#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PALLD	23022	genome.wustl.edu	37	4	169589400	169589400	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr4:169589400G>T	ENST00000505667.1	+	3	1141	c.968G>T	c.(967-969)gGa>gTa	p.G323V	PALLD_ENST00000261509.6_Missense_Mutation_p.G323V|PALLD_ENST00000335742.7_5'UTR|PALLD_ENST00000512127.1_5'UTR|PALLD_ENST00000333488.4_Missense_Mutation_p.G200V			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	323	Ig-like C2-type 1.				cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CACTGTGAGGGAGGGGACCTC	0.507									Pancreatic Cancer, Familial Clustering of																												Esophageal Squamous(109;1482 1532 18347 40239 51172)												0								ENSG00000129116						139.0	125.0	129.0					4																	169589400		2203	4300	6503	PALLD	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	-	HGNC	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.968G>T	4.37:g.169589400G>T	ENSP00000425556:p.Gly323Val	Somatic	0	63	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G323V	ENST00000505667.1	37	c.968	CCDS54818.1	4	.	.	.	.	.	.	.	.	.	.	G	15.70	2.911719	0.52439	.	.	ENSG00000129116	ENST00000261509;ENST00000505667;ENST00000508898;ENST00000333488	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.77	5.77	0.91146	.	0.498364	0.14859	U	0.294208	T	0.60521	0.2275	L	0.33792	1.035	0.58432	D	0.999993	D;D	0.76494	0.999;0.962	D;P	0.70935	0.971;0.805	T	0.52764	-0.8532	10	0.30078	T	0.28	.	19.9983	0.97395	0.0:0.0:1.0:0.0	.	323;323	B7ZMM5;B2RTX2	.;.	V	323;323;302;200	ENSP00000261509:G323V;ENSP00000425556:G323V;ENSP00000423063:G302V;ENSP00000328945:G200V	ENSP00000261509:G323V	G	+	2	0	PALLD	169825975	1.000000	0.71417	0.069000	0.20011	0.006000	0.05464	6.034000	0.70933	2.724000	0.93272	0.561000	0.74099	GGA	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.507	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PALLD	protein_coding	OTTHUMT00000363762.1	G	NM_016081	-		169589400	+1	no_errors	ENST00000261509	ensembl	human	known	74_37	missense	SNP	0.961	T
ZFHX4	79776	genome.wustl.edu	37	8	77767256	77767256	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr8:77767256A>G	ENST00000521891.2	+	10	8547	c.8099A>G	c.(8098-8100)aAt>aGt	p.N2700S	ZFHX4_ENST00000050961.6_Missense_Mutation_p.N2655S|ZFHX4_ENST00000518282.1_Missense_Mutation_p.N2674S|ZFHX4_ENST00000455469.2_Missense_Mutation_p.N2655S	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2655					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CGGCACTGGAATGAAGGAAAG	0.502										HNSCC(33;0.089)																																							0								ENSG00000091656						60.0	59.0	59.0					8																	77767256		1948	4145	6093	ZFHX4	SO:0001583	missense	0			-	HGNC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8099A>G	8.37:g.77767256A>G	ENSP00000430497:p.Asn2700Ser	Somatic	0	52	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	76	30.91	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.N2700S	ENST00000521891.2	37	c.8099	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	A	9.341	1.063002	0.19987	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.49720	0.77;0.82;0.79;0.78	5.18	4.04	0.47022	Zinc finger, C2H2 (1);	0.000000	0.47455	U	0.000235	T	0.46249	0.1383	L	0.40543	1.245	0.41414	D	0.987758	B;B;P	0.50528	0.124;0.196;0.936	B;B;P	0.50896	0.127;0.25;0.653	T	0.32455	-0.9906	10	0.33141	T	0.24	.	10.7116	0.45986	0.9256:0.0:0.0744:0.0	.	2655;2655;2700	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	S	2700;2684;2655;2655;2674	ENSP00000430497:N2700S;ENSP00000399605:N2655S;ENSP00000050961:N2655S;ENSP00000430848:N2674S	ENSP00000050961:N2655S	N	+	2	0	ZFHX4	77929811	1.000000	0.71417	0.986000	0.45419	0.084000	0.17831	6.144000	0.71762	1.004000	0.39156	0.454000	0.30748	AAT	-	pfscan_Znf_C2H2		0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	protein_coding	OTTHUMT00000379197.2	A	NM_024721	-		77767256	+1	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	SNP	1.000	G
CPAMD8	27151	genome.wustl.edu	37	19	17036138	17036138	+	Missense_Mutation	SNP	G	G	A	rs370777148		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr19:17036138G>A	ENST00000443236.1	-	26	3587	c.3556C>T	c.(3556-3558)Cgg>Tgg	p.R1186W		NM_015692.2	NP_056507.2	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain containing 8	1139						extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(11)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(14)|ovary(7)|pancreas(2)|prostate(4)|skin(5)	82						AACGGCAGCCGCAGGAGGTTG	0.547													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22264	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000160111						79.0	84.0	83.0					19																	17036138		1974	4150	6124	CPAMD8	SO:0001583	missense	0			-	HGNC	AY101765	CCDS42519.1	19p13.12	2008-02-05			ENSG00000160111	ENSG00000160111			23228	protein-coding gene	gene with protein product		608841				10574462	Standard	NM_015692		Approved	KIAA1283, VIP, K-CAP	uc002nfb.3	Q8IZJ3	OTTHUMG00000133549	ENST00000443236.1:c.3556C>T	19.37:g.17036138G>A	ENSP00000402505:p.Arg1186Trp	Somatic	0	78	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	17	59.52	Q8NC09|Q9ULD7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A2M_comp,pfam_A2M_N_2,pfam_Methyltransf_FA,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Kazal_dom,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,smart_Kazal_dom	p.R1186W	ENST00000443236.1	37	c.3556	CCDS42519.1	19	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700522	0.48307	.	.	ENSG00000160111	ENST00000291440	.	.	.	2.84	2.84	0.33178	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);Alpha-2-macroglobulin, thiol-ester bond-forming (1);	0.085770	0.46758	U	0.000278	T	0.78572	0.4304	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80966	-0.1146	9	0.87932	D	0	.	10.6397	0.45586	0.0:0.0:0.8079:0.192	.	1139	Q8IZJ3	CPMD8_HUMAN	W	1186	.	ENSP00000291440:R1186W	R	-	1	2	CPAMD8	16897138	0.998000	0.40836	0.989000	0.46669	0.814000	0.46013	0.713000	0.25794	1.121000	0.41925	0.561000	0.74099	CGG	-	pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase		0.547	CPAMD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPAMD8	protein_coding	OTTHUMT00000257531.2	G	NM_015692	-		17036138	-1	no_errors	ENST00000443236	ensembl	human	known	74_37	missense	SNP	0.983	A
TTF1	7270	genome.wustl.edu	37	9	135267466	135267466	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr9:135267466T>G	ENST00000334270.2	-	6	2023	c.1984A>C	c.(1984-1986)Agt>Cgt	p.S662R		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	662	Myb-like 2. {ECO:0000255|PROSITE- ProRule:PRU00133}.				chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		CACTTACGACTGCTGATCTGT	0.542																																																	0								ENSG00000125482						71.0	65.0	67.0					9																	135267466		2203	4300	6503	TTF1	SO:0001583	missense	0			-	HGNC	BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1984A>C	9.37:g.135267466T>G	ENSP00000333920:p.Ser662Arg	Somatic	0	52	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	30	34.78	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S662R	ENST00000334270.2	37	c.1984	CCDS6948.1	9	.	.	.	.	.	.	.	.	.	.	T	11.25	1.583621	0.28268	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.41065	1.01	5.77	-0.952	0.10366	SANT domain, DNA binding (1);Homeodomain-like (1);MYB-like (1);	0.880477	0.09861	N	0.746193	T	0.42585	0.1209	L	0.43152	1.355	0.09310	N	1	D	0.64830	0.994	P	0.60789	0.879	T	0.31779	-0.9931	10	0.19590	T	0.45	.	3.0135	0.06052	0.2902:0.2517:0.0:0.458	.	662	Q15361	TTF1_HUMAN	R	662	ENSP00000333920:S662R	ENSP00000245588:S662R	S	-	1	0	TTF1	134257287	0.045000	0.20229	0.000000	0.03702	0.143000	0.21401	0.589000	0.23939	-0.419000	0.07439	-0.290000	0.09829	AGT	-	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom		0.542	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	protein_coding	OTTHUMT00000054784.2	T	NM_007344	-		135267466	-1	no_errors	ENST00000334270	ensembl	human	known	74_37	missense	SNP	0.000	G
PTPRT	11122	genome.wustl.edu	37	20	41420099	41420099	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr20:41420099G>T	ENST00000373187.1	-	3	221	c.222C>A	c.(220-222)ttC>ttA	p.F74L	PTPRT_ENST00000373184.1_Missense_Mutation_p.F74L|PTPRT_ENST00000373193.3_Missense_Mutation_p.F74L|PTPRT_ENST00000373198.4_Missense_Mutation_p.F74L|PTPRT_ENST00000373190.1_Missense_Mutation_p.F74L|PTPRT_ENST00000356100.2_Missense_Mutation_p.F74L|PTPRT_ENST00000373201.1_Missense_Mutation_p.F74L			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	74	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.		F -> S (in a colorectal cancer). {ECO:0000269|PubMed:15155950}.		cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCACCATCATGAAAGATCCTG	0.498																																																	0								ENSG00000196090						23.0	26.0	25.0					20																	41420099		1885	4120	6005	PTPRT	SO:0001583	missense	0			-	HGNC	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.222C>A	20.37:g.41420099G>T	ENSP00000362283:p.Phe74Leu	Somatic	0	40	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.F74L	ENST00000373187.1	37	c.222	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	G	22.1	4.237559	0.79800	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.02944	4.1;4.1;4.1;4.1;4.1;4.1;4.1	5.54	4.6	0.57074	Concanavalin A-like lectin/glucanase (1);MAM domain (5);	0.053348	0.85682	D	0.000000	T	0.14485	0.0350	M	0.75777	2.31	0.58432	D	0.999997	D;D	0.71674	0.997;0.998	D;D	0.83275	0.996;0.995	T	0.00353	-1.1795	10	0.66056	D	0.02	.	14.2225	0.65836	0.0718:0.0:0.9282:0.0	.	74;74	O14522-1;O14522	.;PTPRT_HUMAN	L	74	ENSP00000362286:F74L;ENSP00000362283:F74L;ENSP00000362289:F74L;ENSP00000348408:F74L;ENSP00000362294:F74L;ENSP00000362280:F74L;ENSP00000362297:F74L	ENSP00000348408:F74L	F	-	3	2	PTPRT	40853513	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	3.966000	0.56795	1.347000	0.45714	0.462000	0.41574	TTC	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom,prints_MAM_dom		0.498	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	protein_coding	OTTHUMT00000080315.1	G		-		41420099	-1	no_errors	ENST00000373198	ensembl	human	known	74_37	missense	SNP	1.000	T
NACC2	138151	genome.wustl.edu	37	9	138903668	138903668	+	Silent	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr9:138903668G>A	ENST00000371753.1	-	5	1516	c.1458C>T	c.(1456-1458)gcC>gcT	p.A486A	NACC2_ENST00000277554.2_Silent_p.A486A			Q96BF6	NACC2_HUMAN	NACC family member 2, BEN and BTB (POZ) domain containing	486					cellular protein complex localization (GO:0034629)|histone deacetylation (GO:0016575)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle by negative regulation of transcription from RNA polymerase II promoter (GO:1900477)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|posttranscriptional regulation of gene expression (GO:0010608)|protein homooligomerization (GO:0051260)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(2)|kidney(1)|lung(1)|urinary_tract(1)	5						CCTGTGCCGCGGCAGGCGGGA	0.677																																																	0								ENSG00000148411						8.0	8.0	8.0					9																	138903668		2160	4188	6348	NACC2	SO:0001819	synonymous_variant	0			-	HGNC	BC015649	CCDS6993.1	9q34.3	2013-01-09	2008-10-03	2008-10-03	ENSG00000148411	ENSG00000148411		"""BEN domain containing"", ""BTB/POZ domain containing"""	23846	protein-coding gene	gene with protein product	"""BEN domain containing 9"""	615786	"""BTB (POZ) domain containing 14A"""	BTBD14A		12477932	Standard	NM_144653		Approved	MGC23427, BEND9, BTBD31	uc004cgv.4	Q96BF6	OTTHUMG00000020921	ENST00000371753.1:c.1458C>T	9.37:g.138903668G>A		Somatic	0	44	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_BEN_domain,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.A486	ENST00000371753.1	37	c.1458	CCDS6993.1	9																																																																																			-	NULL		0.677	NACC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACC2	protein_coding	OTTHUMT00000055040.1	G	NM_144653	-		138903668	-1	no_errors	ENST00000277554	ensembl	human	known	74_37	silent	SNP	0.021	A
XPC	7508	genome.wustl.edu	37	3	14199838	14199838	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr3:14199838G>T	ENST00000285021.7	-	9	1759	c.1545C>A	c.(1543-1545)agC>agA	p.S515R	XPC_ENST00000449060.2_Missense_Mutation_p.S478R	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	515	Interaction with RAD23B.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCTCACCATCGCTGCACATTT	0.517			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	0								ENSG00000154767						147.0	128.0	134.0					3																	14199838		1568	3582	5150	XPC	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	-	HGNC		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.1545C>A	3.37:g.14199838G>T	ENSP00000285021:p.Ser515Arg	Somatic	0	52	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rad4/PNGase_transGLS-fold,pfam_Rad4_beta-hairpin_dom3,pfam_Rad4_beta-hairpin_dom2,pfam_Rad4_beta-hairpin_dom1,tigrfam_DNA_repair_Rad4_subgr	p.S515R	ENST00000285021.7	37	c.1545	CCDS46763.1	3	.	.	.	.	.	.	.	.	.	.	G	9.907	1.208372	0.22205	.	.	ENSG00000154767	ENST00000285021;ENST00000538683;ENST00000449060;ENST00000542703	T;T	0.21031	2.03;2.03	5.8	-11.0	0.00169	Rad4/PNGase transglutaminase-like fold (1);	1.455670	0.04152	N	0.321455	T	0.12944	0.0314	L	0.50333	1.59	0.09310	N	0.999998	B;B	0.20887	0.049;0.049	B;B	0.20767	0.031;0.031	T	0.11203	-1.0597	10	0.16420	T	0.52	14.3556	3.5573	0.07869	0.3237:0.3797:0.2086:0.088	.	478;515	E9PH69;Q01831	.;XPC_HUMAN	R	515;11;478;3	ENSP00000285021:S515R;ENSP00000404002:S478R	ENSP00000285021:S515R	S	-	3	2	XPC	14174840	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.102000	0.15272	-2.319000	0.00643	-2.317000	0.00253	AGC	-	pfam_Rad4/PNGase_transGLS-fold,tigrfam_DNA_repair_Rad4_subgr		0.517	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XPC	protein_coding	OTTHUMT00000340517.3	G	NM_004628	-		14199838	-1	no_errors	ENST00000285021	ensembl	human	known	74_37	missense	SNP	0.000	T
SMURF1	57154	genome.wustl.edu	37	7	98633223	98633223	+	Silent	SNP	C	C	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr7:98633223C>A	ENST00000361125.1	-	17	2323	c.2004G>T	c.(2002-2004)acG>acT	p.T668T	SMURF1_ENST00000361368.2_Silent_p.T642T|AC004893.11_ENST00000468960.2_RNA|AC004893.11_ENST00000360902.1_RNA	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	668	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			CTTCATCGAACGTCTCCACCG	0.567																																																	0								ENSG00000198742						126.0	111.0	116.0					7																	98633223		2203	4300	6503	SMURF1	SO:0001819	synonymous_variant	0			-	HGNC	AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.2004G>T	7.37:g.98633223C>A		Somatic	0	56	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	10	73.68	A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom	p.T668	ENST00000361125.1	37	c.2004	CCDS34690.1	7																																																																																			-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.567	SMURF1-001	KNOWN	basic|CCDS	protein_coding	SMURF1	protein_coding	OTTHUMT00000335001.2	C	NM_020429	-		98633223	-1	no_errors	ENST00000361125	ensembl	human	known	74_37	silent	SNP	0.954	A
GLIS2	84662	genome.wustl.edu	37	16	4386613	4386613	+	Intron	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr16:4386613G>A	ENST00000262366.3	+	8	1596				PAM16_ENST00000577031.1_Intron|GLIS2_ENST00000433375.1_Intron|RP11-295D4.1_ENST00000574705.1_RNA			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2						cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						CCCAGAATTGGGGCATCTATG	0.622																																																	0								ENSG00000262712																																			RP11-295D4.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.776-113G>A	16.37:g.4386613G>A		Somatic	0	53	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	19	42.42	B3KX84	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262366.3	37	NULL	CCDS10511.1	16																																																																																			-	-		0.622	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000262712	protein_coding	OTTHUMT00000251630.1	G	NM_032575	-		4386613	-1	no_errors	ENST00000574705	ensembl	human	known	74_37	rna	SNP	0.001	A
KIAA2018	205717	genome.wustl.edu	37	3	113377482	113377482	+	Frame_Shift_Del	DEL	T	T	-	rs78597857		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr3:113377482delT	ENST00000478658.1	-	5	3064	c.3047delA	c.(3046-3048)aacfs	p.N1016fs	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Frame_Shift_Del_p.N1016fs			Q68DE3	K2018_HUMAN	KIAA2018	1016						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.N1016fs*8(1)|p.N1016fs*9(1)|p.N1016fs*23(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TTTCTGAGGGTTTTTTTTTTT	0.363																																																	3	Deletion - Frameshift(2)|Insertion - Frameshift(1)	ovary(3)						ENSG00000176542						99.0	91.0	93.0					3																	113377482		1809	4067	5876	KIAA2018	SO:0001589	frameshift_variant	0				HGNC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3047delA	3.37:g.113377482delT	ENSP00000420721:p.Asn1016fs	Somatic	0	32	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q7Z3L9|Q8IVF3|Q9H8T4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.N1016fs	ENST00000478658.1	37	c.3047	CCDS43133.1	3																																																																																			-	NULL		0.363	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	protein_coding	OTTHUMT00000354591.1	T	NM_001009899			113377482	-1	no_errors	ENST00000316407	ensembl	human	known	74_37	frame_shift_del	DEL	0.827	-
EBF1	1879	genome.wustl.edu	37	5	158500455	158500465	+	Frame_Shift_Del	DEL	TTCTTGTCACA	TTCTTGTCACA	-			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	TTCTTGTCACA	TTCTTGTCACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr5:158500455_158500465delTTCTTGTCACA	ENST00000313708.6	-	6	775_785	c.493_503delTGTGACAAGAA	c.(493-504)tgtgacaagaaafs	p.CDKK165fs	EBF1_ENST00000517373.1_Frame_Shift_Del_p.CDKK165fs|EBF1_ENST00000380654.4_Intron|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	165					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCACAGCTTTTCTTGTCACAACAGCGGCTA	0.408			T	HMGA2	lipoma																																			Dom	yes		5	5q34	1879	early B-cell factor 1		M	0								ENSG00000164330																																			EBF1	SO:0001589	frameshift_variant	0				HGNC	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.493_503delTGTGACAAGAA	5.37:g.158500455_158500465delTTCTTGTCACA	ENSP00000322898:p.Cys165fs	Somatic	NA	NA	NA		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8IW11	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_IPT,superfamily_Ig_E-set,superfamily_bHLH_dom,smart_IPT	p.C165fs	ENST00000313708.6	37	c.503_493	CCDS4343.1	5																																																																																			-	NULL		0.408	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	protein_coding	OTTHUMT00000252649.1	TTCTTGTCACA	NM_024007			158500465	-1	no_errors	ENST00000313708	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
