1	PO210_HUMAN	nucleoporin 210kDa	1860					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|ovary(7)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	66	all_neural(104;0.187)					AGATGTGGGTGATGAGGCAGC	0.602																																																	0								ENSG00000132182						117.0	110.0	113.0					3																	13359266		2203	4300	6503	NUP210	SO:0001587	stop_gained	0			-	HGNC	AB020713	CCDS33704.1	3p25	2008-02-05			ENSG00000132182	ENSG00000132182			30052	protein-coding gene	gene with protein product		607703				2184032, 7504063	Standard	NM_024923		Approved	GP210, POM210, FLJ22389, KIAA0906	uc003bxv.1	Q8TEM1	OTTHUMG00000157268	ENST00000254508.5:c.5579C>A	3.37:g.13359266G>T	ENSP00000254508:p.Ser1860*	Somatic	0	32	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A6NN56|O94980|Q6NXG6|Q8NBJ1|Q9H6C8|Q9UFP3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,superfamily_Cadherin-like,smart_Big_2	p.S1860*	ENST00000254508.5	37	c.5579	CCDS33704.1	3	.	.	.	.	.	.	.	.	.	.	G	44	11.222766	0.99533	.	.	ENSG00000132182	ENST00000254508	.	.	.	5.51	5.51	0.81932	.	0.594205	0.16337	N	0.218899	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.3844	14.9163	0.70801	0.0:0.0:1.0:0.0	.	.	.	.	X	1860	.	ENSP00000254508:S1860X	S	-	2	0	NUP210	13334266	0.094000	0.21725	0.201000	0.23476	0.261000	0.26267	1.985000	0.40668	2.605000	0.88082	0.655000	0.94253	TCA	-	NULL		0.602	NUP210-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	NUP210	protein_coding	OTTHUMT00000340085.1	G	NM_024923	-		13359266	-1	no_errors	ENST00000254508	ensembl	human	known	74_37	nonsense	SNP	0.087	T
ITGB1BP1	9270	genome.wustl.edu	37	2	9552383	9552384	+	Intron	INS	-	-	TT	rs112462761|rs34086297		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr2:9552383_9552384insTT	ENST00000360635.3	-	5	1185				ITGB1BP1_ENST00000488451.1_Intron|ITGB1BP1_ENST00000355346.4_Intron|ITGB1BP1_ENST00000490426.1_Intron|ITGB1BP1_ENST00000238091.4_Intron|ITGB1BP1_ENST00000456913.2_Intron|ITGB1BP1_ENST00000359712.3_Intron			O14713	ITBP1_HUMAN	integrin beta 1 binding protein 1						activation of protein kinase B activity (GO:0032148)|biomineral tissue development (GO:0031214)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|integrin activation (GO:0033622)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|myoblast migration (GO:0051451)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|Notch signaling pathway (GO:0007219)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein transport (GO:0015031)|receptor clustering (GO:0043113)|regulation of blood vessel size (GO:0050880)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of integrin-mediated signaling pathway (GO:2001044)|transcription, DNA-templated (GO:0006351)|tube formation (GO:0035148)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GDP-dissociation inhibitor activity (GO:0005092)|integrin binding (GO:0005178)|protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)			kidney(2)|large_intestine(2)|lung(2)|prostate(2)	8	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.23)		GAGTTACGGAATTTTTTTTTTT	0.49																																																	0								ENSG00000119185																																			ITGB1BP1	SO:0001627	intron_variant	0				HGNC	AF012023	CCDS1662.1, CCDS1663.1	2p25.2	2008-02-05			ENSG00000119185	ENSG00000119185			23927	protein-coding gene	gene with protein product	"""integrin cytoplasmic domain-associated protein 1"", ""integrin cytoplasmic domain-associated protein 1-beta"", ""integrin cytoplasmic domain-associated protein 1-alpha"", ""bodenin"""	607153				11854171, 9281591	Standard	NM_004763		Approved	ICAP-1A, ICAP-1B, ICAP1, ICAP1A, ICAP1B, ICAP-1alpha	uc002qzj.3	O14713	OTTHUMG00000090414	ENST00000360635.3:c.288+13->AA	2.37:g.9552392_9552393dupTT		Somatic	0	25	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	D6W4Y9|O14714|Q53RS0	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Integrin-bd_ICAP-1	p.N101fs	ENST00000360635.3	37	c.303_302	CCDS1662.1	2																																																																																			-	NULL		0.490	ITGB1BP1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ITGB1BP1	protein_coding	OTTHUMT00000314623.2	-	NM_004763, NM_022334			9552384	-1	no_errors	ENST00000483795	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	TT
ATRX	546	genome.wustl.edu	37	X	76952083	76952084	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chrX:76952083_76952084insA	ENST00000373344.5	-	5	565_566	c.351_352insT	c.(349-354)actatgfs	p.M118fs	ATRX_ENST00000395603.3_Frame_Shift_Ins_p.M118fs|ATRX_ENST00000373341.1_Frame_Shift_Ins_p.M79fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	118					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAGCTCTGCATAGTAATATCAT	0.272			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224																																			ATRX	SO:0001589	frameshift_variant	0				HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.352dupT	X.37:g.76952084_76952084dupA	ENSP00000362441:p.Met118fs	Somatic	0	36	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	10	71.43	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M117fs	ENST00000373344.5	37	c.352_351	CCDS14434.1	X																																																																																			-	NULL		0.272	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	-	NM_000489			76952084	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
