#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TMEM131	23505	genome.wustl.edu	37	2	98408981	98408981	+	Missense_Mutation	SNP	C	C	T	rs375503219		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr2:98408981C>T	ENST00000186436.5	-	31	4240	c.4012G>A	c.(4012-4014)Gcg>Acg	p.A1338T		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1338						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						CTGTGCCTCGCGCTGCTGGCA	0.617																																																	0								ENSG00000075568						40.0	42.0	41.0					2																	98408981		2054	4207	6261	TMEM131	SO:0001583	missense	0			-	HGNC	AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.4012G>A	2.37:g.98408981C>T	ENSP00000186436:p.Ala1338Thr	Somatic	0	51	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	39	23.53		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3651_TMEM131	p.A1338T	ENST00000186436.5	37	c.4012	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	T	7.196	0.592542	0.13875	.	.	ENSG00000075568	ENST00000186436	T	0.15603	2.41	5.91	1.95	0.26073	.	0.703847	0.14397	N	0.322175	T	0.06735	0.0172	N	0.14661	0.345	0.25668	N	0.985922	B	0.02656	0.0	B	0.01281	0.0	T	0.40739	-0.9547	10	0.05959	T	0.93	-5.3888	3.4174	0.07381	0.1178:0.1344:0.1095:0.6383	.	1338	Q92545	TM131_HUMAN	T	1338	ENSP00000186436:A1338T	ENSP00000186436:A1338T	A	-	1	0	TMEM131	97775413	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.072000	0.30678	0.465000	0.27167	-0.254000	0.11334	GCG	-	NULL		0.617	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	protein_coding	OTTHUMT00000329285.2	C	XM_371542	-		98408981	-1	no_errors	ENST00000186436	ensembl	human	known	74_37	missense	SNP	0.078	T
PLBD1	79887	genome.wustl.edu	37	12	14720555	14720557	+	In_Frame_Del	DEL	GCA	GCA	-	rs71669631|rs149862451|rs147342083		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr12:14720555_14720557delGCA	ENST00000240617.5	-	1	726_728	c.74_76delTGC	c.(73-78)ctgccg>ccg	p.L25del	RP11-695J4.2_ENST00000545424.1_RNA|RP11-695J4.2_ENST00000542401.1_RNA	NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	25					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						AAcaacagcggcagcagcagcag	0.744																																																	0								ENSG00000121316																																			PLBD1	SO:0001651	inframe_deletion	0				HGNC	BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.74_76delTGC	12.37:g.14720564_14720566delGCA	ENSP00000240617:p.Leu25del	Somatic	0	10	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	A8K4E9|Q9BVV3|Q9H625	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PLipase_B-like	p.L25in_frame_del	ENST00000240617.5	37	c.76_74	CCDS31751.1	12																																																																																			-	NULL		0.744	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD1	protein_coding	OTTHUMT00000401203.1	GCA	NM_024829			14720557	-1	no_errors	ENST00000240617	ensembl	human	known	74_37	in_frame_del	DEL	0.009:0.005:0.008	-
ZNF772	400720	genome.wustl.edu	37	19	57985781	57985781	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:57985781G>T	ENST00000343280.4	-	5	591	c.331C>A	c.(331-333)Cat>Aat	p.H111N	AC004076.9_ENST00000415705.3_Intron|ZNF772_ENST00000427512.2_5'UTR|ZNF772_ENST00000425074.3_Silent_p.G27G|ZNF772_ENST00000356584.3_Missense_Mutation_p.H70N|ZNF772_ENST00000600175.1_Intron|ZNF772_ENST00000601768.1_Intron|AC004076.9_ENST00000596831.1_Intron	NM_001024596.2	NP_001019767.1	Q68DY9	ZN772_HUMAN	zinc finger protein 772	111					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)	9		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)|Lung(386;0.174)		TCCATTCCATGCCAACAACCT	0.443																																					Melanoma(5;289 436 14293 15924 30817)												0								ENSG00000197128						60.0	64.0	62.0					19																	57985781		2203	4300	6503	ZNF772	SO:0001583	missense	0			-	HGNC	BX647068	CCDS33133.1, CCDS46210.1	19q13.43	2013-01-08				ENSG00000197128		"""Zinc fingers, C2H2-type"", ""-"""	33106	protein-coding gene	gene with protein product							Standard	NM_001024596		Approved	DKFZp686I1569	uc002qot.3	Q68DY9		ENST00000343280.4:c.331C>A	19.37:g.57985781G>T	ENSP00000341165:p.His111Asn	Somatic	0	31	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	A6NJK9|B4DH56|B4DYS0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H111N	ENST00000343280.4	37	c.331	CCDS33133.1	19	.	.	.	.	.	.	.	.	.	.	G	6.201	0.405215	0.11754	.	.	ENSG00000197128	ENST00000343280;ENST00000319969;ENST00000356584;ENST00000291809	T;T	0.05382	3.45;5.7	3.36	2.27	0.28462	.	.	.	.	.	T	0.06554	0.0168	L	0.39245	1.2	0.09310	N	1	B;B	0.19583	0.004;0.037	B;B	0.23574	0.013;0.047	T	0.32719	-0.9896	9	0.49607	T	0.09	.	7.3475	0.26672	0.1499:0.0:0.8501:0.0	.	70;111	A6NJK9;Q68DY9	.;ZN772_HUMAN	N	111;57;70;90	ENSP00000341165:H111N;ENSP00000348992:H70N	ENSP00000291809:H90N	H	-	1	0	ZNF772	62677593	0.000000	0.05858	0.074000	0.20217	0.745000	0.42441	0.401000	0.20948	0.685000	0.31468	0.491000	0.48974	CAT	-	NULL		0.443	ZNF772-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF772	protein_coding	OTTHUMT00000397447.1	G	NM_001024596	-		57985781	-1	no_errors	ENST00000343280	ensembl	human	known	74_37	missense	SNP	0.005	T
NAIF1	203245	genome.wustl.edu	37	9	130825710	130825710	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr9:130825710C>G	ENST00000373078.4	-	2	1200	c.981G>C	c.(979-981)caG>caC	p.Q327H	NAIF1_ENST00000488519.1_5'UTR	NM_197956.3	NP_931045.1	Q69YI7	NAIF1_HUMAN	nuclear apoptosis inducing factor 1	327					negative regulation of cell growth (GO:0030308)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCTGCCCTCACTGGATGATGC	0.607																																																	0								ENSG00000171169						40.0	46.0	44.0					9																	130825710		2203	4299	6502	NAIF1	SO:0001583	missense	0			-	HGNC	AK122729	CCDS6889.1	9q34.11	2008-04-10	2008-04-10	2008-04-10	ENSG00000171169	ENSG00000171169			25446	protein-coding gene	gene with protein product	"""nuclear apoptosis-inducing factor 1"""	610673	"""chromosome 9 open reading frame 90"""	C9orf90		14702039, 16378748	Standard	NM_197956		Approved	DKFZp762G199, bA379C10.2	uc004bta.3	Q69YI7	OTTHUMG00000020727	ENST00000373078.4:c.981G>C	9.37:g.130825710C>G	ENSP00000362170:p.Gln327His	Somatic	0	53	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95	B3KV81|Q8WU12	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q327H	ENST00000373078.4	37	c.981	CCDS6889.1	9	.	.	.	.	.	.	.	.	.	.	C	18.58	3.654250	0.67472	.	.	ENSG00000171169	ENST00000373078	.	.	.	5.3	-0.486	0.12064	.	0.352939	0.29908	N	0.010882	T	0.54549	0.1865	L	0.27053	0.805	0.34452	D	0.700781	D	0.55605	0.972	D	0.70487	0.969	T	0.64110	-0.6484	9	0.87932	D	0	-2.1812	11.108	0.48214	0.0:0.6231:0.0:0.3769	.	327	Q69YI7	NAIF1_HUMAN	H	327	.	ENSP00000362170:Q327H	Q	-	3	2	NAIF1	129865531	0.082000	0.21442	0.997000	0.53966	0.958000	0.62258	-1.145000	0.03194	-0.002000	0.14469	0.563000	0.77884	CAG	-	NULL		0.607	NAIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAIF1	protein_coding	OTTHUMT00000054330.1	C	NM_197956	-		130825710	-1	no_errors	ENST00000373078	ensembl	human	known	74_37	missense	SNP	0.998	G
RGS18	64407	genome.wustl.edu	37	1	192127772	192127772	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr1:192127772A>G	ENST00000367460.3	+	1	186	c.5A>G	c.(4-6)gAa>gGa	p.E2G	RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	2					G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAGAAGATGGAAACAACATTG	0.264																																																	0								ENSG00000150681						31.0	34.0	33.0					1																	192127772		2195	4276	6471	RGS18	SO:0001583	missense	0			-	HGNC	AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.5A>G	1.37:g.192127772A>G	ENSP00000356430:p.Glu2Gly	Somatic	0	47	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	B2RD23	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.E2G	ENST00000367460.3	37	c.5	CCDS1374.1	1	.	.	.	.	.	.	.	.	.	.	A	11.97	1.796584	0.31777	.	.	ENSG00000150681	ENST00000367460	T	0.56444	0.46	5.68	4.56	0.56223	.	0.233058	0.41712	D	0.000827	T	0.39835	0.1093	L	0.34521	1.04	0.45342	D	0.998334	B	0.10296	0.003	B	0.10450	0.005	T	0.33394	-0.9870	10	0.52906	T	0.07	.	8.7177	0.34421	0.9144:0.0:0.0856:0.0	.	2	Q9NS28	RGS18_HUMAN	G	2	ENSP00000356430:E2G	ENSP00000356430:E2G	E	+	2	0	RGS18	190394395	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	3.743000	0.55104	2.169000	0.68431	0.528000	0.53228	GAA	-	NULL		0.264	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS18	protein_coding	OTTHUMT00000086382.1	A	NM_130782	-		192127772	+1	no_errors	ENST00000367460	ensembl	human	known	74_37	missense	SNP	0.997	G
STK25	10494	genome.wustl.edu	37	2	242447504	242447504	+	5'UTR	DEL	G	G	-			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr2:242447504delG	ENST00000316586.4	-	0	296				STK25_ENST00000401869.1_5'UTR|STK25_ENST00000405883.3_5'UTR|STK25_ENST00000535007.1_Intron|STK25_ENST00000403346.3_5'UTR|STK25_ENST00000543554.1_Intron|STK25_ENST00000405585.1_5'UTR	NM_001271977.1|NM_001271978.1|NM_001282308.1	NP_001258906.1|NP_001258907.1|NP_001269237.1	O00506	STK25_HUMAN	serine/threonine kinase 25						establishment or maintenance of cell polarity (GO:0007163)|Golgi localization (GO:0051645)|positive regulation of axonogenesis (GO:0050772)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		TCTGGATCCCGCGGAGAGGCG	0.701																																					NSCLC(99;1100 1566 7679 28647 48345)												0								ENSG00000115694						19.0	22.0	21.0					2																	242447504		691	1591	2282	STK25	SO:0001623	5_prime_UTR_variant	0				HGNC	D63780	CCDS2549.1, CCDS63199.1, CCDS63200.1	2q37.3	2010-06-25	2010-06-25		ENSG00000115694	ENSG00000115694			11404	protein-coding gene	gene with protein product		602255	"""serine/threonine kinase 25 (Ste20, yeast homolog)"""			8887545, 9160885, 15037601	Standard	NM_001271977		Approved	SOK1, YSK1	uc002wbp.4	O00506	OTTHUMG00000133408	ENST00000316586.4:c.-54C>-	2.37:g.242447504delG		Somatic	0	114	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	51	15.00	A8K6Z3|A8K7D2|B7Z9K1|Q15522|Q5BJF1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000316586.4	37	NULL	CCDS2549.1	2																																																																																			-	-		0.701	STK25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK25	protein_coding	OTTHUMT00000257265.4	G	NM_006374			242447504	-1	no_errors	ENST00000436917	ensembl	human	known	74_37	rna	DEL	0.252	-
ATP8B1	5205	genome.wustl.edu	37	18	55351329	55351329	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr18:55351329T>G	ENST00000283684.4	-	14	1568	c.1569A>C	c.(1567-1569)gaA>gaC	p.E523D	ATP8B1_ENST00000536015.1_Missense_Mutation_p.E523D|RP11-35G9.3_ENST00000599199.1_RNA|RP11-35G9.5_ENST00000588925.1_RNA			O43520	AT8B1_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 1	523					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|drug transmembrane transport (GO:0006855)|inner ear receptor cell development (GO:0060119)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|phospholipid translocation (GO:0045332)|regulation of microvillus assembly (GO:0032534)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|vestibulocochlear nerve formation (GO:0021650)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|cardiolipin binding (GO:1901612)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(19)|ovary(3)|prostate(1)	53		Colorectal(73;0.229)				ACTGTCGTACTTCTGGCTCTT	0.448																																																	0								ENSG00000081923						155.0	129.0	138.0					18																	55351329		2203	4300	6503	ATP8B1	SO:0001583	missense	0			-	HGNC	AF038007	CCDS11965.1	18q21	2010-04-28	2010-04-28		ENSG00000081923	ENSG00000081923		"""ATPases / P-type"""	3706	protein-coding gene	gene with protein product		602397	"""ATPase, Class I, type 8B, member 1"", ""ATPase, class I, type 8B, member 1"""	FIC1, BRIC, PFIC1		9500542, 7655458	Standard	NM_005603		Approved	ATPIC, PFIC	uc002lgw.3	O43520	OTTHUMG00000132739	ENST00000283684.4:c.1569A>C	18.37:g.55351329T>G	ENSP00000283684:p.Glu523Asp	Somatic	0	37	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	38	24.00	Q9BTP8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.E523D	ENST00000283684.4	37	c.1569	CCDS11965.1	18	.	.	.	.	.	.	.	.	.	.	T	2.785	-0.252547	0.05829	.	.	ENSG00000081923	ENST00000283684;ENST00000536015	T;T	0.62639	0.01;0.01	5.81	2.1	0.27182	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.101933	0.64402	D	0.000002	T	0.35008	0.0917	N	0.12182	0.205	0.29605	N	0.847356	B	0.13145	0.007	B	0.16289	0.015	T	0.18903	-1.0322	10	0.12430	T	0.62	.	5.5902	0.17297	0.0:0.1437:0.2714:0.5849	.	523	O43520	AT8B1_HUMAN	D	523	ENSP00000283684:E523D;ENSP00000445359:E523D	ENSP00000283684:E523D	E	-	3	2	ATP8B1	53502327	0.272000	0.24172	0.275000	0.24674	0.027000	0.11550	0.273000	0.18662	0.127000	0.18452	0.379000	0.24179	GAA	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp		0.448	ATP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B1	protein_coding	OTTHUMT00000256097.1	T	NM_005603	-		55351329	-1	no_errors	ENST00000283684	ensembl	human	known	74_37	missense	SNP	0.979	G
ADAMTS3	9508	genome.wustl.edu	37	4	73179453	73179453	+	Silent	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr4:73179453G>T	ENST00000286657.4	-	12	1722	c.1686C>A	c.(1684-1686)tcC>tcA	p.S562S		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	562	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCCGAGAACAGGAGCCAAATT	0.423																																					NSCLC(168;1941 2048 2918 13048 43078)												0								ENSG00000156140						138.0	106.0	117.0					4																	73179453		2203	4300	6503	ADAMTS3	SO:0001819	synonymous_variant	0			-	HGNC	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.1686C>A	4.37:g.73179453G>T		Somatic	0	84	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	A1L3U9|Q9BXZ8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.S562	ENST00000286657.4	37	c.1686	CCDS3553.1	4																																																																																			-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Thrombospondin_1_rpt		0.423	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS3	protein_coding	OTTHUMT00000252164.2	G		-		73179453	-1	no_errors	ENST00000286657	ensembl	human	known	74_37	silent	SNP	1.000	T
CLUL1	27098	genome.wustl.edu	37	18	627423	627423	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr18:627423C>A	ENST00000400606.2	+	5	895	c.750C>A	c.(748-750)aaC>aaA	p.N250K	CLUL1_ENST00000540035.1_Missense_Mutation_p.N302K|CLUL1_ENST00000581619.1_Missense_Mutation_p.N275K|CLUL1_ENST00000579494.1_Missense_Mutation_p.N250K|CLUL1_ENST00000338387.7_Missense_Mutation_p.N250K	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)	250					cell death (GO:0008219)	extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						ACATTCCCAACTTCTTCCAGC	0.373																																																	0								ENSG00000079101						105.0	96.0	99.0					18																	627423		1829	4094	5923	CLUL1	SO:0001583	missense	0			-	HGNC	D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846		ENST00000400606.2:c.750C>A	18.37:g.627423C>A	ENSP00000383449:p.Asn250Lys	Somatic	0	41	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	A0FDN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Clusterin-like,smart_Clusterin_N,smart_Clusterin_C	p.N250K	ENST00000400606.2	37	c.750	CCDS42405.1	18	.	.	.	.	.	.	.	.	.	.	C	5.649	0.304468	0.10678	.	.	ENSG00000079101	ENST00000400606;ENST00000540035;ENST00000338387	T;T;T	0.22743	1.94;1.94;1.94	5.86	-0.824	0.10812	Clusterin, C-terminal (1);	0.401814	0.30446	N	0.009609	T	0.13798	0.0334	L	0.34521	1.04	0.09310	N	1	B;B	0.32653	0.328;0.379	B;B	0.37091	0.079;0.241	T	0.24584	-1.0156	10	0.25751	T	0.34	-4.0513	7.3556	0.26717	0.1068:0.4904:0.0:0.4028	.	302;250	F5GWQ8;Q15846	.;CLUL1_HUMAN	K	250;302;250	ENSP00000383449:N250K;ENSP00000441726:N302K;ENSP00000341128:N250K	ENSP00000341128:N250K	N	+	3	2	CLUL1	617423	0.014000	0.17966	0.088000	0.20740	0.793000	0.44817	-0.005000	0.12855	-0.054000	0.13266	0.561000	0.74099	AAC	-	pfam_Clusterin-like,smart_Clusterin_C		0.373	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLUL1	protein_coding	OTTHUMT00000441183.1	C		-		627423	+1	no_errors	ENST00000338387	ensembl	human	known	74_37	missense	SNP	0.026	A
ATP2B2	491	genome.wustl.edu	37	3	10370153	10370153	+	3'UTR	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:10370153G>A	ENST00000352432.4	-	0	4146				ATP2B2_ENST00000343816.4_3'UTR|ATP2B2_ENST00000360273.2_3'UTR|ATP2B2_ENST00000397077.1_3'UTR|ATP2B2_ENST00000383800.4_3'UTR|ATP2B2_ENST00000467702.2_5'UTR|MIR378B_ENST00000578876.1_RNA			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2						auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GGGGAGGATTGAAAGTGTACA	0.512																																					Ovarian(125;1619 1709 15675 19819 38835)												0								ENSG00000157087																																			ATP2B2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.*345C>T	3.37:g.10370153G>A		Somatic	0	138	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	93	16.22	O00766|Q12994|Q16818	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000352432.4	37	NULL	CCDS33701.1	3																																																																																			-	-		0.512	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	protein_coding	OTTHUMT00000250576.2	G	NM_001683	-		10370153	-1	no_errors	ENST00000467702	ensembl	human	known	74_37	rna	SNP	0.141	A
GHSR	2693	genome.wustl.edu	37	3	172165433	172165433	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:172165433G>T	ENST00000241256.2	-	1	813	c.771C>A	c.(769-771)aaC>aaA	p.N257K	GHSR_ENST00000427970.1_Missense_Mutation_p.N257K	NM_198407.2	NP_940799.1	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor	257					actin polymerization or depolymerization (GO:0008154)|adult feeding behavior (GO:0008343)|cellular response to insulin stimulus (GO:0032869)|decidualization (GO:0046697)|G-protein coupled receptor signaling pathway (GO:0007186)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of fatty acid metabolic process (GO:0045923)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of hindgut contraction (GO:0043134)|regulation of synapse assembly (GO:0051963)|response to food (GO:0032094)|response to hormone (GO:0009725)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone secretagogue receptor activity (GO:0001616)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	33	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			TTTGCTTGTGGTTCTGGTCCC	0.612																																					Esophageal Squamous(93;641 1401 20883 29581 34638)												0								ENSG00000121853						93.0	94.0	94.0					3																	172165433		2203	4300	6503	GHSR	SO:0001583	missense	0			-	HGNC	AY429112	CCDS3218.1, CCDS46959.1	3q26.31	2012-08-08			ENSG00000121853	ENSG00000121853		"""GPCR / Class A : Ghrelin receptors"""	4267	protein-coding gene	gene with protein product		601898				8688086	Standard	NM_198407		Approved		uc003fib.2	Q92847	OTTHUMG00000156946	ENST00000241256.2:c.771C>A	3.37:g.172165433G>T	ENSP00000241256:p.Asn257Lys	Somatic	0	58	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	38	56.82	Q14D12|Q6ISR8|Q92848|Q96RJ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GHS-R,prints_GPCR_Rhodpsn	p.N257K	ENST00000241256.2	37	c.771	CCDS3218.1	3	.	.	.	.	.	.	.	.	.	.	G	15.98	2.993685	0.54041	.	.	ENSG00000121853	ENST00000241256;ENST00000427970	T;T	0.69040	-0.37;-0.37	5.43	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.228496	0.52532	D	0.000076	T	0.53997	0.1831	L	0.33792	1.035	0.44825	D	0.997832	P;B	0.40970	0.734;0.302	B;B	0.42030	0.373;0.315	T	0.50775	-0.8788	10	0.30854	T	0.27	-14.8776	8.3157	0.32100	0.223:0.0:0.777:0.0	.	257;257	Q92847-2;Q92847	.;GHSR_HUMAN	K	257	ENSP00000241256:N257K;ENSP00000395344:N257K	ENSP00000241256:N257K	N	-	3	2	GHSR	173648127	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	3.577000	0.53885	2.559000	0.86315	0.455000	0.32223	AAC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GHS-R		0.612	GHSR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHSR	protein_coding	OTTHUMT00000346728.1	G	NM_004122	-		172165433	-1	no_errors	ENST00000241256	ensembl	human	known	74_37	missense	SNP	1.000	T
IGF2R	3482	genome.wustl.edu	37	6	160491065	160491065	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr6:160491065G>T	ENST00000356956.1	+	31	4566	c.4418G>T	c.(4417-4419)cGa>cTa	p.R1473L		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	1473					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	ACCACCATCCGATTCACCTGC	0.532																																																	0								ENSG00000197081						99.0	81.0	87.0					6																	160491065		2203	4300	6503	IGF2R	SO:0001583	missense	0			-	HGNC	J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.4418G>T	6.37:g.160491065G>T	ENSP00000349437:p.Arg1473Leu	Somatic	0	62	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.R1473L	ENST00000356956.1	37	c.4418	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	G	18.15	3.559578	0.65538	.	.	ENSG00000197081	ENST00000356956	T	0.12465	2.68	5.62	3.67	0.42095	Mannose-6-phosphate receptor, binding (1);	0.175470	0.51477	D	0.000087	T	0.07234	0.0183	L	0.47716	1.5	0.54753	D	0.999984	B	0.28713	0.22	B	0.33521	0.165	T	0.08617	-1.0713	10	0.42905	T	0.14	-18.4459	12.1798	0.54206	0.0689:0.0:0.8029:0.1282	.	1473	P11717	MPRI_HUMAN	L	1473	ENSP00000349437:R1473L	ENSP00000349437:R1473L	R	+	2	0	IGF2R	160411055	1.000000	0.71417	0.100000	0.21137	0.751000	0.42716	3.938000	0.56583	1.382000	0.46385	0.561000	0.74099	CGA	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom		0.532	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	protein_coding	OTTHUMT00000042931.1	G	NM_000876	-		160491065	+1	no_errors	ENST00000356956	ensembl	human	known	74_37	missense	SNP	0.226	T
KRT15	3866	genome.wustl.edu	37	17	39671736	39671736	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr17:39671736C>A	ENST00000254043.3	-	6	4820	c.1235G>T	c.(1234-1236)gGc>gTc	p.G412V	KRT15_ENST00000393976.2_Missense_Mutation_p.G412V|KRT15_ENST00000393974.3_Missense_Mutation_p.G247V|KRT15_ENST00000393981.3_Missense_Mutation_p.G247V	NM_002275.3	NP_002266	P19012	K1C15_HUMAN	keratin 15	412	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		Breast(137;0.000286)				GGCATCCTGGCCCTCGAGCAG	0.592																																																	0								ENSG00000171346						94.0	81.0	86.0					17																	39671736		2203	4300	6503	KRT15	SO:0001583	missense	0			-	HGNC		CCDS11398.1	17q21.2	2013-06-20			ENSG00000171346	ENSG00000171346		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6421	protein-coding gene	gene with protein product	"""keratin-15, basic"", ""keratin-15, beta"", ""type I cytoskeletal 15"", ""cytokeratin 15"""	148030				16831889	Standard	NM_002275		Approved	K15, CK15, K1CO	uc002hwy.3	P19012	OTTHUMG00000133435	ENST00000254043.3:c.1235G>T	17.37:g.39671736C>A	ENSP00000254043:p.Gly412Val	Somatic	0	40	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B3KQY1|B3KRA2|E0CX14|Q53XV8|Q9BUG4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.G412V	ENST00000254043.3	37	c.1235	CCDS11398.1	17	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182638	0.78677	.	.	ENSG00000171346	ENST00000254043;ENST00000393974;ENST00000393976;ENST00000393981	D;D;D;D	0.98362	-4.89;-4.89;-4.89;-4.89	4.71	4.71	0.59529	Filament (1);	0.000000	0.50627	D	0.000118	D	0.98960	0.9646	M	0.90870	3.155	0.80722	D	1	P;D;D	0.59357	0.833;0.96;0.985	P;P;D	0.64595	0.6;0.887;0.927	D	0.99184	1.0868	10	0.72032	D	0.01	.	13.3146	0.60399	0.0:0.9216:0.0:0.0784	.	247;412;412	A8MT21;B3KVF5;P19012	.;.;K1C15_HUMAN	V	412;247;412;247	ENSP00000254043:G412V;ENSP00000377544:G247V;ENSP00000377546:G412V;ENSP00000377550:G247V	ENSP00000254043:G412V	G	-	2	0	KRT15	36925262	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.671000	0.54576	2.426000	0.82243	0.655000	0.94253	GGC	-	pfam_IF		0.592	KRT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT15	protein_coding	OTTHUMT00000257301.1	C	NM_002275	-		39671736	-1	no_errors	ENST00000254043	ensembl	human	known	74_37	missense	SNP	1.000	A
