#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CABLES1	91768	genome.wustl.edu	37	18	20716015	20716023	+	In_Frame_Del	DEL	GGCGCCGGC	GGCGCCGGC	-	rs201595073|rs139352344	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	GGCGCCGGC	GGCGCCGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr18:20716015_20716023delGGCGCCGGC	ENST00000256925.7	+	1	289_297	c.289_297delGGCGCCGGC	c.(289-297)ggcgccggcdel	p.GAG97del	CABLES1_ENST00000400473.2_Intron|AC105247.1_ENST00000411067.1_RNA	NM_001100619.2	NP_001094089.1	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1	97	Ala-rich.|Interacts with TDRD7. {ECO:0000250}.				blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|nervous system development (GO:0007399)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)	cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|stomach(1)	11	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ggccaagccgggcgccggcggcgcctgcg	0.785														1123	0.224241	0.2602	0.17	5008	,	,		3844	0.244		0.2048	False		,,,				2504	0.2137																0								ENSG00000134508																																			CABLES1	SO:0001651	inframe_deletion	0				HGNC	BC037218	CCDS42417.1, CCDS42418.1, CCDS58615.1	18q11.2	2005-08-16				ENSG00000134508			25097	protein-coding gene	gene with protein product		609194				12477932	Standard	NM_138375		Approved	HsT2563, FLJ35924	uc002kuc.2	Q8TDN4		ENST00000256925.7:c.289_297delGGCGCCGGC	18.37:g.20716015_20716023delGGCGCCGGC	ENSP00000256925:p.Gly97_Gly99del	Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DK60|Q8N3Y8|Q8NA22|Q9BTG1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,superfamily_Cyclin-like,pirsf_Cdk5/c-Abl_linker_Cables	p.GGA99in_frame_del	ENST00000256925.7	37	c.289_297	CCDS42417.1	18																																																																																			-	pirsf_Cdk5/c-Abl_linker_Cables		0.785	CABLES1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CABLES1	protein_coding	OTTHUMT00000445198.2	GGCGCCGGC	NM_138375			20716023	+1	no_errors	ENST00000256925	ensembl	human	known	74_37	in_frame_del	DEL	0.983:0.981:0.990:0.998:0.999:0.997:0.999:0.999:0.997	-
FAM120C	54954	genome.wustl.edu	37	X	54185981	54185981	+	Silent	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chrX:54185981G>T	ENST00000375180.2	-	2	824	c.768C>A	c.(766-768)ggC>ggA	p.G256G	FAM120C_ENST00000328235.4_Silent_p.G256G	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	256							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						GGGCAAGAAGGCCATGGAAGC	0.483																																																	0								ENSG00000184083						91.0	73.0	79.0					X																	54185981		2203	4300	6503	FAM120C	SO:0001819	synonymous_variant	0			-	HGNC	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.768C>A	X.37:g.54185981G>T		Somatic	0	38	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B2RMT7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G256	ENST00000375180.2	37	c.768	CCDS14356.1	X																																																																																			-	NULL		0.483	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	protein_coding	OTTHUMT00000056795.2	G	NM_017848	-		54185981	-1	no_errors	ENST00000375180	ensembl	human	known	74_37	silent	SNP	0.964	T
CA4	762	genome.wustl.edu	37	17	58235772	58235772	+	Missense_Mutation	SNP	G	G	A	rs2229178	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr17:58235772G>A	ENST00000300900.4	+	7	808	c.709G>A	c.(709-711)Gtg>Atg	p.V237M		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	237			V -> L (in dbSNP:rs2229178).		bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	CGTCTGGACTGTGTTCCGGGA	0.602																																																	0								ENSG00000167434						80.0	67.0	72.0					17																	58235772		2203	4300	6503	CA4	SO:0001583	missense	0			-	HGNC	L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.709G>A	17.37:g.58235772G>A	ENSP00000300900:p.Val237Met	Somatic	0	24	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	46	17.86	B4DQA4|Q6FHI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.V237M	ENST00000300900.4	37	c.709	CCDS11624.1	17	.	.	.	.	.	.	.	.	.	.	G	17.15	3.316565	0.60524	.	.	ENSG00000167434	ENST00000300900	T	0.80738	-1.41	5.54	5.54	0.83059	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.202895	0.43110	D	0.000602	D	0.91805	0.7407	M	0.92219	3.285	0.51233	D	0.999916	D	0.89917	1.0	D	0.97110	1.0	D	0.93375	0.6738	10	0.87932	D	0	.	14.9783	0.71293	0.0:0.0:1.0:0.0	.	237	P22748	CAH4_HUMAN	M	237	ENSP00000300900:V237M	ENSP00000300900:V237M	V	+	1	0	CA4	55590554	0.982000	0.34865	0.961000	0.40146	0.495000	0.33615	1.752000	0.38349	2.589000	0.87451	0.491000	0.48974	GTG	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a		0.602	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA4	protein_coding	OTTHUMT00000449189.1	G	NM_000717	-		58235772	+1	no_errors	ENST00000300900	ensembl	human	known	74_37	missense	SNP	0.977	A
GOLGA6L4	643707	genome.wustl.edu	37	15	82932257	82932288	+	5'UTR	DEL	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC	-	rs555363824	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	ACACAAATAAATTTAAACTATAAATTAGAAAC	ACACAAATAAATTTAAACTATAAATTAGAAAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr15:82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC	ENST00000560844.1	-	0	2502_2533																				NS(1)	1						taaattagaaacacaaataaatttaaactataaattagaaacacaaataaat	0.207																																																	0								ENSG00000215749																																			RP13-996F3.5	SO:0001623	5_prime_UTR_variant	0				Clone_based_vega_gene																												ENST00000560844.1:c.-1851GTTTCTAATTTATAGTTTAAATTTATTTGTGT>-	15.37:g.82932257_82932288delACACAAATAAATTTAAACTATAAATTAGAAAC		Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560844.1	37	NULL		15																																																																																			-	-		0.207	RP13-996F3.5-002	KNOWN	basic	processed_transcript	GOLGA6L4	protein_coding	OTTHUMT00000419267.1	ACACAAATAAATTTAAACTATAAATTAGAAAC				82932288	-1	no_errors	ENST00000560844	ensembl	human	known	74_37	rna	DEL	0.140:0.148:0.154:0.160:0.165:0.169:0.172:0.175:0.177:0.178:0.179:0.179:0.180:0.179:0.135:0.131:0.126:0.121:0.112:0.097:0.077:0.050:0.041:0.040:0.045:0.047:0.048:0.046:0.049:0.052:0.050:0.046	-
TBL1Y	90665	genome.wustl.edu	37	Y	6948851	6948851	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chrY:6948851G>T	ENST00000383032.1	+	14	1681	c.1034G>T	c.(1033-1035)aGg>aTg	p.R345M	TBL1Y_ENST00000346432.3_Missense_Mutation_p.R345M|TBL1Y_ENST00000355162.2_Missense_Mutation_p.R345M	NM_033284.1	NP_150600.1	Q9BQ87	TBL1Y_HUMAN	transducin (beta)-like 1, Y-linked	345					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)|skin(1)	8						CATGTGTGCAGGCTCGGCTGT	0.552																																																	0								ENSG00000092377																																			TBL1Y	SO:0001583	missense	0			-	HGNC	AF332220	CCDS14779.1	Yp11.2	2013-01-10	2009-12-17		ENSG00000092377	ENSG00000092377		"""WD repeat domain containing"""	18502	protein-coding gene	gene with protein product		400033					Standard	NM_033284		Approved	TBL1	uc004frd.3	Q9BQ87	OTTHUMG00000035299	ENST00000383032.1:c.1034G>T	Y.37:g.6948851G>T	ENSP00000372499:p.Arg345Met	Somatic	0	22	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	A1L4B3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R345M	ENST00000383032.1	37	c.1034	CCDS14779.1	Y																																																																																			-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.552	TBL1Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL1Y	protein_coding	OTTHUMT00000085360.1	G	NM_033284	-		6948851	+1	no_errors	ENST00000346432	ensembl	human	known	74_37	missense	SNP	0.987	T
PPM1B	5495	genome.wustl.edu	37	2	44459458	44459458	+	IGR	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:44459458G>A	ENST00000282412.4	+	0	2606				PPM1B_ENST00000378551.2_Missense_Mutation_p.A380T|PPM1B_ENST00000378540.4_Intron	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B						cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CCTGTAGGGTGCTGGAGATCT	0.323																																																	0								ENSG00000138032						109.0	123.0	118.0					2																	44459458		2203	4300	6503	PPM1B	SO:0001628	intergenic_variant	0			-	HGNC	AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757		2.37:g.44459458G>A		Somatic	0	52	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PP2C-like_dom,pfam_PP2C_C,superfamily_PP2C-like_dom,superfamily_PP2C_C,smart_PP2C-like_dom	p.A380T	ENST00000282412.4	37	c.1138	CCDS1817.1	2	.	.	.	.	.	.	.	.	.	.	G	11.63	1.694835	0.30052	.	.	ENSG00000138032	ENST00000378551	T	0.23147	1.92	5.77	5.77	0.91146	.	.	.	.	.	T	0.20210	0.0486	N	0.24115	0.695	0.80722	D	1	B	0.10296	0.003	B	0.12156	0.007	T	0.02190	-1.1198	9	0.56958	D	0.05	.	14.4374	0.67290	0.0:0.0:0.7412:0.2588	.	380	O75688-2	.	T	380	ENSP00000367813:A380T	ENSP00000367813:A380T	A	+	1	0	PPM1B	44312962	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.052000	0.57420	2.928000	0.99379	0.638000	0.83543	GCT	-	NULL		0.323	PPM1B-001	KNOWN	basic|CCDS	protein_coding	PPM1B	protein_coding	OTTHUMT00000250672.1	G	NM_002706	-		44459458	+1	no_errors	ENST00000378551	ensembl	human	known	74_37	missense	SNP	1.000	A
TACR1	6869	genome.wustl.edu	37	2	75425694	75425698	+	Frame_Shift_Del	DEL	TGGAG	TGGAG	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	TGGAG	TGGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:75425694_75425698delTGGAG	ENST00000305249.5	-	1	1128_1132	c.363_367delCTCCA	c.(361-369)tactccatgfs	p.SM122fs	TACR1_ENST00000409848.3_Frame_Shift_Del_p.SM122fs	NM_001058.3	NP_001049.1	P25103	NK1R_HUMAN	tachykinin receptor 1	122					acute inflammatory response (GO:0002526)|aggressive behavior (GO:0002118)|angiotensin-mediated drinking behavior (GO:0003051)|associative learning (GO:0008306)|behavioral response to pain (GO:0048266)|detection of abiotic stimulus (GO:0009582)|eating behavior (GO:0042755)|inflammatory response (GO:0006954)|long-term memory (GO:0007616)|operant conditioning (GO:0035106)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of action potential (GO:0045760)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of ossification (GO:0045778)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of saliva secretion (GO:0046878)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of uterine smooth muscle contraction (GO:0070474)|positive regulation of vascular permeability (GO:0043117)|positive regulation of vasoconstriction (GO:0045907)|regulation of smooth muscle cell migration (GO:0014910)|regulation of smooth muscle cell proliferation (GO:0048660)|response to auditory stimulus (GO:0010996)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to ozone (GO:0010193)|response to progesterone (GO:0032570)|smooth muscle contraction involved in micturition (GO:0060083)|sperm ejaculation (GO:0042713)|tachykinin receptor signaling pathway (GO:0007217)	cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	substance P receptor activity (GO:0016496)|tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(8)|ovary(1)|skin(1)	24					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	ACAGCCGTCATGGAGTAGATACTGG	0.502																																					Pancreas(64;62 1268 3653 14826 43765)												0								ENSG00000115353																																			TACR1	SO:0001589	frameshift_variant	0				HGNC	M76675	CCDS1958.1, CCDS46345.1	2p13.1-p12	2012-08-08			ENSG00000115353	ENSG00000115353		"""GPCR / Class A : Tachykinin receptors"""	11526	protein-coding gene	gene with protein product		162323		TAC1R		1657150	Standard	NM_001058		Approved	SPR, NK1R, NKIR	uc002sng.2	P25103	OTTHUMG00000129973	ENST00000305249.5:c.363_367delCTCCA	2.37:g.75425694_75425698delTGGAG	ENSP00000303522:p.Ser122fs	Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K150	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_NK1_rcpt,prints_Neurokn_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NK3_rcpt	p.S122fs	ENST00000305249.5	37	c.367_363	CCDS1958.1	2																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt		0.502	TACR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACR1	protein_coding	OTTHUMT00000252239.3	TGGAG	NM_001058			75425698	-1	no_errors	ENST00000305249	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000	-
EDAR	10913	genome.wustl.edu	37	2	109545698	109545698	+	Silent	SNP	T	T	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:109545698T>A	ENST00000258443.2	-	4	742	c.312A>T	c.(310-312)ccA>ccT	p.P104P	EDAR_ENST00000376651.1_Silent_p.P104P|EDAR_ENST00000409271.1_Silent_p.P104P	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor	104					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						CCATGTCCCCTGGTGTCAGCA	0.607																																																	0								ENSG00000135960						83.0	63.0	70.0					2																	109545698		2203	4300	6503	EDAR	SO:0001819	synonymous_variant	0			-	HGNC	AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.312A>T	2.37:g.109545698T>A		Somatic	0	76	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Death_domain,superfamily_DEATH-like_dom	p.P104	ENST00000258443.2	37	c.312	CCDS2081.1	2																																																																																			-	NULL		0.607	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDAR	protein_coding	OTTHUMT00000253595.1	T		-		109545698	-1	no_errors	ENST00000376651	ensembl	human	known	74_37	silent	SNP	0.011	A
TRHDE	29953	genome.wustl.edu	37	12	73050729	73050729	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr12:73050729A>G	ENST00000261180.4	+	18	2968	c.2872A>G	c.(2872-2874)Aat>Gat	p.N958D		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	958				N -> Y (in Ref. 2; AAQ89125). {ECO:0000305}.	cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						ATTGTTTATGAATTCCAAACT	0.264																																																	0								ENSG00000072657						83.0	93.0	89.0					12																	73050729		2203	4298	6501	TRHDE	SO:0001583	missense	0			-	HGNC	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2872A>G	12.37:g.73050729A>G	ENSP00000261180:p.Asn958Asp	Somatic	0	158	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	91	14.15	A5PL19|Q6UWJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.N958D	ENST00000261180.4	37	c.2872	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	A	23.6	4.437620	0.83885	.	.	ENSG00000072657	ENST00000261180	T	0.05199	3.48	5.2	5.2	0.72013	.	0.048592	0.85682	D	0.000000	T	0.17365	0.0417	L	0.44542	1.39	0.58432	D	0.999999	D	0.64830	0.994	D	0.64506	0.926	T	0.00357	-1.1792	10	0.72032	D	0.01	.	15.3904	0.74739	1.0:0.0:0.0:0.0	.	958	Q9UKU6	TRHDE_HUMAN	D	958	ENSP00000261180:N958D	ENSP00000261180:N958D	N	+	1	0	TRHDE	71336996	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.910000	0.92685	2.090000	0.63153	0.460000	0.39030	AAT	-	NULL		0.264	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	protein_coding	OTTHUMT00000405380.1	A	NM_013381	-		73050729	+1	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	SNP	1.000	G
DPY19L3	147991	genome.wustl.edu	37	19	32899229	32899229	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:32899229G>C	ENST00000342179.5	+	2	285	c.70G>C	c.(70-72)Gaa>Caa	p.E24Q	DPY19L3_ENST00000586987.1_Missense_Mutation_p.E24Q|DPY19L3_ENST00000587077.2_Missense_Mutation_p.E24Q|AC007773.2_ENST00000595727.1_RNA|AC007773.2_ENST00000592680.2_RNA|DPY19L3_ENST00000392250.2_Missense_Mutation_p.E24Q	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	24						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					AGCCCAAGAAGAAAATGTGAA	0.373																																																	0								ENSG00000178904						84.0	84.0	84.0					19																	32899229		2203	4300	6503	DPY19L3	SO:0001583	missense	0			-	HGNC		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.70G>C	19.37:g.32899229G>C	ENSP00000344937:p.Glu24Gln	Somatic	0	115	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	132	22.22	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dpy-19	p.E24Q	ENST00000342179.5	37	c.70	CCDS12422.1	19	.	.	.	.	.	.	.	.	.	.	G	13.76	2.332548	0.41297	.	.	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179;ENST00000392248	T;T	0.60548	0.18;0.18	5.42	4.38	0.52667	.	0.192982	0.39210	N	0.001425	T	0.39708	0.1088	N	0.24115	0.695	0.24569	N	0.993933	B;P	0.41848	0.001;0.763	B;B	0.39027	0.004;0.288	T	0.26643	-1.0097	10	0.29301	T	0.29	-12.6132	9.4152	0.38517	0.0955:0.0:0.9045:0.0	.	24;24	Q6ZPD9;Q8N6Q4	D19L3_HUMAN;.	Q	24	ENSP00000376081:E24Q;ENSP00000344937:E24Q	ENSP00000315672:E24Q	E	+	1	0	DPY19L3	37591069	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.834000	0.48167	2.689000	0.91719	0.650000	0.86243	GAA	-	NULL		0.373	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L3	protein_coding	OTTHUMT00000450311.1	G	NM_207325	-		32899229	+1	no_errors	ENST00000342179	ensembl	human	known	74_37	missense	SNP	1.000	C