OR6A2	8590	genome.wustl.edu	37	11	6816255	6816255	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr11:6816255C>A	ENST00000332601.3	-	1	873	c.685G>T	c.(685-687)Gct>Tct	p.A229S		NM_003696.2	NP_003687.2	O95222	OR6A2_HUMAN	olfactory receptor, family 6, subfamily A, member 2	229					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(4)|pancreas(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	29		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TGCATCACAGCACCAGTAATG	0.483																																																	0								ENSG00000184933						99.0	103.0	102.0					11																	6816255		2201	4296	6497	OR6A2	SO:0001583	missense	0			-	HGNC	AB065822	CCDS7772.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184933	ENSG00000184933		"""GPCR / Class A : Olfactory receptors"""	15301	protein-coding gene	gene with protein product		608495		OR6A2P, OR6A1			Standard	NM_003696		Approved	OR11-55	uc001mes.1	O95222	OTTHUMG00000165736	ENST00000332601.3:c.685G>T	11.37:g.6816255C>A	ENSP00000330384:p.Ala229Ser	Somatic	0	35	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	Q3MJC7|Q6IF35|Q9H206	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A229S	ENST00000332601.3	37	c.685	CCDS7772.1	11	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609940	0.66558	.	.	ENSG00000184933	ENST00000332601	T	0.00224	8.51	5.07	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.111264	0.39759	N	0.001272	T	0.00210	0.0006	L	0.31526	0.94	0.27349	N	0.956302	P	0.46020	0.871	P	0.51550	0.673	T	0.51276	-0.8726	10	0.41790	T	0.15	.	7.2672	0.26235	0.0:0.7319:0.0:0.2681	.	229	O95222	OR6A2_HUMAN	S	229	ENSP00000330384:A229S	ENSP00000330384:A229S	A	-	1	0	OR6A2	6772831	0.000000	0.05858	0.949000	0.38748	0.964000	0.63967	-0.886000	0.04157	0.842000	0.35045	0.655000	0.94253	GCT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.483	OR6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6A2	protein_coding	OTTHUMT00000385981.1	C	NM_003696	-		6816255	-1	no_errors	ENST00000332601	ensembl	human	known	74_37	missense	SNP	0.968	A
HSP90AB1	3326	genome.wustl.edu	37	6	44221262	44221262	+	Missense_Mutation	SNP	A	A	G	rs201760495	byFrequency	TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr6:44221262A>G	ENST00000371554.1	+	12	2316	c.2102A>G	c.(2101-2103)aAt>aGt	p.N701S	SLC35B2_ENST00000495706.1_5'Flank|MIR4647_ENST00000583964.1_RNA|HSP90AB1_ENST00000371646.5_Missense_Mutation_p.N701S|HSP90AB1_ENST00000353801.3_Missense_Mutation_p.N701S			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	701					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GAGGAACCCAATGCTGCAGTT	0.453											OREG0017471	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000096384						75.0	76.0	76.0					6																	44221262		2203	4300	6503	HSP90AB1	SO:0001583	missense	0			-	HGNC	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.2102A>G	6.37:g.44221262A>G	ENSP00000360609:p.Asn701Ser	Somatic	0	42	0.00	922	0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	39	11.36	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hsp90_fam,pfam_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HATPase_ATP-bd,smart_HATPase_ATP-bd,pirsf_Hsp90_fam,prints_Hsp90_N	p.N701S	ENST00000371554.1	37	c.2102	CCDS4909.1	6	.	.	.	.	.	.	.	.	.	.	G	3.876	-0.026861	0.07589	.	.	ENSG00000096384	ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.08807	3.05;3.05;3.05	3.91	3.91	0.45181	.	0.272984	0.27901	N	0.017393	T	0.00580	0.0019	N	0.01109	-1.01	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.001	T	0.47749	-0.9093	10	0.02654	T	1	-8.621	7.7636	0.28968	0.0881:0.2939:0.618:0.0	.	663;691;701	B4DMA2;B4DGL0;P08238	.;.;HS90B_HUMAN	S	701	ENSP00000360709:N701S;ENSP00000325875:N701S;ENSP00000360609:N701S	ENSP00000325875:N701S	N	+	2	0	HSP90AB1	44329240	1.000000	0.71417	1.000000	0.80357	0.877000	0.50540	2.913000	0.48790	1.010000	0.39314	-0.166000	0.13349	AAT	-	pfam_Hsp90_fam,pirsf_Hsp90_fam		0.453	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSP90AB1	protein_coding	OTTHUMT00000040730.1	A	NM_007355	rs201760495		44221262	+1	no_errors	ENST00000353801	ensembl	human	known	74_37	missense	SNP	0.999	G
PRIM2	5558	genome.wustl.edu	37	6	57182423	57182423	+	3'UTR	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr6:57182423G>T	ENST00000389488.2	+	0	2				PRIM2_ENST00000607273.1_5'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TCCTCTTCCGGTTTCATATGA	0.577																																																	0								ENSG00000146143																																			PRIM2	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*-1G>T	6.37:g.57182423G>T		Somatic	0	49	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	67	8.22	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			-	-		0.577	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	protein_coding	OTTHUMT00000043468.3	G	NM_000947	-		57182423	+1	no_errors	ENST00000274891	ensembl	human	known	74_37	rna	SNP	0.540	T
KIF13B	23303	genome.wustl.edu	37	8	29006108	29006108	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr8:29006108G>T	ENST00000524189.1	-	16	1837	c.1799C>A	c.(1798-1800)gCc>gAc	p.A600D	KIF13B_ENST00000521515.1_Missense_Mutation_p.A600D	NM_015254.3	NP_056069.2	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	600					metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein targeting (GO:0006605)|regulation of axonogenesis (GO:0050770)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	axon (GO:0030424)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|protein kinase binding (GO:0019901)			endometrium(6)|kidney(1)|lung(20)|urinary_tract(1)	28		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		GCTGCCCAGGGCCTTCATGGT	0.542																																																	0								ENSG00000197892						70.0	73.0	72.0					8																	29006108		2003	4174	6177	KIF13B	SO:0001583	missense	0			-	HGNC	AB014539	CCDS55217.1	8p21	2008-07-30				ENSG00000197892		"""Kinesins"""	14405	protein-coding gene	gene with protein product		607350				9734811, 10859302, 16864656	Standard	NM_015254		Approved	GAKIN, KIAA0639	uc003xhh.4	Q9NQT8		ENST00000524189.1:c.1799C>A	8.37:g.29006108G>T	ENSP00000427900:p.Ala600Asp	Somatic	0	50	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B4DGY5|B5MC45|F8VPJ2|O75134|Q9BYJ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_CAP-Gly_domain,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_CAP-Gly_domain,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_CAP-Gly_domain,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A600D	ENST00000524189.1	37	c.1799	CCDS55217.1	8	.	