EMC2	9694	genome.wustl.edu	37	8	109491286	109491286	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr8:109491286G>T	ENST00000220853.3	+	10	789	c.754G>T	c.(754-756)Gac>Tac	p.D252Y	EMC2_ENST00000520294.1_3'UTR	NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	252						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											AACGAAAAAGGACAACATGAA	0.318																																																	0								ENSG00000104412						140.0	126.0	131.0					8																	109491286		2203	4300	6503	EMC2	SO:0001583	missense	0			-	HGNC	BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.754G>T	8.37:g.109491286G>T	ENSP00000220853:p.Asp252Tyr	Somatic	0	32	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q8WUE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D252Y	ENST00000220853.3	37	c.754	CCDS6309.1	8	.	.	.	.	.	.	.	.	.	.	G	27.6	4.844536	0.91197	.	.	ENSG00000104412	ENST00000220853	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.76026	0.3930	M	0.73962	2.25	0.80722	D	1	D	0.63046	0.992	P	0.54499	0.754	T	0.77993	-0.2378	9	0.87932	D	0	-18.6323	20.3552	0.98837	0.0:0.0:1.0:0.0	.	252	Q15006	TTC35_HUMAN	Y	252	.	ENSP00000220853:D252Y	D	+	1	0	TTC35	109560462	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.534000	0.82004	2.812000	0.96745	0.557000	0.71058	GAC	-	NULL		0.318	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC2	protein_coding	OTTHUMT00000380717.1	G	NM_014673	-		109491286	+1	no_errors	ENST00000220853	ensembl	human	known	74_37	missense	SNP	1.000	T
CSPG4	1464	genome.wustl.edu	37	15	75982625	75982625	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr15:75982625G>A	ENST00000308508.5	-	3	873	c.781C>T	c.(781-783)Cgg>Tgg	p.R261W		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	261	Globular or compact configuration stabilized by disulfide bonds.|Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						ACCACGGCCCGCAGGTGGCCC	0.612																																																	0								ENSG00000173546						43.0	40.0	41.0					15																	75982625		2197	4293	6490	CSPG4	SO:0001583	missense	0			-	HGNC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.781C>T	15.37:g.75982625G>A	ENSP00000312506:p.Arg261Trp	Somatic	0	92	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	89	9.18	D3DW77|Q92675	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.R261W	ENST00000308508.5	37	c.781	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	.	18.10	3.548100	0.65311	.	.	ENSG00000173546	ENST00000308508	T	0.78924	-1.22	5.21	3.19	0.36642	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.105378	0.41396	D	0.000896	T	0.74068	0.3668	L	0.47716	1.5	0.44862	D	0.997873	P	0.52316	0.952	P	0.46208	0.507	T	0.76916	-0.2782	10	0.72032	D	0.01	.	12.142	0.54002	0.0:0.0:0.5628:0.4372	.	261	Q6UVK1	CSPG4_HUMAN	W	261	ENSP00000312506:R261W	ENSP00000312506:R261W	R	-	1	2	CSPG4	73769680	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	1.449000	0.35123	1.181000	0.42912	0.555000	0.69702	CGG	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.612	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	protein_coding	OTTHUMT00000286472.1	G	NM_001897	-		75982625	-1	no_errors	ENST00000308508	ensembl	human	known	74_37	missense	SNP	1.000	A
AMZ2	51321	genome.wustl.edu	37	17	66247426	66247427	+	Intron	INS	-	-	CTGTATAG	rs200969552|rs58359332	byFrequency	TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr17:66247426_66247427insCTGTATAG	ENST00000359904.3	+	4	1718				AMZ2_ENST00000577985.1_Intron|AMZ2_ENST00000392720.2_Intron|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577866.1_Intron|AMZ2_ENST00000577273.1_Intron|AMZ2_ENST00000580753.1_Intron|AMZ2_ENST00000359783.4_Intron	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GATATTTAAAATATTTTCAGTT	0.356														1657	0.330871	0.5121	0.3487	5008	,	,		15358	0.2768		0.1918	False		,,,				2504	0.272																0								ENSG00000196704																																			AMZ2	SO:0001627	intron_variant	0				HGNC	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.586+107->CTGTATAG	17.37:g.66247426_66247427insCTGTATAG		Somatic	NA	NA	NA		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359904.3	37	NULL	CCDS11674.1	17																																																																																			-	-		0.356	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	protein_coding	OTTHUMT00000448261.1	-	NM_016627			66247427	+1	no_errors	ENST00000581779	ensembl	human	known	74_37	rna	INS	0.001:0.003	CTGTATAG
ZFYVE28	57732	genome.wustl.edu	37	4	2307170	2307170	+	Silent	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr4:2307170G>A	ENST00000290974.2	-	8	1236	c.897C>T	c.(895-897)gaC>gaT	p.D299D	RP11-478C1.7_ENST00000510632.1_RNA|ZFYVE28_ENST00000511071.1_Silent_p.D269D|ZFYVE28_ENST00000515312.1_Silent_p.D229D	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	299					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						GTCCCTGCACGTCTGCGCGGA	0.647																																																	0								ENSG00000159733						45.0	44.0	44.0					4																	2307170		2203	4297	6500	ZFYVE28	SO:0001819	synonymous_variant	0			-	HGNC	AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.897C>T	4.37:g.2307170G>A		Somatic	0	47	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	37	22.92	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.D299	ENST00000290974.2	37	c.897	CCDS33942.1	4																																																																																			-	NULL		0.647	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE28	protein_coding	OTTHUMT00000360078.1	G	XM_035371	-		2307170	-1	no_errors	ENST00000290974	ensembl	human	known	74_37	silent	SNP	0.000	A
KIAA1549L	25758	genome.wustl.edu	37	11	33566726	33566726	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr11:33566726G>T	ENST00000321505.4	+	2	2476	c.2296G>T	c.(2296-2298)Gca>Tca	p.A766S	KIAA1549L_ENST00000389726.3_Missense_Mutation_p.A772S|KIAA1549L_ENST00000265654.5_Missense_Mutation_p.A772S			Q6ZVL6	K154L_HUMAN	KIAA1549-like	766						integral component of membrane (GO:0016021)											GATGCCCAGAGCATCCACGCC	0.597																																																	0								ENSG00000110427						112.0	140.0	130.0					11																	33566726		2176	4275	6451	KIAA1549L	SO:0001583	missense	0			-	HGNC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2296G>T	11.37:g.33566726G>T	ENSP00000315295:p.Ala766Ser	Somatic	0	43	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B0QYU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A772S	ENST00000321505.4	37	c.2314	CCDS44565.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.99|11.99	1.803141|1.803141	0.31869|0.31869	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568|ENST00000526400	.|.	.|.	.|.	5.0|5.0	2.91|2.91	0.33838|0.33838	.|.	0.470251|.	0.19005|.	N|.	0.125235|.	T|T	0.34658|0.34658	0.0905|0.0905	L|L	0.44542|0.44542	1.39|1.39	0.24021|0.24021	N|N	0.99614|0.99614	B;P|.	0.38078|.	0.278;0.617|.	B;B|.	0.30855|.	0.039;0.121|.	T|T	0.23332|0.23332	-1.0191|-1.0191	9|5	0.32370|.	T|.	0.25|.	-0.4121|-0.4121	3.3943|3.3943	0.07300|0.07300	0.1772:0.2838:0.539:0.0|0.1772:0.2838:0.539:0.0	.|.	772;772|.	E9PAT2;Q6ZVL6-2|.	.;.|.	S|D	766;772;772;605|163	.|.	ENSP00000265654:A772S|.	A|E	+|+	1|3	0|2	C11orf41|C11orf41	33523302|33523302	0.993000|0.993000	0.37304|0.37304	0.316000|0.316000	0.25252|0.25252	0.952000|0.952000	0.60782|0.60782	2.776000|2.776000	0.47709|0.47709	1.290000|1.290000	0.44636|0.44636	0.561000|0.561000	0.74099|0.74099	GCA|GAG	-	NULL		0.597	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1549L	protein_coding	OTTHUMT00000317998.1	G	NM_012194	-		33566726	+1	no_errors	ENST00000389726	ensembl	human	known	74_37	missense	SNP	0.760	T
SCN11A	11280	genome.wustl.edu	37	3	38948822	38948843	+	Intron	DEL	TGTGTGTGTGTGTATATATCTA	TGTGTGTGTGTGTATATATCTA	-	rs138466233|rs371006611|rs200809384|rs62242293	byFrequency	TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	TGTGTGTGTGTGTATATATCTA	TGTGTGTGTGTGTATATATCTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:38948822_38948843delTGTGTGTGTGTGTATATATCTA	ENST00000302328.3	-	10	1672				SCN11A_ENST00000450244.1_Intron|SCN11A_ENST00000456224.3_Intron|AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000444237.2_Intron	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	tgtgtgtgtgtgtgtgtgtgtgtATATATCTATATATacaca	0.387																																																	0								ENSG00000215941																																			AC116038.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+596TAGATATATACACACACACACA>-	3.37:g.38948822_38948843delTGTGTGTGTGTGTATATATCTA		Somatic	NA	NA	NA		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																			-	-		0.387	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	protein_coding	OTTHUMT00000109746.4	TGTGTGTGTGTGTATATATCTA	NM_014139			38948843	+1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	DEL	0.193:0.195:0.137:0.126:0.125:0.119:0.107:0.069:0.062:0.049:0.028:0.020:0.007:0.002:0.001:0.001:0.002:0.002:0.002:0.001:0.001:0.001	-
MED13L	23389	genome.wustl.edu	37	12	116413410	116413410	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr12:116413410G>C	ENST00000281928.3	-	24	5704	c.5498C>G	c.(5497-5499)tCt>tGt	p.S1833C		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1833						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CTGGTCGTGAGACAGACAATA	0.483																																																	0								ENSG00000123066						105.0	100.0	102.0					12																	116413410		2203	4300	6503	MED13L	SO:0001583	missense	0			-	HGNC	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.5498C>G	12.37:g.116413410G>C	ENSP00000281928:p.Ser1833Cys	Somatic	0	64	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	40	14.89	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.S1833C	ENST00000281928.3	37	c.5498	CCDS9177.1	12	.	.	.	.	.	.	.	.	.	.	G	27.3	4.817420	0.90790	.	.	ENSG00000123066	ENST00000281928	D	0.95482	-3.72	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.97980	0.9335	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98059	1.0392	10	0.87932	D	0	.	20.5632	0.99335	0.0:0.0:1.0:0.0	.	1833	Q71F56	MD13L_HUMAN	C	1833	ENSP00000281928:S1833C	ENSP00000281928:S1833C	S	-	2	0	MED13L	114897793	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	9.420000	0.97426	2.937000	0.99478	0.650000	0.86243	TCT	-	pfam_Mediator_Med13		0.483	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13L	protein_coding	OTTHUMT00000403879.3	G		-		116413410	-1	no_errors	ENST00000281928	ensembl	human	known	74_37	missense	SNP	1.000	C
KLK4	9622	genome.wustl.edu	37	19	51411893	51411893	+	Silent	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:51411893C>T	ENST00000324041.1	-	3	416	c.417G>A	c.(415-417)tcG>tcA	p.S139S	KLK4_ENST00000597441.1_5'Flank|KLK4_ENST00000431178.2_Silent_p.S90S	NM_004917.3	NP_004908.3	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4	139	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amelogenesis (GO:0097186)|extracellular matrix disassembly (GO:0022617)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(8)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)		TAGGGCACTGCGAAGCAATGC	0.582																																																	0								ENSG00000167749						115.0	85.0	95.0					19																	51411893		2203	4300	6503	KLK4	SO:0001819	synonymous_variant	0			-	HGNC	AF113141	CCDS12809.1	19q13.41	2014-09-04	2006-10-27		ENSG00000167749	ENSG00000167749		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6365	protein-coding gene	gene with protein product		603767	"""kallikrein 4 (prostase, enamel matrix, prostate)"""	PRSS17		10077646, 10438493, 16800724, 10863090, 9465170	Standard	XM_005259441		Approved	EMSP, EMSP1, PSTS, KLK-L1	uc002pua.1	Q9Y5K2	OTTHUMG00000182964	ENST00000324041.1:c.417G>A	19.37:g.51411893C>T		Somatic	0	37	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	Q4VB16|Q96RU5|Q9GZL6|Q9UBJ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.S139	ENST00000324041.1	37	c.417	CCDS12809.1	19																																																																																			-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.582	KLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK4	protein_coding	OTTHUMT00000464449.1	C	NM_004917	-		51411893	-1	no_errors	ENST00000324041	ensembl	human	known	74_37	silent	SNP	0.000	T
GPR19	2842	genome.wustl.edu	37	12	12815066	12815066	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr12:12815066G>T	ENST00000540510.1	-	2	509	c.317C>A	c.(316-318)tCc>tAc	p.S106Y	GPR19_ENST00000332427.2_Missense_Mutation_p.S106Y			P46093	GPR4_HUMAN	G protein-coupled receptor 19	58					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		ACATGCCATGGAGACCACAAA	0.522																																																	0								ENSG00000183150						137.0	121.0	127.0					12																	12815066		2203	4300	6503	GPR19	SO:0001583	missense	0			-	HGNC		CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.317C>A	12.37:g.12815066G>T	ENSP00000441832:p.Ser106Tyr	Somatic	0	38	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S106Y	ENST00000540510.1	37	c.317	CCDS8652.1	12	.	.	.	.	.	.	.	.	.	.	G	17.88	3.498064	0.64186	.	.	ENSG00000183150	ENST00000540510;ENST00000332427	T;T	0.40225	1.04;1.04	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.73110	0.3545	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79393	-0.1822	10	0.87932	D	0	-26.8714	18.7133	0.91666	0.0:0.0:1.0:0.0	.	106	Q15760	GPR19_HUMAN	Y	106	ENSP00000441832:S106Y;ENSP00000333744:S106Y	ENSP00000333744:S106Y	S	-	2	0	GPR19	12706333	1.000000	0.71417	1.000000	0.80357	0.445000	0.32107	9.349000	0.97066	2.744000	0.94065	0.655000	0.94253	TCC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.522	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR19	protein_coding	OTTHUMT00000400662.1	G	NM_006143	-		12815066	-1	no_errors	ENST00000332427	ensembl	human	known	74_37	missense	SNP	1.000	T
XPO5	57510	genome.wustl.edu	37	6	43491638	43491638	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr6:43491638C>A	ENST00000265351.7	-	32	3793	c.3583G>T	c.(3583-3585)Ggg>Tgg	p.G1195W	POLR1C_ENST00000304004.3_Intron	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	1195					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			AGGCCACCCCCATCATTGTCC	0.478																																																	0								ENSG00000124571						103.0	106.0	105.0					6																	43491638		1931	4123	6054	XPO5	SO:0001583	missense	0			-	HGNC	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.3583G>T	6.37:g.43491638C>A	ENSP00000265351:p.Gly1195Trp	Somatic	0	44	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold,smart_Importin-beta_N	p.G1195W	ENST00000265351.7	37	c.3583	CCDS47430.1	6	.	.	.	.	.	.	.	.	.	.	C	11.83	1.755613	0.31046	.	.	ENSG00000124571	ENST00000265351;ENST00000439465	T	0.30714	1.52	5.81	4.94	0.65067	.	0.638046	0.16253	N	0.222626	T	0.06872	0.0175	N	0.08118	0	0.35701	D	0.815649	P	0.44044	0.825	B	0.32393	0.145	T	0.08806	-1.0704	10	0.54805	T	0.06	-2.7814	13.3675	0.60694	0.0:0.9273:0.0:0.0727	.	1195	Q9HAV4	XPO5_HUMAN	W	1195;823	ENSP00000265351:G1195W	ENSP00000265351:G1195W	G	-	1	0	XPO5	43599616	0.817000	0.29147	0.825000	0.32803	0.087000	0.18053	2.746000	0.47467	1.475000	0.48197	-0.157000	0.13467	GGG	-	NULL		0.478	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO5	protein_coding	OTTHUMT00000040657.2	C	NM_020750	-		43491638	-1	no_errors	ENST00000265351	ensembl	human	known	74_37	missense	SNP	0.997	A
STXBP4	252983	genome.wustl.edu	37	17	53237201	53237201	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr17:53237201G>A	ENST00000376352.2	+	18	1798	c.1591G>A	c.(1591-1593)Gtc>Atc	p.V531I	STXBP4_ENST00000434978.2_Missense_Mutation_p.V509I	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	531					cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						CGTGATGAGTGTCCTGAATCT	0.433																																																	0								ENSG00000166263						129.0	104.0	113.0					17																	53237201		2203	4300	6503	STXBP4	SO:0001583	missense	0			-	HGNC	BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.1591G>A	17.37:g.53237201G>A	ENSP00000365530:p.Val531Ile	Somatic	0	35	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	34	40.68	Q8IVZ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WW_dom,pfam_PDZ,superfamily_PDZ,superfamily_WW_dom,smart_PDZ,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom	p.V531I	ENST00000376352.2	37	c.1591	CCDS11584.2	17	.	.	.	.	.	.	.	.	.	.	G	13.42	2.232561	0.39498	.	.	ENSG00000166263	ENST00000376352;ENST00000434978	T;T	0.03607	3.87;3.87	5.22	3.25	0.37280	.	0.308667	0.27189	N	0.020518	T	0.02380	0.0073	N	0.11341	0.13	0.51767	D	0.999932	B;B	0.09022	0.002;0.002	B;B	0.06405	0.001;0.002	T	0.51694	-0.8673	10	0.49607	T	0.09	-0.8259	8.8855	0.35400	0.172:0.0:0.828:0.0	.	509;531	E7EPP7;Q6ZWJ1	.;STXB4_HUMAN	I	531;509	ENSP00000365530:V531I;ENSP00000391087:V509I	ENSP00000365530:V531I	V	+	1	0	STXBP4	50592200	0.859000	0.29813	0.595000	0.28798	0.994000	0.84299	2.142000	0.42177	0.794000	0.33899	0.563000	0.77884	GTC	-	NULL		0.433	STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP4	protein_coding	OTTHUMT00000157184.1	G	NM_178509	-		53237201	+1	no_errors	ENST00000376352	ensembl	human	known	74_37	missense	SNP	0.757	A
FAF1	11124	genome.wustl.edu	37	1	51121153	51121153	+	Silent	SNP	T	T	C			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr1:51121153T>C	ENST00000396153.2	-	8	1156	c.705A>G	c.(703-705)caA>caG	p.Q235Q	FAF1_ENST00000371778.4_Silent_p.Q235Q	NM_007051.2	NP_008982.1	Q9UNN5	FAF1_HUMAN	Fas (TNFRSF6) associated factor 1	235					apoptotic process (GO:0006915)|cell death (GO:0008219)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of protein complex assembly (GO:0031334)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of cell adhesion (GO:0030155)|regulation of protein catabolic process (GO:0042176)|regulation of protein kinase activity (GO:0045859)	CD95 death-inducing signaling complex (GO:0031265)|Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	heat shock protein binding (GO:0031072)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.0?(1)		breast(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|pancreas(2)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		CCTCCCATAATTGGTGGCGAA	0.383																																																	1	Whole gene deletion(1)	thyroid(1)						ENSG00000185104						132.0	125.0	128.0					1																	51121153		2203	4300	6503	FAF1	SO:0001819	synonymous_variant	0			-	HGNC	AF132938	CCDS554.1	1p32.3	2012-09-20			ENSG00000185104	ENSG00000185104		"""UBX domain containing"""	3578	protein-coding gene	gene with protein product	"""TNFRSF6-associated factor 1"", ""UBX domain protein 3A"""	604460				10462485	Standard	NM_007051		Approved	CGI-03, hFAF1, HFAF1s, UBXD12, UBXN3A	uc001cse.1	Q9UNN5	OTTHUMG00000007930	ENST00000396153.2:c.705A>G	1.37:g.51121153T>C		Somatic	0	69	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	53	31.17	Q549F0|Q9UF34|Q9UNT3|Q9Y2Z3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UBX,superfamily_UBA-like,smart_UAS,smart_UBX,pfscan_UBX	p.Q235	ENST00000396153.2	37	c.705	CCDS554.1	1																																																																																			-	NULL		0.383	FAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF1	protein_coding	OTTHUMT00000021807.1	T	NM_007051	-		51121153	-1	no_errors	ENST00000371778	ensembl	human	known	74_37	silent	SNP	0.998	C
TTLL6	284076	genome.wustl.edu	37	17	46876980	46876980	+	Silent	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr17:46876980G>A	ENST00000393382.3	-	6	895	c.754C>T	c.(754-756)Ctg>Ttg	p.L252L		NM_001130918.1	NP_001124390.1			tubulin tyrosine ligase-like family, member 6											endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						GAAATATACAGCTGACAGATC	0.443																																																	0								ENSG00000170703						157.0	130.0	138.0					17																	46876980		692	1591	2283	TTLL6	SO:0001819	synonymous_variant	0			-	HGNC	AK093127	CCDS11537.2, CCDS45724.1	17q21.32	2013-02-14			ENSG00000170703	ENSG00000170703		"""Tubulin tyrosine ligase-like family"""	26664	protein-coding gene	gene with protein product		610849				15890843	Standard	NM_173623		Approved	FLJ35808	uc021tzm.1	Q8N841	OTTHUMG00000156978	ENST00000393382.3:c.754C>T	17.37:g.46876980G>A		Somatic	0	91	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	67	28.72		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TTL/TTLL_fam	p.L252	ENST00000393382.3	37	c.754	CCDS45724.1	17																																																																																			-	pfam_TTL/TTLL_fam		0.443	TTLL6-003	KNOWN	downstream_ATG|non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TTLL6	protein_coding	OTTHUMT00000346939.3	G	NM_173623	-		46876980	-1	no_errors	ENST00000393382	ensembl	human	known	74_37	silent	SNP	1.000	A
RORC	6097	genome.wustl.edu	37	1	151779974	151779974	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr1:151779974C>T	ENST00000318247.6	-	11	1638	c.1531G>A	c.(1531-1533)Gag>Aag	p.E511K	RORC_ENST00000392697.3_Missense_Mutation_p.E565K|RORC_ENST00000480719.1_5'UTR|RORC_ENST00000356728.6_Missense_Mutation_p.E490K|LINGO4_ENST00000368820.3_5'Flank	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	511	Ligand-binding.				adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ACAGGTGACTCGGTTTCAGTG	0.612																																																	0								ENSG00000143365						107.0	96.0	100.0					1																	151779974		2203	4300	6503	RORC	SO:0001583	missense	0			-	HGNC	U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.1531G>A	1.37:g.151779974C>T	ENSP00000327025:p.Glu511Lys	Somatic	0	91	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	51	10.53	Q5SZR9|Q8N5V7|Q8NCY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_ROR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt,pfscan_Znf_hrmn_rcpt	p.E565K	ENST00000318247.6	37	c.1693	CCDS1004.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.327264	0.95708	.	.	ENSG00000143365	ENST00000356728;ENST00000392697;ENST00000318247	D;D;D	0.94687	-3.45;-3.49;-3.46	5.5	5.5	0.81552	.	0.000000	0.56097	U	0.000025	D	0.94066	0.8098	M	0.70275	2.135	0.22648	N	0.998892	D;D;D;D	0.61697	0.99;0.977;0.977;0.976	P;P;P;B	0.51170	0.661;0.457;0.475;0.372	D	0.90234	0.4281	10	0.66056	D	0.02	.	16.8956	0.86099	0.0:1.0:0.0:0.0	.	499;565;511;490	B6ZGS6;B4DPR1;P51449;F1D8P6	.;.;RORG_HUMAN;.	K	490;565;511	ENSP00000349164:E490K;ENSP00000376461:E565K;ENSP00000327025:E511K	ENSP00000327025:E511K	E	-	1	0	RORC	150046598	0.641000	0.27251	0.167000	0.22817	0.976000	0.68499	1.961000	0.40432	2.578000	0.87016	0.655000	0.94253	GAG	-	NULL		0.612	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RORC	protein_coding	OTTHUMT00000036626.1	C		-		151779974	-1	no_errors	ENST00000392697	ensembl	human	known	74_37	missense	SNP	0.280	T