MGEA5	10724	genome.wustl.edu	37	10	103558659	103558659	+	Silent	SNP	T	T	C	rs369547430		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr10:103558659T>C	ENST00000361464.3	-	9	2144	c.1749A>G	c.(1747-1749)caA>caG	p.Q583Q	MGEA5_ENST00000439817.1_Silent_p.Q530Q|MGEA5_ENST00000482611.1_5'UTR|MGEA5_ENST00000370094.3_Silent_p.Q583Q|MGEA5_ENST00000357797.5_Silent_p.Q530Q	NM_012215.3	NP_036347.1	O60502	OGA_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	583					aging (GO:0007568)|dATP metabolic process (GO:0046060)|glycoprotein catabolic process (GO:0006516)|N-acetylglucosamine metabolic process (GO:0006044)|necrotic cell death (GO:0070265)|negative regulation of cardiac muscle adaptation (GO:0010616)|negative regulation of protein glycosylation (GO:0060051)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cell killing (GO:0031343)|positive regulation of DNA metabolic process (GO:0051054)|positive regulation of glucose import (GO:0046326)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of protein complex disassembly (GO:0043243)|positive regulation of proteolysis (GO:0045862)|protein targeting to membrane (GO:0006612)|response to steroid hormone (GO:0048545)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|hyalurononglucosaminidase activity (GO:0004415)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	23		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		CTCGAAGCCATTGAAATTCCC	0.453																																																	0								ENSG00000198408	T	,	0,4406		0,0,2203	144.0	139.0	140.0		1590,1749	4.0	1.0	10		140	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	MGEA5	NM_001142434.1,NM_012215.3	,	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	,	530/864,583/917	103558659	1,13005	2203	4300	6503	MGEA5	SO:0001819	synonymous_variant	0			-	HGNC	AF036144	CCDS7520.1, CCDS44471.1	10q24.1-q24.3	2008-08-01			ENSG00000198408	ENSG00000198408			7056	protein-coding gene	gene with protein product	"""nuclear cytoplasmic O-GlcNAcase and acetyltransferase"""	604039				9811929, 16356930	Standard	NM_012215		Approved	MEA5, NCOAT, OGA	uc001ktv.2	O60502	OTTHUMG00000018939	ENST00000361464.3:c.1749A>G	10.37:g.103558659T>C		Somatic	0	49	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	35	54.55	B7WPB9|D3DR79|E9PGF9|O75166|Q86WV0|Q8IV98|Q9BVA5|Q9HAR0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Beta-N-acetylglucosaminidase,superfamily_Glycoside_hydrolase_SF,superfamily_Acyl_CoA_acyltransferase	p.Q583	ENST00000361464.3	37	c.1749	CCDS7520.1	10																																																																																			-	NULL		0.453	MGEA5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MGEA5	protein_coding	OTTHUMT00000049987.1	T	NM_012215	-		103558659	-1	no_errors	ENST00000361464	ensembl	human	known	74_37	silent	SNP	1.000	C
NKX2-5	1482	genome.wustl.edu	37	5	172661847	172661847	+	Silent	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr5:172661847G>T	ENST00000329198.4	-	1	513	c.240C>A	c.(238-240)gcC>gcA	p.A80A	NKX2-5_ENST00000521848.1_Silent_p.A80A|NKX2-5_ENST00000424406.2_Silent_p.A80A	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	80	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ACGCACACTTGGCCGGTGAAG	0.701																																					Esophageal Squamous(72;810 1219 2387 13420 44943)												0								ENSG00000183072						17.0	19.0	18.0					5																	172661847		2198	4291	6489	NKX2-5	SO:0001819	synonymous_variant	0			-	HGNC	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.240C>A	5.37:g.172661847G>T		Somatic	0	77	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A8K3K0|B4DNB6|E9PBU6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.A80	ENST00000329198.4	37	c.240	CCDS4387.1	5																																																																																			-	NULL		0.701	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-5	protein_coding	OTTHUMT00000252942.2	G		-		172661847	-1	no_errors	ENST00000329198	ensembl	human	known	74_37	silent	SNP	0.997	T
SHOX	6473	genome.wustl.edu	37	X	601772	601772	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:601772C>T	ENST00000554971.1	+	4	674	c.583C>T	c.(583-585)Cga>Tga	p.R195*	SHOX_ENST00000334060.3_Nonsense_Mutation_p.R195*|SHOX_ENST00000381575.1_Nonsense_Mutation_p.R195*|SHOX_ENST00000381578.1_Nonsense_Mutation_p.R195*			O15266	SHOX_HUMAN	short stature homeobox	195					skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGACGCCTGCCGAGTGGCACC	0.582																																					Ovarian(95;18 1419 12424 14056 28266)												0			GRCh37	CM971378	SHOX	M	rs137852552	ENSG00000185960						243.0	209.0	221.0					X																	601772		2203	4296	6499	SHOX	SO:0001587	stop_gained	0			-	HGNC	U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.583C>T	X.37:g.601772C>T	ENSP00000452016:p.Arg195*	Somatic	0	146	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	60	36.17	O00412|O00413|O15267	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.R195*	ENST00000554971.1	37	c.583	CCDS14107.1	X	.	.	.	.	.	.	.	.	.	.	C	9.544	1.114132	0.20795	.	.	ENSG00000185960	ENST00000334060;ENST00000381578;ENST00000554971;ENST00000381575	.	.	.	1.53	0.12	0.14691	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	7.4216	0.27075	0.5683:0.4316:0.0:0.0	.	.	.	.	X	195	.	ENSP00000335505:R195X	R	+	1	2	SHOX	521772	0.998000	0.40836	0.904000	0.35570	0.204000	0.24138	0.501000	0.22578	-0.146000	0.11274	0.115000	0.15696	CGA	-	NULL		0.582	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SHOX	protein_coding	OTTHUMT00000411999.3	C	NM_000451	-		601772	+1	no_errors	ENST00000381578	ensembl	human	known	74_37	nonsense	SNP	1.000	T
MIR548H4	100313884	genome.wustl.edu	37	8	26906434	26906438	+	RNA	DEL	TAAAG	TAAAG	-	rs150141473|rs184537764|rs374688256	byFrequency	TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	TAAAG	TAAAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr8:26906434_26906438delTAAAG	ENST00000408689.1	-	0	42_46					NR_031680.1				microRNA 548h-4																		gtaaagtaattaaagtaatgacaaa	0.346														697	0.139177	0.053	0.1744	5008	,	,		13958	0.1141		0.2227	False		,,,				2504	0.1708																0								ENSG00000221616			125,2793		21,83,1355							0.0		dbSNP_130	5	859,5373		180,499,2437	no	intergenic				201,582,3792	A1A1,A1R,RR		13.7837,4.2838,10.7541				984,8166				MIR548H4			0				HGNC			8p21.2	2011-09-12		2008-12-18	ENSG00000221616	ENSG00000221616		"""ncRNAs / Micro RNAs"""	35345	non-coding RNA	RNA, micro				MIRN548H4			Standard	NR_031680		Approved	hsa-mir-548h-4	uc021spl.1				8.37:g.26906434_26906438delTAAAG		Somatic	NA	NA	NA		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408689.1	37	NULL		8																																																																																			-	-		0.346	MIR548H4-201	KNOWN	basic	miRNA	MIR548H4	miRNA		TAAAG	NR_031680			26906438	-1	no_errors	ENST00000408689	ensembl	human	known	74_37	rna	DEL	0.003:0.006:0.031:0.044:0.062	-
RXRA	6256	genome.wustl.edu	37	9	137330534	137330534	+	IGR	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr9:137330534G>C	ENST00000481739.1	+	0	1846				RXRA_ENST00000356384.4_3'UTR	NM_002957.4	NP_002948.1	P19793	RXRA_HUMAN	retinoid X receptor, alpha						camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|cellular lipid metabolic process (GO:0044255)|cholesterol metabolic process (GO:0008203)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|maternal placenta development (GO:0001893)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|response to retinoic acid (GO:0032526)|retinoic acid receptor signaling pathway (GO:0048384)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|vitamin metabolic process (GO:0006766)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	9-cis retinoic acid receptor activity (GO:0004886)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein heterodimerization activity (GO:0046982)|retinoic acid receptor activity (GO:0003708)|retinoic acid-responsive element binding (GO:0044323)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|vitamin D receptor binding (GO:0042809)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Bexarotene(DB00307)|Etodolac(DB00749)	GAGTGCAAAAGACCCAACGCC	0.672																																																	0								ENSG00000186350																																			RXRA	SO:0001628	intergenic_variant	0			-	HGNC	X52773	CCDS35172.1	9q34	2013-01-16			ENSG00000186350	ENSG00000186350		"""Nuclear hormone receptors"""	10477	protein-coding gene	gene with protein product	"""nuclear receptor subfamily 2 group B member 1"""	180245				2159111	Standard	XM_005263409		Approved	NR2B1	uc004cfa.1	P19793	OTTHUMG00000020887		9.37:g.137330534G>C		Somatic	0	208	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	85	68	55.19	B3KY83|Q2NL52|Q2V504	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000481739.1	37	NULL	CCDS35172.1	9																																																																																			-	-		0.672	RXRA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RXRA	protein_coding	OTTHUMT00000054949.1	G	NM_002957	-		137330534	+1	no_errors	ENST00000356384	ensembl	human	known	74_37	rna	SNP	0.000	C
MADD	8567	genome.wustl.edu	37	11	47333317	47333317	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr11:47333317G>A	ENST00000311027.5	+	29	4358	c.4193G>A	c.(4192-4194)cGc>cAc	p.R1398H	MADD_ENST00000406482.1_Missense_Mutation_p.R1296H|MADD_ENST00000407859.3_Missense_Mutation_p.R1316H|MADD_ENST00000342922.4_Missense_Mutation_p.R1339H|MADD_ENST00000402799.1_Missense_Mutation_p.R1296H|MADD_ENST00000402192.2_Missense_Mutation_p.R1338H|MADD_ENST00000395344.3_Missense_Mutation_p.R1292H|MADD_ENST00000405573.2_Missense_Mutation_p.R208H|MADD_ENST00000395336.3_Missense_Mutation_p.R1398H|MADD_ENST00000349238.3_Missense_Mutation_p.R1359H	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		AAGGTGAGGCGCCTAATGGGA	0.498																																																	0								ENSG00000110514						110.0	99.0	103.0					11																	47333317		2201	4298	6499	MADD	SO:0001583	missense	0			-	HGNC	AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4193G>A	11.37:g.47333317G>A	ENSP00000310933:p.Arg1398His	Somatic	0	73	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.R1398H	ENST00000311027.5	37	c.4193	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.194850	0.94960	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.61040	2.62;2.45;2.47;2.58;2.57;2.47;2.49;2.58;2.61;0.14	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.75635	0.3876	M	0.66297	2.02	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D	0.91635	0.999;0.964;0.983;0.999;0.993;0.993;0.993;0.999;0.998;0.997;0.998	T	0.78548	-0.2162	10	0.87932	D	0	-11.9969	18.6155	0.91302	0.0:0.0:1.0:0.0	.	208;1292;1292;1398;1296;1296;1296;1359;1316;1398;1339	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	H	1339;1296;1296;1296;1359;1398;1316;1292;1398;1338;208	ENSP00000343902:R1339H;ENSP00000385585:R1296H;ENSP00000384435:R1296H;ENSP00000304505:R1359H;ENSP00000310933:R1398H;ENSP00000384204:R1316H;ENSP00000378753:R1292H;ENSP00000378745:R1398H;ENSP00000384287:R1338H;ENSP00000384483:R208H	ENSP00000310933:R1398H	R	+	2	0	MADD	47289893	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	9.329000	0.96413	2.378000	0.81104	0.563000	0.77884	CGC	-	NULL		0.498	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	protein_coding	OTTHUMT00000317746.1	G		-		47333317	+1	no_errors	ENST00000311027	ensembl	human	known	74_37	missense	SNP	1.000	A
TMCC2	9911	genome.wustl.edu	37	1	205238479	205238479	+	Silent	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:205238479G>A	ENST00000358024.3	+	3	1538	c.1149G>A	c.(1147-1149)ggG>ggA	p.G383G	TMCC2_ENST00000329800.7_Silent_p.G143G|TMCC2_ENST00000330675.7_Silent_p.G158G|TMCC2_ENST00000545499.1_Silent_p.G305G|TMCC2_ENST00000495538.1_3'UTR	NM_014858.3	NP_055673.2	O75069	TMCC2_HUMAN	transmembrane and coiled-coil domain family 2	383						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(3)|pancreas(1)|skin(1)|urinary_tract(1)	20	Breast(84;0.0871)		BRCA - Breast invasive adenocarcinoma(75;0.117)			TGCAGCAGGGGCTGAAGGACG	0.682																																																	0								ENSG00000133069						24.0	25.0	25.0					1																	205238479		2203	4299	6502	TMCC2	SO:0001819	synonymous_variant	0			-	HGNC	AB001596	CCDS30984.1, CCDS55676.1, CCDS73010.1	1q32.1	2008-02-05	2005-07-13		ENSG00000133069	ENSG00000133069		"""Transmembrane and coiled-coil domain containing"""	24239	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 2"""			9455484	Standard	NM_014858		Approved	HUCEP11, FLJ38497	uc021pia.1	O75069	OTTHUMG00000037195	ENST00000358024.3:c.1149G>A	1.37:g.205238479G>A		Somatic	0	98	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	A2RRH3|B7Z1P7|Q6ZN09	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Predicted_TM_coiled-coil_2,superfamily_t-SNARE	p.G383	ENST00000358024.3	37	c.1149	CCDS30984.1	1																																																																																			-	pfam_Predicted_TM_coiled-coil_2		0.682	TMCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMCC2	protein_coding	OTTHUMT00000090383.1	G	NM_014858	-		205238479	+1	no_errors	ENST00000358024	ensembl	human	known	74_37	silent	SNP	0.081	A
PPIL6	285755	genome.wustl.edu	37	6	109721356	109721356	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr6:109721356G>T	ENST00000521072.2	-	7	1286	c.706C>A	c.(706-708)Cct>Act	p.P236T	PPIL6_ENST00000440797.2_Missense_Mutation_p.P262T|PPIL6_ENST00000424445.2_Missense_Mutation_p.P204T	NM_173672.4	NP_775943.1	Q8IXY8	PPIL6_HUMAN	peptidylprolyl isomerase (cyclophilin)-like 6	236	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)		peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)		TTATTATGAGGAACTGAAAAG	0.363																																																	0								ENSG00000185250						81.0	72.0	75.0					6																	109721356		2203	4300	6503	PPIL6	SO:0001583	missense	0			-	HGNC		CCDS5074.1, CCDS47466.1, CCDS47466.2, CCDS69169.1	6q21	2009-11-18			ENSG00000185250	ENSG00000185250			21557	protein-coding gene	gene with protein product	"""radial spoke 12 homolog (Chlamydomonas)"""						Standard	NM_173672		Approved	bA425D10.6, MGC41939, dJ919F19.1, RSPH12	uc010kdp.3	Q8IXY8	OTTHUMG00000036593	ENST00000521072.2:c.706C>A	6.37:g.109721356G>T	ENSP00000427929:p.Pro236Thr	Somatic	0	79	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A9NIU0|A9NIU9|E7EX15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.P236T	ENST00000521072.2	37	c.706	CCDS5074.1	6	.	.	.	.	.	.	.	.	.	.	G	13.60	2.286386	0.40494	.	.	ENSG00000185250	ENST00000424445;ENST00000440797;ENST00000521072;ENST00000417394	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.89	4.07	0.47477	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (3);Cyclophilin-like (1);	0.205175	0.42682	D	0.000664	T	0.14917	0.0360	N	0.12569	0.235	0.36424	D	0.864484	B;B;P	0.37688	0.121;0.056;0.605	B;B;B	0.40782	0.155;0.217;0.34	T	0.07616	-1.0763	10	0.56958	D	0.05	-6.1538	9.5744	0.39447	0.0746:0.0:0.7812:0.1442	.	262;204;236	A9NIU9;E7EX15;Q8IXY8	.;.;PPIL6_HUMAN	T	204;262;236;193	ENSP00000407731:P204T;ENSP00000392257:P262T;ENSP00000427929:P236T;ENSP00000411731:P193T	ENSP00000411731:P193T	P	-	1	0	PPIL6	109828049	1.000000	0.71417	0.878000	0.34440	0.949000	0.60115	4.703000	0.61824	1.447000	0.47661	0.655000	0.94253	CCT	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom		0.363	PPIL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL6	protein_coding	OTTHUMT00000089003.4	G		-		109721356	-1	no_errors	ENST00000521072	ensembl	human	known	74_37	missense	SNP	0.818	T
IGF2R	3482	genome.wustl.edu	37	6	160515039	160515039	+	Intron	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr6:160515039G>A	ENST00000356956.1	+	45	6803				RP11-288H12.3_ENST00000569097.1_RNA	NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor						insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	AGGACAGACAGCAAACTATTC	0.443																																																	0								ENSG00000213073																																			RP11-288H12.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.6656-2432G>A	6.37:g.160515039G>A		Somatic	0	35	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	Q7Z7G9|Q96PT5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356956.1	37	NULL	CCDS5273.1	6																																																																																			-	-		0.443	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC729603	protein_coding	OTTHUMT00000042931.1	G	NM_000876	-		160515039	+1	no_errors	ENST00000569097	ensembl	human	known	74_37	rna	SNP	0.009	A
SCRIB	23513	genome.wustl.edu	37	8	144894510	144894510	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr8:144894510G>T	ENST00000320476.3	-	9	838	c.832C>A	c.(832-834)Ctg>Atg	p.L278M	MIR937_ENST00000401271.1_RNA|SCRIB_ENST00000377533.3_Missense_Mutation_p.L197M|SCRIB_ENST00000356994.2_Missense_Mutation_p.L278M	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	278	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			ACCTCGCACAGCCGATTCTGG	0.592																																					Pancreas(51;966 1133 10533 14576 29674)												0								ENSG00000180900						142.0	121.0	128.0					8																	144894510		2203	4300	6503	SCRIB	SO:0001583	missense	0			-	HGNC	AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.832C>A	8.37:g.144894510G>T	ENSP00000322938:p.Leu278Met	Somatic	0	86	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_Leu-rich_rpt,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.L278M	ENST00000320476.3	37	c.832	CCDS6411.1	8	.	.	.	.	.	.	.	.	.	.	G	12.31	1.899787	0.33535	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;T;T	0.61510	1.66;0.1;1.29	4.21	1.44	0.22558	.	.	.	.	.	T	0.65471	0.2694	M	0.69185	2.1	0.45662	D	0.998589	P;D	0.53312	0.616;0.959	B;P	0.58210	0.178;0.835	T	0.63976	-0.6515	9	0.87932	D	0	.	8.1302	0.31022	0.2659:0.0:0.7341:0.0	.	278;278	Q14160;Q14160-3	SCRIB_HUMAN;.	M	278;278;197	ENSP00000349486:L278M;ENSP00000322938:L278M;ENSP00000366756:L197M	ENSP00000322938:L278M	L	-	1	2	SCRIB	144966498	1.000000	0.71417	0.239000	0.24122	0.003000	0.03518	3.759000	0.55227	0.088000	0.17205	0.563000	0.77884	CTG	-	NULL		0.592	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCRIB	protein_coding	OTTHUMT00000382215.1	G	NM_015356	-		144894510	-1	no_errors	ENST00000320476	ensembl	human	known	74_37	missense	SNP	0.925	T
