#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
XIRP2	129446	genome.wustl.edu	37	2	168101135	168101135	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr2:168101135G>T	ENST00000409195.1	+	9	3322	c.3233G>T	c.(3232-3234)aGt>aTt	p.S1078I	XIRP2_ENST00000409273.1_Missense_Mutation_p.S856I|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.S1078I|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	903					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GAAACAGAAAGTAAAACTGAA	0.348																																																	0								ENSG00000163092						31.0	29.0	30.0					2																	168101135		1812	4073	5885	XIRP2	SO:0001583	missense	0			-	HGNC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.3233G>T	2.37:g.168101135G>T	ENSP00000386840:p.Ser1078Ile	Somatic	0	154	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	133	15.82	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-binding_Xin_repeat	p.S1078I	ENST00000409195.1	37	c.3233	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	1.963	-0.438475	0.04636	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02837	4.14;4.14;4.15	6.08	-0.0844	0.13690	.	0.516189	0.25151	N	0.032759	T	0.01765	0.0056	L	0.41710	1.295	0.09310	N	0.999997	B;B;B	0.33171	0.172;0.4;0.4	B;B;B	0.24269	0.023;0.052;0.052	T	0.46830	-0.9163	10	0.19147	T	0.46	-0.9751	1.8213	0.03111	0.2608:0.224:0.4002:0.1151	.	903;903;856	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	I	1078;1078;856	ENSP00000386840:S1078I;ENSP00000295237:S1078I;ENSP00000387255:S856I	ENSP00000295237:S1078I	S	+	2	0	XIRP2	167809381	0.001000	0.12720	0.625000	0.29200	0.347000	0.29111	-0.275000	0.08525	-0.295000	0.08960	-0.150000	0.13652	AGT	-	NULL		0.348	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	protein_coding	OTTHUMT00000333547.1	G	NM_152381	-		168101135	+1	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	SNP	0.001	T
PTPRVP	148713	genome.wustl.edu	37	1	202156135	202156136	+	RNA	INS	-	-	CCTCGCT	rs369231344|rs139095833|rs78957599|rs368169635	byFrequency	TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr1:202156135_202156136insCCTCGCT	ENST00000482597.1	+	0	3411_3412					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		CTGCAGGCCCCcctcgctcctc	0.639														3092	0.617412	0.3094	0.6816	5008	,	,		20478	0.6835		0.7137	False		,,,				2504	0.8211																0								ENSG00000243323																																			PTPRVP			0				HGNC	AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202156136_202156142dupCCTCGCT		Somatic	NA	NA	NA		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			-	-		0.639	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	pseudogene	OTTHUMT00000334021.1	-	XM_086287			202156136	+1	no_errors	ENST00000482597	ensembl	human	known	74_37	rna	INS	0.022:0.016	CCTCGCT
SYNJ1	8867	genome.wustl.edu	37	21	34003353	34003353	+	Silent	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr21:34003353C>T	ENST00000322229.7	-	31	4673	c.4674G>A	c.(4672-4674)acG>acA	p.T1558T	SYNJ1_ENST00000382499.2_3'UTR|SYNJ1_ENST00000357345.3_3'UTR|SYNJ1_ENST00000382491.3_Silent_p.T1511T|SYNJ1_ENST00000433931.2_Silent_p.T1597T			O43426	SYNJ1_HUMAN	synaptojanin 1	1558	Pro-rich.				cell death (GO:0008219)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of synaptic vesicle uncoating (GO:1903390)|regulation of synaptic vesicle membrane organization (GO:1901632)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)	cytosol (GO:0005829)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|lung(11)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	57						AGGCCAAGGTCGTGAAAGGAT	0.522																																																	0								ENSG00000159082						88.0	85.0	86.0					21																	34003353		2203	4300	6503	SYNJ1	SO:0001819	synonymous_variant	0			-	HGNC	AF009040	CCDS33539.1, CCDS33540.1, CCDS33539.2, CCDS33540.2, CCDS54483.1	21q22.2	2008-06-23			ENSG00000159082	ENSG00000159082			11503	protein-coding gene	gene with protein product		604297				9428629, 10773674	Standard	NM_203446		Approved	INPP5G	uc002yqh.2	O43426	OTTHUMG00000064926	ENST00000322229.7:c.4674G>A	21.37:g.34003353C>T		Somatic	0	50	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	43	21.82	O43425|O94984|Q4KMR1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Syja_N,pfam_Endo/exonuclease/phosphatase,pfam_DUF1866,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.T1597	ENST00000322229.7	37	c.4791	CCDS54484.1	21	.	.	.	.	.	.	.	.	.	.	C	4.014	0.000066	0.07819	.	.	ENSG00000159082	ENST00000479254;ENST00000490462	.	.	.	5.61	-7.61	0.01299	.	.	.	.	.	T	0.18383	0.0441	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	T	0.28713	-1.0035	4	.	.	.	.	4.6309	0.12500	0.2019:0.0793:0.4832:0.2356	.	.	.	.	Q	73	.	.	R	-	2	0	SYNJ1	32925224	0.000000	0.05858	0.001000	0.08648	0.756000	0.42949	-1.368000	0.02580	-1.078000	0.03117	-2.382000	0.00231	CGA	-	NULL		0.522	SYNJ1-201	KNOWN	basic|CCDS	protein_coding	SYNJ1	protein_coding		C		-		34003353	-1	no_errors	ENST00000433931	ensembl	human	known	74_37	silent	SNP	0.000	T
NOB1	28987	genome.wustl.edu	37	16	69783471	69783471	+	Silent	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr16:69783471C>T	ENST00000268802.5	-	4	419	c.390G>A	c.(388-390)ctG>ctA	p.L130L		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	130					visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CCTTGTAGGGCAGATGGAAAC	0.388																																																	0								ENSG00000141101						96.0	88.0	91.0					16																	69783471		2198	4300	6498	NOB1	SO:0001819	synonymous_variant	0			-	HGNC	AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.390G>A	16.37:g.69783471C>T		Somatic	0	89	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	108	26.53	Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NOB1_Zn-bd,smart_PIN_dom,pirsf_D-site_20S_pre-rRNA_nuclease	p.L130	ENST00000268802.5	37	c.390	CCDS10884.1	16																																																																																			-	pirsf_D-site_20S_pre-rRNA_nuclease		0.388	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOB1	protein_coding	OTTHUMT00000268958.2	C	NM_014062	-		69783471	-1	no_errors	ENST00000268802	ensembl	human	known	74_37	silent	SNP	0.997	T
HMCES	56941	genome.wustl.edu	37	3	129017344	129017344	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr3:129017344G>A	ENST00000383463.4	+	5	690	c.601G>A	c.(601-603)Gat>Aat	p.D201N	HMCES_ENST00000417226.2_Missense_Mutation_p.D159N|HMCES_ENST00000502878.2_Missense_Mutation_p.D201N|HMCES_ENST00000389735.3_Missense_Mutation_p.D201N	NM_020187.2	NP_064572.2	Q96FZ2	HMCES_HUMAN	5-hydroxymethylcytosine (hmC) binding, ES cell-specific	201							DNA binding (GO:0003677)|peptidase activity (GO:0008233)										CATCACAGTGGATTCCTGCAA	0.507																																																	0								ENSG00000183624						96.0	82.0	86.0					3																	129017344		2203	4300	6503	HMCES	SO:0001583	missense	0			-	HGNC	AF201934	CCDS33852.1	3q21.3	2013-08-30	2013-08-30	2013-08-30	ENSG00000183624	ENSG00000183624			24446	protein-coding gene	gene with protein product	"""SOS response associated peptidase domain containing 1"""		"""chromosome 3 open reading frame 37"""	C3orf37		23434322, 23945014	Standard	XM_005247636		Approved	DC12, SRAPD1	uc003elt.3	Q96FZ2	OTTHUMG00000159452	ENST00000383463.4:c.601G>A	3.37:g.129017344G>A	ENSP00000372955:p.Asp201Asn	Somatic	0	29	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	52	17.46	A6NJR9|Q96G34|Q9NRP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF159,superfamily_DUF159	p.D201N	ENST00000383463.4	37	c.601	CCDS33852.1	3	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026862	0.54683	.	.	ENSG00000183624	ENST00000509042;ENST00000383463;ENST00000417226;ENST00000510314;ENST00000502878;ENST00000389735;ENST00000509551;ENST00000511665	.	.	.	4.73	3.84	0.44239	.	0.263817	0.42053	D	0.000765	T	0.51160	0.1658	L	0.51853	1.615	0.46203	D	0.998927	B;B	0.31485	0.325;0.281	B;B	0.35655	0.198;0.207	T	0.53034	-0.8495	9	0.41790	T	0.15	-15.5732	9.919	0.41453	0.1004:0.0:0.8996:0.0	.	159;201	E7EMP6;Q96FZ2	.;CC037_HUMAN	N	153;201;159;111;201;201;201;111	.	ENSP00000372955:D201N	D	+	1	0	C3orf37	130500034	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.933000	0.56545	2.165000	0.68154	0.585000	0.79938	GAT	-	pfam_DUF159,superfamily_DUF159		0.507	HMCES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCES	protein_coding	OTTHUMT00000355470.2	G	NM_020187	-		129017344	+1	no_errors	ENST00000383463	ensembl	human	known	74_37	missense	SNP	1.000	A
KRTAP2-2	728279	genome.wustl.edu	37	17	39211139	39211140	+	In_Frame_Ins	INS	-	-	GCAGGGGGGCCGGCA	rs9674636		TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:39211139_39211140insGCAGGGGGGCCGGCA	ENST00000398477.1	-	1	342_343	c.324_325insTGCCGGCCCCCCTGC	c.(322-327)tgcggc>tgcTGCCGGCCCCCCTGCggc	p.107_108insCCRPP	KRTAP2-2_ENST00000542910.1_In_Frame_Ins_p.107_108insCCRPP	NM_033032.2	NP_149021.2	Q9BYT5	KRA22_HUMAN	keratin associated protein 2-2	107	11 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											GTCGGCTGGCCGCAGGGGGACT	0.703																																																	0								ENSG00000214518			369,641		167,35,303						3.3	1.0			2	525,2849		188,149,1350	no	coding	KRTAP2-2	NM_033032.2		355,184,1653	A1A1,A1R,RR		15.5602,36.5347,20.3923				894,3490				KRTAP2-2	SO:0001652	inframe_insertion	0				HGNC	AJ302536	CCDS32648.1, CCDS54122.1	17q21.2	2013-06-25			ENSG00000214518	ENSG00000214518		"""Keratin associated proteins"""	18905	protein-coding gene	gene with protein product							Standard	NM_033032		Approved	KAP2.2	uc010cxj.3	Q9BYT5	OTTHUMG00000133593	ENST00000398477.1:c.324_325insTGCCGGCCCCCCTGC	17.37:g.39211139_39211140insGCAGGGGGGCCGGCA	ENSP00000381494:p.Pro107_Cys108insCysCysArgProPro	Somatic	NA	NA	NA		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MTN3|A8MXM4	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Keratin-assoc	p.108in_frame_insCRPPC	ENST00000398477.1	37	c.325_324	CCDS54122.1	17																																																																																			-	NULL		0.703	KRTAP2-2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KRTAP2-2	protein_coding	OTTHUMT00000257697.1	-				39211140	-1	no_errors	ENST00000542910	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	GCAGGGGGGCCGGCA
ESX1	80712	genome.wustl.edu	37	X	103495558	103495558	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chrX:103495558C>A	ENST00000372588.4	-	4	655	c.572G>T	c.(571-573)aGa>aTa	p.R191I		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	191					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						CCACTTGGCTCTTCTGTTCTG	0.403																																					Pancreas(200;1705 2227 25194 28471 45274)												0								ENSG00000123576						125.0	108.0	114.0					X																	103495558		2203	4300	6503	ESX1	SO:0001583	missense	0			-	HGNC	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.572G>T	X.37:g.103495558C>A	ENSP00000361669:p.Arg191Ile	Somatic	0	31	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	8	50.00	B0QYU3|Q7Z6K7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU	p.R191I	ENST00000372588.4	37	c.572	CCDS14516.1	X	.	.	.	.	.	.	.	.	.	.	C	11.91	1.778347	0.31502	.	.	ENSG00000123576	ENST00000372588	D	0.99311	-5.73	4.96	4.09	0.47781	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	.	.	.	.	D	0.99588	0.9851	H	0.98594	4.275	0.51233	D	0.999917	D	0.89917	1.0	D	0.81914	0.995	D	0.98321	1.0528	9	0.87932	D	0	-16.3936	8.5398	0.33386	0.0:0.8105:0.0:0.1895	.	191	Q8N693	ESX1_HUMAN	I	191	ENSP00000361669:R191I	ENSP00000361669:R191I	R	-	2	0	ESX1	103382214	1.000000	0.71417	0.046000	0.18839	0.031000	0.12232	3.425000	0.52771	1.158000	0.42547	-0.192000	0.12808	AGA	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.403	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	protein_coding	OTTHUMT00000057763.2	C	NM_153448	-		103495558	-1	no_errors	ENST00000372588	ensembl	human	known	74_37	missense	SNP	0.885	A
SLCO6A1	133482	genome.wustl.edu	37	5	101834502	101834502	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr5:101834502G>C	ENST00000506729.1	-	1	218	c.47C>G	c.(46-48)tCa>tGa	p.S16*	SLCO6A1_ENST00000379807.3_Nonsense_Mutation_p.S16*|SLCO6A1_ENST00000379810.1_Nonsense_Mutation_p.S16*|SLCO6A1_ENST00000389019.3_Nonsense_Mutation_p.S16*|RP11-58B2.1_ENST00000502494.1_RNA|SLCO6A1_ENST00000513675.1_Nonsense_Mutation_p.S16*|SLCO6A1_ENST00000514551.1_5'Flank			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	16						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		TACTCCCCTTGAGACTTCATC	0.687																																																	0								ENSG00000205359						74.0	86.0	82.0					5																	101834502		2202	4294	6496	SLCO6A1	SO:0001587	stop_gained	0			-	HGNC	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.47C>G	5.37:g.101834502G>C	ENSP00000421339:p.Ser16*	Somatic	0	62	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	79	18.56	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.S16*	ENST00000506729.1	37	c.47	CCDS34206.1	5	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444464	0.63178	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019;ENST00000513675;ENST00000379810	.	.	.	3.21	-6.41	0.01938	.	41.129500	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	2.0193	0.03505	0.3196:0.1755:0.3771:0.1278	.	.	.	.	X	16	.	ENSP00000369135:S16X	S	-	2	0	SLCO6A1	101862401	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.346000	0.01096	-4.114000	0.00072	-0.680000	0.03767	TCA	-	NULL		0.687	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO6A1	protein_coding	OTTHUMT00000370335.1	G	NM_173488	-		101834502	-1	no_errors	ENST00000379807	ensembl	human	known	74_37	nonsense	SNP	0.000	C
NOB1	28987	genome.wustl.edu	37	16	69782853	69782853	+	Missense_Mutation	SNP	C	C	T	rs543289898		TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr16:69782853C>T	ENST00000268802.5	-	6	723	c.694G>A	c.(694-696)Gtt>Att	p.V232I		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	232					visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						AGGCAGCCAACCCGCACGTCC	0.617													C|||	1	0.000199681	0.0	0.0	5008	,	,		18814	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000141101																																			NOB1	SO:0001583	missense	0			-	HGNC	AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.694G>A	16.37:g.69782853C>T	ENSP00000268802:p.Val232Ile	Somatic	0	24	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	39	25.00	Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e3+1	ENST00000268802.5	37	c.201+1	CCDS10884.1	16	.	.	.	.	.	.	.	.	.	.	C	16.94	3.259792	0.59321	.	.	ENSG00000141101	ENST00000268802	T	0.43294	0.95	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.66925	0.2839	M	0.77712	2.385	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	T	0.67197	-0.5731	9	.	.	.	.	18.9662	0.92697	0.0:1.0:0.0:0.0	.	232	Q9ULX3	NOB1_HUMAN	I	232	ENSP00000268802:V232I	.	V	-	1	0	NOB1	68340354	1.000000	0.71417	0.995000	0.50966	0.365000	0.29674	7.466000	0.80914	2.647000	0.89833	0.585000	0.79938	GTT	-	-		0.617	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOB1	protein_coding	OTTHUMT00000268958.2	C	NM_014062	-		69782853	-1	no_errors	ENST00000569871	ensembl	human	known	74_37	splice_site	SNP	0.997	T
TRIO	7204	genome.wustl.edu	37	5	14368832	14368832	+	Missense_Mutation	SNP	G	G	A	rs139892017		TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr5:14368832G>A	ENST00000344204.4	+	17	2914	c.2890G>A	c.(2890-2892)Gcg>Acg	p.A964T	TRIO_ENST00000509967.2_Missense_Mutation_p.A915T|TRIO_ENST00000537187.1_Missense_Mutation_p.A964T	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	964					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					ACATCAGAGCGCGCTGCAGGT	0.532																																																	0								ENSG00000038382	G	THR/ALA	0,4406		0,0,2203	82.0	76.0	78.0		2890	5.8	0.2	5	dbSNP_134	78	1,8599	1.2+/-3.3	0,1,4299	no	missense	TRIO	NM_007118.2	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	964/3098	14368832	1,13005	2203	4300	6503	TRIO	SO:0001583	missense	0			-	HGNC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2890G>A	5.37:g.14368832G>A	ENSP00000339299:p.Ala964Thr	Somatic	0	19	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.A964T	ENST00000344204.4	37	c.2890	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	G	22.5	4.297314	0.81025	0.0	1.16E-4	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.50277	0.75;0.75;0.75	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.69396	0.3106	M	0.67397	2.05	0.80722	D	1	P;D;D	0.89917	0.903;0.982;1.0	B;P;D	0.85130	0.408;0.778;0.997	T	0.68625	-0.5359	10	0.54805	T	0.06	.	20.0139	0.97470	0.0:0.0:1.0:0.0	.	915;964;964	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	T	964;964;915;651	ENSP00000339299:A964T;ENSP00000446348:A964T;ENSP00000445592:A915T	ENSP00000339299:A964T	A	+	1	0	TRIO	14421832	1.000000	0.71417	0.159000	0.22649	0.910000	0.53928	8.016000	0.88706	2.724000	0.93272	0.563000	0.77884	GCG	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.532	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	protein_coding	OTTHUMT00000253711.2	G	NM_007118	rs139892017		14368832	+1	no_errors	ENST00000344204	ensembl	human	known	74_37	missense	SNP	1.000	A