ABCB5	340273	genome.wustl.edu	37	7	20739461	20739461	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr7:20739461A>G	ENST00000404938.2	+	18	2820	c.2168A>G	c.(2167-2169)aAt>aGt	p.N723S	ABCB5_ENST00000258738.6_Missense_Mutation_p.N278S	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	723	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						TTTGGAAATAATGATAAAACC	0.303																																																	0								ENSG00000004846						122.0	116.0	118.0					7																	20739461		2203	4298	6501	ABCB5	SO:0001583	missense	0			-	HGNC	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2168A>G	7.37:g.20739461A>G	ENSP00000384881:p.Asn723Ser	Somatic	0	111	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.N278S	ENST00000404938.2	37	c.833	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	A	0.838	-0.742896	0.03088	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	T;T	0.80123	-1.34;-1.34	5.51	4.34	0.51931	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	1.237090	0.06335	U	0.706850	T	0.71685	0.3369	N	0.25426	0.745	0.09310	N	1	B;B	0.14012	0.004;0.009	B;B	0.25987	0.016;0.065	T	0.55661	-0.8106	10	0.15499	T	0.54	.	9.9674	0.41732	0.9167:0.0:0.0833:0.0	.	723;278	A7BKA4;Q2M3G0	.;ABCB5_HUMAN	S	723;278	ENSP00000384881:N723S;ENSP00000258738:N278S	ENSP00000258738:N278S	N	+	2	0	ABCB5	20705986	0.040000	0.19996	0.779000	0.31741	0.287000	0.27160	1.635000	0.37134	2.087000	0.62958	0.397000	0.26171	AAT	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom		0.303	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	protein_coding	OTTHUMT00000326736.2	A	NM_178559	-		20739461	+1	no_errors	ENST00000258738	ensembl	human	known	74_37	missense	SNP	0.409	G
RMDN2	151393	genome.wustl.edu	37	2	38178783	38178783	+	Intron	DEL	T	T	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:38178783delT	ENST00000406384.1	+	2	646				RMDN2_ENST00000407257.1_Frame_Shift_Del_p.I142fs|RMDN2_ENST00000402091.3_Frame_Shift_Del_p.I142fs|RMDN2_ENST00000417700.2_Intron|RMDN2_ENST00000354545.2_Intron|RMDN2_ENST00000234195.3_Frame_Shift_Del_p.I142fs|RMDN2-AS1_ENST00000414365.2_RNA	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											AAGAGTGCCATTTTTTTTGAT	0.333																																																	0								ENSG00000115841						67.0	73.0	71.0					2																	38178783		2195	4296	6491	RMDN2	SO:0001627	intron_variant	0				HGNC	AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.452+21911T>-	2.37:g.38178783delT		Somatic	0	33	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.F144fs	ENST00000406384.1	37	c.425	CCDS54351.1	2																																																																																			-	NULL		0.333	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMDN2	protein_coding	OTTHUMT00000325577.1	T	NM_144713			38178783	+1	no_errors	ENST00000234195	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
GOLGA6L6	727832	genome.wustl.edu	37	15	20739938	20739943	+	In_Frame_Del	DEL	CTCCTG	CTCCTG	-	rs201222558		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	CTCCTG	CTCCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr15:20739938_20739943delCTCCTG	ENST00000427390.2	-	8	1897_1902	c.1807_1812delCAGGAG	c.(1807-1812)caggagdel	p.QE603del		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	603	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						acatcttctcctcctgctcctgcctc	0.553																																																	0								ENSG00000215405			8,1308		2,4,652							0.0			5	46,2864		5,36,1414	no	coding	GOLGA6L6	NM_001145004.1		7,40,2066	A1A1,A1R,RR		1.5808,0.6079,1.2778				54,4172				GOLGA6L6	SO:0001651	inframe_deletion	0				HGNC	AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1807_1812delCAGGAG	15.37:g.20739944_20739949delCTCCTG	ENSP00000398615:p.Gln603_Glu604del	Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3YTC0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.QE603in_frame_del	ENST00000427390.2	37	c.1812_1807	CCDS45184.1	15																																																																																			-	NULL		0.553	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	protein_coding	OTTHUMT00000414660.3	CTCCTG	NM_001145004			20739943	-1	no_errors	ENST00000427390	ensembl	human	known	74_37	in_frame_del	DEL	0.795:0.773:0.743:0.715:0.709:0.706	-
LRRIQ1	84125	genome.wustl.edu	37	12	85546891	85546891	+	Silent	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr12:85546891G>A	ENST00000393217.2	+	21	4570	c.4509G>A	c.(4507-4509)ttG>ttA	p.L1503L		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1503										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		AAGAAAATTTGTCTTCTTCAG	0.303																																																	0								ENSG00000133640						91.0	87.0	88.0					12																	85546891		1827	4066	5893	LRRIQ1	SO:0001819	synonymous_variant	0			-	HGNC	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.4509G>A	12.37:g.85546891G>A		Somatic	0	153	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	1029	57	94.66	Q567P4|Q9BS17|Q9HA36	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.L1503	ENST00000393217.2	37	c.4509	CCDS41816.1	12																																																																																			-	NULL		0.303	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	protein_coding	OTTHUMT00000388249.2	G	NM_032165	-		85546891	+1	no_errors	ENST00000393217	ensembl	human	known	74_37	silent	SNP	0.018	A
MPZL1	9019	genome.wustl.edu	37	1	167757562	167757562	+	3'UTR	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:167757562G>A	ENST00000359523.2	+	0	1416				MPZL1_ENST00000403379.3_3'UTR|MPZL1_ENST00000392121.3_3'UTR	NM_003953.5|NM_024569.4	NP_003944.1|NP_078845.3	O95297	MPZL1_HUMAN	myelin protein zero-like 1						cell-cell signaling (GO:0007267)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(2)	15	all_hematologic(923;0.215)					GCTTAAGACTGATTAGTCTTA	0.403																																																	0								ENSG00000197965																																			MPZL1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF087020	CCDS1264.1, CCDS44273.1, CCDS53425.1	1q24.2	2013-01-11			ENSG00000197965	ENSG00000197965		"""Immunoglobulin superfamily / V-set domain containing"""	7226	protein-coding gene	gene with protein product		604376				9792637	Standard	NM_003953		Approved	PZR, FLJ21047	uc001geo.3	O95297	OTTHUMG00000034571	ENST00000359523.2:c.*404G>A	1.37:g.167757562G>A		Somatic	0	53	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	81	53	60.00	B2REB9|B2REC0|Q5R332|Q8IX11|Q9BWZ3|Q9NYK4|Q9UL20	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359523.2	37	NULL	CCDS1264.1	1																																																																																			-	-		0.403	MPZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPZL1	protein_coding	OTTHUMT00000083655.2	G	NM_024569	-		167757562	+1	no_errors	ENST00000403379	ensembl	human	putative	74_37	rna	SNP	0.359	A
ISCA1	81689	genome.wustl.edu	37	9	88886926	88886926	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:88886926delT	ENST00000375991.4	-	3	307	c.237delA	c.(235-237)caafs	p.Q79fs	ISCA1_ENST00000326094.4_Frame_Shift_Del_p.Q79fs|ISCA1_ENST00000311534.6_5'UTR|ISCA1_ENST00000452279.2_Frame_Shift_Del_p.Q126fs	NM_030940.3	NP_112202.2	Q9BUE6	ISCA1_HUMAN	iron-sulfur cluster assembly 1	79					iron-sulfur cluster assembly (GO:0016226)	mitochondrion (GO:0005739)	iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)	8				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		ACTCACCATCTTGAATAACTT	0.353																																																	0								ENSG00000135070						123.0	119.0	121.0					9																	88886926		2203	4300	6503	ISCA1	SO:0001589	frameshift_variant	0				HGNC	AF038186	CCDS35056.1	9q22.1	2013-08-06	2013-08-06	2007-01-18	ENSG00000135070	ENSG00000135070			28660	protein-coding gene	gene with protein product		611006	"""HESB like domain containing 2"", ""iron-sulfur cluster assembly 1 homolog (S. cerevisiae)"""	HBLD2		15262227, 22323289	Standard	NM_030940		Approved	MGC4276, ISA1, hIscA	uc004aop.3	Q9BUE6	OTTHUMG00000020135	ENST00000375991.4:c.237delA	9.37:g.88886926delT	ENSP00000365159:p.Gln79fs	Somatic	0	119	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	67	16.25	B3KP34|B4DJI5|Q8ND75|Q9BZR2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion	p.D127fs	ENST00000375991.4	37	c.378	CCDS35056.1	9																																																																																			-	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion		0.353	ISCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISCA1	protein_coding	OTTHUMT00000052914.1	T	NM_030940			88886926	-1	no_errors	ENST00000452279	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ISCA1	81689	genome.wustl.edu	37	9	88886929	88886929	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:88886929delA	ENST00000375991.4	-	3	304	c.234delT	c.(232-234)attfs	p.I78fs	ISCA1_ENST00000326094.4_Frame_Shift_Del_p.I78fs|ISCA1_ENST00000311534.6_5'UTR|ISCA1_ENST00000452279.2_Frame_Shift_Del_p.I125fs	NM_030940.3	NP_112202.2	Q9BUE6	ISCA1_HUMAN	iron-sulfur cluster assembly 1	78					iron-sulfur cluster assembly (GO:0016226)	mitochondrion (GO:0005739)	iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)	8				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		CACCATCTTGAATAACTTCTT	0.363																																																	0								ENSG00000135070						125.0	121.0	122.0					9																	88886929		2203	4300	6503	ISCA1	SO:0001589	frameshift_variant	0				HGNC	AF038186	CCDS35056.1	9q22.1	2013-08-06	2013-08-06	2007-01-18	ENSG00000135070	ENSG00000135070			28660	protein-coding gene	gene with protein product		611006	"""HESB like domain containing 2"", ""iron-sulfur cluster assembly 1 homolog (S. cerevisiae)"""	HBLD2		15262227, 22323289	Standard	NM_030940		Approved	MGC4276, ISA1, hIscA	uc004aop.3	Q9BUE6	OTTHUMG00000020135	ENST00000375991.4:c.234delT	9.37:g.88886929delA	ENSP00000365159:p.Ile78fs	Somatic	0	122	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	65	16.67	B3KP34|B4DJI5|Q8ND75|Q9BZR2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion	p.Q126fs	ENST00000375991.4	37	c.375	CCDS35056.1	9																																																																																			-	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion		0.363	ISCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISCA1	protein_coding	OTTHUMT00000052914.1	A	NM_030940			88886929	-1	no_errors	ENST00000452279	ensembl	human	known	74_37	frame_shift_del	DEL	0.997	-
PTGS1	5742	genome.wustl.edu	37	9	125148995	125148995	+	Missense_Mutation	SNP	G	G	T	rs144142084		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:125148995G>T	ENST00000362012.2	+	9	1285	c.1280G>T	c.(1279-1281)cGc>cTc	p.R427L	AL162424.1_ENST00000600713.1_5'Flank|PTGS1_ENST00000373698.5_Missense_Mutation_p.R318L|PTGS1_ENST00000540753.1_Intron|PTGS1_ENST00000223423.4_Intron	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	427					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	GCCTTCTCTCGCCAGATTGCT	0.577																																																	0								ENSG00000095303						75.0	64.0	68.0					9																	125148995		2203	4300	6503	PTGS1	SO:0001583	missense	0			-	HGNC	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.1280G>T	9.37:g.125148995G>T	ENSP00000354612:p.Arg427Leu	Somatic	0	50	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_EG-like_dom,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.R427L	ENST00000362012.2	37	c.1280	CCDS6842.1	9	.	.	.	.	.	.	.	.	.	.	G	11.53	1.665404	0.29604	.	.	ENSG00000095303	ENST00000362012;ENST00000373698	T;T	0.68624	-0.34;-0.34	5.01	4.12	0.48240	.	0.362967	0.27535	N	0.018934	T	0.57784	0.2077	L	0.59436	1.845	0.36613	D	0.875315	B	0.14012	0.009	B	0.16722	0.016	T	0.60949	-0.7161	10	0.59425	D	0.04	-17.9876	4.0825	0.09932	0.2483:0.0:0.584:0.1676	.	427	P23219	PGH1_HUMAN	L	427;318	ENSP00000354612:R427L;ENSP00000362802:R318L	ENSP00000354612:R427L	R	+	2	0	PTGS1	124188816	0.981000	0.34729	1.000000	0.80357	0.671000	0.39405	0.828000	0.27435	1.113000	0.41760	-0.140000	0.14226	CGC	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.577	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGS1	protein_coding	OTTHUMT00000053933.1	G		-		125148995	+1	no_errors	ENST00000362012	ensembl	human	known	74_37	missense	SNP	0.939	T
CELP	1057	genome.wustl.edu	37	9	135962555	135962556	+	RNA	INS	-	-	CTGCC	rs370202675|rs58402826|rs112009079		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:135962555_135962556insCTGCC	ENST00000411440.2	+	0	1062_1063					NR_001275.2				carboxyl ester lipase pseudogene																		TGACTCTGAGGCCCGTGCCCAC	0.624																																																	0								ENSG00000170827																																			CELP			0				HGNC	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962555_135962556insCTGCC		Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			-	-		0.624	CELP-002	KNOWN	basic	processed_transcript	CELP	pseudogene	OTTHUMT00000339837.1	-	NM_001808			135962556	+1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	INS	0.038:0.013	CTGCC
PHEX	5251	genome.wustl.edu	37	X	22263450	22263450	+	Splice_Site	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chrX:22263450G>T	ENST00000379374.4	+	21	2636	c.2071G>T	c.(2071-2073)Gtg>Ttg	p.V691L	PHEX_ENST00000535894.1_Splice_Site_p.V594L|PHEX_ENST00000418858.3_Splice_Site_p.V394L|PHEX_ENST00000537599.1_Intron	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	691					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						TCTCTTCTAGGTGAGGTGCAA	0.428																																																	0								ENSG00000102174						166.0	153.0	157.0					X																	22263450		2203	4300	6503	PHEX	SO:0001630	splice_region_variant	0			-	HGNC	U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.2071-1G>T	X.37:g.22263450G>T		Somatic	0	49	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	O00678|Q13646|Q2M325|Q93032|Q99827	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.V691L	ENST00000379374.4	37	c.2071	CCDS14204.1	X	.	.	.	.	.	.	.	.	.	.	G	19.85	3.904215	0.72754	.	.	ENSG00000102174	ENST00000379374;ENST00000535894;ENST00000418858	D;D;D	0.82711	-1.64;-1.64;-1.64	5.82	5.82	0.92795	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.058639	0.64402	D	0.000002	D	0.82300	0.5007	L	0.39147	1.195	0.58432	D	0.999991	D	0.58970	0.984	P	0.49451	0.611	T	0.81193	-0.1044	9	.	.	.	-12.1985	17.2568	0.87059	0.0:0.0:1.0:0.0	.	691	P78562	PHEX_HUMAN	L	691;594;394	ENSP00000368682:V691L;ENSP00000439418:V594L;ENSP00000443531:V394L	.	V	+	1	0	PHEX	22173371	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.561000	0.67339	2.457000	0.83068	0.544000	0.68410	GTG	-	pfam_Peptidase_M13_C		0.428	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHEX	protein_coding	OTTHUMT00000056035.1	G	NM_000444	-	Missense_Mutation	22263450	+1	no_errors	ENST00000379374	ensembl	human	known	74_37	missense	SNP	1.000	T
PLK3	1263	genome.wustl.edu	37	1	45271296	45271296	+	Silent	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:45271296G>T	ENST00000372201.4	+	15	2126	c.1887G>T	c.(1885-1887)ctG>ctT	p.L629L	BTBD19_ENST00000453418.1_5'Flank|BTBD19_ENST00000450269.1_5'Flank|PLK3_ENST00000465443.1_3'UTR|BTBD19_ENST00000409335.2_5'Flank	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	629	POLO box 2. {ECO:0000255|PROSITE- ProRule:PRU00154}.				apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					CTCCAGACCTGCGGCAGCGAC	0.652																																																	0								ENSG00000173846						78.0	76.0	77.0					1																	45271296		2203	4300	6503	PLK3	SO:0001819	synonymous_variant	0			-	HGNC	AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.1887G>T	1.37:g.45271296G>T		Somatic	0	45	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	Q15767|Q5JR99|Q96CV1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_dom	p.L629	ENST00000372201.4	37	c.1887	CCDS515.1	1																																																																																			-	pfam_POLO_box_duplicated_dom,pfscan_POLO_box_duplicated_dom		0.652	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK3	protein_coding	OTTHUMT00000023429.1	G	NM_004073	-		45271296	+1	no_errors	ENST00000372201	ensembl	human	known	74_37	silent	SNP	0.944	T