SVIL	6840	genome.wustl.edu	37	10	29756774	29756774	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr10:29756774G>T	ENST00000355867.4	-	33	6626	c.5874C>A	c.(5872-5874)agC>agA	p.S1958R	PTCHD3P1_ENST00000455774.1_RNA|PTCHD3P1_ENST00000413405.1_RNA|SVIL_ENST00000375398.2_Missense_Mutation_p.S1958R|PTCHD3P1_ENST00000414457.1_RNA|PTCHD3P1_ENST00000445521.1_RNA|PTCHD3P1_ENST00000423223.1_RNA|SVIL_ENST00000535393.1_Missense_Mutation_p.S872R|SVIL_ENST00000375400.3_Missense_Mutation_p.S1532R|PTCHD3P1_ENST00000446807.1_RNA	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1958					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TGACTTTGCTGCTACTATGCA	0.478																																																	0								ENSG00000197321						135.0	119.0	124.0					10																	29756774		2203	4300	6503	SVIL	SO:0001583	missense	0			-	HGNC	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.5874C>A	10.37:g.29756774G>T	ENSP00000348128:p.Ser1958Arg	Somatic	0	40	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.S1958R	ENST00000355867.4	37	c.5874	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	G	22.5	4.298969	0.81025	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.42	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.62551	0.2437	M	0.77313	2.365	0.80722	D	1	D;P;P	0.67145	0.996;0.732;0.613	D;P;P	0.71656	0.974;0.556;0.453	T	0.66610	-0.5880	10	0.66056	D	0.02	-19.8514	11.4377	0.50078	0.1453:0.0:0.8547:0.0	.	872;1532;1958	F5H2Q5;O95425-2;O95425	.;.;SVIL_HUMAN	R	1532;1958;1958;872	ENSP00000364549:S1532R;ENSP00000364547:S1958R;ENSP00000348128:S1958R;ENSP00000445472:S872R	ENSP00000348128:S1958R	S	-	3	2	SVIL	29796780	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.607000	0.67648	1.435000	0.47434	0.650000	0.86243	AGC	-	smart_Villin/Gelsolin		0.478	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	protein_coding	OTTHUMT00000047395.1	G		-		29756774	-1	no_errors	ENST00000355867	ensembl	human	known	74_37	missense	SNP	1.000	T
PDE4B	5142	genome.wustl.edu	37	1	66732400	66732400	+	Intron	DEL	A	A	-			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:66732400delA	ENST00000329654.4	+	7	821				PDE4B_ENST00000423207.2_Intron|PDE4B_ENST00000371048.3_3'UTR|PDE4B_ENST00000371049.3_Intron	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	TGCAGAGAGGAAGGGCCACCT	0.378																																																	0								ENSG00000184588						28.0	25.0	26.0					1																	66732400		876	1991	2867	PDE4B	SO:0001627	intron_variant	0				HGNC	L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.634+630A>-	1.37:g.66732400delA		Somatic	0	39	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000329654.4	37	NULL	CCDS632.1	1																																																																																			-	-		0.378	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	protein_coding	OTTHUMT00000025188.3	A	NM_002600			66732400	+1	no_errors	ENST00000371048	ensembl	human	known	74_37	rna	DEL	0.000	-
KIAA0907	22889	genome.wustl.edu	37	1	155886422	155886423	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:155886422_155886423delCT	ENST00000368321.3	-	12	1569_1570	c.1546_1547delAG	c.(1546-1548)aggfs	p.R516fs	KIAA0907_ENST00000368320.3_Frame_Shift_Del_p.R516fs	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	516							RNA binding (GO:0003723)	p.R516fs*21(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			TTACCTGTCCCTCTCTCTCTCT	0.396																																																	1	Deletion - Frameshift(1)	large_intestine(1)						ENSG00000132680																																			KIAA0907	SO:0001589	frameshift_variant	0				HGNC	BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.1546_1547delAG	1.37:g.155886432_155886433delCT	ENSP00000357304:p.Arg516fs	Somatic	0	54	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.R516fs	ENST00000368321.3	37	c.1547_1546	CCDS30885.1	1																																																																																			-	NULL		0.396	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0907	protein_coding	OTTHUMT00000039583.1	CT	NM_014949			155886423	-1	no_errors	ENST00000368321	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
CCDC18	343099	genome.wustl.edu	37	1	93691986	93691986	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:93691986T>G	ENST00000343253.7	+	17	2771	c.2269T>G	c.(2269-2271)Tta>Gta	p.L757V	CCDC18_ENST00000557479.1_Missense_Mutation_p.L876V|CCDC18_ENST00000338949.4_Missense_Mutation_p.L513V|CCDC18_ENST00000421014.2_3'UTR|CCDC18_ENST00000334652.5_Missense_Mutation_p.L53V|CCDC18_ENST00000401026.3_Missense_Mutation_p.L758V			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	757										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TGAAAAACAGTTAAAGAAGAA	0.279																																																	0								ENSG00000122483						45.0	45.0	45.0					1																	93691986		1794	4053	5847	CCDC18	SO:0001583	missense	0			-	HGNC			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.2269T>G	1.37:g.93691986T>G	ENSP00000343377:p.Leu757Val	Somatic	0	95	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	112	34	76.71	Q6ZU17	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.L876V	ENST00000343253.7	37	c.2626		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.49|15.49	2.848408|2.848408	0.51164|0.51164	.|.	.|.	ENSG00000122483|ENSG00000122483	ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000334652;ENST00000455267|ENST00000370276	T;T;T;T;T;T|.	0.35973|.	1.28;1.28;1.28;1.28;1.28;1.28|.	5.23|5.23	2.13|2.13	0.27403|0.27403	.|.	0.165528|.	0.41001|.	D|.	0.000967|.	T|T	0.31482|0.31482	0.0798|0.0798	L|L	0.46157|0.46157	1.445|1.445	0.45464|0.45464	D|D	0.998432|0.998432	P;P|.	0.52316|.	0.732;0.952|.	B;P|.	0.47673|.	0.26;0.554|.	T|T	0.14783|0.14783	-1.0460|-1.0460	10|5	0.25106|.	T|.	0.35|.	.|.	4.5895|4.5895	0.12299|0.12299	0.2496:0.5203:0.0:0.23|0.2496:0.5203:0.0:0.23	.|.	757;876|.	Q5T9S5;G3V388|.	CCD18_HUMAN;.|.	V|R	757;758;876;513;53;433|810	ENSP00000343377:L757V;ENSP00000383808:L758V;ENSP00000451099:L876V;ENSP00000344380:L513V;ENSP00000334084:L53V;ENSP00000391151:L433V|.	ENSP00000334084:L53V|.	L|S	+|+	1|3	2|2	CCDC18|CCDC18	93464574|93464574	0.907000|0.907000	0.30839|0.30839	0.993000|0.993000	0.49108|0.49108	0.996000|0.996000	0.88848|0.88848	-0.072000|-0.072000	0.11486|0.11486	0.670000|0.670000	0.31165|0.31165	-0.248000|-0.248000	0.11899|0.11899	TTA|AGT	-	NULL		0.279	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	CCDC18	protein_coding	OTTHUMT00000382327.1	T	NM_206886	-		93691986	+1	no_errors	ENST00000557479	ensembl	human	known	74_37	missense	SNP	0.946	G
RET	5979	genome.wustl.edu	37	10	43615162	43615162	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr10:43615162C>A	ENST00000355710.3	+	14	2808	c.2576C>A	c.(2575-2577)tCa>tAa	p.S859*	RET_ENST00000340058.5_Nonsense_Mutation_p.S859*	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	859	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TGGCAGATCTCACAGGGGATG	0.657		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0								ENSG00000165731						60.0	51.0	54.0					10																	43615162		2203	4300	6503	RET	SO:0001587	stop_gained	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	-	HGNC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2576C>A	10.37:g.43615162C>A	ENSP00000347942:p.Ser859*	Somatic	0	71	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	16	36.00	A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Cadherin	p.S859*	ENST00000355710.3	37	c.2576	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	C	41	8.993139	0.99029	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.0766	0.93165	0.0:1.0:0.0:0.0	.	.	.	.	X	859	.	ENSP00000344798:S859X	S	+	2	0	RET	42935168	1.000000	0.71417	0.976000	0.42696	0.774000	0.43823	7.807000	0.86032	2.518000	0.84900	0.313000	0.20887	TCA	-	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.657	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	protein_coding	OTTHUMT00000047694.2	C	NM_020975	-		43615162	+1	no_errors	ENST00000355710	ensembl	human	known	74_37	nonsense	SNP	1.000	A
MEGF6	1953	genome.wustl.edu	37	1	3425216	3425216	+	Silent	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:3425216C>T	ENST00000356575.4	-	13	1792	c.1566G>A	c.(1564-1566)ttG>ttA	p.L522L	MEGF6_ENST00000294599.4_Silent_p.L417L	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	522	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		CATCACAGGTCAAGCTGCAGT	0.627																																					Ovarian(73;978 3658)												0								ENSG00000162591						50.0	56.0	54.0					1																	3425216		2100	4207	6307	MEGF6	SO:0001819	synonymous_variant	0			-	HGNC	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.1566G>A	1.37:g.3425216C>T		Somatic	0	103	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	5	81.48	Q4AC86|Q5VV39	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.L522	ENST00000356575.4	37	c.1566	CCDS41237.1	1																																																																																			-	smart_EG-like_dom,pfscan_EG-like_dom		0.627	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF6	protein_coding	OTTHUMT00000354866.1	C	NM_001409	-		3425216	-1	no_errors	ENST00000356575	ensembl	human	known	74_37	silent	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76849184	76849184	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:76849184T>A	ENST00000373344.5	-	26	6306	c.6092A>T	c.(6091-6093)gAg>gTg	p.E2031V	ATRX_ENST00000395603.3_Missense_Mutation_p.E1993V|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2031	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with MECP2.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						CCCAATTTCCTCTGCCATTCG	0.323			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						64.0	62.0	63.0					X																	76849184		2203	4296	6499	ATRX	SO:0001583	missense	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6092A>T	X.37:g.76849184T>A	ENSP00000362441:p.Glu2031Val	Somatic	0	91	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	51	79	39.23	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E2031V	ENST00000373344.5	37	c.6092	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	T	16.09	3.024852	0.54683	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.91945	-2.94;-2.94	5.27	5.27	0.74061	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92993	0.7770	L	0.31420	0.93	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.997	D	0.93007	0.6428	10	0.44086	T	0.13	-12.1774	14.321	0.66487	0.0:0.0:0.0:1.0	.	1993;2031	P46100-4;P46100	.;ATRX_HUMAN	V	2031;1993	ENSP00000362441:E2031V;ENSP00000378967:E1993V	ENSP00000362441:E2031V	E	-	2	0	ATRX	76735840	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.646000	0.83445	1.761000	0.52028	0.430000	0.28490	GAG	-	superfamily_P-loop_NTPase,pfscan_Helicase_C		0.323	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	T	NM_000489	-		76849184	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	SNP	1.000	A
H1FNT	341567	genome.wustl.edu	37	12	48723491	48723491	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr12:48723491G>C	ENST00000335017.1	+	1	729	c.417G>C	c.(415-417)gaG>gaC	p.E139D		NM_181788.1	NP_861453.1	Q75WM6	H1FNT_HUMAN	H1 histone family, member N, testis-specific	139	Arg-rich.				chromosome condensation (GO:0030261)|multicellular organismal development (GO:0007275)|sperm chromatin condensation (GO:0035092)|spermatid nucleus elongation (GO:0007290)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	13						GGCAAGAGGAGGGCACGCGCG	0.726																																																	0								ENSG00000187166						9.0	13.0	12.0					12																	48723491		2184	4254	6438	H1FNT	SO:0001583	missense	0			-	HGNC	AY302593	CCDS8762.1	12q13.11	2011-01-27				ENSG00000187166		"""Histones / Replication-independent"""	24893	protein-coding gene	gene with protein product						15710904	Standard	NM_181788		Approved	HANP1, H1T2	uc001rrm.3	Q75WM6		ENST00000335017.1:c.417G>C	12.37:g.48723491G>C	ENSP00000334805:p.Glu139Asp	Somatic	0	14	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	1	88.89	Q147U8|Q5GKZ5|Q7Z694	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E139D	ENST00000335017.1	37	c.417	CCDS8762.1	12	.	.	.	.	.	.	.	.	.	.	G	11.30	1.598772	0.28445	.	.	ENSG00000187166	ENST00000335017	T	0.19806	2.12	4.83	1.93	0.25924	.	0.952142	0.08513	N	0.934607	T	0.15392	0.0371	L	0.39898	1.24	0.09310	N	1	B	0.18013	0.025	B	0.21917	0.037	T	0.38972	-0.9636	10	0.18710	T	0.47	-11.3038	3.8943	0.09133	0.2808:0.1848:0.5344:0.0	.	139	Q75WM6	H1FNT_HUMAN	D	139	ENSP00000334805:E139D	ENSP00000334805:E139D	E	+	3	2	H1FNT	47009758	0.716000	0.27956	0.001000	0.08648	0.002000	0.02628	1.854000	0.39368	0.556000	0.29098	-0.172000	0.13284	GAG	-	NULL		0.726	H1FNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H1FNT	protein_coding	OTTHUMT00000406516.1	G	NM_181788	-		48723491	+1	no_errors	ENST00000335017	ensembl	human	known	74_37	missense	SNP	0.000	C
LY6G6F	259215	genome.wustl.edu	37	6	31675750	31675750	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr6:31675750G>C	ENST00000375832.4	+	3	507	c.485G>C	c.(484-486)gGg>gCg	p.G162A	LY6G6F_ENST00000556581.1_Missense_Mutation_p.G162A|MEGT1_ENST00000503322.1_Missense_Mutation_p.G162A|XXbac-BPG32J3.20_ENST00000461287.1_Intron	NM_001003693.1	NP_001003693.1	Q5SQ64	LY66F_HUMAN	lymphocyte antigen 6 complex, locus G6F	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)	12						TGGCAGGAAGGGAAGGGTCCC	0.627																																																	0								ENSG00000204424						93.0	91.0	92.0					6																	31675750		1511	2709	4220	LY6G6F	SO:0001583	missense	0			-	HGNC		CCDS34403.1	6p21	2013-01-11	2008-05-21	2008-05-21		ENSG00000204424		"""Immunoglobulin superfamily / V-set domain containing"""	13933	protein-coding gene	gene with protein product		611404	"""chromosome 6 open reading frame 21"""	LY6G6D, C6orf21		12852788	Standard	NM_001003693		Approved	G6f, NG32	uc003nwa.1	Q5SQ64	OTTHUMG00000031252	ENST00000375832.4:c.485G>C	6.37:g.31675750G>C	ENSP00000364992:p.Gly162Ala	Somatic	0	55	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	26	40.91	B0UXB7|O95869|Q7Z5H2|Q96QC7|Q9NZJ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.G162A	ENST00000375832.4	37	c.485	CCDS34403.1	6	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533105	0.45073	.	.	ENSG00000204424;ENSG00000204424;ENSG00000250641	ENST00000556581;ENST00000375832;ENST00000503322	T;T;T	0.38077	1.51;1.16;1.51	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000006	T	0.49558	0.1564	M	0.66939	2.045	0.31948	N	0.610082	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.53627	-0.8412	10	0.87932	D	0	-19.8165	14.8659	0.70416	0.0:0.0:1.0:0.0	.	162;162	Q9NZJ1;Q5SQ64	.;LY66F_HUMAN	A	162	ENSP00000452432:G162A;ENSP00000364992:G162A;ENSP00000421232:G162A	ENSP00000364992:G162A	G	+	2	0	XXbac-BPG32J3.19;LY6G6F	31783729	0.997000	0.39634	0.979000	0.43373	0.446000	0.32137	1.941000	0.40233	2.596000	0.87737	0.591000	0.81541	GGG	-	NULL		0.627	LY6G6F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY6G6F	protein_coding	OTTHUMT00000076532.2	G	NM_001003693	-		31675750	+1	no_errors	ENST00000556581	ensembl	human	known	74_37	missense	SNP	0.991	C
PIK3C2G	5288	genome.wustl.edu	37	12	18491389	18491390	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr12:18491389_18491390insA	ENST00000266497.5	+	8	1340_1341	c.1302_1303insA	c.(1303-1305)aaafs	p.K435fs	PIK3C2G_ENST00000535651.1_Frame_Shift_Ins_p.K435fs|PIK3C2G_ENST00000538779.1_Frame_Shift_Ins_p.K435fs|PIK3C2G_ENST00000433979.1_Frame_Shift_Ins_p.K435fs			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	435					chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				TTGAAGAAGTTAAAAAAATATG	0.312																																																	0								ENSG00000139144																																			PIK3C2G	SO:0001589	frameshift_variant	0				HGNC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.1309dupA	12.37:g.18491396_18491396dupA	ENSP00000266497:p.Lys435fs	Somatic	0	50	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	103	12.71	A1L3U0	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.I436fs	ENST00000266497.5	37	c.1302_1303	CCDS44839.1	12																																																																																			-	NULL		0.312	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	protein_coding	OTTHUMT00000401316.1	-	NM_004570			18491390	+1	no_errors	ENST00000538779	ensembl	human	known	74_37	frame_shift_ins	INS	0.996:0.999	A
OR51Q1	390061	genome.wustl.edu	37	11	5444355	5444355	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr11:5444355C>T	ENST00000300778.4	+	1	1015	c.925C>T	c.(925-927)Ctt>Ttt	p.L309F	AC104389.28_ENST00000415970.1_RNA|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	309						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTTAAATTTCCTTTCCCTCAA	0.398																																																	0								ENSG00000167360						42.0	42.0	42.0					11																	5444355		2201	4297	6498	OR51Q1	SO:0001583	missense	0			-	HGNC	AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.925C>T	11.37:g.5444355C>T	ENSP00000300778:p.Leu309Phe	Somatic	0	23	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	10	33.33	B2RNN1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L309F	ENST00000300778.4	37	c.925	CCDS31381.1	11	.	.	.	.	.	.	.	.	.	.	C	4.565	0.105037	0.08731	.	.	ENSG00000167360	ENST00000300778	T	0.42131	0.98	5.0	-3.19	0.05171	.	0.460979	0.18208	N	0.148299	T	0.14917	0.0360	N	0.13043	0.29	0.09310	N	1	B	0.13145	0.007	B	0.09377	0.004	T	0.30592	-0.9973	10	0.02654	T	1	.	4.3765	0.11272	0.2446:0.3496:0.0:0.4058	.	309	Q8NH59	O51Q1_HUMAN	F	309	ENSP00000300778:L309F	ENSP00000300778:L309F	L	+	1	0	OR51Q1	5400931	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-2.147000	0.01293	-0.424000	0.07382	0.380000	0.24917	CTT	-	NULL		0.398	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51Q1	protein_coding	OTTHUMT00000143373.1	C	NM_001004757	-		5444355	+1	no_errors	ENST00000300778	ensembl	human	known	74_37	missense	SNP	0.000	T