CEP152	22995	genome.wustl.edu	37	15	49074367	49074367	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr15:49074367G>A	ENST00000380950.2	-	11	1569	c.1382C>T	c.(1381-1383)gCt>gTt	p.A461V	CEP152_ENST00000399334.3_Missense_Mutation_p.A461V|CEP152_ENST00000325747.5_Missense_Mutation_p.A368V|RP11-485O10.2_ENST00000558304.1_RNA	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	461					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TGCACTCATAGCATGTGCCTT	0.443																																																	0								ENSG00000103995						96.0	94.0	95.0					15																	49074367		2001	4189	6190	CEP152	SO:0001583	missense	0			-	HGNC	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.1382C>T	15.37:g.49074367G>A	ENSP00000370337:p.Ala461Val	Somatic	0	36	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A461V	ENST00000380950.2	37	c.1382	CCDS58361.1	15	.	.	.	.	.	.	.	.	.	.	G	11.35	1.612305	0.28712	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334;ENST00000541880	T;T;T	0.21543	2.0;2.0;2.0	5.82	3.91	0.45181	.	0.707928	0.14463	N	0.318063	T	0.09730	0.0239	N	0.17474	0.49	0.09310	N	1	B;B;B	0.20052	0.001;0.041;0.001	B;B;B	0.12156	0.003;0.007;0.003	T	0.38607	-0.9653	10	0.08837	T	0.75	2.3231	3.7673	0.08627	0.2791:0.0:0.5488:0.1721	.	368;461;461	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	V	461;368;461;461	ENSP00000370337:A461V;ENSP00000321000:A368V;ENSP00000382271:A461V	ENSP00000321000:A368V	A	-	2	0	CEP152	46861659	0.000000	0.05858	0.001000	0.08648	0.884000	0.51177	0.358000	0.20216	0.750000	0.32877	0.655000	0.94253	GCT	-	NULL		0.443	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	protein_coding	OTTHUMT00000417365.1	G	NM_014985	-		49074367	-1	no_errors	ENST00000380950	ensembl	human	known	74_37	missense	SNP	0.001	A
MSH3	4437	genome.wustl.edu	37	5	79950742	79950750	+	In_Frame_Del	DEL	CCCCCAGCT	CCCCCAGCT	-	rs144629981|rs3045983|rs557874766|rs1047489	byFrequency	TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	CCCCCAGCT	CCCCCAGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr5:79950742_79950750delCCCCCAGCT	ENST00000265081.6	+	1	276_284	c.196_204delCCCCCAGCT	c.(196-204)cccccagctdel	p.PPA66del	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	66					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		gCCCCCAGCGCCCCCAGCTCCCGCCTTCC	0.732								Mismatch excision repair (MMR)						1174	0.234425	0.2874	0.2061	5008	,	,		7173	0.0565		0.2535	False		,,,				2504	0.3466				Melanoma(88;1010 1399 13793 26548 36275)												0								ENSG00000113318		,	1105,2179		342,421,879					,	4.0	1.0		dbSNP_102	4	1941,4615		567,807,1904	no	coding,utr-5	DHFR,MSH3	NM_002439.3,NM_000791.3	,	909,1228,2783	A1A1,A1R,RR		29.6065,33.648,30.9553	,	,		3046,6794				MSH3	SO:0001651	inframe_deletion	0				HGNC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.196_204delCCCCCAGCT	5.37:g.79950742_79950750delCCCCCAGCT	ENSP00000265081:p.Pro66_Ala68del	Somatic	NA	NA	NA		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.PAP67in_frame_del	ENST00000265081.6	37	c.196_204	CCDS34195.1	5																																																																																			-	NULL		0.732	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	protein_coding	OTTHUMT00000369471.1	CCCCCAGCT	NM_002439			79950750	+1	no_errors	ENST00000265081	ensembl	human	known	74_37	in_frame_del	DEL	0.890:0.802:0.715:0.628:0.541:0.455:0.369:0.282:0.196	-
NOB1	28987	genome.wustl.edu	37	16	69782876	69782876	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr16:69782876C>T	ENST00000268802.5	-	6	700	c.671G>A	c.(670-672)tGt>tAt	p.C224Y		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	224					visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GGGGACGTCACACTGCTCCAG	0.597																																																	0								ENSG00000141101						90.0	65.0	74.0					16																	69782876		2198	4300	6498	NOB1	SO:0001583	missense	0			-	HGNC	AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.671G>A	16.37:g.69782876C>T	ENSP00000268802:p.Cys224Tyr	Somatic	0	26	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	37	27.45	Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NOB1_Zn-bd,smart_PIN_dom,pirsf_D-site_20S_pre-rRNA_nuclease	p.C224Y	ENST00000268802.5	37	c.671	CCDS10884.1	16	.	.	.	.	.	.	.	.	.	.	C	0.034	-1.317369	0.01331	.	.	ENSG00000141101	ENST00000268802	T	0.29142	1.58	5.33	3.34	0.38264	.	0.279681	0.43579	N	0.000544	T	0.12987	0.0315	N	0.03608	-0.345	0.27335	N	0.95667	B	0.02656	0.0	B	0.04013	0.001	T	0.18116	-1.0347	9	.	.	.	.	12.1277	0.53926	0.0:0.8512:0.0:0.1488	.	224	Q9ULX3	NOB1_HUMAN	Y	224	ENSP00000268802:C224Y	.	C	-	2	0	NOB1	68340377	0.488000	0.25996	0.612000	0.29024	0.091000	0.18340	1.871000	0.39539	1.378000	0.46305	0.585000	0.79938	TGT	-	pirsf_D-site_20S_pre-rRNA_nuclease		0.597	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOB1	protein_coding	OTTHUMT00000268958.2	C	NM_014062	-		69782876	-1	no_errors	ENST00000268802	ensembl	human	known	74_37	missense	SNP	0.399	T
MED12	9968	genome.wustl.edu	37	X	70350024	70350024	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chrX:70350024G>T	ENST00000374080.3	+	28	4039	c.4007G>T	c.(4006-4008)gGg>gTg	p.G1336V	MED12_ENST00000374102.1_Missense_Mutation_p.G1336V|MED12_ENST00000333646.6_Missense_Mutation_p.G1336V			Q93074	MED12_HUMAN	mediator complex subunit 12	1336					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AATGAGGATGGGGAAAACCCC	0.582			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0								ENSG00000184634						37.0	35.0	36.0					X																	70350024		1993	4160	6153	MED12	SO:0001583	missense	0			-	HGNC	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4007G>T	X.37:g.70350024G>T	ENSP00000363193:p.Gly1336Val	Somatic	0	43	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.G1336V	ENST00000374080.3	37	c.4007	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	G	19.10	3.761125	0.69763	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	D;D;D;D;T	0.83506	-1.73;-1.73;-1.73;-1.73;1.31	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.89153	0.6634	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.65815	0.995;0.99;0.988;0.991	D;P;D;P	0.63488	0.915;0.841;0.914;0.874	D	0.90009	0.4120	10	0.62326	D	0.03	-13.2922	17.6046	0.88034	0.0:0.0:1.0:0.0	.	1336;1183;1336;1336	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	V	1336;1336;1336;1336;1304;81	ENSP00000333125:G1336V;ENSP00000363215:G1336V;ENSP00000363193:G1336V;ENSP00000414203:G1304V;ENSP00000408388:G81V	ENSP00000333125:G1336V	G	+	2	0	MED12	70266749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.410000	0.80065	2.430000	0.82344	0.544000	0.68410	GGG	-	NULL		0.582	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	protein_coding	OTTHUMT00000057105.1	G	NM_005120	-		70350024	+1	no_errors	ENST00000333646	ensembl	human	known	74_37	missense	SNP	1.000	T
CD163L1	283316	genome.wustl.edu	37	12	7559146	7559146	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr12:7559146C>T	ENST00000313599.3	-	5	1126	c.1069G>A	c.(1069-1071)Gtg>Atg	p.V357M	CD163L1_ENST00000396630.1_Missense_Mutation_p.V357M|CD163L1_ENST00000416109.2_Missense_Mutation_p.V367M			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	357	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						ATCACAGACACATCGTTTTGA	0.408																																																	0								ENSG00000177675						79.0	72.0	75.0					12																	7559146		2203	4300	6503	CD163L1	SO:0001583	missense	0			-	HGNC	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.1069G>A	12.37:g.7559146C>T	ENSP00000315945:p.Val357Met	Somatic	0	63	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	52	10.34	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.V357M	ENST00000313599.3	37	c.1069	CCDS8577.1	12	.	.	.	.	.	.	.	.	.	.	C	17.93	3.509254	0.64522	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.39787	1.06;1.06;1.06	1.75	1.75	0.24633	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.60327	0.2260	M	0.83312	2.635	0.28937	N	0.891218	D;D	0.65815	0.995;0.995	P;P	0.60789	0.879;0.879	T	0.55321	-0.8159	9	0.87932	D	0	.	9.4486	0.38712	0.0:1.0:0.0:0.0	.	367;357	E7EVK4;Q9NR16	.;C163B_HUMAN	M	357;367;357	ENSP00000315945:V357M;ENSP00000393474:V367M;ENSP00000379871:V357M	ENSP00000315945:V357M	V	-	1	0	CD163L1	7450413	0.742000	0.28228	0.014000	0.15608	0.581000	0.36288	3.225000	0.51246	1.263000	0.44181	0.305000	0.20034	GTG	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.408	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	protein_coding	OTTHUMT00000399329.1	C	NM_174941	-		7559146	-1	no_errors	ENST00000313599	ensembl	human	known	74_37	missense	SNP	0.960	T
CAPRIN2	65981	genome.wustl.edu	37	12	30884415	30884415	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr12:30884415A>C	ENST00000395805.2	-	6	1469	c.922T>G	c.(922-924)Ttg>Gtg	p.L308V	CAPRIN2_ENST00000251071.5_Missense_Mutation_p.L308V|CAPRIN2_ENST00000538387.1_Intron|CAPRIN2_ENST00000417045.1_Missense_Mutation_p.L308V|CAPRIN2_ENST00000308433.5_5'UTR|CAPRIN2_ENST00000298892.5_Missense_Mutation_p.L308V	NM_001206856.1	NP_001193785.1			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GAGTTCAGCAATTTAGACAGT	0.348																																																	0								ENSG00000110888						110.0	106.0	107.0					12																	30884415		2203	4300	6503	CAPRIN2	SO:0001583	missense	0			-	HGNC	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000395805.2:c.922T>G	12.37:g.30884415A>C	ENSP00000379150:p.Leu308Val	Somatic	0	60	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	45	19.64		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Caprin-1_C,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.L308V	ENST00000395805.2	37	c.922	CCDS55816.1	12	.	.	.	.	.	.	.	.	.	.	A	15.47	2.844267	0.51164	.	.	ENSG00000110888	ENST00000433722;ENST00000298892;ENST00000395805;ENST00000251071;ENST00000417045;ENST00000438006;ENST00000537108	T;T;T;T;T;T	0.22134	2.15;1.97;1.97;1.97;1.97;1.97	5.43	1.7	0.24286	.	0.074415	0.51477	D	0.000084	T	0.23649	0.0572	N	0.20530	0.585	0.80722	D	1	D;D;D;D;D	0.89917	0.997;1.0;0.99;0.997;0.997	D;D;P;D;D	0.79108	0.95;0.992;0.908;0.969;0.954	T	0.03673	-1.1014	10	0.26408	T	0.33	-6.1537	7.0163	0.24890	0.5972:0.0:0.4028:0.0	.	308;308;308;308;308	Q149P6;Q6IMN6-3;Q6IMN6;Q6IMN6-2;E4NKG2	.;.;CAPR2_HUMAN;.;.	V	54;308;308;308;308;34;227	ENSP00000415407:L54V;ENSP00000298892:L308V;ENSP00000379150:L308V;ENSP00000251071:L308V;ENSP00000391479:L308V;ENSP00000438010:L227V	ENSP00000251071:L308V	L	-	1	2	CAPRIN2	30775682	0.843000	0.29541	0.999000	0.59377	0.995000	0.86356	0.564000	0.23563	0.349000	0.23975	0.528000	0.53228	TTG	-	NULL		0.348	CAPRIN2-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	CAPRIN2	protein_coding	OTTHUMT00000403322.2	A	NM_023925	-		30884415	-1	no_errors	ENST00000251071	ensembl	human	known	74_37	missense	SNP	0.998	C
WIF1	11197	genome.wustl.edu	37	12	65448915	65448915	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr12:65448915C>A	ENST00000286574.4	-	9	1375	c.1001G>T	c.(1000-1002)gGa>gTa	p.G334V		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	334	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		GCAGTGTCTTCCATGCCAACC	0.413			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)			Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	0								ENSG00000156076						95.0	88.0	90.0					12																	65448915		2203	4300	6503	WIF1	SO:0001583	missense	0			-	HGNC	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.1001G>T	12.37:g.65448915C>A	ENSP00000286574:p.Gly334Val	Somatic	0	38	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WIF,pfam_EGF_extracell,smart_WIF,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_WIF,prints_Wnt-inh	p.G334V	ENST00000286574.4	37	c.1001	CCDS8971.1	12	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404493	0.83230	.	.	ENSG00000156076	ENST00000286574;ENST00000543094	D;D	0.99984	-11.61;-1.98	5.71	5.71	0.89125	EGF, extracellular (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99988	0.9998	H	0.95539	3.685	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99975	1.2154	9	.	.	.	.	20.2344	0.98354	0.0:1.0:0.0:0.0	.	334	Q9Y5W5	WIF1_HUMAN	V	334;83	ENSP00000286574:G334V;ENSP00000439024:G83V	.	G	-	2	0	WIF1	63735182	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.420000	0.73349	2.854000	0.98071	0.655000	0.94253	GGA	-	pfam_EGF_extracell,smart_EG-like_dom,pfscan_EG-like_dom		0.413	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIF1	protein_coding	OTTHUMT00000401258.2	C		-		65448915	-1	no_errors	ENST00000286574	ensembl	human	known	74_37	missense	SNP	1.000	A
TUT1	64852	genome.wustl.edu	37	11	62342591	62342591	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr11:62342591delG	ENST00000476907.1	-	9	3291	c.2600delC	c.(2599-2601)cctfs	p.P867fs	TUT1_ENST00000308436.7_Frame_Shift_Del_p.P905fs|EEF1G_ENST00000329251.4_5'Flank|EEF1G_ENST00000378019.3_5'Flank|EEF1G_ENST00000532986.1_5'Flank|MIR3654_ENST00000496634.2_Intron			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	867					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AATTGCTTGAGGGAGGAAAAC	0.507																																																	0								ENSG00000149016						53.0	55.0	54.0					11																	62342591		2202	4299	6501	TUT1	SO:0001589	frameshift_variant	0				HGNC	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.2600delC	11.37:g.62342591delG	ENSP00000419607:p.Pro867fs	Somatic	0	67	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	50	28.57	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PAP_assoc,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P905fs	ENST00000476907.1	37	c.2714		11																																																																																			-	NULL		0.507	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	TUT1	protein_coding	OTTHUMT00000351319.2	G	NM_022830			62342591	-1	no_errors	ENST00000308436	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ADAM12	8038	genome.wustl.edu	37	10	127824045	127824045	+	Intron	DEL	G	G	-	rs397846023|rs35220394	byFrequency	TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr10:127824045delG	ENST00000368679.4	-	5	735				ADAM12_ENST00000368676.4_Intron	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12						cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TAGCTGAGCTGGGAGCCCCCA	0.562													GGG|GGG|GG|deletion	472	0.0942492	0.0499	0.1254	5008	,	,		17274	0.0546		0.2008	False		,,,				2504	0.0634																0								ENSG00000148848																																			ADAM12	SO:0001627	intron_variant	0				HGNC	AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.425+107C>-	10.37:g.127824045delG		Somatic	0	9	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	5	61.54	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368679.4	37	NULL	CCDS7653.1	10																																																																																			-	-		0.562	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	protein_coding	OTTHUMT00000050961.1	G				127824045	-1	no_errors	ENST00000494661	ensembl	human	known	74_37	rna	DEL	0.021	-
SCARA5	286133	genome.wustl.edu	37	8	27729476	27729476	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr8:27729476G>A	ENST00000354914.3	-	9	1948	c.1463C>T	c.(1462-1464)gCc>gTc	p.A488V	SCARA5_ENST00000380385.2_Missense_Mutation_p.A263V	NM_173833.5	NP_776194.2	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	488	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cellular iron ion homeostasis (GO:0006879)|cellular response to heat (GO:0034605)|endocytosis (GO:0006897)|iron ion transmembrane transport (GO:0034755)|protein homotrimerization (GO:0070207)|receptor-mediated endocytosis (GO:0006898)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)	ferritin receptor activity (GO:0070287)|scavenger receptor activity (GO:0005044)			central_nervous_system(1)|large_intestine(6)|lung(5)|prostate(3)|skin(3)	18		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		TGTCACGCTGGCATCTTCGGC	0.587																																																	0								ENSG00000168079						154.0	114.0	127.0					8																	27729476		2203	4300	6503	SCARA5	SO:0001583	missense	0			-	HGNC	AK172746	CCDS6064.1	8p21.1	2014-07-08	2014-07-08		ENSG00000168079	ENSG00000168079			28701	protein-coding gene	gene with protein product		611306	"""scavenger receptor class A, member 5 (putative)"""			19154717	Standard	NM_173833		Approved	FLJ23907, MGC45780, NET33	uc003xgj.3	Q6ZMJ2	OTTHUMG00000132172	ENST00000354914.3:c.1463C>T	8.37:g.27729476G>A	ENSP00000346990:p.Ala488Val	Somatic	0	46	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q6UXZ1|Q7Z4A1|Q8N4Z7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,pfam_Collagen,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_SRCR,pfscan_SRCR	p.A488V	ENST00000354914.3	37	c.1463	CCDS6064.1	8	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167233	0.57476	.	.	ENSG00000168079	ENST00000354914;ENST00000380385	T;T	0.36878	1.23;1.23	5.93	5.93	0.95920	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.060792	0.64402	D	0.000004	T	0.50616	0.1626	L	0.28776	0.89	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.91635	0.994;0.999	T	0.49103	-0.8974	10	0.66056	D	0.02	.	17.8376	0.88704	0.0:0.0:1.0:0.0	.	263;488	Q6ZMJ2-4;Q6ZMJ2	.;SCAR5_HUMAN	V	488;263	ENSP00000346990:A488V;ENSP00000369746:A263V	ENSP00000346990:A488V	A	-	2	0	SCARA5	27785395	1.000000	0.71417	0.960000	0.40013	0.017000	0.09413	7.935000	0.87658	2.815000	0.96918	0.561000	0.74099	GCC	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_SRCR,pfscan_SRCR		0.587	SCARA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARA5	protein_coding	OTTHUMT00000255223.2	G	NM_173833	-		27729476	-1	no_errors	ENST00000354914	ensembl	human	known	74_37	missense	SNP	1.000	A