SALL3	27164	genome.wustl.edu	37	18	76754525	76754525	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr18:76754525A>G	ENST00000537592.2	+	2	2534	c.2534A>G	c.(2533-2535)aAc>aGc	p.N845S	SALL3_ENST00000575389.2_Missense_Mutation_p.N845S|SALL3_ENST00000536229.3_Missense_Mutation_p.N712S	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	845					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCCCTGGAGAACCAGATGAAG	0.667																																																	0								ENSG00000256463						41.0	44.0	43.0					18																	76754525		2202	4298	6500	SALL3	SO:0001583	missense	0			-	HGNC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.2534A>G	18.37:g.76754525A>G	ENSP00000441823:p.Asn845Ser	Somatic	0	41	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	Q9UGH1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N845S	ENST00000537592.2	37	c.2534	CCDS12013.1	18	.	.	.	.	.	.	.	.	.	.	A	11.39	1.625219	0.28889	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.11277	2.79	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000009	T	0.13200	0.0320	M	0.73217	2.22	0.54753	D	0.999983	B;P	0.42692	0.34;0.787	B;B	0.33846	0.171;0.158	T	0.08700	-1.0709	10	0.28530	T	0.3	-51.3036	15.2626	0.73637	1.0:0.0:0.0:0.0	.	577;845	F5GXY4;Q9BXA9	.;SALL3_HUMAN	S	845;845;577	ENSP00000441823:N845S	ENSP00000299466:N845S	N	+	2	0	SALL3	74855513	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.034000	0.70933	2.006000	0.58801	0.459000	0.35465	AAC	-	NULL		0.667	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SALL3	protein_coding	OTTHUMT00000256397.1	A	NM_171999	-		76754525	+1	no_errors	ENST00000537592	ensembl	human	known	74_37	missense	SNP	1.000	G
CAPN13	92291	genome.wustl.edu	37	2	30954221	30954221	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr2:30954221T>C	ENST00000295055.8	-	21	2148	c.1972A>G	c.(1972-1974)Aca>Gca	p.T658A	CAPN13_ENST00000534090.2_Missense_Mutation_p.T658A	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	658	EF-hand 2.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					TCCATTTCTGTCAGGTAGAGT	0.532																																																	0								ENSG00000162949						57.0	56.0	56.0					2																	30954221		1921	4117	6038	CAPN13	SO:0001583	missense	0			-	HGNC		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.1972A>G	2.37:g.30954221T>C	ENSP00000295055:p.Thr658Ala	Somatic	0	61	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	42	16.00	Q17RF0|Q580X1|Q8TE80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.T658A	ENST00000295055.8	37	c.1972	CCDS46252.1	2	.	.	.	.	.	.	.	.	.	.	T	12.96	2.095040	0.36952	.	.	ENSG00000162949	ENST00000295055;ENST00000534090	T;T	0.29142	1.58;1.58	5.44	4.29	0.51040	EF-hand-like domain (1);	10.584500	0.00166	N	0.000000	T	0.34919	0.0914	M	0.71581	2.175	0.29346	N	0.86571	P	0.47302	0.893	B	0.35240	0.198	T	0.39313	-0.9620	10	0.59425	D	0.04	.	7.9603	0.30068	0.0:0.0931:0.0:0.9069	.	658	Q6MZZ7	CAN13_HUMAN	A	658	ENSP00000295055:T658A;ENSP00000431298:T658A	ENSP00000295055:T658A	T	-	1	0	CAPN13	30807725	1.000000	0.71417	1.000000	0.80357	0.469000	0.32828	3.940000	0.56599	0.906000	0.36621	0.528000	0.53228	ACA	-	NULL		0.532	CAPN13-001	KNOWN	basic|CCDS	protein_coding	CAPN13	protein_coding	OTTHUMT00000325101.2	T	NM_144575	-		30954221	-1	no_errors	ENST00000295055	ensembl	human	known	74_37	missense	SNP	0.999	C
PDE3A	5139	genome.wustl.edu	37	12	20833347	20833347	+	3'UTR	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr12:20833347G>T	ENST00000359062.3	+	0	3608				PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	CGCATTTTGTGTGTATATTTT	0.358																																																	0								ENSG00000172572																																			PDE3A	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.*142G>T	12.37:g.20833347G>T		Somatic	0	95	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	64	9.86	O60865|Q13348|Q17RD1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359062.3	37	NULL	CCDS31754.1	12																																																																																			-	-		0.358	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	protein_coding	OTTHUMT00000401756.2	G		-		20833347	+1	no_errors	ENST00000544307	ensembl	human	known	74_37	rna	SNP	0.992	T
LAMA3	3909	genome.wustl.edu	37	18	21427505	21427505	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr18:21427505T>A	ENST00000313654.9	+	32	4250	c.4009T>A	c.(4009-4011)Tgt>Agt	p.C1337S	LAMA3_ENST00000399516.3_Missense_Mutation_p.C1337S	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1337	Domain III B.|Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CAGGCCCCAGTGTGAGGTGTG	0.632																																																	0								ENSG00000053747						36.0	40.0	39.0					18																	21427505		2073	4193	6266	LAMA3	SO:0001583	missense	0			-	HGNC	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.4009T>A	18.37:g.21427505T>A	ENSP00000324532:p.Cys1337Ser	Somatic	0	64	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	90	13.46	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Growth_fac_rcpt_N_dom,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.C1337S	ENST00000313654.9	37	c.4009	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	T	24.4	4.525916	0.85600	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	D;D	0.90900	-2.75;-2.75	5.54	5.54	0.83059	EGF-like, laminin (2);	.	.	.	.	D	0.96787	0.8951	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	D	0.97987	1.0352	9	0.87932	D	0	.	15.691	0.77453	0.0:0.0:0.0:1.0	.	1337;1337	Q6VU67;Q16787	.;LAMA3_HUMAN	S	1337;1337;1335	ENSP00000324532:C1337S;ENSP00000382432:C1337S	ENSP00000324532:C1337S	C	+	1	0	LAMA3	19681503	1.000000	0.71417	0.994000	0.49952	0.593000	0.36681	7.665000	0.83852	2.118000	0.64928	0.459000	0.35465	TGT	-	smart_EGF_laminin		0.632	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	protein_coding	OTTHUMT00000254824.3	T	NM_000227, NM_198129	-		21427505	+1	no_errors	ENST00000313654	ensembl	human	known	74_37	missense	SNP	1.000	A
KRT18P66	442405	genome.wustl.edu	37	9	30774270	30774270	+	RNA	SNP	A	A	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr9:30774270A>T	ENST00000390176.2	+	0	45																											TGAGGAGAGCACCACAGTGGT	0.532																																																	0								ENSG00000211510																																			AL590726.1			0			-	Clone_based_ensembl_gene																													9.37:g.30774270A>T		Somatic	0	37	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000390176.2	37	NULL		9																																																																																			-	-		0.532	AL590726.1-201	NOVEL	basic	miRNA	ENSG00000211510	miRNA		A		-		30774270	+1	no_errors	ENST00000390176	ensembl	human	novel	74_37	rna	SNP	0.928	T
SH3BP5	9467	genome.wustl.edu	37	3	15297082	15297083	+	3'UTR	INS	-	-	T	rs544125875		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:15297082_15297083insT	ENST00000383791.3	-	0	2098_2099				SH3BP5-AS1_ENST00000436602.1_RNA|SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5-AS1_ENST00000420195.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)						intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						GTGTTCTTGGATTTTTTTTTTT	0.361																																																	0								ENSG00000224660																																			SH3BP5-AS1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.*511->A	3.37:g.15297093_15297093dupT		Somatic	0	18	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	B3KQW6|Q5JWV9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000383791.3	37	NULL	CCDS2625.2	3																																																																																			-	-		0.361	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5-AS1	protein_coding	OTTHUMT00000340740.2	-	NM_004844			15297083	+1	no_errors	ENST00000420195	ensembl	human	known	74_37	rna	INS	0.057:0.010	T
ZBED1	9189	genome.wustl.edu	37	X	2408604	2408604	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chrX:2408604G>A	ENST00000381223.4	-	2	360	c.157C>T	c.(157-159)Cag>Tag	p.Q53*	ZBED1_ENST00000381218.3_Nonsense_Mutation_p.Q53*|DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000515319.1_5'Flank|ZBED1_ENST00000381222.2_Nonsense_Mutation_p.Q53*	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	53					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TAGGCGATCTGGGCCATGCAG	0.562																																																	0								ENSG00000214717						226.0	201.0	210.0					X																	2408604		2203	4296	6499	ZBED1	SO:0001587	stop_gained	0			-	HGNC	AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.157C>T	X.37:g.2408604G>A	ENSP00000370621:p.Gln53*	Somatic	0	200	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	92	23.97	Q96BY4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HATC_dom_C,pfam_Znf_BED_prd,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.Q53*	ENST00000381223.4	37	c.157	CCDS14118.1	X	.	.	.	.	.	.	.	.	.	.	G	22.8	4.336234	0.81801	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218;ENST00000461691	.	.	.	2.46	2.46	0.29980	.	0.295883	0.20570	U	0.089745	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-23.935	12.7367	0.57228	0.0:0.0:1.0:0.0	.	.	.	.	X	53	.	ENSP00000370616:Q53X	Q	-	1	0	ZBED1	2418604	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	6.339000	0.72969	0.995000	0.38917	0.425000	0.28330	CAG	-	pfam_Znf_BED_prd,smart_Znf_BED_prd,pfscan_Znf_BED_prd		0.562	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED1	protein_coding	OTTHUMT00000144310.3	G	NM_004729	-		2408604	-1	no_errors	ENST00000381218	ensembl	human	known	74_37	nonsense	SNP	1.000	A
AKT2	208	genome.wustl.edu	37	19	40781025	40781025	+	Intron	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:40781025C>T	ENST00000392038.2	-	2	215				AKT2_ENST00000579047.1_Intron|CTC-425O23.2_ENST00000378432.1_RNA	NM_001243027.1|NM_001243028.1|NM_001626.4	NP_001229956.1|NP_001229957.1|NP_001617.1	P31751	AKT2_HUMAN	v-akt murine thymoma viral oncogene homolog 2						activation of Ral GTPase activity (GO:0032859)|apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|fat cell differentiation (GO:0045444)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|insulin receptor signaling pathway (GO:0008286)|intracellular protein transmembrane transport (GO:0065002)|mammary gland epithelial cell differentiation (GO:0060644)|membrane organization (GO:0061024)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of cell motility (GO:2000147)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)|protein localization to plasma membrane (GO:0072659)|regulation of cell cycle arrest (GO:0071156)|regulation of cell migration (GO:0030334)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(3)|large_intestine(9)|lung(10)|prostate(2)|skin(1)	27			Lung(22;0.000499)			CGAGAGACAGCAGGGACACAG	0.597			A		"""ovarian, pancreatic """																																			Dom	yes		19	19q13.1-q13.2	208	v-akt murine thymoma viral oncogene homolog 2		E	0								ENSG00000205041																																			CTC-425O23.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	M77198	CCDS12552.1	19q13.1-q13.2	2013-01-10			ENSG00000105221	ENSG00000105221	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	392	protein-coding gene	gene with protein product		164731				1409633	Standard	NM_001626		Approved		uc002onf.3	P31751	OTTHUMG00000137375	ENST00000392038.2:c.84-9767G>A	19.37:g.40781025C>T		Somatic	0	80	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B2RBD8|Q05BV0|Q0VAN0|Q0VAN1|Q68GC0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392038.2	37	NULL	CCDS12552.1	19																																																																																			-	-		0.597	AKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000205041	protein_coding	OTTHUMT00000268029.1	C	NM_001626	-		40781025	-1	no_errors	ENST00000378432	ensembl	human	known	74_37	rna	SNP	0.006	T
RELA	5970	genome.wustl.edu	37	11	65425869	65425869	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr11:65425869G>A	ENST00000406246.3	-	8	1027	c.766C>T	c.(766-768)Ccc>Tcc	p.P256S	RELA_ENST00000308639.9_Missense_Mutation_p.P253S|RELA_ENST00000525693.1_Missense_Mutation_p.P256S	NM_001243984.1|NM_001243985.1|NM_021975.3	NP_001230913.1|NP_001230914.1|NP_068810.3	Q04206	TF65_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog A	256	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				acetaldehyde metabolic process (GO:0006117)|aging (GO:0007568)|cellular defense response (GO:0006968)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nicotine (GO:0071316)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|Fc-epsilon receptor signaling pathway (GO:0038095)|hair follicle development (GO:0001942)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|liver development (GO:0001889)|membrane protein intracellular domain proteolysis (GO:0031293)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of Schwann cell differentiation (GO:0014040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of inflammatory response (GO:0050727)|response to amino acid (GO:0043200)|response to cAMP (GO:0051591)|response to cobalamin (GO:0033590)|response to drug (GO:0042493)|response to insulin (GO:0032868)|response to interleukin-1 (GO:0070555)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to muramyl dipeptide (GO:0032495)|response to organic substance (GO:0010033)|response to progesterone (GO:0032570)|response to UV-B (GO:0010224)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phosphate ion binding (GO:0042301)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|repressing transcription factor binding (GO:0070491)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(11)|ovary(1)|urinary_tract(1)	19						TCTGCGTAGGGAGGGGTCCGG	0.622																																																	0								ENSG00000173039						85.0	79.0	81.0					11																	65425869		2201	4297	6498	RELA	SO:0001583	missense	0			-	HGNC	Z22951	CCDS31609.1, CCDS44651.1, CCDS73322.1	11q13	2013-07-09	2013-07-09		ENSG00000173039	ENSG00000173039			9955	protein-coding gene	gene with protein product		164014	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells 3"""	NFKB3		2001591	Standard	NM_021975		Approved	p65	uc001ofg.3	Q04206	OTTHUMG00000166566	ENST00000406246.3:c.766C>T	11.37:g.65425869G>A	ENSP00000384273:p.Pro256Ser	Somatic	0	51	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	45	19.30	Q6GTV1|Q6SLK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NF_Rel_Dor	p.P256S	ENST00000406246.3	37	c.766	CCDS31609.1	11	.	.	.	.	.	.	.	.	.	.	G	20.2	3.950267	0.73787	.	.	ENSG00000173039	ENST00000406246;ENST00000525693;ENST00000308639;ENST00000545816;ENST00000532999	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.11	5.11	0.69529	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.065076	0.64402	D	0.000007	T	0.66799	0.2826	M	0.77820	2.39	0.58432	D	0.999995	B;D;D;D;P;B	0.59767	0.342;0.986;0.986;0.977;0.95;0.442	B;P;P;P;B;B	0.51385	0.121;0.668;0.668;0.467;0.371;0.08	T	0.72020	-0.4416	10	0.66056	D	0.02	-17.8222	11.8732	0.52531	0.0:0.1763:0.8236:0.0	.	246;243;253;256;267;256	Q04206-3;Q04206-2;Q04206-4;Q04206;B4E082;Q2TAM5	.;.;.;TF65_HUMAN;.;.	S	256;256;253;267;267	ENSP00000384273:P256S;ENSP00000432537:P256S;ENSP00000311508:P253S;ENSP00000433526:P267S	ENSP00000311508:P253S	P	-	1	0	RELA	65182445	1.000000	0.71417	0.981000	0.43875	0.993000	0.82548	5.257000	0.65473	2.397000	0.81536	0.555000	0.69702	CCC	-	superfamily_Ig_E-set,smart_IPT,prints_NF_Rel_Dor		0.622	RELA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELA	protein_coding	OTTHUMT00000390457.2	G	NM_021975	-		65425869	-1	no_errors	ENST00000406246	ensembl	human	known	74_37	missense	SNP	1.000	A
BLID	414899	genome.wustl.edu	37	11	121986407	121986407	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr11:121986407G>T	ENST00000560104.1	-	1	516	c.224C>A	c.(223-225)tCt>tAt	p.S75Y		NM_001001786.2	NP_001001786.2	Q8IZY5	BLID_HUMAN	BH3-like motif containing, cell death inducer	75					apoptotic process (GO:0006915)	mitochondrion (GO:0005739)				NS(1)|large_intestine(4)|lung(6)|pancreas(1)	12		Breast(109;0.0164)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;2.08e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.101)		CTTCATGGCAGAGGAGCCAAG	0.473											OREG0021435	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000259571						165.0	164.0	164.0					11																	121986407		2202	4299	6501	BLID	SO:0001583	missense	0			-	HGNC	AF303179	CCDS31693.1	11q24.1	2007-06-22				ENSG00000259571			33495	protein-coding gene	gene with protein product	"""breast cancer cell 2"""	608853				15069058, 17220890	Standard	NM_001001786		Approved	BRCC2	uc001pyf.3	Q8IZY5		ENST00000560104.1:c.224C>A	11.37:g.121986407G>T	ENSP00000453153:p.Ser75Tyr	Somatic	0	56	0.00	1515	0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A1L416	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S75Y	ENST00000560104.1	37	c.224	CCDS31693.1	11	.	.	.	.	.	.	.	.	.	.	G	9.247	1.039742	0.19669	.	.	ENSG00000258606;ENSG00000258574	ENST00000553434;ENST00000556841	.	.	.	4.19	-0.0419	0.13865	.	.	.	.	.	T	0.18593	0.0446	N	0.08118	0	0.09310	N	1	D	0.53462	0.96	P	0.47981	0.563	T	0.14811	-1.0459	8	0.87932	D	0	.	6.3598	0.21422	0.5274:0.0:0.4726:0.0	.	75	Q8IZY5	BLID_HUMAN	Y	75	.	ENSP00000448995:S75Y	S	-	2	0	BLID;AP001924.1	121491617	0.011000	0.17503	0.000000	0.03702	0.003000	0.03518	0.381000	0.20619	0.002000	0.14630	-0.229000	0.12294	TCT	-	NULL		0.473	BLID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLID	protein_coding	OTTHUMT00000387656.1	G	NM_001001786	-		121986407	-1	no_errors	ENST00000560104	ensembl	human	known	74_37	missense	SNP	0.000	T
FLT4	2324	genome.wustl.edu	37	5	180030333	180030333	+	Silent	SNP	C	C	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr5:180030333C>G	ENST00000261937.6	-	30	4029	c.3951G>C	c.(3949-3951)ggG>ggC	p.G1317G		NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	1317					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCCGCCGCCTCCCTTGGGAGT	0.627																																					Colon(97;1075 1466 27033 27547 35871)												0								ENSG00000037280						23.0	24.0	24.0					5																	180030333		2203	4300	6503	FLT4	SO:0001819	synonymous_variant	0			-	HGNC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.3951G>C	5.37:g.180030333C>G		Somatic	0	116	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	77	16.13	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR3_rcpt	p.G1317	ENST00000261937.6	37	c.3951	CCDS4457.1	5																																																																																			-	NULL		0.627	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	protein_coding	OTTHUMT00000253527.4	C		-		180030333	-1	no_errors	ENST00000261937	ensembl	human	known	74_37	silent	SNP	0.144	G
PRNP	5621	genome.wustl.edu	37	20	4680309	4680309	+	Missense_Mutation	SNP	G	G	A	rs181348299	byFrequency	TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr20:4680309G>A	ENST00000379440.4	+	2	730	c.443G>A	c.(442-444)cGt>cAt	p.R148H	PRNP_ENST00000430350.2_Missense_Mutation_p.R148H	NM_000311.3|NM_001080121.1|NM_001080122.1|NM_001080123.1|NM_001271561.1|NM_183079.2	NP_000302.1|NP_001073590.1|NP_001073591.1|NP_001073592.1|NP_001258490.1|NP_898902.1	F7VJQ1	APRIO_HUMAN	prion protein	0						integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	14						TATGAGGACCGTTACTATCGT	0.547													G|||	2	0.000399361	0.0	0.0	5008	,	,		20173	0.0		0.001	False		,,,				2504	0.001																0			GRCh37	CM054824	PRNP	M	rs181348299	ENSG00000171867						119.0	91.0	100.0					20																	4680309		2203	4300	6503	PRNP	SO:0001583	missense	0			GMAF=0.0005	HGNC	M13899	CCDS13080.1	20p13	2014-06-05	2008-07-28		ENSG00000171867	ENSG00000171867		"""CD molecules"""	9449	protein-coding gene	gene with protein product	"""Creutzfeldt-Jakob disease"", ""Gerstmann-Strausler-Scheinker syndrome"", ""fatal familial insomnia"", ""p27-30"""	176640	"""prion protein (p27-30)"""	PRIP, GSS, CJD			Standard	NM_000311		Approved	CD230, PRP, AltPrP	uc002wkw.4	F7VJQ1	OTTHUMG00000031786	ENST00000379440.4:c.443G>A	20.37:g.4680309G>A	ENSP00000368752:p.Arg148His	Somatic	0	41	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prion/Doppel_prot_b-ribbon_dom,pfam_Prion_N_dom,superfamily_Prion/Doppel_prot_b-ribbon_dom,smart_Prion,prints_Prion	p.R148H	ENST00000379440.4	37	c.443	CCDS13080.1	20	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	22.3	4.272438	0.80580	.	.	ENSG00000171867	ENST00000379440;ENST00000430350;ENST00000424424;ENST00000444805;ENST00000457586	D;D;D;D	0.91843	-2.92;-2.92;-2.92;-2.92	5.3	5.3	0.74995	Prion/Doppel protein, beta-ribbon domain (3);	0.000000	0.64402	D	0.000001	D	0.96024	0.8705	M	0.83012	2.62	0.52099	D	0.999941	D;B;D	0.89917	1.0;0.371;0.994	D;B;P	0.85130	0.997;0.102;0.716	D	0.96402	0.9297	10	0.87932	D	0	-1.5874	14.4393	0.67303	0.0:0.0:1.0:0.0	.	148;148;180	B2NI04;P04156;O75942	.;PRIO_HUMAN;.	H	148;148;148;87;148	ENSP00000368752:R148H;ENSP00000399376:R148H;ENSP00000411599:R148H;ENSP00000415284:R148H	ENSP00000368752:R148H	R	+	2	0	PRNP	4628309	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.119000	0.57891	2.486000	0.83907	0.655000	0.94253	CGT	-	pfam_Prion/Doppel_prot_b-ribbon_dom,superfamily_Prion/Doppel_prot_b-ribbon_dom,smart_Prion,prints_Prion		0.547	PRNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRNP	protein_coding	OTTHUMT00000077820.2	G	NM_000311	rs181348299		4680309	+1	no_errors	ENST00000379440	ensembl	human	known	74_37	missense	SNP	1.000	A
JUNB	3726	genome.wustl.edu	37	19	12902946	12902954	+	In_Frame_Del	DEL	GCAGGGGGC	GCAGGGGGC	-	rs555879172	byFrequency	TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	GCAGGGGGC	GCAGGGGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:12902946_12902954delGCAGGGGGC	ENST00000302754.4	+	1	637_645	c.361_369delGCAGGGGGC	c.(361-369)gcagggggcdel	p.AGG124del		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	124				A -> G (in Ref. 5; AAH09465). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						CGGTGGAGGTGCAGGGGGCGCAGGGGGCG	0.66														4	0.000798722	0.0008	0.0043	5008	,	,		13258	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000171223			11,3913		4,3,1955						-1.2	1.0			8	17,7719		7,3,3858	no	coding	JUNB	NM_002229.2		11,6,5813	A1A1,A1R,RR		0.2198,0.2803,0.2401				28,11632				JUNB	SO:0001651	inframe_deletion	0				HGNC	M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.361_369delGCAGGGGGC	19.37:g.12902955_12902963delGCAGGGGGC	ENSP00000303315:p.Ala124_Gly126del	Somatic	NA	NA	NA		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96GH3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_JNK,pfam_bZIP,superfamily_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.AGG124in_frame_del	ENST00000302754.4	37	c.361_369	CCDS12280.1	19																																																																																			-	pfam_JNK		0.660	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUNB	protein_coding	OTTHUMT00000451015.1	GCAGGGGGC	NM_002229			12902954	+1	no_errors	ENST00000302754	ensembl	human	known	74_37	in_frame_del	DEL	0.966:0.969:0.937:0.987:0.990:0.985:0.851:0.799:0.762	-
KDM2A	22992	genome.wustl.edu	37	11	67023809	67023809	+	3'UTR	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr11:67023809G>T	ENST00000529006.2	+	0	5218				KDM2A_ENST00000398645.2_3'UTR|KDM2A_ENST00000308783.5_3'UTR|KDM2A_ENST00000530342.1_3'UTR|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						GCAGCAGAGAGCTTTTTGCAC	0.463																																																	0								ENSG00000173120																																			KDM2A	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.*1283G>T	11.37:g.67023809G>T		Somatic	0	48	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																			-	-		0.463	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	protein_coding	OTTHUMT00000393140.2	G	NM_012308	-		67023809	+1	no_errors	ENST00000524657	ensembl	human	known	74_37	rna	SNP	1.000	T
DAAM2	23500	genome.wustl.edu	37	6	39865095	39865095	+	Intron	SNP	T	T	C			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr6:39865095T>C	ENST00000398904.2	+	21	2800				DAAM2_ENST00000538976.1_Intron|RP11-61I13.3_ENST00000437947.1_RNA|RP11-61I13.3_ENST00000420293.1_RNA|RP11-61I13.3_ENST00000430595.1_RNA|DAAM2_ENST00000274867.4_Intron|RP11-61I13.3_ENST00000606829.1_RNA			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2						actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					CTCCCCATGATGACCCTCATT	0.453																																																	0								ENSG00000235033						47.0	45.0	45.0					6																	39865095		1932	4152	6084	RP11-61I13.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.2618+37T>C	6.37:g.39865095T>C		Somatic	0	82	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	60	23.08	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000398904.2	37	NULL	CCDS56426.1	6																																																																																			-	-		0.453	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	LOC100505635	protein_coding	OTTHUMT00000280648.1	T		-		39865095	-1	no_errors	ENST00000420293	ensembl	human	known	74_37	rna	SNP	0.000	C
