#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TMTC3	160418	genome.wustl.edu	37	12	88547274	88547274	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:88547274A>G	ENST00000266712.6	+	3	616	c.396A>G	c.(394-396)atA>atG	p.I132M		NM_181783.3	NP_861448.2	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat containing 3	132					bud outgrowth involved in lung branching (GO:0060447)|lung alveolus development (GO:0048286)|muscle fiber development (GO:0048747)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|liver(1)|lung(12)|prostate(4)|skin(1)	31						TGCACCCAATACATACAGAAG	0.313																																																	0								ENSG00000139324						83.0	72.0	76.0					12																	88547274		2203	4299	6502	TMTC3	SO:0001583	missense	0			-	HGNC		CCDS9032.1	12q21.32	2014-09-04			ENSG00000139324	ENSG00000139324		"""Tetratricopeptide (TTC) repeat domain containing"""	26899	protein-coding gene	gene with protein product							Standard	NM_181783		Approved	FLJ90492, SMILE	uc001tau.3	Q6ZXV5	OTTHUMG00000169887	ENST00000266712.6:c.396A>G	12.37:g.88547274A>G	ENSP00000266712:p.Ile132Met	Somatic	0	44	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	25	41.86	Q5CZ86|Q5H9T6|Q68DQ6|Q68DX0|Q7Z332|Q8NC50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_2,pfam_TPR_1,pfam_DUF1736,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I132M	ENST00000266712.6	37	c.396	CCDS9032.1	12	.	.	.	.	.	.	.	.	.	.	A	18.09	3.545094	0.65198	.	.	ENSG00000139324	ENST00000549011;ENST00000266712	D;T	0.94092	-3.35;-0.26	5.89	2.22	0.28083	.	0.176280	0.64402	D	0.000014	D	0.93096	0.7802	M	0.77616	2.38	0.49687	D	0.999813	P	0.43788	0.817	P	0.49421	0.61	D	0.89522	0.3779	10	0.59425	D	0.04	-4.7892	4.5504	0.12108	0.6851:0.1305:0.0664:0.118	.	132	Q6ZXV5-2	.	M	132	ENSP00000447640:I132M;ENSP00000266712:I132M	ENSP00000266712:I132M	I	+	3	3	TMTC3	87071405	1.000000	0.71417	0.994000	0.49952	0.951000	0.60555	2.542000	0.45744	0.133000	0.18654	0.477000	0.44152	ATA	-	NULL		0.313	TMTC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC3	protein_coding	OTTHUMT00000406421.1	A	NM_181783	-		88547274	+1	no_errors	ENST00000266712	ensembl	human	known	74_37	missense	SNP	1.000	G
NDST3	9348	genome.wustl.edu	37	4	118975508	118975508	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr4:118975508G>T	ENST00000296499.5	+	2	846	c.443G>T	c.(442-444)aGc>aTc	p.S148I	NDST3_ENST00000433996.2_Missense_Mutation_p.S148I	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	148	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						TGGAATCGAAGCCTTCTAGAT	0.348																																																	0								ENSG00000164100						44.0	46.0	45.0					4																	118975508		2203	4297	6500	NDST3	SO:0001583	missense	0			-	HGNC	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.443G>T	4.37:g.118975508G>T	ENSP00000296499:p.Ser148Ile	Somatic	0	88	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.S148I	ENST00000296499.5	37	c.443	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	G	14.85	2.658666	0.47467	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.44881	1.24;0.91	5.3	5.3	0.74995	.	0.225469	0.47852	D	0.000212	T	0.33089	0.0851	N	0.08118	0	0.39826	D	0.972902	B;B;D	0.59767	0.371;0.288;0.986	B;B;P	0.51016	0.291;0.393;0.656	T	0.37526	-0.9702	10	0.72032	D	0.01	.	12.3079	0.54912	0.0775:0.0:0.9225:0.0	.	148;148;148	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	I	148	ENSP00000296499:S148I;ENSP00000396625:S148I	ENSP00000296499:S148I	S	+	2	0	NDST3	119194956	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.217000	0.58547	2.464000	0.83262	0.655000	0.94253	AGC	-	pfam_Heparan_SO4_deacetylase		0.348	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	protein_coding	OTTHUMT00000256517.4	G	NM_004784	-		118975508	+1	no_errors	ENST00000296499	ensembl	human	known	74_37	missense	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9015716	9015716	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr19:9015716G>C	ENST00000397910.4	-	29	38310	c.38107C>G	c.(38107-38109)Ctc>Gtc	p.L12703V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12705	SEA 5. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGAAGTTGAGGGTGAACGGC	0.478																																																	0								ENSG00000181143						201.0	175.0	184.0					19																	9015716		1982	4139	6121	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38107C>G	19.37:g.9015716G>C	ENSP00000381008:p.Leu12703Val	Somatic	0	90	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	26	35.00	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L12703V	ENST00000397910.4	37	c.38107	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	8.667	0.901888	0.17760	.	.	ENSG00000181143	ENST00000397910	T	0.55413	0.52	3.44	1.12	0.20585	.	.	.	.	.	T	0.65080	0.2657	M	0.81497	2.545	.	.	.	D	0.53885	0.963	D	0.63033	0.91	T	0.66905	-0.5805	8	0.87932	D	0	.	3.5061	0.07691	0.1405:0.0:0.6073:0.2522	.	12703	B5ME49	.	V	12703	ENSP00000381008:L12703V	ENSP00000381008:L12703V	L	-	1	0	MUC16	8876716	0.019000	0.18553	0.978000	0.43139	0.302000	0.27658	-1.437000	0.02419	0.494000	0.27859	0.305000	0.20034	CTC	-	pfam_SEA_dom		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	G	NM_024690	-		9015716	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	1.000	C
RYR2	6262	genome.wustl.edu	37	1	237843759	237843759	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr1:237843759G>A	ENST00000366574.2	+	62	9216	c.8899G>A	c.(8899-8901)Gtt>Att	p.V2967I	RYR2_ENST00000360064.6_Missense_Mutation_p.V2965I|RYR2_ENST00000542537.1_Missense_Mutation_p.V2951I|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2967					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CTTTCAGGTCGTTCTTCCTTT	0.428																																																	0								ENSG00000198626						163.0	134.0	143.0					1																	237843759		1888	4115	6003	RYR2	SO:0001583	missense	0			-	HGNC	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8899G>A	1.37:g.237843759G>A	ENSP00000355533:p.Val2967Ile	Somatic	0	34	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.V2965I	ENST00000366574.2	37	c.8893	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	15.83	2.950197	0.53186	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;D;D	0.97016	-0.03;-4.19;-4.21	5.84	5.84	0.93424	.	0.000000	0.56097	D	0.000039	D	0.92299	0.7557	L	0.35542	1.07	0.80722	D	1	P	0.50710	0.938	B	0.36030	0.216	D	0.92907	0.6344	10	0.54805	T	0.06	.	15.615	0.76760	0.0:0.1367:0.8633:0.0	.	2967	Q92736	RYR2_HUMAN	I	2967;2965;2951	ENSP00000355533:V2967I;ENSP00000353174:V2965I;ENSP00000443798:V2951I	ENSP00000353174:V2965I	V	+	1	0	RYR2	235910382	1.000000	0.71417	0.967000	0.41034	0.995000	0.86356	3.170000	0.50816	2.760000	0.94817	0.655000	0.94253	GTT	-	NULL		0.428	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	protein_coding	OTTHUMT00000095402.2	G	NM_001035	-		237843759	+1	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	SNP	0.984	A
ZNF853	54753	genome.wustl.edu	37	7	6661387	6661389	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr7:6661387_6661389delGCA	ENST00000457543.3	+	3	1323_1325	c.765_767delGCA	c.(763-768)ttgcag>ttg	p.Q259del		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	259	Gln-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						agcaactgttgcagcagcagcag	0.537																																																	0								ENSG00000236609																																			ZNF853	SO:0001651	inframe_deletion	0				HGNC	AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.765_767delGCA	7.37:g.6661396_6661398delGCA	ENSP00000455585:p.Gln259del	Somatic	0	47	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	21	8.70		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q259in_frame_del	ENST00000457543.3	37	c.765_767	CCDS59048.1	7																																																																																			-	NULL		0.537	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF853	protein_coding	OTTHUMT00000324169.2	GCA	NM_017560			6661389	+1	no_errors	ENST00000457543	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.000:0.000	-
RAPGEF2	9693	genome.wustl.edu	37	4	160216908	160216908	+	Intron	SNP	C	C	T	rs66478721|rs373967945|rs4690935|rs113715111|rs60091174		TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr4:160216908C>T	ENST00000264431.4	+	2	479				RAPGEF2_ENST00000504604.1_Intron|AC105316.1_ENST00000401270.1_RNA	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2						adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		tgtgtgtgtgcgcgcgcgcgc	0.423																																																	0								ENSG00000216089																																			AC105316.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.61-8586C>T	4.37:g.160216908C>T		Somatic	0	33	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	D3DP27	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000264431.4	37	NULL	CCDS43277.1	4																																																																																			-	-		0.423	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216089	protein_coding	OTTHUMT00000364980.2	C	NM_014247	rs4690935		160216908	+1	no_errors	ENST00000401270	ensembl	human	novel	74_37	rna	SNP	0.000	T
HIST1H1D	3007	genome.wustl.edu	37	6	26235042	26235042	+	Silent	SNP	T	T	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:26235042T>C	ENST00000244534.5	-	1	174	c.120A>G	c.(118-120)ccA>ccG	p.P40P		NM_005320.2	NP_005311.1	P16402	H13_HUMAN	histone cluster 1, H1d	40	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				GCTCAGATACTGGGGGTCCGG	0.562																																																	0								ENSG00000124575						90.0	88.0	89.0					6																	26235042		2203	4300	6503	HIST1H1D	SO:0001819	synonymous_variant	0			-	HGNC	M60747	CCDS4597.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000124575	ENSG00000124575		"""Histones / Replication-dependent"""	4717	protein-coding gene	gene with protein product		142210	"""H1 histone family, member 3"", ""histone 1, H1d"""	H1F3		1916825, 12408966	Standard	NM_005320		Approved	H1.3, H1d, H1s-2	uc003nhd.3	P16402	OTTHUMG00000014432	ENST00000244534.5:c.120A>G	6.37:g.26235042T>C		Somatic	0	67	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B2R751|Q2M2I2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.P40	ENST00000244534.5	37	c.120	CCDS4597.1	6																																																																																			-	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5		0.562	HIST1H1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1D	protein_coding	OTTHUMT00000040095.1	T	NM_005320	-		26235042	-1	no_errors	ENST00000244534	ensembl	human	known	74_37	silent	SNP	1.000	C
RPL22	6146	genome.wustl.edu	37	1	6257784	6257785	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr1:6257784_6257785insT	ENST00000234875.4	-	2	82_83	c.44_45insA	c.(43-45)aagfs	p.K15fs	RPL22_ENST00000484532.1_5'UTR|RPL22_ENST00000497965.1_5'UTR	NM_000983.3	NP_000974.1	P35268	RL22_HUMAN	ribosomal protein L22	15					alpha-beta T cell differentiation (GO:0046632)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)	p.K15fs*5(1)		kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	Ovarian(185;0.0634)	all_cancers(23;2.78e-38)|all_epithelial(116;8.88e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.53e-38)|GBM - Glioblastoma multiforme(13;3.33e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.8e-19)|Colorectal(212;6.8e-08)|COAD - Colon adenocarcinoma(227;8.04e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		GAACTTGCTTCTTTTTTTTGCC	0.401			T	RUNX1	"""AML, CML"""																																			Dom	yes		1	1p36.31	6146	ribosomal protein L22 (EAP)		L	1	Deletion - Frameshift(1)	large_intestine(1)						ENSG00000116251																																			RPL22	SO:0001589	frameshift_variant	0				HGNC	BC058887	CCDS58.1	1p36.31	2011-04-06			ENSG00000116251	ENSG00000116251		"""L ribosomal proteins"""	10315	protein-coding gene	gene with protein product		180474				8395054	Standard	NM_000983		Approved	EAP, L22	uc001amd.3	P35268	OTTHUMG00000000953	ENST00000234875.4:c.45dupA	1.37:g.6257792_6257792dupT	ENSP00000346088:p.Lys15fs	Somatic	0	48	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	B2R495|Q6IBD1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L22e	p.K16fs	ENST00000234875.4	37	c.45_44	CCDS58.1	1																																																																																			-	pfam_Ribosomal_L22e		0.401	RPL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL22	protein_coding	OTTHUMT00000002830.1	-	NM_000983			6257785	-1	no_errors	ENST00000234875	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	T