STK24	8428	genome.wustl.edu	37	13	99171640	99171655	+	Frame_Shift_Del	DEL	TGTCAATGCCTTTGAA	TGTCAATGCCTTTGAA	-			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	TGTCAATGCCTTTGAA	TGTCAATGCCTTTGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr13:99171640_99171655delTGTCAATGCCTTTGAA	ENST00000376547.3	-	2	296_311	c.151_166delTTCAAAGGCATTGACA	c.(151-168)ttcaaaggcattgacaatfs	p.FKGIDN51fs	STK24_ENST00000481288.1_5'UTR|STK24_ENST00000539966.1_Frame_Shift_Del_p.FKGIDN39fs|STK24_ENST00000397517.2_Frame_Shift_Del_p.FKGIDN39fs	NM_003576.3	NP_003567.2	Q9Y6E0	STK24_HUMAN	serine/threonine kinase 24	51	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of cell migration (GO:0030336)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of axon regeneration (GO:0048679)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	17	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TGAGTCCGATTGTCAATGCCTTTGAACACCTCTCCA	0.426																																																	0								ENSG00000102572																																			STK24	SO:0001589	frameshift_variant	0				HGNC	AF024636	CCDS9488.1, CCDS32001.1, CCDS66573.1	13q31.2-q32.3	2010-06-25	2010-06-25		ENSG00000102572	ENSG00000102572			11403	protein-coding gene	gene with protein product	"""STE20-like kinase 3"", ""sterile 20-like kinase 3"""	604984	"""serine/threonine kinase 24 (Ste20, yeast homolog)"""			9353338, 10644707	Standard	NM_003576		Approved	MST-3, MST3, MST3B, STK3, STE20	uc001vnn.1	Q9Y6E0	OTTHUMG00000017250	ENST00000376547.3:c.151_166delTTCAAAGGCATTGACA	13.37:g.99171640_99171655delTGTCAATGCCTTTGAA	ENSP00000365730:p.Phe51fs	Somatic	NA	NA	NA		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O14840|Q5JV92	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F51fs	ENST00000376547.3	37	c.166_151	CCDS9488.1	13																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.426	STK24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STK24	protein_coding	OTTHUMT00000045549.2	TGTCAATGCCTTTGAA	NM_003576			99171655	-1	no_errors	ENST00000376547	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
PPP2R5C	5527	genome.wustl.edu	37	14	102368201	102368201	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr14:102368201A>C	ENST00000334743.5	+	9	1046	c.998A>C	c.(997-999)aAa>aCa	p.K333T	PPP2R5C_ENST00000422945.2_Missense_Mutation_p.K364T|PPP2R5C_ENST00000557095.1_Missense_Mutation_p.K333T|PPP2R5C_ENST00000328724.5_Missense_Mutation_p.K388T|PPP2R5C_ENST00000445439.3_Missense_Mutation_p.K333T|PPP2R5C_ENST00000350249.3_Missense_Mutation_p.K333T	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	333					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CAGTTGGCCAAATGTGTCTCC	0.433																																																	0								ENSG00000078304						61.0	65.0	64.0					14																	102368201		2203	4300	6503	PPP2R5C	SO:0001583	missense	0			-	HGNC	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.998A>C	14.37:g.102368201A>C	ENSP00000333905:p.Lys333Thr	Somatic	0	67	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	56	30.86	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.K364T	ENST00000334743.5	37	c.1091	CCDS9964.1	14	.	.	.	.	.	.	.	.	.	.	A	19.40	3.820161	0.71028	.	.	ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000334756;ENST00000445439;ENST00000334743;ENST00000557095;ENST00000557716	T;T;T;T;T	0.51325	0.73;0.71;0.73;0.73;0.74	5.3	5.3	0.74995	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64114	0.2569	M	0.83384	2.64	0.80722	D	1	P;B;P;P;B;B	0.45176	0.822;0.025;0.815;0.852;0.103;0.172	P;B;P;P;B;B	0.51266	0.492;0.115;0.664;0.626;0.218;0.425	T	0.70923	-0.4740	10	0.87932	D	0	-16.2922	15.2481	0.73521	1.0:0.0:0.0:0.0	.	364;231;333;333;333;388	F5GWP3;E9PHN5;Q13362-3;Q13362;Q13362-2;Q6ZN33	.;.;.;2A5G_HUMAN;.;.	T	364;388;362;333;231;333;333;333;129	ENSP00000412324:K364T;ENSP00000329009:K388T;ENSP00000450931:K362T;ENSP00000262239:K333T;ENSP00000333905:K333T	ENSP00000329009:K388T	K	+	2	0	PPP2R5C	101437954	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.413000	0.80104	2.015000	0.59207	0.533000	0.62120	AAA	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56		0.433	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	protein_coding	OTTHUMT00000414373.2	A	NM_002719	-		102368201	+1	no_errors	ENST00000422945	ensembl	human	known	74_37	missense	SNP	1.000	C
TRPV2	51393	genome.wustl.edu	37	17	16342302	16342302	+	IGR	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:16342302G>A	ENST00000338560.7	+	0	2808				C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|RP11-138I1.3_ENST00000585048.1_lincRNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000384229.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CTTTTGTGAGGATTGGGATAT	0.532																																																	0								ENSG00000175061																																			C17orf76-AS1	SO:0001628	intergenic_variant	0			-	HGNC	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989		17.37:g.16342302G>A		Somatic	0	44	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	40	21.57	A6NML2|A8K0Z0|Q9Y670	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338560.7	37	NULL	CCDS32576.1	17																																																																																			-	-		0.532	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf76-AS1	protein_coding	OTTHUMT00000130464.2	G	NM_016113	-		16342302	+1	no_errors	ENST00000475947	ensembl	human	known	74_37	rna	SNP	0.000	A
ZNF292	23036	genome.wustl.edu	37	6	87943156	87943156	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr6:87943156C>T	ENST00000369577.3	+	5	695	c.652C>T	c.(652-654)Cat>Tat	p.H218Y	ZNF292_ENST00000339907.4_Missense_Mutation_p.H213Y	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	218						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GTGTTCTGACCATCCAGAGAT	0.373																																																	0								ENSG00000188994						143.0	139.0	140.0					6																	87943156		1862	4107	5969	ZNF292	SO:0001583	missense	0			-	HGNC	AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.652C>T	6.37:g.87943156C>T	ENSP00000358590:p.His218Tyr	Somatic	0	123	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	103	22.56	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H218Y	ENST00000369577.3	37	c.652	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	C	8.189	0.795571	0.16327	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.08720	3.06;3.06	5.36	5.36	0.76844	.	0.153864	0.64402	D	0.000019	T	0.02767	0.0083	N	0.25647	0.755	0.35655	D	0.812111	B	0.31837	0.342	B	0.28638	0.092	T	0.39251	-0.9623	10	0.10377	T	0.69	.	19.4599	0.94912	0.0:1.0:0.0:0.0	.	218	O60281	ZN292_HUMAN	Y	218;213	ENSP00000358590:H218Y;ENSP00000342847:H213Y	ENSP00000342847:H213Y	H	+	1	0	ZNF292	87999875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.116000	0.57871	2.671000	0.90904	0.563000	0.77884	CAT	-	NULL		0.373	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	protein_coding	OTTHUMT00000376192.2	C	NM_015021	-		87943156	+1	no_errors	ENST00000369577	ensembl	human	known	74_37	missense	SNP	1.000	T
ERICH3	127254	genome.wustl.edu	37	1	75037175	75037175	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr1:75037175C>T	ENST00000326665.5	-	14	4437	c.4219G>A	c.(4219-4221)Gaa>Aaa	p.E1407K	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		1407	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CGTGCTAATTCCTCTACCACC	0.537																																																	0								ENSG00000178965						96.0	94.0	95.0					1																	75037175		2203	4300	6503	C1orf173	SO:0001583	missense	0			-	HGNC																												ENST00000326665.5:c.4219G>A	1.37:g.75037175C>T	ENSP00000322609:p.Glu1407Lys	Somatic	0	25	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E1407K	ENST00000326665.5	37	c.4219	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	C	17.92	3.506412	0.64410	.	.	ENSG00000178965	ENST00000326665	T	0.19532	2.14	5.0	4.08	0.47627	.	.	.	.	.	T	0.07188	0.0182	N	0.19112	0.55	0.51233	D	0.999914	P	0.50156	0.932	P	0.51135	0.66	T	0.11421	-1.0588	9	0.09590	T	0.72	-1.0452	7.669	0.28447	0.0:0.8073:0.0:0.1927	.	1407	Q5RHP9	CA173_HUMAN	K	1407	ENSP00000322609:E1407K	ENSP00000322609:E1407K	E	-	1	0	C1orf173	74809763	0.231000	0.23751	0.479000	0.27329	0.010000	0.07245	0.904000	0.28491	1.101000	0.41535	0.561000	0.74099	GAA	-	NULL		0.537	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	protein_coding	OTTHUMT00000026516.1	C		-		75037175	-1	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	SNP	0.698	T
RNF213	57674	genome.wustl.edu	37	17	78272139	78272139	+	Silent	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:78272139G>A	ENST00000582970.1	+	11	2174	c.2031G>A	c.(2029-2031)gtG>gtA	p.V677V	RNF213_ENST00000508628.2_Silent_p.V726V|RNF213_ENST00000319921.4_Silent_p.V677V|RNF213_ENST00000456466.1_Silent_p.V677V	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	677					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			TGTACCTGGTGAACCTGTGCC	0.612																																																	0								ENSG00000173821						60.0	46.0	51.0					17																	78272139		2203	4300	6503	RNF213	SO:0001819	synonymous_variant	0			-	HGNC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.2031G>A	17.37:g.78272139G>A		Somatic	0	20	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	45	23.73	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.V677	ENST00000582970.1	37	c.2031	CCDS58606.1	17																																																																																			-	NULL		0.612	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	protein_coding	OTTHUMT00000443298.1	G	NM_020914	-		78272139	+1	no_errors	ENST00000582970	ensembl	human	known	74_37	silent	SNP	0.000	A
HTR3B	9177	genome.wustl.edu	37	11	113780025	113780025	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr11:113780025G>T	ENST00000260191.2	+	2	318	c.61G>T	c.(61-63)Gcc>Tcc	p.A21S	HTR3B_ENST00000537778.1_Missense_Mutation_p.A10S	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	21					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	AGGAATTCTAGCCACAGATAC	0.403																																																	0								ENSG00000149305						104.0	101.0	102.0					11																	113780025		2201	4296	6497	HTR3B	SO:0001583	missense	0			-	HGNC	AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.61G>T	11.37:g.113780025G>T	ENSP00000260191:p.Ala21Ser	Somatic	0	56	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B0YJ23|Q0VJC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_5HT3_rcpt_B,prints_5HT3_rcpt,prints_Neur_channel,prints_5HT3_rcpt_A,tigrfam_Neur_channel	p.A21S	ENST00000260191.2	37	c.61	CCDS8364.1	11	.	.	.	.	.	.	.	.	.	.	G	11.61	1.690187	0.29962	.	.	ENSG00000149305	ENST00000260191;ENST00000537778	T;T	0.80393	-1.37;-1.33	5.53	4.42	0.53409	.	1.533960	0.04128	N	0.317461	T	0.71367	0.3331	N	0.14661	0.345	0.09310	N	1	B;B	0.21071	0.051;0.044	B;B	0.26614	0.071;0.024	T	0.54377	-0.8303	10	0.25106	T	0.35	-6.6033	12.5073	0.55987	0.0952:0.0:0.9048:0.0	.	10;21	O95264-2;O95264	.;5HT3B_HUMAN	S	21;10	ENSP00000260191:A21S;ENSP00000443118:A10S	ENSP00000260191:A21S	A	+	1	0	HTR3B	113285235	0.016000	0.18221	0.035000	0.18076	0.070000	0.16714	1.845000	0.39279	2.586000	0.87340	0.655000	0.94253	GCC	-	prints_5HT3_rcpt_B,tigrfam_Neur_channel		0.403	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3B	protein_coding	OTTHUMT00000398842.1	G	NM_006028	-		113780025	+1	no_errors	ENST00000260191	ensembl	human	known	74_37	missense	SNP	0.007	T
INTU	27152	genome.wustl.edu	37	4	128635153	128635153	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr4:128635153C>A	ENST00000335251.6	+	15	2725	c.2622C>A	c.(2620-2622)aaC>aaA	p.N874K		NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	874					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						CTTCTCTTAACCCTGTTAAAG	0.373																																																	0								ENSG00000164066						155.0	155.0	155.0					4																	128635153		2203	4300	6503	INTU	SO:0001583	missense	0			-	HGNC	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.2622C>A	4.37:g.128635153C>A	ENSP00000334003:p.Asn874Lys	Somatic	0	131	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	112	19.86	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.N874K	ENST00000335251.6	37	c.2622	CCDS34061.1	4	.	.	.	.	.	.	.	.	.	.	C	7.627	0.678007	0.14841	.	.	ENSG00000164066	ENST00000335251	.	.	.	4.2	-1.36	0.09085	.	0.393103	0.27455	N	0.019281	T	0.27765	0.0683	N	0.22421	0.69	0.48901	D	0.999723	B	0.30973	0.302	B	0.21708	0.036	T	0.01858	-1.1259	9	0.44086	T	0.13	-1.5991	4.3877	0.11325	0.0:0.2137:0.3396:0.4467	.	874	Q9ULD6	PDZD6_HUMAN	K	874	.	ENSP00000334003:N874K	N	+	3	2	INTU	128854603	0.001000	0.12720	0.829000	0.32907	0.552000	0.35366	0.458000	0.21892	-0.194000	0.10399	0.650000	0.86243	AAC	-	NULL		0.373	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	INTU	protein_coding	OTTHUMT00000364147.2	C	XM_371707	-		128635153	+1	no_errors	ENST00000335251	ensembl	human	known	74_37	missense	SNP	0.497	A
QSER1	79832	genome.wustl.edu	37	11	32955585	32955585	+	Silent	SNP	C	C	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr11:32955585C>A	ENST00000399302.2	+	4	2729	c.2394C>A	c.(2392-2394)ctC>ctA	p.L798L	QSER1_ENST00000527788.1_Silent_p.L559L	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	798										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					AAATGGACCTCTCTGAGTCTT	0.368																																																	0								ENSG00000060749						75.0	72.0	73.0					11																	32955585		1891	4116	6007	QSER1	SO:0001819	synonymous_variant	0			-	HGNC	AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.2394C>A	11.37:g.32955585C>A		Somatic	0	34	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	38	17.39	Q6ZU30|Q6ZUR5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L798	ENST00000399302.2	37	c.2394	CCDS41631.1	11																																																																																			-	NULL		0.368	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	protein_coding	OTTHUMT00000388448.1	C	NM_024774	-		32955585	+1	no_errors	ENST00000399302	ensembl	human	known	74_37	silent	SNP	0.664	A
DRD3	1814	genome.wustl.edu	37	3	113850156	113850156	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr3:113850156C>A	ENST00000460779.1	-	7	1104	c.815G>T	c.(814-816)aGa>aTa	p.R272I	DRD3_ENST00000295881.7_Missense_Mutation_p.R272I|DRD3_ENST00000383673.2_Missense_Mutation_p.R272I|DRD3_ENST00000467632.1_Missense_Mutation_p.R272I	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	272					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	CTCTCCTCCTCTTTCTTGGAA	0.542																																																	0								ENSG00000151577						160.0	166.0	164.0					3																	113850156		2203	4300	6503	DRD3	SO:0001583	missense	0			-	HGNC		CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.815G>T	3.37:g.113850156C>A	ENSP00000419402:p.Arg272Ile	Somatic	0	32	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	A1A4V5|Q4VBM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Dopamine_D3_rcpt,prints_GPCR_Rhodpsn,prints_Dopamine_rcpt	p.R272I	ENST00000460779.1	37	c.815	CCDS2978.1	3	.	.	.	.	.	.	.	.	.	.	C	5.855	0.341891	0.11069	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.73258	-0.69;-0.69;-0.69;-0.73	5.28	-4.04	0.04010	GPCR, rhodopsin-like superfamily (1);	1.485970	0.03632	N	0.238109	T	0.52451	0.1735	N	0.11845	0.185	0.18873	N	0.999982	B;B;B;B	0.18310	0.027;0.013;0.013;0.019	B;B;B;B	0.27380	0.039;0.079;0.058;0.029	T	0.45071	-0.9286	10	0.40728	T	0.16	.	7.8785	0.29608	0.0:0.2819:0.2066:0.5115	.	272;272;272;272	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	I	272	ENSP00000419402:R272I;ENSP00000420662:R272I;ENSP00000373169:R272I;ENSP00000295881:R272I	ENSP00000281274:R272I	R	-	2	0	DRD3	115332846	0.000000	0.05858	0.001000	0.08648	0.079000	0.17450	-0.156000	0.10100	-0.707000	0.05022	-0.145000	0.13849	AGA	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD3	protein_coding	OTTHUMT00000354699.1	C	NM_000796.3	-		113850156	-1	no_errors	ENST00000383673	ensembl	human	known	74_37	missense	SNP	0.002	A