PABPN1	8106	genome.wustl.edu	37	14	23790681	23790683	+	Start_Codon_Del	DEL	GGC	GGC	-			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	GGC	GGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr14:23790681_23790683delGGC	ENST00000216727.4	+	0	184_186				PABPN1_ENST00000556821.1_5'Flank|PABPN1_ENST00000397276.2_Start_Codon_Del|BCL2L2-PABPN1_ENST00000553781.1_Intron|PABPN1_ENST00000557702.1_5'Flank|BCL2L2-PABPN1_ENST00000557008.1_Intron	NM_004643.3	NP_004634.1	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1						gene expression (GO:0010467)|modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|muscle contraction (GO:0006936)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			large_intestine(1)|lung(1)|ovary(2)	4	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		GAgcggcgatggcggcggcggcg	0.778																																																	0								ENSG00000100836																																			PABPN1	SO:0001582	initiator_codon_variant	0				HGNC	AF026029	CCDS9592.1	14q11.2	2013-02-12	2001-11-28		ENSG00000100836	ENSG00000100836		"""RNA binding motif (RRM) containing"""	8565	protein-coding gene	gene with protein product		602279	"""poly(A)-binding protein, nuclear 1"""	OPMD, PABP2		7795598	Standard	NM_004643		Approved	PAB2		Q86U42	OTTHUMG00000028739		14.37:g.23790690_23790692delGGC		Somatic	0	36	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	D3DS49|O43484	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A5in_frame_del	ENST00000216727.4	37	c.3_5	CCDS9592.1	14																																																																																			-	NULL		0.778	PABPN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PABPN1	protein_coding	OTTHUMT00000071767.4	GGC	NM_004643			23790683	+1	no_errors	ENST00000216727	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
KIF22	3835	genome.wustl.edu	37	16	29816457	29816457	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr16:29816457G>A	ENST00000160827.4	+	13	1952	c.1912G>A	c.(1912-1914)Gag>Aag	p.E638K	KIF22_ENST00000569382.2_Missense_Mutation_p.E584K|MAZ_ENST00000322945.6_5'Flank|MAZ_ENST00000563402.1_5'Flank|MAZ_ENST00000219782.6_5'Flank|MAZ_ENST00000545521.1_5'Flank|MAZ_ENST00000568544.1_5'Flank|KIF22_ENST00000400751.5_Missense_Mutation_p.E570K|MAZ_ENST00000566906.2_5'Flank|KIF22_ENST00000561482.1_Missense_Mutation_p.E570K|MAZ_ENST00000562337.1_5'Flank|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000569978.1_5'Flank	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	638					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						GGAACGCGTGGAGGGCATAAC	0.682																																																	0								ENSG00000079616						73.0	63.0	66.0					16																	29816457		2197	4296	6493	KIF22	SO:0001583	missense	0			-	HGNC	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1912G>A	16.37:g.29816457G>A	ENSP00000160827:p.Glu638Lys	Somatic	0	50	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	46	11.54	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_RuvA_2-like,smart_Kinesin_motor_dom,smart_Hlx-hairpin-Hlx_DNA-bd_motif,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E638K	ENST00000160827.4	37	c.1912	CCDS10653.1	16	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939806	0.52972	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	T;T	0.73152	-0.63;-0.72	4.86	3.83	0.44106	Helix-hairpin-helix DNA-binding motif, class 1 (1);	.	.	.	.	T	0.47838	0.1467	N	0.04335	-0.225	0.80722	D	1	B;B	0.15473	0.013;0.011	B;B	0.20184	0.028;0.015	T	0.38628	-0.9652	9	0.41790	T	0.15	.	10.1201	0.42616	0.1114:0.0:0.8886:0.0	.	570;638	B7Z265;Q14807	.;KIF22_HUMAN	K	638;570	ENSP00000160827:E638K;ENSP00000383562:E570K	ENSP00000160827:E638K	E	+	1	0	KIF22	29723958	1.000000	0.71417	0.871000	0.34182	0.570000	0.35934	3.903000	0.56318	1.041000	0.40125	0.561000	0.74099	GAG	-	superfamily_RuvA_2-like,smart_Hlx-hairpin-Hlx_DNA-bd_motif		0.682	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF22	protein_coding	OTTHUMT00000215012.2	G		-		29816457	+1	no_errors	ENST00000160827	ensembl	human	known	74_37	missense	SNP	1.000	A
LINC00266-1	140849	genome.wustl.edu	37	20	62934863	62934864	+	RNA	INS	-	-	TT	rs370163240|rs4057443		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr20:62934863_62934864insTT	ENST00000279067.3	+	0	879_880					NR_040415.1				long intergenic non-protein coding RNA 266-1																		GTAATTTTAACTGTGATTTATT	0.332																																																	0								ENSG00000149656																																			LINC00266-1			0				HGNC	BC118988		20q13.33	2012-10-12	2011-08-11	2011-08-11	ENSG00000149656	ENSG00000149656		"""Long non-coding RNAs"""	16202	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 69"", ""non-protein coding RNA 266"", ""non-protein coding RNA 266-1"""	C20orf69, NCRNA00266, NCRNA00266-1			Standard	NR_040415		Approved	bA476I15.3	uc002yio.1		OTTHUMG00000033036		20.37:g.62934863_62934864insTT		Somatic	0	40	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000279067.3	37	NULL		20																																																																																			-	-		0.332	LINC00266-1-001	KNOWN	basic	processed_transcript	LINC00266-1	processed_transcript	OTTHUMT00000080304.2	-				62934864	+1	no_errors	ENST00000279067	ensembl	human	known	74_37	rna	INS	0.448:0.498	TT
ANTXRLP1	100996567	genome.wustl.edu	37	10	47640774	47640792	+	RNA	DEL	AAGCTGAGTGTTGGGAGAG	AAGCTGAGTGTTGGGAGAG	-	rs144049238|rs139997534|rs59150445|rs59784451	byFrequency	TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	AAGCTGAGTGTTGGGAGAG	AAGCTGAGTGTTGGGAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr10:47640774_47640792delAAGCTGAGTGTTGGGAGAG	ENST00000454837.1	-	0	17_35					NR_103827.1				anthrax toxin receptor-like pseudogene 1																		ATtgggagaaaagctgagtgttgggagagaagctgaggc	0.493														2692	0.53754	0.5303	0.6484	5008	,	,		21433	0.2996		0.6461	False		,,,				2504	0.6022																0								ENSG00000243536																																			ANTXRLP1			0				HGNC			10q11.22	2014-05-06			ENSG00000243536	ENSG00000263482			45004	pseudogene	pseudogene							Standard	NR_103827		Approved				OTTHUMG00000188317		10.37:g.47640774_47640792delAAGCTGAGTGTTGGGAGAG		Somatic	NA	NA	NA		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000454837.1	37	NULL		10																																																																																			-	-		0.493	ANTXRLP1-001	KNOWN	basic	processed_transcript	ANTXRLP1	pseudogene	OTTHUMT00000047859.2	AAGCTGAGTGTTGGGAGAG				47640792	-1	no_errors	ENST00000454837	ensembl	human	known	74_37	rna	DEL	0.069:0.070:0.070:0.070:0.068:0.065:0.062:0.057:0.052:0.046:0.038:0.038:0.038:0.036:0.034:0.031:0.027:0.022:0.016	-
OR52K1	390036	genome.wustl.edu	37	11	4511039	4511039	+	Missense_Mutation	SNP	G	G	T	rs540359247		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr11:4511039G>T	ENST00000307632.3	+	1	931	c.909G>T	c.(907-909)gaG>gaT	p.E303D		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		AGATTCGTGAGTATGTGCTCA	0.438																																																	0								ENSG00000196778						120.0	111.0	114.0					11																	4511039		2201	4298	6499	OR52K1	SO:0001583	missense	0			-	HGNC	AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.909G>T	11.37:g.4511039G>T	ENSP00000302422:p.Glu303Asp	Somatic	0	56	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B9EH54|Q6IFK5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E303D	ENST00000307632.3	37	c.909	CCDS31352.1	11	.	.	.	.	.	.	.	.	.	.	T	0.037	-1.300186	0.01364	.	.	ENSG00000196778	ENST00000307632	T	0.37584	1.19	4.5	-1.15	0.09709	.	0.434403	0.19381	N	0.115675	T	0.13970	0.0338	N	0.11892	0.195	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31503	-0.9941	10	0.07175	T	0.84	.	6.3969	0.21616	0.1129:0.0727:0.5674:0.247	.	303	Q8NGK4	O52K1_HUMAN	D	303	ENSP00000302422:E303D	ENSP00000302422:E303D	E	+	3	2	OR52K1	4467615	0.000000	0.05858	0.013000	0.15412	0.009000	0.06853	-6.552000	0.00061	-0.638000	0.05509	-0.690000	0.03725	GAG	-	NULL		0.438	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K1	protein_coding	OTTHUMT00000385846.1	G	NM_001005171	-		4511039	+1	no_errors	ENST00000307632	ensembl	human	known	74_37	missense	SNP	0.001	T
MKI67	4288	genome.wustl.edu	37	10	129903472	129903472	+	Missense_Mutation	SNP	G	G	C	rs193266380		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr10:129903472G>C	ENST00000368654.3	-	13	7007	c.6632C>G	c.(6631-6633)aCg>aGg	p.T2211R	MKI67_ENST00000368653.3_Missense_Mutation_p.T1851R	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2211	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CTCATGAGTCGTGGGCTTGTC	0.502																																																	0								ENSG00000148773						238.0	229.0	232.0					10																	129903472		2203	4300	6503	MKI67	SO:0001583	missense	0			-	HGNC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6632C>G	10.37:g.129903472G>C	ENSP00000357643:p.Thr2211Arg	Somatic	0	104	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	96	14.29	Q5VWH2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.T2211R	ENST00000368654.3	37	c.6632	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	G	10.60	1.395332	0.25205	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01279	5.08;5.06	2.65	-1.17	0.09648	.	1.762890	0.03255	N	0.182393	T	0.03564	0.0102	L	0.44542	1.39	0.09310	N	1	P;D;D	0.89917	0.907;1.0;0.987	B;D;P	0.68943	0.291;0.961;0.67	T	0.44862	-0.9300	10	0.16896	T	0.51	.	2.3456	0.04271	0.3201:0.0:0.2774:0.4025	.	2210;1851;2211	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	R	2211;1851;2210	ENSP00000357643:T2211R;ENSP00000357642:T1851R	ENSP00000357642:T1851R	T	-	2	0	MKI67	129793462	0.041000	0.20044	0.000000	0.03702	0.001000	0.01503	-0.016000	0.12613	-0.256000	0.09473	-0.367000	0.07326	ACG	-	NULL		0.502	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	protein_coding	OTTHUMT00000050999.1	G	NM_002417	-		129903472	-1	no_errors	ENST00000368654	ensembl	human	known	74_37	missense	SNP	0.000	C
FAM78B	149297	genome.wustl.edu	37	1	166135466	166135466	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr1:166135466A>T	ENST00000338353.3	-	2	609	c.20T>A	c.(19-21)aTc>aAc	p.I7N	FAM78B_ENST00000354422.3_Missense_Mutation_p.I7N|RP11-9L18.3_ENST00000451784.1_RNA			Q5VT40	FA78B_HUMAN	family with sequence similarity 78, member B	7										central_nervous_system(1)|endometrium(5)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(923;0.0813)|Acute lymphoblastic leukemia(8;0.155)					CTTGCAGGTGATGCTTTGGAT	0.731																																																	0								ENSG00000188859						48.0	35.0	39.0					1																	166135466		2198	4288	6486	FAM78B	SO:0001583	missense	0			-	HGNC	AL626787	CCDS30931.1	1q24.1	2008-02-05			ENSG00000188859	ENSG00000188859			13495	protein-coding gene	gene with protein product							Standard	NM_001017961		Approved		uc021pee.1	Q5VT40	OTTHUMG00000034705	ENST00000338353.3:c.20T>A	1.37:g.166135466A>T	ENSP00000339681:p.Ile7Asn	Somatic	0	82	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90	B7Z693	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I7N	ENST00000338353.3	37	c.20	CCDS30931.1	1	.	.	.	.	.	.	.	.	.	.	A	16.50	3.141657	0.57044	.	.	ENSG00000188859	ENST00000354422;ENST00000338353	.	.	.	4.01	4.01	0.46588	.	0.257566	0.39475	N	0.001355	T	0.28433	0.0703	L	0.38175	1.15	0.37110	D	0.900288	B	0.29085	0.232	B	0.37047	0.24	T	0.14587	-1.0467	7	.	.	.	-21.0486	10.9256	0.47189	1.0:0.0:0.0:0.0	.	7	Q5VT40	FA78B_HUMAN	N	7	.	.	I	-	2	0	FAM78B	164402090	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.485000	0.90448	1.656000	0.50722	0.383000	0.25322	ATC	-	NULL		0.731	FAM78B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM78B	protein_coding	OTTHUMT00000343108.1	A	NM_001017961	-		166135466	-1	no_errors	ENST00000338353	ensembl	human	known	74_37	missense	SNP	1.000	T
FRMPD1	22844	genome.wustl.edu	37	9	37740268	37740268	+	Silent	SNP	G	G	A	rs369271811		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr9:37740268G>A	ENST00000539465.1	+	15	2336	c.1743G>A	c.(1741-1743)acG>acA	p.T581T	FRMPD1_ENST00000536622.1_Silent_p.T403T|FRMPD1_ENST00000541302.1_Silent_p.T450T|RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Silent_p.T581T			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	581						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CCAGCAGCACGACAGACAGTG	0.647																																																	0								ENSG00000070601	G		1,4405	2.1+/-5.4	0,1,2202	31.0	35.0	34.0		1743	-5.5	0.0	9		34	0,8600		0,0,4300	no	coding-synonymous	FRMPD1	NM_014907.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		581/1579	37740268	1,13005	2203	4300	6503	FRMPD1	SO:0001819	synonymous_variant	0			-	HGNC	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.1743G>A	9.37:g.37740268G>A		Somatic	0	36	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_PDZ,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.T581	ENST00000539465.1	37	c.1743	CCDS6612.1	9																																																																																			-	NULL		0.647	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FRMPD1	protein_coding	OTTHUMT00000402969.1	G	NM_014907	-		37740268	+1	no_errors	ENST00000377765	ensembl	human	known	74_37	silent	SNP	0.000	A
MGAT5B	146664	genome.wustl.edu	37	17	74936909	74936909	+	Silent	SNP	C	C	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr17:74936909C>A	ENST00000569840.2	+	15	2401	c.1827C>A	c.(1825-1827)atC>atA	p.I609I	MGAT5B_ENST00000428789.2_Silent_p.I618I|MGAT5B_ENST00000301618.4_Silent_p.I607I	NM_001199172.1	NP_001186101.1	Q3V5L5	MGT5B_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B	609					protein N-linked glycosylation (GO:0006487)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(15)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AAGCAGCCATCAAGGCCATTA	0.542																																																	0								ENSG00000167889						72.0	67.0	69.0					17																	74936909		2203	4300	6503	MGAT5B	SO:0001819	synonymous_variant	0			-	HGNC	AB109185	CCDS11751.1, CCDS45788.1, CCDS59299.1	17q25.3	2013-02-25	2005-11-16		ENSG00000167889	ENSG00000167889		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	24140	protein-coding gene	gene with protein product		612441	"""mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isoenzyme B"""			14617637, 14623122	Standard	NM_001199172		Approved	GnT-IX, FLJ25132, GnT-VB	uc002jth.3	Q3V5L5	OTTHUMG00000177278	ENST00000569840.2:c.1827C>A	17.37:g.74936909C>A		Somatic	0	19	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32	Q6P3S8|Q6P6B3|Q766X5|Q76D04|Q96LS2	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_PyrdxlP-dep_Trfase	p.I618	ENST00000569840.2	37	c.1854	CCDS59299.1	17																																																																																			-	NULL		0.542	MGAT5B-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGAT5B	protein_coding	OTTHUMT00000460624.2	C	NM_144677	-		74936909	+1	no_errors	ENST00000428789	ensembl	human	known	74_37	silent	SNP	1.000	A
SLMAP	7871	genome.wustl.edu	37	3	57894866	57894866	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:57894866A>G	ENST00000428312.1	+	17	1731	c.1637A>G	c.(1636-1638)cAg>cGg	p.Q546R	SLMAP_ENST00000416870.1_Missense_Mutation_p.Q39R|SLMAP_ENST00000472546.1_Intron|SLMAP_ENST00000442599.2_Intron|SLMAP_ENST00000494088.1_Missense_Mutation_p.Q39R|SLMAP_ENST00000449503.2_Missense_Mutation_p.Q508R|SLMAP_ENST00000295952.3_Missense_Mutation_p.Q529R|SLMAP_ENST00000295951.3_Missense_Mutation_p.Q529R|SLMAP_ENST00000495364.1_Missense_Mutation_p.Q80R			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	546					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		AAACAAATACAGGTTCTTCAA	0.373																																																	0								ENSG00000163681						92.0	101.0	98.0					3																	57894866		2203	4300	6503	SLMAP	SO:0001583	missense	0			-	HGNC	AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.1637A>G	3.37:g.57894866A>G	ENSP00000398661:p.Gln546Arg	Somatic	0	110	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	123	8.89	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FHA_dom,pfam_PFD_beta-like,superfamily_SMAD_FHA_domain,superfamily_Prefoldin,smart_FHA_dom,pfscan_FHA_dom	p.Q546R	ENST00000428312.1	37	c.1637		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.97|16.97	3.269745|3.269745	0.59540|0.59540	.|.	.|.	ENSG00000163681|ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000416870;ENST00000428312;ENST00000449503;ENST00000537224;ENST00000495364;ENST00000494088;ENST00000461354;ENST00000466255|ENST00000417128	T;T;T;T;T;T;T|.	0.50001|.	0.76;0.76;0.76;1.25;0.76;0.76;0.76|.	5.15|5.15	5.15|5.15	0.70609|0.70609	Prefoldin beta-like (1);|.	0.252945|.	0.42172|.	D|.	0.000752|.	T|T	0.68522|0.68522	0.3010|0.3010	L|L	0.54323|0.54323	1.7|1.7	0.43485|0.43485	D|D	0.995713|0.995713	B;B;P;P;B;B;B|.	0.39940|.	0.452;0.27;0.551;0.696;0.005;0.005;0.218|.	P;B;P;B;B;B;B|.	0.45913|.	0.497;0.287;0.466;0.358;0.005;0.006;0.167|.	T|T	0.67189|0.67189	-0.5733|-0.5733	10|5	0.36615|.	T|.	0.2|.	-1.7802|-1.7802	14.9727|14.9727	0.71246|0.71246	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	39;80;39;140;508;546;529|.	B7Z863;Q14BN4-5;Q14BN4-8;Q14BN4-4;Q14BN4-2;Q14BN4;Q14BN4-3|.	.;.;.;.;.;SLMAP_HUMAN;.|.	R|G	529;529;39;546;508;140;80;39;80;39|130	ENSP00000295951:Q529R;ENSP00000295952:Q529R;ENSP00000412342:Q39R;ENSP00000398661:Q546R;ENSP00000412945:Q508R;ENSP00000419543:Q80R;ENSP00000418218:Q39R|.	ENSP00000295951:Q529R|.	Q|R	+|+	2|1	0|2	SLMAP|SLMAP	57869906|57869906	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.964000|0.964000	0.63967|0.63967	5.022000|5.022000	0.64078|0.64078	1.954000|1.954000	0.56735|0.56735	0.477000|0.477000	0.44152|0.44152	CAG|AGG	-	pfam_PFD_beta-like,superfamily_Prefoldin		0.373	SLMAP-013	KNOWN	basic	protein_coding	SLMAP	protein_coding	OTTHUMT00000351584.1	A	NM_007159	-		57894866	+1	no_errors	ENST00000428312	ensembl	human	known	74_37	missense	SNP	1.000	G
ZNF225	7768	genome.wustl.edu	37	19	44635365	44635365	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:44635365G>T	ENST00000262894.6	+	5	878	c.598G>T	c.(598-600)Ggg>Tgg	p.G200W	ZNF225_ENST00000592780.1_3'UTR|ZNF225_ENST00000590612.1_Missense_Mutation_p.G200W	NM_013362.2	NP_037494.2	Q9UK10	ZN225_HUMAN	zinc finger protein 225	200					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	16		Prostate(69;0.0352)|all_neural(266;0.202)				AGTTCACATGGGGGAGAAACT	0.398																																																	0								ENSG00000256294						71.0	77.0	75.0					19																	44635365		2182	4298	6480	ZNF225	SO:0001583	missense	0			-	HGNC	AF187991	CCDS46100.1	19q13.31	2013-01-08				ENSG00000256294		"""Zinc fingers, C2H2-type"", ""-"""	13018	protein-coding gene	gene with protein product							Standard	NM_013362		Approved		uc002oyj.1	Q9UK10		ENST00000262894.6:c.598G>T	19.37:g.44635365G>T	ENSP00000262894:p.Gly200Trp	Somatic	0	54	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	38	20.83	A8K8S2|Q53F12|Q9NS46|Q9UID8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G200W	ENST00000262894.6	37	c.598	CCDS46100.1	19	.	.	.	.	.	.	.	.	.	.	G	17.61	3.432745	0.62844	.	.	ENSG00000256294	ENST00000262894;ENST00000544184	T	0.26810	1.71	2.97	1.92	0.25849	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.59445	0.2194	H	0.95745	3.715	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50136	-0.8863	9	0.87932	D	0	.	9.0178	0.36182	0.1175:0.0:0.8825:0.0	.	200	Q9UK10	ZN225_HUMAN	W	200;164	ENSP00000262894:G200W	ENSP00000262894:G200W	G	+	1	0	ZNF225	49327205	0.887000	0.30362	0.004000	0.12327	0.880000	0.50808	3.420000	0.52735	0.562000	0.29204	0.561000	0.74099	GGG	-	pfscan_Znf_C2H2		0.398	ZNF225-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF225	protein_coding	OTTHUMT00000460581.1	G		-		44635365	+1	no_errors	ENST00000262894	ensembl	human	known	74_37	missense	SNP	0.091	T
ZNF710	374655	genome.wustl.edu	37	15	90611108	90611108	+	Missense_Mutation	SNP	G	G	T	rs550826482		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr15:90611108G>T	ENST00000268154.4	+	2	990	c.739G>T	c.(739-741)Gtg>Ttg	p.V247L		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	247					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			ACAGGGCTTCGTGTGGCAGGA	0.657																																																	0								ENSG00000140548						33.0	40.0	38.0					15																	90611108		2199	4288	6487	ZNF710	SO:0001583	missense	0			-	HGNC	AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.739G>T	15.37:g.90611108G>T	ENSP00000268154:p.Val247Leu	Somatic	0	144	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	111	11.90	A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V247L	ENST00000268154.4	37	c.739	CCDS10358.1	15	.	.	.	.	.	.	.	.	.	.	G	11.15	1.554707	0.27739	.	.	ENSG00000140548	ENST00000268154	T	0.08458	3.09	5.22	4.3	0.51218	.	1.710450	0.03420	N	0.206113	T	0.10723	0.0262	L	0.29908	0.895	0.36686	D	0.879295	B	0.06786	0.001	B	0.04013	0.001	T	0.12400	-1.0549	10	0.44086	T	0.13	-32.4007	13.9545	0.64140	0.0:0.0:0.8469:0.1531	.	247	Q8N1W2	ZN710_HUMAN	L	247	ENSP00000268154:V247L	ENSP00000268154:V247L	V	+	1	0	ZNF710	88412112	.	.	0.998000	0.56505	0.855000	0.48748	.	.	1.407000	0.46875	0.561000	0.74099	GTG	-	NULL		0.657	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF710	protein_coding	OTTHUMT00000313423.1	G	NM_198526	-		90611108	+1	no_errors	ENST00000268154	ensembl	human	known	74_37	missense	SNP	0.972	T
UBE2I	7329	genome.wustl.edu	37	16	1364372	1364372	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr16:1364372A>G	ENST00000355803.4	+	3	696	c.145A>G	c.(145-147)Aaa>Gaa	p.K49E	UBE2I_ENST00000397515.2_Missense_Mutation_p.K49E|UBE2I_ENST00000566587.1_Missense_Mutation_p.K49E|UBE2I_ENST00000325437.5_Missense_Mutation_p.K49E|UBE2I_ENST00000397514.3_Missense_Mutation_p.K49E|UBE2I_ENST00000402301.1_Missense_Mutation_p.K49E|UBE2I_ENST00000403747.2_Missense_Mutation_p.K49E|UBE2I_ENST00000406620.1_Missense_Mutation_p.K49E	NM_194260.2	NP_919236.1	P63279	UBC9_HUMAN	ubiquitin-conjugating enzyme E2I	49					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intracellular steroid hormone receptor signaling pathway (GO:0033145)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein sumoylation (GO:0016925)|regulation of receptor activity (GO:0010469)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|fibrillar center (GO:0001650)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RING-like zinc finger domain binding (GO:0071535)|SUMO ligase activity (GO:0019789)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	5		Hepatocellular(780;0.00369)				TCCAGGAAAGAAAGGGGTAAG	0.582																																																	0								ENSG00000103275						63.0	62.0	62.0					16																	1364372		2199	4300	6499	UBE2I	SO:0001583	missense	0			-	HGNC	D45050	CCDS10433.1	16p13.3	2011-05-19	2011-05-19		ENSG00000103275	ENSG00000103275	6.3.2.19	"""Ubiquitin-conjugating enzymes E2"""	12485	protein-coding gene	gene with protein product		601661	"""ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9)"", ""ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)"""			8565643	Standard	NM_003345		Approved	UBC9	uc002cld.2	P63279	OTTHUMG00000047845	ENST00000355803.4:c.145A>G	16.37:g.1364372A>G	ENSP00000348056:p.Lys49Glu	Somatic	0	71	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	34	17.07	D3DU69|P50550|Q15698|Q59GX1|Q86VB3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.K49E	ENST00000355803.4	37	c.145	CCDS10433.1	16	.	.	.	.	.	.	.	.	.	.	A	11.87	1.767138	0.31320	.	.	ENSG00000103275	ENST00000325437;ENST00000355803;ENST00000397514;ENST00000397515;ENST00000406620;ENST00000403747;ENST00000402301	T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29	5.0	2.66	0.31614	Ubiquitin-conjugating enzyme, E2 (2);Ubiquitin-conjugating enzyme/RWD-like (2);	0.000000	0.85682	D	0.000000	T	0.17916	0.0430	N	0.20766	0.605	0.80722	D	1	P;B	0.36330	0.548;0.042	B;B	0.36030	0.216;0.096	T	0.05273	-1.0895	10	0.10377	T	0.69	.	5.7749	0.18273	0.7649:0.0:0.0867:0.1485	.	49;49	B0QYN7;P63279	.;UBC9_HUMAN	E	49	ENSP00000324897:K49E;ENSP00000348056:K49E;ENSP00000380649:K49E;ENSP00000380650:K49E;ENSP00000384568:K49E;ENSP00000385009:K49E;ENSP00000384361:K49E	ENSP00000324897:K49E	K	+	1	0	UBE2I	1304373	1.000000	0.71417	0.985000	0.45067	0.736000	0.42039	7.383000	0.79741	0.725000	0.32318	-0.336000	0.08194	AAA	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2		0.582	UBE2I-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBE2I	protein_coding	OTTHUMT00000250317.2	A	NM_003345	-		1364372	+1	no_errors	ENST00000325437	ensembl	human	known	74_37	missense	SNP	1.000	G