BCL9L	283149	genome.wustl.edu	37	11	118770652	118770652	+	Frame_Shift_Del	DEL	G	G	-	rs139987150		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr11:118770652delG	ENST00000334801.3	-	7	4344	c.3380delC	c.(3379-3381)ccafs	p.P1130fs	BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	1130	Pro-rich.				canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		CGGTGGTGGTGGGGGGGGCAG	0.706																																																	0								ENSG00000186174						35.0	36.0	36.0					11																	118770652		2199	4294	6493	BCL9L	SO:0001589	frameshift_variant	0				HGNC	AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.3380delC	11.37:g.118770652delG	ENSP00000335320:p.Pro1130fs	Somatic	0	28	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_BCL9_beta-catenin-bd_dom	p.P1127fs	ENST00000334801.3	37	c.3380	CCDS8403.1	11																																																																																			-	NULL		0.706	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	protein_coding	OTTHUMT00000389653.1	G	NM_182557			118770652	-1	no_errors	ENST00000334801	ensembl	human	known	74_37	frame_shift_del	DEL	0.996	-
ATRX	546	genome.wustl.edu	37	X	76937678	76937678	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chrX:76937678C>A	ENST00000373344.5	-	9	3284	c.3070G>T	c.(3070-3072)Gaa>Taa	p.E1024*	ATRX_ENST00000395603.3_Nonsense_Mutation_p.E986*|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1024					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TGACAAATTTCTTCTCGCTCA	0.289			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						65.0	68.0	67.0					X																	76937678		2195	4286	6481	ATRX	SO:0001587	stop_gained	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.3070G>T	X.37:g.76937678C>A	ENSP00000362441:p.Glu1024*	Somatic	0	27	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	0	100.00	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E1024*	ENST00000373344.5	37	c.3070	CCDS14434.1	X	.	.	.	.	.	.	.	.	.	.	C	42	9.546347	0.99201	.	.	ENSG00000085224	ENST00000373344;ENST00000395603;ENST00000400862	.	.	.	5.56	4.7	0.59300	.	1.074000	0.07091	N	0.838731	.	.	.	.	.	.	0.29270	N	0.870732	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-1.164	2.4962	0.04622	0.1437:0.5322:0.1549:0.1692	.	.	.	.	X	1024;986;951	.	ENSP00000362441:E1024X	E	-	1	0	ATRX	76824334	0.975000	0.34042	0.147000	0.22382	0.925000	0.55904	1.203000	0.32284	1.104000	0.41587	0.513000	0.50165	GAA	-	NULL		0.289	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	C	NM_000489	-		76937678	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	nonsense	SNP	0.416	A
KSR2	283455	genome.wustl.edu	37	12	118199117	118199117	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr12:118199117C>T	ENST00000339824.5	-	4	1412	c.685G>A	c.(685-687)Gtg>Atg	p.V229M	KSR2_ENST00000425217.1_Missense_Mutation_p.V200M			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	229	Pro-rich.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TAGGCGTCCACGGTAAGCCTG	0.726																																																	0								ENSG00000171435						14.0	17.0	16.0					12																	118199117		1860	4070	5930	KSR2	SO:0001583	missense	0			-	HGNC	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.685G>A	12.37:g.118199117C>T	ENSP00000339952:p.Val229Met	Somatic	0	71	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	39	29.09	A0PJT2|Q3B828|Q8N775	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.V229M	ENST00000339824.5	37	c.685		12	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857650	0.71834	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	T;T	0.56444	0.46;0.46	5.16	5.16	0.70880	.	0.251641	0.33253	N	0.005109	T	0.46092	0.1375	L	0.44542	1.39	0.45464	D	0.998433	B	0.30709	0.291	B	0.21917	0.037	T	0.40997	-0.9533	10	0.38643	T	0.18	.	18.2313	0.89936	0.0:1.0:0.0:0.0	.	229	Q6VAB6	KSR2_HUMAN	M	200;229	ENSP00000389715:V200M;ENSP00000339952:V229M	ENSP00000339952:V229M	V	-	1	0	KSR2	116683500	1.000000	0.71417	0.922000	0.36590	0.405000	0.30901	7.404000	0.79996	2.385000	0.81259	0.491000	0.48974	GTG	-	NULL		0.726	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	protein_coding	OTTHUMT00000401987.2	C	NM_173598	-		118199117	-1	no_errors	ENST00000339824	ensembl	human	known	74_37	missense	SNP	1.000	T
EPHA1	2041	genome.wustl.edu	37	7	143095499	143095499	+	Missense_Mutation	SNP	G	G	A	rs202178565		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr7:143095499G>A	ENST00000275815.3	-	7	1465	c.1379C>T	c.(1378-1380)cCg>cTg	p.P460L		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	460	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				TAGTTGCCTCGGTTCTTTCTT	0.552																																																	0								ENSG00000146904						53.0	56.0	55.0					7																	143095499		2203	4300	6503	EPHA1	SO:0001583	missense	0			-	HGNC	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1379C>T	7.37:g.143095499G>A	ENSP00000275815:p.Pro460Leu	Somatic	0	57	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	25	30.56	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_SAM/pointed,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.P460L	ENST00000275815.3	37	c.1379	CCDS5884.1	7	.	.	.	.	.	.	.	.	.	.	G	15.57	2.871811	0.51695	.	.	ENSG00000146904	ENST00000275815	T	0.58506	0.33	5.08	5.08	0.68730	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.232852	0.30840	N	0.008774	T	0.69477	0.3115	M	0.65498	2.005	0.40858	D	0.983818	D	0.76494	0.999	P	0.62089	0.898	T	0.70583	-0.4832	10	0.44086	T	0.13	.	12.122	0.53897	0.0:0.173:0.827:0.0	.	460	P21709	EPHA1_HUMAN	L	460	ENSP00000275815:P460L	ENSP00000275815:P460L	P	-	2	0	EPHA1	142805621	0.062000	0.20869	0.914000	0.36105	0.937000	0.57800	1.072000	0.30678	2.517000	0.84864	0.655000	0.94253	CCG	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.552	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA1	protein_coding	OTTHUMT00000342154.1	G		rs202178565		143095499	-1	no_errors	ENST00000275815	ensembl	human	known	74_37	missense	SNP	0.686	A
VPS13C	54832	genome.wustl.edu	37	15	62234079	62234079	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr15:62234079G>C	ENST00000261517.5	-	46	5409	c.5336C>G	c.(5335-5337)gCa>gGa	p.A1779G	VPS13C_ENST00000395898.3_Missense_Mutation_p.A1736G|VPS13C_ENST00000249837.3_Missense_Mutation_p.A1736G|VPS13C_ENST00000395896.4_Missense_Mutation_p.A1779G	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ACCCAGATCTGCTATAACAGC	0.363																																																	0								ENSG00000129003						83.0	83.0	83.0					15																	62234079		2203	4300	6503	VPS13C	SO:0001583	missense	0			-	HGNC	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.5336C>G	15.37:g.62234079G>C	ENSP00000261517:p.Ala1779Gly	Somatic	0	79	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.20		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.A1779G	ENST00000261517.5	37	c.5336	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087743	0.76642	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.15487	2.42;2.42;2.42	5.09	5.09	0.68999	.	0.186729	0.48767	D	0.000170	T	0.46908	0.1417	M	0.83953	2.67	0.52099	D	0.999946	D;D;D;D	0.69078	0.962;0.995;0.995;0.997	P;D;D;D	0.69142	0.878;0.962;0.962;0.947	T	0.53143	-0.8480	10	0.87932	D	0	.	18.8527	0.92238	0.0:0.0:1.0:0.0	.	1736;1779;1736;1779	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	G	1736;1779;1779;1779	ENSP00000249837:A1736G;ENSP00000261517:A1779G;ENSP00000379233:A1779G	ENSP00000249837:A1736G	A	-	2	0	VPS13C	60021371	1.000000	0.71417	0.990000	0.47175	0.987000	0.75469	5.010000	0.64004	2.533000	0.85409	0.655000	0.94253	GCA	-	NULL		0.363	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	protein_coding	OTTHUMT00000415997.1	G	NM_017684	-		62234079	-1	no_errors	ENST00000261517	ensembl	human	known	74_37	missense	SNP	1.000	C
APBA1	320	genome.wustl.edu	37	9	72071280	72071280	+	Silent	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:72071280C>T	ENST00000265381.4	-	8	1893	c.1671G>A	c.(1669-1671)ctG>ctA	p.L557L	APBA1_ENST00000470082.1_5'UTR	NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	557	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						GGCGGGCCATCAGCACAACGA	0.582																																																	0								ENSG00000107282						247.0	231.0	237.0					9																	72071280		2203	4300	6503	APBA1	SO:0001819	synonymous_variant	0			-	HGNC	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1671G>A	9.37:g.72071280C>T		Somatic	0	77	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	34	38.18	O14914|O60570|Q5VYR8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.L557	ENST00000265381.4	37	c.1671	CCDS6630.1	9																																																																																			-	pfam_PTB/PI_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.582	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA1	protein_coding	OTTHUMT00000052589.2	C	NM_001163	-		72071280	-1	no_errors	ENST00000265381	ensembl	human	known	74_37	silent	SNP	0.998	T
SLC16A10	117247	genome.wustl.edu	37	6	111498746	111498746	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr6:111498746A>C	ENST00000368851.5	+	3	995	c.820A>C	c.(820-822)Aaa>Caa	p.K274Q	SLC16A10_ENST00000465319.1_3'UTR|SLC16A10_ENST00000368850.3_5'UTR	NM_018593.4	NP_061063.2	Q8TF71	MOT10_HUMAN	solute carrier family 16 (aromatic amino acid transporter), member 10	274					amino acid transport (GO:0006865)|aromatic amino acid transport (GO:0015801)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)	12		all_cancers(87;0.00172)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0313)|Colorectal(196;0.0466)		OV - Ovarian serous cystadenocarcinoma(136;0.0703)|Epithelial(106;0.12)|all cancers(137;0.132)	Droxidopa(DB06262)|Glycine(DB00145)|L-Alanine(DB00160)|L-Arginine(DB00125)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Cysteine(DB00151)|L-Cystine(DB00138)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Histidine(DB00117)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Lysine(DB00123)|L-Methionine(DB00134)|L-Phenylalanine(DB00120)|L-Proline(DB00172)|L-Serine(DB00133)|L-Threonine(DB00156)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|L-Valine(DB00161)|Liothyronine(DB00279)|Liotrix(DB01583)|Pyruvic acid(DB00119)	CTTTTCCAGGAAAAAGTTCAG	0.428																																																	0								ENSG00000112394						60.0	62.0	61.0					6																	111498746		2203	4300	6503	SLC16A10	SO:0001583	missense	0			-	HGNC	AF116652	CCDS5089.1	6q21-q22	2014-01-28	2013-07-18		ENSG00000112394	ENSG00000112394		"""Solute carriers"""	17027	protein-coding gene	gene with protein product		607550	"""solute carrier family 16 (monocarboxylic acid transporters), member 10"""			11278508, 11827462	Standard	NM_018593		Approved	TAT1, MCT10	uc003pus.3	Q8TF71	OTTHUMG00000015371	ENST00000368851.5:c.820A>C	6.37:g.111498746A>C	ENSP00000357844:p.Lys274Gln	Somatic	0	20	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	14	36.36	B3KWY0|Q6ZMG0|Q8WVI5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.K274Q	ENST00000368851.5	37	c.820	CCDS5089.1	6	.	.	.	.	.	.	.	.	.	.	A	11.85	1.761923	0.31228	.	.	ENSG00000112394	ENST00000535637;ENST00000368851;ENST00000368853	T	0.61859	0.07	5.21	2.69	0.31865	Major facilitator superfamily domain, general substrate transporter (1);	3.694310	0.00682	N	0.000697	T	0.10852	0.0265	N	0.00926	-1.1	0.80722	D	1	B;B	0.20887	0.001;0.049	B;B	0.22152	0.007;0.038	T	0.32161	-0.9917	10	0.10636	T	0.68	.	7.5221	0.27635	0.5653:0.0:0.4347:0.0	.	274;274	Q8TF71;Q05BR4	MOT10_HUMAN;.	Q	274;274;165	ENSP00000357844:K274Q	ENSP00000357844:K274Q	K	+	1	0	SLC16A10	111605439	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	2.690000	0.47001	0.342000	0.23796	0.460000	0.39030	AAA	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.428	SLC16A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A10	protein_coding	OTTHUMT00000041822.2	A		-		111498746	+1	no_errors	ENST00000368851	ensembl	human	known	74_37	missense	SNP	1.000	C
HECW1	23072	genome.wustl.edu	37	7	43548735	43548735	+	Intron	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr7:43548735G>T	ENST00000395891.2	+	24	4624				AC011738.4_ENST00000436105.1_RNA|HECW1_ENST00000453890.1_Intron	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GCTCTATAATGTTCACTTTCT	0.418																																																	0								ENSG00000231638						66.0	62.0	64.0					7																	43548735		1889	4110	5999	AC011738.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4019+15G>T	7.37:g.43548735G>T		Somatic	0	44	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395891.2	37	NULL	CCDS5469.2	7																																																																																			-	-		0.418	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100506895	protein_coding	OTTHUMT00000250893.2	G	NM_015052	-		43548735	-1	no_errors	ENST00000436105	ensembl	human	known	74_37	rna	SNP	0.000	T
ERBB3	2065	genome.wustl.edu	37	12	56486837	56486837	+	Silent	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr12:56486837C>T	ENST00000267101.3	+	11	1691	c.1251C>T	c.(1249-1251)acC>acT	p.T417T	ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000553131.1_5'Flank|ERBB3_ENST00000415288.2_Silent_p.T358T	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	417					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			ATTTGACAACCATTGGAGGCA	0.473																																																	0								ENSG00000065361						71.0	70.0	71.0					12																	56486837		2203	4300	6503	ERBB3	SO:0001819	synonymous_variant	0			-	HGNC	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1251C>T	12.37:g.56486837C>T		Somatic	0	66	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	26	43.75	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T417	ENST00000267101.3	37	c.1251	CCDS31833.1	12																																																																																			-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L		0.473	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	protein_coding	OTTHUMT00000407619.3	C		-		56486837	+1	no_errors	ENST00000267101	ensembl	human	known	74_37	silent	SNP	1.000	T
C22orf42	150297	genome.wustl.edu	37	22	32545908	32545908	+	Intron	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr22:32545908C>T	ENST00000382097.3	-	8	727				C22orf42_ENST00000490640.1_5'UTR	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42											NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						GAAGCATAGACGATGTGTGTG	0.418																																																	0								ENSG00000205856																																			C22orf42	SO:0001627	intron_variant	0			-	HGNC	BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.655-141G>A	22.37:g.32545908C>T		Somatic	0	43	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	12	61.29	A4QPH5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382097.3	37	NULL	CCDS33639.1	22																																																																																			-	-		0.418	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf42	protein_coding	OTTHUMT00000075268.2	C	NM_001010859	-		32545908	-1	no_errors	ENST00000490640	ensembl	human	known	74_37	rna	SNP	0.000	T
COL21A1	81578	genome.wustl.edu	37	6	55956320	55956320	+	Intron	SNP	T	T	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr6:55956320T>C	ENST00000244728.5	-	17	2210				COL21A1_ENST00000535941.1_Intron|COL21A1_ENST00000467045.1_5'UTR|COL21A1_ENST00000370819.1_Intron	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			AAACACGGCATTCTTTTTCTC	0.438																																																	0								ENSG00000124749																																			COL21A1	SO:0001627	intron_variant	0			-	HGNC	AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.1812+9949A>G	6.37:g.55956320T>C		Somatic	0	35	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	20	39.39	A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000244728.5	37	NULL	CCDS55025.1	6																																																																																			-	-		0.438	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	protein_coding	OTTHUMT00000041004.2	T		-		55956320	-1	no_errors	ENST00000467045	ensembl	human	known	74_37	rna	SNP	0.001	C