PTCHD3	374308	genome.wustl.edu	37	10	27702334	27702334	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr10:27702334G>T	ENST00000438700.3	-	1	963	c.846C>A	c.(844-846)agC>agA	p.S282R		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	282					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						GGAAGGAGATGCTGCTCAGGT	0.617																																																	0								ENSG00000182077						63.0	69.0	67.0					10																	27702334		2203	4300	6503	PTCHD3	SO:0001583	missense	0			-	HGNC	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.846C>A	10.37:g.27702334G>T	ENSP00000417658:p.Ser282Arg	Somatic	0	30	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	I3L499|Q6ZU28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD	p.S282R	ENST00000438700.3	37	c.846	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	G	6.256	0.415396	0.11870	.	.	ENSG00000182077	ENST00000438700	D	0.85484	-1.99	3.74	-1.75	0.08031	.	2.189740	0.01705	N	0.027398	T	0.76011	0.3928	L	0.29908	0.895	0.09310	N	1	B	0.21753	0.06	B	0.25405	0.06	T	0.58115	-0.7693	10	0.21014	T	0.42	0.0305	5.4003	0.16293	0.402:0.3603:0.2377:0.0	.	282	Q3KNS1	PTHD3_HUMAN	R	282	ENSP00000417658:S282R	ENSP00000417658:S282R	S	-	3	2	PTCHD3	27742340	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.115000	0.15540	-0.214000	0.10078	-0.258000	0.10820	AGC	-	pfam_Patched		0.617	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	protein_coding	OTTHUMT00000047325.3	G	XM_370541	-		27702334	-1	no_errors	ENST00000438700	ensembl	human	known	74_37	missense	SNP	0.000	T
HSD17B2	3294	genome.wustl.edu	37	16	82131683	82131683	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr16:82131683T>A	ENST00000199936.4	+	5	999	c.806T>A	c.(805-807)aTc>aAc	p.I269N	RP11-510J16.5_ENST00000567021.1_RNA	NM_002153.2	NP_002144.1	P37059	DHB2_HUMAN	hydroxysteroid (17-beta) dehydrogenase 2	269					in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|response to retinoic acid (GO:0032526)|steroid biosynthetic process (GO:0006694)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	10						ACCCCAGATATCGCAGGCACC	0.547																																																	0								ENSG00000086696						72.0	61.0	65.0					16																	82131683		2201	4300	6501	HSD17B2	SO:0001583	missense	0			-	HGNC		CCDS10936.1	16q24.1-q24.2	2011-09-14			ENSG00000086696	ENSG00000086696	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5211	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 2"""	109685				7759109, 19027726	Standard	NM_002153		Approved	HSD17, SDR9C2	uc002fgv.3	P37059	OTTHUMG00000137631	ENST00000199936.4:c.806T>A	16.37:g.82131683T>A	ENSP00000199936:p.Ile269Asn	Somatic	0	33	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	47	25.40	B2R7T4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.I269N	ENST00000199936.4	37	c.806	CCDS10936.1	16	.	.	.	.	.	.	.	.	.	.	t	15.64	2.894165	0.52121	.	.	ENSG00000086696	ENST00000199936	T	0.44881	0.91	5.44	5.44	0.79542	NAD(P)-binding domain (1);	0.062472	0.64402	D	0.000009	T	0.58481	0.2125	M	0.82716	2.605	0.09310	N	0.999996	D	0.54047	0.964	P	0.53912	0.737	T	0.58645	-0.7600	10	0.48119	T	0.1	.	12.1715	0.54161	0.0:0.0:0.0:1.0	.	269	P37059	DHB2_HUMAN	N	269	ENSP00000199936:I269N	ENSP00000199936:I269N	I	+	2	0	HSD17B2	80689184	0.893000	0.30496	0.010000	0.14722	0.028000	0.11728	5.184000	0.65070	2.193000	0.70182	0.460000	0.39030	ATC	-	prints_Glc/ribitol_DH		0.547	HSD17B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B2	protein_coding	OTTHUMT00000269057.2	T	NM_002153	-		82131683	+1	no_errors	ENST00000199936	ensembl	human	known	74_37	missense	SNP	0.026	A
LOC101927060	101927060	genome.wustl.edu	37	17	45177320	45177321	+	IGR	INS	-	-	CGGCCC	rs71354656|rs11283220|rs143602867	byFrequency	TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:45177320_45177321insCGGCCC								RP11-156P1.3 (32417 upstream) : CDC27 (17747 downstream)																							gcccccggccgcggccccggcc	0.757														2232	0.445687	0.2821	0.5245	5008	,	,		8276	0.2927		0.6441	False		,,,				2504	0.5644																0								ENSG00000262879																																			RP11-156P1.3	SO:0001628	intergenic_variant	0				Clone_based_vega_gene																													17.37:g.45177321_45177326dupCGGCCC		Somatic	NA	NA	NA		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		17																																																																																			-	-	0	0.757					LOC101927060			-				45177321	-1	no_errors	ENST00000571665	ensembl	human	known	74_37	rna	INS	0.380:0.408	CGGCCC
SCARB1	949	genome.wustl.edu	37	12	125270910	125270910	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr12:125270910C>A	ENST00000415380.2	-	11	1519	c.1394G>T	c.(1393-1395)cGg>cTg	p.R465L	SCARB1_ENST00000339570.5_Missense_Mutation_p.R465L|SCARB1_ENST00000535005.1_5'UTR|SCARB1_ENST00000261693.6_Missense_Mutation_p.R465L|SCARB1_ENST00000376788.1_Missense_Mutation_p.R365L|SCARB1_ENST00000540495.1_Missense_Mutation_p.R428L|SCARB1_ENST00000541205.1_Missense_Mutation_p.R424L|SCARB1_ENST00000544327.1_Missense_Mutation_p.R411L|SCARB1_ENST00000546215.1_Intron			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	465					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	TACTTGGCTCCGGATTTGGCA	0.637																																																	0								ENSG00000073060						114.0	108.0	110.0					12																	125270910		2203	4300	6503	SCARB1	SO:0001583	missense	0			-	HGNC	Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.1394G>T	12.37:g.125270910C>A	ENSP00000414979:p.Arg465Leu	Somatic	0	24	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD36,prints_CD36,prints_CD36_antigen	p.R465L	ENST00000415380.2	37	c.1394		12	.	.	.	.	.	.	.	.	.	.	C	15.35	2.808706	0.50421	.	.	ENSG00000073060	ENST00000339570;ENST00000415380;ENST00000261693;ENST00000376788;ENST00000541205;ENST00000544327;ENST00000540495	T;T;T;T;T;T;T	0.72835	-0.69;-0.69;-0.69;-0.69;-0.69;-0.69;-0.69	5.35	2.42	0.29668	.	0.737082	0.12733	N	0.443673	T	0.79650	0.4482	M	0.85373	2.75	0.45378	D	0.998366	D;D;D;P;P	0.58970	0.984;0.984;0.984;0.829;0.804	P;P;P;B;B	0.57846	0.828;0.828;0.828;0.287;0.203	T	0.76666	-0.2875	10	0.72032	D	0.01	-30.7525	4.5196	0.11952	0.1583:0.5952:0.0:0.2465	.	424;465;465;465;465	B3KW46;B4E3I1;Q8WTV0;F8W8N0;Q8WTV0-2	.;.;SCRB1_HUMAN;.;.	L	465;465;465;365;424;411;428	ENSP00000343795:R465L;ENSP00000414979:R465L;ENSP00000261693:R465L;ENSP00000365984:R365L;ENSP00000446107:R424L;ENSP00000444851:R411L;ENSP00000443286:R428L	ENSP00000261693:R465L	R	-	2	0	SCARB1	123836863	0.901000	0.30685	0.896000	0.35187	0.148000	0.21650	0.359000	0.20233	0.604000	0.29930	0.555000	0.69702	CGG	-	pfam_CD36		0.637	SCARB1-006	KNOWN	basic	protein_coding	SCARB1	protein_coding	OTTHUMT00000400165.1	C	NM_005505	-		125270910	-1	no_errors	ENST00000415380	ensembl	human	known	74_37	missense	SNP	0.958	A
TBX18	9096	genome.wustl.edu	37	6	85447068	85447068	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr6:85447068G>A	ENST00000369663.5	-	8	1496	c.1159C>T	c.(1159-1161)Cct>Tct	p.P387S	TBX18_ENST00000606784.1_Intron	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	387					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		AAAAGGTGAGGGTGAGTGGCA	0.532																																																	0								ENSG00000112837						74.0	76.0	75.0					6																	85447068		2203	4300	6503	TBX18	SO:0001583	missense	0			-	HGNC	AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.1159C>T	6.37:g.85447068G>A	ENSP00000358677:p.Pro387Ser	Somatic	0	55	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	58	14.71	A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.P387S	ENST00000369663.5	37	c.1159	CCDS34495.1	6	.	.	.	.	.	.	.	.	.	.	G	0.195	-1.049751	0.01981	.	.	ENSG00000112837	ENST00000369663	D	0.85773	-2.03	5.48	3.65	0.41850	.	0.721310	0.13292	N	0.398908	T	0.44329	0.1288	N	0.12182	0.205	0.43130	D	0.994867	B	0.09022	0.002	B	0.06405	0.002	T	0.45041	-0.9288	10	0.06365	T	0.9	.	3.3168	0.07036	0.1477:0.1381:0.5713:0.1429	.	387	O95935	TBX18_HUMAN	S	387	ENSP00000358677:P387S	ENSP00000358677:P387S	P	-	1	0	TBX18	85503787	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	2.180000	0.42537	0.644000	0.30656	0.585000	0.79938	CCT	-	NULL		0.532	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX18	protein_coding	OTTHUMT00000041378.2	G	NM_001080508	-		85447068	-1	no_errors	ENST00000369663	ensembl	human	known	74_37	missense	SNP	1.000	A
PADI1	29943	genome.wustl.edu	37	1	17531793	17531793	+	Silent	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr1:17531793G>A	ENST00000375471.4	+	1	173	c.81G>A	c.(79-81)gtG>gtA	p.V27V		NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	27					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	AGGCACATGTGGACATTCACA	0.587																																					Esophageal Squamous(80;414 1257 4580 27746 50832)												0								ENSG00000142623						143.0	108.0	120.0					1																	17531793		2203	4300	6503	PADI1	SO:0001819	synonymous_variant	0			-	HGNC	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.81G>A	1.37:g.17531793G>A		Somatic	0	57	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	42	36.36	A1L4K6|Q70SX6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.V27	ENST00000375471.4	37	c.81	CCDS178.1	1																																																																																			-	pfam_PAD_N,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub		0.587	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI1	protein_coding	OTTHUMT00000006621.1	G	NM_013358	-		17531793	+1	no_errors	ENST00000375471	ensembl	human	known	74_37	silent	SNP	0.917	A
CSN1S1	1446	genome.wustl.edu	37	4	70800429	70800429	+	Splice_Site	SNP	G	G	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr4:70800429G>T	ENST00000246891.4	+	4	154		c.e4+1		CSN1S1_ENST00000444405.3_Splice_Site|CSN1S1_ENST00000507763.1_Splice_Site|CSN1S1_ENST00000507772.1_Splice_Site|CSN1S1_ENST00000505782.1_Splice_Site	NM_001890.1	NP_001881.1	P47710	CASA1_HUMAN	casein alpha s1							extracellular region (GO:0005576)|extracellular space (GO:0005615)	transporter activity (GO:0005215)			lung(5)|prostate(1)|upper_aerodigestive_tract(1)	7						GAGCAGTGAGGTAAGCTCTGT	0.343																																																	0								ENSG00000126545						180.0	175.0	176.0					4																	70800429		1848	4095	5943	CSN1S1	SO:0001630	splice_region_variant	0			-	HGNC	X78416	CCDS47067.1, CCDS54769.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000126545	ENSG00000126545			2445	protein-coding gene	gene with protein product		115450	"""casein, alpha"""	CASA, CSN1		9050925, 7619062	Standard	NM_001890		Approved		uc003hep.1	P47710	OTTHUMG00000160843	ENST00000246891.4:c.105+1G>T	4.37:g.70800429G>T		Somatic	0	35	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	A1A510|A1A511|E9PB60|Q4PNR5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e3+1	ENST00000246891.4	37	c.105+1	CCDS47067.1	4	.	.	.	.	.	.	.	.	.	.	G	13.12	2.143139	0.37825	.	.	ENSG00000126545	ENST00000246891;ENST00000444405;ENST00000354865;ENST00000507763;ENST00000507772;ENST00000505782	.	.	.	3.9	2.18	0.27775	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.1053	0.20069	0.227:0.0:0.773:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CSN1S1	70835018	1.000000	0.71417	0.987000	0.45799	0.406000	0.30931	1.370000	0.34238	0.633000	0.30452	0.650000	0.86243	.	-	-		0.343	CSN1S1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSN1S1	protein_coding	OTTHUMT00000362629.1	G		-	Intron	70800429	+1	no_errors	ENST00000246891	ensembl	human	known	74_37	splice_site	SNP	0.990	T
TJP1	7082	genome.wustl.edu	37	15	30033627	30033627	+	Silent	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr15:30033627C>T	ENST00000346128.6	-	10	1638	c.1164G>A	c.(1162-1164)gtG>gtA	p.V388V	TJP1_ENST00000545208.2_Silent_p.V388V|TJP1_ENST00000356107.6_Silent_p.V388V|TJP1_ENST00000400011.2_Silent_p.V392V	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	388					apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		CTTGGGCATACACAGGCTTTG	0.373																																					Melanoma(77;681 1843 6309 6570)												0								ENSG00000104067						58.0	58.0	58.0					15																	30033627		1828	4077	5905	TJP1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.1164G>A	15.37:g.30033627C>T		Somatic	0	49	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	B4E3K1|Q2NKP3|Q4ZGJ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_ZU5,pfam_GK/Ca_channel_bsu,pfam_SH3_2,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_GK/Ca_channel_bsu,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin-like,prints_ZonOcculS1,prints_ZonOcculdens	p.V388	ENST00000346128.6	37	c.1164	CCDS42007.1	15																																																																																			-	prints_ZonOcculS1		0.373	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	protein_coding	OTTHUMT00000268237.3	C	NM_003257	-		30033627	-1	no_errors	ENST00000346128	ensembl	human	known	74_37	silent	SNP	0.980	T
TGM5	9333	genome.wustl.edu	37	15	43531082	43531082	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr15:43531082delA	ENST00000220420.5	-	9	1285	c.1278delT	c.(1276-1278)tttfs	p.F426fs	TGM5_ENST00000349114.4_Frame_Shift_Del_p.F344fs	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	426					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	TTGTGCTGATAAAATTGCCAA	0.507																																																	0								ENSG00000104055						190.0	153.0	165.0					15																	43531082		2202	4299	6501	TGM5	SO:0001589	frameshift_variant	0				HGNC	AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.1278delT	15.37:g.43531082delA	ENSP00000220420:p.Phe426fs	Somatic	0	22	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	O43549|Q0VF40|Q9UEZ4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.F426fs	ENST00000220420.5	37	c.1278	CCDS32212.1	15																																																																																			-	NULL		0.507	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	protein_coding	OTTHUMT00000432257.1	A	NM_004245			43531082	-1	no_errors	ENST00000220420	ensembl	human	known	74_37	frame_shift_del	DEL	0.003	-
ZBTB41	360023	genome.wustl.edu	37	1	197128578	197128578	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr1:197128578G>A	ENST00000367405.4	-	10	2709	c.2641C>T	c.(2641-2643)Cct>Tct	p.P881S	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	881					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						TGTTCTCTAGGATCTAGCATT	0.378																																																	0								ENSG00000177888						189.0	191.0	190.0					1																	197128578		2203	4299	6502	ZBTB41	SO:0001583	missense	0			-	HGNC		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.2641C>T	1.37:g.197128578G>A	ENSP00000356375:p.Pro881Ser	Somatic	0	89	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	71	34.26	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P881S	ENST00000367405.4	37	c.2641	CCDS30960.1	1	.	.	.	.	.	.	.	.	.	.	G	13.31	2.199327	0.38806	.	.	ENSG00000177888	ENST00000367405	T	0.04970	3.52	5.63	5.63	0.86233	.	0.000000	0.43416	D	0.000573	T	0.04861	0.0131	N	0.20986	0.625	0.42482	D	0.99286	B	0.14012	0.009	B	0.12156	0.007	T	0.44590	-0.9318	10	0.29301	T	0.29	.	8.9104	0.35550	0.0743:0.0:0.7765:0.1492	.	881	Q5SVQ8	ZBT41_HUMAN	S	881	ENSP00000356375:P881S	ENSP00000356375:P881S	P	-	1	0	ZBTB41	195395201	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.066000	0.71185	2.657000	0.90304	0.591000	0.81541	CCT	-	NULL		0.378	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB41	protein_coding	OTTHUMT00000088249.2	G	NM_194314	-		197128578	-1	no_errors	ENST00000367405	ensembl	human	known	74_37	missense	SNP	1.000	A
NUDT21	11051	genome.wustl.edu	37	16	56480573	56480573	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr16:56480573C>T	ENST00000300291.5	-	3	518	c.346G>A	c.(346-348)Gat>Aat	p.D116N		NM_007006.2	NP_008937.1	O43809	CPSF5_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 21	116	Necessary for RNA-binding.|Necessary for interactions with PAPOLA and PABPN1.|Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	AU-rich element binding (GO:0017091)|histone deacetylase binding (GO:0042826)|hydrolase activity (GO:0016787)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)	7						TCAACTTCATCTTCTCCTGGG	0.318																																																	0								ENSG00000167005						131.0	126.0	128.0					16																	56480573		2198	4300	6498	NUDT21	SO:0001583	missense	0			-	HGNC	AJ001810	CCDS10760.1	16q12.2	2013-06-18	2005-07-11	2005-07-11	ENSG00000167005	ENSG00000167005		"""Nudix motif containing"""	13870	protein-coding gene	gene with protein product	"""cleavage factor Im complex 25 kDa subunit"""	604978	"""cleavage and polyadenylation specific factor 5, 25 kDa"", ""cleavage and polyadenylation specific factor 5, 25 kD subunit"""	CPSF5		9659921	Standard	NM_007006		Approved	CFIM25	uc002eja.3	O43809	OTTHUMG00000133240	ENST00000300291.5:c.346G>A	16.37:g.56480573C>T	ENSP00000300291:p.Asp116Asn	Somatic	0	129	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	142	22.83	Q6IB85|Q6NE84	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_NUDIX_hydrolase_dom-like,pirsf_Cleav_polyA_spec_factor_su5	p.D116N	ENST00000300291.5	37	c.346	CCDS10760.1	16	.	.	.	.	.	.	.	.	.	.	C	18.97	3.734947	0.69189	.	.	ENSG00000167005	ENST00000300291	T	0.15372	2.43	5.81	5.81	0.92471	NUDIX hydrolase domain (2);	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	L	0.58925	1.835	0.80722	D	1	B	0.27013	0.166	B	0.33454	0.164	T	0.02917	-1.1094	10	0.23302	T	0.38	-10.2873	20.0763	0.97746	0.0:1.0:0.0:0.0	.	116	O43809	CPSF5_HUMAN	N	116	ENSP00000300291:D116N	ENSP00000300291:D116N	D	-	1	0	NUDT21	55038074	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.481000	0.81124	2.756000	0.94617	0.655000	0.94253	GAT	-	superfamily_NUDIX_hydrolase_dom-like,pirsf_Cleav_polyA_spec_factor_su5		0.318	NUDT21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT21	protein_coding	OTTHUMT00000256980.3	C	NM_007006	-		56480573	-1	no_errors	ENST00000300291	ensembl	human	known	74_37	missense	SNP	1.000	T