ANKRD49	54851	genome.wustl.edu	37	11	94230119	94230120	+	Splice_Site	INS	-	-	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr11:94230119_94230120insA	ENST00000544612.1	+	2	755		c.e2+2		ANKRD49_ENST00000302755.4_Splice_Site|ANKRD49_ENST00000544253.1_Frame_Shift_Ins_p.VK87fs|ANKRD49_ENST00000540349.1_Frame_Shift_Ins_p.VK87fs	NM_017704.2	NP_060174.2	Q8WVL7	ANR49_HUMAN	ankyrin repeat domain 49						positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|urinary_tract(1)	12		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AAAAATCGGGTAAAAAAAAAAA	0.396																																					Melanoma(113;823 1621 4352 9582 22033)												0								ENSG00000168876																																			ANKRD49	SO:0001630	splice_region_variant	0				HGNC	AF025354	CCDS8300.1	11q21	2013-01-10				ENSG00000168876		"""Ankyrin repeat domain containing"""	25970	protein-coding gene	gene with protein product						11162141	Standard	NM_017704		Approved	FLJ20189, FGIF, GBIF	uc001pew.3	Q8WVL7		ENST00000544612.1:c.258+2->A	11.37:g.94230130_94230130dupA		Somatic	0	26	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	48	11.11	Q8NDF2|Q96JE5|Q9NXK7	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.K91fs	ENST00000544612.1	37	c.260_261	CCDS8300.1	11																																																																																			-	NULL		0.396	ANKRD49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD49	protein_coding	OTTHUMT00000396314.2	-	NM_017704		Intron	94230120	+1	no_errors	ENST00000534911	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
ANK1	286	genome.wustl.edu	37	8	41545745	41545745	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr8:41545745G>T	ENST00000347528.4	-	35	4270	c.4187C>A	c.(4186-4188)tCt>tAt	p.S1396Y	ANK1_ENST00000265709.8_Missense_Mutation_p.S1437Y|ANK1_ENST00000352337.4_Missense_Mutation_p.S1396Y|ANK1_ENST00000289734.7_Missense_Mutation_p.S1396Y|ANK1_ENST00000379758.2_Missense_Mutation_p.S1396Y|ANK1_ENST00000396945.1_Missense_Mutation_p.S1396Y|ANK1_ENST00000396942.1_Missense_Mutation_p.S1396Y	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1396	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCCACTGAGAGAACCTGGGGA	0.552																																																	0								ENSG00000029534						203.0	175.0	185.0					8																	41545745		2203	4300	6503	ANK1	SO:0001583	missense	0			-	HGNC	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.4187C>A	8.37:g.41545745G>T	ENSP00000339620:p.Ser1396Tyr	Somatic	0	52	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.S1396Y	ENST00000347528.4	37	c.4187	CCDS6119.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	6.831|6.831	0.522556|0.522556	0.13066|0.13066	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000520299|ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820	.|T;T;T;T;T;T;T	.|0.66815	.|-0.22;-0.23;-0.2;-0.18;-0.2;-0.19;-0.22	5.64|5.64	1.9|1.9	0.25705|0.25705	.|Death (1);DEATH-like (1);	.|0.534254	.|0.20973	.|N	.|0.082356	T|T	0.57272|0.57272	0.2042|0.2042	L|L	0.47716|0.47716	1.5|1.5	0.41383|0.41383	D|D	0.98756|0.98756	.|B;B;B;B;B;B	.|0.22541	.|0.039;0.071;0.001;0.068;0.011;0.03	.|B;B;B;B;B;B	.|0.36534	.|0.156;0.056;0.005;0.227;0.099;0.075	T|T	0.49835|0.49835	-0.8897|-0.8897	5|10	.|0.37606	.|T	.|0.19	.|.	2.339|2.339	0.04255|0.04255	0.4245:0.0:0.3496:0.2259|0.4245:0.0:0.3496:0.2259	.|.	.|1437;1396;1396;1396;1396;712	.|P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39	.|.;.;ANK1_HUMAN;.;.;.	L|Y	717|1396;1396;1396;1396;1396;1396;1437;1396	.|ENSP00000339620:S1396Y;ENSP00000289734:S1396Y;ENSP00000369082:S1396Y;ENSP00000380149:S1396Y;ENSP00000380147:S1396Y;ENSP00000309131:S1396Y;ENSP00000265709:S1437Y	.|ENSP00000265709:S1437Y	F|S	-|-	3|2	2|0	ANK1|ANK1	41664902|41664902	0.717000|0.717000	0.27966|0.27966	0.002000|0.002000	0.10522|0.10522	0.001000|0.001000	0.01503|0.01503	2.731000|2.731000	0.47343|0.47343	0.389000|0.389000	0.25086|0.25086	-0.404000|-0.404000	0.06349|0.06349	TTC|TCT	-	superfamily_DEATH-like_dom,smart_Death_domain		0.552	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	protein_coding	OTTHUMT00000317297.1	G	NM_020475	-		41545745	-1	no_errors	ENST00000396942	ensembl	human	known	74_37	missense	SNP	0.041	T
GLT8D2	83468	genome.wustl.edu	37	12	104396990	104396990	+	Silent	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr12:104396990G>T	ENST00000360814.4	-	5	612	c.207C>A	c.(205-207)atC>atA	p.I69I	GLT8D2_ENST00000548660.1_Silent_p.I69I|GLT8D2_ENST00000546436.1_Silent_p.I69I	NM_031302.3	NP_112592.1	Q9H1C3	GL8D2_HUMAN	glycosyltransferase 8 domain containing 2	69						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			kidney(3)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)	16						AGATGCTATTGATGGCAGCCA	0.468																																																	0								ENSG00000120820						221.0	176.0	191.0					12																	104396990		2203	4300	6503	GLT8D2	SO:0001819	synonymous_variant	0			-	HGNC	BC022343	CCDS9096.1	12q23.3	2013-02-22			ENSG00000120820	ENSG00000120820		"""Glycosyltransferase family 8 domain containing"""	24890	protein-coding gene	gene with protein product							Standard	NM_031302		Approved	FLJ31494	uc001tkh.1	Q9H1C3	OTTHUMG00000170120	ENST00000360814.4:c.207C>A	12.37:g.104396990G>T		Somatic	0	63	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	8	80.95	Q96KA2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_8	p.I69	ENST00000360814.4	37	c.207	CCDS9096.1	12																																																																																			-	pfam_Glyco_trans_8		0.468	GLT8D2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT8D2	protein_coding	OTTHUMT00000407371.1	G	NM_031302	-		104396990	-1	no_errors	ENST00000360814	ensembl	human	known	74_37	silent	SNP	1.000	T
TRO	7216	genome.wustl.edu	37	X	54950979	54950979	+	Silent	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:54950979A>G	ENST00000173898.7	+	4	1444	c.1332A>G	c.(1330-1332)ttA>ttG	p.L444L	TRO_ENST00000375022.4_Silent_p.L444L|SNORA11_ENST00000408823.1_RNA|TRO_ENST00000375041.2_Silent_p.L47L|TRO_ENST00000420798.2_5'UTR|TRO_ENST00000399736.1_Silent_p.L47L|TRO_ENST00000319167.8_Silent_p.L444L|TRO_ENST00000484031.1_3'UTR	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	444	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						TGGCCATTTTACAAGAAAGGG	0.502																																																	0								ENSG00000067445						51.0	49.0	49.0					X																	54950979		2018	4171	6189	TRO	SO:0001819	synonymous_variant	0			-	HGNC	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.1332A>G	X.37:g.54950979A>G		Somatic	0	62	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	24	48.94	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.L444	ENST00000173898.7	37	c.1332	CCDS43959.1	X																																																																																			-	pfscan_MAGE		0.502	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	protein_coding	OTTHUMT00000056837.3	A	NM_016157	-		54950979	+1	no_errors	ENST00000173898	ensembl	human	known	74_37	silent	SNP	0.993	G
ZMYM3	9203	genome.wustl.edu	37	X	70469941	70469941	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:70469941G>A	ENST00000353904.2	-	6	1373	c.1186C>T	c.(1186-1188)Ccg>Tcg	p.P396S	ZMYM3_ENST00000373984.3_Missense_Mutation_p.P398S|ZMYM3_ENST00000373978.1_Silent_p.A299A|ZMYM3_ENST00000373981.1_Missense_Mutation_p.P396S|ZMYM3_ENST00000373988.1_Missense_Mutation_p.P398S|ZMYM3_ENST00000373982.1_Missense_Mutation_p.P398S|ZMYM3_ENST00000314425.5_Missense_Mutation_p.P396S|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373998.1_Missense_Mutation_p.P396S	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	396					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TGGGGGATCGGGCGCTGCTGC	0.607																																																	0								ENSG00000147130						50.0	44.0	46.0					X																	70469941		2203	4300	6503	ZMYM3	SO:0001583	missense	0			-	HGNC	AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.1186C>T	X.37:g.70469941G>A	ENSP00000343909:p.Pro396Ser	Somatic	0	73	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	10	44.44	D3DVV3|O15089|Q96E26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.P398S	ENST00000353904.2	37	c.1192	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	g	10.40	1.339509	0.24339	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373984;ENST00000373988;ENST00000373982;ENST00000373981	T;T;T;T;T;T;T	0.49139	1.5;0.93;1.5;1.5;1.5;0.79;0.79	3.4	3.4	0.38934	.	0.486738	0.18768	N	0.131690	T	0.32436	0.0829	L	0.35341	1.055	0.33649	D	0.608262	B;B;B;B	0.33212	0.402;0.402;0.004;0.002	B;B;B;B	0.33196	0.159;0.159;0.006;0.002	T	0.41645	-0.9497	10	0.30078	T	0.28	-6.4602	6.8954	0.24253	0.218:0.0:0.782:0.0	.	398;396;396;396	A6NL54;Q96E26;Q14202-2;Q14202	.;.;.;ZMYM3_HUMAN	S	396;396;396;398;398;398;396	ENSP00000322845:P396S;ENSP00000363110:P396S;ENSP00000343909:P396S;ENSP00000363096:P398S;ENSP00000363100:P398S;ENSP00000363094:P398S;ENSP00000363093:P396S	ENSP00000322845:P396S	P	-	1	0	ZMYM3	70386666	1.000000	0.71417	0.996000	0.52242	0.987000	0.75469	4.016000	0.57159	1.957000	0.56846	0.468000	0.43344	CCG	-	NULL		0.607	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	protein_coding	OTTHUMT00000057154.1	G	NM_201599	-		70469941	-1	no_errors	ENST00000373988	ensembl	human	known	74_37	missense	SNP	0.996	A
PRAMEF20	645425	genome.wustl.edu	37	1	13743010	13743010	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:13743010G>C	ENST00000602960.1	+	1	203	c.199G>C	c.(199-201)Ggg>Cgg	p.G67R	PRAMEF20_ENST00000316412.5_Missense_Mutation_p.G67R			Q5VT98	PRA20_HUMAN	PRAME family member 20	67					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					endometrium(1)|kidney(1)|large_intestine(1)|ovary(1)	4	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.5e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000156)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCTTCCTCTGGGGTCTCTGAT	0.582																																																	0								ENSG00000204478						25.0	27.0	27.0					1																	13743010		2185	4253	6438	PRAMEF20	SO:0001583	missense	0			-	HGNC		CCDS41265.1	1p36.21	2014-07-15			ENSG00000204478	ENSG00000204478		"""-"""	25224	protein-coding gene	gene with protein product			"""PRAME family member 21"""	PRAMEF21			Standard	NM_001099852		Approved	OTTHUMG00000007911, OTTHUMT00000008157	uc009vnv.1	Q5VT98	OTTHUMG00000007911	ENST00000602960.1:c.199G>C	1.37:g.13743010G>C	ENSP00000473584:p.Gly67Arg	Somatic	0	157	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	86	24.56		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G67R	ENST00000602960.1	37	c.199	CCDS41265.1	1	.	.	.	.	.	.	.	.	.	.	.	6.431	0.447635	0.12223	.	.	ENSG00000204478	ENST00000316412	T	0.04970	3.52	1.51	0.573	0.17363	.	0.000000	0.85682	D	0.000000	T	0.09818	0.0241	M	0.67625	2.065	0.09310	N	1	.	.	.	.	.	.	T	0.10590	-1.0623	8	0.52906	T	0.07	.	4.0884	0.09958	0.226:0.0:0.774:0.0	.	.	.	.	R	67	ENSP00000346275:G67R	ENSP00000346275:G67R	G	+	1	0	PRAMEF20	13615597	0.128000	0.22383	0.015000	0.15790	0.008000	0.06430	1.147000	0.31602	0.232000	0.21100	-0.667000	0.03836	GGG	-	NULL		0.582	PRAMEF20-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	PRAMEF20	protein_coding	OTTHUMT00000021782.1	G	NM_001099852	-		13743010	+1	no_errors	ENST00000316412	ensembl	human	known	74_37	missense	SNP	0.015	C
ZNF833P	401898	genome.wustl.edu	37	19	11797000	11797000	+	lincRNA	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr19:11797000G>C	ENST00000344893.3	+	0	2999					NR_028594.1		Q6ZTB9	ZN833_HUMAN	zinc finger protein 833, pseudogene								metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5						TGTAAAGAATGTGGTAAAACC	0.333																																																	0								ENSG00000197332																																			ZNF833P			0			-	HGNC	BC137336		19p13.2	2010-08-03	2010-08-03	2010-08-03	ENSG00000197332	ENSG00000197332			33819	pseudogene	pseudogene			"""zinc finger protein 833"""	ZNF833			Standard	NR_028594		Approved		uc021upi.1	Q6ZTB9	OTTHUMG00000156530		19.37:g.11797000G>C		Somatic	0	64	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	19	77.91	B2RPA0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000344893.3	37	NULL		19																																																																																			-	-		0.333	ZNF833P-001	KNOWN	basic|readthrough_transcript	lincRNA	ZNF833P	lincRNA	OTTHUMT00000458891.1	G	NM_001013691	-		11797000	+1	no_errors	ENST00000344893	ensembl	human	known	74_37	rna	SNP	0.095	C
PASK	23178	genome.wustl.edu	37	2	242054559	242054559	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr2:242054559G>A	ENST00000405260.1	-	14	3930	c.3232C>T	c.(3232-3234)Cag>Tag	p.Q1078*	PASK_ENST00000475666.1_5'Flank|PASK_ENST00000234040.4_Nonsense_Mutation_p.Q1078*|PASK_ENST00000544142.1_Nonsense_Mutation_p.Q892*|PASK_ENST00000358649.4_Nonsense_Mutation_p.Q1078*|PASK_ENST00000539818.1_Nonsense_Mutation_p.Q862*|PASK_ENST00000403638.3_Nonsense_Mutation_p.Q1078*	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	1078	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		ATCACAAGCTGGAAGAACCCT	0.488																																																	0								ENSG00000115687						64.0	70.0	68.0					2																	242054559		2203	4300	6503	PASK	SO:0001587	stop_gained	0			-	HGNC	U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.3232C>T	2.37:g.242054559G>A	ENSP00000384016:p.Gln1078*	Somatic	0	24	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	9	35.71	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,superfamily_PAS,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_dom,tigrfam_PAS	p.Q1078*	ENST00000405260.1	37	c.3232	CCDS2545.1	2	.	.	.	.	.	.	.	.	.	.	G	48	14.148800	0.99782	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	.	.	.	5.63	5.63	0.86233	.	0.000000	0.51477	D	0.000085	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.6668	0.95895	0.0:0.0:1.0:0.0	.	.	.	.	X	1078;892;1078;1078;862;1078	.	ENSP00000234040:Q1078X	Q	-	1	0	PASK	241703232	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.285000	0.95894	2.650000	0.89964	0.655000	0.94253	CAG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.488	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	protein_coding	OTTHUMT00000323753.1	G	NM_015148	-		242054559	-1	no_errors	ENST00000358649	ensembl	human	known	74_37	nonsense	SNP	1.000	A
POTEM	641455	genome.wustl.edu	37	14	20012890	20012890	+	Intron	SNP	A	A	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr14:20012890A>T	ENST00000551509.1	-	4	862				RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						tcgaggttgcagtgagctgtg	0.348																																																	0								ENSG00000187537																																			POTEM	SO:0001627	intron_variant	0			-	HGNC		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.811-1233T>A	14.37:g.20012890A>T		Somatic	0	21	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	39	29.09		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L289Q	ENST00000551509.1	37	c.866	CCDS45076.1	14	.	.	.	.	.	.	.	.	.	.	a	2.357	-0.347586	0.05208	.	.	ENSG00000187537	ENST00000439503	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	T	0.29423	0.0733	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26573	-1.0099	3	.	.	.	.	.	.	.	.	.	.	.	Q	289	.	.	L	-	2	0	POTEM	19082890	0.000000	0.05858	0.016000	0.15963	0.030000	0.12068	-1.894000	0.01607	0.156000	0.19299	0.155000	0.16302	CTG	-	NULL		0.348	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	protein_coding	OTTHUMT00000409490.3	A	NM_001145442	-		20012890	-1	no_errors	ENST00000547722	ensembl	human	known	74_37	missense	SNP	0.017	T
CAPZB	832	genome.wustl.edu	37	1	19683234	19683234	+	Silent	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:19683234G>A	ENST00000375142.1	-	6	529	c.483C>T	c.(481-483)agC>agT	p.S161S	CAPZB_ENST00000433834.1_Silent_p.S190S|CAPZB_ENST00000375144.1_Silent_p.S149S|CAPZB_ENST00000264203.3_Silent_p.S187S|CAPZB_ENST00000264202.6_Silent_p.S161S|CAPZB_ENST00000401084.2_Silent_p.S161S	NM_001206540.1	NP_001193469.1	P47756	CAPZB_HUMAN	capping protein (actin filament) muscle Z-line, beta	161					actin cytoskeleton organization (GO:0030036)|barbed-end actin filament capping (GO:0051016)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|muscle fiber development (GO:0048747)|negative regulation of microtubule polymerization (GO:0031115)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)|regulation of protein kinase C signaling (GO:0090036)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|membrane (GO:0016020)|WASH complex (GO:0071203)|Z disc (GO:0030018)	actin binding (GO:0003779)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	7		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		CGGTGCGACCGCTGGATTTCT	0.552																																																	0								ENSG00000077549						208.0	212.0	211.0					1																	19683234		2020	4184	6204	CAPZB	SO:0001819	synonymous_variant	0			-	HGNC	U03271	CCDS41277.1, CCDS55579.1, CCDS72717.1, CCDS72718.1	1p36.1	2014-05-09			ENSG00000077549	ENSG00000077549			1491	protein-coding gene	gene with protein product		601572					Standard	NM_004930		Approved		uc021ohr.1	P47756	OTTHUMG00000002556	ENST00000375142.1:c.483C>T	1.37:g.19683234G>A		Somatic	0	59	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q32Q68|Q5U0L4|Q8TB49|Q9NUC4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CapZ_beta,prints_CapZ_beta	p.S190	ENST00000375142.1	37	c.570	CCDS55579.1	1																																																																																			-	pfam_CapZ_beta		0.552	CAPZB-003	KNOWN	basic|CCDS	protein_coding	CAPZB	protein_coding	OTTHUMT00000007260.1	G		-		19683234	-1	no_errors	ENST00000433834	ensembl	human	known	74_37	silent	SNP	0.976	A
MUC4	4585	genome.wustl.edu	37	3	195510015	195510015	+	Silent	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr3:195510015A>G	ENST00000463781.3	-	2	8895	c.8436T>C	c.(8434-8436)ggT>ggC	p.G2812G	MUC4_ENST00000475231.1_Silent_p.G2812G|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGGTGGCGTGACCTGTGGACA	0.587																																																	0								ENSG00000145113						70.0	44.0	52.0					3																	195510015		685	1511	2196	MUC4	SO:0001819	synonymous_variant	0			-	HGNC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8436T>C	3.37:g.195510015A>G		Somatic	0	187	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	18	29.63	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.G2812	ENST00000463781.3	37	c.8436	CCDS54700.1	3																																																																																			-	NULL		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	A	NM_018406	-		195510015	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	SNP	0.287	G