EMR1	2015	genome.wustl.edu	37	19	6896476	6896476	+	Silent	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:6896476C>T	ENST00000312053.4	+	3	199	c.162C>T	c.(160-162)taC>taT	p.Y54Y	EMR1_ENST00000450315.3_Silent_p.Y54Y|EMR1_ENST00000381407.5_Silent_p.Y54Y|EMR1_ENST00000250572.8_Silent_p.Y54Y|EMR1_ENST00000381404.4_Silent_p.Y54Y|AC020895.1_ENST00000580648.1_RNA|EMR1_ENST00000601198.1_3'UTR	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	54	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					TGGACAGTTACTATTGCGCTT	0.458																																																	0								ENSG00000174837						185.0	152.0	163.0					19																	6896476		2203	4300	6503	EMR1	SO:0001819	synonymous_variant	0			-	HGNC	X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.162C>T	19.37:g.6896476C>T		Somatic	0	86	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like	p.Y54	ENST00000312053.4	37	c.162	CCDS12175.1	19																																																																																			-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.458	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR1	protein_coding	OTTHUMT00000458485.1	C		-		6896476	+1	no_errors	ENST00000312053	ensembl	human	known	74_37	silent	SNP	0.095	T
LRRC8A	56262	genome.wustl.edu	37	9	131670884	131670884	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr9:131670884G>T	ENST00000259324.5	+	3	1964	c.1441G>T	c.(1441-1443)Gcc>Tcc	p.A481S	LRRC8A_ENST00000372599.3_Missense_Mutation_p.A481S|LRRC8A_ENST00000372600.4_Missense_Mutation_p.A481S	NM_001127244.1	NP_001120716.1	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member A	481					anion transport (GO:0006820)|cell volume homeostasis (GO:0006884)|pre-B cell differentiation (GO:0002329)|response to osmotic stress (GO:0006970)	cell surface (GO:0009986)|ion channel complex (GO:0034702)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(3)	28						CCACACAGCGGCCAAGATTGA	0.622																																																	0								ENSG00000136802						18.0	18.0	18.0					9																	131670884		2196	4296	6492	LRRC8A	SO:0001583	missense	0			-	HGNC	AB037858	CCDS35155.1	9q34.2	2014-09-17	2005-06-29	2005-06-29	ENSG00000136802	ENSG00000136802			19027	protein-coding gene	gene with protein product		608360	"""leucine rich repeat containing 8"""	LRRC8			Standard	NM_001127244		Approved	KIAA1437, FLJ10337	uc010myp.3	Q8IWT6	OTTHUMG00000020766	ENST00000259324.5:c.1441G>T	9.37:g.131670884G>T	ENSP00000259324:p.Ala481Ser	Somatic	0	21	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	Q6UXM2|Q8NCI0|Q9P2B1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A481S	ENST00000259324.5	37	c.1441	CCDS35155.1	9	.	.	.	.	.	.	.	.	.	.	G	15.26	2.782010	0.49891	.	.	ENSG00000136802	ENST00000372600;ENST00000372599;ENST00000259324	T;T;T	0.24538	1.85;1.85;1.85	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.32556	0.0833	L	0.55481	1.735	0.80722	D	1	D	0.61080	0.989	P	0.45167	0.472	T	0.07424	-1.0773	10	0.54805	T	0.06	.	18.4034	0.90525	0.0:0.0:1.0:0.0	.	481	Q8IWT6	LRC8A_HUMAN	S	481	ENSP00000361682:A481S;ENSP00000361680:A481S;ENSP00000259324:A481S	ENSP00000259324:A481S	A	+	1	0	LRRC8A	130710705	1.000000	0.71417	0.958000	0.39756	0.235000	0.25334	9.869000	0.99810	2.595000	0.87683	0.561000	0.74099	GCC	-	NULL		0.622	LRRC8A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8A	protein_coding	OTTHUMT00000054516.2	G	NM_019594	-		131670884	+1	no_errors	ENST00000259324	ensembl	human	known	74_37	missense	SNP	1.000	T
SELV	348303	genome.wustl.edu	37	19	40009544	40009544	+	Splice_Site	SNP	A	A	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:40009544A>G	ENST00000335426.4	+	4	990	c.890A>G	c.(889-891)gAg>gGg	p.E297G	SELV_ENST00000423711.1_Splice_Site_p.E297G	NM_182704.1	NP_874363.1	P59797	SELV_HUMAN		297					cell redox homeostasis (GO:0045454)		selenium binding (GO:0008430)	p.E297V(1)		breast(1)|endometrium(1)|lung(3)|prostate(1)	6	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;8.61e-26)|all cancers(26;2.76e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			TCCTCCCAGGAGGAGGACAGA	0.602																																																	1	Substitution - Missense(1)	prostate(1)						ENSG00000186838						112.0	113.0	112.0					19																	40009544		1941	4141	6082	SELV	SO:0001630	splice_region_variant	0			-	Uniprot_gn																												ENST00000335426.4:c.889-1A>G	19.37:g.40009544A>G		Somatic	0	37	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	32	23.81	Q17RG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Selenoprotein_Rdx-typ,superfamily_Thioredoxin-like_fold,tigrfam_Selenoprotein_Rdx-typ	p.E297G	ENST00000335426.4	37	c.890	CCDS54266.1	19	.	.	.	.	.	.	.	.	.	.	A	17.44	3.389196	0.61956	.	.	ENSG00000186838	ENST00000335426;ENST00000423711	T;T	0.52057	0.68;0.68	3.88	1.47	0.22746	Thioredoxin-like fold (2);	.	.	.	.	T	0.52725	0.1752	L	0.43152	1.355	0.30368	N	0.783169	D	0.89917	1.0	D	0.75020	0.985	T	0.48917	-0.8992	9	0.29301	T	0.29	-6.7491	6.0082	0.19559	0.5763:0.0:0.0:0.4237	.	297	P59797	SELV_HUMAN	G	297	ENSP00000333956:E297G;ENSP00000412508:E297G	ENSP00000333956:E297G	E	+	2	0	AC011500.1	44701384	1.000000	0.71417	0.994000	0.49952	0.788000	0.44548	1.244000	0.32778	0.617000	0.30160	0.392000	0.25879	GAG	-	pfam_Selenoprotein_Rdx-typ,superfamily_Thioredoxin-like_fold,tigrfam_Selenoprotein_Rdx-typ		0.602	SELV-001	KNOWN	basic|appris_candidate_longest|CCDS|seleno	protein_coding	SELV	protein_coding	OTTHUMT00000389802.1	A		-	Missense_Mutation	40009544	+1	no_errors	ENST00000423711	ensembl	human	known	74_37	missense	SNP	0.985	G
RBM47	54502	genome.wustl.edu	37	4	40440825	40440825	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr4:40440825G>A	ENST00000381793.2	-	3	482	c.86C>T	c.(85-87)gCg>gTg	p.A29V	RBM47_ENST00000295971.7_Missense_Mutation_p.A29V|RBM47_ENST00000515809.1_Intron|RBM47_ENST00000381795.6_Missense_Mutation_p.A29V|RBM47_ENST00000319592.4_Missense_Mutation_p.A29V|RBM47_ENST00000514014.1_Intron			A0AV96	RBM47_HUMAN	RNA binding motif protein 47	29					hematopoietic progenitor cell differentiation (GO:0002244)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(5)|endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	29						CTCGTTGGGCGCGCCCGCCAC	0.687																																																	0								ENSG00000163694						7.0	9.0	8.0					4																	40440825		2124	4116	6240	RBM47	SO:0001583	missense	0			-	HGNC	AK000280	CCDS3460.1, CCDS43223.1	4p14	2013-02-12			ENSG00000163694	ENSG00000163694		"""RNA binding motif (RRM) containing"""	30358	protein-coding gene	gene with protein product							Standard	NM_019027		Approved	FLJ20273, NET18	uc003gvc.2	A0AV96	OTTHUMG00000128598	ENST00000381793.2:c.86C>T	4.37:g.40440825G>A	ENSP00000371212:p.Ala29Val	Somatic	0	44	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	34	20.93	A0PJK2|B5MED4|Q8NI52|Q8NI53|Q9NXG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.A29V	ENST00000381793.2	37	c.86	CCDS43223.1	4	.	.	.	.	.	.	.	.	.	.	G	12.29	1.895000	0.33442	.	.	ENSG00000163694	ENST00000319592;ENST00000381793;ENST00000381795;ENST00000295971;ENST00000515053;ENST00000513473;ENST00000505414;ENST00000514782;ENST00000507180;ENST00000511598;ENST00000511902;ENST00000505220	T;T;T;T;T;T;T;T;T;T	0.65364	2.32;2.28;2.32;2.28;1.81;1.76;1.78;1.77;0.37;-0.15	5.78	5.78	0.91487	.	0.594426	0.19202	N	0.120178	T	0.52901	0.1763	L	0.41961	1.31	0.54753	D	0.999982	B;B	0.27971	0.196;0.007	B;B	0.17098	0.017;0.006	T	0.47182	-0.9137	10	0.29301	T	0.29	-27.5965	14.2018	0.65710	0.0712:0.0:0.9288:0.0	.	29;29	A0AV96-2;A0AV96	.;RBM47_HUMAN	V	29	ENSP00000320108:A29V;ENSP00000371212:A29V;ENSP00000371214:A29V;ENSP00000295971:A29V;ENSP00000422564:A29V;ENSP00000421589:A29V;ENSP00000423527:A29V;ENSP00000426542:A29V;ENSP00000423398:A29V;ENSP00000424019:A29V	ENSP00000295971:A29V	A	-	2	0	RBM47	40135582	1.000000	0.71417	1.000000	0.80357	0.406000	0.30931	6.794000	0.75135	2.740000	0.93945	0.313000	0.20887	GCG	-	tigrfam_HnRNP_R/Q_splicing_fac		0.687	RBM47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM47	protein_coding	OTTHUMT00000250456.2	G	NM_019027	-		40440825	-1	no_errors	ENST00000295971	ensembl	human	known	74_37	missense	SNP	1.000	A
DROSHA	29102	genome.wustl.edu	37	5	31526295	31526295	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr5:31526295G>A	ENST00000511367.2	-	4	989	c.745C>T	c.(745-747)Cgg>Tgg	p.R249W	DROSHA_ENST00000442743.1_Missense_Mutation_p.R249W|DROSHA_ENST00000344624.3_Missense_Mutation_p.R249W|DROSHA_ENST00000504361.1_5'Flank|DROSHA_ENST00000513349.1_Missense_Mutation_p.R249W	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	249	Arg-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						CGCTCCCGCCGATCCAGGGAC	0.587																																																	0								ENSG00000113360						101.0	105.0	104.0					5																	31526295		2003	4162	6165	DROSHA	SO:0001583	missense	0			-	HGNC	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.745C>T	5.37:g.31526295G>A	ENSP00000425979:p.Arg249Trp	Somatic	0	46	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_III_dom,pfam_dsRNA-bd_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.R249W	ENST00000511367.2	37	c.745	CCDS47195.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.83|16.83	3.231370|3.231370	0.58777|0.58777	.|.	.|.	ENSG00000113360|ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188;ENST00000512302|ENST00000512076	T;T;T;T;T|.	0.56611|.	1.14;1.14;0.47;0.47;0.45|.	4.83|4.83	4.83|4.83	0.62350|0.62350	.|.	0.062798|.	0.64402|.	D|.	0.000010|.	T|T	0.55800|0.55800	0.1943|0.1943	L|L	0.27053|0.27053	0.805|0.805	0.51233|0.51233	D|D	0.99991|0.99991	D;D;D|.	0.89917|.	1.0;0.997;0.997|.	D;P;P|.	0.69654|.	0.965;0.73;0.73|.	T|T	0.52388|0.52388	-0.8582|-0.8582	10|5	0.87932|.	D|.	0|.	-12.0125|-12.0125	17.9467|17.9467	0.89040|0.89040	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	249;249;249|.	Q9NRR4-2;E7EMP9;Q9NRR4|.	.;.;RNC_HUMAN|.	W|L	249;249;249;249;242;242;47|78	ENSP00000425979:R249W;ENSP00000339845:R249W;ENSP00000409335:R249W;ENSP00000424161:R249W;ENSP00000428782:R47W|.	ENSP00000265075:R242W|.	R|S	-|-	1|2	2|0	DROSHA|DROSHA	31562052|31562052	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.980000|0.980000	0.70556|0.70556	3.812000|3.812000	0.55628|0.55628	2.223000|2.223000	0.72356|0.72356	0.655000|0.655000	0.94253|0.94253	CGG|TCG	-	NULL		0.587	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	protein_coding	OTTHUMT00000366561.3	G	NM_013235	-		31526295	-1	no_errors	ENST00000344624	ensembl	human	known	74_37	missense	SNP	0.996	A
SNHG24	101929369	genome.wustl.edu	37	14	101448360	101448360	+	lincRNA	SNP	C	C	T	rs540952554		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr14:101448360C>T	ENST00000554693.2	+	0	635				SNORD113_ENST00000364840.1_RNA|SNORD114-24_ENST00000365029.1_RNA|SNORD114-22_ENST00000365423.1_RNA|SNORD114-21_ENST00000606412.1_RNA|SNORD113_ENST00000364166.1_RNA|SNORD114-23_ENST00000363536.1_RNA|SNORD114-20_ENST00000365178.1_RNA																							GTGATGAATACGTGTCTGGAA	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		17533	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000272344						186.0	172.0	177.0					14																	101448360		876	1991	2867	SNORD114-21			0			-	HGNC																													14.37:g.101448360C>T		Somatic	0	86	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	72	26.53		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000554693.2	37	NULL		14																																																																																			-	-		0.413	RP11-909M7.3-001	KNOWN	basic	lincRNA	SNORD114-21	lincRNA	OTTHUMT00000468646.1	C		-		101448360	+1	no_errors	ENST00000606412	ensembl	human	known	74_37	rna	SNP	0.000	T
SYNE1	23345	genome.wustl.edu	37	6	152772193	152772193	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr6:152772193T>G	ENST00000367255.5	-	26	3776	c.3175A>C	c.(3175-3177)Aaa>Caa	p.K1059Q	SYNE1_ENST00000367253.4_Missense_Mutation_p.K1059Q|SYNE1_ENST00000413186.2_Missense_Mutation_p.K1059Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.K1066Q|SYNE1_ENST00000341594.5_Missense_Mutation_p.K1125Q|SYNE1_ENST00000367248.3_Missense_Mutation_p.K1049Q|SYNE1_ENST00000265368.4_Missense_Mutation_p.K1059Q|SYNE1_ENST00000448038.1_Missense_Mutation_p.K1066Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1059					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGTGCTCTTTAATTATCTTT	0.433										HNSCC(10;0.0054)																																							0								ENSG00000131018						238.0	212.0	221.0					6																	152772193		2203	4300	6503	SYNE1	SO:0001583	missense	0			-	HGNC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3175A>C	6.37:g.152772193T>G	ENSP00000356224:p.Lys1059Gln	Somatic	0	44	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.K1059Q	ENST00000367255.5	37	c.3175	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	11.50	1.658035	0.29425	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186	T;T;T;T;T;D;D;D	0.87412	0.77;0.76;0.67;0.77;0.88;-2.11;-2.25;-2.25	5.87	0.408	0.16377	.	0.281373	0.30556	N	0.009369	T	0.54886	0.1886	N	0.16602	0.42	0.38119	D	0.937803	B;B;B;B;B;B	0.32467	0.136;0.043;0.072;0.372;0.043;0.072	B;B;B;B;B;B	0.24394	0.017;0.024;0.053;0.053;0.024;0.053	T	0.46105	-0.9215	10	0.32370	T	0.25	.	6.4301	0.21792	0.0:0.1878:0.2191:0.5931	.	1042;1059;1049;1059;1059;1066	B3W695;Q8NF91;F5GXQ8;Q8NF91-6;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.;.	Q	1059;1066;1059;1066;1125;1059;1049;1059	ENSP00000356224:K1059Q;ENSP00000396024:K1066Q;ENSP00000265368:K1059Q;ENSP00000390975:K1066Q;ENSP00000341887:K1125Q;ENSP00000356222:K1059Q;ENSP00000356217:K1049Q;ENSP00000414510:K1059Q	ENSP00000265368:K1059Q	K	-	1	0	SYNE1	152813886	0.550000	0.26489	0.224000	0.23877	0.991000	0.79684	0.782000	0.26788	0.190000	0.20209	0.533000	0.62120	AAA	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom		0.433	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	T	NM_182961	-		152772193	-1	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	SNP	0.217	G
CLEC4F	165530	genome.wustl.edu	37	2	71043556	71043556	+	Silent	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr2:71043556G>A	ENST00000272367.2	-	4	1033	c.957C>T	c.(955-957)ttC>ttT	p.F319F	CLEC4F_ENST00000426626.1_Silent_p.F319F	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	319					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						GACCTCTTAAGAACTGGATCT	0.418																																					Colon(107;10 2157 6841 26035)												0								ENSG00000152672						92.0	93.0	93.0					2																	71043556		2203	4300	6503	CLEC4F	SO:0001819	synonymous_variant	0			-	HGNC	AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.957C>T	2.37:g.71043556G>A		Somatic	0	46	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A4QPA5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Prefoldin,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.F319	ENST00000272367.2	37	c.957	CCDS1910.1	2																																																																																			-	NULL		0.418	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4F	protein_coding	OTTHUMT00000251922.1	G	NM_173535	-		71043556	-1	no_errors	ENST00000272367	ensembl	human	known	74_37	silent	SNP	0.000	A
UNC45B	146862	genome.wustl.edu	37	17	33477089	33477089	+	Silent	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr17:33477089C>T	ENST00000268876.5	+	4	325	c.228C>T	c.(226-228)gaC>gaT	p.D76D	UNC45B_ENST00000433649.1_Silent_p.D76D|UNC45B_ENST00000591048.1_Silent_p.D76D|UNC45B_ENST00000378449.1_Silent_p.D76D|UNC45B_ENST00000394570.2_Silent_p.D76D	NM_173167.2	NP_775259.1	Q8IWX7	UN45B_HUMAN	unc-45 homolog B (C. elegans)	76					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(10)|lung(24)|ovary(3)|prostate(2)|skin(1)|stomach(1)|urinary_tract(3)	59		Ovarian(249;0.17)				ACTCCTCGGACATCAAGGCTC	0.617																																																	0								ENSG00000141161						94.0	74.0	81.0					17																	33477089		2203	4300	6503	UNC45B	SO:0001819	synonymous_variant	0			-	HGNC	AW755253	CCDS11292.1, CCDS45648.1	17q12	2008-02-05	2005-11-17	2005-11-17	ENSG00000141161	ENSG00000141161			14304	protein-coding gene	gene with protein product		611220	"""cardiomyopathy associated 4"""	CMYA4		12356907	Standard	NM_001267052		Approved	UNC45	uc002hja.3	Q8IWX7	OTTHUMG00000132931	ENST00000268876.5:c.228C>T	17.37:g.33477089C>T		Somatic	0	112	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	64	22.89	Q495Q8|Q495Q9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UNC-45/Ring3,superfamily_ARM-type_fold,smart_TPR_repeat,smart_Armadillo,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D76	ENST00000268876.5	37	c.228	CCDS11292.1	17																																																																																			-	superfamily_ARM-type_fold,smart_TPR_repeat,pfscan_TPR-contain_dom		0.617	UNC45B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UNC45B	protein_coding	OTTHUMT00000256458.2	C	NM_173167	-		33477089	+1	no_errors	ENST00000268876	ensembl	human	known	74_37	silent	SNP	1.000	T
ADPGK	83440	genome.wustl.edu	37	15	73044752	73044752	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr15:73044752C>A	ENST00000311669.8	-	7	1514	c.1421G>T	c.(1420-1422)cGa>cTa	p.R474L	ADPGK_ENST00000456471.2_Missense_Mutation_p.R200L	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase	475	ADPK. {ECO:0000255|PROSITE- ProRule:PRU00584}.				glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						GCCTACAGTTCGAATGGGGTC	0.443																																																	0								ENSG00000159322						73.0	72.0	72.0					15																	73044752		1900	4108	6008	ADPGK	SO:0001583	missense	0			-	HGNC	AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777	ENST00000311669.8:c.1421G>T	15.37:g.73044752C>A	ENSP00000312250:p.Arg474Leu	Somatic	0	50	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	61	10.29	Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ADP_PFK/GK	p.R474L	ENST00000311669.8	37	c.1421	CCDS42057.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.625477	0.96671	.	.	ENSG00000159322	ENST00000311669;ENST00000443764;ENST00000456471	T;T	0.44482	0.92;0.92	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.58352	0.2116	M	0.67953	2.075	0.80722	D	1	D;D;D;D	0.60575	0.988;0.988;0.985;0.967	P;P;P;P	0.57679	0.825;0.825;0.807;0.643	T	0.48614	-0.9020	10	0.17832	T	0.49	-14.0779	20.139	0.98050	0.0:1.0:0.0:0.0	.	417;475;474;200	B4DG35;Q9BRR6;Q9BRR6-2;Q9BRR6-4	.;ADPGK_HUMAN;.;.	L	474;394;200	ENSP00000312250:R474L;ENSP00000397694:R200L	ENSP00000312250:R474L	R	-	2	0	ADPGK	70831805	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	7.695000	0.84257	2.764000	0.94973	0.655000	0.94253	CGA	-	pfam_ADP_PFK/GK		0.443	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPGK	protein_coding	OTTHUMT00000420434.1	C	NM_031284	-		73044752	-1	no_errors	ENST00000311669	ensembl	human	known	74_37	missense	SNP	1.000	A
TOR1A	1861	genome.wustl.edu	37	9	132584885	132584885	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr9:132584885T>C	ENST00000351698.4	-	2	467	c.419A>G	c.(418-420)cAt>cGt	p.H140R	TOR1A_ENST00000473084.1_5'UTR	NM_000113.2	NP_000104.1	O14656	TOR1A_HUMAN	torsin family 1, member A (torsin A)	140	Interaction with SNAPIN.				ATP catabolic process (GO:0006200)|cell adhesion (GO:0007155)|chaperone mediated protein folding requiring cofactor (GO:0051085)|chaperone-mediated protein folding (GO:0061077)|chaperone-mediated protein transport (GO:0072321)|ER-associated misfolded protein catabolic process (GO:0071712)|intermediate filament cytoskeleton organization (GO:0045104)|neuron projection development (GO:0031175)|nuclear envelope organization (GO:0006998)|nuclear membrane organization (GO:0071763)|organelle organization (GO:0006996)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|protein deneddylation (GO:0000338)|protein homooligomerization (GO:0051260)|protein localization to nucleus (GO:0034504)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of protein localization to cell surface (GO:2000008)|response to oxidative stress (GO:0006979)|synaptic vesicle transport (GO:0048489)|wound healing, spreading of cells (GO:0044319)	cell junction (GO:0030054)|cytoplasmic vesicle membrane (GO:0030659)|cytoskeleton (GO:0005856)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cytoskeletal protein binding (GO:0008092)|kinesin binding (GO:0019894)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	20		Ovarian(14;0.00556)				GTTTGAAGCATGTGGAAAGTG	0.463																																																	0								ENSG00000136827						139.0	112.0	121.0					9																	132584885		2203	4300	6503	TOR1A	SO:0001583	missense	0			-	HGNC	AF007871	CCDS6930.1	9q32-q34	2008-07-21	2004-11-24	2004-11-26	ENSG00000136827	ENSG00000136827			3098	protein-coding gene	gene with protein product		605204	"""dystonia 1, torsion (autosomal dominant; torsin A)"""	DYT1		10644435	Standard	NM_000113		Approved	DQ2	uc004byl.3	O14656	OTTHUMG00000020794	ENST00000351698.4:c.419A>G	9.37:g.132584885T>C	ENSP00000345719:p.His140Arg	Somatic	0	81	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	69	13.75	B2RB58|Q53Y64|Q96CA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Torsin,superfamily_P-loop_NTPase,pirsf_Torsin_subgr	p.H140R	ENST00000351698.4	37	c.419	CCDS6930.1	9	.	.	.	.	.	.	.	.	.	.	T	14.98	2.698360	0.48307	.	.	ENSG00000136827	ENST00000427355;ENST00000351698	T	0.39406	1.08	5.32	5.32	0.75619	.	0.089860	0.85682	D	0.000000	T	0.65964	0.2742	M	0.80028	2.48	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.79784	0.99;0.993	T	0.70425	-0.4875	10	0.59425	D	0.04	-9.7982	14.4685	0.67499	0.0:0.0:0.0:1.0	.	140;140	O14656-2;O14656	.;TOR1A_HUMAN	R	109;140	ENSP00000345719:H140R	ENSP00000345719:H140R	H	-	2	0	TOR1A	131624706	1.000000	0.71417	0.059000	0.19551	0.020000	0.10135	7.694000	0.84235	2.022000	0.59522	0.459000	0.35465	CAT	-	pfam_Torsin,superfamily_P-loop_NTPase,pirsf_Torsin_subgr		0.463	TOR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR1A	protein_coding	OTTHUMT00000054611.1	T	NM_000113	-		132584885	-1	no_errors	ENST00000351698	ensembl	human	known	74_37	missense	SNP	0.997	C