STEAP2	261729	genome.wustl.edu	37	7	89854616	89854616	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr7:89854616G>T	ENST00000287908.3	+	2	613	c.220G>T	c.(220-222)Gta>Tta	p.V74L	STEAP2_ENST00000394622.2_Missense_Mutation_p.V74L|STEAP2_ENST00000394629.2_Missense_Mutation_p.V74L|STEAP2_ENST00000402625.2_Missense_Mutation_p.V74L|STEAP2_ENST00000394632.1_Missense_Mutation_p.V74L|STEAP2_ENST00000394626.1_Missense_Mutation_p.V74L|STEAP2_ENST00000394621.2_Missense_Mutation_p.V74L	NM_001244944.1|NM_152999.3	NP_001231873.1|NP_694544.2	Q8NFT2	STEA2_HUMAN	STEAP family member 2, metalloreductase	74					copper ion import (GO:0015677)|endocytosis (GO:0006897)|ferric iron import into cell (GO:0097461)|Golgi to plasma membrane transport (GO:0006893)|iron ion homeostasis (GO:0055072)|regulated secretory pathway (GO:0045055)|response to hormone (GO:0009725)	cytosol (GO:0005829)|early endosome (GO:0005769)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15	all_hematologic(106;0.112)					TCCTCATGTGGTAGATGTCAC	0.378																																																	0								ENSG00000157214						185.0	165.0	172.0					7																	89854616		2203	4300	6503	STEAP2	SO:0001583	missense	0			-	HGNC	AF455138	CCDS5615.1, CCDS43612.1, CCDS59064.1	7q21.13	2011-09-30	2011-09-30		ENSG00000157214	ENSG00000157214			17885	protein-coding gene	gene with protein product		605094	"""prostate cancer associated protein 1"", ""six transmembrane epithelial antigen of the prostate 2"""	PCANAP1		10613842, 12095985	Standard	NM_001040665		Approved	IPCA-1, STAMP1, STMP	uc003ujz.3	Q8NFT2	OTTHUMG00000023341	ENST00000287908.3:c.220G>T	7.37:g.89854616G>T	ENSP00000287908:p.Val74Leu	Somatic	0	53	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	25	45.65	A4D1F1|G5E9C6|Q6UXN6|Q6YPB1|Q8IUE7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fe3_Rdtase_TM_dom	p.V74L	ENST00000287908.3	37	c.220	CCDS5615.1	7	.	.	.	.	.	.	.	.	.	.	G	31	5.096264	0.94197	.	.	ENSG00000157214	ENST00000428074;ENST00000287908;ENST00000394626;ENST00000394622;ENST00000394632;ENST00000394624;ENST00000426158;ENST00000394621;ENST00000402625;ENST00000394629	T;T;T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.83	5.83	0.93111	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.62624	0.2443	L	0.51914	1.62	0.58432	D	0.999995	D;D;D;D	0.54397	0.958;0.966;0.964;0.964	P;P;P;P	0.58820	0.763;0.846;0.783;0.783	T	0.62067	-0.6932	10	0.66056	D	0.02	-19.5146	20.1338	0.98010	0.0:0.0:1.0:0.0	.	74;74;74;74	G5E9C6;Q6YPB2;Q8NFT2;B5MC02	.;.;STEA2_HUMAN;.	L	74	ENSP00000401783:V74L;ENSP00000287908:V74L;ENSP00000378123:V74L;ENSP00000378120:V74L;ENSP00000378128:V74L;ENSP00000415931:V74L;ENSP00000378119:V74L;ENSP00000384191:V74L;ENSP00000378125:V74L	ENSP00000287908:V74L	V	+	1	0	STEAP2	89692552	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.325000	0.72901	2.770000	0.95276	0.655000	0.94253	GTA	-	NULL		0.378	STEAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP2	protein_coding	OTTHUMT00000059662.4	G	NM_152999	-		89854616	+1	no_errors	ENST00000287908	ensembl	human	known	74_37	missense	SNP	1.000	T
DGKD	8527	genome.wustl.edu	37	2	234343445	234343445	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:234343445G>T	ENST00000264057.2	+	5	496	c.484G>T	c.(484-486)Ggg>Tgg	p.G162W	DGKD_ENST00000409813.3_Missense_Mutation_p.G118W	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	162					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CCACTTCTCAGGGATGCACAA	0.532																																																	0								ENSG00000077044						193.0	169.0	177.0					2																	234343445		2203	4300	6503	DGKD	SO:0001583	missense	0			-	HGNC	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.484G>T	2.37:g.234343445G>T	ENSP00000264057:p.Gly162Trp	Somatic	0	44	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_SAM_2,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SAM_type1,pfam_Pleckstrin_homology,superfamily_SAM/pointed,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_SAM,pfscan_Pleckstrin_homology,pfscan_SAM,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.G162W	ENST00000264057.2	37	c.484	CCDS2504.1	2	.	.	.	.	.	.	.	.	.	.	G	26.3	4.724859	0.89298	.	.	ENSG00000077044	ENST00000264057;ENST00000427930;ENST00000447484;ENST00000409813	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	4.92	4.92	0.64577	.	0.158034	0.40302	N	0.001130	T	0.61073	0.2318	M	0.83012	2.62	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.997	D;D;D;P	0.97110	0.991;0.998;1.0;0.894	T	0.66689	-0.5860	10	0.87932	D	0	.	18.7132	0.91666	0.0:0.0:1.0:0.0	.	46;98;118;162	Q53SE4;C9JY42;Q16760-2;Q16760	.;.;.;DGKD_HUMAN	W	162;98;132;118	ENSP00000264057:G162W;ENSP00000407938:G98W;ENSP00000395530:G132W;ENSP00000386455:G118W	ENSP00000264057:G162W	G	+	1	0	DGKD	234008184	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.125000	0.94402	2.724000	0.93272	0.563000	0.77884	GGG	-	NULL		0.532	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	protein_coding	OTTHUMT00000257072.2	G	NM_003648	-		234343445	+1	no_errors	ENST00000264057	ensembl	human	known	74_37	missense	SNP	1.000	T
SALL2	6297	genome.wustl.edu	37	14	21992685	21992685	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr14:21992685G>A	ENST00000327430.3	-	2	1471	c.1177C>T	c.(1177-1179)Cgt>Tgt	p.R393C	AE000658.22_ENST00000535893.1_RNA|SALL2_ENST00000450879.2_Missense_Mutation_p.R256C|SALL2_ENST00000317492.5_Intron|SALL2_ENST00000538754.1_Intron	NM_005407.1	NP_005398.1	Q9Y467	SALL2_HUMAN	spalt-like transcription factor 2	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R393C(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(6)|urinary_tract(2)	43	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		GTGTGGGAACGAAGGTGGATC	0.542																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000165821						110.0	97.0	102.0					14																	21992685		2203	4300	6503	SALL2	SO:0001583	missense	0			-	HGNC	AB002358	CCDS32045.1	14q11.1-q12.1	2013-10-17	2013-10-17		ENSG00000165821	ENSG00000165821		"""Zinc fingers, C2H2-type"""	10526	protein-coding gene	gene with protein product		602219	"""sal (Drosophila)-like 2"", ""sal-like 2 (Drosophila)"""			8975705	Standard	XM_005267983		Approved	KIAA0360, Hsal2, ZNF795	uc001wbe.3	Q9Y467	OTTHUMG00000168826	ENST00000327430.3:c.1177C>T	14.37:g.21992685G>A	ENSP00000333537:p.Arg393Cys	Somatic	0	22	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	17	41.38	B2RMX6|B9EGK8|Q8N656|Q9Y4G1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R393C	ENST00000327430.3	37	c.1177	CCDS32045.1	14	.	.	.	.	.	.	.	.	.	.	G	16.62	3.174268	0.57692	.	.	ENSG00000165821	ENST00000327430;ENST00000450879;ENST00000541876	T;T	0.25749	1.78;1.78	4.3	3.42	0.39159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38605	N	0.001638	T	0.46756	0.1409	M	0.72894	2.215	0.80722	D	1	D;D;B;D	0.89917	1.0;1.0;0.358;1.0	D;D;B;D	0.87578	0.995;0.995;0.111;0.998	T	0.45731	-0.9241	10	0.87932	D	0	-24.515	9.89	0.41285	0.1005:0.0:0.8995:0.0	.	256;256;391;393	B4DK65;E7EW59;B4DFD9;Q9Y467	.;.;.;SALL2_HUMAN	C	393;256;393	ENSP00000333537:R393C;ENSP00000396773:R256C	ENSP00000333537:R393C	R	-	1	0	SALL2	21062525	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.657000	0.98554	1.031000	0.39867	-0.136000	0.14681	CGT	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.542	SALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL2	protein_coding	OTTHUMT00000401242.1	G	NM_005407	-		21992685	-1	no_errors	ENST00000327430	ensembl	human	known	74_37	missense	SNP	1.000	A
MEI1	150365	genome.wustl.edu	37	22	42166717	42166717	+	Silent	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr22:42166717C>T	ENST00000401548.3	+	20	2336	c.2296C>T	c.(2296-2298)Cta>Tta	p.L766L	MEI1_ENST00000400107.1_Silent_p.L134L|MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000540880.1_Silent_p.L84L	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CAGAAAATTCCTAGAAGGCAT	0.493																																																	0								ENSG00000167077						70.0	66.0	67.0					22																	42166717		1930	4132	6062	MEI1	SO:0001819	synonymous_variant	0			-	HGNC	AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.2296C>T	22.37:g.42166717C>T		Somatic	0	14	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	4	60.00		Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.L766	ENST00000401548.3	37	c.2296	CCDS46718.1	22																																																																																			-	superfamily_ARM-type_fold		0.493	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	protein_coding	OTTHUMT00000074937.3	C	NM_152513	-		42166717	+1	no_errors	ENST00000401548	ensembl	human	known	74_37	silent	SNP	0.972	T
PARP3	10039	genome.wustl.edu	37	3	51978127	51978127	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:51978127C>T	ENST00000417220.2	+	4	694	c.206C>T	c.(205-207)aCc>aTc	p.T69I	RRP9_ENST00000232888.6_5'Flank|PARP3_ENST00000398755.3_Missense_Mutation_p.T76I|PARP3_ENST00000431474.1_Missense_Mutation_p.T69I			Q9Y6F1	PARP3_HUMAN	poly (ADP-ribose) polymerase family, member 3	69					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|positive regulation of DNA ligation (GO:0051106)|protein ADP-ribosylation (GO:0006471)|protein localization to site of double-strand break (GO:1990166)|regulation of mitotic spindle organization (GO:0060236)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	catalytic activity (GO:0003824)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		TACAACTGCACCCTGAACCAG	0.587																																																	0								ENSG00000041880						143.0	153.0	150.0					3																	51978127		2057	4201	6258	PARP3	SO:0001583	missense	0			-	HGNC	AF083068	CCDS43097.1, CCDS46839.1	3p22.2-p21.1	2010-07-14	2004-08-20	2004-08-26	ENSG00000041880	ENSG00000041880	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	273	protein-coding gene	gene with protein product	"""poly(ADP-ribose) synthetase-3"", ""NAD+ ADP-ribosyltransferase 3"", ""poly(ADP-ribose) polymerase 3"""	607726	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3"""	ADPRTL3		10329013	Standard	NM_001003931		Approved	ADPRT3, IRT1, hPARP-3, pADPRT-3	uc003dbz.3	Q9Y6F1	OTTHUMG00000156931	ENST00000417220.2:c.206C>T	3.37:g.51978127C>T	ENSP00000395951:p.Thr69Ile	Somatic	0	63	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q8NER9|Q96CG2|Q9UG81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_WGR_domain,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,smart_WGR_domain,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.T76I	ENST00000417220.2	37	c.227	CCDS43097.1	3	.	.	.	.	.	.	.	.	.	.	C	16.39	3.109286	0.56398	.	.	ENSG00000041880	ENST00000417220;ENST00000431474;ENST00000398755;ENST00000498510	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	4.87	4.87	0.63330	WGR domain (3);	0.048311	0.85682	D	0.000000	T	0.35248	0.0925	M	0.86573	2.825	0.39419	D	0.966887	P;P	0.48589	0.893;0.912	P;P	0.52793	0.585;0.709	T	0.29366	-1.0014	10	0.46703	T	0.11	-24.8708	8.9644	0.35867	0.0:0.8337:0.0:0.1663	.	76;69	Q9Y6F1-2;Q9Y6F1	.;PARP3_HUMAN	I	69;69;76;69	ENSP00000395951:T69I;ENSP00000401511:T69I;ENSP00000381740:T76I;ENSP00000417625:T69I	ENSP00000381740:T76I	T	+	2	0	PARP3	51953167	1.000000	0.71417	0.997000	0.53966	0.309000	0.27889	3.581000	0.53914	2.235000	0.73313	0.655000	0.94253	ACC	-	pfam_WGR_domain,superfamily_WGR_domain,smart_WGR_domain		0.587	PARP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PARP3	protein_coding	OTTHUMT00000348612.2	C	NM_005485.4	-		51978127	+1	no_errors	ENST00000398755	ensembl	human	known	74_37	missense	SNP	1.000	T
KIR3DL1	3811	genome.wustl.edu	37	19	55281331	55281331	+	Intron	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:55281331G>A	ENST00000538269.1	+	1	61				KIR2DL1_ENST00000336077.6_Missense_Mutation_p.C10Y|CTB-61M7.1_ENST00000400864.3_RNA|KIR2DL1_ENST00000291633.7_Missense_Mutation_p.C10Y|KIR3DL1_ENST00000541392.1_Intron|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR2DL3_ENST00000434419.2_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		AGCATGGCGTGTGTTGGTGAG	0.607											OREG0003674	type=REGULATORY REGION|Gene=KIR2DL1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0								ENSG00000125498						124.0	110.0	115.0					19																	55281331		2158	4193	6351	KIR2DL1	SO:0001627	intron_variant	0			-	HGNC	L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.34+45296G>A	19.37:g.55281331G>A		Somatic	0	54	0.00	1006	0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	7	80.00	O43473|Q14946|Q16541	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Immunoglobulin,smart_Ig_sub	p.C10Y	ENST00000538269.1	37	c.29		19	.	.	.	.	.	.	.	.	.	.	G	3.084	-0.188410	0.06299	.	.	ENSG00000125498	ENST00000336077;ENST00000291633	T;T	0.00510	6.9;6.91	0.514	-0.85	0.10720	.	.	.	.	.	T	0.00666	0.0022	M	0.87827	2.91	0.18873	N	0.999989	B;B	0.10296	0.0;0.003	B;B	0.11329	0.002;0.006	T	0.35773	-0.9775	8	0.46703	T	0.11	.	.	.	.	.	10;10	Q6IST4;Q6H2H3	.;.	Y	10	ENSP00000336769:C10Y;ENSP00000291633:C10Y	ENSP00000291633:C10Y	C	+	2	0	KIR2DL1	59973143	0.239000	0.23836	0.098000	0.21074	0.009000	0.06853	0.713000	0.25794	-0.262000	0.09392	-0.552000	0.04208	TGT	-	NULL		0.607	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL1	protein_coding		G	NM_013289	-		55281331	+1	no_errors	ENST00000336077	ensembl	human	known	74_37	missense	SNP	0.960	A
ISCA1	81689	genome.wustl.edu	37	9	88886934	88886943	+	Frame_Shift_Del	DEL	CTTCTTCATC	CTTCTTCATC	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	CTTCTTCATC	CTTCTTCATC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:88886934_88886943delCTTCTTCATC	ENST00000375991.4	-	3	290_299	c.220_229delGATGAAGAAG	c.(220-231)gatgaagaagttfs	p.DEEV74fs	ISCA1_ENST00000326094.4_Frame_Shift_Del_p.DEEV74fs|ISCA1_ENST00000311534.6_5'UTR|ISCA1_ENST00000452279.2_Frame_Shift_Del_p.DEEV121fs	NM_030940.3	NP_112202.2	Q9BUE6	ISCA1_HUMAN	iron-sulfur cluster assembly 1	74					iron-sulfur cluster assembly (GO:0016226)	mitochondrion (GO:0005739)	iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)	8				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		TCTTGAATAACTTCTTCATCAGAATCTCCT	0.348																																																	0								ENSG00000135070																																			ISCA1	SO:0001589	frameshift_variant	0				HGNC	AF038186	CCDS35056.1	9q22.1	2013-08-06	2013-08-06	2007-01-18	ENSG00000135070	ENSG00000135070			28660	protein-coding gene	gene with protein product		611006	"""HESB like domain containing 2"", ""iron-sulfur cluster assembly 1 homolog (S. cerevisiae)"""	HBLD2		15262227, 22323289	Standard	NM_030940		Approved	MGC4276, ISA1, hIscA	uc004aop.3	Q9BUE6	OTTHUMG00000020135	ENST00000375991.4:c.220_229delGATGAAGAAG	9.37:g.88886934_88886943delCTTCTTCATC	ENSP00000365159:p.Asp74fs	Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KP34|B4DJI5|Q8ND75|Q9BZR2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion	p.D121fs	ENST00000375991.4	37	c.370_361	CCDS35056.1	9																																																																																			-	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion		0.348	ISCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISCA1	protein_coding	OTTHUMT00000052914.1	CTTCTTCATC	NM_030940			88886943	-1	no_errors	ENST00000452279	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
MECR	51102	genome.wustl.edu	37	1	29542523	29542523	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:29542523C>T	ENST00000263702.6	-	3	425	c.400G>A	c.(400-402)Ggt>Agt	p.G134S	MECR_ENST00000373791.3_Missense_Mutation_p.G58S|MECR_ENST00000489248.1_5'UTR			Q9BV79	MECR_HUMAN	mitochondrial trans-2-enoyl-CoA reductase	134					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)	11		Colorectal(325;0.000389)|Breast(348;0.00765)|Lung NSC(340;0.0081)|all_lung(284;0.00914)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.39e-07)|COAD - Colon adenocarcinoma(152;2.04e-05)|STAD - Stomach adenocarcinoma(196;0.0195)|BRCA - Breast invasive adenocarcinoma(304;0.053)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.137)		TCACCTAAACCAGCATTTGCT	0.557																																																	0								ENSG00000116353						106.0	98.0	101.0					1																	29542523		2203	4300	6503	MECR	SO:0001583	missense	0			-	HGNC		CCDS30659.1, CCDS30660.1	1p35.3	2012-09-20			ENSG00000116353	ENSG00000116353	1.3.1.38		19691	protein-coding gene	gene with protein product	"""nuclear receptor binding factor 1"", ""mitochondrial 2-enoyl thioester reductase"""	608205				9795230, 12654921	Standard	XM_005245885		Approved	CGI-63, NRBF1, FASN2B	uc001brq.1	Q9BV79	OTTHUMG00000059082	ENST00000263702.6:c.400G>A	1.37:g.29542523C>T	ENSP00000263702:p.Gly134Ser	Somatic	0	45	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	18	41.94	B3KT72|Q5SYU0|Q5SYU1|Q5SYU2|Q6IBU9|Q9Y373	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.G134S	ENST00000263702.6	37	c.400	CCDS30659.1	1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.159303	0.78226	.	.	ENSG00000116353	ENST00000373791;ENST00000263702;ENST00000373792	T;T	0.40476	1.03;1.03	5.53	5.53	0.82687	GroES-like (1);	0.261642	0.43579	D	0.000560	T	0.38241	0.1033	L	0.37561	1.115	0.80722	D	1	B	0.14438	0.01	B	0.24269	0.052	T	0.11616	-1.0580	10	0.44086	T	0.13	.	16.963	0.86278	0.0:1.0:0.0:0.0	.	134	Q9BV79	MECR_HUMAN	S	58;134;46	ENSP00000362896:G58S;ENSP00000263702:G134S	ENSP00000263702:G134S	G	-	1	0	MECR	29415110	1.000000	0.71417	0.956000	0.39512	0.982000	0.71751	5.261000	0.65496	2.617000	0.88574	0.549000	0.68633	GGT	-	superfamily_GroES-like,smart_PKS_ER		0.557	MECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MECR	protein_coding	OTTHUMT00000130740.1	C	NM_016011	-		29542523	-1	no_errors	ENST00000263702	ensembl	human	known	74_37	missense	SNP	1.000	T