GDPD2	54857	genome.wustl.edu	37	X	69644894	69644894	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chrX:69644894C>G	ENST00000374382.3	+	2	311	c.60C>G	c.(58-60)agC>agG	p.S20R	GDPD2_ENST00000538649.1_Intron|GDPD2_ENST00000536730.1_Intron|GDPD2_ENST00000453994.2_Missense_Mutation_p.S20R	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	20					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					GCCTGTATAGCTGCCACTGGA	0.637																																																	0								ENSG00000130055						22.0	16.0	18.0					X																	69644894		2203	4299	6502	GDPD2	SO:0001583	missense	0			-	HGNC	AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.60C>G	X.37:g.69644894C>G	ENSP00000363503:p.Ser20Arg	Somatic	0	70	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	78	25.71	B4DRH4|B4DVC9|Q9NXJ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.S20R	ENST00000374382.3	37	c.60	CCDS14402.1	X	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186158	0.78789	.	.	ENSG00000130055	ENST00000453994;ENST00000374382	T;T	0.34472	1.36;1.36	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.56217	0.1970	M	0.64997	1.995	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.78314	0.991;0.991	T	0.54529	-0.8280	9	.	.	.	-8.5092	14.4397	0.67306	0.0:1.0:0.0:0.0	.	20;20	B4DVC9;Q9HCC8	.;GDPD2_HUMAN	R	20	ENSP00000414019:S20R;ENSP00000363503:S20R	.	S	+	3	2	GDPD2	69561619	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.969000	0.56816	2.426000	0.82243	0.600000	0.82982	AGC	-	NULL		0.637	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD2	protein_coding	OTTHUMT00000057070.1	C	NM_017711	-		69644894	+1	no_errors	ENST00000453994	ensembl	human	known	74_37	missense	SNP	1.000	G
RELN	5649	genome.wustl.edu	37	7	103183261	103183261	+	Silent	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr7:103183261G>A	ENST00000428762.1	-	43	6747	c.6588C>T	c.(6586-6588)atC>atT	p.I2196I	RELN_ENST00000343529.5_Silent_p.I2196I|RELN_ENST00000424685.2_Silent_p.I2196I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2196					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CACTAGAAAGGATTCCACACT	0.383																																					NSCLC(146;835 1944 15585 22231 52158)												0								ENSG00000189056						108.0	103.0	104.0					7																	103183261		2203	4300	6503	RELN	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6588C>T	7.37:g.103183261G>A		Somatic	0	91	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	78	31.58	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.I2196	ENST00000428762.1	37	c.6588	CCDS47680.1	7																																																																																			-	superfamily_Sialidases		0.383	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	protein_coding	OTTHUMT00000348148.1	G	NM_005045	-		103183261	-1	no_errors	ENST00000424685	ensembl	human	known	74_37	silent	SNP	1.000	A
RP11-690I21.2	0	genome.wustl.edu	37	2	232677017	232677018	+	RNA	INS	-	-	A	rs532945700		TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr2:232677017_232677018insA	ENST00000563949.1	+	0	2462_2463																											TTGACTTGCTGAAAAAAAAAAA	0.371																																																	0								ENSG00000261096																																			RP11-690I21.2			0				Clone_based_vega_gene																													2.37:g.232677028_232677028dupA		Somatic	0	22	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000563949.1	37	NULL		2																																																																																			-	-		0.371	RP11-690I21.2-001	KNOWN	basic	sense_overlapping	ENSG00000261096	sense_overlapping	OTTHUMT00000431716.1	-				232677018	+1	no_errors	ENST00000563949	ensembl	human	known	74_37	rna	INS	0.014:0.017	A
POLQ	10721	genome.wustl.edu	37	3	121168204	121168204	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr3:121168204C>A	ENST00000264233.5	-	26	7350	c.7222G>T	c.(7222-7224)Gat>Tat	p.D2408Y		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2408					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		CATGCAGCATCATTTTCTTTA	0.338								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)												0								ENSG00000051341						215.0	212.0	213.0					3																	121168204		2203	4300	6503	POLQ	SO:0001583	missense	0			-	HGNC	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.7222G>T	3.37:g.121168204C>A	ENSP00000264233:p.Asp2408Tyr	Somatic	0	69	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	79	26.85	O95160|Q6VMB5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.D2408Y	ENST00000264233.5	37	c.7222	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	C	21.1	4.104074	0.76983	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	D	0.96774	-4.12	5.41	5.41	0.78517	DNA-directed DNA polymerase, family A, palm domain (2);	0.349867	0.32769	N	0.005679	D	0.97920	0.9316	M	0.82323	2.585	0.40986	D	0.984819	D;D	0.89917	1.0;1.0	D;D	0.72338	0.977;0.971	D	0.98942	1.0791	10	0.87932	D	0	.	13.5043	0.61476	0.0:0.9226:0.0:0.0774	.	2408;1580	O75417;O75417-2	DPOLQ_HUMAN;.	Y	2031;2408;2544	ENSP00000264233:D2408Y	ENSP00000264233:D2408Y	D	-	1	0	POLQ	122650894	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.147000	0.77382	2.524000	0.85096	0.655000	0.94253	GAT	-	pfam_DNA-dir_DNA_pol_A_palm_dom,smart_DNA-dir_DNA_pol_A_palm_dom		0.338	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	protein_coding	OTTHUMT00000355097.1	C	NM_199420	-		121168204	-1	no_errors	ENST00000264233	ensembl	human	known	74_37	missense	SNP	1.000	A
ZBTB41	360023	genome.wustl.edu	37	1	197128821	197128821	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr1:197128821G>C	ENST00000367405.4	-	10	2466	c.2398C>G	c.(2398-2400)Cag>Gag	p.Q800E	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	800					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						GATACATTCTGTAACATCGTC	0.443																																																	0								ENSG00000177888						196.0	177.0	184.0					1																	197128821		2203	4300	6503	ZBTB41	SO:0001583	missense	0			-	HGNC		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.2398C>G	1.37:g.197128821G>C	ENSP00000356375:p.Gln800Glu	Somatic	0	80	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	53	28.38	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.Q800E	ENST00000367405.4	37	c.2398	CCDS30960.1	1	.	.	.	.	.	.	.	.	.	.	G	12.86	2.063089	0.36373	.	.	ENSG00000177888	ENST00000367405	T	0.05513	3.43	6.17	5.21	0.72293	.	0.000000	0.41605	D	0.000849	T	0.04952	0.0133	N	0.12746	0.255	0.37923	D	0.931767	B	0.02656	0.0	B	0.06405	0.002	T	0.43702	-0.9375	10	0.42905	T	0.14	.	15.5383	0.76021	0.0:0.2508:0.7492:0.0	.	800	Q5SVQ8	ZBT41_HUMAN	E	800	ENSP00000356375:Q800E	ENSP00000356375:Q800E	Q	-	1	0	ZBTB41	195395444	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	5.666000	0.68059	2.941000	0.99782	0.655000	0.94253	CAG	-	NULL		0.443	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB41	protein_coding	OTTHUMT00000088249.2	G	NM_194314	-		197128821	-1	no_errors	ENST00000367405	ensembl	human	known	74_37	missense	SNP	0.994	C
CLNK	116449	genome.wustl.edu	37	4	10566314	10566314	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr4:10566314G>C	ENST00000226951.6	-	7	619	c.380C>G	c.(379-381)aCa>aGa	p.T127R	CLNK_ENST00000507719.1_Missense_Mutation_p.T85R|CLNK_ENST00000442825.2_Missense_Mutation_p.T85R	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	127					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						CCTCGTCTGTGTGTTCCAGGT	0.488																																					GBM(87;402 1286 6949 13902 35851)												0								ENSG00000109684						194.0	183.0	187.0					4																	10566314		2001	4160	6161	CLNK	SO:0001583	missense	0			-	HGNC	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.380C>G	4.37:g.10566314G>C	ENSP00000226951:p.Thr127Arg	Somatic	0	53	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	62	12.68	Q05C27|Q9P2U9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.T127R	ENST00000226951.6	37	c.380	CCDS47024.1	4	.	.	.	.	.	.	.	.	.	.	G	13.73	2.325849	0.41197	.	.	ENSG00000109684	ENST00000226951;ENST00000429087;ENST00000442825;ENST00000507719	T;T;T	0.47177	1.77;0.85;0.85	5.18	-8.51	0.00923	.	2.619650	0.01285	N	0.009867	T	0.28732	0.0712	N	0.24115	0.695	0.09310	N	1	B;P	0.51351	0.048;0.944	B;P	0.45913	0.015;0.497	T	0.48854	-0.8998	10	0.20519	T	0.43	5.7892	1.1771	0.01838	0.4233:0.185:0.2053:0.1864	.	85;127	Q7Z7G1-2;Q7Z7G1	.;CLNK_HUMAN	R	127;127;85;85	ENSP00000226951:T127R;ENSP00000390744:T85R;ENSP00000427208:T85R	ENSP00000226951:T127R	T	-	2	0	CLNK	10175412	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.501000	0.02281	-1.990000	0.00978	-0.323000	0.08544	ACA	-	NULL		0.488	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLNK	protein_coding	OTTHUMT00000359047.1	G	NM_052964	-		10566314	-1	no_errors	ENST00000226951	ensembl	human	known	74_37	missense	SNP	0.000	C
ZDBF2	57683	genome.wustl.edu	37	2	207175936	207175936	+	Silent	SNP	G	G	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr2:207175936G>T	ENST00000374423.3	+	5	7070	c.6684G>T	c.(6682-6684)tcG>tcT	p.S2228S		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2228							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AGTATATTTCGAAATACTCTG	0.363																																																	0								ENSG00000204186						39.0	38.0	38.0					2																	207175936		1817	4076	5893	ZDBF2	SO:0001819	synonymous_variant	0			-	HGNC	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.6684G>T	2.37:g.207175936G>T		Somatic	0	105	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	121	12.32	Q6ZNP7|Q6ZSN8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_DBF,smart_Znf_DBF	p.S2228	ENST00000374423.3	37	c.6684	CCDS46501.1	2																																																																																			-	NULL		0.363	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	protein_coding	OTTHUMT00000336458.1	G	NM_020923	-		207175936	+1	no_errors	ENST00000374423	ensembl	human	known	74_37	silent	SNP	0.152	T
AQP4	361	genome.wustl.edu	37	18	24436262	24436262	+	Silent	SNP	T	T	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr18:24436262T>C	ENST00000383168.4	-	5	1013	c.885A>G	c.(883-885)aaA>aaG	p.K295K	AQP4_ENST00000440832.3_Silent_p.K273K|AQP4_ENST00000583022.1_5'UTR|AQP4-AS1_ENST00000582605.1_RNA|AQP4_ENST00000581374.1_Silent_p.K273K|AQP4-AS1_ENST00000579964.1_RNA	NM_001650.4|NM_004028.3	NP_001641.1|NP_004019.1	P55087	AQP4_HUMAN	aquaporin 4	295					carbon dioxide transport (GO:0015670)|cellular response to estradiol stimulus (GO:0071392)|cellular response to interferon-gamma (GO:0071346)|female pregnancy (GO:0007565)|hyperosmotic salinity response (GO:0042538)|multicellular organismal water homeostasis (GO:0050891)|protein homooligomerization (GO:0051260)|renal water absorption (GO:0070295)|response to glucocorticoid (GO:0051384)|response to radiation (GO:0009314)|sensory perception of sound (GO:0007605)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)	porin activity (GO:0015288)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			kidney(2)|large_intestine(3)|lung(5)|skin(1)	11	all_cancers(21;0.0172)|Lung NSC(5;0.00299)|all_lung(6;0.00747)|Ovarian(20;0.124)					CCACTCCAGGTTTTAGAATCA	0.483																																																	0								ENSG00000171885						359.0	297.0	318.0					18																	24436262		2203	4300	6503	AQP4	SO:0001819	synonymous_variant	0			-	HGNC	U63622	CCDS11889.1, CCDS58617.1	18q11.2-q12.1	2005-09-20			ENSG00000171885	ENSG00000171885		"""Ion channels / Aquaporins"""	637	protein-coding gene	gene with protein product		600308				7528931	Standard	NM_001650		Approved	MIWC	uc002kwa.3	P55087	OTTHUMG00000131955	ENST00000383168.4:c.885A>G	18.37:g.24436262T>C		Somatic	0	55	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	53	20.90	P78564	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	p.K295	ENST00000383168.4	37	c.885	CCDS11889.1	18																																																																																			-	NULL		0.483	AQP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP4	protein_coding	OTTHUMT00000254914.2	T	NM_001650, NM_004028	-		24436262	-1	no_errors	ENST00000383168	ensembl	human	known	74_37	silent	SNP	1.000	C
ARAP2	116984	genome.wustl.edu	37	4	36148956	36148956	+	Silent	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr4:36148956C>T	ENST00000303965.4	-	19	3714	c.3225G>A	c.(3223-3225)ggG>ggA	p.G1075G		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1075	PH 4. {ECO:0000255|PROSITE- ProRule:PRU00145}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						CCAGTTTTTCCCCATTTTGAA	0.343																																																	0								ENSG00000047365						98.0	110.0	106.0					4																	36148956		2202	4299	6501	ARAP2	SO:0001819	synonymous_variant	0			-	HGNC	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.3225G>A	4.37:g.36148956C>T		Somatic	0	166	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	146	15.12	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.G1075	ENST00000303965.4	37	c.3225	CCDS3441.1	4																																																																																			-	smart_Pleckstrin_homology		0.343	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	protein_coding	OTTHUMT00000215074.2	C	NM_015230	-		36148956	-1	no_errors	ENST00000303965	ensembl	human	known	74_37	silent	SNP	0.995	T
ADAM15	8751	genome.wustl.edu	37	1	155030473	155030473	+	Silent	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr1:155030473C>T	ENST00000356955.2	+	14	1664	c.1563C>T	c.(1561-1563)caC>caT	p.H521H	ADAM15_ENST00000271836.6_Silent_p.H521H|ADAM15_ENST00000368410.2_Silent_p.H227H|ADAM15_ENST00000531455.1_Silent_p.H531H|ADAM15_ENST00000449910.2_Silent_p.H521H|ADAM15_ENST00000360674.4_Silent_p.H521H|ADAM15_ENST00000359280.4_Silent_p.H521H|ADAM15_ENST00000447332.3_Silent_p.H505H|ADAM15_ENST00000368413.1_Silent_p.H227H|ADAM15_ENST00000472434.1_3'UTR|ADAM15_ENST00000355956.2_Silent_p.H521H|ADAM15_ENST00000368412.3_Silent_p.H521H	NM_207197.2	NP_997080.1	Q13444	ADA15_HUMAN	ADAM metallopeptidase domain 15	521	Cys-rich.				angiogenesis (GO:0001525)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of receptor binding (GO:1900121)|protein kinase C signaling (GO:0070528)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(5)|urinary_tract(1)	39	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TGTGCATGCACGGGCGTTGTG	0.632																																																	0								ENSG00000143537						83.0	80.0	81.0					1																	155030473		2203	4300	6503	ADAM15	SO:0001819	synonymous_variant	0			-	HGNC	U46005	CCDS1084.1, CCDS1085.1, CCDS1086.1, CCDS1087.1, CCDS1088.1, CCDS44236.1, CCDS58031.1, CCDS58032.1, CCDS60282.1	1q21.3	2008-02-05	2007-06-04		ENSG00000143537	ENSG00000143537		"""ADAM metallopeptidase domain containing"""	193	protein-coding gene	gene with protein product	"""metargidin"""	605548	"""a disintegrin and metalloproteinase domain 15 (metargidin)"""			9516430	Standard	NM_003815		Approved	MDC15	uc001fgr.2	Q13444	OTTHUMG00000013898	ENST00000356955.2:c.1563C>T	1.37:g.155030473C>T		Somatic	0	29	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B3KQU5|B4DLB5|B4DMH8|E9PN65|Q13493|Q53XQ0|Q5SR68|Q5SR69|Q6R267|Q71S61|Q71S62|Q71S63|Q71S64|Q71S65|Q71S66|Q71S67|Q71S68|Q71S69|Q96C78|U3KQL5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B_N,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.H521	ENST00000356955.2	37	c.1563	CCDS1087.1	1																																																																																			-	pfam_ADAM_Cys-rich,smart_ADAM_Cys-rich		0.632	ADAM15-019	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM15	protein_coding	OTTHUMT00000387168.1	C	NM_003815	-		155030473	+1	no_errors	ENST00000356955	ensembl	human	known	74_37	silent	SNP	0.081	T
AKAP10	11216	genome.wustl.edu	37	17	19866275	19866275	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:19866275G>C	ENST00000225737.6	-	3	354	c.197C>G	c.(196-198)gCa>gGa	p.A66G	AKAP10_ENST00000395536.3_Missense_Mutation_p.A66G|AKAP10_ENST00000572155.1_5'UTR	NM_007202.3	NP_009133.2	O43572	AKA10_HUMAN	A kinase (PRKA) anchor protein 10	66					blood coagulation (GO:0007596)|protein localization (GO:0008104)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				NS(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	21	all_cancers(12;2.08e-05)|all_epithelial(12;0.00158)|Breast(13;0.165)					ACTTGGTCCTGCAGCCTCCAG	0.403																																																	0								ENSG00000108599						136.0	130.0	132.0					17																	19866275		2203	4300	6503	AKAP10	SO:0001583	missense	0			-	HGNC	AF037439	CCDS11214.1	17p11.1	2008-07-18			ENSG00000108599	ENSG00000108599		"""A-kinase anchor proteins"""	368	protein-coding gene	gene with protein product	"""dual-specificity A-kinase anchoring protein 2"", ""protein kinase A anchoring protein 10"", ""mitochondrial A kinase PPKA anchor protein 10"""	604694				9326583	Standard	NM_007202		Approved	D-AKAP2, PRKA10, MGC9414	uc002gwo.4	O43572	OTTHUMG00000059515	ENST00000225737.6:c.197C>G	17.37:g.19866275G>C	ENSP00000225737:p.Ala66Gly	Somatic	0	81	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	91	22.88	B2R650|Q96AJ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam	p.A66G	ENST00000225737.6	37	c.197	CCDS11214.1	17	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192081	0.38707	.	.	ENSG00000108599	ENST00000225737;ENST00000395536	T	0.44482	0.92	5.76	5.76	0.90799	.	0.045923	0.85682	D	0.000000	T	0.63367	0.2505	L	0.56769	1.78	0.46317	D	0.99898	D;D;D	0.76494	0.991;0.999;0.999	P;D;D	0.78314	0.73;0.991;0.991	T	0.63985	-0.6513	10	0.87932	D	0	-9.6199	18.9462	0.92623	0.0:0.0:1.0:0.0	.	66;66;66	E7EMD6;Q2XPN4;O43572	.;.;AKA10_HUMAN	G	66	ENSP00000225737:A66G	ENSP00000225737:A66G	A	-	2	0	AKAP10	19806867	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.181000	0.94874	2.721000	0.93114	0.591000	0.81541	GCA	-	NULL		0.403	AKAP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP10	protein_coding	OTTHUMT00000132380.2	G	NM_007202	-		19866275	-1	no_errors	ENST00000225737	ensembl	human	known	74_37	missense	SNP	1.000	C