KANK1	23189	genome.wustl.edu	37	9	734665	734666	+	Intron	INS	-	-	AA	rs377485461|rs77731420|rs142267604	byFrequency	TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr9:734665_734666insAA	ENST00000382303.1	+	11	3897				KANK1_ENST00000382297.2_Intron|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Intron	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1						negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		gaccctgtctcaaaaaaaaaaT	0.426																																																	0								ENSG00000107104																																			KANK1	SO:0001627	intron_variant	0				HGNC	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3246-82->AA	9.37:g.734674_734675dupAA		Somatic	0	46	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	34	8.11	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382303.1	37	NULL	CCDS34976.1	9																																																																																			-	-		0.426	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	protein_coding	OTTHUMT00000051484.2	-	NM_015158			734666	+1	no_errors	ENST00000489369	ensembl	human	known	74_37	rna	INS	0.002:0.002	AA
LOXHD1	125336	genome.wustl.edu	37	18	44139448	44139448	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr18:44139448T>C	ENST00000398722.4	-	13	2344	c.2345A>G	c.(2344-2346)aAg>aGg	p.K782R	LOXHD1_ENST00000441893.2_5'Flank|LOXHD1_ENST00000582408.1_5'Flank|LOXHD1_ENST00000579038.1_5'Flank|LOXHD1_ENST00000536736.1_Missense_Mutation_p.K1060R|LOXHD1_ENST00000441551.2_Intron|LOXHD1_ENST00000300591.6_5'Flank			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	782	PLAT 6. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GTCTGACTTCTTCAGGGGTCG	0.592																																																	0								ENSG00000167210						123.0	118.0	119.0					18																	44139448		692	1591	2283	LOXHD1	SO:0001583	missense	0			-	HGNC	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2345A>G	18.37:g.44139448T>C	ENSP00000381707:p.Lys782Arg	Somatic	0	101	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	6	64.71	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.K1060R	ENST00000398722.4	37	c.3179		18	.	.	.	.	.	.	.	.	.	.	T	8.056	0.767030	0.15983	.	.	ENSG00000167210	ENST00000398722;ENST00000536736;ENST00000335730	T;T	0.64991	-0.13;-0.13	5.27	1.62	0.23740	.	0.382239	0.31156	N	0.008151	T	0.35566	0.0936	N	0.04705	-0.18	0.80722	D	1	B;B	0.26512	0.094;0.151	B;B	0.29862	0.07;0.108	T	0.04509	-1.0946	10	0.14656	T	0.56	.	9.0389	0.36305	0.0:0.2871:0.0:0.7129	.	1060;782	F5GZB4;Q8IVV2-2	.;.	R	782;1060;782	ENSP00000381707:K782R;ENSP00000444586:K1060R	ENSP00000338222:K782R	K	-	2	0	LOXHD1	42393446	1.000000	0.71417	0.999000	0.59377	0.944000	0.59088	1.734000	0.38166	0.340000	0.23745	0.368000	0.22195	AAG	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.592	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	protein_coding		T	NM_144612	-		44139448	-1	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	SNP	1.000	C
KDM4A	9682	genome.wustl.edu	37	1	44156546	44156546	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:44156546G>T	ENST00000372396.3	+	14	2202	c.2068G>T	c.(2068-2070)Gga>Tga	p.G690*		NM_014663.2	NP_055478.2	O75164	KDM4A_HUMAN	lysine (K)-specific demethylase 4A	690					cardiac muscle hypertrophy in response to stress (GO:0014898)|histone demethylation (GO:0016577)|histone H3-K36 demethylation (GO:0070544)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|methylated histone binding (GO:0035064)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(13)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	37						TCAGAACTGTGGAAATGCTTC	0.478																																																	0								ENSG00000066135						205.0	203.0	204.0					1																	44156546		2203	4300	6503	KDM4A	SO:0001587	stop_gained	0			-	HGNC	AB014577	CCDS491.1	1p34.1	2013-01-23	2009-04-06	2009-04-06	ENSG00000066135	ENSG00000066135		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	22978	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 3A"", ""tudor domain containing 14A"""	609764	"""jumonji domain containing 2"", ""jumonji domain containing 2A"""	JMJD2, JMJD2A		9734811, 15138608	Standard	XM_005271354		Approved	KIAA0677, JHDM3A, TDRD14A	uc001cjx.3	O75164	OTTHUMG00000007560	ENST00000372396.3:c.2068G>T	1.37:g.44156546G>T	ENSP00000361473:p.Gly690*	Somatic	0	113	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q5VVB1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.G690*	ENST00000372396.3	37	c.2068	CCDS491.1	1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.944263	0.92593	.	.	ENSG00000066135	ENST00000372396	.	.	.	5.42	4.31	0.51392	.	1.154180	0.06042	N	0.654987	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-2.6206	8.0835	0.30758	0.149:0.145:0.706:0.0	.	.	.	.	X	690	.	ENSP00000361473:G690X	G	+	1	0	KDM4A	43929133	0.168000	0.22989	0.168000	0.22838	0.246000	0.25737	1.234000	0.32660	2.546000	0.85860	0.557000	0.71058	GGA	-	NULL		0.478	KDM4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4A	protein_coding	OTTHUMT00000019960.1	G	NM_014663	-		44156546	+1	no_errors	ENST00000372396	ensembl	human	known	74_37	nonsense	SNP	0.000	T
PAPOLA	10914	genome.wustl.edu	37	14	97022235	97022235	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr14:97022235G>T	ENST00000216277.8	+	18	1936	c.1716G>T	c.(1714-1716)caG>caT	p.Q572H	PAPOLA_ENST00000392990.2_Missense_Mutation_p.Q572H	NM_032632.4	NP_116021.2	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	572	Ser/Thr-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|RNA polyadenylation (GO:0043631)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(6)|skin(1)|urinary_tract(1)	21		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		CCAACATACAGGCTACTGAAG	0.353																																					NSCLC(19;254 734 11908 35501 39234)												0								ENSG00000090060						87.0	90.0	89.0					14																	97022235		2203	4300	6503	PAPOLA	SO:0001583	missense	0			-	HGNC	X76770	CCDS9946.1, CCDS58334.1, CCDS58335.1	14q32.1-q32.2	2008-02-08				ENSG00000090060	2.7.7.19		14981	protein-coding gene	gene with protein product		605553				8302877, 10429366	Standard	NM_032632		Approved	PAP	uc001yfq.3	P51003		ENST00000216277.8:c.1716G>T	14.37:g.97022235G>T	ENSP00000216277:p.Gln572His	Somatic	0	81	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q86SX4|Q86TV0|Q8IYF5|Q9BVU2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PolA_pol_cen_dom,pfam_PolA_pol_RNA-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.Q572H	ENST00000216277.8	37	c.1716	CCDS9946.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.48|19.48	3.835009|3.835009	0.71373|0.71373	.|.	.|.	ENSG00000090060|ENSG00000090060	ENST00000216277;ENST00000546064;ENST00000392990;ENST00000555626|ENST00000556459	.|.	.|.	.|.	5.81|5.81	4.89|4.89	0.63831|0.63831	.|.	0.205182|.	0.44902|.	D|.	0.000416|.	T|T	0.70254|0.70254	0.3203|0.3203	M|M	0.63843|0.63843	1.955|1.955	0.49130|0.49130	D|D	0.999758|0.999758	P;P;P|.	0.49783|.	0.928;0.855;0.855|.	P;P;P|.	0.50440|.	0.641;0.459;0.459|.	T|T	0.69778|0.69778	-0.5053|-0.5053	9|5	0.33940|.	T|.	0.23|.	.|.	14.3689|14.3689	0.66826|0.66826	0.0737:0.0:0.9263:0.0|0.0737:0.0:0.9263:0.0	.|.	588;588;572|.	F5H5I8;B4DYF4;P51003|.	.;.;PAPOA_HUMAN|.	H|M	572;588;572;322|73	.|.	ENSP00000216277:Q572H|.	Q|R	+|+	3|2	2|0	PAPOLA|PAPOLA	96091988|96091988	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.009000|4.009000	0.57110|0.57110	1.531000|1.531000	0.49152|0.49152	0.655000|0.655000	0.94253|0.94253	CAG|AGG	-	pirsf_PolyA_polymerase		0.353	PAPOLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPOLA	protein_coding	OTTHUMT00000413411.2	G		-		97022235	+1	no_errors	ENST00000216277	ensembl	human	known	74_37	missense	SNP	1.000	T
ARHGAP31	57514	genome.wustl.edu	37	3	119099802	119099802	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr3:119099802G>T	ENST00000264245.4	+	4	932	c.400G>T	c.(400-402)Gtt>Ttt	p.V134F		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	134	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						AATCCAAAATGTTATCCAGGA	0.517																																					Pancreas(7;176 297 5394 51128 51241)												0								ENSG00000031081						94.0	97.0	96.0					3																	119099802		2018	4177	6195	ARHGAP31	SO:0001583	missense	0			-	HGNC		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.400G>T	3.37:g.119099802G>T	ENSP00000264245:p.Val134Phe	Somatic	0	55	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q9ULL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.V134F	ENST00000264245.4	37	c.400	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264467	0.80358	.	.	ENSG00000031081	ENST00000264245;ENST00000543280;ENST00000482743	T;T	0.20598	2.06;2.06	5.27	4.4	0.53042	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.175862	0.37393	N	0.002119	T	0.48642	0.1511	M	0.86573	2.825	0.58432	D	0.999992	D	0.60575	0.988	D	0.68765	0.96	T	0.56195	-0.8019	10	0.87932	D	0	.	11.3555	0.49613	0.0825:0.0:0.9175:0.0	.	134	Q2M1Z3	RHG31_HUMAN	F	134;134;105	ENSP00000264245:V134F;ENSP00000418429:V105F	ENSP00000264245:V134F	V	+	1	0	ARHGAP31	120582492	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.601000	0.67606	1.459000	0.47892	0.655000	0.94253	GTT	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.517	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	protein_coding	OTTHUMT00000354942.2	G		-		119099802	+1	no_errors	ENST00000264245	ensembl	human	known	74_37	missense	SNP	1.000	T
GAB3	139716	genome.wustl.edu	37	X	153906237	153906237	+	3'UTR	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:153906237C>T	ENST00000369575.3	-	0	2010				GAB3_ENST00000496390.1_5'UTR	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3						macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GAGCCCCCTCCGGAAGGCAAC	0.453																																																	0								ENSG00000160219																																			GAB3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.*218G>A	X.37:g.153906237C>T		Somatic	0	14	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	10	28.57	A6NHF8|E9PB44	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369575.3	37	NULL	CCDS14760.1	X																																																																																			-	-		0.453	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	protein_coding	OTTHUMT00000061192.2	C	NM_001081573	-		153906237	-1	no_errors	ENST00000496390	ensembl	human	known	74_37	rna	SNP	0.000	T
ZNF804A	91752	genome.wustl.edu	37	2	185803515	185803515	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr2:185803515T>A	ENST00000302277.6	+	4	3986	c.3392T>A	c.(3391-3393)tTt>tAt	p.F1131Y		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1131							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CACCAACAGTTTCTTTCCCAA	0.532																																																	0								ENSG00000170396						144.0	139.0	141.0					2																	185803515		2203	4300	6503	ZNF804A	SO:0001583	missense	0			-	HGNC	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3392T>A	2.37:g.185803515T>A	ENSP00000303252:p.Phe1131Tyr	Somatic	0	38	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	A7E253|Q6ZN26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2_jaz	p.F1131Y	ENST00000302277.6	37	c.3392	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	T	16.14	3.038207	0.54896	.	.	ENSG00000170396	ENST00000302277	T	0.06687	3.27	5.03	5.03	0.67393	.	0.000000	0.49916	D	0.000130	T	0.24005	0.0581	L	0.57536	1.79	0.33030	D	0.530029	D	0.76494	0.999	D	0.78314	0.991	T	0.24657	-1.0154	10	0.72032	D	0.01	-16.832	12.5019	0.55960	0.0:0.0:0.0:1.0	.	1131	Q7Z570	Z804A_HUMAN	Y	1131	ENSP00000303252:F1131Y	ENSP00000303252:F1131Y	F	+	2	0	ZNF804A	185511760	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.333000	0.52090	1.882000	0.54519	0.260000	0.18958	TTT	-	NULL		0.532	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	protein_coding	OTTHUMT00000255871.1	T	NM_194250	-		185803515	+1	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	SNP	1.000	A
MAP1A	4130	genome.wustl.edu	37	15	43820411	43820411	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr15:43820411T>A	ENST00000300231.5	+	4	7190	c.6740T>A	c.(6739-6741)cTg>cAg	p.L2247Q	MAP1A_ENST00000399453.1_Missense_Mutation_p.L2247Q|MAP1A_ENST00000382031.1_Missense_Mutation_p.L2485Q			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2247					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CTCTCCAATCTGCCACGACCT	0.607																																																	0								ENSG00000166963						63.0	69.0	67.0					15																	43820411		1931	4115	6046	MAP1A	SO:0001583	missense	0			-	HGNC	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.6740T>A	15.37:g.43820411T>A	ENSP00000300231:p.Leu2247Gln	Somatic	0	143	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	41	34.38	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L2247Q	ENST00000300231.5	37	c.6740	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	T	12.46	1.944658	0.34283	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01725	4.67;4.67;4.67	4.56	4.56	0.56223	.	0.000000	0.27802	N	0.017781	T	0.05318	0.0141	L	0.36672	1.1	0.37034	D	0.896842	D	0.76494	0.999	D	0.76575	0.988	T	0.58047	-0.7705	10	0.28530	T	0.3	-4.6459	12.6407	0.56709	0.0:0.0:0.0:1.0	.	2247	P78559	MAP1A_HUMAN	Q	2485;2247;2247	ENSP00000371462:L2485Q;ENSP00000382380:L2247Q;ENSP00000300231:L2247Q	ENSP00000300231:L2247Q	L	+	2	0	MAP1A	41607703	1.000000	0.71417	0.679000	0.29978	0.970000	0.65996	1.921000	0.40035	1.911000	0.55334	0.459000	0.35465	CTG	-	NULL		0.607	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	protein_coding	OTTHUMT00000132894.5	T	NM_002373	-		43820411	+1	no_errors	ENST00000399453	ensembl	human	known	74_37	missense	SNP	0.972	A
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578	ENSG00000141510						50.0	50.0	50.0					17																	7578406		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His	Somatic	0	30	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	3	85.71	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	rs28934578		7578406	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
GOLGA6L7P	728310	genome.wustl.edu	37	15	29090545	29090545	+	RNA	SNP	C	C	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr15:29090545C>G	ENST00000569815.1	-	0	717					NR_047567.1				golgin A6 family-like 7, pseudogene																		CAACCACGCACAAAAGCAGCA	0.597																																																	0								ENSG00000261649																																			GOLGA6L7P			0			-	HGNC	AK302238		15q13.1	2012-10-05	2011-04-15	2010-04-20	ENSG00000261649	ENSG00000261649			37442	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 6-like 7 (pseudogene)"""	GOLGA6L7			Standard	NR_047567		Approved		uc010uar.2		OTTHUMG00000176345		15.37:g.29090545C>G		Somatic	0	26	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	2	77.78		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000569815.1	37	NULL		15																																																																																			-	-		0.597	GOLGA6L7P-002	PUTATIVE	basic	processed_transcript	GOLGA6L7P	pseudogene	OTTHUMT00000431796.1	C	XR_078490	-		29090545	-1	no_errors	ENST00000569815	ensembl	human	putative	74_37	rna	SNP	0.028	G
OR6C76	390326	genome.wustl.edu	37	12	55820114	55820114	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr12:55820114T>C	ENST00000328314.3	+	1	77	c.77T>C	c.(76-78)tTc>tCc	p.F26S		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GTTGTGATTTTCTCGTTCCTA	0.418																																																	0								ENSG00000185821						168.0	162.0	164.0					12																	55820114		2203	4300	6503	OR6C76	SO:0001583	missense	0			-	HGNC		CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.77T>C	12.37:g.55820114T>C	ENSP00000328402:p.Phe26Ser	Somatic	0	50	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	6	86.05		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F26S	ENST00000328314.3	37	c.77	CCDS31823.1	12	.	.	.	.	.	.	.	.	.	.	t	16.81	3.225932	0.58668	.	.	ENSG00000185821	ENST00000328314	T	0.04551	3.6	4.35	4.35	0.52113	.	0.000000	0.44688	U	0.000423	T	0.15046	0.0363	M	0.83692	2.655	0.30245	N	0.794666	P	0.50528	0.936	P	0.50270	0.636	T	0.03761	-1.1006	10	0.72032	D	0.01	.	13.6441	0.62270	0.0:0.0:0.0:1.0	.	26	A6NM76	O6C76_HUMAN	S	26	ENSP00000328402:F26S	ENSP00000328402:F26S	F	+	2	0	OR6C76	54106381	0.751000	0.28327	0.077000	0.20336	0.028000	0.11728	1.506000	0.35747	1.945000	0.56424	0.487000	0.48397	TTC	-	prints_GPCR_Rhodpsn		0.418	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C76	protein_coding	OTTHUMT00000406675.1	T	NM_001005183	-		55820114	+1	no_errors	ENST00000328314	ensembl	human	known	74_37	missense	SNP	0.865	C
AGTR2	186	genome.wustl.edu	37	X	115304619	115304619	+	Silent	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:115304619G>T	ENST00000371906.4	+	3	1276	c.1086G>T	c.(1084-1086)gtG>gtT	p.V362V		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	362					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	AGACCTTTGTGTCTTAAACGT	0.378																																																	0								ENSG00000180772						72.0	68.0	70.0					X																	115304619		2202	4300	6502	AGTR2	SO:0001819	synonymous_variant	0			-	HGNC	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.1086G>T	X.37:g.115304619G>T		Somatic	0	63	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B2R9V1|Q13016|Q6FGY7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_ATII_AT2_rcpt,prints_GPCR_Rhodpsn,prints_ATII_rcpt,prints_Brdyknn_rcpt,prints_Chemokine_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.V362	ENST00000371906.4	37	c.1086	CCDS14569.1	X																																																																																			-	NULL		0.378	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGTR2	protein_coding	OTTHUMT00000057984.1	G	NM_000686	-		115304619	+1	no_errors	ENST00000371906	ensembl	human	known	74_37	silent	SNP	0.001	T
SNORD3B-1	26851	genome.wustl.edu	37	17	18965294	18965294	+	lincRNA	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr17:18965294C>T	ENST00000363359.1	+	0	70				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		tgtagagcaccgaaaaccccg	0.498																																																	0								ENSG00000265185						6.0	4.0	5.0					17																	18965294		618	734	1352	SNORD3B-1			0			-	HGNC	AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18965294C>T		Somatic	0	23	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	20	25.93		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			-	-		0.498	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-1	lincRNA		C	NR_003271	-		18965294	+1	no_errors	ENST00000363359	ensembl	human	known	74_37	rna	SNP	0.075	T