TUBA3D	113457	genome.wustl.edu	37	2	132237643	132237643	+	Splice_Site	SNP	C	C	T	rs72992288	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:132237643C>T	ENST00000321253.6	+	4	484	c.377C>T	c.(376-378)gCg>gTg	p.A126V	TUBA3D_ENST00000409047.2_3'UTR	NM_080386.3	NP_525125.2	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	126					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32				BRCA - Breast invasive adenocarcinoma(221;0.13)		TTCTCTCAGGCGGATCTGTGC	0.572																																					Ovarian(137;2059 2432 35543 39401)												0								ENSG00000075886						42.0	47.0	45.0					2																	132237643		2203	4300	6503	TUBA3D	SO:0001630	splice_region_variant	0			-	HGNC	K03460	CCDS33290.1	2q21.1	2007-03-16			ENSG00000075886	ENSG00000075886		"""Tubulins"""	24071	protein-coding gene	gene with protein product	"""alpha-tubulin isotype H2-alpha"""					3785200	Standard	NM_080386		Approved	H2-ALPHA	uc002tsu.4	Q13748	OTTHUMG00000153600	ENST00000321253.6:c.376-1C>T	2.37:g.132237643C>T		Somatic	0	42	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	73	14.12	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.A126V	ENST00000321253.6	37	c.377	CCDS33290.1	2	.	.	.	.	.	.	.	.	.	.	c	3.775	-0.046823	0.07407	.	.	ENSG00000075886	ENST00000321253;ENST00000341158	T	0.66638	-0.22	2.24	1.33	0.21861	Tubulin/FtsZ, GTPase domain (4);	0.356468	0.19523	U	0.112234	T	0.54663	0.1872	L	0.41415	1.275	0.80722	D	1	B	0.26363	0.147	B	0.31191	0.125	T	0.51348	-0.8717	10	0.87932	D	0	.	6.8167	0.23835	0.0:0.8406:0.0:0.1594	.	126	Q13748	TBA3C_HUMAN	V	126	ENSP00000326042:A126V	ENSP00000326042:A126V	A	+	2	0	TUBA3D	131954113	1.000000	0.71417	0.989000	0.46669	0.080000	0.17528	4.780000	0.62382	0.267000	0.21916	0.194000	0.17425	GCG	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin		0.572	TUBA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA3D	protein_coding	OTTHUMT00000331800.2	C	NM_080386	rs72992288	Missense_Mutation	132237643	+1	no_errors	ENST00000321253	ensembl	human	known	74_37	missense	SNP	1.000	T
SIGLEC7	27036	genome.wustl.edu	37	19	51650058	51650058	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:51650058G>A	ENST00000317643.6	+	5	1144	c.1075G>A	c.(1075-1077)Gct>Act	p.A359T	SIGLEC7_ENST00000600577.1_Intron|SIGLEC7_ENST00000305628.7_Missense_Mutation_p.A266T	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	359					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		GGTCGGGGGAGCTGGAGCCAC	0.572																																																	0								ENSG00000168995						99.0	95.0	97.0					19																	51650058		2203	4300	6503	SIGLEC7	SO:0001583	missense	0			-	HGNC	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.1075G>A	19.37:g.51650058G>A	ENSP00000323328:p.Ala359Thr	Somatic	0	37	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	41	18.00	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A359T	ENST00000317643.6	37	c.1075	CCDS12826.1	19	.	.	.	.	.	.	.	.	.	.	.	15.96	2.985993	0.53934	.	.	ENSG00000168995	ENST00000317643;ENST00000305628	T;T	0.08634	3.07;3.07	2.75	1.63	0.23807	.	1.071740	0.07440	N	0.897080	T	0.23532	0.0569	M	0.87097	2.86	0.18873	N	0.999989	D;D	0.59357	0.963;0.985	B;P	0.53518	0.349;0.728	T	0.10776	-1.0615	10	0.52906	T	0.07	.	6.6314	0.22859	0.0:0.0:0.6992:0.3008	.	266;359	Q9Y286-2;Q9Y286	.;SIGL7_HUMAN	T	359;266	ENSP00000323328:A359T;ENSP00000306757:A266T	ENSP00000306757:A266T	A	+	1	0	SIGLEC7	56341870	0.003000	0.15002	0.002000	0.10522	0.369000	0.29798	0.776000	0.26704	0.451000	0.26802	0.420000	0.28162	GCT	-	NULL		0.572	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	protein_coding	OTTHUMT00000464226.2	G	NM_016543	-		51650058	+1	no_errors	ENST00000317643	ensembl	human	known	74_37	missense	SNP	0.005	A
LILRA1	11024	genome.wustl.edu	37	19	55106778	55106778	+	Missense_Mutation	SNP	G	G	T	rs10418391	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:55106778G>T	ENST00000251372.3	+	5	754	c.572G>T	c.(571-573)cGc>cTc	p.R191L	LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000453777.1_Missense_Mutation_p.R191L	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	191	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		AGCCCGAGTCGCAGGTGGTCG	0.572																																																	0								ENSG00000104974						152.0	157.0	156.0					19																	55106778		2203	4300	6503	LILRA1	SO:0001583	missense	0			-	HGNC	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.572G>T	19.37:g.55106778G>T	ENSP00000251372:p.Arg191Leu	Somatic	0	82	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	19	45.95	O75018|Q3MJA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like_dom	p.R191L	ENST00000251372.3	37	c.572	CCDS12901.1	19	.	.	.	.	.	.	.	.	.	.	G	10.24	1.294833	0.23564	.	.	ENSG00000104974	ENST00000251372;ENST00000453777	T;T	0.02974	4.09;4.09	2.24	-0.33	0.12683	Immunoglobulin-like fold (1);	1.389240	0.04584	N	0.395426	T	0.03390	0.0098	L	0.37850	1.14	0.09310	N	1	P;B	0.42375	0.778;0.001	B;B	0.43251	0.413;0.002	T	0.32241	-0.9914	10	0.42905	T	0.14	.	2.0528	0.03574	0.5644:0.0:0.1783:0.2573	.	191;191	O75019-2;O75019	.;LIRA1_HUMAN	L	191	ENSP00000251372:R191L;ENSP00000413715:R191L	ENSP00000251372:R191L	R	+	2	0	LILRA1	59798590	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.058000	0.11750	-0.319000	0.08652	0.194000	0.17425	CGC	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt		0.572	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA1	protein_coding	OTTHUMT00000140807.2	G	NM_006863	-		55106778	+1	no_errors	ENST00000251372	ensembl	human	known	74_37	missense	SNP	0.000	T
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000382968.5_Intron|RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
KIF26A	26153	genome.wustl.edu	37	14	104646007	104646007	+	Silent	SNP	C	C	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr14:104646007C>A	ENST00000423312.2	+	15	5529	c.5529C>A	c.(5527-5529)gcC>gcA	p.A1843A	KIF26A_ENST00000315264.7_Silent_p.A1704A	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1843					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		TGGAGCGAGCCACGGCGGCCC	0.692																																																	0								ENSG00000066735						11.0	15.0	14.0					14																	104646007		1883	3817	5700	KIF26A	SO:0001819	synonymous_variant	0			-	HGNC	AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.5529C>A	14.37:g.104646007C>A		Somatic	0	39	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	24	45.45	Q8TAZ7|Q96GK3|Q9UFL3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.A1843	ENST00000423312.2	37	c.5529	CCDS45171.1	14																																																																																			-	NULL		0.692	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	protein_coding	OTTHUMT00000414356.1	C		-		104646007	+1	no_errors	ENST00000423312	ensembl	human	known	74_37	silent	SNP	1.000	A
ISCA1	81689	genome.wustl.edu	37	9	88886926	88886927	+	Frame_Shift_Ins	INS	-	-	GA			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:88886926_88886927insGA	ENST00000375991.4	-	3	306_307	c.236_237insTC	c.(235-237)caafs	p.Q79fs	ISCA1_ENST00000326094.4_Frame_Shift_Ins_p.Q79fs|ISCA1_ENST00000311534.6_5'UTR|ISCA1_ENST00000452279.2_Frame_Shift_Ins_p.Q126fs	NM_030940.3	NP_112202.2	Q9BUE6	ISCA1_HUMAN	iron-sulfur cluster assembly 1	79					iron-sulfur cluster assembly (GO:0016226)	mitochondrion (GO:0005739)	iron-sulfur cluster binding (GO:0051536)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)	8				OV - Ovarian serous cystadenocarcinoma(323;5.4e-34)|Lung(182;0.0375)		ACTCACCATCTTGAATAACTTC	0.356																																																	0								ENSG00000135070																																			ISCA1	SO:0001589	frameshift_variant	0				HGNC	AF038186	CCDS35056.1	9q22.1	2013-08-06	2013-08-06	2007-01-18	ENSG00000135070	ENSG00000135070			28660	protein-coding gene	gene with protein product		611006	"""HESB like domain containing 2"", ""iron-sulfur cluster assembly 1 homolog (S. cerevisiae)"""	HBLD2		15262227, 22323289	Standard	NM_030940		Approved	MGC4276, ISA1, hIscA	uc004aop.3	Q9BUE6	OTTHUMG00000020135	ENST00000375991.4:c.236_237insTC	9.37:g.88886926_88886927insGA	ENSP00000365159:p.Gln79fs	Somatic	0	119	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	72	10.00	B3KP34|B4DJI5|Q8ND75|Q9BZR2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion	p.Q126fs	ENST00000375991.4	37	c.378_377	CCDS35056.1	9																																																																																			-	pfam_FeS_biogenesis,superfamily_FeS_biogenesis,tigrfam_FeS_cluster_insertion		0.356	ISCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISCA1	protein_coding	OTTHUMT00000052914.1	-	NM_030940			88886927	-1	no_errors	ENST00000452279	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	GA
LNPEP	4012	genome.wustl.edu	37	5	96358015	96358015	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr5:96358015T>G	ENST00000231368.5	+	14	3080	c.2388T>G	c.(2386-2388)ttT>ttG	p.F796L	LNPEP_ENST00000395770.3_Missense_Mutation_p.F782L	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	796					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		CTAGGGTATTTAAATTACTTC	0.403																																																	0								ENSG00000113441						56.0	57.0	57.0					5																	96358015		2203	4300	6503	LNPEP	SO:0001583	missense	0			-	HGNC	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.2388T>G	5.37:g.96358015T>G	ENSP00000231368:p.Phe796Leu	Somatic	0	52	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	27	28.95	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.F796L	ENST00000231368.5	37	c.2388	CCDS4087.1	5	.	.	.	.	.	.	.	.	.	.	T	0.489	-0.876381	0.02550	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.04454	3.62;3.62	5.6	1.85	0.25348	.	0.735084	0.14162	N	0.337287	T	0.00967	0.0032	N	0.00377	-1.585	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47586	-0.9106	10	0.05833	T	0.94	.	2.8149	0.05453	0.2622:0.2502:0.0:0.4876	.	796	Q9UIQ6	LCAP_HUMAN	L	796;782	ENSP00000231368:F796L;ENSP00000379117:F782L	ENSP00000231368:F796L	F	+	3	2	LNPEP	96383771	0.001000	0.12720	0.996000	0.52242	0.486000	0.33341	-0.211000	0.09332	1.066000	0.40716	0.533000	0.62120	TTT	-	NULL		0.403	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNPEP	protein_coding	OTTHUMT00000250624.1	T	NM_005575	-		96358015	+1	no_errors	ENST00000231368	ensembl	human	known	74_37	missense	SNP	0.121	G
RUNX3	864	genome.wustl.edu	37	1	25291022	25291022	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:25291022G>T	ENST00000338888.3	-	2	286	c.41C>A	c.(40-42)tCg>tAg	p.S14*	RUNX3_ENST00000399916.1_Nonsense_Mutation_p.S14*|RP11-84D1.1_ENST00000456316.1_RNA			Q13761	RUNX3_HUMAN	runt-related transcription factor 3	0					axon guidance (GO:0007411)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|hair follicle morphogenesis (GO:0031069)|interferon-gamma production (GO:0032609)|negative regulation of cell cycle (GO:0045786)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system neuron development (GO:0048935)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(3)	18		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00131)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;2.85e-26)|Colorectal(126;4.35e-08)|COAD - Colon adenocarcinoma(152;1.92e-06)|GBM - Glioblastoma multiforme(114;0.000102)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00148)|BRCA - Breast invasive adenocarcinoma(304;0.00173)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.136)		GAAGGTCGGCGAGTAGGTCGG	0.627																																																	0								ENSG00000020633						63.0	51.0	55.0					1																	25291022		2202	4300	6502	RUNX3	SO:0001587	stop_gained	0			-	HGNC	BC013362	CCDS257.1, CCDS30633.1	1p36	2008-02-05			ENSG00000020633	ENSG00000020633			10473	protein-coding gene	gene with protein product		600210		CBFA3		7835892	Standard	NM_001031680		Approved	AML2, PEBP2A3	uc001bjq.3	Q13761	OTTHUMG00000003316	ENST00000338888.3:c.41C>A	1.37:g.25291022G>T	ENSP00000343477:p.Ser14*	Somatic	0	80	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	71	30.39	B1AJV5|Q12969|Q13760	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Runt_dom,pfam_RunxI_C_dom,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_Runt_dom,prints_AML1_Runt	p.S14*	ENST00000338888.3	37	c.41	CCDS30633.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.902034	0.97920	.	.	ENSG00000020633	ENST00000399916;ENST00000338888	.	.	.	5.67	5.67	0.87782	.	0.738391	0.11146	N	0.594662	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-1.2643	15.2825	0.73797	0.0:0.0:1.0:0.0	.	.	.	.	X	14	.	ENSP00000343477:S14X	S	-	2	0	RUNX3	25163609	1.000000	0.71417	0.996000	0.52242	0.491000	0.33493	5.755000	0.68750	2.677000	0.91161	0.561000	0.74099	TCG	-	pirsf_TF_Runt-rel_RUNX		0.627	RUNX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX3	protein_coding	OTTHUMT00000009285.1	G	NM_004350	-		25291022	-1	no_errors	ENST00000338888	ensembl	human	known	74_37	nonsense	SNP	0.965	T
TUBE1	51175	genome.wustl.edu	37	6	112406880	112406880	+	Intron	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr6:112406880C>T	ENST00000368662.5	-	3	231				TUBE1_ENST00000604814.1_5'UTR|FAM229B_ENST00000604268.1_5'Flank|FAM229B_ENST00000368656.2_5'Flank	NM_016262.4	NP_057346.1	Q9UJT0	TBE_HUMAN	tubulin, epsilon 1						centrosome cycle (GO:0007098)|protein polymerization (GO:0051258)	microtubule (GO:0005874)|pericentriolar material (GO:0000242)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|large_intestine(5)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	12		all_cancers(87;0.0101)|all_hematologic(75;0.000258)|Colorectal(196;0.0466)|all_epithelial(87;0.1)		all cancers(137;0.0217)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0636)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)	Vinblastine(DB00570)	taactaacttcctttggtctg	0.333																																																	0								ENSG00000074935																																			TUBE1	SO:0001627	intron_variant	0			-	HGNC	AF201334	CCDS5100.1	6q21	2005-11-03			ENSG00000074935	ENSG00000074935		"""Tubulins"""	20775	protein-coding gene	gene with protein product		607345				10620804	Standard	NM_016262		Approved	dJ142L7.2, FLJ22589, TUBE	uc003pvq.3	Q9UJT0	OTTHUMG00000015382	ENST00000368662.5:c.152+878G>A	6.37:g.112406880C>T		Somatic	0	76	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	36	26.53	Q5H8W8|Q8NEG3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368662.5	37	NULL	CCDS5100.1	6																																																																																			-	-		0.333	TUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBE1	protein_coding	OTTHUMT00000041867.1	C	NM_016262	-		112406880	-1	no_errors	ENST00000441191	ensembl	human	known	74_37	rna	SNP	0.000	T
OR6F1	343169	genome.wustl.edu	37	1	247875753	247875753	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:247875753delT	ENST00000302084.2	-	1	352	c.305delA	c.(304-306)tacfs	p.Y102fs	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	102						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GAAAACAAAGTACATCTGCAA	0.488																																																	0								ENSG00000169214						111.0	108.0	109.0					1																	247875753		2203	4300	6503	OR6F1	SO:0001589	frameshift_variant	0				HGNC	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.305delA	1.37:g.247875753delT	ENSP00000305640:p.Tyr102fs	Somatic	0	47	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	B2RNV6|Q6IF02|Q96R39	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y102fs	ENST00000302084.2	37	c.305	CCDS31095.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.488	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6F1	protein_coding	OTTHUMT00000096870.1	T	NM_001005286			247875753	-1	no_errors	ENST00000302084	ensembl	human	known	74_37	frame_shift_del	DEL	0.784	-