POTEC	388468	genome.wustl.edu	37	18	14538212	14538212	+	Silent	SNP	T	T	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr18:14538212T>A	ENST00000358970.5	-	2	557	c.558A>T	c.(556-558)tcA>tcT	p.S186S	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	186										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						GTACTACTTCTGAATTTCCAT	0.403																																																	0								ENSG00000183206																																			POTEC	SO:0001819	synonymous_variant	0			-	HGNC	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.558A>T	18.37:g.14538212T>A		Somatic	0	29	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	10	54.55		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S186	ENST00000358970.5	37	c.558	CCDS45835.1	18																																																																																			-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt		0.403	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	POTEC	protein_coding	OTTHUMT00000371179.1	T	XM_496269	-		14538212	-1	no_errors	ENST00000358970	ensembl	human	known	74_37	silent	SNP	0.863	A
WBP11P1	441818	genome.wustl.edu	37	18	30092568	30092568	+	RNA	SNP	T	T	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr18:30092568T>C	ENST00000567636.1	+	0	943					NR_003558.1				WW domain binding protein 11 pseudogene 1																		TTAGCACCAGTGAAGATGATG	0.483																																																	0								ENSG00000260389																																			WBP11P1			0			-	HGNC	BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30092568T>C		Somatic	0	13	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	14	41.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			-	-		0.483	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	pseudogene	OTTHUMT00000435119.1	T		-		30092568	+1	no_errors	ENST00000567636	ensembl	human	known	74_37	rna	SNP	1.000	C
OR51A4	401666	genome.wustl.edu	37	11	4967847	4967847	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr11:4967847G>T	ENST00000380373.2	-	1	509	c.484C>A	c.(484-486)Cct>Act	p.P162T	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P162S(1)		large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAAGTGAAAGGGAAGGGAAGA	0.438																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000205497						196.0	187.0	190.0					11																	4967847		2185	4259	6444	OR51A4	SO:0001583	missense	0			-	HGNC	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.484C>A	11.37:g.4967847G>T	ENSP00000369731:p.Pro162Thr	Somatic	0	106	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	80	20.79		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P162T	ENST00000380373.2	37	c.484	CCDS31367.1	11	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157536	0.38119	.	.	ENSG00000205497	ENST00000380373	T	0.70869	-0.52	3.44	1.52	0.23074	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.74786	0.3762	L	0.43923	1.385	0.09310	N	1	D	0.69078	0.997	D	0.75484	0.986	T	0.61496	-0.7051	9	0.35671	T	0.21	.	8.1628	0.31209	0.2067:0.0:0.7933:0.0	.	162	Q8NGJ6	O51A4_HUMAN	T	162	ENSP00000369731:P162T	ENSP00000369731:P162T	P	-	1	0	OR51A4	4924423	0.055000	0.20627	0.002000	0.10522	0.180000	0.23129	1.970000	0.40520	0.278000	0.22164	0.479000	0.44913	CCT	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.438	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A4	protein_coding	OTTHUMT00000142821.1	G	NM_001005329	-		4967847	-1	no_errors	ENST00000380373	ensembl	human	known	74_37	missense	SNP	0.041	T
SLC35G5	83650	genome.wustl.edu	37	8	11188715	11188715	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr8:11188715T>A	ENST00000382435.4	+	1	319	c.100T>A	c.(100-102)Tct>Act	p.S34T		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	34						integral component of membrane (GO:0016021)											CTGCCAGCCCTCTGGTGCCAC	0.672																																																	0								ENSG00000177710						58.0	63.0	61.0					8																	11188715		2203	4300	6503	SLC35G5	SO:0001583	missense	0			-	HGNC	AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.100T>A	8.37:g.11188715T>A	ENSP00000371872:p.Ser34Thr	Somatic	0	120	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	97	14.91	A2RRL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DMT	p.S34T	ENST00000382435.4	37	c.100	CCDS5980.1	8	.	.	.	.	.	.	.	.	.	.	T	0.102	-1.150730	0.01700	.	.	ENSG00000177710	ENST00000382435	T	0.29655	1.56	0.34	0.34	0.15985	.	0.000000	0.44097	D	0.000494	T	0.16471	0.0396	L	0.27053	0.805	0.21915	N	0.999471	B	0.21071	0.051	B	0.15052	0.012	T	0.15723	-1.0427	9	0.27785	T	0.31	-9.0173	.	.	.	.	34	Q96KT7	S35G5_HUMAN	T	34	ENSP00000371872:S34T	ENSP00000371872:S34T	S	+	1	0	SLC35G5	11226125	0.896000	0.30565	0.328000	0.25416	0.055000	0.15305	0.169000	0.16641	0.358000	0.24211	0.076000	0.15429	TCT	-	NULL		0.672	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G5	protein_coding	OTTHUMT00000207313.2	T	NM_054028	-		11188715	+1	no_errors	ENST00000382435	ensembl	human	known	74_37	missense	SNP	0.727	A
TRIM4	89122	genome.wustl.edu	37	7	99490311	99490311	+	Silent	SNP	C	C	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr7:99490311C>A	ENST00000355947.2	-	7	1107	c.978G>T	c.(976-978)ggG>ggT	p.G326G	TRIM4_ENST00000349062.2_Silent_p.G300G	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	326	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				TCACGTATCTCCCTTCCTGGG	0.463																																																	0								ENSG00000146833						58.0	55.0	56.0					7																	99490311		2197	4290	6487	TRIM4	SO:0001819	synonymous_variant	0			-	HGNC	AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.978G>T	7.37:g.99490311C>A		Somatic	0	36	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	29	35.56	A4D298|Q75MK1|Q96F06|Q9C036	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.G326	ENST00000355947.2	37	c.978	CCDS5679.1	7																																																																																			-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY		0.463	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM4	protein_coding	OTTHUMT00000345050.1	C	NM_033017	-		99490311	-1	no_errors	ENST00000355947	ensembl	human	known	74_37	silent	SNP	0.994	A
PTMAP5	150928	genome.wustl.edu	37	13	82264345	82264345	+	RNA	SNP	C	C	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr13:82264345C>A	ENST00000607242.1	+	0	300									prothymosin, alpha pseudogene 5																		GAGCAGGAAGCTGACAGTgaa	0.483																																																	0								ENSG00000214182																																			PTMAP5			0			-	HGNC	S38627		13q13.1	2008-11-06	2008-04-03		ENSG00000214182	ENSG00000214182			9628	pseudogene	pseudogene	"""gene sequence 150"""		"""prothymosin, alpha pseudogene 5 (gene sequence 150)"""			1612591	Standard	NG_004798		Approved				OTTHUMG00000017147		13.37:g.82264345C>A		Somatic	0	71	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	31	24.39		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000607242.1	37	NULL		13																																																																																			-	-		0.483	PTMAP5-002	KNOWN	basic	processed_transcript	PTMAP5	pseudogene	OTTHUMT00000470311.1	C		-		82264345	+1	no_errors	ENST00000607242	ensembl	human	known	74_37	rna	SNP	0.708	A
METTL23	124512	genome.wustl.edu	37	17	74725851	74725851	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:74725851C>G	ENST00000341249.6	+	2	391	c.59C>G	c.(58-60)tCt>tGt	p.S20C	METTL23_ENST00000586752.1_Intron|METTL23_ENST00000586200.1_Intron|METTL23_ENST00000591571.1_Intron|METTL23_ENST00000586738.1_Missense_Mutation_p.S20C|METTL23_ENST00000588822.1_Intron|METTL23_ENST00000588783.1_Missense_Mutation_p.S20C|METTL23_ENST00000589977.1_Missense_Mutation_p.S20C|METTL23_ENST00000590964.1_Intron|METTL23_ENST00000588302.1_Intron	NM_001206984.1	NP_001193913.1	Q86XA0	MET23_HUMAN	methyltransferase like 23	20						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	methyltransferase activity (GO:0008168)			large_intestine(2)|lung(1)	3						CACAGAAGATCTCTGCCAGGC	0.448																																																	0								ENSG00000181038						91.0	84.0	86.0					17																	74725851		1909	4131	6040	METTL23	SO:0001583	missense	0			-	HGNC		CCDS45787.1, CCDS59298.1	17q25.2	2011-03-03	2011-03-03	2011-03-03	ENSG00000181038	ENSG00000181038			26988	protein-coding gene	gene with protein product		615262	"""chromosome 17 open reading frame 95"""	C17orf95		12477932	Standard	NM_001080510		Approved	LOC124512	uc021udl.1	Q86XA0		ENST00000341249.6:c.59C>G	17.37:g.74725851C>G	ENSP00000341543:p.Ser20Cys	Somatic	0	76	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	106	10.08	H9ZYJ0|K7EK32	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nicotinamide_N-MeTfrase-like	p.S20C	ENST00000341249.6	37	c.59	CCDS45787.1	17	.	.	.	.	.	.	.	.	.	.	C	17.07	3.296129	0.60086	.	.	ENSG00000181038	ENST00000341249	T	0.22743	1.94	5.71	-0.313	0.12754	.	1.119650	0.06496	N	0.735462	T	0.22975	0.0555	L	0.34521	1.04	0.09310	N	0.99999	B	0.31893	0.345	P	0.44897	0.463	T	0.49943	-0.8885	10	0.56958	D	0.05	.	5.0955	0.14731	0.2084:0.2573:0.457:0.0773	.	20	Q86XA0	MET23_HUMAN	C	20	ENSP00000341543:S20C	ENSP00000341543:S20C	S	+	2	0	METTL23	72237446	0.000000	0.05858	0.954000	0.39281	0.997000	0.91878	-0.143000	0.10296	0.303000	0.22785	0.655000	0.94253	TCT	-	pfam_Nicotinamide_N-MeTfrase-like		0.448	METTL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL23	protein_coding	OTTHUMT00000451002.1	C	NM_001080510	-		74725851	+1	no_errors	ENST00000341249	ensembl	human	known	74_37	missense	SNP	0.072	G
GTF3C1	2975	genome.wustl.edu	37	16	27512569	27512569	+	Silent	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr16:27512569C>T	ENST00000356183.4	-	12	2019	c.2004G>A	c.(2002-2004)gaG>gaA	p.E668E	GTF3C1_ENST00000561623.1_Silent_p.E668E	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	668					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						AGAGACCTTCCTCAGACAGGT	0.547																																																	0								ENSG00000077235						157.0	127.0	137.0					16																	27512569		2197	4300	6497	GTF3C1	SO:0001819	synonymous_variant	0			-	HGNC	U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.2004G>A	16.37:g.27512569C>T		Somatic	0	36	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	37	21.28	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TFIIIC_Bblock-bd	p.E668	ENST00000356183.4	37	c.2004	CCDS32414.1	16																																																																																			-	NULL		0.547	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	protein_coding	OTTHUMT00000433856.1	C	NM_001520	-		27512569	-1	no_errors	ENST00000356183	ensembl	human	known	74_37	silent	SNP	1.000	T
BIRC6	57448	genome.wustl.edu	37	2	32582523	32582523	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr2:32582523delG	ENST00000421745.2	+	1	428	c.294delG	c.(292-294)tcgfs	p.S98fs		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	98					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					ACGGCACCTCGGGGGCCACAC	0.711																																					Pancreas(94;175 1509 16028 18060 45422)												0								ENSG00000115760						17.0	11.0	13.0					2																	32582523		2029	3987	6016	BIRC6	SO:0001589	frameshift_variant	0				HGNC	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.294delG	2.37:g.32582523delG	ENSP00000393596:p.Ser98fs	Somatic	0	10	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	Q9ULD1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.A100fs	ENST00000421745.2	37	c.294	CCDS33175.2	2																																																																																			-	superfamily_WD40_repeat_dom		0.711	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	protein_coding	OTTHUMT00000318769.3	G	NM_016252			32582523	+1	no_errors	ENST00000421745	ensembl	human	known	74_37	frame_shift_del	DEL	0.996	-
TRPV2	51393	genome.wustl.edu	37	17	16342498	16342498	+	IGR	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:16342498G>A	ENST00000338560.7	+	0	2808				C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|RP11-138I1.3_ENST00000585048.1_lincRNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000384229.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GGCAGCTGTTGAGATGGCGTG	0.672																																																	0								ENSG00000175061						25.0	31.0	29.0					17																	16342498		1976	3997	5973	C17orf76-AS1	SO:0001628	intergenic_variant	0			-	HGNC	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989		17.37:g.16342498G>A		Somatic	0	66	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	78	17.02	A6NML2|A8K0Z0|Q9Y670	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338560.7	37	NULL	CCDS32576.1	17																																																																																			-	-		0.672	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf76-AS1	protein_coding	OTTHUMT00000130464.2	G	NM_016113	-		16342498	+1	no_errors	ENST00000470491	ensembl	human	known	74_37	rna	SNP	0.001	A
TRPV2	51393	genome.wustl.edu	37	17	16342828	16342828	+	IGR	SNP	G	G	A	rs11540320		TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:16342828G>A	ENST00000338560.7	+	0	2808				C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|RP11-138I1.3_ENST00000585048.1_lincRNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000384229.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		CTGTCCTGATGATACTTGTAA	0.483																																																	0								ENSG00000175061						173.0	162.0	165.0					17																	16342828		876	1991	2867	C17orf76-AS1	SO:0001628	intergenic_variant	0			-	HGNC	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989		17.37:g.16342828G>A		Somatic	0	81	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	97	21.77	A6NML2|A8K0Z0|Q9Y670	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338560.7	37	NULL	CCDS32576.1	17																																																																																			-	-		0.483	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf76-AS1	protein_coding	OTTHUMT00000130464.2	G	NM_016113	-		16342828	+1	no_errors	ENST00000365172	ensembl	human	known	74_37	rna	SNP	1.000	A
VTN	7448	genome.wustl.edu	37	17	26696816	26696816	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:26696816C>T	ENST00000226218.4	-	3	859	c.241G>A	c.(241-243)Ggc>Agc	p.G81S	VTN_ENST00000438614.1_5'Flank|VTN_ENST00000536498.1_5'UTR|SARM1_ENST00000457710.3_5'Flank|CTB-96E2.3_ENST00000591482.1_RNA|TMEM199_ENST00000509083.1_Intron|CTB-96E2.2_ENST00000555059.2_5'Flank|SARM1_ENST00000379061.4_Intron	NM_000638.3	NP_000629.3	P04004	VTNC_HUMAN	vitronectin	81					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of blood coagulation (GO:0030195)|negative regulation of endopeptidase activity (GO:0010951)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein binding (GO:0032092)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of wound healing (GO:0090303)|regulation of complement activation (GO:0030449)|smooth muscle cell-matrix adhesion (GO:0061302)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|blood microparticle (GO:0072562)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix binding (GO:0050840)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			kidney(2)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	13	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Abciximab(DB00054)	TTCTCCTCGCCATCGTCATAG	0.587																																																	0								ENSG00000109072						65.0	64.0	65.0					17																	26696816		2203	4300	6503	VTN	SO:0001583	missense	0			-	HGNC	BC005046	CCDS11229.1	17q11.2	2014-08-08	2006-02-10		ENSG00000109072	ENSG00000109072		"""Endogenous ligands"""	12724	protein-coding gene	gene with protein product	"""serum spreading factor"", ""somatomedin B"", ""complement S-protein"""	193190	"""vitronectin (serum spreading factor, somatomedin B, complement S-protein)"""			2447940	Standard	NM_000638		Approved	VN	uc002hbc.3	P04004	OTTHUMG00000132500	ENST00000226218.4:c.241G>A	17.37:g.26696816C>T	ENSP00000226218:p.Gly81Ser	Somatic	0	8	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	7	56.25	B2R7G0|P01141|Q9BSH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hemopexin-like_repeat,pfam_Somatomedin_B_dom,superfamily_Hemopexin-like_dom,smart_Somatomedin_B_dom,smart_Hemopexin-like_repeat,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.G81S	ENST00000226218.4	37	c.241	CCDS11229.1	17	.	.	.	.	.	.	.	.	.	.	C	5.476	0.272930	0.10349	.	.	ENSG00000255604	ENST00000226218;ENST00000542029	T	0.03689	3.84	4.82	-4.97	0.03029	.	3.178710	0.00945	N	0.002897	T	0.01029	0.0034	N	0.01352	-0.895	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.41858	-0.9485	10	0.02654	T	1	9.0515	0.38	0.00393	0.2901:0.243:0.2444:0.2225	.	81	P04004	VTNC_HUMAN	S	81	ENSP00000226218:G81S	ENSP00000226218:G81S	G	-	1	0	AC002094.1	23720943	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.167000	0.09940	-0.495000	0.06659	-0.140000	0.14226	GGC	-	NULL		0.587	VTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VTN	protein_coding	OTTHUMT00000255680.2	C	NM_000638	-		26696816	-1	no_errors	ENST00000226218	ensembl	human	known	74_37	missense	SNP	0.000	T