CACNA1B	774	genome.wustl.edu	37	9	140946634	140946634	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr9:140946634G>T	ENST00000371372.1	+	25	3946	c.3801G>T	c.(3799-3801)aaG>aaT	p.K1267N	CACNA1B_ENST00000371357.1_Missense_Mutation_p.K1268N|CACNA1B_ENST00000277549.5_Missense_Mutation_p.K463N|CACNA1B_ENST00000371363.1_Missense_Mutation_p.K1267N|CACNA1B_ENST00000371355.4_Missense_Mutation_p.K1268N|CACNA1B_ENST00000277551.2_Missense_Mutation_p.K1267N	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1267					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCTGCCCAAGCTCAAGGTTA	0.532																																																	0								ENSG00000148408						30.0	35.0	33.0					9																	140946634		2034	4176	6210	CACNA1B	SO:0001583	missense	0			-	HGNC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.3801G>T	9.37:g.140946634G>T	ENSP00000360423:p.Lys1267Asn	Somatic	0	40	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B1AQK5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.K1268N	ENST00000371372.1	37	c.3804	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	G	19.77	3.890140	0.72524	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.98567	-5.0;-5.0;-5.0;-5.0;-5.0;-5.0	4.64	2.29	0.28610	.	0.000000	0.85682	D	0.000000	D	0.98441	0.9481	M	0.76838	2.35	0.80722	D	1	D;D;D	0.89917	0.995;1.0;1.0	P;D;D	0.97110	0.858;1.0;1.0	D	0.97955	1.0334	10	0.54805	T	0.06	.	8.9571	0.35825	0.287:0.0:0.713:0.0	.	1267;1268;1267	B1AQK4;B1AQK7;B1AQK6	.;.;.	N	1267;1267;463;1267;1268;1268	ENSP00000360423:K1267N;ENSP00000277551:K1267N;ENSP00000277549:K463N;ENSP00000360414:K1267N;ENSP00000360408:K1268N;ENSP00000360406:K1268N	ENSP00000277549:K463N	K	+	3	2	CACNA1B	140066455	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.015000	0.29963	1.035000	0.39972	0.561000	0.74099	AAG	-	pfam_Ion_trans_dom		0.532	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	protein_coding	OTTHUMT00000055380.1	G	NM_000718	-		140946634	+1	no_errors	ENST00000371355	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC2A14	144195	genome.wustl.edu	37	12	8023832	8023832	+	5'UTR	SNP	C	C	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:8023832C>A	ENST00000543909.1	-	0	403				SLC2A14_ENST00000544749.1_5'UTR|SLC2A14_ENST00000539924.1_Intron|SLC2A14_ENST00000542505.1_Intron|SLC2A14_ENST00000396589.2_Intron|SLC2A14_ENST00000535295.1_Intron|SLC2A14_ENST00000340749.5_Intron|SLC2A14_ENST00000431042.2_Intron			Q8TDB8	GTR14_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 14						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	38				Kidney(36;0.0883)		AGGAGCTGCTCACCACCATGG	0.493																																																	0								ENSG00000173262																																			SLC2A14	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF481878	CCDS8585.1, CCDS66300.1, CCDS66301.1, CCDS66302.1	12p13.31	2013-07-15			ENSG00000173262	ENSG00000173262		"""Solute carriers"""	18301	protein-coding gene	gene with protein product		611039	"""solute carrier family 2 (facilitated glucose transporter), member 3 pseudogene 3"""	SLC2A3P3		12504846	Standard	NM_001286234		Approved	GLUT14	uc001qtn.3	Q8TDB8	OTTHUMG00000168463	ENST00000543909.1:c.-357G>T	12.37:g.8023832C>A		Somatic	0	36	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	B3KVB5|B3KWW7|B7Z844|B7ZAC3|Q6UY84|Q8TDB9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000543909.1	37	NULL	CCDS8585.1	12																																																																																			-	-		0.493	SLC2A14-001	KNOWN	basic|CCDS	protein_coding	SLC2A14	protein_coding	OTTHUMT00000399836.2	C	NM_153449	-		8023832	-1	no_errors	ENST00000544749	ensembl	human	known	74_37	rna	SNP	1.000	A
ZNF264	9422	genome.wustl.edu	37	19	57724201	57724201	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr19:57724201G>T	ENST00000263095.6	+	4	2150	c.1736G>T	c.(1735-1737)gGa>gTa	p.G579V	ZNF264_ENST00000536056.1_Missense_Mutation_p.G579V	NM_003417.4	NP_003408.1	O43296	ZN264_HUMAN	zinc finger protein 264	579					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	27		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0135)		TTTACAAGTGGACAAACCTCA	0.448																																																	0								ENSG00000083844						102.0	100.0	101.0					19																	57724201		2203	4300	6503	ZNF264	SO:0001583	missense	0			-	HGNC	AB007872	CCDS33127.1	19q13.4	2013-01-08				ENSG00000083844		"""Zinc fingers, C2H2-type"", ""-"""	13057	protein-coding gene	gene with protein product		604668				9455477	Standard	NM_003417		Approved	KIAA0412	uc002qob.3	O43296		ENST00000263095.6:c.1736G>T	19.37:g.57724201G>T	ENSP00000263095:p.Gly579Val	Somatic	0	55	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.11	A8K8Y9|Q9P1V0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G579V	ENST00000263095.6	37	c.1736	CCDS33127.1	19	.	.	.	.	.	.	.	.	.	.	G	5.182	0.219146	0.09863	.	.	ENSG00000083844	ENST00000263095;ENST00000536056	T;T	0.05258	3.47;3.47	2.35	-4.01	0.04045	.	.	.	.	.	T	0.03390	0.0098	N	0.24115	0.695	0.09310	N	0.999997	B	0.02656	0.0	B	0.01281	0.0	T	0.47341	-0.9125	9	0.16420	T	0.52	.	5.4571	0.16596	0.0:0.1747:0.2355:0.5898	.	579	O43296	ZN264_HUMAN	V	579	ENSP00000263095:G579V;ENSP00000440376:G579V	ENSP00000263095:G579V	G	+	2	0	ZNF264	62416013	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-1.556000	0.02168	-0.796000	0.04456	-0.500000	0.04577	GGA	-	NULL		0.448	ZNF264-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF264	protein_coding	OTTHUMT00000465080.1	G		-		57724201	+1	no_errors	ENST00000263095	ensembl	human	known	74_37	missense	SNP	0.000	T
SLC2A9	56606	genome.wustl.edu	37	4	9943604	9943604	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr4:9943604delA	ENST00000264784.3	-	6	800	c.747delT	c.(745-747)cttfs	p.L249fs	SLC2A9_ENST00000309065.3_Frame_Shift_Del_p.L220fs|SLC2A9_ENST00000506583.1_Frame_Shift_Del_p.L220fs	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	249					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	GGAGAAAGGGAAGGCTCAGCA	0.587																																																	0								ENSG00000109667						125.0	94.0	105.0					4																	9943604		2203	4300	6503	SLC2A9	SO:0001589	frameshift_variant	0				HGNC	AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.747delT	4.37:g.9943604delA	ENSP00000264784:p.Leu249fs	Somatic	0	54	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.L252fs	ENST00000264784.3	37	c.747	CCDS3407.1	4																																																																																			-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.587	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC2A9	protein_coding	OTTHUMT00000207055.1	A				9943604	-1	no_errors	ENST00000264784	ensembl	human	known	74_37	frame_shift_del	DEL	0.990	-
OR4C46	119749	genome.wustl.edu	37	11	51516009	51516009	+	Missense_Mutation	SNP	C	C	T	rs137991158		TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr11:51516009C>T	ENST00000328188.1	+	1	728	c.728C>T	c.(727-729)aCg>aTg	p.T243M		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						TCCCACATCACGGTTGTCATC	0.468													.|||	1	0.000199681	0.0	0.0	5008	,	,		19962	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000185926	C	MET/THR	1,4401		0,1,2200	135.0	114.0	121.0		728	1.4	0.3	11	dbSNP_134	121	0,8592		0,0,4296	no	missense	OR4C46	NM_001004703.1	81	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	243/310	51516009	1,12993	2201	4296	6497	OR4C46	SO:0001583	missense	0			-	HGNC		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.728C>T	11.37:g.51516009C>T	ENSP00000329056:p.Thr243Met	Somatic	0	93	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	24	33.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T243M	ENST00000328188.1	37	c.728	CCDS31498.1	11	.	.	.	.	.	.	.	.	.	.	.	7.494	0.651307	0.14516	2.27E-4	0.0	ENSG00000185926	ENST00000328188	T	0.38401	1.14	2.33	1.38	0.22167	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47093	D	0.000249	T	0.40767	0.1130	L	0.60904	1.88	0.09310	N	1	D	0.59357	0.985	P	0.53146	0.719	T	0.19712	-1.0297	10	0.52906	T	0.07	.	6.9475	0.24526	0.0:0.8456:0.0:0.1544	.	243	A6NHA9	O4C46_HUMAN	M	243	ENSP00000329056:T243M	ENSP00000329056:T243M	T	+	2	0	OR4C46	51372585	0.000000	0.05858	0.345000	0.25642	0.051000	0.14879	-0.509000	0.06336	0.340000	0.23745	0.121000	0.15741	ACG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.468	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C46	protein_coding	OTTHUMT00000391155.1	C	NM_001004703	rs137991158		51516009	+1	no_errors	ENST00000328188	ensembl	human	known	74_37	missense	SNP	0.103	T
TENM4	26011	genome.wustl.edu	37	11	78369776	78369776	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr11:78369776G>T	ENST00000278550.7	-	34	8099	c.7637C>A	c.(7636-7638)aCa>aAa	p.T2546K		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	2546					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										GCTGGTGATTGTGGAGCCATA	0.542																																																	0								ENSG00000149256						64.0	66.0	65.0					11																	78369776		2000	4161	6161	TENM4	SO:0001583	missense	0			-	HGNC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.7637C>A	11.37:g.78369776G>T	ENSP00000278550:p.Thr2546Lys	Somatic	0	35	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.T2546K	ENST00000278550.7	37	c.7637	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	G	0.341	-0.950397	0.02285	.	.	ENSG00000149256	ENST00000278550	D	0.88664	-2.41	5.35	3.3	0.37823	.	0.322809	0.31233	N	0.008007	T	0.66277	0.2773	N	0.00841	-1.15	0.30649	N	0.755608	B	0.02656	0.0	B	0.01281	0.0	T	0.61342	-0.7082	9	.	.	.	.	10.5483	0.45072	0.0:0.3018:0.5734:0.1248	.	2546	Q6N022	TEN4_HUMAN	K	2546	ENSP00000278550:T2546K	.	T	-	2	0	ODZ4	78047424	0.990000	0.36364	0.860000	0.33809	0.976000	0.68499	2.421000	0.44688	1.448000	0.47680	0.655000	0.94253	ACA	-	NULL		0.542	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	protein_coding	OTTHUMT00000391406.2	G		-		78369776	-1	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	SNP	0.656	T
S100G	795	genome.wustl.edu	37	X	16669217	16669217	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chrX:16669217G>T	ENST00000380200.3	+	2	142	c.88G>T	c.(88-90)Gat>Tat	p.D30Y	CTPS2_ENST00000380241.3_Intron|CTPS2_ENST00000443824.1_Intron|CTPS2_ENST00000359276.4_Intron	NM_004057.2	NP_004048.1	P29377	S100G_HUMAN	S100 calcium binding protein G	30	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.					apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)	calcium ion binding (GO:0005509)|vitamin D binding (GO:0005499)			large_intestine(1)|lung(1)	2	Hepatocellular(33;0.0997)					GTTGTCAAAGGATGAACTGAA	0.448																																																	0								ENSG00000169906						134.0	135.0	135.0					X																	16669217		2203	4300	6503	S100G	SO:0001583	missense	0			-	HGNC		CCDS14176.1	Xp22.2	2014-01-28	2001-11-28	2004-10-07	ENSG00000169906	ENSG00000169906		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	1436	protein-coding gene	gene with protein product	"""calbindin-D9K"""	302020	"""calbindin 3, (vitamin D-dependent calcium-binding protein)"""	CALB3		1610358, 1379540	Standard	NM_004057		Approved	CABP9K, CABP1	uc004cxn.1	P29377	OTTHUMG00000021194	ENST00000380200.3:c.88G>T	X.37:g.16669217G>T	ENSP00000369547:p.Asp30Tyr	Somatic	0	57	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q5JS49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.D30Y	ENST00000380200.3	37	c.88	CCDS14176.1	X	.	.	.	.	.	.	.	.	.	.	G	13.46	2.242334	0.39598	.	.	ENSG00000169906	ENST00000380200	T	0.10005	2.92	5.58	5.58	0.84498	S100/CaBP-9k-type, calcium binding, subdomain (1);EF-hand-like domain (1);	0.794679	0.11753	N	0.532843	T	0.18173	0.0436	.	.	.	0.30330	N	0.78673	B	0.32425	0.371	B	0.41466	0.358	T	0.06844	-1.0804	9	0.72032	D	0.01	-18.6936	14.018	0.64536	0.0:0.0:1.0:0.0	.	30	P29377	S100G_HUMAN	Y	30	ENSP00000369547:D30Y	ENSP00000369547:D30Y	D	+	1	0	S100G	16579138	1.000000	0.71417	0.815000	0.32552	0.580000	0.36256	2.951000	0.49089	2.471000	0.83476	0.600000	0.82982	GAT	-	pfam_S100_Ca-bd_sub		0.448	S100G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100G	protein_coding	OTTHUMT00000055910.1	G	NM_004057	-		16669217	+1	no_errors	ENST00000380200	ensembl	human	known	74_37	missense	SNP	0.963	T
C3orf20	84077	genome.wustl.edu	37	3	14725834	14725834	+	Silent	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr3:14725834C>T	ENST00000253697.3	+	4	1022	c.570C>T	c.(568-570)aaC>aaT	p.N190N	C3orf20_ENST00000435614.1_Silent_p.N68N|C3orf20_ENST00000412910.1_Silent_p.N68N	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	190						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						TGGCCTTCAACTGCCTGATCA	0.542																																																	0								ENSG00000131379						123.0	105.0	111.0					3																	14725834		2203	4300	6503	C3orf20	SO:0001819	synonymous_variant	0			-	HGNC	AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.570C>T	3.37:g.14725834C>T		Somatic	0	39	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	Q7L0U6|Q8NCP2|Q9H0I7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N190	ENST00000253697.3	37	c.570	CCDS33706.1	3																																																																																			-	NULL		0.542	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf20	protein_coding	OTTHUMT00000340586.1	C	NM_032137	-		14725834	+1	no_errors	ENST00000253697	ensembl	human	known	74_37	silent	SNP	0.001	T
FAM83G	644815	genome.wustl.edu	37	17	18891589	18891589	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr17:18891589G>A	ENST00000388995.6	-	3	884	c.661C>T	c.(661-663)Cgg>Tgg	p.R221W	SLC5A10_ENST00000317977.6_Intron|FAM83G_ENST00000345041.4_Missense_Mutation_p.R221W|SLC5A10_ENST00000395647.2_Intron|FAM83G_ENST00000585154.2_Missense_Mutation_p.R221W|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000417251.2_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	221					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						ATGCAGGCCCGCTCACACATG	0.567																																																	0								ENSG00000188522						98.0	102.0	101.0					17																	18891589		2096	4225	6321	FAM83G	SO:0001583	missense	0			-	HGNC	AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.661C>T	17.37:g.18891589G>A	ENSP00000373647:p.Arg221Trp	Somatic	0	44	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75	Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1669	p.R221W	ENST00000388995.6	37	c.661	CCDS42276.1	17	.	.	.	.	.	.	.	.	.	.	G	12.08	1.829902	0.32329	.	.	ENSG00000188522	ENST00000388995;ENST00000345041;ENST00000399096	T;T	0.12984	2.63;2.63	5.29	4.26	0.50523	.	0.056249	0.64402	D	0.000003	T	0.25975	0.0633	M	0.65498	2.005	0.46725	D	0.999172	D	0.54772	0.968	P	0.52793	0.709	T	0.01326	-1.1384	10	0.87932	D	0	-38.2082	12.6507	0.56759	0.0:0.0:0.7102:0.2898	.	221	A6ND36	FA83G_HUMAN	W	221	ENSP00000373647:R221W;ENSP00000343279:R221W	ENSP00000343279:R221W	R	-	1	2	FAM83G	18832314	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	4.926000	0.63433	2.497000	0.84241	0.591000	0.81541	CGG	-	pfam_DUF1669		0.567	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	protein_coding	OTTHUMT00000253108.4	G		-		18891589	-1	no_errors	ENST00000345041	ensembl	human	known	74_37	missense	SNP	1.000	A