PLEC	5339	genome.wustl.edu	37	8	144992885	144992910	+	Frame_Shift_Del	DEL	GCCTGGAACCGGGCAGGTAGACACCA	GCCTGGAACCGGGCAGGTAGACACCA	-	rs368558825|rs17062686|rs374177544|rs372372955	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	GCCTGGAACCGGGCAGGTAGACACCA	GCCTGGAACCGGGCAGGTAGACACCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr8:144992885_144992910delGCCTGGAACCGGGCAGGTAGACACCA	ENST00000322810.4	-	32	11659_11684	c.11490_11515delTGGTGTCTACCTGCCCGGTTCCAGGC	c.(11488-11517)gctggtgtctacctgcccggttccaggcagfs	p.GVYLPGSRQ3831fs	PLEC_ENST00000356346.3_Frame_Shift_Del_p.GVYLPGSRQ3680fs|PLEC_ENST00000527096.1_Frame_Shift_Del_p.GVYLPGSRQ3717fs|PLEC_ENST00000357649.2_Frame_Shift_Del_p.GVYLPGSRQ3698fs|PLEC_ENST00000398774.2_Frame_Shift_Del_p.GVYLPGSRQ3662fs|PLEC_ENST00000354589.3_Frame_Shift_Del_p.GVYLPGSRQ3694fs|PLEC_ENST00000354958.2_Frame_Shift_Del_p.GVYLPGSRQ3672fs|PLEC_ENST00000345136.3_Frame_Shift_Del_p.GVYLPGSRQ3694fs|PLEC_ENST00000436759.2_Frame_Shift_Del_p.GVYLPGSRQ3721fs	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3831	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.P3835P(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTCAGTGTCTGCCTGGAACCGGGCAGGTAGACACCAGCCACGGAGC	0.655																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)						ENSG00000178209																																			PLEC	SO:0001589	frameshift_variant	0				HGNC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11490_11515delTGGTGTCTACCTGCCCGGTTCCAGGC	8.37:g.144992885_144992910delGCCTGGAACCGGGCAGGTAGACACCA	ENSP00000323856:p.Gly3831fs	Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.G3831fs	ENST00000322810.4	37	c.11515_11490	CCDS43772.1	8																																																																																			-	pfam_Plectin_repeat,smart_Plectin_repeat		0.655	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	protein_coding	OTTHUMT00000383281.1	GCCTGGAACCGGGCAGGTAGACACCA	NM_000445			144992910	-1	no_errors	ENST00000322810	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:0.997:0.998:0.999:0.999:1.000:0.998:0.994:0.991:0.879:0.018:0.509:0.484:0.206:0.181:0.005:0.013:0.254:0.266:0.222:0.313:0.008:0.009:0.996:0.996:0.009	-
THRB	7068	genome.wustl.edu	37	3	24169081	24169081	+	Silent	SNP	G	G	A	rs115445992	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:24169081G>A	ENST00000356447.4	-	9	1337	c.1053C>T	c.(1051-1053)gaC>gaT	p.D351D	THRB_ENST00000396671.2_Silent_p.D351D|THRB_ENST00000280696.5_Silent_p.D366D|THRB_ENST00000416420.1_Silent_p.D351D	NM_000461.4|NM_001128177.1	NP_000452.2|NP_001121649.1	P10828	THB_HUMAN	thyroid hormone receptor, beta	351	Interaction with NR2F6.|Ligand-binding.				female courtship behavior (GO:0008050)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of female receptivity (GO:0007621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|sensory perception of sound (GO:0007605)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|Type I pneumocyte differentiation (GO:0060509)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(2)|prostate(1)|skin(3)	19					Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CAAAGATGGCGTCTGACACCA	0.532													G|||	3	0.000599042	0.0	0.0014	5008	,	,		18935	0.002		0.0	False		,,,				2504	0.0				Melanoma(21;896 1043 15021 37958)												0								ENSG00000151090	G	,,	1,4405	2.1+/-5.4	0,1,2202	144.0	133.0	136.0		1053,1053,1053	-6.5	0.8	3	dbSNP_132	136	3,8597	3.0+/-9.4	0,3,4297	no	coding-synonymous,coding-synonymous,coding-synonymous	THRB	NM_000461.4,NM_001128176.1,NM_001128177.1	,,	0,4,6499	AA,AG,GG		0.0349,0.0227,0.0308	,,	351/462,351/462,351/462	24169081	4,13002	2203	4300	6503	THRB	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC		CCDS2641.1	3p24.2	2013-01-16	2011-05-19		ENSG00000151090	ENSG00000151090		"""Nuclear hormone receptors"""	11799	protein-coding gene	gene with protein product	"""avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2"", ""oncogene ERBA2"", ""generalized resistance to thyroid hormone"", ""thyroid hormone receptor beta 1"""	190160	"""thyroid hormone receptor, beta (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog 2)"", ""pituitary resistance to thyroid hormone"", ""thyroid hormone receptor, beta (erythroblastic leukemia viral (v-erb-a) oncogene homolog 2, avian)"""	ERBA2, PRTH		1973914, 8040303	Standard	NM_000461		Approved	THRB1, THRB2, NR1A2, THR1, ERBA-BETA, GRTH	uc003ccy.4	P10828	OTTHUMG00000130478	ENST00000356447.4:c.1053C>T	3.37:g.24169081G>A		Somatic	0	100	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	61	42.45	B3KU79|P37243|Q13986|Q3KP35|Q6WGL2|Q9UD41	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.D351	ENST00000356447.4	37	c.1053	CCDS2641.1	3																																																																																			-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.532	THRB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	THRB	protein_coding	OTTHUMT00000252877.3	G	NM_000461	rs115445992		24169081	-1	no_errors	ENST00000356447	ensembl	human	known	74_37	silent	SNP	0.894	A
CCDC80	151887	genome.wustl.edu	37	3	112357638	112357638	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:112357638G>T	ENST00000206423.3	-	2	2068	c.1115C>A	c.(1114-1116)gCt>gAt	p.A372D	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.A372D	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	372	Thr-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						AGGTCTTGCAGCAACTGTTAC	0.642																																																	0								ENSG00000091986						81.0	71.0	75.0					3																	112357638		2203	4300	6503	CCDC80	SO:0001583	missense	0			-	HGNC	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1115C>A	3.37:g.112357638G>T	ENSP00000206423:p.Ala372Asp	Somatic	0	26	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A372D	ENST00000206423.3	37	c.1115	CCDS2968.1	3	.	.	.	.	.	.	.	.	.	.	G	16.83	3.232225	0.58777	.	.	ENSG00000091986	ENST00000206423;ENST00000439685	T;T	0.50548	0.74;0.74	4.89	4.89	0.63831	.	0.110597	0.64402	D	0.000007	T	0.45915	0.1366	L	0.27053	0.805	0.80722	D	1	P;P;P	0.52577	0.835;0.954;0.745	B;P;B	0.49752	0.429;0.621;0.247	T	0.33137	-0.9880	10	0.32370	T	0.25	-7.3048	18.2349	0.89946	0.0:0.0:1.0:0.0	.	383;372;372	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	D	372	ENSP00000206423:A372D;ENSP00000411814:A372D	ENSP00000206423:A372D	A	-	2	0	CCDC80	113840328	0.994000	0.37717	0.108000	0.21378	0.034000	0.12701	5.501000	0.66950	2.535000	0.85469	0.555000	0.69702	GCT	-	NULL		0.642	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC80	protein_coding	OTTHUMT00000354219.1	G	NM_199511	-		112357638	-1	no_errors	ENST00000206423	ensembl	human	known	74_37	missense	SNP	0.796	T
TM9SF2	9375	genome.wustl.edu	37	13	100199256	100199256	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr13:100199256delT	ENST00000376387.4	+	11	1358	c.1168delT	c.(1168-1170)tttfs	p.F390fs		NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	390					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					TTGCCTGGGATTTTTGTCACC	0.473																																																	0								ENSG00000125304						155.0	145.0	148.0					13																	100199256		2203	4300	6503	TM9SF2	SO:0001589	frameshift_variant	0				HGNC	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.1168delT	13.37:g.100199256delT	ENSP00000365567:p.Phe390fs	Somatic	0	26	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	A8K399|Q2TAY5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EMP70	p.L391fs	ENST00000376387.4	37	c.1168	CCDS9493.1	13																																																																																			-	pfam_EMP70		0.473	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF2	protein_coding	OTTHUMT00000045602.3	T				100199256	+1	no_errors	ENST00000376387	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
TBX19	9095	genome.wustl.edu	37	1	168269673	168269673	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:168269673G>T	ENST00000367821.3	+	5	730	c.679G>T	c.(679-681)Gac>Tac	p.D227Y		NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19	227					anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					TCACCTAAGAGACGTACCGGA	0.478																																																	0								ENSG00000143178						111.0	99.0	103.0					1																	168269673		2203	4300	6503	TBX19	SO:0001583	missense	0			-	HGNC	AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.679G>T	1.37:g.168269673G>T	ENSP00000356795:p.Asp227Tyr	Somatic	0	53	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q52M53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box,prints_TF_Brachyury	p.D227Y	ENST00000367821.3	37	c.679	CCDS1272.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.94|16.94	3.260583|3.260583	0.59431|0.59431	.|.	.|.	ENSG00000143178|ENSG00000143178	ENST00000367821;ENST00000367828|ENST00000431969;ENST00000441464	D|D;T	0.84800|0.94723	-1.9|-3.5;1.36	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	.|.	.|.	.|.	.|.	D|D	0.94604|0.94604	0.8261|0.8261	L|L	0.49640|0.49640	1.575|1.575	0.44995|.	D|.	0.998013|.	D;P|.	0.59767|.	0.986;0.845|.	P;B|.	0.53722|.	0.733;0.272|.	D|D	0.95232|0.95232	0.8343|0.8343	8|6	0.62326|0.66056	D|D	0.03|0.02	.|.	18.1717|18.1717	0.89747|0.89747	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	227;158|.	O60806;B3KRD9|.	TBX19_HUMAN;.|.	Y|I	227;167|159;59	ENSP00000356795:D227Y|ENSP00000397540:R159I;ENSP00000390731:R59I	ENSP00000356795:D227Y|ENSP00000397540:R159I	D|R	+|+	1|2	0|0	TBX19|TBX19	166536297|166536297	1.000000|1.000000	0.71417|0.71417	0.903000|0.903000	0.35520|0.35520	0.076000|0.076000	0.17211|0.17211	6.851000|6.851000	0.75425|0.75425	2.352000|2.352000	0.79861|0.79861	0.650000|0.650000	0.86243|0.86243	GAC|AGA	-	NULL		0.478	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX19	protein_coding	OTTHUMT00000083825.1	G	NM_005149	-		168269673	+1	no_errors	ENST00000367821	ensembl	human	known	74_37	missense	SNP	1.000	T
PLK2	10769	genome.wustl.edu	37	5	57753404	57753404	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr5:57753404T>C	ENST00000274289.3	-	6	1020	c.720A>G	c.(718-720)atA>atG	p.I240M	PLK2_ENST00000502671.1_5'Flank	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	240	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		GGGTACCACATATCGTTCTGG	0.398																																																	0								ENSG00000145632						93.0	91.0	92.0					5																	57753404		2203	4300	6503	PLK2	SO:0001583	missense	0			-	HGNC		CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.720A>G	5.37:g.57753404T>C	ENSP00000274289:p.Ile240Met	Somatic	0	30	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	O60679|Q96CV7|Q9UE61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_dom	p.I240M	ENST00000274289.3	37	c.720	CCDS3974.1	5	.	.	.	.	.	.	.	.	.	.	T	17.79	3.476929	0.63849	.	.	ENSG00000145632	ENST00000274289;ENST00000537944;ENST00000442330	T	0.25414	1.8	5.76	4.55	0.56014	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.31199	0.0789	N	0.16743	0.435	0.58432	D	0.999998	D	0.89917	1.0	D	0.81914	0.995	T	0.10823	-1.0613	10	0.72032	D	0.01	-25.6883	9.1447	0.36925	0.1039:0.0:0.177:0.7191	.	240	Q9NYY3	PLK2_HUMAN	M	240;240;226	ENSP00000274289:I240M	ENSP00000274289:I240M	I	-	3	3	PLK2	57789161	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.825000	0.55730	2.191000	0.70037	0.533000	0.62120	ATA	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.398	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK2	protein_coding	OTTHUMT00000214150.1	T	NM_006622	-		57753404	-1	no_errors	ENST00000274289	ensembl	human	known	74_37	missense	SNP	1.000	C
TIE1	7075	genome.wustl.edu	37	1	43779725	43779726	+	Intron	DEL	TG	TG	-	rs138876276		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:43779725_43779726delTG	ENST00000372476.3	+	14	2488				TIE1_ENST00000433781.2_Intron|TIE1_ENST00000473014.1_Intron	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1						angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TTGTACACCTtgtgtgtgtgtg	0.436																																																	0								ENSG00000066056																																			TIE1	SO:0001627	intron_variant	0				HGNC	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2409+86TG>-	1.37:g.43779735_43779736delTG		Somatic	0	18	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	B5A949|B5A950	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372476.3	37	NULL	CCDS482.1	1																																																																																			-	-		0.436	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIE1	protein_coding	OTTHUMT00000019011.1	TG	NM_005424			43779726	+1	no_errors	ENST00000471187	ensembl	human	known	74_37	rna	DEL	0.002:0.002	-
OR4S1	256148	genome.wustl.edu	37	11	48328685	48328685	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr11:48328685G>T	ENST00000319988.1	+	1	911	c.911G>T	c.(910-912)aGg>aTg	p.R304M		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						AGGGTCAAGAGGAGCTTAGGG	0.423																																																	0								ENSG00000176555						47.0	46.0	46.0					11																	48328685		2201	4298	6499	OR4S1	SO:0001583	missense	0			-	HGNC	AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.911G>T	11.37:g.48328685G>T	ENSP00000321447:p.Arg304Met	Somatic	0	30	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q6IFB4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R304M	ENST00000319988.1	37	c.911	CCDS31488.1	11	.	.	.	.	.	.	.	.	.	.	G	7.394	0.631413	0.14322	.	.	ENSG00000176555	ENST00000319988	T	0.38887	1.11	4.72	-4.45	0.03546	.	.	.	.	.	T	0.22589	0.0545	N	0.25992	0.78	0.09310	N	1	B	0.17667	0.023	B	0.12156	0.007	T	0.22977	-1.0201	9	0.21014	T	0.42	.	5.6451	0.17584	0.3393:0.0:0.4544:0.2063	.	304	Q8NGB4	OR4S1_HUMAN	M	304	ENSP00000321447:R304M	ENSP00000321447:R304M	R	+	2	0	OR4S1	48285261	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.896000	0.04114	-0.968000	0.03578	-0.797000	0.03246	AGG	-	NULL		0.423	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S1	protein_coding	OTTHUMT00000390556.1	G	NM_001004725	-		48328685	+1	no_errors	ENST00000319988	ensembl	human	known	74_37	missense	SNP	0.000	T
ARHGEF11	9826	genome.wustl.edu	37	1	156917189	156917189	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:156917189T>C	ENST00000361409.2	-	25	3017	c.2275A>G	c.(2275-2277)Atc>Gtc	p.I759V	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.I799V|ARHGEF11_ENST00000487682.1_5'Flank|ARHGEF11_ENST00000315174.8_Missense_Mutation_p.I175V	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	759	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TGGTAGAAGATCAGGTCCAGG	0.562																																																	0								ENSG00000132694						45.0	50.0	49.0					1																	156917189		2203	4300	6503	ARHGEF11	SO:0001583	missense	0			-	HGNC	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2275A>G	1.37:g.156917189T>C	ENSP00000354644:p.Ile759Val	Somatic	0	32	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	24	38.46	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RGS-like_dom,pfam_DH-domain,pfam_PDZ,pfam_RGS_dom,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal_superfam,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal_superfam,pfscan_DH-domain	p.I799V	ENST00000361409.2	37	c.2395	CCDS1162.1	1	.	.	.	.	.	.	.	.	.	.	T	0.020	-1.438214	0.01098	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	T;T;T	0.65916	-0.18;-0.18;-0.18	5.44	5.44	0.79542	Dbl homology (DH) domain (5);	0.111649	0.40222	N	0.001156	T	0.11067	0.0270	N	0.01473	-0.845	0.31576	N	0.655742	B;B;B	0.19935	0.04;0.018;0.003	B;B;B	0.24974	0.057;0.03;0.012	T	0.21008	-1.0258	10	0.02654	T	1	-18.4605	7.0627	0.25135	0.0:0.0771:0.1505:0.7724	.	175;759;799	F8W8P9;O15085;O15085-2	.;ARHGB_HUMAN;.	V	799;759;175	ENSP00000357177:I799V;ENSP00000354644:I759V;ENSP00000313470:I175V	ENSP00000313470:I175V	I	-	1	0	ARHGEF11	155183813	0.390000	0.25213	0.997000	0.53966	0.138000	0.21146	0.797000	0.26999	2.278000	0.76064	0.533000	0.62120	ATC	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.562	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	protein_coding	OTTHUMT00000098931.1	T	NM_198236	-		156917189	-1	no_errors	ENST00000368194	ensembl	human	known	74_37	missense	SNP	0.675	C