TRIM58	25893	genome.wustl.edu	37	1	248039664	248039664	+	Missense_Mutation	SNP	G	G	T	rs200018732		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:248039664G>T	ENST00000366481.3	+	6	1382	c.1334G>T	c.(1333-1335)cGg>cTg	p.R445L	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	445	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGTCTTCTTCGGCCTTACTTT	0.428																																																	0								ENSG00000162722						160.0	156.0	158.0					1																	248039664		2203	4300	6503	TRIM58	SO:0001583	missense	0			-	HGNC	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1334G>T	1.37:g.248039664G>T	ENSP00000355437:p.Arg445Leu	Somatic	0	114	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	4	81.82	Q6B0H9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R445L	ENST00000366481.3	37	c.1334	CCDS1636.1	1	.	.	.	.	.	.	.	.	.	.	G	9.271	1.045657	0.19748	.	.	ENSG00000162722	ENST00000366481	T	0.68181	-0.31	4.05	3.14	0.36123	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.51477	D	0.000090	T	0.68220	0.2977	M	0.64260	1.97	0.20703	N	0.999867	D	0.56035	0.974	P	0.57204	0.815	T	0.57539	-0.7794	10	0.10636	T	0.68	.	7.8462	0.29426	0.1103:0.0:0.8897:0.0	.	445	Q8NG06	TRI58_HUMAN	L	445	ENSP00000355437:R445L	ENSP00000355437:R445L	R	+	2	0	TRIM58	246106287	0.006000	0.16342	0.900000	0.35374	0.322000	0.28314	1.526000	0.35964	1.313000	0.45069	0.650000	0.86243	CGG	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.428	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	protein_coding	OTTHUMT00000096860.1	G	NM_015431	-		248039664	+1	no_errors	ENST00000366481	ensembl	human	known	74_37	missense	SNP	0.350	T
ARL4D	379	genome.wustl.edu	37	17	41477378	41477378	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr17:41477378G>T	ENST00000320033.4	+	2	485	c.278G>T	c.(277-279)cGg>cTg	p.R93L		NM_001661.3	NP_001652.2	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D	93					GTP catabolic process (GO:0006184)|protein secretion (GO:0009306)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		TATACCCGCCGGACAGACGGT	0.652																																																	0								ENSG00000175906						66.0	70.0	69.0					17																	41477378		2203	4300	6503	ARL4D	SO:0001583	missense	0			-	HGNC	AB060692	CCDS11463.1	17q21.31	2014-05-09	2005-11-03	2005-11-03	ENSG00000175906	ENSG00000175906		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	656	protein-coding gene	gene with protein product		600732	"""ADP-ribosylation factor 4-like"""	ARF4L		7590735	Standard	NM_001661		Approved		uc002idt.3	P49703		ENST00000320033.4:c.278G>T	17.37:g.41477378G>T	ENSP00000322628:p.Arg93Leu	Somatic	0	66	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B2RC59|D3DX43	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_MIRO-like,pfam_SRP_receptor_beta_su,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R93L	ENST00000320033.4	37	c.278	CCDS11463.1	17	.	.	.	.	.	.	.	.	.	.	G	14.04	2.415363	0.42817	.	.	ENSG00000175906	ENST00000320033	D	0.82344	-1.6	4.89	3.91	0.45181	Small GTP-binding protein domain (1);	0.068673	0.56097	D	0.000022	T	0.75627	0.3875	L	0.38838	1.175	0.45899	D	0.998743	P	0.35139	0.486	B	0.37780	0.258	T	0.76394	-0.2975	10	0.87932	D	0	-12.7824	8.7832	0.34804	0.0834:0.1551:0.7615:0.0	.	93	P49703	ARL4D_HUMAN	L	93	ENSP00000322628:R93L	ENSP00000322628:R93L	R	+	2	0	ARL4D	38832904	1.000000	0.71417	0.914000	0.36105	0.006000	0.05464	7.724000	0.84798	1.395000	0.46643	0.563000	0.77884	CGG	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_MIRO-like,pfam_SRP_receptor_beta_su,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,tigrfam_Small_GTP-bd_dom		0.652	ARL4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL4D	protein_coding	OTTHUMT00000453481.2	G	NM_001661	-		41477378	+1	no_errors	ENST00000320033	ensembl	human	known	74_37	missense	SNP	0.996	T
SPATA5	166378	genome.wustl.edu	37	4	123868616	123868616	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr4:123868616G>T	ENST00000274008.4	+	9	1756	c.1687G>T	c.(1687-1689)Gac>Tac	p.D563Y	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	563					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						CGTTGGAGCAGACTTGAAAGT	0.433																																																	0								ENSG00000145375						117.0	114.0	115.0					4																	123868616		2203	4300	6503	SPATA5	SO:0001583	missense	0			-	HGNC	AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.1687G>T	4.37:g.123868616G>T	ENSP00000274008:p.Asp563Tyr	Somatic	0	45	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	C9JT97|Q86XW1|Q8NI20|Q8TDL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase	p.D563Y	ENST00000274008.4	37	c.1687	CCDS3730.1	4	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062015	0.76187	.	.	ENSG00000145375	ENST00000274008	D	0.95482	-3.72	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.98858	0.9614	H	0.98629	4.285	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99211	1.0876	10	0.87932	D	0	-38.7922	19.9462	0.97183	0.0:0.0:1.0:0.0	.	563;563	Q8NB90;Q8NB90-3	SPAT5_HUMAN;.	Y	563	ENSP00000274008:D563Y	ENSP00000274008:D563Y	D	+	1	0	SPATA5	124088066	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	8.623000	0.90957	2.717000	0.92951	0.585000	0.79938	GAC	-	superfamily_P-loop_NTPase		0.433	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA5	protein_coding	OTTHUMT00000256714.2	G	NM_145207	-		123868616	+1	no_errors	ENST00000274008	ensembl	human	known	74_37	missense	SNP	1.000	T
TF	7018	genome.wustl.edu	37	3	133467272	133467272	+	Silent	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr3:133467272C>T	ENST00000402696.3	+	2	545	c.60C>T	c.(58-60)gtC>gtT	p.V20V	TF_ENST00000264998.3_Intron|TFP1_ENST00000460564.1_RNA|TF_ENST00000475382.1_3'UTR	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	20					blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	GTCTGGCTGTCCCTGATAAAA	0.572																																																	0								ENSG00000091513						130.0	114.0	120.0					3																	133467272		2203	4300	6503	TF	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.60C>T	3.37:g.133467272C>T		Somatic	0	71	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	11	69.44	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.V20	ENST00000402696.3	37	c.60	CCDS3080.1	3																																																																																			-	pirsf_Transferrin		0.572	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TF	protein_coding	OTTHUMT00000317775.1	C	NM_001063	-		133467272	+1	no_errors	ENST00000402696	ensembl	human	known	74_37	silent	SNP	0.003	T
PLK3	1263	genome.wustl.edu	37	1	45270778	45270778	+	Intron	DEL	A	A	-			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:45270778delA	ENST00000372201.4	+	14	1874				PLK3_ENST00000465443.1_Intron	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3						apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					actccatctcaaaaaaaaaaa	0.512																																																	0								ENSG00000173846																																			PLK3	SO:0001627	intron_variant	0				HGNC	AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.1636-160A>-	1.37:g.45270778delA		Somatic	0	14	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	Q15767|Q5JR99|Q96CV1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372201.4	37	NULL	CCDS515.1	1																																																																																			-	-		0.512	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK3	protein_coding	OTTHUMT00000023429.1	A	NM_004073			45270778	+1	no_errors	ENST00000461769	ensembl	human	known	74_37	rna	DEL	0.019	-
TNRC6C	57690	genome.wustl.edu	37	17	76047369	76047369	+	Silent	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr17:76047369A>G	ENST00000588061.1	+	5	2953	c.2226A>G	c.(2224-2226)gtA>gtG	p.V742V	TNRC6C_ENST00000301624.4_Silent_p.V742V|TNRC6C_ENST00000588847.1_Silent_p.V742V|TNRC6C_ENST00000541771.1_Silent_p.V742V|TNRC6C_ENST00000544502.1_Silent_p.V742V|TNRC6C_ENST00000335749.4_Silent_p.V742V			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	742	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			ATAAAACTGTAAACATGTGGG	0.517																																																	0								ENSG00000078687						33.0	33.0	33.0					17																	76047369		1939	4060	5999	TNRC6C	SO:0001819	synonymous_variant	0			-	HGNC	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2226A>G	17.37:g.76047369A>G		Somatic	0	59	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	55	46.08	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Argonaute_hook_dom,pfam_UBA/Ts_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.V742	ENST00000588061.1	37	c.2226	CCDS45798.1	17																																																																																			-	NULL		0.517	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	protein_coding	OTTHUMT00000395947.1	A	NM_018996	-		76047369	+1	no_errors	ENST00000335749	ensembl	human	known	74_37	silent	SNP	0.996	G
MED14	9282	genome.wustl.edu	37	X	40511075	40511075	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:40511075G>A	ENST00000324817.1	-	31	4466	c.4348C>T	c.(4348-4350)Cct>Tct	p.P1450S		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	1450					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CGCCCACCAGGGGGCAGTGTA	0.393																																																	0								ENSG00000180182						45.0	39.0	41.0					X																	40511075		2203	4299	6502	MED14	SO:0001583	missense	0			-	HGNC	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.4348C>T	X.37:g.40511075G>A	ENSP00000323720:p.Pro1450Ser	Somatic	0	90	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	105	26.57	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med14	p.P1450S	ENST00000324817.1	37	c.4348	CCDS14254.1	X	.	.	.	.	.	.	.	.	.	.	G	12.82	2.051597	0.36181	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.88	5.88	0.94601	.	0.159176	0.64402	D	0.000019	T	0.23014	0.0556	N	0.00841	-1.15	0.58432	D	0.999996	B	0.17038	0.02	B	0.12837	0.008	T	0.41215	-0.9521	9	0.02654	T	1	.	19.1532	0.93499	0.0:0.0:1.0:0.0	.	1450	O60244	MED14_HUMAN	S	1450	.	ENSP00000323720:P1450S	P	-	1	0	MED14	40396019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.038000	0.76537	2.474000	0.83562	0.600000	0.82982	CCT	-	NULL		0.393	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	protein_coding	OTTHUMT00000060692.1	G	NM_004229	-		40511075	-1	no_errors	ENST00000324817	ensembl	human	known	74_37	missense	SNP	1.000	A
CDYL2	124359	genome.wustl.edu	37	16	80719022	80719022	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr16:80719022T>C	ENST00000570137.2	-	2	184	c.29A>G	c.(28-30)gAa>gGa	p.E10G	CDYL2_ENST00000562812.1_Missense_Mutation_p.E10G|CDYL2_ENST00000566173.1_Missense_Mutation_p.E10G|CDYL2_ENST00000563890.1_Missense_Mutation_p.E10G|CDYL2_ENST00000562753.1_5'UTR	NM_152342.2	NP_689555.2	Q8N8U2	CDYL2_HUMAN	chromodomain protein, Y-like 2	10	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.					nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	21						TACAATCCTTTCAACCTGCGA	0.483																																																	0								ENSG00000166446						88.0	78.0	82.0					16																	80719022		2203	4297	6500	CDYL2	SO:0001583	missense	0			-	HGNC	AK096185	CCDS32493.1	16q23.2	2008-02-05	2003-09-12			ENSG00000166446			23030	protein-coding gene	gene with protein product			"""chromodomain Y-like protein 2"""			12837688	Standard	NM_152342		Approved	FLJ38866	uc002ffs.3	Q8N8U2		ENST00000570137.2:c.29A>G	16.37:g.80719022T>C	ENSP00000476295:p.Glu10Gly	Somatic	0	24	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00	Q7Z5I8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Crotonase_core_superfam,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.E10G	ENST00000570137.2	37	c.29	CCDS32493.1	16	.	.	.	.	.	.	.	.	.	.	T	23.6	4.439747	0.83885	.	.	ENSG00000166446	ENST00000299564	T	0.58210	0.35	5.08	5.08	0.68730	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.000000	0.85682	D	0.000000	T	0.80188	0.4577	H	0.95151	3.63	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.86231	0.1637	10	0.87932	D	0	.	14.1946	0.65662	0.0:0.0:0.0:1.0	.	10	Q8N8U2	CDYL2_HUMAN	G	10	ENSP00000299564:E10G	ENSP00000299564:E10G	E	-	2	0	CDYL2	79276523	1.000000	0.71417	0.999000	0.59377	0.895000	0.52256	7.757000	0.85209	2.131000	0.65755	0.533000	0.62120	GAA	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow		0.483	CDYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDYL2	protein_coding	OTTHUMT00000434727.2	T	NM_152342	-		80719022	-1	no_errors	ENST00000570137	ensembl	human	known	74_37	missense	SNP	1.000	C
COL11A2	1302	genome.wustl.edu	37	6	33157162	33157162	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr6:33157162G>A	ENST00000374708.4	-	2	425	c.167C>T	c.(166-168)gCt>gTt	p.A56V	COL11A2_ENST00000374712.1_Missense_Mutation_p.A56V|COL11A2_ENST00000395197.1_Missense_Mutation_p.A56V|COL11A2_ENST00000374713.1_Missense_Mutation_p.A56V|COL11A2_ENST00000361917.1_Missense_Mutation_p.A56V|COL11A2_ENST00000395194.1_Missense_Mutation_p.A56V|COL11A2_ENST00000341947.2_Missense_Mutation_p.A56V|COL11A2_ENST00000374714.1_Missense_Mutation_p.A56V|COL11A2_ENST00000357486.1_Missense_Mutation_p.A56V	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	56					cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GGCCACATCAGCTGGACAGAT	0.642																																					Melanoma(1;90 116 3946 5341 17093)												0								ENSG00000204248						81.0	68.0	72.0					6																	33157162		1511	2709	4220	COL11A2	SO:0001583	missense	0			-	HGNC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.167C>T	6.37:g.33157162G>A	ENSP00000363840:p.Ala56Val	Somatic	0	62	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.A56V	ENST00000374708.4	37	c.167	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285040	0.59867	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000457788;ENST00000395194	T;T;T;T;T;T;T;T;T;T	0.02032	4.49;4.49;4.49;4.49;4.49;4.49;4.49;4.49;4.49;4.49	4.19	1.18	0.20946	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.360241	0.25011	N	0.033831	T	0.00724	0.0024	L	0.43923	1.385	0.20975	N	0.999817	B;B;B;P	0.34662	0.209;0.069;0.069;0.462	B;B;B;B	0.26094	0.053;0.025;0.025;0.066	T	0.49762	-0.8905	10	0.45353	T	0.12	.	8.8008	0.34907	0.0:0.305:0.5379:0.1571	.	56;56;56;56	Q7Z6C3;P13942-8;P13942-6;P13942	.;.;.;COBA2_HUMAN	V	56	ENSP00000363840:A56V;ENSP00000339915:A56V;ENSP00000350079:A56V;ENSP00000363846:A56V;ENSP00000363845:A56V;ENSP00000378623:A56V;ENSP00000363844:A56V;ENSP00000355123:A56V;ENSP00000405520:A56V;ENSP00000378620:A56V	ENSP00000339915:A56V	A	-	2	0	COL11A2	33265140	0.158000	0.22850	0.113000	0.21522	0.949000	0.60115	2.794000	0.47853	0.099000	0.17552	0.501000	0.49751	GCT	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G		0.642	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	protein_coding	OTTHUMT00000076032.2	G		-		33157162	-1	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	SNP	0.495	A
TRMT1L	81627	genome.wustl.edu	37	1	185097863	185097863	+	Silent	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:185097863C>T	ENST00000367506.5	-	11	1798	c.1530G>A	c.(1528-1530)caG>caA	p.Q510Q	TRMT1L_ENST00000367504.3_Missense_Mutation_p.S376N	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	510	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.				adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						TACAAGGCAGCTGTCTATATG	0.333																																																	0								ENSG00000121486						111.0	118.0	116.0					1																	185097863		2203	4300	6503	TRMT1L	SO:0001819	synonymous_variant	0			-	HGNC	AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.1530G>A	1.37:g.185097863C>T		Somatic	0	35	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TRM1,pfam_tRNA_Trfase_Trm5/Tyw2,pfscan_Znf_C2H2	p.S376N	ENST00000367506.5	37	c.1127	CCDS1366.1	1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229801	0.58777	.	.	ENSG00000121486	ENST00000367504	.	.	.	6.06	4.21	0.49690	.	.	.	.	.	T	0.21921	0.0528	.	.	.	0.21064	N	0.999796	.	.	.	.	.	.	T	0.24083	-1.0170	5	0.12766	T	0.61	-13.9234	7.9046	0.29755	0.1303:0.7369:0.0:0.1328	.	.	.	.	N	376	.	ENSP00000356474:S376N	S	-	2	0	TRMT1L	183364486	1.000000	0.71417	0.995000	0.50966	0.977000	0.68977	3.144000	0.50616	0.905000	0.36596	-0.157000	0.13467	AGC	-	NULL		0.333	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT1L	protein_coding	OTTHUMT00000085787.1	C	NM_030934	-		185097863	-1	no_errors	ENST00000367504	ensembl	human	known	74_37	missense	SNP	1.000	T
OTOGL	283310	genome.wustl.edu	37	12	80672001	80672001	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr12:80672001G>T	ENST00000547103.1	+	24	2714	c.2708G>T	c.(2707-2709)tGg>tTg	p.W903L	OTOGL_ENST00000458043.2_Missense_Mutation_p.W903L			Q3ZCN5	OTOGL_HUMAN	otogelin-like	903					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						CCATGTATTTGGAAAGATTGG	0.373																																																	0								ENSG00000165899																																			OTOGL	SO:0001583	missense	0			-	HGNC	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.2708G>T	12.37:g.80672001G>T	ENSP00000447211:p.Trp903Leu	Somatic	0	41	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.09	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.W903L	ENST00000547103.1	37	c.2708		12	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778578	0.90195	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.15256	2.44;2.44	5.11	5.11	0.69529	.	.	.	.	.	T	0.23094	0.0558	N	0.26092	0.79	0.80722	D	1	.	.	.	.	.	.	T	0.01436	-1.1355	7	0.36615	T	0.2	.	18.8898	0.92395	0.0:0.0:1.0:0.0	.	.	.	.	L	903	ENSP00000447211:W903L;ENSP00000400895:W903L	ENSP00000400895:W903L	W	+	2	0	OTOGL	79196132	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.827000	0.92041	2.538000	0.85594	0.591000	0.81541	TGG	-	NULL		0.373	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	protein_coding	OTTHUMT00000407438.1	G	NM_173591	-		80672001	+1	no_errors	ENST00000458043	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF678	339500	genome.wustl.edu	37	1	227842949	227842949	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:227842949G>T	ENST00000343776.5	+	4	1343	c.998G>T	c.(997-999)tGt>tTt	p.C333F	ZNF678_ENST00000608949.1_Intron|ZNF678_ENST00000397097.3_Missense_Mutation_p.C388F	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	333					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				TTTAATCGGTGTTCACACCTA	0.388																																																	0								ENSG00000181450						31.0	37.0	35.0					1																	227842949		2201	4295	6496	ZNF678	SO:0001583	missense	0			-	HGNC	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.998G>T	1.37:g.227842949G>T	ENSP00000344828:p.Cys333Phe	Somatic	0	35	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q8IVQ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C388F	ENST00000343776.5	37	c.1163		1	.	.	.	.	.	.	.	.	.	.	G	0.621	-0.821121	0.02755	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	T;T	0.39997	1.05;1.05	1.34	-0.185	0.13276	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19765	0.0475	N	0.11789	0.175	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17561	-1.0365	9	0.40728	T	0.16	.	2.3313	0.04236	0.2585:0.3374:0.4041:0.0	.	333	Q5SXM1	ZN678_HUMAN	F	333;388	ENSP00000344828:C333F;ENSP00000440403:C388F	ENSP00000344828:C333F	C	+	2	0	ZNF678	225909572	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.541000	0.06099	0.596000	0.29794	0.603000	0.83216	TGT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.388	ZNF678-001	KNOWN	basic	protein_coding	ZNF678	protein_coding	OTTHUMT00000091976.2	G	NM_178549	-		227842949	+1	no_errors	ENST00000397097	ensembl	human	known	74_37	missense	SNP	0.000	T