SLC9C2	284525	genome.wustl.edu	37	1	173556926	173556926	+	Missense_Mutation	SNP	A	A	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr1:173556926A>T	ENST00000367714.3	-	5	823	c.401T>A	c.(400-402)aTa>aAa	p.I134K	SLC9C2_ENST00000536496.1_Missense_Mutation_p.I32K|RP3-436N22.3_ENST00000431459.1_RNA	NM_178527.3	NP_848622.2	Q5TAH2	SL9C2_HUMAN	solute carrier family 9, member C2 (putative)	134					sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)										ATATCCAATTATGATGCTTGC	0.353																																																	0								ENSG00000162753						93.0	94.0	94.0					1																	173556926		2203	4299	6502	SLC9C2	SO:0001583	missense	0			-	HGNC	AK128104	CCDS1308.1	1q25.1	2013-07-18	2013-07-18	2012-03-22	ENSG00000162753	ENSG00000162753		"""Solute carriers"""	28664	protein-coding gene	gene with protein product			"""solute carrier family 9, isoform 11"", ""solute carrier family 9, member 11"", ""solute carrier family 9, member C2"""	SLC9A11			Standard	NM_178527		Approved	MGC43026	uc001giz.2	Q5TAH2	OTTHUMG00000034800	ENST00000367714.3:c.401T>A	1.37:g.173556926A>T	ENSP00000356687:p.Ile134Lys	Somatic	0	115	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	89	42.58	Q86UF3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cation/H_exchanger,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.I134K	ENST00000367714.3	37	c.401	CCDS1308.1	1	.	.	.	.	.	.	.	.	.	.	A	13.88	2.369105	0.42003	.	.	ENSG00000162753	ENST00000367714;ENST00000536496	T;T	0.13538	2.58;2.58	5.59	3.23	0.37069	Cation/H+ exchanger (1);	1.025750	0.07750	N	0.948496	T	0.07279	0.0184	L	0.44542	1.39	0.09310	N	1	P	0.50369	0.934	P	0.47206	0.541	T	0.34675	-0.9819	10	0.62326	D	0.03	-4.903	7.372	0.26806	0.8245:0.0:0.1755:0.0	.	134	Q5TAH2	S9A11_HUMAN	K	134;32	ENSP00000356687:I134K;ENSP00000445437:I32K	ENSP00000356687:I134K	I	-	2	0	SLC9A11	171823549	0.005000	0.15991	0.000000	0.03702	0.012000	0.07955	0.645000	0.24782	0.393000	0.25203	0.482000	0.46254	ATA	-	pfam_Cation/H_exchanger		0.353	SLC9C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C2	protein_coding	OTTHUMT00000084205.1	A	NM_178527	-		173556926	-1	no_errors	ENST00000367714	ensembl	human	known	74_37	missense	SNP	0.001	T
MORF4L1	10933	genome.wustl.edu	37	15	79189830	79189830	+	3'UTR	SNP	G	G	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr15:79189830G>T	ENST00000331268.5	+	0	1714				RNU6-415P_ENST00000516252.1_RNA|MORF4L1_ENST00000426013.2_3'UTR|MORF4L1_ENST00000379535.4_3'UTR|MORF4L1_ENST00000561171.1_3'UTR	NM_206839.2	NP_996670.1	Q9UBU8	MO4L1_HUMAN	mortality factor 4 like 1						cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|double-strand break repair via homologous recombination (GO:0000724)|histone deacetylation (GO:0016575)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|protein N-terminus binding (GO:0047485)			breast(1)|large_intestine(3)|lung(4)|prostate(1)|urinary_tract(1)	10						TTGTGCTTTTGTTTTTTTTTA	0.343																																																	0								ENSG00000185787																																			MORF4L1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF100615	CCDS10307.1, CCDS32304.1, CCDS58393.1	15q25.1	2009-07-13			ENSG00000185787	ENSG00000185787			16989	protein-coding gene	gene with protein product	"""MORF-related gene on chromosome 15"", ""Esa1p-associated factor 3 homolog (S. cerevisiae)"""	607303				8619474, 9110174	Standard	NM_006791		Approved	MRG15, MORFRG15, HsT17725, Eaf3, MEAF3	uc002bel.4	Q9UBU8	OTTHUMG00000143865	ENST00000331268.5:c.*421G>T	15.37:g.79189830G>T		Somatic	0	33	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	B4DKN6|B7Z6R1|D3DW88|O95899|Q5QTS1|Q6NVX8|Q86YT7|Q9HBP6|Q9NSW5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000331268.5	37	NULL	CCDS10307.1	15																																																																																			-	-		0.343	MORF4L1-001	KNOWN	basic|CCDS	protein_coding	MORF4L1	protein_coding	OTTHUMT00000290131.4	G	NM_006791	-		79189830	+1	no_errors	ENST00000561171	ensembl	human	known	74_37	rna	SNP	0.000	T
LOC101927905	101927905	genome.wustl.edu	37	12	8388156	8388156	+	lincRNA	SNP	G	G	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr12:8388156G>C	ENST00000304751.9	+	0	146				FAM86FP_ENST00000427893.2_RNA																							CTGCACCAGGGTAAGCCTGCC	0.622																																																	0								ENSG00000215241																																			RP11-266K4.9			0			-	Clone_based_vega_gene																													12.37:g.8388156G>C		Somatic	0	144	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	112	14.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000304751.9	37	NULL		12																																																																																			-	-		0.622	RP11-266K4.9-001	KNOWN	basic	lincRNA	LOC101927905	lincRNA	OTTHUMT00000400464.1	G		-		8388156	+1	no_errors	ENST00000304751	ensembl	human	known	74_37	rna	SNP	0.002	C
APC	324	genome.wustl.edu	37	5	112178997	112178997	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr5:112178997G>A	ENST00000457016.1	+	16	8086	c.7706G>A	c.(7705-7707)aGt>aAt	p.S2569N	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.S2569N|APC_ENST00000508376.2_Missense_Mutation_p.S2569N			P25054	APC_HUMAN	adenomatous polyposis coli	2569	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGAACTGGAAGTTCATCTTCA	0.398		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	1	Unknown(1)	skin(1)						ENSG00000134982						78.0	80.0	79.0					5																	112178997		2202	4300	6502	APC	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	-	HGNC	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.7706G>A	5.37:g.112178997G>A	ENSP00000413133:p.Ser2569Asn	Somatic	0	38	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	29	35.56	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.S2569N	ENST00000457016.1	37	c.7706	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	G	19.51	3.841060	0.71488	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.87029	-2.2;-2.2;-2.2	5.97	5.97	0.96955	Adenomatous polyposis coli protein basic domain (1);	0.074585	0.85682	D	0.000000	D	0.92779	0.7704	M	0.61703	1.905	0.58432	D	0.999995	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	D	0.91132	0.4938	9	.	.	.	-18.3416	20.4238	0.99064	0.0:0.0:1.0:0.0	.	2571;2569	Q4LE70;P25054	.;APC_HUMAN	N	2569	ENSP00000413133:S2569N;ENSP00000257430:S2569N;ENSP00000427089:S2569N	.	S	+	2	0	APC	112206896	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.188000	0.94921	2.828000	0.97474	0.655000	0.94253	AGT	-	pfam_APC_basic_dom		0.398	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	protein_coding	OTTHUMT00000250738.2	G	NM_000038	-		112178997	+1	no_errors	ENST00000257430	ensembl	human	known	74_37	missense	SNP	1.000	A
ERCC5	2073	genome.wustl.edu	37	13	103498672	103498672	+	Missense_Mutation	SNP	C	C	G	rs34291397	byFrequency	TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr13:103498672C>G	ENST00000355739.4	+	1	1479	c.56C>G	c.(55-57)cCc>cGc	p.P19R	ERCC5_ENST00000535557.1_Missense_Mutation_p.P19R|BIVM-ERCC5_ENST00000602836.1_Intron	NM_000123.3	NP_000114	P28715	ERCC5_HUMAN	excision repair cross-complementation group 5	19	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|response to UV (GO:0009411)|response to UV-C (GO:0010225)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	51	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					CAGGTCAGCCCCGAAGCGCTG	0.647			"""Mis, N, F"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (G)	13	13q33	2073	"""excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome))"""		E	0								ENSG00000134899						43.0	44.0	44.0					13																	103498672		2203	4300	6503	ERCC5	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	-	HGNC	X71342	CCDS32004.1	13q22-q34	2014-09-17	2014-03-07		ENSG00000134899	ENSG00000134899			3437	protein-coding gene	gene with protein product	"""Cockayne syndrome"""	133530	"""xeroderma pigmentosum, complementation group G"", ""excision repair cross-complementing rodent repair deficiency, complementation group 5"""	ERCM2, XPGC		8088806	Standard	NM_000123		Approved			P28715	OTTHUMG00000017310	ENST00000355739.4:c.56C>G	13.37:g.103498672C>G	ENSP00000347978:p.Pro19Arg	Somatic	0	243	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	166	27.83	A6NGT4|Q5JUS4|Q5JUS5|Q7Z2V3|Q8IZL6|Q8N1B7|Q9HD59|Q9HD60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_XPG_DNA_repair_N,pfam_XPG-I_dom,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG-I_dom,smart_HhH2,prints_XPG/Rad2_eukaryotes,prints_XPG/Rad2,tigrfam_XPG/Rad2_eukaryotes	p.P19R	ENST00000355739.4	37	c.56	CCDS32004.1	13	.	.	.	.	.	.	.	.	.	.	C	19.27	3.795876	0.70452	.	.	ENSG00000134899	ENST00000355739;ENST00000535557	T;T	0.64618	-0.11;-0.11	5.18	5.18	0.71444	XPG N-terminal (2);	0.161268	0.56097	D	0.000029	T	0.81059	0.4744	.	.	.	0.58432	D	0.999998	D;D	0.89917	0.997;1.0	D;D	0.85130	0.975;0.997	T	0.82942	-0.0207	9	0.66056	D	0.02	-9.4083	18.8927	0.92412	0.0:1.0:0.0:0.0	.	19;19	B4DSI5;P28715	.;ERCC5_HUMAN	R	19	ENSP00000347978:P19R;ENSP00000442117:P19R	ENSP00000347978:P19R	P	+	2	0	ERCC5	102296673	1.000000	0.71417	0.996000	0.52242	0.597000	0.36814	7.195000	0.77798	2.687000	0.91594	0.655000	0.94253	CCC	-	pfam_XPG_DNA_repair_N,smart_XPG_DNA_repair_N,prints_XPG/Rad2_eukaryotes,tigrfam_XPG/Rad2_eukaryotes		0.647	ERCC5-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ERCC5	protein_coding	OTTHUMT00000045708.1	C		-		103498672	+1	no_errors	ENST00000355739	ensembl	human	known	74_37	missense	SNP	1.000	G
CNIH3	149111	genome.wustl.edu	37	1	224872522	224872522	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr1:224872522C>T	ENST00000272133.3	+	3	1057	c.175C>T	c.(175-177)Cgc>Tgc	p.R59C		NM_152495.1	NP_689708.1	Q8TBE1	CNIH3_HUMAN	cornichon family AMPA receptor auxiliary protein 3	59					intracellular signal transduction (GO:0035556)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|postsynaptic membrane (GO:0045211)	channel regulator activity (GO:0016247)			large_intestine(5)|lung(4)	9	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		GAACATCGAGCGCATCTGCTT	0.532																																																	0								ENSG00000143786						204.0	164.0	177.0					1																	224872522		2203	4300	6503	CNIH3	SO:0001583	missense	0			-	HGNC	AF070524	CCDS1544.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143786	ENSG00000143786			26802	protein-coding gene	gene with protein product			"""cornichon homolog 3 (Drosophila)"""			8619474, 9110174	Standard	NM_152495		Approved	FLJ38993, CNIH-3	uc001hos.1	Q8TBE1	OTTHUMG00000037634	ENST00000272133.3:c.175C>T	1.37:g.224872522C>T	ENSP00000272133:p.Arg59Cys	Somatic	0	49	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	37	38.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cornichon	p.R59C	ENST00000272133.3	37	c.175	CCDS1544.1	1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944782	0.73672	.	.	ENSG00000143786	ENST00000272133	T	0.42900	0.96	4.49	4.49	0.54785	.	0.000000	0.85682	U	0.000000	T	0.48333	0.1494	N	0.22421	0.69	0.58432	D	0.999997	D	0.89917	1.0	D	0.78314	0.991	T	0.51733	-0.8668	10	0.66056	D	0.02	-12.5912	11.8507	0.52410	0.1756:0.8244:0.0:0.0	.	59	Q8TBE1	CNIH3_HUMAN	C	59	ENSP00000272133:R59C	ENSP00000272133:R59C	R	+	1	0	CNIH3	222939145	0.998000	0.40836	0.997000	0.53966	0.994000	0.84299	2.526000	0.45607	2.063000	0.61619	0.551000	0.68910	CGC	-	NULL		0.532	CNIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNIH3	protein_coding	OTTHUMT00000091752.2	C	NM_152495	-		224872522	+1	no_errors	ENST00000272133	ensembl	human	known	74_37	missense	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76874272	76874272	+	Splice_Site	SNP	A	A	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chrX:76874272A>T	ENST00000373344.5	-	21	5663		c.e21+1		ATRX_ENST00000395603.3_Splice_Site|ATRX_ENST00000480283.1_Splice_Site	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ACATATTTGTACCTGAACACA	0.313			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						95.0	85.0	88.0					X																	76874272		2203	4295	6498	ATRX	SO:0001630	splice_region_variant	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5448+1T>A	X.37:g.76874272A>T		Somatic	0	112	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	49	25.76	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e21+2	ENST00000373344.5	37	c.5448+2	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	a	14.10	2.433813	0.43224	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400866	.	.	.	5.28	4.11	0.48088	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8731	0.46896	0.8567:0.0:0.0:0.1433	.	.	.	.	.	-1	.	.	.	-	.	.	ATRX	76760928	1.000000	0.71417	0.983000	0.44433	0.623000	0.37688	8.854000	0.92228	0.655000	0.30866	-0.396000	0.06452	.	-	-		0.313	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	A	NM_000489	-	Intron	76874272	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	splice_site	SNP	1.000	T
PLS1	5357	genome.wustl.edu	37	3	142405129	142405129	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr3:142405129T>A	ENST00000337777.3	+	9	1105	c.892T>A	c.(892-894)Tcg>Acg	p.S298T	PLS1_ENST00000497002.1_Missense_Mutation_p.S298T|PLS1_ENST00000457734.2_Missense_Mutation_p.S298T	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	298	Actin-binding 1.|CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						CTTGAAGGACTCGAGAGCCTA	0.378																																																	0								ENSG00000120756						130.0	121.0	124.0					3																	142405129		2203	4300	6503	PLS1	SO:0001583	missense	0			-	HGNC	L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.892T>A	3.37:g.142405129T>A	ENSP00000336831:p.Ser298Thr	Somatic	0	86	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	105	19.23	A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_EF_hand_dom,superfamily_CH-domain,smart_EF_hand_dom,smart_CH-domain,pfscan_CH-domain,pfscan_EF_hand_dom	p.S298T	ENST00000337777.3	37	c.892	CCDS3125.1	3	.	.	.	.	.	.	.	.	.	.	T	21.6	4.173066	0.78452	.	.	ENSG00000120756	ENST00000457734;ENST00000476044;ENST00000337777;ENST00000497002	D;D;D;D	0.95412	-3.7;-3.7;-3.7;-3.7	5.36	5.36	0.76844	Calponin homology domain (5);	0.055299	0.85682	D	0.000000	D	0.96494	0.8856	M	0.91920	3.255	0.80722	D	1	P	0.45044	0.849	B	0.43478	0.421	D	0.97312	0.9938	10	0.87932	D	0	-10.3311	15.5191	0.75851	0.0:0.0:0.0:1.0	.	298	Q14651	PLSI_HUMAN	T	298;219;298;298	ENSP00000387890:S298T;ENSP00000417481:S219T;ENSP00000336831:S298T;ENSP00000418700:S298T	ENSP00000336831:S298T	S	+	1	0	PLS1	143887819	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.762000	0.85270	2.239000	0.73571	0.533000	0.62120	TCG	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.378	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLS1	protein_coding	OTTHUMT00000354435.1	T	NM_002670	-		142405129	+1	no_errors	ENST00000337777	ensembl	human	known	74_37	missense	SNP	1.000	A
ATP1A4	480	genome.wustl.edu	37	1	160156148	160156148	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr1:160156148C>T	ENST00000368081.4	+	21	3523	c.3052C>T	c.(3052-3054)Cac>Tac	p.H1018Y	ATP1A4_ENST00000470705.1_Missense_Mutation_p.H154Y	NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	1018					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CATCCGTCAGCACCCGGATGG	0.567																																																	0								ENSG00000132681						154.0	158.0	157.0					1																	160156148		2203	4300	6503	ATP1A4	SO:0001583	missense	0			-	HGNC	BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.3052C>T	1.37:g.160156148C>T	ENSP00000357060:p.His1018Tyr	Somatic	0	17	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	12	33.33	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.H1018Y	ENST00000368081.4	37	c.3052	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	c	0.100	-1.154148	0.01700	.	.	ENSG00000132681	ENST00000368081;ENST00000470705	D;D	0.87491	-2.26;-2.26	4.88	-1.79	0.07932	ATPase, P-type,  transmembrane domain (1);	1.567720	0.04217	N	0.332829	T	0.49355	0.1552	N	0.04148	-0.265	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43491	-0.9388	10	0.27785	T	0.31	.	5.3586	0.16075	0.1549:0.3344:0.0:0.5107	.	1018	Q13733	AT1A4_HUMAN	Y	1018;154	ENSP00000357060:H1018Y;ENSP00000433094:H154Y	ENSP00000357060:H1018Y	H	+	1	0	ATP1A4	158422772	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	0.129000	0.15830	-0.221000	0.09973	0.444000	0.29173	CAC	-	tigrfam_ATPase_P-typ_Na/K_IIC		0.567	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	protein_coding	OTTHUMT00000077415.1	C	NM_144699	-		160156148	+1	no_errors	ENST00000368081	ensembl	human	known	74_37	missense	SNP	0.000	T