ALKBH4	54784	genome.wustl.edu	37	7	102097908	102097908	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr7:102097908C>T	ENST00000292566.3	-	3	881	c.842G>A	c.(841-843)gGg>gAg	p.G281E		NM_017621.3	NP_060091.1	Q9NXW9	ALKB4_HUMAN	alkB, alkylation repair homolog 4 (E. coli)	281					actomyosin structure organization (GO:0031032)|cleavage furrow ingression (GO:0036090)|protein demethylation (GO:0006482)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	contractile ring (GO:0070938)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)	actin binding (GO:0003779)|demethylase activity (GO:0032451)|metal ion binding (GO:0046872)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			kidney(1)|lung(5)|skin(2)	8						TTGCTGCCTCCCTCCAGGGCC	0.647																																																	0								ENSG00000160993						56.0	45.0	49.0					7																	102097908		2203	4300	6503	ALKBH4	SO:0001583	missense	0			-	HGNC	BC017096	CCDS5723.1	7q22.1	2006-02-09			ENSG00000160993	ENSG00000160993		"""Alkylation repair homologs"""	21900	protein-coding gene	gene with protein product		613302					Standard	NM_017621		Approved	FLJ20013	uc003uzl.3	Q9NXW9	OTTHUMG00000157720	ENST00000292566.3:c.842G>A	7.37:g.102097908C>T	ENSP00000292566:p.Gly281Glu	Somatic	0	78	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	32	48.39	Q53H92|Q9H6A4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Oxoglu/Fe-dep_dioxygenase	p.G281E	ENST00000292566.3	37	c.842	CCDS5723.1	7	.	.	.	.	.	.	.	.	.	.	C	16.14	3.037934	0.54896	.	.	ENSG00000160993	ENST00000292566	T	0.57107	0.42	5.08	4.2	0.49525	.	0.051417	0.85682	N	0.000000	T	0.68924	0.3054	M	0.77820	2.39	0.80722	D	1	D	0.69078	0.997	P	0.62813	0.907	T	0.72243	-0.4350	10	0.59425	D	0.04	-10.1747	12.2608	0.54649	0.0:0.9183:0.0:0.0817	.	281	Q9NXW9	ALKB4_HUMAN	E	281	ENSP00000292566:G281E	ENSP00000292566:G281E	G	-	2	0	ALKBH4	101884913	1.000000	0.71417	0.057000	0.19452	0.088000	0.18126	7.235000	0.78143	1.137000	0.42214	0.561000	0.74099	GGG	-	NULL		0.647	ALKBH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH4	protein_coding	OTTHUMT00000349503.1	C	NM_017621	-		102097908	-1	no_errors	ENST00000292566	ensembl	human	known	74_37	missense	SNP	0.990	T
PLEKHG5	57449	genome.wustl.edu	37	1	6529183	6529188	+	In_Frame_Del	DEL	TCCTCC	TCCTCC	-	rs201551894|rs201182604|rs386628081|rs375111412|rs113541584|rs62639695	byFrequency	TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	TCCTCC	TCCTCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr1:6529183_6529188delTCCTCC	ENST00000400915.3	-	20	2397_2402	c.2331_2336delGGAGGA	c.(2329-2337)gaggaggaa>gaa	p.777_779EEE>E	PLEKHG5_ENST00000340850.5_In_Frame_Del_p.721_723EEE>E|TNFRSF25_ENST00000377782.3_5'Flank|PLEKHG5_ENST00000544978.1_In_Frame_Del_p.721_723EEE>E|PLEKHG5_ENST00000377725.1_In_Frame_Del_p.721_723EEE>E|PLEKHG5_ENST00000535355.1_In_Frame_Del_p.790_792EEE>E|TNFRSF25_ENST00000351959.5_5'Flank|TNFRSF25_ENST00000356876.3_5'Flank|PLEKHG5_ENST00000400913.1_In_Frame_Del_p.721_723EEE>E|PLEKHG5_ENST00000537245.1_In_Frame_Del_p.800_802EEE>E|PLEKHG5_ENST00000377737.2_In_Frame_Del_p.721_723EEE>E|PLEKHG5_ENST00000377740.3_In_Frame_Del_p.798_800EEE>E|PLEKHG5_ENST00000377732.1_In_Frame_Del_p.758_760EEE>E|PLEKHG5_ENST00000377748.1_In_Frame_Del_p.798_800EEE>E|PLEKHG5_ENST00000377728.3_In_Frame_Del_p.721_723EEE>E	NM_001042663.1	NP_001036128.1	O94827	PKHG5_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 5	777	Glu-rich.			Missing (in Ref. 6; BAC77354). {ECO:0000305}.	apoptotic signaling pathway (GO:0097190)|endothelial cell chemotaxis (GO:0035767)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			liver(1)	1	Ovarian(185;0.02)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;5.51e-35)|GBM - Glioblastoma multiforme(13;3.57e-27)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000894)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00159)|READ - Rectum adenocarcinoma(331;0.0419)		Gtcctcgccttcctcctcctcctcct	0.631																																																	0								ENSG00000171680																																			PLEKHG5	SO:0001651	inframe_deletion	0				HGNC	AK024676	CCDS79.1, CCDS41240.1, CCDS41241.1, CCDS57967.1, CCDS57968.1, CCDS57969.1	1p36.31	2014-09-17		2005-08-09	ENSG00000171680	ENSG00000171680		"""Pleckstrin homology (PH) domain containing"""	29105	protein-coding gene	gene with protein product	"""synectin-binding guanine exchange factor"""	611101				17564964	Standard	NM_001042663		Approved	KIAA0720, Syx, GEF720, Tech	uc010nzr.1	O94827	OTTHUMG00000000905	ENST00000400915.3:c.2331_2336delGGAGGA	1.37:g.6529189_6529194delTCCTCC	ENSP00000383706:p.Glu777_Glu778del	Somatic	NA	NA	NA		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KU07|B7Z2M3|B7Z5X2|F5GZ21|F5H1I0|Q5SY17|Q5T8W5|Q5T8W9|Q6ZNM0|Q7Z436|Q86YD8|Q96BS1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.EE801in_frame_del	ENST00000400915.3	37	c.2405_2400	CCDS41241.1	1																																																																																			-	NULL		0.631	PLEKHG5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHG5	protein_coding	OTTHUMT00000002631.1	TCCTCC	NM_020631			6529188	-1	no_errors	ENST00000537245	ensembl	human	known	74_37	in_frame_del	DEL	0.152:0.271:0.391:0.513:0.634:0.754	-
DPH2	1802	genome.wustl.edu	37	1	44437362	44437362	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr1:44437362G>A	ENST00000255108.3	+	4	960	c.788G>A	c.(787-789)cGg>cAg	p.R263Q	DPH2_ENST00000529729.1_3'UTR|DPH2_ENST00000412950.2_Missense_Mutation_p.R128Q|DPH2_ENST00000396758.2_Intron|ATP6V0B_ENST00000472174.2_5'Flank	NM_001384.4	NP_001375.2	Q9BQC3	DPH2_HUMAN	DPH2 homolog (S. cerevisiae)	263					peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)	cytoplasm (GO:0005737)				autonomic_ganglia(1)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(2)|skin(1)	19	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)				GAGGGTGCCCGGGCTGGACGG	0.622																																																	0								ENSG00000132768						50.0	54.0	53.0					1																	44437362		2203	4300	6503	DPH2	SO:0001583	missense	0			-	HGNC	AF053003	CCDS504.1, CCDS41314.1	1p34	2008-02-05	2005-06-03	2005-06-03	ENSG00000132768	ENSG00000132768			3004	protein-coding gene	gene with protein product		603456	"""diptheria toxin resistance protein required for diphthamide biosynthesis-like 2 (S. cerevisiae)"", ""DPH2-like 2 (S. cerevisiae)"""	DPH2L2		9782084, 15485916	Standard	XM_005270559		Approved		uc001ckz.3	Q9BQC3	OTTHUMG00000008295	ENST00000255108.3:c.788G>A	1.37:g.44437362G>A	ENSP00000255108:p.Arg263Gln	Somatic	0	28	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	A8MVC9|B2RDE3|B4DNI8|O60623	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DPH1/DPH2,tigrfam_DPH1/DPH2,tigrfam_DHP2_eu	p.R263Q	ENST00000255108.3	37	c.788	CCDS504.1	1	.	.	.	.	.	.	.	.	.	.	G	2.317	-0.356434	0.05138	.	.	ENSG00000132768	ENST00000255108;ENST00000412950;ENST00000459879	T;T;T	0.40756	1.02;1.02;1.02	4.58	1.67	0.24075	.	0.626322	0.17009	N	0.190581	T	0.16557	0.0398	N	0.04132	-0.27	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.27971	-1.0058	10	0.11182	T	0.66	-0.856	6.8436	0.23977	0.5628:0.0:0.4372:0.0	.	128;263	B4DNI8;Q9BQC3	.;DPH2_HUMAN	Q	263;128;36	ENSP00000255108:R263Q;ENSP00000413862:R128Q;ENSP00000432162:R36Q	ENSP00000255108:R263Q	R	+	2	0	DPH2	44209949	0.001000	0.12720	0.065000	0.19835	0.026000	0.11368	0.817000	0.27281	0.182000	0.20032	-0.277000	0.10078	CGG	-	pfam_DPH1/DPH2,tigrfam_DPH1/DPH2,tigrfam_DHP2_eu		0.622	DPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPH2	protein_coding	OTTHUMT00000022832.1	G	NM_001384	-		44437362	+1	no_errors	ENST00000255108	ensembl	human	known	74_37	missense	SNP	0.001	A
CHPF2	54480	genome.wustl.edu	37	7	150935155	150935155	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr7:150935155G>T	ENST00000035307.2	+	4	3220	c.1707G>T	c.(1705-1707)gaG>gaT	p.E569D	CHPF2_ENST00000495645.1_Missense_Mutation_p.E561D|MIR671_ENST00000390183.1_RNA|RP4-548D19.3_ENST00000607902.1_RNA	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	569					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						TGCGAGCAGAGGCCCCTTCCC	0.627																																																	0								ENSG00000033100						35.0	38.0	37.0					7																	150935155		2203	4300	6503	CHPF2	SO:0001583	missense	0			-	HGNC	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.1707G>T	7.37:g.150935155G>T	ENSP00000035307:p.Glu569Asp	Somatic	0	42	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	13	38.10	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chond_GalNAc,pfam_Fringe-like	p.E569D	ENST00000035307.2	37	c.1707	CCDS34779.1	7	.	.	.	.	.	.	.	.	.	.	G	10.03	1.239838	0.22711	.	.	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.16324	2.35;2.35	4.71	3.84	0.44239	.	0.000000	0.85682	D	0.000000	T	0.12561	0.0305	L	0.28740	0.885	0.53688	D	0.999973	B;B	0.23058	0.046;0.079	B;B	0.29524	0.103;0.035	T	0.10474	-1.0628	10	0.17369	T	0.5	-25.1034	10.28	0.43534	0.165:0.0:0.835:0.0	.	569;561	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	D	561;569;569	ENSP00000418914:E561D;ENSP00000035307:E569D	ENSP00000035307:E569D	E	+	3	2	CHPF2	150566088	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.164000	0.42387	1.210000	0.43336	-0.225000	0.12378	GAG	-	pfam_Chond_GalNAc		0.627	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF2	protein_coding	OTTHUMT00000348648.2	G	NM_019015	-		150935155	+1	no_errors	ENST00000035307	ensembl	human	known	74_37	missense	SNP	1.000	T
TBC1D15	64786	genome.wustl.edu	37	12	72291723	72291723	+	Splice_Site	SNP	T	T	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:72291723T>A	ENST00000550746.1	+	11	1298		c.e11+2		TBC1D15_ENST00000319106.8_Splice_Site|TBC1D15_ENST00000393309.3_Splice_Site|TBC1D15_ENST00000548679.1_Splice_Site|TBC1D15_ENST00000485960.2_Splice_Site	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15						positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GTCTTATCGGTAATTTTTTCT	0.353																																																	0								ENSG00000121749						56.0	59.0	58.0					12																	72291723		2203	4295	6498	TBC1D15	SO:0001630	splice_region_variant	0			-	HGNC	AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.1234+2T>A	12.37:g.72291723T>A		Somatic	0	66	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	31	64.37	B4DMT9|B9A6L6|J3KNI9|Q9HA83	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e11+2	ENST00000550746.1	37	c.1234+2	CCDS31858.1	12	.	.	.	.	.	.	.	.	.	.	T	20.2	3.951515	0.73787	.	.	ENSG00000121749	ENST00000550746;ENST00000319106;ENST00000485960;ENST00000393309	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3365	0.43852	0.0:0.0733:0.0:0.9267	.	.	.	.	.	-1	.	.	.	+	.	.	TBC1D15	70577990	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.027000	0.70881	2.173000	0.68751	0.460000	0.39030	.	-	-		0.353	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	TBC1D15	protein_coding	OTTHUMT00000351266.2	T	NM_022771	-	Intron	72291723	+1	no_errors	ENST00000550746	ensembl	human	known	74_37	splice_site	SNP	1.000	A
KRT17	3872	genome.wustl.edu	37	17	39777227	39777227	+	Silent	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr17:39777227C>T	ENST00000311208.8	-	5	1018	c.951G>A	c.(949-951)caG>caA	p.Q317Q	JUP_ENST00000540235.1_Silent_p.Q476Q	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	317	Coil 2.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				CCATGCTGAGCTGGGACTGCA	0.612																																					Pancreas(92;1242 2086 39193 50508)												0								ENSG00000173801						69.0	60.0	63.0					17																	39777227		2203	4300	6503	JUP	SO:0001819	synonymous_variant	0			-	HGNC	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.951G>A	17.37:g.39777227C>T		Somatic	0	47	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,pfam_Armadillo,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo,pfscan_Armadillo,prints_Keratin_I,prints_Beta-catenin	p.Q476	ENST00000311208.8	37	c.1428	CCDS11402.1	17																																																																																			-	pfam_IF,prints_Keratin_I		0.612	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	protein_coding	OTTHUMT00000257460.1	C	NM_000422	-		39777227	-1	no_errors	ENST00000540235	ensembl	human	known	74_37	silent	SNP	0.999	T
IKBKAP	8518	genome.wustl.edu	37	9	111685148	111685148	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr9:111685148T>C	ENST00000374647.5	-	6	833	c.526A>G	c.(526-528)Aga>Gga	p.R176G	IKBKAP_ENST00000537196.1_Intron	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	176					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						GCTGCTTGTCTGCCTTCTGAT	0.428																																																	0								ENSG00000070061						214.0	188.0	197.0					9																	111685148		2203	4300	6503	IKBKAP	SO:0001583	missense	0			-	HGNC	AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.526A>G	9.37:g.111685148T>C	ENSP00000363779:p.Arg176Gly	Somatic	0	58	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	30	34.78	Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IKI3,superfamily_ARM-type_fold,superfamily_UBA-like,pirsf_IKI3	p.R176G	ENST00000374647.5	37	c.526	CCDS6773.1	9	.	.	.	.	.	.	.	.	.	.	T	18.18	3.565710	0.65651	.	.	ENSG00000070061	ENST00000374647	T	0.31247	1.5	5.62	4.48	0.54585	.	0.041576	0.85682	D	0.000000	T	0.37156	0.0993	M	0.73962	2.25	0.80722	D	1	P	0.48998	0.918	B	0.43701	0.428	T	0.32025	-0.9922	10	0.72032	D	0.01	-18.6106	11.0021	0.47611	0.0:0.0:0.1671:0.8329	.	176	O95163	ELP1_HUMAN	G	176	ENSP00000363779:R176G	ENSP00000363779:R176G	R	-	1	2	IKBKAP	110724969	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.742000	0.68646	0.955000	0.37878	0.528000	0.53228	AGA	-	pfam_IKI3,pirsf_IKI3		0.428	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	protein_coding	OTTHUMT00000053574.1	T		-		111685148	-1	no_errors	ENST00000374647	ensembl	human	known	74_37	missense	SNP	1.000	C