KIF22	3835	genome.wustl.edu	37	16	29816167	29816167	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr16:29816167G>C	ENST00000160827.4	+	12	1750	c.1710G>C	c.(1708-1710)gaG>gaC	p.E570D	KIF22_ENST00000569382.2_Missense_Mutation_p.E516D|MAZ_ENST00000322945.6_5'Flank|MAZ_ENST00000563402.1_5'Flank|MAZ_ENST00000219782.6_5'Flank|MAZ_ENST00000545521.1_5'Flank|KIF22_ENST00000400751.5_Missense_Mutation_p.E502D|MAZ_ENST00000566906.2_5'Flank|KIF22_ENST00000561482.1_Missense_Mutation_p.E502D|MAZ_ENST00000562337.1_5'Flank|AC009133.15_ENST00000566537.1_RNA	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	570					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						AGCCTGAGGAGAAGGCTGAGG	0.587																																																	0								ENSG00000079616						28.0	26.0	27.0					16																	29816167		2197	4296	6493	KIF22	SO:0001583	missense	0			-	HGNC	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1710G>C	16.37:g.29816167G>C	ENSP00000160827:p.Glu570Asp	Somatic	0	56	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_RuvA_2-like,smart_Kinesin_motor_dom,smart_Hlx-hairpin-Hlx_DNA-bd_motif,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E570D	ENST00000160827.4	37	c.1710	CCDS10653.1	16	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215768	0.39102	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	T;T	0.73789	-0.7;-0.78	5.64	0.155	0.14906	.	.	.	.	.	T	0.55609	0.1931	N	0.24115	0.695	0.22354	N	0.999178	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.40040	-0.9584	9	0.36615	T	0.2	.	5.4852	0.16745	0.2272:0.279:0.4937:0.0	.	502;570	B7Z265;Q14807	.;KIF22_HUMAN	D	570;502	ENSP00000160827:E570D;ENSP00000383562:E502D	ENSP00000160827:E570D	E	+	3	2	KIF22	29723668	0.999000	0.42202	0.069000	0.20011	0.788000	0.44548	0.346000	0.19997	0.083000	0.17047	0.561000	0.74099	GAG	-	NULL		0.587	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF22	protein_coding	OTTHUMT00000215012.2	G		-		29816167	+1	no_errors	ENST00000160827	ensembl	human	known	74_37	missense	SNP	0.047	C
EPHA6	285220	genome.wustl.edu	37	3	97251225	97251225	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:97251225G>A	ENST00000514100.1	+	8	642	c.400G>A	c.(400-402)Ggg>Agg	p.G134R	EPHA6_ENST00000389672.5_Missense_Mutation_p.G742R|EPHA6_ENST00000442602.2_Missense_Mutation_p.G108R|EPHA6_ENST00000502694.1_Missense_Mutation_p.G134R	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	648	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AGTCTGTAGTGGGCGTTTGAA	0.393																																																	0								ENSG00000080224						135.0	129.0	131.0					3																	97251225		1830	4096	5926	EPHA6	SO:0001583	missense	0			-	HGNC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.400G>A	3.37:g.97251225G>A	ENSP00000421711:p.Gly134Arg	Somatic	0	71	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	80	22.86	D6RAL5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G742R	ENST00000514100.1	37	c.2224		3	.	.	.	.	.	.	.	.	.	.	G	32	5.152815	0.94645	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18	5.85	5.85	0.93711	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.96241	0.8774	H	0.96805	3.885	0.80722	D	1	D;D;P;D	0.89917	1.0;1.0;0.934;1.0	D;D;P;D	0.97110	1.0;1.0;0.723;1.0	D	0.96986	0.9718	9	0.87932	D	0	.	20.1542	0.98100	0.0:0.0:1.0:0.0	.	108;647;134;134	B4DXQ6;Q9UF33;Q9UF33-2;D6RAL5	.;EPHA6_HUMAN;.;.	R	742;134;134;108	ENSP00000374323:G742R;ENSP00000421711:G134R;ENSP00000423950:G134R;ENSP00000403100:G108R	ENSP00000374323:G742R	G	+	1	0	EPHA6	98733915	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.869000	0.99810	2.767000	0.95098	0.563000	0.77884	GGG	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.393	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	protein_coding	OTTHUMT00000359997.1	G	NM_001080448	-		97251225	+1	no_errors	ENST00000389672	ensembl	human	known	74_37	missense	SNP	1.000	A
PIK3AP1	118788	genome.wustl.edu	37	10	98412517	98412517	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr10:98412517G>T	ENST00000339364.5	-	4	769	c.650C>A	c.(649-651)tCt>tAt	p.S217Y	PIK3AP1_ENST00000468783.1_5'UTR|PIK3AP1_ENST00000371110.2_Missense_Mutation_p.S39Y	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	217	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		TACAGAGGGAGAATCCTCAGG	0.493																																																	0								ENSG00000155629						165.0	155.0	159.0					10																	98412517		2203	4300	6503	PIK3AP1	SO:0001583	missense	0			-	HGNC	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.650C>A	10.37:g.98412517G>T	ENSP00000339826:p.Ser217Tyr	Somatic	0	51	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	53	19.70	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Ankyrin_rpt-contain_dom	p.S217Y	ENST00000339364.5	37	c.650	CCDS31259.1	10	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214308	0.58452	.	.	ENSG00000155629	ENST00000339364;ENST00000371110	T;T	0.19532	2.79;2.14	6.03	6.03	0.97812	DBB domain (1);	0.441395	0.24523	N	0.037785	T	0.37652	0.1011	L	0.58101	1.795	0.58432	D	0.999999	D	0.59767	0.986	P	0.54100	0.742	T	0.02901	-1.1096	10	0.72032	D	0.01	-14.8626	17.7156	0.88336	0.0:0.0:1.0:0.0	.	217	Q6ZUJ8	BCAP_HUMAN	Y	217;39	ENSP00000339826:S217Y;ENSP00000360151:S39Y	ENSP00000339826:S217Y	S	-	2	0	PIK3AP1	98402507	0.565000	0.26610	0.995000	0.50966	0.553000	0.35397	1.316000	0.33620	2.868000	0.98415	0.555000	0.69702	TCT	-	NULL		0.493	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3AP1	protein_coding	OTTHUMT00000049619.2	G	NM_152309	-		98412517	-1	no_errors	ENST00000339364	ensembl	human	known	74_37	missense	SNP	0.589	T
AC079610.1	0	genome.wustl.edu	37	2	213628297	213628298	+	RNA	INS	-	-	TATATA	rs57305053|rs13431749		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr2:213628297_213628298insTATATA	ENST00000415387.1	-	0	381				AC093865.1_ENST00000408461.1_RNA																							atatatatgtgtatatatatat	0.208																																																	0								ENSG00000221388																																			AC093865.1			0				Clone_based_ensembl_gene																													2.37:g.213628298_213628303dupTATATA		Somatic	NA	NA	NA		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000415387.1	37	NULL		2																																																																																			-	-		0.208	AC079610.1-001	KNOWN	basic	sense_overlapping	ENSG00000221388	sense_overlapping	OTTHUMT00000337265.1	-				213628298	-1	no_errors	ENST00000408461	ensembl	human	novel	74_37	rna	INS	0.000:0.000	TATATA
NRG2	9542	genome.wustl.edu	37	5	139251347	139251347	+	Silent	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr5:139251347G>A	ENST00000361474.1	-	4	1295	c.1071C>T	c.(1069-1071)ggC>ggT	p.G357G	NRG2_ENST00000394770.1_Silent_p.G357G|NRG2_ENST00000541337.1_Intron|NRG2_ENST00000545385.1_Silent_p.G357G|NRG2_ENST00000518130.1_5'UTR|NRG2_ENST00000289409.4_Silent_p.G357G|NRG2_ENST00000358522.3_Silent_p.G357G|NRG2_ENST00000289422.7_Silent_p.G357G|NRG2_ENST00000340391.3_Silent_p.G154G	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	357	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTAGCAGACGCCTCCATTGA	0.572																																																	0								ENSG00000158458						211.0	158.0	176.0					5																	139251347		2203	4300	6503	NRG2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.1071C>T	5.37:g.139251347G>A		Somatic	0	95	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	60	9.09		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_EG-like_dom,pfscan_Ig-like_dom	p.G357	ENST00000361474.1	37	c.1071	CCDS4217.1	5																																																																																			-	pfscan_EG-like_dom		0.572	NRG2-001	KNOWN	basic|CCDS	protein_coding	NRG2	protein_coding	OTTHUMT00000251340.1	G	NM_013982	-		139251347	-1	no_errors	ENST00000545385	ensembl	human	known	74_37	silent	SNP	0.936	A
CASR	846	genome.wustl.edu	37	3	122003418	122003418	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:122003418C>T	ENST00000490131.1	+	7	2989	c.2617C>T	c.(2617-2619)Cgt>Tgt	p.R873C	CASR_ENST00000296154.5_Missense_Mutation_p.R873C|AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000498619.1_Missense_Mutation_p.R883C	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	873					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.R873C(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CGAGGAGGTGCGTTGCAGCAC	0.612																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000036828						45.0	45.0	45.0					3																	122003418		2203	4300	6503	CASR	SO:0001583	missense	0			-	HGNC	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2617C>T	3.37:g.122003418C>T	ENSP00000418685:p.Arg873Cys	Somatic	0	59	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	33	25.00	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,superfamily_Growth_fac_rcpt_N_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.R883C	ENST00000490131.1	37	c.2647	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909577	0.72868	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.90385	-2.66;-2.66;-2.66	5.89	5.89	0.94794	GPCR, family 3, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93086	0.7799	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.993;0.996	D	0.93495	0.6839	10	0.72032	D	0.01	.	19.2448	0.93898	0.0:1.0:0.0:0.0	.	883;873	E7ENE0;P41180	.;CASR_HUMAN	C	873;883;873	ENSP00000418685:R873C;ENSP00000420194:R883C;ENSP00000296154:R873C	ENSP00000296154:R873C	R	+	1	0	CASR	123486108	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.762000	0.55250	2.793000	0.96121	0.561000	0.74099	CGT	-	pfscan_GPCR_3_C		0.612	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	protein_coding	OTTHUMT00000355761.1	C	NM_000388	-		122003418	+1	no_errors	ENST00000498619	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH7	1005	genome.wustl.edu	37	18	63430124	63430124	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr18:63430124G>T	ENST00000397968.2	+	2	472	c.46G>T	c.(46-48)Gct>Tct	p.A16S	CDH7_ENST00000323011.3_Missense_Mutation_p.A16S|CDH7_ENST00000536984.2_Missense_Mutation_p.A16S	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	16					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				GCAGCTAATAGCTCTTTTCCT	0.428																																																	0								ENSG00000081138						117.0	114.0	115.0					18																	63430124		2203	4300	6503	CDH7	SO:0001583	missense	0			-	HGNC	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.46G>T	18.37:g.63430124G>T	ENSP00000381058:p.Ala16Ser	Somatic	0	47	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q9H157	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A16S	ENST00000397968.2	37	c.46	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	G	13.12	2.141363	0.37825	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.55052	0.54;0.57;0.54	5.83	4.95	0.65309	.	0.175990	0.40064	N	0.001197	T	0.42607	0.1210	L	0.40543	1.245	0.35519	D	0.80127	B;B	0.29037	0.2;0.231	B;B	0.22601	0.03;0.04	T	0.48433	-0.9036	10	0.15499	T	0.54	.	16.3201	0.82949	0.0:0.0:0.8667:0.1333	.	16;16	F5H5X9;Q9ULB5	.;CADH7_HUMAN	S	16	ENSP00000319166:A16S;ENSP00000443030:A16S;ENSP00000381058:A16S	ENSP00000319166:A16S	A	+	1	0	CDH7	61581104	0.874000	0.30092	0.467000	0.27180	0.907000	0.53573	1.792000	0.38754	1.455000	0.47813	0.650000	0.86243	GCT	-	NULL		0.428	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	protein_coding	OTTHUMT00000256217.2	G	NM_033646	-		63430124	+1	no_errors	ENST00000323011	ensembl	human	known	74_37	missense	SNP	0.994	T
CPVL	54504	genome.wustl.edu	37	7	29160601	29160601	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr7:29160601G>C	ENST00000409850.1	-	6	723	c.77C>G	c.(76-78)tCc>tGc	p.S26C	CPVL_ENST00000265394.5_Missense_Mutation_p.S26C|CPVL_ENST00000488891.2_5'UTR|CPVL_ENST00000396276.3_Missense_Mutation_p.S26C			Q9H3G5	CPVL_HUMAN	carboxypeptidase, vitellogenic-like	26						extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)	28						TCTGTATAGGGAGCGAAACAG	0.483																																																	0								ENSG00000106066						102.0	93.0	96.0					7																	29160601		2203	4300	6503	CPVL	SO:0001583	missense	0			-	HGNC	AF106704	CCDS5419.1	7p15.1	2012-02-10			ENSG00000106066	ENSG00000106066			14399	protein-coding gene	gene with protein product	"""carboxypeptidase WUG"", ""vitellogenic carboxypeptidase-like protein"", ""CP-Mac carboxypeptidase"""	609780				11401439	Standard	XM_005249786		Approved		uc003szw.3	Q9H3G5	OTTHUMG00000023669	ENST00000409850.1:c.77C>G	7.37:g.29160601G>C	ENSP00000387164:p.Ser26Cys	Somatic	0	66	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	52	14.75	A4D1A4|Q6UX20|Q8NBL7|Q96AR7|Q9HB41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S10,prints_Peptidase_S10	p.S26C	ENST00000409850.1	37	c.77	CCDS5419.1	7	.	.	.	.	.	.	.	.	.	.	G	16.84	3.232772	0.58777	.	.	ENSG00000106066	ENST00000265394;ENST00000396276;ENST00000409850;ENST00000449801;ENST00000455544	T;T;T;T;T	0.49139	2.47;2.47;2.47;0.95;0.79	5.58	2.81	0.32909	.	0.962852	0.08662	N	0.912189	T	0.47637	0.1456	M	0.68317	2.08	0.09310	N	1	D	0.57571	0.98	B	0.43916	0.436	T	0.37430	-0.9706	10	0.54805	T	0.06	-1.7606	6.7391	0.23424	0.3412:0.0:0.6588:0.0	.	26	Q9H3G5	CPVL_HUMAN	C	26	ENSP00000265394:S26C;ENSP00000379572:S26C;ENSP00000387164:S26C;ENSP00000413287:S26C;ENSP00000412857:S26C	ENSP00000265394:S26C	S	-	2	0	CPVL	29127126	0.606000	0.26949	0.003000	0.11579	0.386000	0.30323	0.438000	0.21559	0.722000	0.32252	0.563000	0.77884	TCC	-	NULL		0.483	CPVL-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CPVL	protein_coding	OTTHUMT00000328305.1	G	NM_019029	-		29160601	-1	no_errors	ENST00000265394	ensembl	human	known	74_37	missense	SNP	0.005	C
CDKL2	8999	genome.wustl.edu	37	4	76532521	76532521	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr4:76532521C>A	ENST00000429927.2	-	4	1091	c.388G>T	c.(388-390)Gag>Tag	p.E130*	CDKL2_ENST00000307465.4_Nonsense_Mutation_p.E130*	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	130	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			AATATATTCTCTGGCTTTATA	0.428																																																	0								ENSG00000138769						70.0	66.0	68.0					4																	76532521		2203	4300	6503	CDKL2	SO:0001587	stop_gained	0			-	HGNC	U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.388G>T	4.37:g.76532521C>A	ENSP00000412365:p.Glu130*	Somatic	0	43	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2R695	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E130*	ENST00000429927.2	37	c.388	CCDS3570.1	4	.	.	.	.	.	.	.	.	.	.	c	43	10.030577	0.99321	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	.	.	.	4.72	4.72	0.59763	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.5158	16.975	0.86310	0.0:1.0:0.0:0.0	.	.	.	.	X	130	.	ENSP00000306340:E130X	E	-	1	0	CDKL2	76751545	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	6.663000	0.74431	2.605000	0.88082	0.639000	0.83563	GAG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.428	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKL2	protein_coding	OTTHUMT00000252409.2	C	NM_003948	-		76532521	-1	no_errors	ENST00000429927	ensembl	human	known	74_37	nonsense	SNP	1.000	A
CACNA1C	775	genome.wustl.edu	37	12	2786965	2786965	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr12:2786965G>A	ENST00000347598.4	+	43	5167	c.5167G>A	c.(5167-5169)Gct>Act	p.A1723T	CACNA1C_ENST00000399655.1_Missense_Mutation_p.A1675T|CACNA1C_ENST00000399634.1_Missense_Mutation_p.A1675T|CACNA1C_ENST00000399644.1_Missense_Mutation_p.A1675T|CACNA1C_ENST00000399617.1_Missense_Mutation_p.A1675T|CACNA1C_ENST00000406454.3_Missense_Mutation_p.A1675T|CACNA1C_ENST00000399621.1_Missense_Mutation_p.A1694T|CACNA1C_ENST00000399638.1_Missense_Mutation_p.A1703T|CACNA1C_ENST00000399649.1_Missense_Mutation_p.A1681T|CACNA1C_ENST00000399601.1_Missense_Mutation_p.A1675T|CACNA1C_ENST00000402845.3_Missense_Mutation_p.A1694T|CACNA1C_ENST00000399597.1_Missense_Mutation_p.A1675T|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399595.1_Missense_Mutation_p.A1683T|CACNA1C_ENST00000399641.1_Missense_Mutation_p.A1675T|CACNA1C_ENST00000344100.3_Missense_Mutation_p.A1716T|CACNA1C_ENST00000335762.5_Missense_Mutation_p.A1700T|CACNA1C_ENST00000399637.1_Missense_Mutation_p.A1694T|CACNA1C_ENST00000399629.1_Missense_Mutation_p.A1692T|CACNA1C_ENST00000327702.7_Missense_Mutation_p.A1675T|CACNA1C_ENST00000399591.1_Missense_Mutation_p.A1683T|CACNA1C_ENST00000399606.1_Missense_Mutation_p.A1695T|CACNA1C_ENST00000399603.1_Missense_Mutation_p.A1675T	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1723					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGATCTCACCGCTGAGGAGGA	0.612																																																	0								ENSG00000151067						54.0	61.0	59.0					12																	2786965		2125	4242	6367	CACNA1C	SO:0001583	missense	0			-	HGNC	AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5167G>A	12.37:g.2786965G>A	ENSP00000266376:p.Ala1723Thr	Somatic	0	87	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	46	24.59	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.A1675T	ENST00000347598.4	37	c.5023	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	10.56	1.383524	0.25031	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96200	-3.86;-3.86;-3.86;-3.86;-3.86;-3.89;-3.78;-3.82;-3.86;-3.79;-3.78;-3.86;-3.92;-3.78;-3.7;-3.94;-3.88;-3.86;-3.89;-3.79;-3.89;-3.93	4.62	4.62	0.57501	.	292.508000	0.00166	N	0.000001	D	0.96009	0.8700	L	0.43152	1.355	0.51767	D	0.999938	P;D;P;B;D;P;P;D;B;B;D;P;B;P;P;P;D;B;D;B;P;D;D;P;P	0.63046	0.829;0.99;0.907;0.222;0.992;0.939;0.847;0.966;0.33;0.031;0.966;0.907;0.227;0.939;0.85;0.829;0.975;0.224;0.966;0.194;0.948;0.966;0.966;0.926;0.907	B;P;B;B;P;B;B;B;B;B;B;B;B;B;B;B;P;B;B;B;B;B;B;B;B	0.52856	0.21;0.49;0.131;0.018;0.711;0.407;0.121;0.407;0.027;0.012;0.407;0.131;0.04;0.407;0.122;0.283;0.455;0.027;0.245;0.027;0.09;0.407;0.407;0.307;0.131	D	0.86669	0.1909	10	0.16896	T	0.51	.	17.6395	0.88131	0.0:0.0:1.0:0.0	.	366;1716;1672;1723;1675;1694;1675;1692;1703;1675;1695;1675;1635;1723;1675;1675;1675;1683;1681;1683;1664;1694;1694;1675;1675	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	T	1700;1675;1675;1703;1675;1694;1694;1683;1675;1723;1695;1675;1716;1692;1675;1681;1694;1675;1675;1675;1675;1683;1505	ENSP00000336982:A1700T;ENSP00000382563:A1675T;ENSP00000382552:A1675T;ENSP00000382547:A1703T;ENSP00000382506:A1675T;ENSP00000382530:A1694T;ENSP00000382546:A1694T;ENSP00000382500:A1683T;ENSP00000382549:A1675T;ENSP00000266376:A1723T;ENSP00000382515:A1695T;ENSP00000382510:A1675T;ENSP00000341092:A1716T;ENSP00000382537:A1692T;ENSP00000329877:A1675T;ENSP00000382557:A1681T;ENSP00000385724:A1694T;ENSP00000382512:A1675T;ENSP00000382542:A1675T;ENSP00000382526:A1675T;ENSP00000385896:A1675T;ENSP00000382504:A1683T	ENSP00000323129:A1505T	A	+	1	0	CACNA1C	2657226	1.000000	0.71417	0.038000	0.18304	0.077000	0.17291	9.130000	0.94437	2.402000	0.81655	0.467000	0.42956	GCT	-	NULL		0.612	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	protein_coding	OTTHUMT00000317035.1	G	NM_000719	-		2786965	+1	no_errors	ENST00000399634	ensembl	human	known	74_37	missense	SNP	0.953	A
TNFRSF9	3604	genome.wustl.edu	37	1	7998781	7998781	+	Splice_Site	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr1:7998781C>T	ENST00000377507.3	-	3	374	c.208G>A	c.(208-210)Ggt>Agt	p.G70S		NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9	70					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)	p.G70C(1)		NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		GAACTCATACCTTTACACTGC	0.398																																																	1	Substitution - Missense(1)	kidney(1)						ENSG00000049249						176.0	178.0	177.0					1																	7998781		2203	4300	6503	TNFRSF9	SO:0001630	splice_region_variant	0			-	HGNC	L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.208+1G>A	1.37:g.7998781C>T		Somatic	0	77	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	51	31.08		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_9	p.G70S	ENST00000377507.3	37	c.208	CCDS92.1	1	.	.	.	.	.	.	.	.	.	.	C	16.60	3.167985	0.57476	.	.	ENSG00000049249	ENST00000377507	D	0.97906	-4.6	5.39	5.39	0.77823	TNFR/CD27/30/40/95 cysteine-rich region (3);	0.000000	0.85682	D	0.000000	D	0.97864	0.9298	L	0.47190	1.495	0.45502	D	0.998462	D	0.89917	1.0	D	0.87578	0.998	D	0.97379	0.9981	9	.	.	.	-25.1718	15.0045	0.71501	0.0:1.0:0.0:0.0	.	70	Q07011	TNR9_HUMAN	S	70	ENSP00000366729:G70S	.	G	-	1	0	TNFRSF9	7921368	1.000000	0.71417	0.999000	0.59377	0.022000	0.10575	3.442000	0.52900	2.698000	0.92095	0.563000	0.77884	GGT	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg		0.398	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF9	protein_coding	OTTHUMT00000003622.1	C		-	Missense_Mutation	7998781	-1	no_errors	ENST00000377507	ensembl	human	known	74_37	missense	SNP	1.000	T
KCNA3	3738	genome.wustl.edu	37	1	111215894	111215894	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr1:111215894T>C	ENST00000369769.2	-	1	1761	c.1538A>G	c.(1537-1539)gAg>gGg	p.E513G		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	513					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	TCGGAGCTCCTCGGCTGAAGA	0.527																																																	0								ENSG00000177272						84.0	75.0	78.0					1																	111215894		2203	4300	6503	KCNA3	SO:0001583	missense	0			-	HGNC	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1538A>G	1.37:g.111215894T>C	ENSP00000358784:p.Glu513Gly	Somatic	0	52	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	Q5VWN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.3,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.E513G	ENST00000369769.2	37	c.1538	CCDS828.2	1	.	.	.	.	.	.	.	.	.	.	T	10.93	1.489511	0.26686	.	.	ENSG00000177272	ENST00000369769	D	0.97041	-4.22	5.91	4.79	0.61399	.	0.000000	0.33591	U	0.004744	D	0.88265	0.6390	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	D	0.84838	0.0806	10	0.20519	T	0.43	.	11.4281	0.50022	0.0:0.0699:0.0:0.9301	.	513	P22001	KCNA3_HUMAN	G	513	ENSP00000358784:E513G	ENSP00000358784:E513G	E	-	2	0	KCNA3	111017417	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	4.278000	0.58946	2.255000	0.74692	0.533000	0.62120	GAG	-	NULL		0.527	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA3	protein_coding	OTTHUMT00000083391.1	T	NM_002232	-		111215894	-1	no_errors	ENST00000369769	ensembl	human	known	74_37	missense	SNP	1.000	C
OR51D1	390038	genome.wustl.edu	37	11	4661220	4661220	+	Missense_Mutation	SNP	G	G	A	rs138099428		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr11:4661220G>A	ENST00000357605.2	+	1	276	c.200G>A	c.(199-201)cGa>cAa	p.R67Q		NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGGAGAGGCGACTGCATGAG	0.512																																																	0								ENSG00000197428	G	GLN/ARG	1,4401	2.1+/-5.4	0,1,2200	203.0	151.0	169.0		200	0.5	0.0	11	dbSNP_134	169	1,8595	1.2+/-3.3	0,1,4297	yes	missense	OR51D1	NM_001004751.2	43	0,2,6497	AA,AG,GG		0.0116,0.0227,0.0154	benign	67/325	4661220	2,12996	2201	4298	6499	OR51D1	SO:0001583	missense	0			-	HGNC	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.200G>A	11.37:g.4661220G>A	ENSP00000350222:p.Arg67Gln	Somatic	0	68	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	53	27.03	B9EIK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R67Q	ENST00000357605.2	37	c.200	CCDS31357.1	11	.	.	.	.	.	.	.	.	.	.	G	6.073	0.381861	0.11524	2.27E-4	1.16E-4	ENSG00000197428	ENST00000357605	T	0.00374	7.72	4.71	0.466	0.16716	GPCR, rhodopsin-like superfamily (1);	0.903328	0.09280	N	0.823875	T	0.00241	0.0007	L	0.28649	0.875	0.09310	N	1	B	0.22541	0.071	B	0.22152	0.038	T	0.34825	-0.9813	10	0.87932	D	0	.	6.93	0.24435	0.2353:0.1275:0.6372:0.0	.	67	Q8NGF3	O51D1_HUMAN	Q	67	ENSP00000350222:R67Q	ENSP00000350222:R67Q	R	+	2	0	OR51D1	4617796	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.745000	0.26259	0.301000	0.22738	-0.448000	0.05591	CGA	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.512	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51D1	protein_coding	OTTHUMT00000385956.1	G	NM_001004751	rs138099428		4661220	+1	no_errors	ENST00000357605	ensembl	human	known	74_37	missense	SNP	0.000	A