GNL3	26354	genome.wustl.edu	37	3	52727524	52727524	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr3:52727524G>T	ENST00000418458.1	+	12	1461	c.1288G>T	c.(1288-1290)Gaa>Taa	p.E430*	SNORD69_ENST00000391150.1_RNA|SNORD19_ENST00000410413.1_RNA|SNORD19B_ENST00000459623.1_RNA|GNL3_ENST00000394799.2_Nonsense_Mutation_p.E418*|GLT8D1_ENST00000463827.1_5'Flank	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	430	Intermediate. {ECO:0000250}.				cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		CTTCAATCTGGAAGAACTGGA	0.448																																																	0								ENSG00000163938						159.0	166.0	164.0					3																	52727524		2203	4300	6503	GNL3	SO:0001587	stop_gained	0			-	HGNC	AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.1288G>T	3.37:g.52727524G>T	ENSP00000395772:p.Glu430*	Somatic	0	46	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gnl3_N_dom,pfam_GTP_binding_domain,superfamily_P-loop_NTPase	p.E430*	ENST00000418458.1	37	c.1288	CCDS2861.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.273903	0.97431	.	.	ENSG00000163938	ENST00000418458;ENST00000394799	.	.	.	5.87	5.87	0.94306	.	0.281328	0.46145	D	0.000306	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	16.9296	0.86187	0.0:0.0:1.0:0.0	.	.	.	.	X	430;418	.	ENSP00000378278:E418X	E	+	1	0	GNL3	52702564	1.000000	0.71417	0.973000	0.42090	0.685000	0.39939	4.875000	0.63072	2.780000	0.95670	0.563000	0.77884	GAA	-	NULL		0.448	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3	protein_coding	OTTHUMT00000352032.1	G	NM_014366	-		52727524	+1	no_errors	ENST00000418458	ensembl	human	known	74_37	nonsense	SNP	0.999	T
JPH1	56704	genome.wustl.edu	37	8	75227251	75227251	+	Silent	SNP	C	C	T			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr8:75227251C>T	ENST00000342232.4	-	2	1024	c.984G>A	c.(982-984)gaG>gaA	p.E328E		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	328					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			TGTATTTTCCCTCTTCTTTGG	0.443																																																	0								ENSG00000104369						119.0	120.0	120.0					8																	75227251		2203	4300	6503	JPH1	SO:0001819	synonymous_variant	0			-	HGNC	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.984G>A	8.37:g.75227251C>T		Somatic	0	38	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	23	30.30	B2RTZ0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.E328	ENST00000342232.4	37	c.984	CCDS6217.1	8																																																																																			-	pirsf_Junctophilin		0.443	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH1	protein_coding	OTTHUMT00000379102.1	C		-		75227251	-1	no_errors	ENST00000342232	ensembl	human	known	74_37	silent	SNP	1.000	T
METTL21C	196541	genome.wustl.edu	37	13	103343313	103343313	+	Splice_Site	SNP	T	T	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr13:103343313T>A	ENST00000267273.6	-	2	137	c.132A>T	c.(130-132)gaA>gaT	p.E44D		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	44					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						TCTTGTTGGATTCTGTGAAGC	0.393																																																	0								ENSG00000139780						116.0	113.0	114.0					13																	103343313		2203	4300	6503	METTL21C	SO:0001630	splice_region_variant	0			-	HGNC		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.131-1A>T	13.37:g.103343313T>A		Somatic	0	47	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	39	22.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nicotinamide_N-MeTfrase-like	p.E44D	ENST00000267273.6	37	c.132	CCDS32003.1	13	.	.	.	.	.	.	.	.	.	.	T	3.818	-0.038417	0.07497	.	.	ENSG00000139780	ENST00000267273	T	0.13538	2.58	6.16	-3.97	0.04094	.	0.880378	0.09779	N	0.756952	T	0.03827	0.0108	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43261	-0.9402	10	0.13108	T	0.6	.	2.9461	0.05846	0.3162:0.219:0.3604:0.1044	.	44	Q5VZV1	MT21C_HUMAN	D	44	ENSP00000267273:E44D	ENSP00000267273:E44D	E	-	3	2	METTL21C	102141314	0.002000	0.14202	0.002000	0.10522	0.047000	0.14425	-0.232000	0.09055	-0.595000	0.05828	-0.309000	0.09137	GAA	-	NULL		0.393	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL21C	protein_coding	OTTHUMT00000045682.2	T	NM_001010977	-	Missense_Mutation	103343313	-1	no_errors	ENST00000267273	ensembl	human	known	74_37	missense	SNP	0.001	A
POM121L2	94026	genome.wustl.edu	37	6	27276926	27276926	+	Silent	SNP	A	A	C			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr6:27276926A>C	ENST00000444565.1	-	1	3023	c.3024T>G	c.(3022-3024)tcT>tcG	p.S1008S	POM121L2_ENST00000377451.2_Silent_p.S944S	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	1008										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						TGGAAAATGAAGAGGCTGATG	0.512																																																	0								ENSG00000158553						129.0	115.0	119.0					6																	27276926		692	1591	2283	POM121L2	SO:0001819	synonymous_variant	0			-	HGNC	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.3024T>G	6.37:g.27276926A>C		Somatic	0	69	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	51	32.00	C9J1I7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S1008	ENST00000444565.1	37	c.3024	CCDS59497.1	6																																																																																			-	NULL		0.512	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POM121L2	protein_coding	OTTHUMT00000040143.2	A	NM_033482	-		27276926	-1	no_errors	ENST00000444565	ensembl	human	known	74_37	silent	SNP	0.439	C
TMEM229A	730130	genome.wustl.edu	37	7	123672457	123672459	+	In_Frame_Del	DEL	GCT	GCT	-	rs71163719|rs374529977|rs566327350|rs72310362	byFrequency	TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr7:123672457_123672459delGCT	ENST00000455783.1	-	1	1064_1066	c.599_601delAGC	c.(598-603)cagcgg>cgg	p.Q200del	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	200						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						GCGCCCCTCCgctgctgctgctg	0.754														347	0.0692891	0.1271	0.0317	5008	,	,		13703	0.0417		0.0427	False		,,,				2504	0.0736																0								ENSG00000234224																																			TMEM229A	SO:0001651	inframe_deletion	0				HGNC	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.599_601delAGC	7.37:g.123672466_123672468delGCT	ENSP00000395244:p.Gln200del	Somatic	0	9	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00	A4D0X6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.Q200in_frame_del	ENST00000455783.1	37	c.601_599	CCDS47694.1	7																																																																																			-	NULL		0.754	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM229A	protein_coding	OTTHUMT00000336960.3	GCT	NM_001136002			123672459	-1	no_errors	ENST00000455783	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.001	-
APOB	338	genome.wustl.edu	37	2	21229754	21229754	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr2:21229754A>G	ENST00000233242.1	-	26	10113	c.9986T>C	c.(9985-9987)aTt>aCt	p.I3329T		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3329					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGGAATAAAAATATGGCTTAT	0.373																																																	0								ENSG00000084674						92.0	96.0	94.0					2																	21229754		2203	4300	6503	APOB	SO:0001583	missense	0			-	HGNC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.9986T>C	2.37:g.21229754A>G	ENSP00000233242:p.Ile3329Thr	Somatic	0	48	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	44	15.38	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.I3329T	ENST00000233242.1	37	c.9986	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	A	12.60	1.985671	0.35036	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.39229	1.09	5.41	5.41	0.78517	.	0.205262	0.33753	N	0.004596	T	0.73087	0.3542	M	0.93197	3.39	0.44432	D	0.997354	D	0.76494	0.999	D	0.79784	0.993	T	0.81265	-0.1011	10	0.72032	D	0.01	.	15.4433	0.75204	1.0:0.0:0.0:0.0	.	3329	P04114	APOB_HUMAN	T	3329	ENSP00000233242:I3329T	ENSP00000233242:I3329T	I	-	2	0	APOB	21083259	1.000000	0.71417	0.898000	0.35279	0.709000	0.40893	6.771000	0.74996	2.034000	0.60081	0.533000	0.62120	ATT	-	NULL		0.373	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	A		-		21229754	-1	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	SNP	0.142	G
OR4K14	122740	genome.wustl.edu	37	14	20482732	20482732	+	Silent	SNP	A	A	T	rs141271240	byFrequency	TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr14:20482732A>T	ENST00000305045.2	-	1	620	c.621T>A	c.(619-621)ctT>ctA	p.L207L		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		AGCTCAAGGAAAGCAACCCAC	0.502																																																	0								ENSG00000169484						88.0	81.0	83.0					14																	20482732		2203	4300	6503	OR4K14	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.621T>A	14.37:g.20482732A>T		Somatic	0	64	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	23	28.12	Q6IEU1|Q96R71	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L207	ENST00000305045.2	37	c.621	CCDS32027.1	14																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.502	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K14	protein_coding	OTTHUMT00000410343.1	A		-		20482732	-1	no_errors	ENST00000305045	ensembl	human	known	74_37	silent	SNP	0.001	T
CDC123	8872	genome.wustl.edu	37	10	12289026	12289028	+	Intron	DEL	TCC	TCC	-	rs5783246	byFrequency	TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr10:12289026_12289028delTCC	ENST00000281141.4	+	11	1126				RP11-186N15.3_ENST00000598961.1_RNA|CDC123_ENST00000455773.3_Intron|RP11-186N15.3_ENST00000421657.1_RNA|CDC123_ENST00000378900.2_Intron	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123						cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						GGACACTGTGTCCTCCTCTCTCA	0.606														1859	0.371206	0.2859	0.4409	5008	,	,		18842	0.2827		0.4622	False		,,,				2504	0.4346																0								ENSG00000228302																																			RP11-186N15.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.846+750TCC>-	10.37:g.12289029_12289031delTCC		Somatic	0	10	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	5	50.00	A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000281141.4	37	NULL	CCDS7090.1	10																																																																																			-	-		0.606	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228302	protein_coding	OTTHUMT00000046801.1	TCC	NM_006023			12289028	-1	no_errors	ENST00000421657	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.002	-
RAB1B	81876	genome.wustl.edu	37	11	66039143	66039143	+	Intron	DEL	A	A	-			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr11:66039143delA	ENST00000311481.6	+	2	161				RP11-867G23.3_ENST00000501708.1_lincRNA|RAB1B_ENST00000527397.1_Intron	NM_030981.2	NP_112243.1	Q9H0U4	RAB1B_HUMAN	RAB1B, member RAS oncogene family						ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of glycoprotein metabolic process (GO:1903020)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|virion assembly (GO:0019068)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)			large_intestine(2)|lung(1)|ovary(1)|prostate(1)	5						ccttattgctaaaaaaaaaat	0.498																																																	0								ENSG00000245156																																			RP11-867G23.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	AJ245875	CCDS31613.1	11q13.1	2008-02-05			ENSG00000174903	ENSG00000174903		"""RAB, member RAS oncogene"""	18370	protein-coding gene	gene with protein product		612565				9030196	Standard	NM_030981		Approved		uc001ohf.3	Q9H0U4	OTTHUMG00000166916	ENST00000311481.6:c.15-125A>-	11.37:g.66039143delA		Somatic	0	22	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	A8K7S1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000311481.6	37	NULL	CCDS31613.1	11																																																																																			-	-		0.498	RAB1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000245156	protein_coding	OTTHUMT00000391886.2	A	NM_030981			66039143	-1	no_errors	ENST00000501708	ensembl	human	known	74_37	rna	DEL	0.020	-
MSH3	4437	genome.wustl.edu	37	5	79950700	79950717	+	In_Frame_Del	DEL	GCAGCGGCTGCAGCGGCC	GCAGCGGCTGCAGCGGCC	-	rs530525176|rs2431220|rs2405875|rs144776112|rs201874762|rs201906899	byFrequency	TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	GCAGCGGCTGCAGCGGCC	GCAGCGGCTGCAGCGGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr5:79950700_79950717delGCAGCGGCTGCAGCGGCC	ENST00000265081.6	+	1	234_251	c.154_171delGCAGCGGCTGCAGCGGCC	c.(154-171)gcagcggctgcagcggccdel	p.AAAAAA52del	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000511032.1_5'Flank|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000513048.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	52	Poly-Ala.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CCCTGGCGCTgcagcggctgcagcggccgcagcggccg	0.693								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)												0								ENSG00000113318		,	1153,2933		197,759,1087					,		0.2		dbSNP_100	12	2199,5723		382,1435,2144	no	coding,utr-5	DHFR,MSH3	NM_002439.3,NM_000791.3	,	579,2194,3231	A1A1,A1R,RR		27.7581,28.2183,27.9147	,	,		3352,8656				MSH3	SO:0001651	inframe_deletion	0				HGNC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.154_171delGCAGCGGCTGCAGCGGCC	5.37:g.79950700_79950717delGCAGCGGCTGCAGCGGCC	ENSP00000265081:p.Ala52_Ala57del	Somatic	NA	NA	NA		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.AAAAAA55in_frame_del	ENST00000265081.6	37	c.154_171	CCDS34195.1	5																																																																																			-	NULL		0.693	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	protein_coding	OTTHUMT00000369471.1	GCAGCGGCTGCAGCGGCC	NM_002439			79950717	+1	no_errors	ENST00000265081	ensembl	human	known	74_37	in_frame_del	DEL	0.640:0.607:0.574:0.541:0.508:0.474:0.440:0.406:0.372:0.338:0.304:0.271:0.238:0.205:0.172:0.140:0.107:0.075	-
LRRC75A	388341	genome.wustl.edu	37	17	16343502	16343502	+	IGR	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr17:16343502G>A	ENST00000409083.3	-	0	2656				C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|RP11-138I1.3_ENST00000585048.1_lincRNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000384229.1_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA	NM_207387.3	NP_997270.2														lung(1)	1						CACCTAGGTTGCAAATTCGTG	0.483																																																	0								ENSG00000175061						129.0	117.0	121.0					17																	16343502		2203	4300	6503	C17orf76-AS1	SO:0001628	intergenic_variant	0			-	HGNC																													17.37:g.16343502G>A		Somatic	0	56	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	84	21.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409083.3	37	NULL	CCDS11178.2	17																																																																																			-	-		0.483	FAM211A-001	NOVEL	basic|exp_conf|CCDS	protein_coding	C17orf76-AS1	protein_coding	OTTHUMT00000130461.2	G		-		16343502	+1	no_errors	ENST00000460249	ensembl	human	known	74_37	rna	SNP	0.052	A
MAS1L	116511	genome.wustl.edu	37	6	29455533	29455533	+	Silent	SNP	G	G	A			TCGA-DX-AB37-01A-11D-A417-09	TCGA-DX-AB37-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	15076dc6-beed-4d04-be1d-56f27a846f2b	a997a9b9-974e-4494-b473-f7f442843b4c	g.chr6:29455533G>A	ENST00000377127.3	-	1	205	c.147C>T	c.(145-147)ggC>ggT	p.G49G		NM_052967.1	NP_443199.1	P35410	MAS1L_HUMAN	MAS1 proto-oncogene like, G protein-coupled receptor	49					G-protein coupled receptor signaling pathway (GO:0007186)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(7)|pancreas(1)|prostate(2)|skin(2)	28						GAAGAAAGACGCCACAGAGCT	0.502																																					NSCLC(153;755 1987 3859 11251 32945)												0								ENSG00000204687						89.0	88.0	88.0					6																	29455533		2203	4300	6503	MAS1L	SO:0001819	synonymous_variant	0			-	HGNC	S78653	CCDS4661.1	6p22.1	2014-06-26	2014-06-26		ENSG00000204687	ENSG00000204687		"""GPCR / Class A : Orphans"""	13961	protein-coding gene	gene with protein product		607235	"""MAS1 oncogene-like"""				Standard	NM_052967		Approved	MAS-L, MRG, dJ994E9.2	uc011dlq.2	P35410	OTTHUMG00000031089	ENST00000377127.3:c.147C>T	6.37:g.29455533G>A		Somatic	0	32	0.00		0.5167936412959764	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	29	17.14	Q5SUN5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.G49	ENST00000377127.3	37	c.147	CCDS4661.1	6																																																																																			-	NULL		0.502	MAS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1L	protein_coding	OTTHUMT00000076126.2	G	NM_052967	-		29455533	-1	no_errors	ENST00000377127	ensembl	human	known	74_37	silent	SNP	0.003	A