APC	324	genome.wustl.edu	37	5	112116600	112116600	+	Splice_Site	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr5:112116600G>T	ENST00000457016.1	+	6	1025	c.645G>T	c.(643-645)caG>caT	p.Q215H	APC_ENST00000257430.4_Splice_Site_p.Q215H|APC_ENST00000508376.2_Splice_Site_p.Q215H|RNU6-482P_ENST00000391068.1_RNA			P25054	APC_HUMAN	adenomatous polyposis coli	215	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)			NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AACGAGCACAGGTAAGTTACT	0.348		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)		yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	0								ENSG00000134982						53.0	52.0	53.0					5																	112116600		2202	4300	6502	APC	SO:0001630	splice_region_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	-	HGNC	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.645+1G>T	5.37:g.112116600G>T		Somatic	0	121	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	103	14.88	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_APC_dom,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Q215H	ENST00000457016.1	37	c.645	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839048	0.91117	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.95281	0.8469	M	0.76328	2.33	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.73708	0.981;0.981	D	0.95405	0.8493	10	0.87932	D	0	-7.1624	19.5353	0.95251	0.0:0.0:1.0:0.0	.	217;215	Q4LE70;P25054	.;APC_HUMAN	H	215;225;215;215;215	ENSP00000413133:Q215H;ENSP00000423224:Q225H;ENSP00000257430:Q215H;ENSP00000427089:Q215H;ENSP00000423828:Q215H	ENSP00000257430:Q215H	Q	+	3	2	APC	112144499	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	8.834000	0.92094	2.607000	0.88179	0.655000	0.94253	CAG	-	NULL		0.348	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	protein_coding	OTTHUMT00000250738.2	G	NM_000038	-	Missense_Mutation	112116600	+1	no_errors	ENST00000257430	ensembl	human	known	74_37	missense	SNP	1.000	T
HCLS1	3059	genome.wustl.edu	37	3	121351315	121351316	+	In_Frame_Ins	INS	-	-	GGCTCAGGCTCA	rs150627065|rs372720825|rs80289672	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:121351315_121351316insGGCTCAGGCTCA	ENST00000314583.3	-	12	1194_1195	c.1103_1104insTGAGCCTGAGCC	c.(1102-1104)ccc>ccTGAGCCTGAGCCc	p.368_368P>PEPEP	HCLS1_ENST00000428394.2_In_Frame_Ins_p.331_331P>PEPEP|HCLS1_ENST00000473883.1_5'UTR	NM_005335.4	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	368					actin filament polymerization (GO:0030041)|cellular response to cytokine stimulus (GO:0071345)|erythrocyte differentiation (GO:0030218)|intracellular signal transduction (GO:0035556)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell proliferation (GO:0008284)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|regulation of actin filament polymerization (GO:0030833)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein kinase binding (GO:0019901)|RNA polymerase II transcription factor binding (GO:0001085)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				GBM - Glioblastoma multiforme(114;0.0912)		gctcaggctcgggctcaggctc	0.604														1208	0.241214	0.1573	0.1599	5008	,	,		14710	0.4563		0.2485	False		,,,				2504	0.183																0			GRCh37	CI045897	HCLS1	I	rs80289672	ENSG00000180353																																			HCLS1	SO:0001652	inframe_insertion	0				HGNC		CCDS3003.1	3q13	2007-08-03			ENSG00000180353	ENSG00000180353			4844	protein-coding gene	gene with protein product	"""cortactin-like"""	601306				8978766, 15710041	Standard	NM_001292041		Approved	HS1, CTTNL	uc003eeh.4	P14317	OTTHUMG00000159409	ENST00000314583.3:c.1092_1103dupTGAGCCTGAGCC	3.37:g.121351315_121351316insGGCTCAGGCTCA	ENSP00000320176:p.GluProGluPro372dup	Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DQ69|Q53Y93|Q6IBK9|Q9UDK0	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.372in_frame_insPEPE	ENST00000314583.3	37	c.1104_1103	CCDS3003.1	3																																																																																			-	NULL		0.604	HCLS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCLS1	protein_coding	OTTHUMT00000355144.1	-	NM_005335			121351316	-1	no_errors	ENST00000314583	ensembl	human	known	74_37	in_frame_ins	INS	0.001:0.003	GGCTCAGGCTCA
U2SURP	23350	genome.wustl.edu	37	3	142720221	142720222	+	5'Flank	INS	-	-	GGACAACGA	rs3832221|rs11282240	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:142720221_142720222insGGACAACGA	ENST00000473835.2	+	0	0				U2SURP_ENST00000493598.2_5'Flank|RP11-91G21.1_ENST00000597953.1_lincRNA|RP11-372E1.6_ENST00000497652.1_RNA|U2SURP_ENST00000397933.2_5'Flank|RP11-372E1.6_ENST00000595248.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing						RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						CAGCTGGCCCTGATTCTCTGAA	0.515														3604	0.719649	0.8949	0.6988	5008	,	,		19350	0.7212		0.6183	False		,,,				2504	0.6002																0								ENSG00000241570																																			RP11-372E1.6	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323		3.37:g.142720221_142720222insGGACAACGA	Exception_encountered	Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000473835.2	37	NULL	CCDS46928.1	3																																																																																			-	-		0.515	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927832	protein_coding	OTTHUMT00000354603.2	-	NM_001080415			142720222	+1	no_errors	ENST00000595248	ensembl	human	known	74_37	rna	INS	0.005:0.015	GGACAACGA
NBPF9	400818	genome.wustl.edu	37	1	144815234	144815234	+	Intron	SNP	C	C	G			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:144815234C>G	ENST00000468645.1	+	3	528				NBPF9_ENST00000440491.2_Intron|NBPF9_ENST00000281815.8_Intron|NBPF9_ENST00000338347.4_Intron			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9							cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						CCCAGGCTGTCTTTTCGGCAA	0.468																																																	0								ENSG00000168614																																			NBPF9	SO:0001627	intron_variant	0			-	HGNC		CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000468645.1:c.528+340C>G	1.37:g.144815234C>G		Somatic	0	8	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	4	92.16		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000468645.1	37	NULL		1																																																																																			-	-		0.468	NBPF9-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	NBPF9	protein_coding	OTTHUMT00000038846.1	C	NM_001037675	-		144815234	+1	no_errors	ENST00000483630	ensembl	human	known	74_37	rna	SNP	0.000	G
LINC01317	104355287	genome.wustl.edu	37	2	33953017	33953017	+	lincRNA	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:33953017G>A	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							GGGACCGCATGGTGGTCGTGA	0.632																																																	0								ENSG00000239649																																			MYADML			0			-	HGNC																													2.37:g.33953017G>A		Somatic	0	28	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	21	30.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			-	-		0.632	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	lincRNA	OTTHUMT00000325406.1	G		-		33953017	-1	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	SNP	0.815	A
USP27X	389856	genome.wustl.edu	37	X	49641832	49641833	+	5'Flank	INS	-	-	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chrX:49641832_49641833insA	ENST00000508866.2	+	0	0				USP27X-AS1_ENST00000437322.2_lincRNA	NM_001145073.1	NP_001138545.1	A6NNY8	UBP27_HUMAN	ubiquitin specific peptidase 27, X-linked						ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			endometrium(7)	7						GAGGACTACTTAAAAAAAATCA	0.351											OREG0019777	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000234390																																			USP27X-AS1	SO:0001631	upstream_gene_variant	0				HGNC	AW851065	CCDS65260.1	Xp11.23	2007-10-05	2005-08-08			ENSG00000273820		"""Ubiquitin-specific peptidases"""	13486	protein-coding gene	gene with protein product			"""ubiquitin specific protease 27, X chromosome"", ""ubiquitin specific protease 27, X-linked"""			12838346	Standard	NM_001145073		Approved	USP27	uc004dop.3	A6NNY8			X.37:g.49641840_49641840dupA	Exception_encountered	Somatic	0	8	0.00	963	0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	6	25.00		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000508866.2	37	NULL		X																																																																																			-	-		0.351	USP27X-001	KNOWN	basic|appris_principal	protein_coding	USP27X-AS1	protein_coding	OTTHUMT00000060837.3	-	XM_372213			49641833	-1	no_errors	ENST00000437322	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
CTBP2	1488	genome.wustl.edu	37	10	126715159	126715160	+	Intron	INS	-	-	GCCGCAGGCTGGGGCTGCAGG	rs529129641|rs372118432	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr10:126715159_126715160insGCCGCAGGCTGGGGCTGCAGG	ENST00000337195.5	-	3	458				CTBP2_ENST00000309035.6_In_Frame_Ins_p.390_390A>ALQPQPAA|CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000531469.1_Intron	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		TCTGCAGAGGAGCCGCAGCGCC	0.698														537	0.107228	0.1006	0.2478	5008	,	,		14420	0.0417		0.1093	False		,,,				2504	0.0818																0								ENSG00000175029		,,	295,3727		33,229,1749					,,	-1.1	0.0			8	694,7122		93,508,3307	no	coding,intron,intron	CTBP2	NM_022802.2,NM_001329.2,NM_001083914.1	,,	126,737,5056	A1A1,A1R,RR		8.8792,7.3347,8.3545	,,	,,		989,10849				CTBP2	SO:0001627	intron_variant	0				HGNC	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12405->CCTGCAGCCCCAGCCTGCGGC	10.37:g.126715159_126715160insGCCGCAGGCTGGGGCTGCAGG		Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom	p.391in_frame_insLQPQPAA	ENST00000337195.5	37	c.1170_1169	CCDS7643.1	10																																																																																			-	NULL		0.698	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	protein_coding	OTTHUMT00000050900.3	-	NM_001083914			126715160	-1	no_errors	ENST00000309035	ensembl	human	known	74_37	in_frame_ins	INS	0.257:0.112	GCCGCAGGCTGGGGCTGCAGG
CYB5R3	1727	genome.wustl.edu	37	22	43015932	43015932	+	Silent	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr22:43015932G>T	ENST00000352397.5	-	9	1005	c.753C>A	c.(751-753)ggC>ggA	p.G251G	CYB5R3_ENST00000407332.1_Silent_p.G228G|CYB5R3_ENST00000407623.3_Silent_p.G228G|CYB5R3_ENST00000402438.1_Silent_p.G228G|CYB5R3_ENST00000361740.4_Silent_p.G284G|CYB5R3_ENST00000396303.3_Silent_p.G228G	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3	251					blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	CATTCACGAAGCCCTGGCCGT	0.627																																																	0								ENSG00000100243						56.0	49.0	51.0					22																	43015932		2203	4300	6503	CYB5R3	SO:0001819	synonymous_variant	0			-	HGNC	M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.753C>A	22.37:g.43015932G>T		Somatic	0	66	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_OxRdtase_FAD-bd_dom,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	p.G284	ENST00000352397.5	37	c.852	CCDS33658.1	22																																																																																			-	pfam_OxRdtase_FAD/NAD-bd,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase		0.627	CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R3	protein_coding	OTTHUMT00000320439.1	G		-		43015932	-1	no_errors	ENST00000361740	ensembl	human	known	74_37	silent	SNP	1.000	T
HEATR2	54919	genome.wustl.edu	37	7	769393	769393	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr7:769393C>T	ENST00000297440.6	+	2	709	c.689C>T	c.(688-690)gCc>gTc	p.A230V	PRKAR1B_ENST00000537384.1_5'Flank|HEATR2_ENST00000313147.5_Missense_Mutation_p.A230V|HEATR2_ENST00000438961.1_3'UTR|PRKAR1B_ENST00000403562.1_5'Flank|PRKAR1B_ENST00000488474.1_5'Flank	NM_017802.3	NP_060272.3	Q86Y56	HEAT2_HUMAN	HEAT repeat containing 2	230						cytoplasm (GO:0005737)				breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|prostate(4)|skin(1)	22		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0182)|Epithelial(4;5.48e-17)|OV - Ovarian serous cystadenocarcinoma(56;1.95e-16)|all cancers(6;2.98e-14)		GCCATTGAAGCCACAGGCGCA	0.582																																																	0								ENSG00000164818						111.0	88.0	96.0					7																	769393		2203	4300	6503	HEATR2	SO:0001583	missense	0			-	HGNC	AL832914, AK000404, NM_017802, AK056233	CCDS34580.1	7p22.3	2014-05-06	2006-05-19		ENSG00000164818	ENSG00000164818			26013	protein-coding gene	gene with protein product		614864				23040496	Standard	NM_017802		Approved	FLJ20397, FLJ31671, FLJ39381, FLJ25564, CILD18	uc010krz.1	Q86Y56	OTTHUMG00000151416	ENST00000297440.6:c.689C>T	7.37:g.769393C>T	ENSP00000297440:p.Ala230Val	Somatic	0	75	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q69YL1|Q96FI9|Q9NX75	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.A230V	ENST00000297440.6	37	c.689	CCDS34580.1	7	.	.	.	.	.	.	.	.	.	.	C	26.8	4.769632	0.90020	.	.	ENSG00000164818	ENST00000297440;ENST00000313147	T;T	0.28069	1.63;1.63	5.19	5.19	0.71726	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000002	T	0.60843	0.2300	M	0.85197	2.74	0.58432	D	0.999999	D	0.89917	1.0	D	0.67725	0.953	T	0.67933	-0.5542	10	0.72032	D	0.01	-33.9698	18.7191	0.91686	0.0:1.0:0.0:0.0	.	230	Q86Y56	HEAT2_HUMAN	V	230	ENSP00000297440:A230V;ENSP00000321451:A230V	ENSP00000297440:A230V	A	+	2	0	HEATR2	735919	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	7.035000	0.76517	2.420000	0.82092	0.655000	0.94253	GCC	-	superfamily_ARM-type_fold		0.582	HEATR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR2	protein_coding	OTTHUMT00000322542.1	C	NM_017802	-		769393	+1	no_errors	ENST00000297440	ensembl	human	known	74_37	missense	SNP	1.000	T
AC069285.1	0	genome.wustl.edu	37	7	62528467	62528467	+	RNA	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr7:62528467C>T	ENST00000581408.1	-	0	62																											AACACCCATCCGAGTTGGACA	0.652																																																	0								ENSG00000265865																																			AC069285.1			0			-	Clone_based_ensembl_gene																													7.37:g.62528467C>T		Somatic	0	29	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581408.1	37	NULL		7																																																																																			-	-		0.652	AC069285.1-201	NOVEL	basic	miRNA	ENSG00000265865	miRNA		C		-		62528467	-1	no_errors	ENST00000581408	ensembl	human	novel	74_37	rna	SNP	0.006	T
MFGE8	4240	genome.wustl.edu	37	15	89450444	89450444	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr15:89450444G>T	ENST00000566497.1	-	3	430	c.369C>A	c.(367-369)gaC>gaA	p.D123E	MFGE8_ENST00000268150.8_Missense_Mutation_p.D123E|MFGE8_ENST00000539437.1_Missense_Mutation_p.D115E|MFGE8_ENST00000559997.1_5'UTR|MFGE8_ENST00000268151.7_Missense_Mutation_p.D123E|MFGE8_ENST00000542878.1_Missense_Mutation_p.D79E			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	123	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					AGGGGTTATCGTCATTGCTGC	0.607																																																	0								ENSG00000140545						71.0	56.0	61.0					15																	89450444		2200	4299	6499	MFGE8	SO:0001583	missense	0			-	HGNC	U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.369C>A	15.37:g.89450444G>T	ENSP00000456281:p.Asp123Glu	Somatic	0	35	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,superfamily_Galactose-bd-like,smart_EG-like_dom,smart_Coagulation_fac_5/8-C_type_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.D123E	ENST00000566497.1	37	c.369	CCDS10347.1	15	.	.	.	.	.	.	.	.	.	.	g	9.730	1.162061	0.21538	.	.	ENSG00000140545	ENST00000268150;ENST00000268151;ENST00000539437;ENST00000542878	D;D;D;D	0.97811	-4.55;-4.55;-4.55;-1.83	5.45	-3.01	0.05463	Coagulation factor 5/8 C-terminal type domain (4);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.98182	0.9399	M	0.84326	2.69	0.39274	D	0.964436	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.997;0.999;1.0;1.0;0.994;0.997	D	0.96802	0.9590	10	0.40728	T	0.16	-62.0991	13.3201	0.60428	0.4721:0.0:0.5279:0.0	.	115;79;79;115;123;123	B3KTQ2;F5GZN3;B4E396;F5H7N9;Q08431-3;Q08431	.;.;.;.;.;MFGM_HUMAN	E	123;123;115;79	ENSP00000268150:D123E;ENSP00000268151:D123E;ENSP00000442386:D115E;ENSP00000444332:D79E	ENSP00000268150:D123E	D	-	3	2	MFGE8	87251448	1.000000	0.71417	0.003000	0.11579	0.000000	0.00434	1.474000	0.35398	-1.013000	0.03383	-1.439000	0.01073	GAC	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.607	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	MFGE8	protein_coding	OTTHUMT00000432804.1	G	NM_005928	-		89450444	-1	no_errors	ENST00000268150	ensembl	human	known	74_37	missense	SNP	0.272	T