LTN1	26046	genome.wustl.edu	37	21	30316157	30316157	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr21:30316157G>A	ENST00000361371.5	-	23	4131	c.4052C>T	c.(4051-4053)aCg>aTg	p.T1351M	LTN1_ENST00000389194.2_Missense_Mutation_p.T1397M			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	1351					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TGAGATATACGTTAATGTTTC	0.358																																																	0								ENSG00000198862						142.0	137.0	139.0					21																	30316157		2203	4300	6503	LTN1	SO:0001583	missense	0			-	HGNC	AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.4052C>T	21.37:g.30316157G>A	ENSP00000354977:p.Thr1351Met	Somatic	0	67	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	77	10.47	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C3HC4_RING-type,superfamily_ARM-type_fold,smart_Znf_RING-CH,pfscan_Znf_RING	p.T1397M	ENST00000361371.5	37	c.4190		21	.	.	.	.	.	.	.	.	.	.	G	9.702	1.154850	0.21371	.	.	ENSG00000198862	ENST00000389194;ENST00000361371	T;T	0.19105	2.17;2.18	4.81	3.92	0.45320	.	0.396811	0.27068	N	0.021100	T	0.11153	0.0272	L	0.27053	0.805	0.46131	D	0.99888	P	0.45569	0.861	B	0.29353	0.101	T	0.08617	-1.0713	10	0.48119	T	0.1	.	10.5696	0.45192	0.0:0.1443:0.7058:0.1499	.	1351	O94822	LTN1_HUMAN	M	1397;1351	ENSP00000373846:T1397M;ENSP00000354977:T1351M	ENSP00000354977:T1351M	T	-	2	0	LTN1	29238028	1.000000	0.71417	0.959000	0.39883	0.569000	0.35902	3.142000	0.50601	1.377000	0.46286	-0.182000	0.12963	ACG	-	NULL		0.358	LTN1-008	NOVEL	basic|appris_principal	protein_coding	LTN1	protein_coding	OTTHUMT00000472108.1	G	NM_015565	-		30316157	-1	no_errors	ENST00000389194	ensembl	human	known	74_37	missense	SNP	0.891	A
DST	667	genome.wustl.edu	37	6	56397194	56397194	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr6:56397194G>A	ENST00000361203.3	-	60	16430	c.16423C>T	c.(16423-16425)Ctc>Ttc	p.L5475F	DST_ENST00000370769.4_Missense_Mutation_p.L5477F|DST_ENST00000244364.6_Missense_Mutation_p.L3063F|DST_ENST00000340834.4_5'UTR|DST_ENST00000446842.2_Missense_Mutation_p.L5151F|DST_ENST00000421834.2_Missense_Mutation_p.L3389F|DST_ENST00000370754.5_Missense_Mutation_p.L5655F|DST_ENST00000370788.2_Missense_Mutation_p.L3389F|DST_ENST00000312431.6_3'UTR			Q03001	DYST_HUMAN	dystonin	5475					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AAGAGACTGAGCTGTTTCAAA	0.418																																																	0								ENSG00000151914						107.0	97.0	100.0					6																	56397194		1860	4097	5957	DST	SO:0001583	missense	0			-	HGNC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.16423C>T	6.37:g.56397194G>A	ENSP00000354508:p.Leu5475Phe	Somatic	0	76	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	68	13.92	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.L5655F	ENST00000361203.3	37	c.16963		6	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195661	0.58126	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45	5.59	5.59	0.84812	.	0.000000	0.41938	D	0.000787	T	0.67088	0.2856	M	0.81682	2.555	0.33340	D	0.569715	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;0.981	D;D;D;D;D	0.91635	0.999;0.997;0.991;0.964;0.914	T	0.68716	-0.5335	9	0.45353	T	0.12	.	13.7289	0.62776	0.0798:0.0:0.9202:0.0	.	3389;5477;5655;5475;3063	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	F	3063;5655;5477;3389;5151;3389;5475	ENSP00000244364:L3063F;ENSP00000359790:L5655F;ENSP00000359805:L5477F;ENSP00000400883:L3389F;ENSP00000393645:L5151F;ENSP00000359824:L3389F;ENSP00000354508:L5475F	ENSP00000244364:L3063F	L	-	1	0	DST	56505153	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.306000	0.51881	2.810000	0.96702	0.586000	0.80456	CTC	-	pfam_Spectrin_repeat,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.418	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	G	NM_001723	-		56397194	-1	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	SNP	1.000	A
CDK5RAP3	80279	genome.wustl.edu	37	17	46053334	46053334	+	Silent	SNP	A	A	G	rs202125432	byFrequency	TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr17:46053334A>G	ENST00000338399.4	+	8	859	c.753A>G	c.(751-753)gaA>gaG	p.E251E	RP11-6N17.9_ENST00000582262.1_RNA|CDK5RAP3_ENST00000536708.2_Silent_p.E276E	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	251					brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)	p.E251E(1)		NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						CTGTGGTGGAACGACCCCACC	0.602																																																	1	Substitution - coding silent(1)	prostate(1)						ENSG00000108465																																			CDK5RAP3	SO:0001819	synonymous_variant	0			-	HGNC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.753A>G	17.37:g.46053334A>G		Somatic	0	88	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	51	10.53	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF773	p.E251	ENST00000338399.4	37	c.753	CCDS42356.1	17																																																																																			-	pfam_DUF773		0.602	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	protein_coding	OTTHUMT00000442913.1	A	NM_176096	rs202125432		46053334	+1	no_errors	ENST00000338399	ensembl	human	known	74_37	silent	SNP	1.000	G
SLC30A9	10463	genome.wustl.edu	37	4	42003739	42003739	+	Silent	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr4:42003739G>A	ENST00000264451.7	+	2	396	c.216G>A	c.(214-216)caG>caA	p.Q72Q		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	72					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CAAATGTTCAGAAAGAAGGAC	0.353																																																	0								ENSG00000014824						94.0	88.0	90.0					4																	42003739		2203	4300	6503	SLC30A9	SO:0001819	synonymous_variant	0			-	HGNC	AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.216G>A	4.37:g.42003739G>A		Somatic	0	74	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	108	13.60	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.Q72	ENST00000264451.7	37	c.216	CCDS3465.1	4																																																																																			-	NULL		0.353	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	protein_coding	OTTHUMT00000216842.3	G		-		42003739	+1	no_errors	ENST00000264451	ensembl	human	known	74_37	silent	SNP	1.000	A
NAP1L3	4675	genome.wustl.edu	37	X	92928153	92928155	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chrX:92928153_92928155delTGC	ENST00000373079.3	-	1	412_414	c.149_151delGCA	c.(148-153)agcact>act	p.S50del	FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000332647.4_5'Flank|FAM133A_ENST00000538690.1_5'Flank|NAP1L3_ENST00000475430.2_In_Frame_Del_p.S43del|FAM133A_ENST00000322139.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	50	Ser-rich.				nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						ctgccactagtgctgctgctgct	0.586																																																	0								ENSG00000186310			192,3509		5,127,55,1456,470						-0.4	0.0			14	387,6034		9,190,179,2144,1556	no	coding	NAP1L3	NM_004538.5		14,317,234,3600,2026	A1A1,A1R,A1,RR,R		6.0271,5.1878,5.7202				579,9543				NAP1L3	SO:0001651	inframe_deletion	0				HGNC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.149_151delGCA	X.37:g.92928162_92928164delTGC	ENSP00000362171:p.Ser50del	Somatic	0	76	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	51	10.53	B2RCM0|O60788	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.S50in_frame_del	ENST00000373079.3	37	c.151_149	CCDS14465.1	X																																																																																			-	NULL		0.586	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L3	protein_coding	OTTHUMT00000057449.1	TGC	NM_004538			92928155	-1	no_errors	ENST00000373079	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.001	-
SOX12	6666	genome.wustl.edu	37	20	307338	307338	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr20:307338G>A	ENST00000342665.2	+	1	1100	c.770G>A	c.(769-771)aGg>aAg	p.R257K	RP5-1103G7.4_ENST00000414676.1_RNA|RP5-1103G7.4_ENST00000442637.1_RNA|SOX12_ENST00000544632.1_Missense_Mutation_p.R257K	NM_006943.2	NP_008874.2	O15370	SOX12_HUMAN	SRY (sex determining region Y)-box 12	257					cell fate commitment (GO:0045165)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord development (GO:0021510)	nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	2		all_cancers(10;0.000331)|Lung NSC(37;0.0496)|all_lung(30;0.0831)|all_epithelial(17;0.0868)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			TTTCTGTCCAGGCTGCCCCCT	0.706																																																	0								ENSG00000177732						17.0	17.0	17.0					20																	307338		2177	4274	6451	SOX12	SO:0001583	missense	0			-	HGNC	U35612	CCDS12995.1	20p13	2008-07-28	2002-07-22	2002-07-26	ENSG00000177732	ENSG00000177732		"""SRY (sex determining region Y)-boxes"""	11198	protein-coding gene	gene with protein product		601947	"""SRY (sex determining region Y)-box 22"""	SOX22		9215677	Standard	NM_006943		Approved		uc002wdh.4	O15370	OTTHUMG00000031623	ENST00000342665.2:c.770G>A	20.37:g.307338G>A	ENSP00000347646:p.Arg257Lys	Somatic	0	33	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q5D038|Q9NUD4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pirsf_SOX-12/11/4a,pfscan_HMG_box_dom	p.R257K	ENST00000342665.2	37	c.770	CCDS12995.1	20	.	.	.	.	.	.	.	.	.	.	G	5.405	0.259998	0.10239	.	.	ENSG00000177732	ENST00000544632;ENST00000342665	D;D	0.97665	-4.48;-4.48	3.23	3.23	0.37069	.	0.879586	0.09387	U	0.809110	D	0.91626	0.7354	N	0.24115	0.695	0.24006	N	0.996194	B	0.28324	0.207	B	0.30105	0.111	T	0.83355	-0.0001	10	0.05620	T	0.96	.	7.4588	0.27283	0.1264:0.0:0.8736:0.0	.	257	O15370	SOX12_HUMAN	K	257	ENSP00000441671:R257K;ENSP00000347646:R257K	ENSP00000347646:R257K	R	+	2	0	SOX12	255338	0.262000	0.24073	1.000000	0.80357	0.615000	0.37417	1.228000	0.32588	1.643000	0.50594	0.195000	0.17529	AGG	-	pirsf_SOX-12/11/4a		0.706	SOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX12	protein_coding	OTTHUMT00000077435.2	G	NM_006943	-		307338	+1	no_errors	ENST00000342665	ensembl	human	known	74_37	missense	SNP	1.000	A
KY	339855	genome.wustl.edu	37	3	134329079	134329079	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:134329079C>A	ENST00000423778.2	-	9	918	c.857G>T	c.(856-858)gGc>gTc	p.G286V	KY_ENST00000503669.1_Missense_Mutation_p.G286V|KY_ENST00000508956.1_Missense_Mutation_p.G265V|KY_ENST00000508041.1_5'Flank	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	286					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)	p.G286D(2)		central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						CAGGCCGCTGCCCCAGGTGCT	0.582																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000174611						76.0	83.0	81.0					3																	134329079		2135	4244	6379	KY	SO:0001583	missense	0			-	HGNC	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.857G>T	3.37:g.134329079C>A	ENSP00000397598:p.Gly286Val	Somatic	0	52	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	55	9.84	B7Z1S4|Q6ZT15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transglutaminase-like,smart_Transglutaminase-like	p.G286V	ENST00000423778.2	37	c.857	CCDS46920.1	3	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530152	0.85706	.	.	ENSG00000174611	ENST00000508956;ENST00000423778;ENST00000503669;ENST00000310263	T;T;T	0.28255	1.62;1.62;1.62	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.59702	0.2213	M	0.75264	2.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.60762	-0.7199	10	0.87932	D	0	-10.4183	20.1278	0.97990	0.0:1.0:0.0:0.0	.	265;286;286	Q8NBH2-3;B4DGA7;Q8NBH2-4	.;.;.	V	265;286;286;286	ENSP00000421297:G265V;ENSP00000397598:G286V;ENSP00000426777:G286V	ENSP00000309520:G286V	G	-	2	0	KY	135811769	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.677000	0.68142	2.768000	0.95171	0.561000	0.74099	GGC	-	NULL		0.582	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KY	protein_coding	OTTHUMT00000357320.1	C	NM_178554	-		134329079	-1	no_errors	ENST00000423778	ensembl	human	known	74_37	missense	SNP	1.000	A
ERAP1	51752	genome.wustl.edu	37	5	96139198	96139198	+	Silent	SNP	C	C	T	rs147576297		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr5:96139198C>T	ENST00000443439.2	-	2	498	c.432G>A	c.(430-432)ccG>ccA	p.P144P	CTD-2260A17.3_ENST00000606656.1_RNA|ERAP1_ENST00000296754.3_Silent_p.P144P|CTD-2260A17.3_ENST00000606346.1_RNA	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	144					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		CAACTGTGTACGGGAGCCCGA	0.532																																																	0								ENSG00000164307						66.0	72.0	70.0					5																	96139198		2203	4300	6503	ERAP1	SO:0001819	synonymous_variant	0			-	HGNC	AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.432G>A	5.37:g.96139198C>T		Somatic	0	52	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.P144	ENST00000443439.2	37	c.432	CCDS47250.1	5																																																																																			-	pfam_Peptidase_M1_N		0.532	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAP1	protein_coding	OTTHUMT00000370699.1	C	NM_016442	-		96139198	-1	no_errors	ENST00000296754	ensembl	human	known	74_37	silent	SNP	0.000	T
DNAH8	1769	genome.wustl.edu	37	6	38800097	38800097	+	Splice_Site	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr6:38800097G>A	ENST00000359357.3	+	29	3791		c.e29-1		DNAH8_ENST00000449981.2_Splice_Site|DNAH8_ENST00000441566.1_Splice_Site			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TTTTATTGTAGGTTTCAGTAC	0.333																																																	0								ENSG00000124721						84.0	76.0	79.0					6																	38800097		2203	4300	6503	DNAH8	SO:0001630	splice_region_variant	0			-	HGNC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.3538-1G>A	6.37:g.38800097G>A		Somatic	0	80	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	87	11.22	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e27-1	ENST00000359357.3	37	c.3538-1		6	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996061	0.54147	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.41	4.35	0.52113	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2919	0.60276	0.0871:0.0:0.9129:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH8	38908075	1.000000	0.71417	1.000000	0.80357	0.792000	0.44763	6.847000	0.75404	2.548000	0.85928	0.563000	0.77884	.	-	-		0.333	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	G	NM_001206927	-	Intron	38800097	+1	no_errors	ENST00000359357	ensembl	human	known	74_37	splice_site	SNP	0.986	A
KIF22	3835	genome.wustl.edu	37	16	29815365	29815365	+	Silent	SNP	G	G	A	rs372310662		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr16:29815365G>A	ENST00000160827.4	+	11	1696	c.1656G>A	c.(1654-1656)aaG>aaA	p.K552K	KIF22_ENST00000400750.2_Silent_p.K57K|KIF22_ENST00000569382.2_Silent_p.K484K|MAZ_ENST00000322945.6_5'Flank|MAZ_ENST00000563402.1_5'Flank|MAZ_ENST00000219782.6_5'Flank|MAZ_ENST00000545521.1_5'Flank|KIF22_ENST00000400751.5_Silent_p.K484K|MAZ_ENST00000566906.2_5'Flank|KIF22_ENST00000561482.1_Silent_p.K484K|MAZ_ENST00000562337.1_5'Flank|AC009133.15_ENST00000566537.1_RNA	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	552					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						ACATCCTGAAGAATAAAGGCC	0.542																																																	0								ENSG00000079616						71.0	71.0	71.0					16																	29815365		2197	4296	6493	KIF22	SO:0001819	synonymous_variant	0			-	HGNC	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1656G>A	16.37:g.29815365G>A		Somatic	0	24	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,superfamily_RuvA_2-like,smart_Kinesin_motor_dom,smart_Hlx-hairpin-Hlx_DNA-bd_motif,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K552	ENST00000160827.4	37	c.1656	CCDS10653.1	16																																																																																			-	NULL		0.542	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF22	protein_coding	OTTHUMT00000215012.2	G		-		29815365	+1	no_errors	ENST00000160827	ensembl	human	known	74_37	silent	SNP	1.000	A
MGAM	8972	genome.wustl.edu	37	7	141708495	141708495	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr7:141708495C>T	ENST00000549489.2	+	3	412	c.317C>T	c.(316-318)cCg>cTg	p.P106L	MGAM_ENST00000475668.2_Missense_Mutation_p.P106L	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	106	P-type 1. {ECO:0000255|PROSITE- ProRule:PRU00779}.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CCTGACCAGCCGCCAACAAAG	0.368																																																	0								ENSG00000257335						62.0	62.0	62.0					7																	141708495		1852	4096	5948	MGAM	SO:0001583	missense	0			-	HGNC	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.317C>T	7.37:g.141708495C>T	ENSP00000447378:p.Pro106Leu	Somatic	0	56	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	61	16.44	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.P106L	ENST00000549489.2	37	c.317	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	C	1.016	-0.686451	0.03328	.	.	ENSG00000257335	ENST00000465654;ENST00000549489;ENST00000497673;ENST00000475668	T;D;T	0.88509	-0.66;-2.39;0.74	4.33	1.54	0.23209	P-type trefoil, conserved site (1);P-type trefoil (4);	1.400010	0.04991	N	0.467247	T	0.78175	0.4242	N	0.16368	0.405	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.62086	-0.6928	10	0.18276	T	0.48	.	3.8241	0.08848	0.1907:0.6088:0.0:0.2005	.	106	O43451	MGA_HUMAN	L	106	ENSP00000419372:P106L;ENSP00000447378:P106L;ENSP00000417103:P106L	ENSP00000373973:P106L	P	+	2	0	MGAM	141354964	0.047000	0.20315	0.069000	0.20011	0.892000	0.51952	0.275000	0.18698	0.356000	0.24157	-0.897000	0.02905	CCG	-	pfam_P_trefoil,smart_P_trefoil		0.368	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	protein_coding	OTTHUMT00000351244.3	C		-		141708495	+1	no_errors	ENST00000549489	ensembl	human	known	74_37	missense	SNP	0.076	T
TUBB2B	347733	genome.wustl.edu	37	6	3227775	3227775	+	Start_Codon_SNP	SNP	C	C	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr6:3227775C>A	ENST00000259818.7	-	1	194	c.3G>T	c.(1-3)atG>atT	p.M1I	TUBB2B_ENST00000473006.1_Intron	NM_178012.4	NP_821080.1	Q9BVA1	TBB2B_HUMAN	tubulin, beta 2B class IIb	1					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|neuron migration (GO:0001764)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			kidney(2)|large_intestine(5)|lung(1)|prostate(1)|skin(1)	10	Ovarian(93;0.0386)	all_hematologic(90;0.108)				CGATCTCACGCATGGTGCCTC	0.711																																																	0								ENSG00000137285						45.0	44.0	45.0					6																	3227775		2202	4300	6502	TUBB2B	SO:0001582	initiator_codon_variant	0			-	HGNC	BC001352	CCDS4485.1	6p25.2	2011-10-10	2011-10-10		ENSG00000137285	ENSG00000137285		"""Tubulins"""	30829	protein-coding gene	gene with protein product	"""class IIb beta-tubulin"""	612850	"""tubulin, beta 2B"""			8619474, 9110174	Standard	NM_178012		Approved	MGC8685, DKFZp566F223, bA506K6.1	uc003mvg.3	Q9BVA1	OTTHUMG00000014143	ENST00000259818.7:c.3G>T	6.37:g.3227775C>A	ENSP00000259818:p.Met1Ile	Somatic	1	319	0.31		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	238	14.39	A8K068	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.M1I	ENST00000259818.7	37	c.3	CCDS4485.1	6	.	.	.	.	.	.	.	.	.	.	C	24.8	4.570488	0.86542	.	.	ENSG00000137285	ENST00000259818	T	0.70869	-0.52	4.34	4.34	0.51931	Tubulin/FtsZ, GTPase domain (2);	0.000000	0.64402	D	0.000001	D	0.82318	0.5011	.	.	.	0.80722	D	1	D;D	0.69078	0.995;0.997	D;D	0.79784	0.989;0.993	D	0.85280	0.1061	9	0.87932	D	0	.	17.4008	0.87459	0.0:1.0:0.0:0.0	.	1;1	Q8IZ29;Q9BVA1	.;TBB2B_HUMAN	I	1	ENSP00000259818:M1I	ENSP00000259818:M1I	M	-	3	0	TUBB2B	3172774	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.657000	0.67996	2.403000	0.81681	0.561000	0.74099	ATG	-	pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase		0.711	TUBB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB2B	protein_coding	OTTHUMT00000039680.2	C	NM_178012	-	Missense_Mutation	3227775	-1	no_errors	ENST00000259818	ensembl	human	known	74_37	missense	SNP	1.000	A
NCBP2	22916	genome.wustl.edu	37	3	196664064	196664064	+	Intron	DEL	A	A	-			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:196664064delA	ENST00000321256.5	-	4	493				NCBP2_ENST00000427641.2_Intron|NCBP2_ENST00000452404.2_Intron|NCBP2_ENST00000422610.1_Intron|NCBP2-AS1_ENST00000447775.1_RNA|NCBP2_ENST00000447325.1_Intron|NCBP2_ENST00000467803.1_5'UTR	NM_007362.3	NP_031388.2	P52298	NCBP2_HUMAN	nuclear cap binding protein subunit 2, 20kDa						7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of RNA export from nucleus (GO:0046833)|positive regulation of viral transcription (GO:0050434)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mRNA cap binding complex (GO:0005845)|nuclear cap binding complex (GO:0005846)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA 7-methylguanosine cap binding (GO:0000340)|RNA cap binding (GO:0000339)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	5	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.42e-24)|all cancers(36;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(49;4.13e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00551)		CCACAATGTGAACATTTCAAG	0.413																																																	0								ENSG00000114503																																			NCBP2	SO:0001627	intron_variant	0				HGNC	D59253	CCDS3323.1, CCDS46986.1	3q29	2013-02-12	2002-08-29		ENSG00000114503	ENSG00000114503		"""RNA binding motif (RRM) containing"""	7659	protein-coding gene	gene with protein product		605133	"""nuclear cap binding protein subunit 2, 20kD"""			7478990, 7651522, 8682299	Standard	NM_001042540		Approved	NIP1, CBP20, Cbc2	uc003fxd.1	P52298	OTTHUMG00000155520	ENST00000321256.5:c.400-111T>-	3.37:g.196664064delA		Somatic	0	30	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	46	11.54	B2RE91|B4DMK7|E9PAR5|Q14924|Q2TS50	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000321256.5	37	NULL	CCDS3323.1	3																																																																																			-	-		0.413	NCBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCBP2	protein_coding	OTTHUMT00000340470.2	A	NM_007362			196664064	-1	no_errors	ENST00000467803	ensembl	human	putative	74_37	rna	DEL	0.000	-
OR4Q3	441669	genome.wustl.edu	37	14	20215944	20215944	+	Missense_Mutation	SNP	G	G	A	rs146262204	byFrequency	TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr14:20215944G>A	ENST00000331723.1	+	1	358	c.358G>A	c.(358-360)Gcc>Acc	p.A120T		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	120						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GACAGTCATGGCCTATGACAG	0.517																																																	0								ENSG00000182652						97.0	99.0	98.0					14																	20215944		2203	4299	6502	OR4Q3	SO:0001583	missense	0			-	HGNC	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.358G>A	14.37:g.20215944G>A	ENSP00000330049:p.Ala120Thr	Somatic	0	118	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	118	9.23	Q6IEX4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A120T	ENST00000331723.1	37	c.358	CCDS32020.1	14	.	.	.	.	.	.	.	.	.	.	.	20.8	4.050597	0.75960	.	.	ENSG00000182652	ENST00000331723	T	0.54071	0.59	4.36	4.36	0.52297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39834	U	0.001255	T	0.80497	0.4634	H	0.98133	4.155	0.40724	D	0.982689	D	0.89917	1.0	D	0.97110	1.0	D	0.85678	0.1299	10	0.87932	D	0	.	9.6164	0.39694	0.0:0.0:0.7913:0.2087	.	120	Q8NH05	OR4Q3_HUMAN	T	120	ENSP00000330049:A120T	ENSP00000330049:A120T	A	+	1	0	OR4Q3	19285784	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.121000	0.71602	2.257000	0.74773	0.406000	0.27484	GCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.517	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4Q3	protein_coding	OTTHUMT00000409818.2	G		-		20215944	+1	no_errors	ENST00000331723	ensembl	human	known	74_37	missense	SNP	1.000	A