.	.	.	.	.	.	.	.	.	G	15.93	2.978157	0.53720	.	.	ENSG00000197892	ENST00000524189;ENST00000521515	T;T	0.72282	-0.64;-0.64	5.11	5.11	0.69529	.	0.050840	0.85682	D	0.000000	T	0.80439	0.4623	L	0.49350	1.555	0.80722	D	1	D;D;B	0.76494	0.999;0.999;0.081	D;D;B	0.83275	0.996;0.953;0.034	T	0.74893	-0.3509	10	0.23891	T	0.37	.	19.098	0.93260	0.0:0.0:1.0:0.0	.	586;600;600	C9JK41;Q9NQT8;F8VPJ2	.;KI13B_HUMAN;.	D	600	ENSP00000427900:A600D;ENSP00000429201:A600D	ENSP00000429201:A600D	A	-	2	0	KIF13B	29062027	1.000000	0.71417	0.978000	0.43139	0.991000	0.79684	3.329000	0.52060	2.826000	0.97356	0.561000	0.74099	GCC	-	NULL		0.542	KIF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF13B	protein_coding	OTTHUMT00000376878.1	G		-		29006108	-1	no_errors	ENST00000524189	ensembl	human	known	74_37	missense	SNP	0.990	T
UGGT2	55757	genome.wustl.edu	37	13	96513064	96513064	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr13:96513064G>C	ENST00000376747.3	-	32	3788	c.3718C>G	c.(3718-3720)Cat>Gat	p.H1240D		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1240	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TCATATAAATGACCAGAAGCA	0.239																																																	0								ENSG00000102595						52.0	53.0	53.0					13																	96513064		2194	4255	6449	UGGT2	SO:0001583	missense	0			-	HGNC	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.3718C>G	13.37:g.96513064G>C	ENSP00000365938:p.His1240Asp	Somatic	0	300	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	455	12.31	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.H1240D	ENST00000376747.3	37	c.3718	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114157	0.77210	.	.	ENSG00000102595	ENST00000376747	T	0.19394	2.15	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.59998	0.2235	H	0.94925	3.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.72697	-0.4215	10	0.87932	D	0	-14.9908	17.9944	0.89178	0.0:0.0:1.0:0.0	.	1240	Q9NYU1	UGGG2_HUMAN	D	1240	ENSP00000365938:H1240D	ENSP00000365938:H1240D	H	-	1	0	UGGT2	95311065	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	8.699000	0.91316	2.548000	0.85928	0.655000	0.94253	CAT	-	NULL		0.239	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	protein_coding	OTTHUMT00000045507.1	G	NM_020121	-		96513064	-1	no_errors	ENST00000376747	ensembl	human	known	74_37	missense	SNP	1.000	C
ADAMTS9	56999	genome.wustl.edu	37	3	64502706	64502707	+	3'UTR	DEL	AC	AC	-	rs372944190		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr3:64502706_64502707delAC	ENST00000498707.1	-	0	6246_6247				ADAMTS9_ENST00000467257.1_5'UTR|ADAMTS9_ENST00000295903.4_3'UTR	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9						glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		tcacacacaaacacacacacac	0.347																																																	0								ENSG00000163638																																			ADAMTS9	SO:0001624	3_prime_UTR_variant	0				HGNC	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.*97GT>-	3.37:g.64502716_64502717delAC		Somatic	0	36	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000498707.1	37	NULL	CCDS2903.1	3																																																																																			-	-		0.347	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	protein_coding	OTTHUMT00000351891.1	AC				64502707	-1	no_errors	ENST00000467257	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
OR6C3	254786	genome.wustl.edu	37	12	55725940	55725940	+	Silent	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr12:55725940C>A	ENST00000379667.1	+	1	456	c.456C>A	c.(454-456)acC>acA	p.T152T		NM_054104.1	NP_473445.1	Q9NZP0	OR6C3_HUMAN	olfactory receptor, family 6, subfamily C, member 3	152					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(2)	11						GGTTTCTGACCATTTTCCCAC	0.463																																																	0								ENSG00000205329						251.0	206.0	221.0					12																	55725940		2203	4300	6503	OR6C3	SO:0001819	synonymous_variant	0			-	HGNC	AF179770	CCDS31819.1	12q13.2	2013-09-23			ENSG00000205329	ENSG00000205329		"""GPCR / Class A : Olfactory receptors"""	15437	protein-coding gene	gene with protein product							Standard	NM_054104		Approved	OST709	uc010spj.2	Q9NZP0	OTTHUMG00000169861	ENST00000379667.1:c.456C>A	12.37:g.55725940C>A		Somatic	0	53	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	53	13.11		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T152	ENST00000379667.1	37	c.456	CCDS31819.1	12																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.463	OR6C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C3	protein_coding	OTTHUMT00000406309.1	C		-		55725940	+1	no_errors	ENST00000379667	ensembl	human	known	74_37	silent	SNP	0.000	A
FHOD1	29109	genome.wustl.edu	37	16	67267601	67267601	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr16:67267601G>T	ENST00000258201.4	-	13	2252	c.2005C>A	c.(2005-2007)Cac>Aac	p.H669N		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	669	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.|Interaction with ROCK1.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		TCAAAGAGGTGTTCCAGTCGG	0.607																																																	0								ENSG00000135723						31.0	30.0	31.0					16																	67267601		2198	4300	6498	FHOD1	SO:0001583	missense	0			-	HGNC	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2005C>A	16.37:g.67267601G>T	ENSP00000258201:p.His669Asn	Somatic	0	50	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,superfamily_ARM-type_fold,smart_FH2_Formin	p.H669N	ENST00000258201.4	37	c.2005	CCDS10834.1	16	.	.	.	.	.	.	.	.	.	.	G	12.75	2.031997	0.35893	.	.	ENSG00000135723	ENST00000258201	T	0.16457	2.34	5.17	5.17	0.71159	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.046760	0.85682	D	0.000000	T	0.33030	0.0849	L	0.61387	1.9	0.80722	D	1	P;B	0.47034	0.889;0.236	P;B	0.53861	0.736;0.345	T	0.01294	-1.1393	10	0.30854	T	0.27	.	17.663	0.88197	0.0:0.0:1.0:0.0	.	248;669	B4DVN5;Q9Y613	.;FHOD1_HUMAN	N	669	ENSP00000258201:H669N	ENSP00000258201:H669N	H	-	1	0	FHOD1	65825102	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.350000	0.73017	2.415000	0.81967	0.561000	0.74099	CAC	-	pfam_FH2_Formin,smart_FH2_Formin		0.607	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHOD1	protein_coding	OTTHUMT00000268844.2	G		-		67267601	-1	no_errors	ENST00000258201	ensembl	human	known	74_37	missense	SNP	1.000	T