MRVI1	10335	genome.wustl.edu	37	11	10615134	10615134	+	Silent	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr11:10615134G>T	ENST00000436272.1	-	16	2077	c.1999C>A	c.(1999-2001)Cgg>Agg	p.R667R	MRVI1_ENST00000534266.2_Silent_p.R379R|MRVI1_ENST00000547195.1_Silent_p.R603R|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000552103.1_Silent_p.R603R|MRVI1_ENST00000531107.1_Silent_p.R686R|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000424001.1_Silent_p.R379R|LYVE1_ENST00000531706.1_Intron|MRVI1_ENST00000541483.1_Silent_p.R488R|MRVI1-AS1_ENST00000525578.1_RNA|MRVI1_ENST00000545852.1_Silent_p.R379R|MRVI1_ENST00000527509.2_Silent_p.R603R|MRVI1_ENST00000423302.2_Silent_p.R694R|MRVI1_ENST00000421747.1_Silent_p.R685R|MRVI1_ENST00000558540.1_Silent_p.R379R			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	667					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		CTGACCCTCCGGCGAGGCATA	0.517																																																	0								ENSG00000072952						85.0	83.0	84.0					11																	10615134		2201	4294	6495	MRVI1	SO:0001819	synonymous_variant	0			-	HGNC	AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1999C>A	11.37:g.10615134G>T		Somatic	0	30	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MRVI1	p.P420Q	ENST00000436272.1	37	c.1259		11																																																																																			-	pfam_MRVI1		0.517	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	protein_coding		G	NM_001098579	-		10615134	-1	no_errors	ENST00000526414	ensembl	human	known	74_37	missense	SNP	0.999	T
SNX21	90203	genome.wustl.edu	37	20	44469993	44469993	+	3'UTR	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr20:44469993C>T	ENST00000491381.1	+	0	1231				SNX21_ENST00000344780.4_3'UTR|SNX21_ENST00000342644.5_Intron|SNX21_ENST00000372542.1_3'UTR			Q969T3	SNX21_HUMAN	sorting nexin family member 21						protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	7		Myeloproliferative disorder(115;0.0122)				AGAGGGGTTGCCCCAGAAGGC	0.547																																																	0								ENSG00000124104						27.0	31.0	30.0					20																	44469993		2196	4288	6484	SNX21	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK095851	CCDS13376.1, CCDS13377.1, CCDS42883.1	20q13.12	2013-01-10	2006-07-24	2006-07-24	ENSG00000124104	ENSG00000124104		"""Sorting nexins"", ""Tetratricopeptide (TTC) repeat domain containing"""	16154	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 161"""	C20orf161		12461558, 12459172	Standard	NM_152897		Approved	dJ337O18.4, SNX-L	uc002xpv.1	Q969T3	OTTHUMG00000032624	ENST00000491381.1:c.*41C>T	20.37:g.44469993C>T		Somatic	0	47	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q5JZH5|Q5JZH6|Q5JZH7|Q8WUR6|Q9BR16	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000491381.1	37	NULL	CCDS13377.1	20																																																																																			-	-		0.547	SNX21-010	KNOWN	basic|CCDS	protein_coding	SNX21	protein_coding	OTTHUMT00000079534.1	C	NM_033421	-		44469993	+1	no_errors	ENST00000344780	ensembl	human	known	74_37	rna	SNP	0.005	T
COL12A1	1303	genome.wustl.edu	37	6	75814960	75814960	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:75814960G>T	ENST00000322507.8	-	54	8536	c.8227C>A	c.(8227-8229)Cag>Aag	p.Q2743K	COL12A1_ENST00000483888.2_Missense_Mutation_p.Q2743K|COL12A1_ENST00000345356.6_Missense_Mutation_p.Q1579K|COL12A1_ENST00000416123.2_Missense_Mutation_p.Q2667K	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	2743	Nonhelical region (NC3).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACGCTGTCCTGTGTACATGTG	0.373																																																	0								ENSG00000111799						63.0	78.0	74.0					6																	75814960		1869	4114	5983	COL12A1	SO:0001583	missense	0			-	HGNC	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.8227C>A	6.37:g.75814960G>T	ENSP00000325146:p.Gln2743Lys	Somatic	0	28	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.Q2743K	ENST00000322507.8	37	c.8227	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	G	17.83	3.486551	0.63962	.	.	ENSG00000111799	ENST00000322507;ENST00000425443;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	D;D;D;D;D	0.95554	-3.74;-3.74;-3.74;-3.74;-3.74	5.62	5.62	0.85841	.	0.128293	0.52532	D	0.000073	D	0.94621	0.8266	M	0.61703	1.905	0.40575	D	0.981338	D;P	0.53745	0.962;0.86	P;B	0.46659	0.523;0.4	D	0.94831	0.7996	10	0.62326	D	0.03	.	19.6611	0.95871	0.0:0.0:1.0:0.0	.	1579;2743	Q99715-2;Q99715	.;COCA1_HUMAN	K	2743;381;2667;1579;2667;2743	ENSP00000325146:Q2743K;ENSP00000399812:Q381K;ENSP00000305147:Q1579K;ENSP00000412864:Q2667K;ENSP00000421216:Q2743K	ENSP00000325146:Q2743K	Q	-	1	0	COL12A1	75871680	1.000000	0.71417	0.978000	0.43139	0.661000	0.39034	6.998000	0.76277	2.643000	0.89663	0.655000	0.94253	CAG	-	NULL		0.373	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	protein_coding	OTTHUMT00000041249.3	G	NM_004370	-		75814960	-1	no_errors	ENST00000322507	ensembl	human	known	74_37	missense	SNP	0.999	T
FLI1	2313	genome.wustl.edu	37	11	128642720	128642720	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr11:128642720G>T	ENST00000527786.2	+	4	918	c.429G>T	c.(427-429)gaG>gaT	p.E143D	FLI1_ENST00000344954.6_Missense_Mutation_p.E110D|FLI1_ENST00000281428.8_Missense_Mutation_p.E77D|FLI1_ENST00000525560.1_Intron|FLI1_ENST00000534087.2_Missense_Mutation_p.E110D	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	143	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		AATGGCTGGAGTGGGCCATAA	0.512			T	EWSR1	Ewing sarcoma																																			Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	0								ENSG00000151702						190.0	194.0	193.0					11																	128642720		2113	4241	6354	FLI1	SO:0001583	missense	0			-	HGNC	M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.429G>T	11.37:g.128642720G>T	ENSP00000433488:p.Glu143Asp	Somatic	0	34	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.E143D	ENST00000527786.2	37	c.429	CCDS44768.1	11	.	.	.	.	.	.	.	.	.	.	G	11.54	1.668791	0.29604	.	.	ENSG00000151702	ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	4.55	2.67	0.31697	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.154798	0.56097	D	0.000024	T	0.14527	0.0351	N	0.10733	0.035	0.41332	D	0.987249	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.07121	-1.0789	10	0.25751	T	0.34	.	10.2399	0.43305	0.227:0.0:0.773:0.0	.	143;77	Q01543;Q01543-2	FLI1_HUMAN;.	D	110;143;110;77	ENSP00000339627:E110D;ENSP00000399985:E143D;ENSP00000432950:E110D;ENSP00000281428:E77D	ENSP00000281428:E77D	E	+	3	2	FLI1	128147930	0.993000	0.37304	1.000000	0.80357	0.974000	0.67602	0.235000	0.17948	0.883000	0.36040	-0.343000	0.07986	GAG	-	pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom		0.512	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLI1	protein_coding	OTTHUMT00000386226.2	G	NM_002017	-		128642720	+1	no_errors	ENST00000527786	ensembl	human	known	74_37	missense	SNP	1.000	T
ACSS2	55902	genome.wustl.edu	37	20	33503020	33503020	+	Intron	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr20:33503020G>T	ENST00000360596.2	+	7	1045				ACSS2_ENST00000476922.1_Intron|ACSS2_ENST00000336325.4_Intron|ACSS2_ENST00000253382.5_Splice_Site	NM_018677.3	NP_061147.1	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2						acetate biosynthetic process (GO:0019413)|acetyl-CoA biosynthetic process from acetate (GO:0019427)|ethanol oxidation (GO:0006069)|lipid biosynthetic process (GO:0008610)|propionate biosynthetic process (GO:0019542)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	acetate-CoA ligase activity (GO:0003987)|AMP binding (GO:0016208)|ATP binding (GO:0005524)			cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(9)	21					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GCTCTTAACAGGGTAAACTGA	0.507																																																	0								ENSG00000131069						150.0	130.0	136.0					20																	33503020		1568	3582	5150	ACSS2	SO:0001627	intron_variant	0			-	HGNC	AF263614	CCDS13243.1, CCDS42868.1, CCDS42868.2	20q11.22	2012-07-13	2005-09-08	2005-09-08	ENSG00000131069	ENSG00000131069	6.2.1.1	"""Acyl-CoA synthetase family"""	15814	protein-coding gene	gene with protein product		605832	"""acetyl-Coenzyme A synthetase 2 (ADP forming)"""	ACAS2		10843999	Standard	NM_018677		Approved	ACS, ACSA, AceCS, dJ1161H23.1	uc010gey.2	Q9NR19	OTTHUMG00000032317	ENST00000360596.2:c.834+780G>T	20.37:g.33503020G>T		Somatic	0	50	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A6NE90|Q5QPH2|Q5QPH3|Q8N238|Q96EL0|Q9NQP7|Q9UJ15	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e8-1	ENST00000360596.2	37	c.835-1	CCDS13243.1	20	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347820	0.41599	.	.	ENSG00000131069	ENST00000253382	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5069	0.95121	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSS2	32966681	1.000000	0.71417	1.000000	0.80357	0.251000	0.25915	5.412000	0.66392	2.941000	0.99782	0.655000	0.94253	.	-	-		0.507	ACSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSS2	protein_coding	OTTHUMT00000078823.3	G	NM_018677	-		33503020	+1	no_errors	ENST00000253382	ensembl	human	known	74_37	splice_site	SNP	1.000	T
AVIL	10677	genome.wustl.edu	37	12	58207134	58207134	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:58207134G>C	ENST00000257861.3	-	3	644	c.214C>G	c.(214-216)Caa>Gaa	p.Q72E	AVIL_ENST00000537081.1_Missense_Mutation_p.Q65E|RP11-571M6.18_ENST00000602327.1_lincRNA	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	72	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GCGCAGCTTTGCTCATCCTGG	0.577																																																	0								ENSG00000135407						123.0	111.0	115.0					12																	58207134		2203	4300	6503	AVIL	SO:0001583	missense	0			-	HGNC	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.214C>G	12.37:g.58207134G>C	ENSP00000257861:p.Gln72Glu	Somatic	0	17	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	128	330	27.95	B2RAU7|Q2NKM9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.Q72E	ENST00000257861.3	37	c.214	CCDS8959.1	12	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584145	0.65992	.	.	ENSG00000135407	ENST00000537081;ENST00000257861;ENST00000549994	T;T;T	0.54279	0.58;0.58;0.58	4.92	4.02	0.46733	Gelsolin domain (1);	0.000000	0.85682	D	0.000000	T	0.77987	0.4213	M	0.93594	3.435	0.58432	D	0.999995	D;P;D	0.65815	0.968;0.943;0.995	P;P;D	0.70487	0.882;0.742;0.969	D	0.84215	0.0458	10	0.66056	D	0.02	-12.1337	14.1085	0.65107	0.0:0.0:0.8485:0.1515	.	65;72;72	O75366-2;F8VVU1;O75366	.;.;AVIL_HUMAN	E	65;72;72	ENSP00000443207:Q65E;ENSP00000257861:Q72E;ENSP00000449239:Q72E	ENSP00000257861:Q72E	Q	-	1	0	AVIL	56493401	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.625000	0.83145	1.419000	0.47118	0.650000	0.86243	CAA	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin		0.577	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	protein_coding	OTTHUMT00000409276.1	G	NM_006576	-		58207134	-1	no_errors	ENST00000257861	ensembl	human	known	74_37	missense	SNP	1.000	C
ZNF446	55663	genome.wustl.edu	37	19	58988668	58988668	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr19:58988668G>T	ENST00000594369.1	+	2	464	c.83G>T	c.(82-84)cGc>cTc	p.R28L	CTD-2619J13.23_ENST00000598051.1_RNA|ZNF446_ENST00000596341.1_Missense_Mutation_p.R28L|ZNF446_ENST00000335841.4_Missense_Mutation_p.R28L	NM_017908.2	NP_060378.1	Q9NWS9	ZN446_HUMAN	zinc finger protein 446	28	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GCCCGCCTCCGCTTCCGAGGG	0.667																																																	0								ENSG00000083838						64.0	76.0	72.0					19																	58988668		2203	4300	6503	ZNF446	SO:0001583	missense	0			-	HGNC		CCDS12982.1	19q13.43	2013-01-09				ENSG00000083838		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21036	protein-coding gene	gene with protein product							Standard	NM_017908		Approved	ZKSCAN20, FLJ20626, ZSCAN52	uc002qsz.3	Q9NWS9		ENST00000594369.1:c.83G>T	19.37:g.58988668G>T	ENSP00000472802:p.Arg28Leu	Somatic	0	48	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R28L	ENST00000594369.1	37	c.83	CCDS12982.1	19	.	.	.	.	.	.	.	.	.	.	G	13.91	2.376560	0.42105	.	.	ENSG00000083838	ENST00000335841;ENST00000540481;ENST00000539679	T	0.04758	3.56	4.52	2.11	0.27256	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.398584	0.18460	N	0.140560	T	0.12817	0.0311	M	0.66560	2.04	0.33268	D	0.560611	D;D;D	0.65815	0.994;0.995;0.995	D;D;D	0.67900	0.954;0.927;0.927	T	0.17228	-1.0376	10	0.18276	T	0.48	-13.8596	7.2947	0.26387	0.096:0.0:0.737:0.167	.	28;28;28	F5H201;Q96AF5;Q9NWS9	.;.;ZN446_HUMAN	L	28	ENSP00000336565:R28L	ENSP00000336565:R28L	R	+	2	0	ZNF446	63680480	0.000000	0.05858	0.475000	0.27278	0.598000	0.36846	0.507000	0.22675	1.170000	0.42753	0.491000	0.48974	CGC	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN		0.667	ZNF446-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF446	protein_coding	OTTHUMT00000467052.1	G	NM_017908	-		58988668	+1	no_errors	ENST00000594369	ensembl	human	known	74_37	missense	SNP	0.306	T