DHRS4-AS1	55449	genome.wustl.edu	37	14	24410284	24410284	+	IGR	SNP	G	G	A	rs375732735		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr14:24410284G>A	ENST00000354854.1	+	0	1257				DHRS4-AS1_ENST00000556379.1_RNA			Q9P1J3	DHAS1_HUMAN	DHRS4 antisense RNA 1																		AGATCTTGAAGAAAGGAGACt	0.468																																																	0								ENSG00000215256																																			DHRS4-AS1	SO:0001628	intergenic_variant	0			-	HGNC	AF116636		14q11.2	2013-10-11	2012-08-16	2012-04-30	ENSG00000215256	ENSG00000215256		"""Long non-coding RNAs"""	23175	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 167"", ""DHRS4 antisense RNA 1 (non-protein coding)"""	C14orf167		22891334	Standard	NR_023924		Approved	PRO1488, AS1DHRS4	uc001wky.3	Q9P1J3	OTTHUMG00000171901		14.37:g.24410284G>A		Somatic	0	81	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	55	8.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000354854.1	37	NULL		14																																																																																			-	-		0.468	DHRS4-AS1-201	KNOWN	basic|appris_principal	protein_coding	DHRS4-AS1	protein_coding		G	NR_023921	-		24410284	-1	no_errors	ENST00000555045	ensembl	human	known	74_37	rna	SNP	0.004	A
TECPR1	25851	genome.wustl.edu	37	7	97860661	97860661	+	Missense_Mutation	SNP	C	C	T	rs547498286		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr7:97860661C>T	ENST00000447648.2	-	14	2298	c.1999G>A	c.(1999-2001)Gtg>Atg	p.V667M	TECPR1_ENST00000379795.3_Missense_Mutation_p.V668M|TECPR1_ENST00000542604.1_Missense_Mutation_p.V597M|TECPR1_ENST00000479975.1_5'Flank			Q7Z6L1	TCPR1_HUMAN	tectonin beta-propeller repeat containing 1	667	PH.				autophagic vacuole fusion (GO:0000046)|autophagy (GO:0006914)	autophagic vacuole membrane (GO:0000421)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(2)|endometrium(8)|kidney(1)|large_intestine(1)|lung(9)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						AGCGCCACCACCTCATTCAGG	0.632																																																	0								ENSG00000205356						48.0	53.0	51.0					7																	97860661		2078	4200	6278	TECPR1	SO:0001583	missense	0			-	HGNC		CCDS47648.1	7q21.3	2009-01-30			ENSG00000205356	ENSG00000205356			22214	protein-coding gene	gene with protein product		614781					Standard	NM_015395		Approved	DKFZP434B0335, FLJ23419, FLJ90593, KIAA1358	uc003upg.4	Q7Z6L1	OTTHUMG00000154273	ENST00000447648.2:c.1999G>A	7.37:g.97860661C>T	ENSP00000404923:p.Val667Met	Somatic	0	70	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	48	17.24	A8KAD1|B3KPZ1|C9J024|F5GX57|Q96EB0|Q9P2I9|Q9UFR6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Beta-propeller_rpt_TECPR,superfamily_RCC1/BLIP-II,smart_Beta-propeller_rpt_TECPR,smart_Peroxin/Ferlin	p.V668M	ENST00000447648.2	37	c.2002	CCDS47648.1	7	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735571	0.49045	.	.	ENSG00000205356	ENST00000447648;ENST00000379795;ENST00000542604	T;T;T	0.42900	1.01;1.01;0.96	4.84	4.84	0.62591	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.63850	0.2546	M	0.66939	2.045	0.45139	D	0.998156	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.68345	-0.5433	10	0.87932	D	0	-19.8106	16.9131	0.86144	0.0:1.0:0.0:0.0	.	597;667	F5GX57;Q7Z6L1	.;TCPR1_HUMAN	M	667;668;597	ENSP00000404923:V667M;ENSP00000369121:V668M;ENSP00000441121:V597M	ENSP00000369121:V668M	V	-	1	0	TECPR1	97698597	1.000000	0.71417	0.999000	0.59377	0.003000	0.03518	6.032000	0.70918	2.229000	0.72834	0.462000	0.41574	GTG	-	NULL		0.632	TECPR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TECPR1	protein_coding	OTTHUMT00000334661.1	C	NM_015395	-		97860661	-1	no_errors	ENST00000379795	ensembl	human	known	74_37	missense	SNP	1.000	T
HMHA1	23526	genome.wustl.edu	37	19	1080092	1080092	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:1080092G>C	ENST00000313093.2	+	13	1909	c.1678G>C	c.(1678-1680)Gag>Cag	p.E560Q	HMHA1_ENST00000590214.1_Missense_Mutation_p.E587Q|HMHA1_ENST00000586866.1_Missense_Mutation_p.E564Q|HMHA1_ENST00000590577.1_Missense_Mutation_p.E195Q|HMHA1_ENST00000543365.1_Missense_Mutation_p.E443Q|HMHA1_ENST00000536472.1_Missense_Mutation_p.E400Q|HMHA1_ENST00000539243.2_Missense_Mutation_p.E576Q	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	560					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTACGACTTTGAGCCCCACGT	0.687																																																	0								ENSG00000180448						45.0	45.0	45.0					19																	1080092		2203	4300	6503	HMHA1	SO:0001583	missense	0			-	HGNC	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.1678G>C	19.37:g.1080092G>C	ENSP00000316772:p.Glu560Gln	Somatic	0	90	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	109	17.42	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.E560Q	ENST00000313093.2	37	c.1678	CCDS32863.1	19	.	.	.	.	.	.	.	.	.	.	G	10.36	1.327753	0.24080	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	3.97	3.97	0.46021	.	0.060805	0.64402	U	0.000005	T	0.38665	0.1049	L	0.27975	0.815	0.36815	D	0.886083	P;P;B;P;P	0.45715	0.831;0.865;0.382;0.639;0.647	B;B;B;B;B	0.42555	0.284;0.391;0.091;0.155;0.131	T	0.42032	-0.9475	10	0.33141	T	0.24	-17.9403	9.7646	0.40552	0.0:0.2118:0.7882:0.0	.	400;576;195;443;560	F5H4A3;F6QP70;B3KVA9;F5H1R4;Q92619	.;.;.;.;HMHA1_HUMAN	Q	576;560;560;400;554;443	ENSP00000439601:E576Q;ENSP00000316772:E560Q;ENSP00000445109:E400Q;ENSP00000438979:E443Q	ENSP00000316772:E560Q	E	+	1	0	HMHA1	1031092	1.000000	0.71417	0.788000	0.31933	0.065000	0.16274	6.761000	0.74945	1.783000	0.52377	0.561000	0.74099	GAG	-	NULL		0.687	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	protein_coding	OTTHUMT00000458026.1	G		-		1080092	+1	no_errors	ENST00000313093	ensembl	human	known	74_37	missense	SNP	0.987	C
RYR1	6261	genome.wustl.edu	37	19	39077992	39077992	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:39077992G>T	ENST00000359596.3	+	106	15049	c.15049G>T	c.(15049-15051)Gag>Tag	p.E5017*	RYR1_ENST00000355481.4_Nonsense_Mutation_p.E5012*|RYR1_ENST00000360985.3_Nonsense_Mutation_p.E5012*			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	5017					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GATGTACCAAGAGAGATGTTG	0.453																																																	0								ENSG00000196218						108.0	95.0	100.0					19																	39077992		2203	4300	6503	RYR1	SO:0001587	stop_gained	0			-	HGNC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.15049G>T	19.37:g.39077992G>T	ENSP00000352608:p.Glu5017*	Somatic	0	48	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	48	15.79	Q16314|Q16368|Q9NPK1|Q9P1U4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.E5017*	ENST00000359596.3	37	c.15049	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	G	56	26.241876	0.99968	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	5.52	5.52	0.82312	.	0.155058	0.40064	U	0.001188	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	19.0913	0.93228	0.0:0.0:1.0:0.0	.	.	.	.	X	5017;5012;5012	.	ENSP00000347667:E5012X	E	+	1	0	RYR1	43769832	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.434000	0.97515	2.617000	0.88574	0.650000	0.86243	GAG	-	NULL		0.453	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	protein_coding	OTTHUMT00000462137.1	G		-		39077992	+1	no_errors	ENST00000359596	ensembl	human	known	74_37	nonsense	SNP	1.000	T
C2CD5	9847	genome.wustl.edu	37	12	22610069	22610069	+	Missense_Mutation	SNP	C	C	T	rs375588532		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr12:22610069C>T	ENST00000333957.4	-	23	2815	c.2560G>A	c.(2560-2562)Gtg>Atg	p.V854M	C2CD5_ENST00000545552.1_Missense_Mutation_p.V908M|C2CD5_ENST00000446597.1_Missense_Mutation_p.V905M|C2CD5_ENST00000544930.1_Missense_Mutation_p.V710M|C2CD5_ENST00000536386.1_Missense_Mutation_p.V907M|C2CD5_ENST00000542676.1_Missense_Mutation_p.V905M|C2CD5_ENST00000396028.2_Missense_Mutation_p.V896M	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	854					cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CCATCACCCACTGGACTTGCT	0.408																																																	0								ENSG00000111731						97.0	89.0	92.0					12																	22610069		2203	4300	6503	C2CD5	SO:0001583	missense	0			-	HGNC	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.2560G>A	12.37:g.22610069C>T	ENSP00000334229:p.Val854Met	Somatic	0	75	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	56	22.22	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.V854M	ENST00000333957.4	37	c.2560	CCDS31758.1	12	.	.	.	.	.	.	.	.	.	.	C	6.191	0.403433	0.11754	.	.	ENSG00000111731	ENST00000333957;ENST00000446597;ENST00000536386;ENST00000396028;ENST00000542676;ENST00000545552;ENST00000544930	T;T;T;T;T;T	0.64260	-0.07;-0.09;-0.09;-0.09;-0.09;-0.09	4.96	-8.53	0.00916	.	0.377447	0.28182	N	0.016298	T	0.26268	0.0641	N	0.08118	0	0.09310	N	0.999997	B;B;B;B;B	0.11235	0.001;0.0;0.004;0.004;0.0	B;B;B;B;B	0.17098	0.003;0.002;0.017;0.009;0.001	T	0.16453	-1.0402	10	0.20519	T	0.43	-1.6006	3.7657	0.08622	0.122:0.4241:0.2551:0.1987	.	907;905;710;896;854	F5H2A1;B4DRN7;F5H3N1;Q86YS7-2;Q86YS7	.;.;.;.;K0528_HUMAN	M	854;905;907;896;905;908;710	ENSP00000334229:V854M;ENSP00000388756:V905M;ENSP00000439392:V907M;ENSP00000379345:V896M;ENSP00000441951:V905M;ENSP00000443204:V908M	ENSP00000334229:V854M	V	-	1	0	KIAA0528	22501336	0.041000	0.20044	0.158000	0.22627	0.898000	0.52572	0.185000	0.16958	-1.291000	0.02368	-1.058000	0.02302	GTG	-	NULL		0.408	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD5	protein_coding	OTTHUMT00000402257.1	C	NM_014802	-		22610069	-1	no_errors	ENST00000333957	ensembl	human	known	74_37	missense	SNP	0.014	T
DNAJC13	23317	genome.wustl.edu	37	3	132175349	132175349	+	Silent	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr3:132175349C>T	ENST00000260818.6	+	11	1352	c.1104C>T	c.(1102-1104)ggC>ggT	p.G368G	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	368					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTACAGATGGCAACTTTGCAG	0.308																																																	0								ENSG00000138246						135.0	132.0	133.0					3																	132175349		2203	4300	6503	DNAJC13	SO:0001819	synonymous_variant	0			-	HGNC	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.1104C>T	3.37:g.132175349C>T		Somatic	0	59	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.G368	ENST00000260818.6	37	c.1104	CCDS33857.1	3																																																																																			-	NULL		0.308	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	protein_coding	OTTHUMT00000356807.2	C	NM_015268	-		132175349	+1	no_errors	ENST00000260818	ensembl	human	known	74_37	silent	SNP	0.988	T
KANK3	256949	genome.wustl.edu	37	19	8398950	8398961	+	In_Frame_Del	DEL	TCGCTGTCGCCA	TCGCTGTCGCCA	-	rs111751275|rs199822445|rs201862465|rs6146458|rs200669927	byFrequency	TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	TCGCTGTCGCCA	TCGCTGTCGCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:8398950_8398961delTCGCTGTCGCCA	ENST00000593649.1	-	5	1532_1543	c.1467_1478delTGGCGACAGCGA	c.(1465-1479)gatggcgacagcgag>gag	p.DGDS489del	KANK3_ENST00000330915.3_In_Frame_Del_p.DGDS489del			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	489								p.D489_S492delDGDS(2)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						GCCACCGTTCTCGCTGTCGCCATCGCTGTCGC	0.717														1760	0.351438	0.4085	0.428	5008	,	,		15278	0.2927		0.2962	False		,,,				2504	0.3374																2	Deletion - In frame(2)	large_intestine(1)|breast(1)						ENSG00000186994			958,2544		287,384,1080						-7.5	0.0		dbSNP_114	6	1402,5766		338,726,2520	no	coding	KANK3	NM_198471.2		625,1110,3600	A1A1,A1R,RR		19.5592,27.3558,22.1181				2360,8310				KANK3	SO:0001651	inframe_deletion	0				HGNC	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.1467_1478delTGGCGACAGCGA	19.37:g.8398950_8398961delTCGCTGTCGCCA	ENSP00000470728:p.Asp489_Ser492del	Somatic	NA	NA	NA		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6NZI1|Q6ZQR3|Q8IUV2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.DGDS489in_frame_del	ENST00000593649.1	37	c.1478_1467		19																																																																																			-	NULL		0.717	KANK3-002	KNOWN	basic	protein_coding	KANK3	protein_coding	OTTHUMT00000461379.1	TCGCTGTCGCCA	NM_198471			8398961	-1	no_errors	ENST00000593649	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.046:0.028:0.025:0.017:0.004:0.003:0.002:0.000:0.001:0.003:0.001	-
SHROOM4	57477	genome.wustl.edu	37	X	50350758	50350759	+	In_Frame_Ins	INS	-	-	TGCTGCTGCTGT	rs201922875|rs553160982		TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chrX:50350758_50350759insTGCTGCTGCTGT	ENST00000289292.7	-	6	3666_3667	c.3383_3384insACAGCAGCAGCA	c.(3382-3384)cag>caACAGCAGCAGCAg	p.1128_1128Q>QQQQQ	SHROOM4_ENST00000460112.3_In_Frame_Ins_p.1012_1012Q>QQQQQ|SHROOM4_ENST00000376020.2_In_Frame_Ins_p.1128_1128Q>QQQQQ			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1128	Gln-rich.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					cctgttgcttctgctgctgctg	0.589																																																	0								ENSG00000158352			12,1892,1813		0,4,5,3,450,721,267,412,263						-6.4	0.0			16	21,2147,4298		1,7,3,9,306,942,586,1095,1163	no	codingComplex	SHROOM4	NM_020717.3		1,11,8,12,756,1663,853,1507,1426	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		33.5292,49.0987,39.9882				33,4039,6111				SHROOM4	SO:0001652	inframe_insertion	0				HGNC	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3372_3383dupACAGCAGCAGCA	X.37:g.50350758_50350759insTGCTGCTGCTGT	ENSP00000289292:p.GlnGlnGlnGln1128dup	Somatic	NA	NA	NA		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7E2X9|D6RFW0|Q96LA0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.1129in_frame_insQQQQ	ENST00000289292.7	37	c.3384_3383	CCDS35277.1	X																																																																																			-	NULL		0.589	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	protein_coding	OTTHUMT00000056564.4	-	NM_020717			50350759	-1	no_errors	ENST00000289292	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.000	TGCTGCTGCTGT
IDH3G	3421	genome.wustl.edu	37	X	153055183	153055183	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chrX:153055183G>T	ENST00000217901.5	-	5	526	c.330C>A	c.(328-330)aaC>aaA	p.N110K	IDH3G_ENST00000370092.3_Missense_Mutation_p.N110K|IDH3G_ENST00000427365.2_Missense_Mutation_p.N52K|IDH3G_ENST00000497043.1_5'UTR|IDH3G_ENST00000370093.1_Missense_Mutation_p.N110K	NM_004135.3	NP_004126.1	P51553	IDH3G_HUMAN	isocitrate dehydrogenase 3 (NAD+) gamma	110					carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|prostate(1)	17	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGCCACGCGGTTCCGGCGGA	0.552																																																	0								ENSG00000067829						57.0	40.0	46.0					X																	153055183		2201	4298	6499	IDH3G	SO:0001583	missense	0			-	HGNC		CCDS14730.1, CCDS44019.1	Xq28	2008-02-05			ENSG00000067829	ENSG00000067829	1.1.1.41		5386	protein-coding gene	gene with protein product		300089				9286695	Standard	NM_004135		Approved		uc004fip.4	P51553	OTTHUMG00000024219	ENST00000217901.5:c.330C>A	X.37:g.153055183G>T	ENSP00000217901:p.Asn110Lys	Somatic	0	50	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	32	17.95	E9PDD5|Q9BUU5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_NAD	p.N110K	ENST00000217901.5	37	c.330	CCDS14730.1	X	.	.	.	.	.	.	.	.	.	.	G	18.68	3.675849	0.67928	.	.	ENSG00000067829	ENST00000370092;ENST00000217901;ENST00000370093;ENST00000427365;ENST00000393771;ENST00000444450;ENST00000444338	T;T;T;T;T;T	0.72725	0.53;0.53;0.53;0.53;0.53;-0.68	5.34	3.3	0.37823	Isopropylmalate dehydrogenase-like domain (2);	0.196903	0.51477	D	0.000089	D	0.87904	0.6295	H	0.97390	3.995	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88698	0.3213	10	0.87932	D	0	.	8.8788	0.35363	0.2585:0.0:0.7415:0.0	.	110;110	E9PDD5;P51553	.;IDH3G_HUMAN	K	110;110;110;52;6;87;21	ENSP00000359110:N110K;ENSP00000217901:N110K;ENSP00000359111:N110K;ENSP00000408529:N52K;ENSP00000401862:N87K;ENSP00000402747:N21K	ENSP00000217901:N110K	N	-	3	2	IDH3G	152708377	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	1.065000	0.30592	1.042000	0.40150	0.529000	0.55759	AAC	-	pfam_IsoPropMal-DH-like_dom,tigrfam_Isocitrate_DH_NAD		0.552	IDH3G-005	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH3G	protein_coding	OTTHUMT00000061084.27	G		-		153055183	-1	no_errors	ENST00000217901	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC34A2	10568	genome.wustl.edu	37	4	25667869	25667869	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr4:25667869G>A	ENST00000382051.3	+	5	549	c.499G>A	c.(499-501)Gtt>Att	p.V167I	SLC34A2_ENST00000510033.2_3'UTR|SLC34A2_ENST00000503434.1_Missense_Mutation_p.V166I|SLC34A2_ENST00000504570.1_Missense_Mutation_p.V166I	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	167					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				AACGTCCATCGTTGTCAGCAT	0.572			T	ROS1	NSCLC																																			Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	0								ENSG00000157765						115.0	100.0	105.0					4																	25667869		2203	4300	6503	SLC34A2	SO:0001583	missense	0			-	HGNC	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.499G>A	4.37:g.25667869G>A	ENSP00000371483:p.Val167Ile	Somatic	0	55	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/Pi_transpt,superfamily_ABC1_TM_dom,tigrfam_Na/Pi_transpt	p.V167I	ENST00000382051.3	37	c.499	CCDS3435.1	4	.	.	.	.	.	.	.	.	.	.	G	6.006	0.369578	0.11352	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	D;D;D	0.86030	-2.06;-2.06;-2.06	5.4	-5.45	0.02616	.	0.242536	0.42420	N	0.000706	T	0.68238	0.2979	N	0.16233	0.39	0.31660	N	0.645714	B;B	0.28584	0.216;0.05	B;B	0.27500	0.058;0.08	T	0.54997	-0.8209	9	.	.	.	-12.1217	14.2961	0.66314	0.4521:0.0:0.5479:0.0	.	166;167	O95436-2;O95436	.;NPT2B_HUMAN	I	166;167;166	ENSP00000425501:V166I;ENSP00000371483:V167I;ENSP00000423021:V166I	.	V	+	1	0	SLC34A2	25276967	0.002000	0.14202	0.452000	0.26994	0.276000	0.26787	-0.024000	0.12435	-1.166000	0.02783	-0.258000	0.10820	GTT	-	pfam_Na/Pi_transpt,tigrfam_Na/Pi_transpt		0.572	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A2	protein_coding	OTTHUMT00000214990.1	G	NM_006424	-		25667869	+1	no_errors	ENST00000382051	ensembl	human	known	74_37	missense	SNP	0.988	A
KIT	3815	genome.wustl.edu	37	4	55602958	55602958	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr4:55602958C>T	ENST00000288135.5	+	19	2765	c.2668C>T	c.(2668-2670)Ctc>Ttc	p.L890F		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	890	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTTCCGGATGCTCAGCCCTGA	0.438		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0								ENSG00000157404						80.0	77.0	78.0					4																	55602958		2203	4300	6503	KIT	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	-	HGNC	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.2668C>T	4.37:g.55602958C>T	ENSP00000288135:p.Leu890Phe	Somatic	0	44	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L890F	ENST00000288135.5	37	c.2668	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	C	4.289	0.052751	0.08291	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82893	-1.66;-1.66	5.59	3.78	0.43462	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.390655	0.21729	N	0.069989	T	0.67646	0.2915	L	0.37897	1.145	0.33120	D	0.541601	B;B	0.06786	0.001;0.001	B;B	0.14023	0.004;0.01	T	0.56498	-0.7969	10	0.11182	T	0.66	.	1.2394	0.01960	0.1689:0.4368:0.1648:0.2295	.	886;890	P10721-2;P10721	.;KIT_HUMAN	F	890;886	ENSP00000288135:L890F;ENSP00000390987:L886F	ENSP00000288135:L890F	L	+	1	0	KIT	55297715	1.000000	0.71417	1.000000	0.80357	0.536000	0.34869	1.195000	0.32186	0.625000	0.30304	0.655000	0.94253	CTC	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.438	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	protein_coding	OTTHUMT00000250618.1	C		-		55602958	+1	no_errors	ENST00000288135	ensembl	human	known	74_37	missense	SNP	0.964	T
NIPBL	25836	genome.wustl.edu	37	5	36995692	36995693	+	Intron	INS	-	-	T	rs148066104	byFrequency	TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr5:36995692_36995693insT	ENST00000282516.8	+	11	3620				NIPBL_ENST00000448238.2_Intron|NIPBL_ENST00000504430.1_Intron	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)						brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TCAGATTTACATTTTTTTTTTA	0.262													|||unknown(HR)	86	0.0171725	0.0552	0.0029	5008	,	,		16347	0.005		0.002	False		,,,				2504	0.0041																0								ENSG00000164190																																			NIPBL	SO:0001627	intron_variant	0				HGNC	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.3122-31->T	5.37:g.36995702_36995702dupT		Somatic	0	25	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000282516.8	37	NULL	CCDS3920.1	5																																																																																			-	-		0.262	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	protein_coding	OTTHUMT00000207582.1	-	NM_015384			36995693	+1	no_errors	ENST00000503274	ensembl	human	known	74_37	rna	INS	0.869:0.879	T
SPHK2	56848	genome.wustl.edu	37	19	49132505	49132505	+	Silent	SNP	A	A	G			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr19:49132505A>G	ENST00000245222.4	+	7	1806	c.1440A>G	c.(1438-1440)gcA>gcG	p.A480A	SPHK2_ENST00000443164.1_Silent_p.A542A|SPHK2_ENST00000340932.3_Silent_p.A442A|SPHK2_ENST00000600537.1_Silent_p.A421A|SPHK2_ENST00000598088.1_Silent_p.A480A|SPHK2_ENST00000599029.1_Silent_p.A444A|SPHK2_ENST00000599748.1_Silent_p.A444A	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	480					blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CTCCCAAGGCAGCTCTACACT	0.692																																																	0								ENSG00000063176						60.0	76.0	71.0					19																	49132505		2203	4300	6503	SPHK2	SO:0001819	synonymous_variant	0			-	HGNC	AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.1440A>G	19.37:g.49132505A>G		Somatic	0	195	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	142	13.41	A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.A542	ENST00000245222.4	37	c.1626	CCDS12727.1	19																																																																																			-	NULL		0.692	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHK2	protein_coding	OTTHUMT00000466153.1	A		-		49132505	+1	no_errors	ENST00000443164	ensembl	human	known	74_37	silent	SNP	0.002	G
OR2L8	391190	genome.wustl.edu	37	1	248112446	248112446	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB2Z-01A-11D-A387-09	TCGA-DX-AB2Z-10A-01D-A38A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24690075-90d4-4ca2-89da-feff903d6810	3c1d12e0-8846-46c2-86ba-a6ef01cbf595	g.chr1:248112446G>T	ENST00000357191.3	+	1	287	c.287G>T	c.(286-288)tGt>tTt	p.C96F	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TTCACTGGGTGTGGGATTCAG	0.433																																																	0								ENSG00000196936						294.0	251.0	266.0					1																	248112446		2203	4300	6503	OR2L8	SO:0001583	missense	0			-	HGNC	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.287G>T	1.37:g.248112446G>T	ENSP00000349719:p.Cys96Phe	Somatic	0	132	0.00		0.40449077908715325	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	112	19.42	Q6IF03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C96F	ENST00000357191.3	37	c.287	CCDS31101.1	1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.694231	0.30052	.	.	ENSG00000196936	ENST00000357191	T	0.00547	6.66	1.64	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.236977	0.21862	U	0.068020	T	0.01730	0.0055	H	0.99058	4.415	0.50632	D	0.999888	P	0.45594	0.862	B	0.40375	0.327	T	0.36962	-0.9726	10	0.72032	D	0.01	.	11.1275	0.48328	0.0:0.0:1.0:0.0	.	96	Q8NGY9	OR2L8_HUMAN	F	96	ENSP00000349719:C96F	ENSP00000349719:C96F	C	+	2	0	OR2L8	246179069	1.000000	0.71417	0.378000	0.26068	0.032000	0.12392	7.205000	0.77881	0.905000	0.36596	0.479000	0.44913	TGT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.433	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L8	protein_coding	OTTHUMT00000096853.2	G		-		248112446	+1	no_errors	ENST00000357191	ensembl	human	known	74_37	missense	SNP	0.988	T