CTBS	1486	genome.wustl.edu	37	1	85039999	85040007	+	In_Frame_Del	DEL	GCAGCGCCA	GCAGCGCCA	-	rs142534762|rs3217269|rs199701060|rs201060055	byFrequency	TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	GCAGCGCCA	GCAGCGCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:85039999_85040007delGCAGCGCCA	ENST00000370630.5	-	1	140_148	c.92_100delTGGCGCTGC	c.(91-102)ctggcgctgcgg>cgg	p.LAL31del	CTBS_ENST00000477677.1_5'UTR	NM_004388.2	NP_004379.1	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl-	31					chitin catabolic process (GO:0006032)|oligosaccharide catabolic process (GO:0009313)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	chitinase activity (GO:0004568)			breast(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)	9				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		GCCGCGAGCCgcagcgccagcagcgccag	0.718														1537	0.306909	0.5038	0.2954	5008	,	,		11352	0.0556		0.2624	False		,,,				2504	0.3538																0								ENSG00000117151			865,21,1798		349,2,165,3,13,810						-3.6	0.0		dbSNP_134	4	1279,4,4361		415,1,448,1,1,1956	no	codingComplex	CTBS	NM_004388.2		764,3,613,4,14,2766	A1A1,A1A2,A1R,A2A2,A2R,RR		22.7321,33.0104,26.0447				2144,25,6159				CTBS	SO:0001651	inframe_deletion	0				HGNC	M95767	CCDS698.1	1p22	2010-05-04			ENSG00000117151	ENSG00000117151	3.2.1.-		2496	protein-coding gene	gene with protein product		600873		CTB		1549114, 7606925	Standard	NM_004388		Approved		uc001dka.2	Q01459	OTTHUMG00000009922	ENST00000370630.5:c.92_100delTGGCGCTGC	1.37:g.85040008_85040016delGCAGCGCCA	ENSP00000359664:p.Leu31_Leu33del	Somatic	NA	NA	NA		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5VX50	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.LAL31in_frame_del	ENST00000370630.5	37	c.100_92	CCDS698.1	1																																																																																			-	NULL		0.718	CTBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBS	protein_coding	OTTHUMT00000027457.2	GCAGCGCCA	NM_004388			85040007	-1	no_errors	ENST00000370630	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.011:0.000:0.000:0.002:0.000:0.000:0.649:0.644	-
DNAH11	8701	genome.wustl.edu	37	7	21698459	21698459	+	Missense_Mutation	SNP	C	C	T	rs202034810		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr7:21698459C>T	ENST00000409508.3	+	30	5169	c.5138C>T	c.(5137-5139)aCg>aTg	p.T1713M	DNAH11_ENST00000328843.6_Missense_Mutation_p.T1718M	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1718	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ATGCAAGAAACGGTGCGTCAT	0.423									Kartagener syndrome				C|||	1	0.000199681	0.0008	0.0	5008	,	,		18250	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000105877	C	MET/THR	3,3769		0,3,1883	48.0	45.0	46.0		5153	5.9	0.2	7		46	0,8204		0,0,4102	yes	missense	DNAH11	NM_003777.3	81	0,3,5985	TT,TC,CC		0.0,0.0795,0.0251	probably-damaging	1718/4524	21698459	3,11973	1886	4102	5988	DNAH11	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.5138C>T	7.37:g.21698459C>T	ENSP00000475939:p.Thr1713Met	Somatic	0	70	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	20	66.10	Q9UJ82	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T1718M	ENST00000409508.3	37	c.5153		7	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474402	0.43942	7.95E-4	0.0	ENSG00000105877	ENST00000328843	T	0.57752	0.38	5.92	5.92	0.95590	Dynein heavy chain, domain-2 (1);	0.161766	0.52532	D	0.000068	T	0.71091	0.3299	.	.	.	0.34212	D	0.67438	D	0.64830	0.994	P	0.58331	0.837	T	0.78797	-0.2063	9	0.87932	D	0	.	19.983	0.97336	0.0:1.0:0.0:0.0	.	1718	Q96DT5	DYH11_HUMAN	M	1718	ENSP00000330671:T1718M	ENSP00000330671:T1718M	T	+	2	0	DNAH11	21664984	0.766000	0.28496	0.214000	0.23707	0.237000	0.25408	3.556000	0.53734	2.826000	0.97356	0.603000	0.83216	ACG	-	pfam_Dynein_heavy_dom-2		0.423	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	protein_coding	OTTHUMT00000326582.6	C	NM_003777	rs202034810		21698459	+1	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	SNP	0.655	T
NPTX2	4885	genome.wustl.edu	37	7	98256582	98256582	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr7:98256582C>A	ENST00000265634.3	+	4	1159	c.994C>A	c.(994-996)Ctg>Atg	p.L332M		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	332	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			CGGAGAGAAGCTGGGCACTGG	0.647																																																	0								ENSG00000106236						96.0	78.0	84.0					7																	98256582		2203	4300	6503	NPTX2	SO:0001583	missense	0			-	HGNC		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.994C>A	7.37:g.98256582C>A	ENSP00000265634:p.Leu332Met	Somatic	0	43	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	29	42.00	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.L332M	ENST00000265634.3	37	c.994	CCDS5657.1	7	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690980	0.88735	.	.	ENSG00000106236	ENST00000265634	T	0.59772	0.24	5.39	5.39	0.77823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.060211	0.64402	D	0.000001	T	0.67088	0.2856	L	0.37507	1.11	0.80722	D	1	D	0.71674	0.998	D	0.66979	0.948	T	0.63278	-0.6673	10	0.33940	T	0.23	-15.4276	18.4968	0.90867	0.0:1.0:0.0:0.0	.	332	P47972	NPTX2_HUMAN	M	332	ENSP00000265634:L332M	ENSP00000265634:L332M	L	+	1	2	NPTX2	98094518	1.000000	0.71417	0.995000	0.50966	0.828000	0.46876	4.874000	0.63064	2.682000	0.91365	0.655000	0.94253	CTG	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.647	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX2	protein_coding	OTTHUMT00000334982.1	C	NM_002523	-		98256582	+1	no_errors	ENST00000265634	ensembl	human	known	74_37	missense	SNP	1.000	A