CTAGE5	4253	genome.wustl.edu	37	14	39790147	39790147	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr14:39790147G>C	ENST00000280083.3	+	19	1873	c.1559G>C	c.(1558-1560)gGt>gCt	p.G520A	CTAGE5_ENST00000396158.2_Missense_Mutation_p.G525A|CTAGE5_ENST00000553352.1_Missense_Mutation_p.G491A|RP11-407N17.3_ENST00000603904.1_Missense_Mutation_p.G491A|CTAGE5_ENST00000341502.5_Missense_Mutation_p.G520A|CTAGE5_ENST00000341749.3_Missense_Mutation_p.G508A|CTAGE5_ENST00000396165.4_Missense_Mutation_p.G491A|CTAGE5_ENST00000557038.1_Missense_Mutation_p.G440A|CTAGE5_ENST00000348007.3_Intron|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.G1055A|CTAGE5_ENST00000556148.1_Missense_Mutation_p.G445A			O15320	CTGE5_HUMAN	CTAGE family, member 5	520	Pro-rich.				positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		TCCCCATATGGTCCCTCACCA	0.423																																																	0								ENSG00000150527						129.0	135.0	133.0					14																	39790147		2203	4300	6503	CTAGE5	SO:0001583	missense	0			-	HGNC	U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.1559G>C	14.37:g.39790147G>C	ENSP00000280083:p.Gly520Ala	Somatic	0	77	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	8	79.49	B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G525A	ENST00000280083.3	37	c.1574	CCDS9674.1	14	.	.	.	.	.	.	.	.	.	.	G	19.22	3.785910	0.70337	.	.	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000341502;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000553352	T;T;T;T;T;T;T;T;T	0.60424	0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19	5.95	5.05	0.67936	.	0.000000	0.35407	N	0.003229	T	0.57932	0.2087	L	0.59436	1.845	0.44142	D	0.996931	B;B;B;B	0.22541	0.071;0.039;0.039;0.022	B;B;B;B	0.32624	0.149;0.106;0.106;0.106	T	0.53899	-0.8373	9	.	.	.	.	15.4115	0.74929	0.0:0.1384:0.8616:0.0	.	482;525;520;508	F8W9E1;O15320-5;O15320;G3XAC5	.;.;CTGE5_HUMAN;.	A	1055;508;440;482;491;520;525;520;445;491	ENSP00000452252:G1055A;ENSP00000343897:G508A;ENSP00000450869:G440A;ENSP00000379468:G491A;ENSP00000339286:G520A;ENSP00000379462:G525A;ENSP00000280083:G520A;ENSP00000452562:G445A;ENSP00000450449:G491A	.	G	+	2	0	CTAGE5;RP11-407N17.3	38859898	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.590000	0.67530	1.486000	0.48398	0.655000	0.94253	GGT	-	NULL		0.423	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CTAGE5	protein_coding	OTTHUMT00000276771.2	G	NM_005930	-		39790147	+1	no_errors	ENST00000396158	ensembl	human	known	74_37	missense	SNP	1.000	C
DNM1P47	100216544	genome.wustl.edu	37	15	102299771	102299771	+	RNA	SNP	C	C	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr15:102299771C>A	ENST00000561463.1	+	0	7817									DNM1 pseudogene 47																		GTCGGCAGAGCAGGCACAGAG	0.577																																																	0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299771C>A		Somatic	0	16	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	8	33.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.577	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	C	NG_009149	-		102299771	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	1.000	A
WBSCR22	114049	genome.wustl.edu	37	7	73112209	73112209	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr7:73112209G>A	ENST00000265758.2	+	12	897	c.839G>A	c.(838-840)cGc>cAc	p.R280H	WBSCR22_ENST00000423497.1_Missense_Mutation_p.R297H|WBSCR22_ENST00000423166.2_Intron|STX1A_ENST00000484736.1_5'Flank	NM_017528.4	NP_059998.2	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22	280					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|large_intestine(2)|lung(9)|prostate(1)	13		Lung NSC(55;0.0908)|all_lung(88;0.198)				CGCAAGCCCCGCTTCTAAGTC	0.458																																																	0								ENSG00000071462						53.0	56.0	55.0					7																	73112209		2203	4300	6503	WBSCR22	SO:0001583	missense	0			-	HGNC	AF420248	CCDS5557.1, CCDS56490.1	7q11.23	2012-06-12			ENSG00000071462	ENSG00000071462			16405	protein-coding gene	gene with protein product	"""metastasis-related methyltransferase 1"""	615733				12073013, 11978965, 21148752	Standard	NM_001202560		Approved	MGC19709, MGC2022, MGC5140, PP3381, WBMT, MERM1	uc003tyt.3	O43709	OTTHUMG00000023306	ENST00000265758.2:c.839G>A	7.37:g.73112209G>A	ENSP00000265758:p.Arg280His	Somatic	0	132	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	77	26.67	A8K501|C9K060|Q96P12|Q9BQ58|Q9HBP9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Unchr_MeTrfase_Williams-Beuren,pfam_Methyltransf_11	p.R280H	ENST00000265758.2	37	c.839	CCDS5557.1	7	.	.	.	.	.	.	.	.	.	.	G	14.25	2.478176	0.44044	.	.	ENSG00000071462	ENST00000265758;ENST00000423497	T;T	0.48522	0.83;0.81	6.08	0.183	0.15082	.	0.582707	0.18861	N	0.129124	T	0.40570	0.1122	L	0.60455	1.87	0.80722	D	1	B;B	0.25312	0.123;0.018	B;B	0.24394	0.053;0.036	T	0.28138	-1.0053	10	0.48119	T	0.1	-20.5154	9.7358	0.40386	0.5069:0.0:0.4931:0.0	.	297;280	C9K060;O43709	.;WBS22_HUMAN	H	280;297	ENSP00000265758:R280H;ENSP00000401191:R297H	ENSP00000265758:R280H	R	+	2	0	WBSCR22	72750145	0.011000	0.17503	0.994000	0.49952	0.617000	0.37484	-0.049000	0.11924	0.093000	0.17368	0.655000	0.94253	CGC	-	pfam_Unchr_MeTrfase_Williams-Beuren		0.458	WBSCR22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR22	protein_coding	OTTHUMT00000252303.1	G		-		73112209	+1	no_errors	ENST00000265758	ensembl	human	known	74_37	missense	SNP	0.997	A
MS4A14	84689	genome.wustl.edu	37	11	60183891	60183891	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr11:60183891A>G	ENST00000300187.6	+	5	1727	c.1450A>G	c.(1450-1452)Aga>Gga	p.R484G	MS4A14_ENST00000395005.2_Missense_Mutation_p.R467G|MS4A14_ENST00000531787.1_Missense_Mutation_p.R372G|MS4A14_ENST00000531783.1_Missense_Mutation_p.R517G	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	484	Gln-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						AAAATCCTCAAGACGGCATTC	0.393																																																	0								ENSG00000166928						80.0	82.0	81.0					11																	60183891		2203	4300	6503	MS4A14	SO:0001583	missense	0			-	HGNC	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.1450A>G	11.37:g.60183891A>G	ENSP00000300187:p.Arg484Gly	Somatic	0	20	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	9	66.67	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD20-like	p.R484G	ENST00000300187.6	37	c.1450	CCDS31569.1	11	.	.	.	.	.	.	.	.	.	.	A	12.73	2.024721	0.35701	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	T;T;T;T	0.38560	1.13;2.31;1.13;2.69	4.13	1.77	0.24775	.	2.940030	0.01067	N	0.004746	T	0.39145	0.1067	L	0.52573	1.65	0.09310	N	1	P;P	0.50819	0.939;0.9	B;B	0.42916	0.402;0.227	T	0.26155	-1.0111	10	0.51188	T	0.08	-1.0233	2.7685	0.05328	0.6562:0.0:0.1193:0.2245	.	467;484	Q96JA4-2;Q96JA4	.;M4A14_HUMAN	G	372;484;467;517	ENSP00000437222:R372G;ENSP00000300187:R484G;ENSP00000378453:R467G;ENSP00000433761:R517G	ENSP00000300187:R484G	R	+	1	2	MS4A14	59940467	0.003000	0.15002	0.002000	0.10522	0.004000	0.04260	1.517000	0.35867	0.667000	0.31107	0.528000	0.53228	AGA	-	NULL		0.393	MS4A14-002	KNOWN	basic|CCDS	protein_coding	MS4A14	protein_coding	OTTHUMT00000395383.2	A		-		60183891	+1	no_errors	ENST00000300187	ensembl	human	known	74_37	missense	SNP	0.000	G
ETV2	2116	genome.wustl.edu	37	19	36133568	36133568	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr19:36133568C>T	ENST00000403402.1	+	2	428	c.122C>T	c.(121-123)aCg>aTg	p.T41M	ETV2_ENST00000402764.2_Missense_Mutation_p.T41M|ETV2_ENST00000479824.1_5'UTR|ETV2_ENST00000379023.4_Missense_Mutation_p.T41M|ETV2_ENST00000379026.2_Missense_Mutation_p.T69M			O00321	ETV2_HUMAN	ets variant 2	41					blastocyst development (GO:0001824)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway involved in mesodermal cell fate specification (GO:0060803)|cell differentiation (GO:0030154)|erythrocyte differentiation (GO:0030218)|Notch signaling pathway (GO:0007219)|placenta development (GO:0001890)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of mesoderm development (GO:2000382)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			lung(2)	2	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAAGGGGACACGCCGACAGCG	0.612																																																	0								ENSG00000105672						38.0	28.0	31.0					19																	36133568		2203	4300	6503	ETV2	SO:0001583	missense	0			-	HGNC	AF000671	CCDS32995.2, CCDS74341.1	19q13.11	2008-09-12	2008-09-12		ENSG00000105672	ENSG00000105672			3491	protein-coding gene	gene with protein product		609358	"""ets variant gene 2"""			1340465	Standard	XM_005258654		Approved	ER71	uc002oar.2	O00321	OTTHUMG00000150545	ENST00000403402.1:c.122C>T	19.37:g.36133568C>T	ENSP00000385369:p.Thr41Met	Somatic	0	84	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A6NFN5|B3KUL0|B9EIN1|Q9UEA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ets_dom,smart_Ets_dom,prints_Ets_dom,pfscan_Ets_dom	p.T41M	ENST00000403402.1	37	c.122	CCDS32995.2	19	.	.	.	.	.	.	.	.	.	.	c	14.23	2.472351	0.43942	.	.	ENSG00000105672	ENST00000379026;ENST00000402764;ENST00000412475;ENST00000379023;ENST00000379021;ENST00000403402	T;T;T;T	0.19938	2.11;2.12;2.55;2.12	4.16	3.13	0.36017	.	984.407000	0.00166	N	0.000000	T	0.26304	0.0642	N	0.14661	0.345	0.09310	N	0.999997	B;D;P	0.76494	0.011;0.999;0.458	B;P;B	0.56088	0.001;0.791;0.025	T	0.30446	-0.9978	10	0.87932	D	0	.	7.9093	0.29780	0.0:0.8856:0.0:0.1144	.	41;69;41	Q3KNT2;A6NFN5;B9EIN1	.;.;.	M	69;41;41;41;41;41	ENSP00000368312:T69M;ENSP00000384524:T41M;ENSP00000368309:T41M;ENSP00000385369:T41M	ENSP00000368307:T41M	T	+	2	0	ETV2	40825408	0.000000	0.05858	0.481000	0.27354	0.213000	0.24496	-0.207000	0.09384	1.103000	0.41568	-0.447000	0.05616	ACG	-	NULL		0.612	ETV2-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ETV2	protein_coding	OTTHUMT00000318848.2	C	XM_209182	-		36133568	+1	no_errors	ENST00000402764	ensembl	human	known	74_37	missense	SNP	0.374	T
ALG14	199857	genome.wustl.edu	37	1	95492733	95492733	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:95492733G>T	ENST00000370205.5	-	3	418	c.372C>A	c.(370-372)caC>caA	p.H124Q		NM_144988.3	NP_659425.1	Q96F25	ALG14_HUMAN	ALG14, UDP-N-acetylglucosaminyltransferase subunit	124					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	6		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.0615)|Epithelial(280;0.139)		GCCACATGGAGTGCAAGGTGG	0.473																																																	0								ENSG00000172339						91.0	86.0	88.0					1																	95492733		2203	4300	6503	ALG14	SO:0001583	missense	0			-	HGNC		CCDS752.1	1p21.3	2013-02-21	2013-02-21		ENSG00000172339	ENSG00000172339			28287	protein-coding gene	gene with protein product		612866	"""asparagine-linked glycosylation 14 homolog (yeast)"", ""asparagine-linked glycosylation 14 homolog (S. cerevisiae)"""			15615718	Standard	NM_144988		Approved	MGC19780	uc001dra.2	Q96F25	OTTHUMG00000010781	ENST00000370205.5:c.372C>A	1.37:g.95492733G>T	ENSP00000359224:p.His124Gln	Somatic	0	84	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A8K030	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Oligosacch_biosynth_Alg14	p.H124Q	ENST00000370205.5	37	c.372	CCDS752.1	1	.	.	.	.	.	.	.	.	.	.	G	10.23	1.292303	0.23564	.	.	ENSG00000172339	ENST00000370205	T	0.75938	-0.98	5.49	1.41	0.22369	.	0.484667	0.22602	N	0.057947	T	0.27205	0.0667	N	0.10837	0.055	0.21256	N	0.999744	B	0.13145	0.007	B	0.06405	0.002	T	0.21965	-1.0230	10	0.29301	T	0.29	-0.0014	5.0344	0.14426	0.318:0.1525:0.5295:0.0	.	124	Q96F25	ALG14_HUMAN	Q	124	ENSP00000359224:H124Q	ENSP00000359224:H124Q	H	-	3	2	ALG14	95265321	1.000000	0.71417	0.349000	0.25694	0.506000	0.33950	0.654000	0.24918	0.361000	0.24292	0.591000	0.81541	CAC	-	pfam_Oligosacch_biosynth_Alg14		0.473	ALG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG14	protein_coding	OTTHUMT00000029699.2	G	NM_144988	-		95492733	-1	no_errors	ENST00000370205	ensembl	human	known	74_37	missense	SNP	0.652	T
ARV1	64801	genome.wustl.edu	37	1	231115061	231115061	+	Intron	SNP	A	A	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr1:231115061A>G	ENST00000310256.2	+	1	231				TTC13_ENST00000414259.1_5'Flank|ARV1_ENST00000497753.1_3'UTR|TTC13_ENST00000366661.4_5'Flank|TTC13_ENST00000366662.4_5'Flank|ARV1_ENST00000366658.2_Intron	NM_022786.1	NP_073623.1	Q9H2C2	ARV1_HUMAN	ARV1 homolog (S. cerevisiae)						bile acid metabolic process (GO:0008206)|cholesterol transport (GO:0030301)|regulation of cholesterol metabolic process (GO:0090181)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|large_intestine(2)|lung(2)	7	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)		TTGAGAAGAAAATGGCGCGGC	0.532																																																	0								ENSG00000173409						57.0	67.0	63.0					1																	231115061		2203	4300	6503	ARV1	SO:0001627	intron_variant	0			-	HGNC	AF271780	CCDS1589.1	1q42.2	2014-02-03	2006-04-04		ENSG00000173409	ENSG00000173409			29561	protein-coding gene	gene with protein product		611647	"""ARV1 homolog (yeast)"""			11063737, 12145310, 20663892	Standard	NM_022786		Approved		uc001huh.3	Q9H2C2	OTTHUMG00000037837	ENST00000310256.2:c.174+36A>G	1.37:g.231115061A>G		Somatic	0	39	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	7	66.67	A8KAI4|Q5VSN7|Q5VSN8|Q5VSN9|Q5VSP0|Q5VSP2|Q9H2H2|Q9H5V6|Q9UFF5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000310256.2	37	NULL	CCDS1589.1	1																																																																																			-	-		0.532	ARV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARV1	protein_coding	OTTHUMT00000092362.2	A	NM_022786	-		231115061	+1	no_errors	ENST00000497753	ensembl	human	known	74_37	rna	SNP	0.002	G
SLC26A4	5172	genome.wustl.edu	37	7	107330649	107330649	+	Silent	SNP	G	G	A	rs371756312		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr7:107330649G>A	ENST00000265715.3	+	10	1454	c.1230G>A	c.(1228-1230)acG>acA	p.T410T	SLC26A4_ENST00000541474.1_5'Flank|SLC26A4_ENST00000544569.1_5'Flank	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	410			T -> M (in DFNB4 and PDS; fails to localize to cell membrane; abolishes iodide transport). {ECO:0000269|PubMed:10700480, ECO:0000269|PubMed:11748854, ECO:0000269|PubMed:11919333, ECO:0000269|PubMed:12676893, ECO:0000269|PubMed:14679580, ECO:0000269|PubMed:15355436, ECO:0000269|PubMed:9618167}.		chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						TTTCCCGCACGGCCGTCCAGG	0.493									Pendred syndrome																																								0								ENSG00000091137						131.0	121.0	124.0					7																	107330649		2203	4300	6503	SLC26A4	SO:0001819	synonymous_variant	0	Familial Cancer Database	Goiter-Deafness syndrome	-	HGNC	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.1230G>A	7.37:g.107330649G>A		Somatic	0	34	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	12	47.83	B7Z266|O43170	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.T410	ENST00000265715.3	37	c.1230	CCDS5746.1	7																																																																																			-	pfam_Sulph_transpt,tigrfam_SulP_transpt		0.493	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A4	protein_coding	OTTHUMT00000337148.1	G	NM_000441	-		107330649	+1	no_errors	ENST00000265715	ensembl	human	known	74_37	silent	SNP	0.001	A
ACAN	176	genome.wustl.edu	37	15	89381937	89381937	+	Silent	SNP	G	G	A	rs367956651		TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr15:89381937G>A	ENST00000561243.1	+	2	114	c.114G>A	c.(112-114)ccG>ccA	p.P38P	ACAN_ENST00000559004.1_Silent_p.P38P|ACAN_ENST00000352105.7_Silent_p.P38P|ACAN_ENST00000439576.2_Silent_p.P38P|ACAN_ENST00000558207.1_Silent_p.P38P			P16112	PGCA_HUMAN	aggrecan	38	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AACCGTCCCCGCTGAGGGTCC	0.622																																																	0								ENSG00000157766	A	,	3,4007		0,3,2002	107.0	117.0	114.0		114,114	-9.9	0.0	15		114	0,8328		0,0,4164	no	coding-synonymous,coding-synonymous	ACAN	NM_001135.3,NM_013227.3	,	0,3,6166	AA,AG,GG		0.0,0.0748,0.0243	,	38/2432,38/2531	89381937	3,12335	2005	4164	6169	ACAN	SO:0001819	synonymous_variant	0			-	HGNC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.114G>A	15.37:g.89381937G>A		Somatic	0	88	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	30	21.05	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.P38	ENST00000561243.1	37	c.114	CCDS53970.1	15																																																																																			-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom		0.622	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	protein_coding	OTTHUMT00000416267.2	G	NM_001135	-		89381937	+1	no_errors	ENST00000439576	ensembl	human	known	74_37	silent	SNP	0.000	A
HIPK4	147746	genome.wustl.edu	37	19	40890005	40890005	+	Silent	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr19:40890005G>T	ENST00000291823.2	-	2	791	c.507C>A	c.(505-507)cgC>cgA	p.R169R		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	169	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			CCTTCACGTAGCGCACCTCGC	0.637																																																	0								ENSG00000160396						60.0	58.0	59.0					19																	40890005		2203	4300	6503	HIPK4	SO:0001819	synonymous_variant	0			-	HGNC	BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.507C>A	19.37:g.40890005G>T		Somatic	0	49	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	A8K863|Q96M54	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R169	ENST00000291823.2	37	c.507	CCDS12555.1	19																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.637	HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIPK4	protein_coding	OTTHUMT00000462593.1	G	NM_144685	-		40890005	-1	no_errors	ENST00000291823	ensembl	human	known	74_37	silent	SNP	0.994	T