CSRNP3	80034	genome.wustl.edu	37	2	166536009	166536009	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr2:166536009G>A	ENST00000342316.4	+	5	1776	c.1504G>A	c.(1504-1506)Gtt>Att	p.V502I	CSRNP3_ENST00000409420.1_Missense_Mutation_p.V534I|CSRNP3_ENST00000314499.7_Missense_Mutation_p.V502I	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	502					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						CTCTGTAATCGTTTGCTGCTC	0.507																																																	0								ENSG00000178662						89.0	75.0	80.0					2																	166536009		2203	4300	6503	CSRNP3	SO:0001583	missense	0			-	HGNC	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.1504G>A	2.37:g.166536009G>A	ENSP00000344042:p.Val502Ile	Somatic	0	27	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	12	50.00	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	prints_Cys/Ser-rich_nuc_prot	p.V502I	ENST00000342316.4	37	c.1504	CCDS2225.1	2	.	.	.	.	.	.	.	.	.	.	G	12.06	1.825289	0.32237	.	.	ENSG00000178662	ENST00000314499;ENST00000342316;ENST00000409420	T;T;T	0.49432	0.78;0.78;0.78	5.88	5.88	0.94601	.	0.182840	0.43579	D	0.000554	T	0.36276	0.0961	L	0.27053	0.805	0.37107	D	0.900175	B	0.31581	0.329	B	0.22880	0.042	T	0.24621	-1.0155	9	.	.	.	-17.3619	20.2422	0.98381	0.0:0.0:1.0:0.0	.	502	Q8WYN3	CSRN3_HUMAN	I	502;502;534	ENSP00000318258:V502I;ENSP00000344042:V502I;ENSP00000387195:V534I	.	V	+	1	0	CSRNP3	166244255	0.996000	0.38824	0.916000	0.36221	0.933000	0.57130	2.615000	0.46368	2.782000	0.95742	0.655000	0.94253	GTT	-	NULL		0.507	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP3	protein_coding	OTTHUMT00000255191.2	G	NM_024969	-		166536009	+1	no_errors	ENST00000314499	ensembl	human	known	74_37	missense	SNP	0.893	A
TCP10L	140290	genome.wustl.edu	37	21	33947970	33947970	+	IGR	SNP	G	G	A	rs528991484	byFrequency	TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr21:33947970G>A	ENST00000300258.3	-	0	984				LINC00846_ENST00000334165.4_lincRNA	NM_144659.5	NP_653260.1	Q8TDR4	TCP1L_HUMAN	t-complex 10-like						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	protein self-association (GO:0043621)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)			breast(1)|central_nervous_system(1)|liver(1)|skin(1)	4						TGCAGAGGTCGTGAAGCTGCT	0.567													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19669	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000186842																																			LINC00846	SO:0001628	intergenic_variant	0			-	HGNC	AF115967	CCDS13616.1	21p22.11	2012-09-20	2012-09-20		ENSG00000242220	ENSG00000242220			11657	protein-coding gene	gene with protein product		608365	"""t-complex 10 (a murine tcp homolog)-like"", ""t-complex 10 (mouse)-like"""			10830953	Standard	NM_144659		Approved	PRED77		Q8TDR4	OTTHUMG00000064901		21.37:g.33947970G>A		Somatic	0	41	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	15	37.50	Q53EW0|Q96LN5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000300258.3	37	NULL	CCDS13616.1	21																																																																																			-	-		0.567	TCP10L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LINC00846	protein_coding	OTTHUMT00000139350.1	G	NM_144659	-		33947970	-1	no_errors	ENST00000334165	ensembl	human	known	74_37	rna	SNP	0.005	A
MUC4	4585	genome.wustl.edu	37	3	195515372	195515372	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr3:195515372C>T	ENST00000463781.3	-	2	3538	c.3079G>A	c.(3079-3081)Gtc>Atc	p.V1027I	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V1027I|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	459	Repeat.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S1013_T1028delSPSSVSTGHTTPLPVT(4)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGTCGGTGACAGGAAGAGGG	0.567																																																	4	Deletion - In frame(4)	stomach(4)						ENSG00000145113						49.0	25.0	32.0					3																	195515372		692	1590	2282	MUC4	SO:0001583	missense	0			-	HGNC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.3079G>A	3.37:g.195515372C>T	ENSP00000417498:p.Val1027Ile	Somatic	0	86	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.V1027I	ENST00000463781.3	37	c.3079	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	0.325	-0.959577	0.02267	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.40756	1.02;1.03	1.0	-2.01	0.07410	.	.	.	.	.	T	0.19725	0.0474	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.15896	-1.0421	8	.	.	.	.	0.4901	0.00562	0.1801:0.2589:0.1806:0.3804	.	1027	E7ESK3	.	I	1027	ENSP00000417498:V1027I;ENSP00000420243:V1027I	.	V	-	1	0	MUC4	196999767	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.881000	0.01626	-2.293000	0.00664	0.064000	0.15345	GTC	-	NULL		0.567	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	C	NM_018406	-		195515372	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	SNP	0.000	T
RPF2	84154	genome.wustl.edu	37	6	111346637	111346637	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:111346637C>G	ENST00000441448.2	+	10	865	c.773C>G	c.(772-774)aCt>aGt	p.T258S		NM_032194.1	NP_115570.1	Q9H7B2	RPF2_HUMAN	ribosome production factor 2 homolog (S. cerevisiae)	258						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|ovary(2)	7						TCCCATGATACTTTTGGTACA	0.358																																																	0								ENSG00000197498						79.0	82.0	81.0					6																	111346637		2203	4300	6503	RPF2	SO:0001583	missense	0			-	HGNC	AK024740	CCDS5088.1	6q21	2009-09-25	2009-09-25	2009-09-25	ENSG00000197498	ENSG00000197498			20870	protein-coding gene	gene with protein product	"""ribosomal processing factor 2 homolog (S. cerevisiae)"""		"""brix domain containing 1"""	BXDC1		12048200	Standard	NM_032194		Approved	FLJ21087, bA397G5.4	uc003pun.3	Q9H7B2	OTTHUMG00000015368	ENST00000441448.2:c.773C>G	6.37:g.111346637C>G	ENSP00000402338:p.Thr258Ser	Somatic	0	30	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	13	53.57	Q5VXN1|Q8N4A1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Brix,superfamily_Anticodon-bd,smart_Brix,pfscan_Brix	p.T258S	ENST00000441448.2	37	c.773	CCDS5088.1	6	.	.	.	.	.	.	.	.	.	.	c	10.23	1.292566	0.23564	.	.	ENSG00000197498	ENST00000441448	T	0.71698	-0.59	5.8	4.93	0.64822	.	0.100576	0.64402	D	0.000002	T	0.31734	0.0806	L	0.28608	0.87	0.31528	N	0.661575	B;B	0.25441	0.016;0.126	B;B	0.21546	0.005;0.035	T	0.08146	-1.0736	10	0.10377	T	0.69	-12.7754	7.7445	0.28860	0.1601:0.7374:0.0:0.1026	.	258;258	A8K800;Q9H7B2	.;RPF2_HUMAN	S	258	ENSP00000402338:T258S	ENSP00000402338:T258S	T	+	2	0	RPF2	111453330	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.271000	0.43364	1.453000	0.47775	0.563000	0.77884	ACT	-	NULL		0.358	RPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPF2	protein_coding	OTTHUMT00000041813.2	C	NM_032194	-		111346637	+1	no_errors	ENST00000441448	ensembl	human	known	74_37	missense	SNP	1.000	G
EYA4	2070	genome.wustl.edu	37	6	133804184	133804184	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:133804184G>A	ENST00000367895.5	+	13	1586	c.1122G>A	c.(1120-1122)tgG>tgA	p.W374*	EYA4_ENST00000355167.3_Nonsense_Mutation_p.W374*|EYA4_ENST00000355286.6_Nonsense_Mutation_p.W351*|EYA4_ENST00000525849.1_Nonsense_Mutation_p.W351*|EYA4_ENST00000531901.1_Nonsense_Mutation_p.W380*|EYA4_ENST00000431403.2_Nonsense_Mutation_p.W374*|EYA4_ENST00000430974.2_Nonsense_Mutation_p.W326*|EYA4_ENST00000452339.2_Nonsense_Mutation_p.W320*	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4	374					anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		TGTTTGTCTGGGATTTGGATG	0.368																																					Melanoma(57;398 1237 3528 4702 7415)												0								ENSG00000112319						130.0	125.0	127.0					6																	133804184		2203	4300	6503	EYA4	SO:0001587	stop_gained	0			-	HGNC	Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1122G>A	6.37:g.133804184G>A	ENSP00000356870:p.Trp374*	Somatic	0	62	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	p.W374*	ENST00000367895.5	37	c.1122	CCDS5165.1	6	.	.	.	.	.	.	.	.	.	.	G	43	9.984172	0.99310	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000367895;ENST00000355167;ENST00000355286;ENST00000531901;ENST00000525849;ENST00000431403	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.104	19.5117	0.95144	0.0:0.0:1.0:0.0	.	.	.	.	X	320;326;374;374;351;380;351;374	.	ENSP00000347294:W374X	W	+	3	0	EYA4	133845877	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.869000	0.99810	2.604000	0.88044	0.650000	0.86243	TGG	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA		0.368	EYA4-001	KNOWN	basic|CCDS	protein_coding	EYA4	protein_coding	OTTHUMT00000042282.2	G	NM_004100	-		133804184	+1	no_errors	ENST00000355167	ensembl	human	known	74_37	nonsense	SNP	1.000	A
EYA1	2138	genome.wustl.edu	37	8	72246376	72246376	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr8:72246376G>T	ENST00000340726.3	-	4	797	c.158C>A	c.(157-159)gCt>gAt	p.A53D	EYA1_ENST00000419131.1_Missense_Mutation_p.A53D|EYA1_ENST00000388742.4_Missense_Mutation_p.A53D|EYA1_ENST00000388743.2_Missense_Mutation_p.A53D|EYA1_ENST00000388741.2_Missense_Mutation_p.A20D|EYA1_ENST00000303824.7_Missense_Mutation_p.A53D|EYA1_ENST00000388740.3_Missense_Mutation_p.A20D	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	53					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			TGTCGTTGAAGCTGTTTCACT	0.328																																																	0								ENSG00000104313						129.0	124.0	126.0					8																	72246376		2203	4300	6503	EYA1	SO:0001583	missense	0			-	HGNC	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.158C>A	8.37:g.72246376G>T	ENSP00000342626:p.Ala53Asp	Somatic	0	71	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	p.A53D	ENST00000340726.3	37	c.158	CCDS34906.1	8	.	.	.	.	.	.	.	.	.	.	G	12.43	1.934557	0.34189	.	.	ENSG00000104313	ENST00000388742;ENST00000340726;ENST00000388744;ENST00000388740;ENST00000303824;ENST00000388741;ENST00000388743;ENST00000419131	T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.65	4.71	0.59529	.	0.209202	0.49305	D	0.000151	T	0.54013	0.1832	L	0.34521	1.04	0.45464	D	0.998435	P;B;P;B	0.35192	0.489;0.07;0.489;0.07	B;B;B;B	0.39660	0.306;0.171;0.2;0.097	T	0.49390	-0.8945	10	0.25106	T	0.35	-2.3854	6.6471	0.22941	0.1589:0.0:0.8411:0.0	.	53;20;53;53	A6NCB9;Q99502-2;Q99502;G5E9R4	.;.;EYA1_HUMAN;.	D	53;53;21;20;53;20;53;53	ENSP00000373394:A53D;ENSP00000342626:A53D;ENSP00000373392:A20D;ENSP00000303221:A53D;ENSP00000373393:A20D;ENSP00000373395:A53D;ENSP00000410176:A53D	ENSP00000303221:A53D	A	-	2	0	EYA1	72408930	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	5.250000	0.65432	1.359000	0.45940	0.563000	0.77884	GCT	-	NULL		0.328	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EYA1	protein_coding	OTTHUMT00000313788.2	G	NM_000503, NM_172060	-		72246376	-1	no_errors	ENST00000340726	ensembl	human	known	74_37	missense	SNP	1.000	T
RAI1	10743	genome.wustl.edu	37	17	17682439	17682442	+	Intron	DEL	ACAC	ACAC	-			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	ACAC	ACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr17:17682439_17682442delACAC	ENST00000353383.1	+	3	453				SMCR5_ENST00000543475.1_RNA|RP1-253P7.1_ENST00000583598.1_RNA	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1						circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		GTCCATTCAGACACAAGACAAGGC	0.549																																																	0								ENSG00000226746																																			SMCR5	SO:0001627	intron_variant	0				HGNC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.-16-13805ACAC>-	17.37:g.17682439_17682442delACAC		Somatic	0	45	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	16	33.33	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000353383.1	37	NULL	CCDS11188.1	17																																																																																			-	-		0.549	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR5	protein_coding	OTTHUMT00000131775.1	ACAC	NM_030665			17682442	-1	no_errors	ENST00000543475	ensembl	human	known	74_37	rna	DEL	0.002:0.004:0.000:0.001	-
ZNF616	90317	genome.wustl.edu	37	19	52619626	52619626	+	Missense_Mutation	SNP	G	G	T	rs202056241		TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr19:52619626G>T	ENST00000600228.1	-	4	1052	c.791C>A	c.(790-792)aCt>aAt	p.T264N	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	264					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		TTTCTGTCCAGTGTGACTCCT	0.383													G|||	1	0.000199681	0.0	0.0	5008	,	,		22272	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000204611						85.0	83.0	84.0					19																	52619626		2203	4299	6502	ZNF616	SO:0001583	missense	0			GMAF=0.0005	HGNC	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.791C>A	19.37:g.52619626G>T	ENSP00000471000:p.Thr264Asn	Somatic	0	52	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T264N	ENST00000600228.1	37	c.791	CCDS33090.1	19	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	14.69	2.609774	0.46527	.	.	ENSG00000204611	ENST00000330123	.	.	.	0.954	-0.139	0.13460	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46814	0.1412	L	0.58583	1.82	0.21416	N	0.999694	P	0.46020	0.871	P	0.57244	0.816	T	0.40117	-0.9580	8	0.62326	D	0.03	.	0.387	0.00404	0.2021:0.2422:0.3121:0.2435	.	264	Q08AN1	ZN616_HUMAN	N	264	.	ENSP00000328722:T264N	T	-	2	0	ZNF616	57311438	0.007000	0.16637	0.032000	0.17829	0.716000	0.41182	0.335000	0.19806	-0.018000	0.14079	0.305000	0.20034	ACT	-	pfscan_Znf_C2H2		0.383	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF616	protein_coding	OTTHUMT00000462451.1	G	XM_030892	rs202056241		52619626	-1	no_errors	ENST00000600228	ensembl	human	known	74_37	missense	SNP	0.713	T