PSIP1	11168	genome.wustl.edu	37	9	15472612	15472612	+	Intron	DEL	A	A	-	rs201263257		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr9:15472612delA	ENST00000380733.4	-	10	1321				PSIP1_ENST00000380716.4_Intron|PSIP1_ENST00000397519.2_Intron|PSIP1_ENST00000380715.1_Intron|PSIP1_ENST00000380738.4_Intron			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1						establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		CAAAATTTAGAAAAAAAAAAA	0.343																																																	0								ENSG00000164985						81.0	78.0	79.0					9																	15472612		2202	4297	6499	PSIP1	SO:0001627	intron_variant	0				HGNC	AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.977+17T>-	9.37:g.15472612delA		Somatic	0	50	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380733.4	37	NULL	CCDS6479.1	9																																																																																			-	-		0.343	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PSIP1	protein_coding	OTTHUMT00000055445.1	A	NM_033222			15472612	-1	no_errors	ENST00000495873	ensembl	human	known	74_37	rna	DEL	0.001	-
TCERG1	10915	genome.wustl.edu	37	5	145890060	145890060	+	Nonsense_Mutation	SNP	T	T	G			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr5:145890060T>G	ENST00000296702.5	+	22	3190	c.3152T>G	c.(3151-3153)tTa>tGa	p.L1051*	TCERG1_ENST00000394421.2_Nonsense_Mutation_p.L1030*	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	1051	FF 6.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAAAAAATTTTACAGAATGAC	0.413																																																	0								ENSG00000113649						89.0	88.0	89.0					5																	145890060		2203	4300	6503	TCERG1	SO:0001587	stop_gained	0			-	HGNC	AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.3152T>G	5.37:g.145890060T>G	ENSP00000296702:p.Leu1051*	Somatic	0	39	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	71	10.13	Q2NKN2|Q59EA1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.L1051*	ENST00000296702.5	37	c.3152	CCDS4282.1	5	.	.	.	.	.	.	.	.	.	.	T	38	7.273512	0.98179	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	.	.	.	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7956	16.8061	0.85666	0.0:0.0:0.0:1.0	.	.	.	.	X	1051;1030	.	ENSP00000296702:L1051X	L	+	2	0	TCERG1	145870253	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.990000	0.88215	2.367000	0.80283	0.528000	0.53228	TTA	-	pfam_FF_domain,smart_FF_domain		0.413	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	protein_coding	OTTHUMT00000251886.1	T	NM_001040006	-		145890060	+1	no_errors	ENST00000296702	ensembl	human	known	74_37	nonsense	SNP	1.000	G
MAG	4099	genome.wustl.edu	37	19	35786326	35786326	+	Silent	SNP	G	G	T	rs201625172		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr19:35786326G>T	ENST00000392213.3	+	3	174	c.15G>T	c.(13-15)acG>acT	p.T5T	MAG_ENST00000597035.1_Silent_p.T5T|MAG_ENST00000361922.4_Silent_p.T5T|MAG_ENST00000537831.2_Intron	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	5					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			TATTCCTCACGGCACTGCCTC	0.557																																																	0								ENSG00000105695						247.0	243.0	245.0					19																	35786326		2203	4300	6503	MAG	SO:0001819	synonymous_variant	0			-	HGNC	M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.15G>T	19.37:g.35786326G>T		Somatic	0	42	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	B7Z2E5|F5GYC0|Q567S4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T5	ENST00000392213.3	37	c.15	CCDS12455.1	19																																																																																			-	NULL		0.557	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	protein_coding	OTTHUMT00000466071.1	G	NM_080600	-		35786326	+1	no_errors	ENST00000392213	ensembl	human	known	74_37	silent	SNP	0.353	T
RUSC1	23623	genome.wustl.edu	37	1	155290825	155290825	+	Intron	SNP	G	G	C			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr1:155290825G>C	ENST00000368352.5	+	1	65				RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368347.4_5'Flank|RUSC1_ENST00000368354.3_Intron	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1						positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			ATGGACCTGGGCACGAGGGGC	0.642																																																	0								ENSG00000225855						51.0	61.0	57.0					1																	155290825		2021	4156	6177	RUSC1-AS1	SO:0001627	intron_variant	0			-	HGNC	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.-87+43G>C	1.37:g.155290825G>C		Somatic	0	23	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	14	57.58	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368352.5	37	NULL	CCDS41410.1	1																																																																																			-	-		0.642	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1-AS1	protein_coding	OTTHUMT00000039071.1	G		-		155290825	-1	no_errors	ENST00000450199	ensembl	human	known	74_37	rna	SNP	0.007	C