CHD3	1107	genome.wustl.edu	37	17	7809530	7809530	+	Intron	SNP	G	G	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr17:7809530G>T	ENST00000330494.7	+	28	4508				CHD3_ENST00000380358.4_Intron|SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000358181.4_Intron	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3						centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CCCCAGGGGAGGGGCGTTGAA	0.597																																																	0								ENSG00000252835						51.0	49.0	50.0					17																	7809530		876	1991	2867	SCARNA21	SO:0001627	intron_variant	0			-	HGNC	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4358+223G>T	17.37:g.7809530G>T		Somatic	0	43	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	D3DTQ9|E9PG89|Q9Y4I0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000330494.7	37	NULL	CCDS32554.1	17																																																																																			-	-		0.597	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCARNA21	protein_coding	OTTHUMT00000318050.1	G	NM_001005273	-		7809530	+1	no_errors	ENST00000517026	ensembl	human	known	74_37	rna	SNP	0.074	T
NF1	4763	genome.wustl.edu	37	17	29664854	29664854	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr17:29664854T>G	ENST00000358273.4	+	44	7043	c.6660T>G	c.(6658-6660)atT>atG	p.I2220M	NF1_ENST00000417592.2_Missense_Mutation_p.S6A|NF1_ENST00000444181.2_Missense_Mutation_p.S6A|NF1_ENST00000356175.3_Missense_Mutation_p.I2199M	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2220					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TGAGAGATATTCCAACGTGCA	0.313			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)						ENSG00000196712						71.0	71.0	71.0					17																	29664854		2202	4300	6502	NF1	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome	-	HGNC		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.6660T>G	17.37:g.29664854T>G	ENSP00000351015:p.Ile2220Met	Somatic	0	67	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	14	63.16	O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.I2220M	ENST00000358273.4	37	c.6660	CCDS42292.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.26|13.26	2.184987|2.184987	0.38609|0.38609	.|.	.|.	ENSG00000196712|ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735|ENST00000444181;ENST00000417592	T;T;T|T	0.34275|0.44083	1.37;1.37;1.37|0.93	5.65|5.65	3.42|3.42	0.39159|0.39159	Armadillo-type fold (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.44477|0.44477	0.1295|0.1295	L|L	0.52573|0.52573	1.65|1.65	0.22142|0.22142	N|N	0.999338|0.999338	D;P|.	0.60575|.	0.988;0.459|.	D;B|.	0.72338|.	0.977;0.358|.	T|T	0.36212|0.36212	-0.9757|-0.9757	10|7	0.46703|0.72032	T|D	0.11|0.01	.|.	8.5992|8.5992	0.33734|0.33734	0.0:0.2732:0.0:0.7268|0.0:0.2732:0.0:0.7268	.|.	2199;2220|.	P21359-2;P21359|.	.;NF1_HUMAN|.	M|A	2220;2199;1865|6	ENSP00000351015:I2220M;ENSP00000348498:I2199M;ENSP00000389907:I1865M|ENSP00000396481:S6A	ENSP00000348498:I2199M|ENSP00000398991:S6A	I|S	+|+	3|1	3|0	NF1|NF1	26688980|26688980	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	1.401000|1.401000	0.34589|0.34589	1.081000|1.081000	0.41110|0.41110	0.460000|0.460000	0.39030|0.39030	ATT|TCC	-	superfamily_ARM-type_fold		0.313	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	protein_coding	OTTHUMT00000256351.2	T	NM_000267	-		29664854	+1	no_errors	ENST00000358273	ensembl	human	known	74_37	missense	SNP	1.000	G
CXorf22	170063	genome.wustl.edu	37	X	35937998	35937998	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:35937998C>A	ENST00000297866.5	+	1	148	c.82C>A	c.(82-84)Ccc>Acc	p.P28T		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	28										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TTCCCTCGTCCCCCGGGATAT	0.612																																																	0								ENSG00000165164						52.0	41.0	45.0					X																	35937998		2202	4300	6502	CXorf22	SO:0001583	missense	0			-	HGNC	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.82C>A	X.37:g.35937998C>A	ENSP00000297866:p.Pro28Thr	Somatic	0	127	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	48	54.72	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PapD-like	p.P28T	ENST00000297866.5	37	c.82	CCDS14237.2	X	.	.	.	.	.	.	.	.	.	.	C	9.710	1.156820	0.21454	.	.	ENSG00000165164	ENST00000297866	T	0.14640	2.49	4.81	0.774	0.18521	.	1.194060	0.06213	N	0.685432	T	0.15522	0.0374	L	0.57536	1.79	0.09310	N	1	B	0.22414	0.069	B	0.30029	0.11	T	0.40194	-0.9576	10	0.39692	T	0.17	-37.141	3.3823	0.07259	0.1312:0.5508:0.1408:0.1772	.	28	Q6ZTR5	CX022_HUMAN	T	28	ENSP00000297866:P28T	ENSP00000297866:P28T	P	+	1	0	CXorf22	35847919	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.388000	0.07352	-0.518000	0.06452	-1.231000	0.01572	CCC	-	NULL		0.612	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	protein_coding	OTTHUMT00000056216.2	C	NM_152632	-		35937998	+1	no_errors	ENST00000297866	ensembl	human	known	74_37	missense	SNP	0.000	A
TMF1	7110	genome.wustl.edu	37	3	69087758	69087758	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr3:69087758G>A	ENST00000398559.2	-	8	2324	c.2108C>T	c.(2107-2109)gCc>gTc	p.A703V	TMF1_ENST00000543976.1_Missense_Mutation_p.A706V|CTD-2013N24.2_ENST00000595925.1_RNA|CTD-2013N24.2_ENST00000596274.1_RNA|CTD-2013N24.2_ENST00000596523.1_RNA|CTD-2013N24.2_ENST00000482368.2_RNA|CTD-2013N24.2_ENST00000598783.1_RNA|CTD-2013N24.2_ENST00000596732.1_RNA|CTD-2013N24.2_ENST00000601735.1_RNA|CTD-2013N24.2_ENST00000597950.1_RNA			P82094	TMF1_HUMAN	TATA element modulatory factor 1	703					acrosome assembly (GO:0001675)|cellular response to organic cyclic compound (GO:0071407)|defense response to bacterium (GO:0042742)|Leydig cell differentiation (GO:0033327)|luteinizing hormone secretion (GO:0032275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|positive regulation of cytokine production (GO:0001819)|positive regulation of testosterone secretion (GO:2000845)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of transcription, DNA-templated (GO:0006355)|sperm motility (GO:0030317)|spermatid nucleus differentiation (GO:0007289)|transcription from RNA polymerase II promoter (GO:0006366)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription cofactor activity (GO:0003712)			cervix(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		TTCTTCTTGGGCCTTCTCTAA	0.408																																																	0								ENSG00000144747						132.0	118.0	122.0					3																	69087758		1878	4113	5991	TMF1	SO:0001583	missense	0			-	HGNC		CCDS43105.1	3p21-p12	2009-02-11			ENSG00000144747	ENSG00000144747			11870	protein-coding gene	gene with protein product		601126				1409643	Standard	NM_007114		Approved	ARA160, TMF	uc003dnn.3	P82094	OTTHUMG00000158771	ENST00000398559.2:c.2108C>T	3.37:g.69087758G>A	ENSP00000381567:p.Ala703Val	Somatic	0	100	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B7ZLJ2|Q17R87|Q59GK0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TMF_TATA-bd,pfam_TMF_DNA-bd	p.A706V	ENST00000398559.2	37	c.2117	CCDS43105.1	3	.	.	.	.	.	.	.	.	.	.	G	11.38	1.622671	0.28889	.	.	ENSG00000144747	ENST00000398559;ENST00000543976;ENST00000356248	T;T	0.20069	2.1;2.1	5.72	2.68	0.31781	.	0.202373	0.51477	N	0.000084	T	0.15696	0.0378	L	0.38838	1.175	0.47245	D	0.999369	B;B	0.15473	0.013;0.001	B;B	0.15484	0.013;0.004	T	0.06463	-1.0825	10	0.34782	T	0.22	1.2642	9.5589	0.39357	0.2483:0.0:0.7517:0.0	.	706;703	P82094-2;P82094	.;TMF1_HUMAN	V	703;706;619	ENSP00000381567:A703V;ENSP00000438706:A706V	ENSP00000348582:A619V	A	-	2	0	TMF1	69170448	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	3.933000	0.56545	0.224000	0.20940	0.591000	0.81541	GCC	-	NULL		0.408	TMF1-001	KNOWN	basic|CCDS	protein_coding	TMF1	protein_coding	OTTHUMT00000352106.1	G	NM_007114	-		69087758	-1	no_errors	ENST00000543976	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM47B	170062	genome.wustl.edu	37	X	34962204	34962204	+	Missense_Mutation	SNP	G	G	A	rs146264202	byFrequency	TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:34962204G>A	ENST00000329357.5	+	1	1292	c.1256G>A	c.(1255-1257)cGg>cAg	p.R419Q		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	419										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						AAGACTCGTCGGGTGTCCAGT	0.562																																																	0								ENSG00000189132						69.0	62.0	65.0					X																	34962204		2202	4300	6502	FAM47B	SO:0001583	missense	0			-	HGNC	BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1256G>A	X.37:g.34962204G>A	ENSP00000328307:p.Arg419Gln	Somatic	0	94	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	49	44.32	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R419Q	ENST00000329357.5	37	c.1256	CCDS14236.1	X	.	.	.	.	.	.	.	.	.	.	G	4.508	0.094292	0.08632	.	.	ENSG00000189132	ENST00000329357	T	0.15487	2.42	0.158	0.158	0.14942	.	.	.	.	.	T	0.11665	0.0284	L	0.47716	1.5	0.09310	N	1	B	0.26258	0.145	B	0.13407	0.009	T	0.37220	-0.9715	8	0.14252	T	0.57	.	.	.	.	.	419	Q8NA70	FA47B_HUMAN	Q	419	ENSP00000328307:R419Q	ENSP00000328307:R419Q	R	+	2	0	FAM47B	34872125	0.021000	0.18746	0.001000	0.08648	0.002000	0.02628	0.287000	0.18920	0.187000	0.20147	0.190000	0.17370	CGG	-	NULL		0.562	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47B	protein_coding	OTTHUMT00000056211.1	G	NM_152631	-		34962204	+1	no_errors	ENST00000329357	ensembl	human	known	74_37	missense	SNP	0.001	A
LMO7	4008	genome.wustl.edu	37	13	76429454	76429454	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr13:76429454G>A	ENST00000321797.8	+	27	4742	c.4021G>A	c.(4021-4023)Gcc>Acc	p.A1341T	LMO7_ENST00000357063.3_Intron|LMO7_ENST00000526202.1_Missense_Mutation_p.A1218T|LMO7_ENST00000377534.3_Intron|LMO7_ENST00000465261.2_Intron|LMO7_ENST00000341547.4_Missense_Mutation_p.A1292T			Q8WWI1	LMO7_HUMAN	LIM domain 7	1626					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CAAAGGAGCCGCCATGATCAT	0.488																																																	0								ENSG00000136153						152.0	127.0	136.0					13																	76429454		2203	4300	6503	LMO7	SO:0001583	missense	0			-	HGNC	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.4021G>A	13.37:g.76429454G>A	ENSP00000317802:p.Ala1341Thr	Somatic	0	69	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_PDZ,pfam_Znf_LIM,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,pfscan_PDZ,prints_SM22_calponin	p.A1292T	ENST00000321797.8	37	c.3874		13	.	.	.	.	.	.	.	.	.	.	G	36	5.940733	0.97128	.	.	ENSG00000136153	ENST00000341547;ENST00000321797;ENST00000526202	D;D;D	0.87334	-2.24;-2.24;-2.24	5.99	5.99	0.97316	.	0.051380	0.85682	D	0.000000	D	0.94801	0.8321	M	0.86864	2.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.94700	0.7882	10	0.87932	D	0	-15.5751	20.4777	0.99188	0.0:0.0:1.0:0.0	.	1218;1292	E9PMS6;Q8WWI1-3	.;.	T	1292;1341;1218	ENSP00000342112:A1292T;ENSP00000317802:A1341T;ENSP00000431129:A1218T	ENSP00000317802:A1341T	A	+	1	0	LMO7	75327455	1.000000	0.71417	0.983000	0.44433	0.997000	0.91878	9.476000	0.97823	2.840000	0.97914	0.655000	0.94253	GCC	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.488	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	LMO7	protein_coding	OTTHUMT00000045301.3	G	NM_005358	-		76429454	+1	no_errors	ENST00000341547	ensembl	human	known	74_37	missense	SNP	1.000	A
SYTL4	94121	genome.wustl.edu	37	X	99934327	99934327	+	Silent	SNP	T	T	C			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chrX:99934327T>C	ENST00000372989.1	-	17	1972	c.1641A>G	c.(1639-1641)tcA>tcG	p.S547S	SYTL4_ENST00000276141.6_Silent_p.S547S|SYTL4_ENST00000455616.1_Silent_p.S547S|SYTL4_ENST00000491602.1_5'Flank|SYTL4_ENST00000454200.2_Silent_p.S549S|SYTL4_ENST00000263033.5_Silent_p.S547S	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	547	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CAAAGCTGTCTGAAGTCCCTC	0.488																																																	0								ENSG00000102362						122.0	89.0	100.0					X																	99934327		2203	4300	6503	SYTL4	SO:0001819	synonymous_variant	0			-	HGNC		CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.1641A>G	X.37:g.99934327T>C		Somatic	0	72	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ,prints_Synaptotagmin	p.S549	ENST00000372989.1	37	c.1647	CCDS14472.1	X																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.488	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL4	protein_coding	OTTHUMT00000057488.1	T	NM_080737	-		99934327	-1	no_errors	ENST00000454200	ensembl	human	known	74_37	silent	SNP	0.982	C
NEU4	129807	genome.wustl.edu	37	2	242756292	242756292	+	Silent	SNP	G	G	A	rs367892217	byFrequency	TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr2:242756292G>A	ENST00000391969.2	+	4	1116	c.405G>A	c.(403-405)tcG>tcA	p.S135S	NEU4_ENST00000325935.6_Silent_p.S148S|NEU4_ENST00000404257.1_Silent_p.S147S|NEU4_ENST00000407683.1_Silent_p.S135S|NEU4_ENST00000405370.1_Silent_p.S135S	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	135					ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		CCGGCCTCTCGTGGGGCAGCG	0.721													G|||	5	0.000998403	0.003	0.0014	5008	,	,		12955	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000204099	G	,,,,	12,4106		0,12,2047	6.0	7.0	7.0		444,405,405,405,441	-3.2	0.0	2		7	0,8142		0,0,4071	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NEU4	NM_001167599.1,NM_001167600.1,NM_001167601.1,NM_001167602.1,NM_080741.2	,,,,	0,12,6118	AA,AG,GG		0.0,0.2914,0.0979	,,,,	148/498,135/485,135/485,135/485,147/497	242756292	12,12248	2059	4071	6130	NEU4	SO:0001819	synonymous_variant	0			-	HGNC	BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.405G>A	2.37:g.242756292G>A		Somatic	0	105	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	28	24.32	A8K056|J3KNJ5|Q96D64	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Sialidases	p.S148	ENST00000391969.2	37	c.444	CCDS54442.1	2																																																																																			-	superfamily_Sialidases		0.721	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NEU4	protein_coding	OTTHUMT00000257270.2	G	NM_080741	-		242756292	+1	no_errors	ENST00000325935	ensembl	human	known	74_37	silent	SNP	0.943	A
TRPA1	8989	genome.wustl.edu	37	8	72975032	72975032	+	Splice_Site	SNP	A	A	T			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr8:72975032A>T	ENST00000262209.4	-	6	1015		c.e6+1			NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1						calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	ATGAAGAGTTACCTCCACTGG	0.363																																																	0								ENSG00000104321						115.0	107.0	110.0					8																	72975032		2203	4300	6503	TRPA1	SO:0001630	splice_region_variant	0			-	HGNC	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.807+1T>A	8.37:g.72975032A>T		Somatic	0	52	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	54	27.03	A6NIN6	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6+2	ENST00000262209.4	37	c.807+2	CCDS34908.1	8	.	.	.	.	.	.	.	.	.	.	A	10.02	1.235463	0.22626	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	.	.	.	5.62	4.43	0.53597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8246	0.52259	0.9304:0.0:0.0696:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRPA1	73137586	1.000000	0.71417	0.803000	0.32268	0.071000	0.16799	5.143000	0.64826	0.909000	0.36697	0.528000	0.53228	.	-	-		0.363	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	protein_coding	OTTHUMT00000379079.2	A	NM_007332	-	Intron	72975032	-1	no_errors	ENST00000262209	ensembl	human	known	74_37	splice_site	SNP	0.998	T
TTC21A	199223	genome.wustl.edu	37	3	39170278	39170278	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr3:39170278delC	ENST00000431162.2	+	14	1906	c.1772delC	c.(1771-1773)gccfs	p.A591fs	TTC21A_ENST00000440121.1_Frame_Shift_Del_p.A543fs|TTC21A_ENST00000301819.6_Frame_Shift_Del_p.A592fs			Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A	591										NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(23)|ovary(1)|prostate(1)|skin(3)	50				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		TATCCAGAGGCCATAAAGACG	0.567																																																	0								ENSG00000168026						126.0	127.0	127.0					3																	39170278		1945	4142	6087	TTC21A	SO:0001589	frameshift_variant	0				HGNC	AJ487015	CCDS43068.1, CCDS46800.1, CCDS43068.2	3p22.2	2014-09-04			ENSG00000168026	ENSG00000168026		"""Tetratricopeptide (TTC) repeat domain containing"""	30761	protein-coding gene	gene with protein product		611430					Standard	NM_145755		Approved	STI2	uc003cjc.2	Q8NDW8	OTTHUMG00000155973	ENST00000431162.2:c.1772delC	3.37:g.39170278delC	ENSP00000398211:p.Ala591fs	Somatic	0	42	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	A1L388|B4DYF6|B4DYJ3|D3YTE7|D4PHA5|Q6P5W8|Q8N7G5|Q8NA02	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I593fs	ENST00000431162.2	37	c.1775	CCDS46800.1	3																																																																																			-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.567	TTC21A-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC21A	protein_coding	OTTHUMT00000377829.1	C	NM_145755			39170278	+1	no_errors	ENST00000301819	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PFKP	5214	genome.wustl.edu	37	10	3143147	3143147	+	Intron	SNP	C	C	A			TCGA-DX-AB2X-01A-11D-A387-09	TCGA-DX-AB2X-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e974c2c7-3bb3-487c-b408-70d51608c374	afa3e1cd-afd2-4a98-bdc9-f6ae7beb9855	g.chr10:3143147C>A	ENST00000381125.4	+	4	340				PFKP_ENST00000421751.1_Intron|PFKP_ENST00000381075.2_Silent_p.G65G	NM_002627.4	NP_002618.1	Q01813	PFKAP_HUMAN	phosphofructokinase, platelet						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein complex binding (GO:0032403)			breast(2)|central_nervous_system(4)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)		AGAAGCCTGGCTGCTGGTCAC	0.557																																																	0								ENSG00000067057						120.0	112.0	114.0					10																	3143147		876	1991	2867	PFKP	SO:0001627	intron_variant	0			-	HGNC	AK092597	CCDS7059.1, CCDS55698.1	10p15.3-p15.2	2006-08-25			ENSG00000067057	ENSG00000067057	2.7.1.11		8878	protein-coding gene	gene with protein product	"""Phosphofructokinase, platelet type"""	171840					Standard	NM_002627		Approved	PFK-C, PFKF	uc001igp.3	Q01813	OTTHUMG00000017556	ENST00000381125.4:c.265-410C>A	10.37:g.3143147C>A		Somatic	0	123	0.00		0.7021573068696856	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	B3KS15|Q5VSR7|Q5VSR8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.G65	ENST00000381125.4	37	c.195	CCDS7059.1	10																																																																																			-	pirsf_6-phosphofructokinase_euk		0.557	PFKP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKP	protein_coding	OTTHUMT00000046454.1	C	NM_002627	-		3143147	+1	no_errors	ENST00000381075	ensembl	human	known	74_37	silent	SNP	0.000	A