ISOC1	51015	genome.wustl.edu	37	5	128440685	128440685	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr5:128440685G>T	ENST00000173527.5	+	2	362	c.346G>T	c.(346-348)Gtg>Ttg	p.V116L		NM_016048.2	NP_057132.2	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1	116						extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	catalytic activity (GO:0003824)			kidney(2)|lung(7)	9		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		TTCAAGCACTGTGTTTTTCTG	0.388																																																	0								ENSG00000066583						201.0	188.0	192.0					5																	128440685		1871	4111	5982	ISOC1	SO:0001583	missense	0			-	HGNC	AF151869	CCDS43357.1	5q22.1-q33.3	2010-03-19			ENSG00000066583	ENSG00000066583			24254	protein-coding gene	gene with protein product						10810093, 18566572	Standard	NM_016048		Approved	CGI-111	uc003kva.3	Q96CN7	OTTHUMG00000163144	ENST00000173527.5:c.346G>T	5.37:g.128440685G>T	ENSP00000173527:p.Val116Leu	Somatic	0	54	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	Q7Z770	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Isochorismatase-like,superfamily_Isochorismatase-like	p.V116L	ENST00000173527.5	37	c.346	CCDS43357.1	5	.	.	.	.	.	.	.	.	.	.	G	17.34	3.365215	0.61513	.	.	ENSG00000066583	ENST00000506986;ENST00000514194;ENST00000173527;ENST00000513879	.	.	.	4.86	4.86	0.63082	Isochorismatase-like (3);	0.000000	0.64402	D	0.000002	T	0.40886	0.1135	N	0.10664	0.02	0.58432	D	0.999997	B	0.29766	0.256	B	0.33960	0.173	T	0.27226	-1.0080	8	.	.	.	-18.4648	18.567	0.91120	0.0:0.0:1.0:0.0	.	116	Q96CN7	ISOC1_HUMAN	L	95;107;116;107	.	.	V	+	1	0	ISOC1	128468584	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.693000	0.91288	2.709000	0.92574	0.655000	0.94253	GTG	-	pfam_Isochorismatase-like,superfamily_Isochorismatase-like		0.388	ISOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISOC1	protein_coding	OTTHUMT00000371826.1	G	NM_016048	-		128440685	+1	no_errors	ENST00000173527	ensembl	human	known	74_37	missense	SNP	1.000	T
NSMCE1	197370	genome.wustl.edu	37	16	27245549	27245549	+	Missense_Mutation	SNP	G	G	A	rs11553886		TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr16:27245549G>A	ENST00000361439.4	-	4	395	c.296C>T	c.(295-297)aCg>aTg	p.T99M		NM_145080.3	NP_659547.2	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog (S. cerevisiae)	99	Interaction with NDNL2.				DNA recombination (GO:0006310)|DNA repair (GO:0006281)|intracellular signal transduction (GO:0035556)|positive regulation of response to DNA damage stimulus (GO:2001022)|protein ubiquitination (GO:0016567)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)	7						TGCAAAATCCGTAGCCATTTT	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		22522	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000169189						144.0	140.0	141.0					16																	27245549		1950	4145	6095	NSMCE1	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF161451	CCDS10628.2	16p12.1	2010-03-23	2006-07-05		ENSG00000169189	ENSG00000169189			29897	protein-coding gene	gene with protein product						11927594	Standard	XM_005255163		Approved	NSE1	uc002doi.1	Q8WV22	OTTHUMG00000131674	ENST00000361439.4:c.296C>T	16.37:g.27245549G>A	ENSP00000355077:p.Thr99Met	Somatic	0	71	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	D3DWF6|Q9P045|Q9P049	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nse1,pfam_Znf_RING-like,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Znf_RING	p.T99M	ENST00000361439.4	37	c.296	CCDS10628.2	16	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	21.7	4.186384	0.78789	.	.	ENSG00000169189	ENST00000361439	T	0.53206	0.63	5.76	5.76	0.90799	.	0.124536	0.56097	D	0.000028	T	0.55401	0.1918	L	0.39898	1.24	0.41380	D	0.987546	D	0.76494	0.999	P	0.55011	0.766	T	0.57860	-0.7738	10	0.87932	D	0	.	17.4698	0.87642	0.0:0.0:1.0:0.0	rs11553886;rs52829655	99	Q8WV22	NSE1_HUMAN	M	99	ENSP00000355077:T99M	ENSP00000355077:T99M	T	-	2	0	NSMCE1	27153050	0.967000	0.33354	0.800000	0.32199	0.946000	0.59487	5.146000	0.64845	2.713000	0.92767	0.655000	0.94253	ACG	-	pfam_Nse1		0.443	NSMCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMCE1	protein_coding	OTTHUMT00000254577.3	G	NM_145080	rs11553886		27245549	-1	no_errors	ENST00000361439	ensembl	human	known	74_37	missense	SNP	0.941	A
FPGS	2356	genome.wustl.edu	37	9	130575476	130575476	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr9:130575476C>A	ENST00000373247.2	+	15	1407	c.1357C>A	c.(1357-1359)Caa>Aaa	p.Q453K	FPGS_ENST00000373225.3_Missense_Mutation_p.Q403K|FPGS_ENST00000373245.1_3'UTR|FPGS_ENST00000460181.1_3'UTR|RP11-228B15.4_ENST00000439298.1_RNA|FPGS_ENST00000393706.2_Missense_Mutation_p.Q427K	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	453					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	CCCCACAGACCAACAGAACTT	0.622																																																	0								ENSG00000136877						64.0	54.0	57.0					9																	130575476		2203	4300	6503	FPGS	SO:0001583	missense	0			-	HGNC		CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.1357C>A	9.37:g.130575476C>A	ENSP00000362344:p.Gln453Lys	Somatic	0	33	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Mur_ligase_cen,superfamily_Mur_ligase_C,tigrfam_Folylpolyglutamate_synth	p.Q453K	ENST00000373247.2	37	c.1357	CCDS35148.1	9	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795188	0.70452	.	.	ENSG00000136877	ENST00000373247;ENST00000393706;ENST00000373225	T;T;T	0.13901	2.95;2.95;2.55	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	M	0.77103	2.36	0.80722	D	1	P;P	0.51057	0.594;0.941	P;P	0.51135	0.561;0.66	T	0.10132	-1.0643	10	0.15499	T	0.54	-28.6389	17.3369	0.87283	0.0:1.0:0.0:0.0	.	427;453	Q05932-4;Q05932	.;FOLC_HUMAN	K	453;427;403	ENSP00000362344:Q453K;ENSP00000377309:Q427K;ENSP00000362322:Q403K	ENSP00000362322:Q403K	Q	+	1	0	FPGS	129615297	1.000000	0.71417	1.000000	0.80357	0.471000	0.32888	7.291000	0.78721	2.330000	0.79161	0.555000	0.69702	CAA	-	tigrfam_Folylpolyglutamate_synth		0.622	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	FPGS	protein_coding	OTTHUMT00000054251.1	C		-		130575476	+1	no_errors	ENST00000373247	ensembl	human	known	74_37	missense	SNP	1.000	A
EFEMP1	2202	genome.wustl.edu	37	2	56103828	56103828	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr2:56103828G>T	ENST00000394555.2	-	7	1245	c.810C>A	c.(808-810)aaC>aaA	p.N270K	EFEMP1_ENST00000355426.3_Missense_Mutation_p.N270K|EFEMP1_ENST00000424836.2_Intron|EFEMP1_ENST00000394554.1_Missense_Mutation_p.N270K	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	270	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.|Mediates interaction with TIMP3.				epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			AACCAAGAATGTTGTAGCACT	0.338																																					GBM(92;934 1319 7714 28760 40110)												0								ENSG00000115380						128.0	113.0	118.0					2																	56103828		2203	4300	6503	EFEMP1	SO:0001583	missense	0			-	HGNC	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.810C>A	2.37:g.56103828G>T	ENSP00000378058:p.Asn270Lys	Somatic	0	45	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00	A8K3I4|B4DW75|D6W5D2|Q541U7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	p.N270K	ENST00000394555.2	37	c.810	CCDS1857.1	2	.	.	.	.	.	.	.	.	.	.	G	15.71	2.912493	0.52439	.	.	ENSG00000115380	ENST00000394555;ENST00000394554;ENST00000405693;ENST00000355426	D;D;D	0.89050	-2.46;-2.46;-2.46	5.73	3.64	0.41730	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000002	D	0.96197	0.8760	H	0.99238	4.48	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.94739	0.7917	10	0.87932	D	0	.	6.3243	0.21234	0.3445:0.0:0.6555:0.0	.	270	Q12805	FBLN3_HUMAN	K	270;270;126;270	ENSP00000378058:N270K;ENSP00000378057:N270K;ENSP00000347596:N270K	ENSP00000347596:N270K	N	-	3	2	EFEMP1	55957332	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.651000	0.37302	1.337000	0.45525	0.650000	0.86243	AAC	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.338	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFEMP1	protein_coding	OTTHUMT00000251491.2	G		-		56103828	-1	no_errors	ENST00000355426	ensembl	human	known	74_37	missense	SNP	1.000	T
CHRNA9	55584	genome.wustl.edu	37	4	40356073	40356073	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr4:40356073T>C	ENST00000310169.2	+	5	1115	c.976T>C	c.(976-978)Tgt>Cgt	p.C326R		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	326					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	TATCCACTTCTGTGGGGCCGA	0.517																																					Esophageal Squamous(115;1297 1602 22235 25158 43327)												0								ENSG00000174343						146.0	150.0	148.0					4																	40356073		2203	4300	6503	CHRNA9	SO:0001583	missense	0			-	HGNC	AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.976T>C	4.37:g.40356073T>C	ENSP00000312663:p.Cys326Arg	Somatic	0	45	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q14CY7|Q4W5A2|Q9NYV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.C326R	ENST00000310169.2	37	c.976	CCDS3459.1	4	.	.	.	.	.	.	.	.	.	.	T	13.93	2.384141	0.42308	.	.	ENSG00000174343	ENST00000310169	T	0.81247	-1.47	5.72	5.72	0.89469	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	T	0.78214	0.4248	N	0.12502	0.225	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73100	-0.4089	10	0.02654	T	1	.	15.9994	0.80280	0.0:0.0:0.0:1.0	.	326	Q9UGM1	ACHA9_HUMAN	R	326	ENSP00000312663:C326R	ENSP00000312663:C326R	C	+	1	0	CHRNA9	40050830	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.698000	0.84413	2.187000	0.69744	0.459000	0.35465	TGT	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.517	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA9	protein_coding	OTTHUMT00000216822.1	T		-		40356073	+1	no_errors	ENST00000310169	ensembl	human	known	74_37	missense	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152697665	152697665	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:152697665G>A	ENST00000367255.5	-	58	9776	c.9175C>T	c.(9175-9177)Cag>Tag	p.Q3059*	SYNE1_ENST00000341594.5_Nonsense_Mutation_p.Q3098*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.Q3066*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.Q3059*|SYNE1_ENST00000448038.1_Nonsense_Mutation_p.Q3066*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3059					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCTTTATTCTGGCAGCCCTTG	0.383										HNSCC(10;0.0054)																																							0								ENSG00000131018						62.0	64.0	63.0					6																	152697665		2203	4300	6503	SYNE1	SO:0001587	stop_gained	0			-	HGNC	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.9175C>T	6.37:g.152697665G>A	ENSP00000356224:p.Gln3059*	Somatic	0	103	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	48	36.00	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.Q3059*	ENST00000367255.5	37	c.9175	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	33	5.231761	0.95207	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	.	.	.	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8557	0.96758	0.0:0.0:1.0:0.0	.	.	.	.	X	3059;3066;3059;3066;3098	.	ENSP00000265368:Q3059X	Q	-	1	0	SYNE1	152739358	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.397000	0.97276	2.707000	0.92482	0.655000	0.94253	CAG	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom		0.383	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	protein_coding	OTTHUMT00000334755.2	G	NM_182961	-		152697665	-1	no_errors	ENST00000265368	ensembl	human	known	74_37	nonsense	SNP	1.000	A
SCAI	286205	genome.wustl.edu	37	9	127765856	127765857	+	Intron	INS	-	-	A	rs559516156|rs559723416|rs557619116|rs375041526	byFrequency	TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr9:127765856_127765857insA	ENST00000336505.6	-	10	920				SCAI_ENST00000373549.4_Intron|SCAI_ENST00000487795.1_5'UTR	NM_001144877.2	NP_001138349.1	Q8N9R8	SCAI_HUMAN	suppressor of cancer cell invasion						negative regulation of cell migration (GO:0030336)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(5)|stomach(1)|urinary_tract(1)	35						TAACCTGCAAGAAAAAAAAAAA	0.386																																																	0								ENSG00000173611																																			SCAI	SO:0001627	intron_variant	0				HGNC	AK093983	CCDS43877.1, CCDS48017.1	9q34.11	2009-11-06	2009-07-09	2009-07-09	ENSG00000173611	ENSG00000173611			26709	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 126"""	C9orf126			Standard	NM_173690		Approved	FLJ36664, NET40	uc004bpd.3	Q8N9R8	OTTHUMG00000020667	ENST00000336505.6:c.862-7->T	9.37:g.127765867_127765867dupA		Somatic	0	27	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	Q3SXZ1|Q3SXZ2|Q5T163|Q8N1I4	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000336505.6	37	NULL	CCDS48017.1	9																																																																																			-	-		0.386	SCAI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAI	protein_coding	OTTHUMT00000054055.3	-	NM_173690			127765857	-1	no_errors	ENST00000487795	ensembl	human	known	74_37	rna	INS	0.089:0.025	A
FRK	2444	genome.wustl.edu	37	6	116381270	116381270	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:116381270G>A	ENST00000606080.1	-	1	651	c.205C>T	c.(205-207)Ctt>Ttt	p.L69F		NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	69	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	AGAACTTGAAGTTTGTCACCT	0.507																																																	0								ENSG00000111816						131.0	130.0	131.0					6																	116381270		2203	4300	6503	FRK	SO:0001583	missense	0			-	HGNC	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.205C>T	6.37:g.116381270G>A	ENSP00000476145:p.Leu69Phe	Somatic	0	26	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	15	50.00	B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.L69F	ENST00000606080.1	37	c.205	CCDS5103.1	6	.	.	.	.	.	.	.	.	.	.	G	10.42	1.345016	0.24426	.	.	ENSG00000111816	ENST00000368626	T	0.38887	1.11	4.74	3.87	0.44632	Src homology-3 domain (5);	0.134545	0.32041	N	0.006679	T	0.39306	0.1073	L	0.41027	1.25	0.80722	D	1	D	0.76494	0.999	D	0.71870	0.975	T	0.16778	-1.0391	10	0.31617	T	0.26	.	11.6729	0.51413	0.0828:0.0:0.9172:0.0	.	69	P42685	FRK_HUMAN	F	69	ENSP00000357615:L69F	ENSP00000357615:L69F	L	-	1	0	FRK	116487963	1.000000	0.71417	1.000000	0.80357	0.041000	0.13682	3.863000	0.56016	1.344000	0.45657	-0.140000	0.14226	CTT	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain		0.507	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRK	protein_coding	OTTHUMT00000041924.2	G	NM_002031	-		116381270	-1	no_errors	ENST00000606080	ensembl	human	known	74_37	missense	SNP	1.000	A