FAM109A	144717	genome.wustl.edu	37	12	111800949	111800949	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr12:111800949C>T	ENST00000547838.2	-	2	380	c.283G>A	c.(283-285)Gct>Act	p.A95T	FAM109A_ENST00000361483.3_Missense_Mutation_p.A108T|FAM109A_ENST00000450786.2_Silent_p.P75P|FAM109A_ENST00000392658.5_Missense_Mutation_p.A95T|FAM109A_ENST00000548163.1_Missense_Mutation_p.A95T			Q8N4B1	SESQ1_HUMAN	family with sequence similarity 109, member A	95	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				endosome organization (GO:0007032)|receptor recycling (GO:0001881)|retrograde transport, endosome to Golgi (GO:0042147)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	protein homodimerization activity (GO:0042803)	p.A108T(1)|p.A95T(1)		breast(1)|endometrium(1)|lung(1)|ovary(1)	4						TGACTCTCAGCGGCCAGCACG	0.692																																																	2	Substitution - Missense(2)	endometrium(2)						ENSG00000198324						17.0	19.0	18.0					12																	111800949		2199	4292	6491	FAM109A	SO:0001583	missense	0			-	HGNC	BC034809	CCDS9152.1, CCDS53833.1	12q24.12	2013-01-10			ENSG00000198324	ENSG00000198324		"""Pleckstrin homology (PH) domain containing"""	26509	protein-coding gene	gene with protein product		614239				12477932	Standard	NM_144671		Approved	FLJ32356	uc009zvu.3	Q8N4B1	OTTHUMG00000169547	ENST00000547838.2:c.283G>A	12.37:g.111800949C>T	ENSP00000447353:p.Ala95Thr	Somatic	0	27	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	J3KP50|Q6PJL9|Q96MH8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.A108T	ENST00000547838.2	37	c.322	CCDS9152.1	12	.	.	.	.	.	.	.	.	.	.	C	25.9	4.680211	0.88542	.	.	ENSG00000198324	ENST00000547838;ENST00000361483;ENST00000392658;ENST00000548163;ENST00000547710	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	4.38	4.38	0.52667	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	.	.	.	.	T	0.73385	0.3580	M	0.89214	3.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.78886	-0.2027	9	0.48119	T	0.1	.	16.949	0.86239	0.0:1.0:0.0:0.0	.	95;95	Q8N4B1;B4DRN3	SESQ1_HUMAN;.	T	95;108;95;95;95	ENSP00000447353:A95T;ENSP00000354461:A108T;ENSP00000376426:A95T;ENSP00000449994:A95T;ENSP00000447349:A95T	ENSP00000354461:A108T	A	-	1	0	FAM109A	110285332	1.000000	0.71417	0.194000	0.23346	0.761000	0.43186	7.639000	0.83342	1.982000	0.57802	0.561000	0.74099	GCT	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.692	FAM109A-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM109A	protein_coding	OTTHUMT00000404768.2	C	NM_144671	-		111800949	-1	no_errors	ENST00000361483	ensembl	human	known	74_37	missense	SNP	0.999	T
FRA10AC1	118924	genome.wustl.edu	37	10	95443848	95443848	+	Silent	SNP	G	G	A			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr10:95443848G>A	ENST00000359204.4	-	10	830	c.633C>T	c.(631-633)tgC>tgT	p.C211C	FRA10AC1_ENST00000536233.1_Silent_p.C211C|FRA10AC1_ENST00000394100.2_Silent_p.C211C|FRA10AC1_ENST00000371430.2_Silent_p.C211C	NM_145246.4	NP_660289.2	Q70Z53	F10C1_HUMAN	fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1	211	Lys-rich.					nucleus (GO:0005634)				NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(1)	14						AACATTCTTGGCATAACCCTA	0.308																																																	0								ENSG00000148690						132.0	150.0	144.0					10																	95443848		2203	4300	6503	FRA10AC1	SO:0001819	synonymous_variant	0			-	HGNC	AK090955	CCDS7430.1	10q23.33	2014-01-28	2010-05-25	2010-05-25	ENSG00000148690	ENSG00000148690			1162	protein-coding gene	gene with protein product		608866	"""chromosome 10 open reading frame 4"""	C10orf4		15203205	Standard	NM_145246		Approved		uc001kiz.2	Q70Z53	OTTHUMG00000018776	ENST00000359204.4:c.633C>T	10.37:g.95443848G>A		Somatic	0	48	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	C9JCR4|C9JCR5|C9JMY4|Q70Z49|Q70Z50|Q70Z51|Q70Z52|Q8N293|Q8WVH5|Q96JQ8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Folate-sensitive_fs_Fra10Ac1	p.C211	ENST00000359204.4	37	c.633	CCDS7430.1	10																																																																																			-	pfam_Folate-sensitive_fs_Fra10Ac1		0.308	FRA10AC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRA10AC1	protein_coding	OTTHUMT00000049439.1	G	NM_145246	-		95443848	-1	no_errors	ENST00000359204	ensembl	human	known	74_37	silent	SNP	1.000	A
DNAH6	1768	genome.wustl.edu	37	2	84885458	84885458	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr2:84885458C>T	ENST00000237449.6	+	35	5808	c.5800C>T	c.(5800-5802)Cgt>Tgt	p.R1934C	DNAH6_ENST00000602588.1_5'UTR|DNAH6_ENST00000389394.3_Missense_Mutation_p.R1934C|DNAH6_ENST00000398278.2_Missense_Mutation_p.R1934C			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1934	AAA 2. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TCTTTTCCAACGTTATGTTGA	0.323																																																	0								ENSG00000115423						104.0	89.0	94.0					2																	84885458		692	1590	2282	DNAH6	SO:0001583	missense	0			-	HGNC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.5800C>T	2.37:g.84885458C>T	ENSP00000237449:p.Arg1934Cys	Somatic	0	94	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	95	33.10	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1934C	ENST00000237449.6	37	c.5800	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	C	18.49	3.636419	0.67130	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	D;D;D	0.87491	-2.26;-2.26;-2.26	4.92	3.97	0.46021	.	.	.	.	.	D	0.88142	0.6357	L	0.56769	1.78	0.45439	D	0.998415	D	0.61697	0.99	P	0.51657	0.676	D	0.88346	0.2978	9	0.51188	T	0.08	.	13.2167	0.59865	0.16:0.84:0.0:0.0	.	1934	Q9C0G6	DYH6_HUMAN	C	1934	ENSP00000374045:R1934C;ENSP00000381326:R1934C;ENSP00000237449:R1934C	ENSP00000237449:R1934C	R	+	1	0	DNAH6	84738969	0.988000	0.35896	1.000000	0.80357	0.996000	0.88848	2.581000	0.46077	2.415000	0.81967	0.544000	0.68410	CGT	-	NULL		0.323	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	protein_coding	OTTHUMT00000328537.2	C	NM_001370	-		84885458	+1	no_errors	ENST00000237449	ensembl	human	known	74_37	missense	SNP	0.996	T
RP11-359E19.1	0	genome.wustl.edu	37	8	39961703	39961703	+	lincRNA	SNP	A	A	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr8:39961703A>T	ENST00000524098.1	+	0	16																											caacacaaaaaaaatgtggct	0.408																																																	0								ENSG00000253381						148.0	117.0	126.0					8																	39961703		692	1591	2283	RP11-359E19.1			0			-	Clone_based_vega_gene																													8.37:g.39961703A>T		Somatic	0	74	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	56	39.78		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000524098.1	37	NULL		8																																																																																			-	-		0.408	RP11-359E19.1-001	KNOWN	basic	lincRNA	ENSG00000253381	lincRNA	OTTHUMT00000376941.1	A		-		39961703	+1	no_errors	ENST00000524098	ensembl	human	known	74_37	rna	SNP	0.004	T
SLC26A4	5172	genome.wustl.edu	37	7	107315522	107315522	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr7:107315522delA	ENST00000265715.3	+	6	957	c.733delA	c.(733-735)aaafs	p.K245fs		NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	245					chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TGTTTCAACCAAAAACTACAA	0.433									Pendred syndrome																																								0								ENSG00000091137						185.0	180.0	182.0					7																	107315522		2203	4300	6503	SLC26A4	SO:0001589	frameshift_variant	0	Familial Cancer Database	Goiter-Deafness syndrome		HGNC	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.733delA	7.37:g.107315522delA	ENSP00000265715:p.Lys245fs	Somatic	0	29	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	B7Z266|O43170	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.N246fs	ENST00000265715.3	37	c.733	CCDS5746.1	7																																																																																			-	pfam_Sulph_transpt,tigrfam_SulP_transpt		0.433	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A4	protein_coding	OTTHUMT00000337148.1	A	NM_000441			107315522	+1	no_errors	ENST00000265715	ensembl	human	known	74_37	frame_shift_del	DEL	0.998	-
IL16	3603	genome.wustl.edu	37	15	81592162	81592164	+	In_Frame_Del	DEL	CCT	CCT	-	rs562825970		TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr15:81592162_81592164delCCT	ENST00000302987.4	+	13	2495_2497	c.2495_2497delCCT	c.(2494-2499)gcctcc>gcc	p.S838del	IL16_ENST00000394660.2_In_Frame_Del_p.S838del|IL16_ENST00000560230.1_3'UTR|IL16_ENST00000394652.2_In_Frame_Del_p.S137del			Q14005	IL16_HUMAN	interleukin 16	838					immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.S792delS(1)|p.S838delS(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CACATCCGGGcctcctcctcctc	0.586																																																	2	Deletion - In frame(2)	large_intestine(2)						ENSG00000172349		,,	50,2,4208		3,0,44,0,2,2081					,,	3.2	0.1			40	99,6,8147		7,0,85,0,6,4028	no	codingComplex,codingComplex,codingComplex	IL16	NM_172217.3,NM_004513.5,NM_001172128.1	,,	10,0,129,0,8,6109	A1A1,A1A2,A1R,A2A2,A2R,RR		1.2724,1.2207,1.2548	,,	,,		149,8,12355				IL16	SO:0001651	inframe_deletion	0				HGNC	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.2495_2497delCCT	15.37:g.81592171_81592173delCCT	ENSP00000302935:p.Ser838del	Somatic	0	36	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	41	12.77	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,prints_IL-16	p.S836in_frame_del	ENST00000302987.4	37	c.2495_2497	CCDS42069.1	15																																																																																			-	NULL		0.586	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL16	protein_coding	OTTHUMT00000303952.1	CCT	NM_172217			81592164	+1	no_errors	ENST00000302987	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.004:0.009	-
PRIMA1	145270	genome.wustl.edu	37	14	94203701	94203701	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr14:94203701G>T	ENST00000393140.1	-	4	347	c.245C>A	c.(244-246)tCt>tAt	p.S82Y	PRIMA1_ENST00000393143.1_Missense_Mutation_p.S82Y|PRIMA1_ENST00000316227.3_Missense_Mutation_p.S82Y	NM_178013.3	NP_821092.1	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1	82					establishment of localization in cell (GO:0051649)|neurotransmitter catabolic process (GO:0042135)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|synapse (GO:0045202)				endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		AGTGGGGCAAGAGGTAGAGTT	0.552																																																	0								ENSG00000175785						90.0	82.0	85.0					14																	94203701		2203	4300	6503	PRIMA1	SO:0001583	missense	0			-	HGNC		CCDS9912.1	14q32.13	2008-08-29			ENSG00000175785	ENSG00000175785			18319	protein-coding gene	gene with protein product	"""membrane anchor of acetylcholinesterase"""	613851				11804574	Standard	NM_178013		Approved	PRIMA	uc001ybw.1	Q86XR5	OTTHUMG00000141313	ENST00000393140.1:c.245C>A	14.37:g.94203701G>T	ENSP00000376848:p.Ser82Tyr	Somatic	0	54	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	Q86XR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S82Y	ENST00000393140.1	37	c.245	CCDS9912.1	14	.	.	.	.	.	.	.	.	.	.	G	15.54	2.865131	0.51482	.	.	ENSG00000175785	ENST00000393140;ENST00000393143;ENST00000316227	.	.	.	4.95	4.04	0.47022	.	0.463730	0.18456	N	0.140677	T	0.32285	0.0824	L	0.29908	0.895	0.35656	D	0.812141	B	0.34241	0.444	B	0.34652	0.187	T	0.39522	-0.9610	9	0.41790	T	0.15	-14.2544	5.7405	0.18092	0.2187:0.0:0.7813:0.0	.	82	Q86XR5	PRIMA_HUMAN	Y	82	.	ENSP00000320948:S82Y	S	-	2	0	PRIMA1	93273454	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.739000	0.47409	2.457000	0.83068	0.555000	0.69702	TCT	-	NULL		0.552	PRIMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRIMA1	protein_coding	OTTHUMT00000280658.1	G	NM_178013	-		94203701	-1	no_errors	ENST00000393140	ensembl	human	known	74_37	missense	SNP	1.000	T