CCDC60	160777	genome.wustl.edu	37	12	119968815	119968815	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:119968815C>T	ENST00000327554.2	+	13	1963	c.1498C>T	c.(1498-1500)Cag>Tag	p.Q500*	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	500										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GAAGGTGCTGCAGGATCTGAG	0.522																																																	0								ENSG00000183273						141.0	116.0	124.0					12																	119968815		2203	4300	6503	CCDC60	SO:0001587	stop_gained	0			-	HGNC	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1498C>T	12.37:g.119968815C>T	ENSP00000333374:p.Gln500*	Somatic	0	66	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q500*	ENST00000327554.2	37	c.1498	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	C	42	9.280563	0.99123	.	.	ENSG00000183273	ENST00000327554	.	.	.	5.55	4.61	0.57282	.	0.252125	0.27214	N	0.020390	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-29.9813	11.9867	0.53151	0.0:0.7329:0.2671:0.0	.	.	.	.	X	500	.	.	Q	+	1	0	CCDC60	118453198	0.939000	0.31865	0.993000	0.49108	0.996000	0.88848	1.603000	0.36794	2.601000	0.87937	0.655000	0.94253	CAG	-	NULL		0.522	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	protein_coding	OTTHUMT00000401680.1	C	NM_178499	-		119968815	+1	no_errors	ENST00000327554	ensembl	human	known	74_37	nonsense	SNP	0.980	T
CHM	1121	genome.wustl.edu	37	X	85282554	85282554	+	Silent	SNP	A	A	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chrX:85282554A>C	ENST00000357749.2	-	2	86	c.57T>G	c.(55-57)ccT>ccG	p.P19P	CHM_ENST00000358786.4_Silent_p.P19P|CHM_ENST00000537751.1_Intron|CHM_ENST00000467744.2_5'UTR	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	19					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TGATGGATTCAGGCAAACCTA	0.338																																																	0								ENSG00000188419						69.0	61.0	64.0					X																	85282554		2203	4300	6503	CHM	SO:0001819	synonymous_variant	0			-	HGNC	X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.57T>G	X.37:g.85282554A>C		Somatic	0	141	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	11	85.90	A1L4D2|O43732	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.P19	ENST00000357749.2	37	c.57	CCDS14454.1	X																																																																																			-	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_GDP_dissociation_inhibitor		0.338	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	protein_coding	OTTHUMT00000057396.3	A	NM_000390	-		85282554	-1	no_errors	ENST00000357749	ensembl	human	known	74_37	silent	SNP	1.000	C
CLVS1	157807	genome.wustl.edu	37	8	62412295	62412295	+	3'UTR	DEL	T	T	-			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr8:62412295delT	ENST00000519846.1	+	0	1731				CLVS1_ENST00000325897.4_3'UTR|CLVS1_ENST00000518858.1_3'UTR|CLVS1_ENST00000518592.1_3'UTR			Q8IUQ0	CLVS1_HUMAN	clavesin 1						lysosome organization (GO:0007040)	clathrin-coated vesicle (GO:0030136)|endosome (GO:0005768)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|transporter activity (GO:0005215)			endometrium(3)|kidney(4)|large_intestine(4)|lung(21)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	41						TGAGAGATGCTTTTTTTTTCC	0.438																																																	0								ENSG00000177182																																			CLVS1	SO:0001624	3_prime_UTR_variant	0				HGNC	AY094971	CCDS6176.1	8q12.1	2009-10-14	2009-10-14	2009-10-14		ENSG00000177182			23139	protein-coding gene	gene with protein product		611292	"""retinaldehyde binding protein 1-like 1"""	RLBP1L1		16802092, 19651769	Standard	NM_173519		Approved	MGC34646, CRALBPL, C6orf212L	uc003xuh.3	Q8IUQ0		ENST00000519846.1:c.*194T>-	8.37:g.62412295delT		Somatic	0	48	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	23	8.00	B2R7M5|C8UZT3|Q8NB32	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000519846.1	37	NULL	CCDS6176.1	8																																																																																			-	-		0.438	CLVS1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLVS1	protein_coding	OTTHUMT00000378323.1	T	NM_173519			62412295	+1	no_errors	ENST00000518858	ensembl	human	known	74_37	rna	DEL	0.005	-
AVIL	10677	genome.wustl.edu	37	12	58207180	58207180	+	Silent	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr12:58207180G>A	ENST00000257861.3	-	3	598	c.168C>T	c.(166-168)tcC>tcT	p.S56S	AVIL_ENST00000537081.1_Silent_p.S49S|RP11-571M6.18_ENST00000602327.1_lincRNA	NM_006576.3	NP_006567.3	O75366	AVIL_HUMAN	advillin	56	Core. {ECO:0000250}.				actin filament capping (GO:0051693)|cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|positive regulation of neuron projection development (GO:0010976)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)	actin binding (GO:0003779)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(6)	32	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					GGATGTCCTGGGATAGGAGAC	0.597																																																	0								ENSG00000135407						74.0	68.0	70.0					12																	58207180		2203	4300	6503	AVIL	SO:0001819	synonymous_variant	0			-	HGNC	AF041449	CCDS8959.1	12q13.11	2006-03-30				ENSG00000135407			14188	protein-coding gene	gene with protein product		613397				9664034, 12034507	Standard	NM_006576		Approved	p92, FLJ12386, ADVIL, DOC6	uc001sqj.2	O75366	OTTHUMG00000170461	ENST00000257861.3:c.168C>T	12.37:g.58207180G>A		Somatic	0	11	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	104	269	27.88	B2RAU7|Q2NKM9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.S56	ENST00000257861.3	37	c.168	CCDS8959.1	12																																																																																			-	pfam_Gelsolin_dom,smart_Villin/Gelsolin		0.597	AVIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVIL	protein_coding	OTTHUMT00000409276.1	G	NM_006576	-		58207180	-1	no_errors	ENST00000257861	ensembl	human	known	74_37	silent	SNP	1.000	A
SPR	6697	genome.wustl.edu	37	2	73115591	73115591	+	Silent	SNP	C	C	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr2:73115591C>T	ENST00000234454.5	+	2	526	c.453C>T	c.(451-453)acC>acT	p.T151T	SPR_ENST00000498749.1_3'UTR	NM_003124.4	NP_003115.1	P35270	SPRE_HUMAN	sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase)	151					cell morphogenesis involved in neuron differentiation (GO:0048667)|death (GO:0016265)|dopamine metabolic process (GO:0042417)|L-phenylalanine metabolic process (GO:0006558)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|norepinephrine metabolic process (GO:0042415)|oxidation-reduction process (GO:0055114)|pteridine metabolic process (GO:0019889)|regulation of multicellular organism growth (GO:0040014)|regulation of nitric-oxide synthase activity (GO:0050999)|serotonin metabolic process (GO:0042428)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldo-keto reductase (NADP) activity (GO:0004033)|NADP binding (GO:0050661)|sepiapterin reductase activity (GO:0004757)			lung(4)|ovary(2)	6						TCAACAGAACCGTGGTTAACA	0.562											OREG0014704	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000116096						162.0	141.0	148.0					2																	73115591		2203	4300	6503	SPR	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1920.1	2p14-p12	2013-06-03			ENSG00000116096	ENSG00000116096	1.1.1.153	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	11257	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 38C, member 1"""	182125				1883349, 19027726	Standard	NM_003124		Approved	SDR38C1	uc002sik.2	P35270	OTTHUMG00000129777	ENST00000234454.5:c.453C>T	2.37:g.73115591C>T		Somatic	0	54	0.00	1142	0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	13	51.85	A8K741|D6W5H2|Q53GI9|Q9UBB1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,tigrfam_Sepiapterin_red	p.T151	ENST00000234454.5	37	c.453	CCDS1920.1	2																																																																																			-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,tigrfam_Sepiapterin_red		0.562	SPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPR	protein_coding	OTTHUMT00000251993.2	C		-		73115591	+1	no_errors	ENST00000234454	ensembl	human	known	74_37	silent	SNP	0.000	T
BTN1A1	696	genome.wustl.edu	37	6	26508941	26508941	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:26508941G>A	ENST00000244513.6	+	7	1186	c.1120G>A	c.(1120-1122)Gtg>Atg	p.V374M		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	374	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						GGCAATCGGCGTGTGTAGGGA	0.542																																																	0								ENSG00000124557						164.0	145.0	152.0					6																	26508941		2203	4300	6503	BTN1A1	SO:0001583	missense	0			-	HGNC	U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.1120G>A	6.37:g.26508941G>A	ENSP00000244513:p.Val374Met	Somatic	0	44	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	20	37.50	Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.V374M	ENST00000244513.6	37	c.1120	CCDS4614.1	6	.	.	.	.	.	.	.	.	.	.	G	17.11	3.306882	0.60305	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.74421	-0.84	5.48	5.48	0.80851	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.52532	D	0.000063	D	0.87087	0.6090	M	0.88377	2.95	0.51012	D	0.9999	D	0.89917	1.0	D	0.87578	0.998	D	0.88814	0.3294	10	0.87932	D	0	.	17.1811	0.86855	0.0:0.0:1.0:0.0	.	374	Q13410	BT1A1_HUMAN	M	374	ENSP00000244513:V374M	ENSP00000244513:V374M	V	+	1	0	BTN1A1	26616920	1.000000	0.71417	0.919000	0.36401	0.093000	0.18481	4.612000	0.61169	2.727000	0.93392	0.655000	0.94253	GTG	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.542	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	protein_coding	OTTHUMT00000043776.1	G	NM_001732	-		26508941	+1	no_errors	ENST00000244513	ensembl	human	known	74_37	missense	SNP	1.000	A
CATSPER1	117144	genome.wustl.edu	37	11	65793082	65793082	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr11:65793082G>A	ENST00000312106.5	-	1	906	c.769C>T	c.(769-771)Cag>Tag	p.Q257*		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	257	His-rich.				calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						ATCCCACGCTGGTAGGACCCC	0.567																																																	0								ENSG00000175294						120.0	104.0	109.0					11																	65793082		2201	4296	6497	CATSPER1	SO:0001587	stop_gained	0			-	HGNC	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.769C>T	11.37:g.65793082G>A	ENSP00000309052:p.Gln257*	Somatic	0	18	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	4	55.56	Q96P76	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.Q257*	ENST00000312106.5	37	c.769	CCDS8127.1	11	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385200	0.61956	.	.	ENSG00000175294	ENST00000312106	.	.	.	3.87	0.698	0.18087	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	4.4697	0.11706	0.1612:0.0:0.5291:0.3097	.	.	.	.	X	257	.	ENSP00000309052:Q257X	Q	-	1	0	CATSPER1	65549658	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.200000	0.09478	0.039000	0.15632	0.404000	0.27445	CAG	-	NULL		0.567	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER1	protein_coding	OTTHUMT00000391055.1	G	NM_053054	-		65793082	-1	no_errors	ENST00000312106	ensembl	human	known	74_37	nonsense	SNP	0.000	A
NPAT	4863	genome.wustl.edu	37	11	108032182	108032182	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr11:108032182G>T	ENST00000278612.8	-	17	3736	c.3631C>A	c.(3631-3633)Caa>Aaa	p.Q1211K		NM_002519.2	NP_002510.2	Q14207	NPAT_HUMAN	nuclear protein, ataxia-telangiectasia locus	1211					positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gene expression (GO:0010468)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(21)|ovary(2)|prostate(2)|skin(5)	46		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		GATGTGCCTTGTTTTTTGGTC	0.363																																																	0								ENSG00000149308						272.0	270.0	271.0					11																	108032182		1841	4103	5944	NPAT	SO:0001583	missense	0			-	HGNC	X97186	CCDS41710.1	11q22-q23	2008-02-01			ENSG00000149308	ENSG00000149308			7896	protein-coding gene	gene with protein product		601448				9205109	Standard	NM_002519		Approved	E14	uc001pjz.4	Q14207	OTTHUMG00000166385	ENST00000278612.8:c.3631C>A	11.37:g.108032182G>T	ENSP00000278612:p.Gln1211Lys	Somatic	0	88	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8K1V5|A8K6M2|Q13632|Q14967|Q16580|Q86W55|Q8IWE9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.Q1211K	ENST00000278612.8	37	c.3631	CCDS41710.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.20|15.20	2.763093|2.763093	0.49574|0.49574	.|.	.|.	ENSG00000149308|ENSG00000149308	ENST00000527296|ENST00000278612	.|T	.|0.04275	.|3.66	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.157209	.|0.42294	.|D	.|0.000721	T|T	0.11750|0.11750	0.0286|0.0286	M|M	0.65975|0.65975	2.015|2.015	0.45580|0.45580	D|D	0.99852|0.99852	.|P	.|0.41848	.|0.763	.|P	.|0.44811	.|0.461	T|T	0.05273|0.05273	-1.0895|-1.0895	5|10	.|0.27082	.|T	.|0.32	-6.3346|-6.3346	19.6787|19.6787	0.95950|0.95950	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1211	.|Q14207	.|NPAT_HUMAN	K|K	209|1211	.|ENSP00000278612:Q1211K	.|ENSP00000278612:Q1211K	N|Q	-|-	3|1	2|0	NPAT|NPAT	107537392|107537392	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.089000|0.089000	0.18198|0.18198	4.232000|4.232000	0.58645|0.58645	2.890000|2.890000	0.99128|0.99128	0.650000|0.650000	0.86243|0.86243	AAC|CAA	-	NULL		0.363	NPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAT	protein_coding	OTTHUMT00000389506.2	G	NM_002519	-		108032182	-1	no_errors	ENST00000278612	ensembl	human	known	74_37	missense	SNP	1.000	T
EPDR1	54749	genome.wustl.edu	37	7	37960263	37960275	+	5'UTR	DEL	AGGCAGTGGCAGC	AGGCAGTGGCAGC	-	rs201513905|rs62443108|rs200181352|rs76859517	byFrequency	TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	AGGCAGTGGCAGC	AGGCAGTGGCAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr7:37960263_37960275delAGGCAGTGGCAGC	ENST00000199448.4	+	0	101_113				EPDR1_ENST00000559325.1_Frame_Shift_Del_p.RQWQQ28fs|EPDR1_ENST00000476620.1_Intron|EPDR1_ENST00000425345.1_5'Flank|EPDR1_ENST00000423717.1_5'UTR	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1						cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)	p.A36fs*79(3)		breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						AAGCGGCAGAAGGCAGTGGCAGCAGGCAGTGGC	0.634														805	0.160743	0.059	0.2104	5008	,	,		17289	0.1389		0.3052	False		,,,				2504	0.137																3	Deletion - Frameshift(3)	urinary_tract(1)|ovary(1)|breast(1)						ENSG00000086289			445,3795		57,331,1732						-0.3	0.2			25	2789,5371		581,1627,1872	no	frameshift	EPDR1	NM_017549.4		638,1958,3604	A1A1,A1R,RR		34.1789,10.4953,26.0806				3234,9166				EPDR1	SO:0001623	5_prime_UTR_variant	0				HGNC	BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.-267AGGCAGTGGCAGC>-	7.37:g.37960263_37960275delAGGCAGTGGCAGC		Somatic	NA	NA	NA		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K4C0|C9JYS3|Q06BL0|Q99M77	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ependymin,smart_Ependymin,prints_Ependymin	p.Q31fs	ENST00000199448.4	37	c.82_94	CCDS5454.2	7																																																																																			-	NULL		0.634	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EPDR1	protein_coding	OTTHUMT00000220037.3	AGGCAGTGGCAGC	NM_017549			37960275	+1	no_errors	ENST00000559325	ensembl	human	known	74_37	frame_shift_del	DEL	0.174:0.169:0.163:0.158:0.152:0.146:0.139:0.133:0.126:0.118:0.111:0.103:0.095	-
NUTM2B	729262	genome.wustl.edu	37	10	81463657	81463657	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr10:81463657T>C	ENST00000429828.1	+	1	675	c.292T>C	c.(292-294)Tct>Cct	p.S98P	RP11-119F19.2_ENST00000596088.1_RNA|NUTM2B_ENST00000372321.1_Missense_Mutation_p.S31P|RP11-119F19.2_ENST00000600376.1_RNA|NUTM2B_ENST00000448135.1_Missense_Mutation_p.S98P|RP11-119F19.2_ENST00000601369.1_RNA	NM_001278495.1	NP_001265424.1	A6NNL0	NTM2B_HUMAN	NUT family member 2B	98																	GCCAGGTCACTCTCTGGGTCT	0.527																																																	0								ENSG00000188199																																			NUTM2B	SO:0001583	missense	0			-	HGNC		CCDS60574.1	10q22.3	2014-08-13	2013-03-14	2013-03-14	ENSG00000188199	ENSG00000188199			23445	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member B"""	FAM22B			Standard	NM_001278495		Approved	bA119F19.1		A6NNL0	OTTHUMG00000018572	ENST00000429828.1:c.292T>C	10.37:g.81463657T>C	ENSP00000394623:p.Ser98Pro	Somatic	0	54	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92	A6NM73	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S98P	ENST00000429828.1	37	c.292		10	.	.	.	.	.	.	.	.	.	.	.	4.683	0.126931	0.08931	.	.	ENSG00000188199	ENST00000448135;ENST00000429828;ENST00000372321	T;T;T	0.30714	1.52;2.35;1.66	1.37	-2.74	0.05932	.	.	.	.	.	T	0.21631	0.0521	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32268	-0.9913	6	0.66056	D	0.02	.	0.1105	0.00056	0.2411:0.1785:0.2448:0.3356	.	.	.	.	P	98;98;31	ENSP00000391631:S98P;ENSP00000394623:S98P;ENSP00000361396:S31P	ENSP00000361396:S31P	S	+	1	0	FAM22B	81133663	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.456000	0.02377	-0.892000	0.03935	0.000000	0.15137	TCT	-	NULL		0.527	NUTM2B-201	KNOWN	basic|appris_principal	protein_coding	NUTM2B	protein_coding		T	NG_012780	-		81463657	+1	no_errors	ENST00000429828	ensembl	human	known	74_37	missense	SNP	0.000	C
SHROOM2	357	genome.wustl.edu	37	X	9862480	9862480	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chrX:9862480G>A	ENST00000380913.3	+	4	622	c.532G>A	c.(532-534)Gtt>Att	p.V178I		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	178					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				CTTGGGGAGCGTTGACAGCCT	0.602																																																	0								ENSG00000146950						84.0	67.0	73.0					X																	9862480		2203	4300	6503	SHROOM2	SO:0001583	missense	0			-	HGNC	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.532G>A	X.37:g.9862480G>A	ENSP00000370299:p.Val178Ile	Somatic	0	12	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	2	75.00	B9EIQ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V178I	ENST00000380913.3	37	c.532	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	G	5.937	0.356901	0.11239	.	.	ENSG00000146950	ENST00000380913	T	0.64438	-0.1	4.21	0.732	0.18283	.	0.179093	0.46442	N	0.000291	T	0.31638	0.0803	N	0.13043	0.29	0.80722	D	1	P	0.37525	0.598	B	0.21151	0.033	T	0.04767	-1.0928	10	0.32370	T	0.25	-16.4046	6.4179	0.21728	0.7541:0.0:0.2459:0.0	.	178	Q13796	SHRM2_HUMAN	I	178	ENSP00000370299:V178I	ENSP00000370299:V178I	V	+	1	0	SHROOM2	9822480	1.000000	0.71417	0.005000	0.12908	0.069000	0.16628	2.875000	0.48491	0.142000	0.18901	-0.268000	0.10319	GTT	-	NULL		0.602	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	protein_coding	OTTHUMT00000055721.1	G	NM_001649	-		9862480	+1	no_errors	ENST00000380913	ensembl	human	known	74_37	missense	SNP	0.932	A
FOXS1	2307	genome.wustl.edu	37	20	30432903	30432903	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr20:30432903G>T	ENST00000375978.3	-	1	517	c.443C>A	c.(442-444)aCc>aAc	p.T148N		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	148					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						CTGCCTGCCGGTCGTGGCGTT	0.692																																																	0								ENSG00000179772																																			FOXS1	SO:0001583	missense	0			-	HGNC	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.443C>A	20.37:g.30432903G>T	ENSP00000365145:p.Thr148Asn	Somatic	0	47	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q96D28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.T148N	ENST00000375978.3	37	c.443	CCDS13192.1	20	.	.	.	.	.	.	.	.	.	.	G	4.772	0.143625	0.09134	.	.	ENSG00000179772	ENST00000375978	D	0.93247	-3.19	4.47	4.47	0.54385	.	0.140624	0.32068	N	0.006628	D	0.85691	0.5755	N	0.19112	0.55	0.09310	N	1	P	0.37864	0.61	B	0.31812	0.136	T	0.75605	-0.3260	10	0.16896	T	0.51	.	15.8518	0.78937	0.0:0.0:1.0:0.0	.	148	O43638	FOXS1_HUMAN	N	148	ENSP00000365145:T148N	ENSP00000365145:T148N	T	-	2	0	FOXS1	29896564	0.608000	0.26966	0.004000	0.12327	0.027000	0.11550	5.014000	0.64029	2.327000	0.79052	0.455000	0.32223	ACC	-	NULL		0.692	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXS1	protein_coding	OTTHUMT00000078560.2	G	NM_004118	-		30432903	-1	no_errors	ENST00000375978	ensembl	human	known	74_37	missense	SNP	0.008	T
CDV3	55573	genome.wustl.edu	37	3	133292940	133292942	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr3:133292940_133292942delAAG	ENST00000264993.3	+	1	367_369	c.52_54delAAG	c.(52-54)aagdel	p.K22del	CDV3_ENST00000515421.1_5'Flank|CDV3_ENST00000431519.2_In_Frame_Del_p.K22del|CDV3_ENST00000508481.1_5'Flank|CDV3_ENST00000511392.1_5'Flank|CDV3_ENST00000420115.2_5'Flank	NM_001134422.1|NM_001282763.1|NM_017548.4	NP_001127894.1|NP_001269692.1|NP_060018.1	Q9UKY7	CDV3_HUMAN	CDV3 homolog (mouse)	22	Poly-Lys.				cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)				kidney(3)|lung(1)|prostate(1)	5						CAAGAGGGACAAGAAGAAGAAGA	0.744																																																	0								ENSG00000091527		,	27,3461		1,25,1718					,	1.8	1.0			4	68,7044		3,62,3491	no	coding,coding	CDV3	NM_017548.4,NM_001134422.1	,	4,87,5209	A1A1,A1R,RR		0.9561,0.7741,0.8962	,	,		95,10505				CDV3	SO:0001651	inframe_deletion	0				HGNC	AK096865	CCDS3079.1, CCDS46917.1, CCDS46918.1, CCDS75013.1, CCDS75014.1, CCDS75015.1	3q22.1	2008-02-05			ENSG00000091527	ENSG00000091527			26928	protein-coding gene	gene with protein product						10497265	Standard	NM_017548		Approved	H41	uc003epq.3	Q9UKY7	OTTHUMG00000159764	ENST00000264993.3:c.52_54delAAG	3.37:g.133292949_133292951delAAG	ENSP00000264993:p.Lys22del	Somatic	0	10	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00	B3KUC2|Q96IP9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.K21in_frame_del	ENST00000264993.3	37	c.52_54	CCDS3079.1	3																																																																																			-	NULL		0.744	CDV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDV3	protein_coding	OTTHUMT00000357203.1	AAG	NM_017548			133292942	+1	no_errors	ENST00000264993	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
SLC35A5	55032	genome.wustl.edu	37	3	112300024	112300024	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr3:112300024A>G	ENST00000492406.1	+	6	1343	c.1060A>G	c.(1060-1062)Agg>Ggg	p.R354G	SLC35A5_ENST00000460713.1_3'UTR	NM_017945.2	NP_060415.1	Q9BS91	S35A5_HUMAN	solute carrier family 35, member A5	354					nucleotide-sugar transport (GO:0015780)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	nucleotide-sugar transmembrane transporter activity (GO:0005338)|sugar:proton symporter activity (GO:0005351)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|skin(1)	11						CTTTGACTTCAGGCCCTCCCT	0.458																																																	0								ENSG00000138459						68.0	68.0	68.0					3																	112300024		2203	4299	6502	SLC35A5	SO:0001583	missense	0			-	HGNC	AK000737	CCDS2967.1	3q13.13	2013-05-22			ENSG00000138459	ENSG00000138459		"""Solute carriers"""	20792	protein-coding gene	gene with protein product							Standard	NM_017945		Approved	FLJ20730	uc003dze.4	Q9BS91	OTTHUMG00000159263	ENST00000492406.1:c.1060A>G	3.37:g.112300024A>G	ENSP00000417654:p.Arg354Gly	Somatic	0	39	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	D3DN66|Q69YY6|Q6ZMD6|Q9NWM9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6-2	ENST00000492406.1	37	c.590-2	CCDS2967.1	3	.	.	.	.	.	.	.	.	.	.	A	17.07	3.294178	0.60086	.	.	ENSG00000138459	ENST00000492406	T	0.45668	0.89	5.77	4.6	0.57074	.	0.282543	0.46145	D	0.000309	T	0.39064	0.1064	M	0.64997	1.995	0.41381	D	0.987555	P	0.38677	0.642	B	0.34418	0.182	T	0.24190	-1.0167	9	.	.	.	-2.2642	13.3771	0.60745	0.8685:0.1315:0.0:0.0	.	354	Q9BS91	S35A5_HUMAN	G	354	ENSP00000417654:R354G	.	R	+	1	2	SLC35A5	113782714	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.060000	0.64312	1.093000	0.41377	0.477000	0.44152	AGG	-	-		0.458	SLC35A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A5	protein_coding	OTTHUMT00000354184.1	A	NM_017945	-		112300024	+1	no_errors	ENST00000261034	ensembl	human	known	74_37	splice_site	SNP	0.998	G
DYNC1I1	1780	genome.wustl.edu	37	7	95726883	95726883	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr7:95726883G>A	ENST00000324972.6	+	17	2109	c.1916G>A	c.(1915-1917)gGc>gAc	p.G639D	DYNC1I1_ENST00000359388.4_Missense_Mutation_p.G602D|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.G622D|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.G619D|DYNC1I1_ENST00000537881.1_Intron|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.G622D	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	639					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			GAGGAGGAAGGCACTGTTGAG	0.517																																																	0								ENSG00000158560						137.0	124.0	129.0					7																	95726883		2203	4300	6503	DYNC1I1	SO:0001583	missense	0			-	HGNC	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1916G>A	7.37:g.95726883G>A	ENSP00000320130:p.Gly639Asp	Somatic	0	43	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	17	19.05	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.G639D	ENST00000324972.6	37	c.1916	CCDS5644.1	7	.	.	.	.	.	.	.	.	.	.	G	11.79	1.744512	0.30865	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T	0.71579	-0.57;-0.58;-0.58;-0.57;-0.57	5.32	4.38	0.52667	.	0.049333	0.85682	D	0.000000	T	0.49795	0.1578	N	0.13043	0.29	0.80722	D	1	B;B;B;B;B	0.23249	0.049;0.026;0.01;0.049;0.082	B;B;B;B;B	0.25291	0.027;0.041;0.025;0.027;0.059	T	0.44847	-0.9301	10	0.02654	T	1	-8.1345	14.5333	0.67942	0.0:0.0:0.8542:0.1458	.	622;619;622;639;602	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	D	622;639;619;602;622	ENSP00000392337:G622D;ENSP00000320130:G639D;ENSP00000398118:G619D;ENSP00000352348:G602D;ENSP00000412444:G622D	ENSP00000320130:G639D	G	+	2	0	DYNC1I1	95564819	1.000000	0.71417	0.923000	0.36655	0.184000	0.23303	4.537000	0.60643	2.941000	0.99782	0.655000	0.94253	GGC	-	NULL		0.517	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	protein_coding	OTTHUMT00000333432.1	G	NM_004411	-		95726883	+1	no_errors	ENST00000324972	ensembl	human	known	74_37	missense	SNP	0.990	A
PXT1	222659	genome.wustl.edu	37	6	36359683	36359683	+	Intron	SNP	T	T	G	rs528371402|rs551810823|rs199535119|rs397885267|rs536877221|rs532081573	byFrequency	TCGA-DX-AB36-01A-11D-A417-09	TCGA-DX-AB36-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7f562dc7-35c9-49e0-8e0c-0832529d5c56	93f73315-178e-4e78-bd48-5523cfe9495e	g.chr6:36359683T>G	ENST00000454782.2	-	5	784				RP1-50J22.4_ENST00000411643.1_RNA	NM_152990.3	NP_694535.2	Q8NFP0	PXT1_HUMAN	peroxisomal, testis specific 1						positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|peroxisome (GO:0005777)											CAGAGAAAGGTTTTTTTTTTT	0.318													T|||	25	0.00499201	0.0015	0.0072	5008	,	,		18219	0.0		0.003	False		,,,				2504	0.0153																0								ENSG00000224666						28.0	33.0	31.0					6																	36359683		2200	4299	6499	RP1-50J22.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF486827	CCDS4820.2	6p21.31	2004-04-30			ENSG00000179165	ENSG00000179165			18312	protein-coding gene	gene with protein product							Standard	NM_152990		Approved	STEPP	uc003omd.2	Q8NFP0	OTTHUMG00000159815	ENST00000454782.2:c.301-32A>C	6.37:g.36359683T>G		Somatic	0	59	0.00		0.5159290087996042	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	38	9.80	J3KR74	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000454782.2	37	NULL	CCDS4820.2	6																																																																																			-	-		0.318	PXT1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000224666	protein_coding	OTTHUMT00000357516.2	T	NM_152990	-		36359683	+1	no_errors	ENST00000411643	ensembl	human	known	74_37	rna	SNP	0.000	G