KALRN	8997	genome.wustl.edu	37	3	124160810	124160810	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr3:124160810C>T	ENST00000240874.3	+	19	3368	c.3211C>T	c.(3211-3213)Cgg>Tgg	p.R1071W	KALRN_ENST00000360013.3_Missense_Mutation_p.R1071W|KALRN_ENST00000460856.1_Missense_Mutation_p.R1062W	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1071					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CCTGGCTCGGCGGAATGCTGA	0.567																																																	0								ENSG00000160145						57.0	53.0	54.0					3																	124160810		2203	4300	6503	KALRN	SO:0001583	missense	0			-	HGNC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.3211C>T	3.37:g.124160810C>T	ENSP00000240874:p.Arg1071Trp	Somatic	0	71	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	52	18.75	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.R1071W	ENST00000240874.3	37	c.3211	CCDS3027.1	3	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174674	0.78452	.	.	ENSG00000160145	ENST00000460856;ENST00000240874;ENST00000360013	T;T;T	0.44482	0.92;0.92;0.92	5.22	4.28	0.50868	.	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.997;0.99;1.0	T	0.66681	-0.5862	10	0.87932	D	0	.	11.4421	0.50102	0.3348:0.6652:0.0:0.0	.	1062;417;1071;1071	C9IZQ6;F2Z3Q6;O60229;O60229-2	.;.;KALRN_HUMAN;.	W	1062;1071;1071	ENSP00000418611:R1062W;ENSP00000240874:R1071W;ENSP00000353109:R1071W	ENSP00000240874:R1071W	R	+	1	2	KALRN	125643500	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	4.055000	0.57441	2.872000	0.98467	0.650000	0.86243	CGG	-	NULL		0.567	KALRN-005	KNOWN	basic|CCDS	protein_coding	KALRN	protein_coding	OTTHUMT00000258843.4	C	NM_003947	-		124160810	+1	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	SNP	1.000	T
ELSPBP1	64100	genome.wustl.edu	37	19	48517529	48517529	+	Missense_Mutation	SNP	G	G	A	rs145096514	byFrequency	TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr19:48517529G>A	ENST00000339841.2	+	3	350	c.172G>A	c.(172-174)Gtg>Atg	p.V58M	ELSPBP1_ENST00000597519.1_Intron	NM_022142.4	NP_071425.3	Q96BH3	ESPB1_HUMAN	epididymal sperm binding protein 1	58	Fibronectin type-II 1. {ECO:0000255|PROSITE-ProRule:PRU00479}.				single fertilization (GO:0007338)	extracellular region (GO:0005576)				NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(6)	10		all_cancers(25;8.7e-09)|all_lung(116;1.15e-06)|all_epithelial(76;1.17e-06)|Lung NSC(112;2.56e-06)|all_neural(266;0.0138)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000253)|all cancers(93;0.00129)|Epithelial(262;0.0314)|GBM - Glioblastoma multiforme(486;0.0606)		CACCAGAGCCGTGTACAACGG	0.483													g|||	3	0.000599042	0.0008	0.0	5008	,	,		16494	0.002		0.0	False		,,,				2504	0.0																0								ENSG00000169393						162.0	140.0	148.0					19																	48517529		2203	4300	6503	ELSPBP1	SO:0001583	missense	0			GMAF=0.0005	HGNC	AJ278478	CCDS12708.1	19q13.33	2009-09-17							14417	protein-coding gene	gene with protein product	"""epididymal protein 12"""	607443					Standard	NM_022142		Approved	HE12, E12, EDDM12	uc002pht.3	Q96BH3		ENST00000339841.2:c.172G>A	19.37:g.48517529G>A	ENSP00000340660:p.Val58Met	Somatic	0	51	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	28	56.25	Q96RT0|Q9H4C8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.V58M	ENST00000339841.2	37	c.172	CCDS12708.1	19	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	10.17	1.276506	0.23307	.	.	ENSG00000169393	ENST00000339841	T	0.49720	0.77	3.27	-3.13	0.05266	Fibronectin, type II, collagen-binding (4);Kringle-like fold (1);	0.831139	0.09799	N	0.754340	T	0.39860	0.1094	L	0.51914	1.62	0.09310	N	1	P	0.38922	0.651	B	0.41666	0.363	T	0.36040	-0.9764	10	0.33940	T	0.23	.	7.7531	0.28909	0.6183:0.0:0.3817:0.0	.	58	Q96BH3	ESPB1_HUMAN	M	58	ENSP00000340660:V58M	ENSP00000340660:V58M	V	+	1	0	ELSPBP1	53209341	0.000000	0.05858	0.000000	0.03702	0.121000	0.20230	-0.847000	0.04331	-0.535000	0.06307	0.544000	0.68410	GTG	-	pfam_FN_type2_col-bd,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd		0.483	ELSPBP1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ELSPBP1	protein_coding	OTTHUMT00000465207.1	G		rs145096514		48517529	+1	no_errors	ENST00000339841	ensembl	human	known	74_37	missense	SNP	0.000	A
PGBD3	267004	genome.wustl.edu	37	10	50724120	50724120	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB2P-01A-11D-A387-09	TCGA-DX-AB2P-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	229d1a12-6364-4b92-8764-35b6beafc697	6fb55b48-5d07-4cfe-b318-bdb9270807e7	g.chr10:50724120G>T	ENST00000374127.3	-	2	1242	c.1041C>A	c.(1039-1041)taC>taA	p.Y347*	PGBD3_ENST00000603152.1_Nonsense_Mutation_p.Y815*|ERCC6-PGBD3_ENST00000447839.2_Nonsense_Mutation_p.Y815*|ERCC6_ENST00000355832.5_Intron|PGBD3_ENST00000508005.2_Nonsense_Mutation_p.Y347*|ERCC6-PGBD3_ENST00000515869.1_Nonsense_Mutation_p.Y815*	NM_170753.2	NP_736609.2	Q8N328	PGBD3_HUMAN	piggyBac transposable element derived 3	347										breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(16)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	33						ATACAAAATGGTATTGTCCAG	0.418																																																	0								ENSG00000243251						75.0	71.0	72.0					10																	50724120		2203	4299	6502	PGBD3	SO:0001587	stop_gained	0			-	HGNC	AK074682	CCDS7230.1	10q11	2011-03-24			ENSG00000243251	ENSG00000243251			19400	protein-coding gene	gene with protein product							Standard	NM_170753		Approved	FLJ90201		Q8N328	OTTHUMG00000018193	ENST00000374127.3:c.1041C>A	10.37:g.50724120G>T	ENSP00000363242:p.Tyr347*	Somatic	0	43	0.00		0.680786368864844	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	B3KQC4|Q5W0M0|Q6PIH0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Y815*	ENST00000374127.3	37	c.2445	CCDS7230.1	10	.	.	.	.	.	.	.	.	.	.	G	37	6.479166	0.97598	.	.	ENSG00000243251;ENSG00000243251;ENSG00000258838;ENSG00000258838	ENST00000374127;ENST00000508005;ENST00000515869;ENST00000447839	.	.	.	0.699	-0.62	0.11567	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.3241	.	.	.	.	.	.	.	X	347;347;815;815	.	ENSP00000387966:Y815X	Y	-	3	2	PGBD3;RP11-123B3.6	50394126	0.119000	0.22226	0.008000	0.14137	0.963000	0.63663	0.659000	0.24994	-0.241000	0.09681	0.491000	0.48974	TAC	-	NULL		0.418	PGBD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PGBD3	protein_coding	OTTHUMT00000047988.1	G		-		50724120	-1	no_errors	ENST00000603152	ensembl	human	known	74_37	nonsense	SNP	0.002	T