BTBD18	643376	genome.wustl.edu	37	11	57513163	57513163	+	Silent	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr11:57513163G>A	ENST00000436147.3	-	2	769	c.582C>T	c.(580-582)aaC>aaT	p.N194N	BTBD18_ENST00000422652.1_Silent_p.N194N|TMX2-CTNND1_ENST00000528395.1_Intron|RP11-691N7.6_ENST00000531074.1_Intron			B2RXH4	BTBDI_HUMAN	BTB (POZ) domain containing 18	194										endometrium(3)|kidney(1)	4						CATTCTGTCGGTTGTTTTCCT	0.507																																																	0								ENSG00000233436						94.0	75.0	81.0					11																	57513163		692	1591	2283	BTBD18	SO:0001819	synonymous_variant	0			-	HGNC		CCDS44603.1	11q12.1	2013-01-08			ENSG00000233436	ENSG00000233436		"""BTB/POZ domain containing"""	37214	protein-coding gene	gene with protein product							Standard	NM_001145101		Approved		uc010rjy.2	B2RXH4	OTTHUMG00000167203	ENST00000436147.3:c.582C>T	11.37:g.57513163G>A		Somatic	0	58	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.N194	ENST00000436147.3	37	c.582	CCDS44603.1	11																																																																																			-	NULL		0.507	BTBD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD18	protein_coding	OTTHUMT00000393718.2	G	NM_001145101	-		57513163	-1	no_errors	ENST00000422652	ensembl	human	known	74_37	silent	SNP	0.000	A
AP001623.1	0	genome.wustl.edu	37	21	43720386	43720387	+	RNA	DEL	GT	GT	-	rs142198765		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr21:43720386_43720387delGT	ENST00000401378.1	-	0	68_69																											ACAGGGGCTGgtgtgtgtgtgt	0.55																																																	0								ENSG00000216197			117,2837		8,101,1368						-0.2	0.0		dbSNP_134	70	210,4996		37,136,2430	no	intergenic				45,237,3798	A1A1,A1R,RR		4.0338,3.9607,4.0074				327,7833				AP001623.1			0				Clone_based_ensembl_gene																													21.37:g.43720396_43720397delGT		Somatic	0	26	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401378.1	37	NULL		21																																																																																			-	-		0.550	AP001623.1-201	NOVEL	basic	miRNA	ENSG00000216197	miRNA		GT				43720387	-1	no_errors	ENST00000401378	ensembl	human	novel	74_37	rna	DEL	0.001:0.000	-
HNRNPKP3	399881	genome.wustl.edu	37	11	43284496	43284496	+	RNA	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr11:43284496G>T	ENST00000511537.1	-	0	439					NR_033868.1				heterogeneous nuclear ribonucleoprotein K pseudogene 3																		AGTGGAATGAGGACAGCATTC	0.413																																																	0								ENSG00000251557																																			HNRNPKP3			0			-	HGNC			11p12	2011-07-05				ENSG00000251557			42376	pseudogene	pseudogene							Standard	NR_033868		Approved		uc001mxe.2				11.37:g.43284496G>T		Somatic	0	22	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000511537.1	37	NULL		11																																																																																			-	-		0.413	HNRNPKP3-003	KNOWN	basic	processed_transcript	HNRNPKP3	pseudogene	OTTHUMT00000390385.1	G	NR_033868	-		43284496	-1	no_errors	ENST00000511537	ensembl	human	known	74_37	rna	SNP	1.000	T
NUDT16	131870	genome.wustl.edu	37	3	131101009	131101009	+	Silent	SNP	C	C	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:131101009C>A	ENST00000521288.1	+	2	289	c.258C>A	c.(256-258)gcC>gcA	p.A86A	NUDT16_ENST00000502852.1_Silent_p.A86A|RP11-933H2.4_ENST00000502521.1_RNA|NUDT16_ENST00000537561.1_Silent_p.A40A|NUDT16_ENST00000359850.3_Silent_p.A53A			Q96DE0	NUD16_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 16	86	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				adenosine to inosine editing (GO:0006382)|dephosphorylation (GO:0016311)|dITP catabolic process (GO:0035863)|IDP catabolic process (GO:0046709)|mRNA catabolic process (GO:0006402)|negative regulation of rRNA processing (GO:2000233)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|snoRNA catabolic process (GO:0016077)|XDP catabolic process (GO:1901639)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cobalt ion binding (GO:0050897)|dIDP diphosphatase activity (GO:0097383)|dITP diphosphatase activity (GO:0035870)|GTP binding (GO:0005525)|inosine-diphosphatase activity (GO:0090450)|ITP binding (GO:1901641)|m7G(5')pppN diphosphatase activity (GO:0050072)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)|mRNA binding (GO:0003729)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|protein homodimerization activity (GO:0042803)|snoRNA binding (GO:0030515)|XTP binding (GO:1901640)			large_intestine(1)|lung(6)	7						AAGCGGCTGCCGCTTTCCGCG	0.682																																																	0								ENSG00000198585						23.0	27.0	25.0					3																	131101009		2169	4234	6403	NUDT16	SO:0001819	synonymous_variant	0			-	HGNC	AK055827	CCDS3070.1, CCDS3070.2, CCDS54640.1, CCDS54641.1	3q21.3	2005-01-25						"""Nudix motif containing"""	26442	protein-coding gene	gene with protein product						12477932	Standard	NM_152395		Approved	FLJ31265	uc021xec.1	Q96DE0		ENST00000521288.1:c.258C>A	3.37:g.131101009C>A		Somatic	0	53	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	67	20.00	B4E3B4|E9PED4|F5GYJ1|Q96N82	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.A86	ENST00000521288.1	37	c.258	CCDS3070.2	3																																																																																			-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like		0.682	NUDT16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT16	protein_coding	OTTHUMT00000356537.9	C	NM_152395	-		131101009	+1	no_errors	ENST00000521288	ensembl	human	known	74_37	silent	SNP	0.752	A
EPC1	80314	genome.wustl.edu	37	10	32582546	32582546	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr10:32582546G>T	ENST00000263062.8	-	3	702	c.433C>A	c.(433-435)Cgc>Agc	p.R145S	EPC1_ENST00000375110.2_Missense_Mutation_p.R95S|EPC1_ENST00000319778.6_Missense_Mutation_p.R145S	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	145					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				TTTTCTAGGCGGTCAATCATC	0.348																																																	0								ENSG00000120616						73.0	71.0	72.0					10																	32582546		2203	4300	6503	EPC1	SO:0001583	missense	0			-	HGNC	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.433C>A	10.37:g.32582546G>T	ENSP00000263062:p.Arg145Ser	Somatic	0	40	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.R145S	ENST00000263062.8	37	c.433	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	G	20.5	4.001091	0.74818	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	T;T;T	0.48522	0.81;0.81;0.81	5.67	4.77	0.60923	Enhancer of polycomb-like, N-terminal (1);	0.050310	0.85682	D	0.000000	T	0.63414	0.2509	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.89917	0.99;1.0;1.0;0.995	D;D;D;D	0.87578	0.963;0.998;0.998;0.947	T	0.64466	-0.6401	10	0.52906	T	0.07	-8.778	10.8613	0.46829	0.0685:0.0:0.8012:0.1303	.	145;95;145;145	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	S	95;145;145	ENSP00000364251:R95S;ENSP00000318559:R145S;ENSP00000263062:R145S	ENSP00000263062:R145S	R	-	1	0	EPC1	32622552	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.445000	0.66594	1.408000	0.46895	0.467000	0.42956	CGC	-	pfam_Enhancer_polycomb-like_N		0.348	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	protein_coding	OTTHUMT00000047484.1	G		-		32582546	-1	no_errors	ENST00000263062	ensembl	human	known	74_37	missense	SNP	1.000	T
MRPL44	65080	genome.wustl.edu	37	2	224824683	224824683	+	Missense_Mutation	SNP	G	G	T	rs544208460		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:224824683G>T	ENST00000258383.3	+	2	681	c.612G>T	c.(610-612)caG>caT	p.Q204H		NM_022915.3	NP_075066.1	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44	204	RNase III.				mitochondrial translational elongation (GO:0070125)|RNA processing (GO:0006396)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		CCCTGTTACAGAGCAGTGGAC	0.438													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20078	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000135900						83.0	80.0	81.0					2																	224824683		2203	4300	6503	MRPL44	SO:0001583	missense	0			-	HGNC	AK022763	CCDS2459.1	2p24.3-p24.1	2012-09-13			ENSG00000135900	ENSG00000135900		"""Mitochondrial ribosomal proteins / large subunits"""	16650	protein-coding gene	gene with protein product	"""39S ribosomal protein L44, mitochondrial"""	611849					Standard	NM_022915		Approved	FLJ12701, FLJ13990	uc002vnr.4	Q9H9J2	OTTHUMG00000133164	ENST00000258383.3:c.612G>T	2.37:g.224824683G>T	ENSP00000258383:p.Gln204His	Somatic	0	36	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q53S16|Q6IA62|Q9H821	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_RNase_III_dom,pfscan_dsRNA-bd_dom	p.Q204H	ENST00000258383.3	37	c.612	CCDS2459.1	2	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654017	0.29425	.	.	ENSG00000135900	ENST00000258383	T	0.42513	0.97	5.7	0.189	0.15119	Ribonuclease III (3);	0.377447	0.30020	N	0.010618	T	0.26122	0.0637	L	0.37561	1.115	0.42674	D	0.993525	B	0.09022	0.002	B	0.06405	0.002	T	0.06789	-1.0807	10	0.20046	T	0.44	-30.9317	7.0498	0.25067	0.3137:0.1224:0.5639:0.0	.	204	Q9H9J2	RM44_HUMAN	H	204	ENSP00000258383:Q204H	ENSP00000258383:Q204H	Q	+	3	2	MRPL44	224532927	0.969000	0.33509	0.716000	0.30569	0.858000	0.48976	0.201000	0.17276	0.077000	0.16863	0.650000	0.86243	CAG	-	superfamily_RNase_III_dom		0.438	MRPL44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL44	protein_coding	OTTHUMT00000256866.2	G	NM_022915	-		224824683	+1	no_errors	ENST00000258383	ensembl	human	known	74_37	missense	SNP	0.983	T
SCN11A	11280	genome.wustl.edu	37	3	38948849	38948856	+	Intron	DEL	ACACACAC	ACACACAC	-	rs376599495|rs74884713|rs377500548|rs75317406|rs370348256|rs75658739|rs76050581		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	ACACACAC	ACACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:38948849_38948856delACACACAC	ENST00000302328.3	-	10	1672				SCN11A_ENST00000444237.2_Intron|AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000450244.1_Intron|SCN11A_ENST00000456224.3_Intron	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATCTATATATacacacacacacacacac	0.385																																																	0								ENSG00000215941																																			AC116038.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+583GTGTGTGT>-	3.37:g.38948857_38948864delACACACAC		Somatic	NA	NA	NA		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																			-	-		0.385	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	protein_coding	OTTHUMT00000109746.4	ACACACAC	NM_014139			38948856	+1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
IFT80	57560	genome.wustl.edu	37	3	160083847	160083847	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr3:160083847T>A	ENST00000326448.7	-	6	965	c.533A>T	c.(532-534)aAt>aTt	p.N178I	IFT80_ENST00000496589.1_Missense_Mutation_p.N41I|RP11-432B6.3_ENST00000483754.1_Missense_Mutation_p.N349I|IFT80_ENST00000483465.1_Missense_Mutation_p.N41I	NM_020800.2	NP_065851.1	Q9P2H3	IFT80_HUMAN	intraflagellar transport 80	178					bone morphogenesis (GO:0060349)|chondrocyte differentiation (GO:0002062)|cilium assembly (GO:0042384)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|osteoblast differentiation (GO:0001649)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)				NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(12)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AACTTTAGCATTTGGTTGAAG	0.428																																																	0								ENSG00000248710						140.0	133.0	135.0					3																	160083847		2203	4300	6503	RP11-432B6.3	SO:0001583	missense	0			-	Clone_based_vega_gene	AB037795	CCDS3188.1, CCDS54668.1	3q25.33	2014-07-03	2014-07-03	2005-11-02	ENSG00000068885	ENSG00000068885		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29262	protein-coding gene	gene with protein product		611177	"""WD repeat domain 56"", ""intraflagellar transport 80 homolog (Chlamydomonas)"""	WDR56		10718198	Standard	NM_020800		Approved	KIAA1374	uc021xgq.1	Q9P2H3	OTTHUMG00000158953	ENST00000326448.7:c.533A>T	3.37:g.160083847T>A	ENSP00000312778:p.Asn178Ile	Somatic	0	88	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	44	24.14	B4E0K1|C9J8I0|Q3MJC4|Q86YF4|Q9UIX1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N349I	ENST00000326448.7	37	c.1046	CCDS3188.1	3	.	.	.	.	.	.	.	.	.	.	T	18.00	3.524891	0.64747	.	.	ENSG00000068885	ENST00000326448;ENST00000483465;ENST00000496589;ENST00000465537;ENST00000475677;ENST00000498409;ENST00000468218	T;T;T;T;T	0.61274	1.52;5.0;5.0;1.53;0.12	5.63	4.46	0.54185	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.114051	0.36002	U	0.002856	T	0.50735	0.1633	M	0.73217	2.22	0.58432	D	0.999997	P	0.39216	0.664	B	0.31191	0.125	T	0.54323	-0.8311	10	0.66056	D	0.02	-1.1854	8.9078	0.35535	0.0:0.1443:0.0:0.8557	.	178	Q9P2H3	IFT80_HUMAN	I	178;41;41;41;41;178;41	ENSP00000312778:N178I;ENSP00000418196:N41I;ENSP00000420646:N41I;ENSP00000418602:N41I;ENSP00000420001:N178I	ENSP00000312778:N178I	N	-	2	0	IFT80	161566541	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.807000	0.47955	0.951000	0.37770	0.533000	0.62120	AAT	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.428	IFT80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT80	protein_coding	OTTHUMT00000352651.2	T	NM_020800	-		160083847	-1	no_errors	ENST00000483754	ensembl	human	known	74_37	missense	SNP	1.000	A
TTI1	9675	genome.wustl.edu	37	20	36641017	36641017	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr20:36641017A>G	ENST00000373448.2	-	3	1440	c.1202T>C	c.(1201-1203)cTt>cCt	p.L401P	TTI1_ENST00000373447.3_Missense_Mutation_p.L401P|TTI1_ENST00000487362.1_Intron|TTI1_ENST00000449821.1_Missense_Mutation_p.L401P	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	401					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						TAACAAGGAAAGAGTAGAGAA	0.473																																																	0								ENSG00000101407						87.0	90.0	89.0					20																	36641017		2203	4300	6503	TTI1	SO:0001583	missense	0			-	HGNC	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.1202T>C	20.37:g.36641017A>G	ENSP00000362547:p.Leu401Pro	Somatic	0	50	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold,pirsf_UCP005250	p.L401P	ENST00000373448.2	37	c.1202	CCDS13300.1	20	.	.	.	.	.	.	.	.	.	.	A	14.04	2.415384	0.42817	.	.	ENSG00000101407	ENST00000373448;ENST00000373447;ENST00000449821	T;T;T	0.26660	1.72;1.72;1.72	5.5	5.5	0.81552	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.52789	0.1756	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.57112	-0.7867	10	0.72032	D	0.01	-13.9422	14.9457	0.71029	1.0:0.0:0.0:0.0	.	401	O43156	TTI1_HUMAN	P	401	ENSP00000362547:L401P;ENSP00000362546:L401P;ENSP00000407270:L401P	ENSP00000362546:L401P	L	-	2	0	TTI1	36074431	1.000000	0.71417	0.976000	0.42696	0.281000	0.26958	8.761000	0.91691	2.308000	0.77769	0.533000	0.62120	CTT	-	superfamily_ARM-type_fold,pirsf_UCP005250		0.473	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTI1	protein_coding	OTTHUMT00000079138.2	A	NM_014657	-		36641017	-1	no_errors	ENST00000373447	ensembl	human	known	74_37	missense	SNP	0.997	G
IRF2BP2	359948	genome.wustl.edu	37	1	234743418	234743418	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:234743418T>C	ENST00000366609.3	-	2	1259	c.1229A>G	c.(1228-1230)aAc>aGc	p.N410S	RP4-781K5.2_ENST00000436039.1_RNA|IRF2BP2_ENST00000366610.3_Missense_Mutation_p.N394S|IRF2BP2_ENST00000491430.1_5'UTR	NM_182972.2	NP_892017.2	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	410					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			TGTGGTCCGGTTGGAATGAGG	0.587																																																	0								ENSG00000168264						96.0	103.0	101.0					1																	234743418		2203	4300	6503	IRF2BP2	SO:0001583	missense	0			-	HGNC	AY278023	CCDS1602.1, CCDS41475.1	1q42.3	2008-02-05			ENSG00000168264	ENSG00000168264			21729	protein-coding gene	gene with protein product		615332				12799427	Standard	NM_182972		Approved	IRF-2BP2	uc001hwg.3	Q7Z5L9	OTTHUMG00000037981	ENST00000366609.3:c.1229A>G	1.37:g.234743418T>C	ENSP00000355568:p.Asn410Ser	Somatic	0	43	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	13	59.38	B1AM35|B1AM36|Q6P083|Q7Z5L8|Q8N351|Q8WUH8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_reg_fac2-bd1_2_Znf	p.N410S	ENST00000366609.3	37	c.1229	CCDS1602.1	1	.	.	.	.	.	.	.	.	.	.	T	12.53	1.965076	0.34659	.	.	ENSG00000168264	ENST00000366610;ENST00000366609	T;T	0.30714	1.52;1.52	5.44	5.44	0.79542	.	0.177493	0.49305	D	0.000144	T	0.30417	0.0764	L	0.29908	0.895	0.46901	D	0.999241	P;D	0.55385	0.951;0.971	B;P	0.50659	0.444;0.647	T	0.03051	-1.1078	10	0.10636	T	0.68	-4.8531	15.4818	0.75534	0.0:0.0:0.0:1.0	.	410;394	Q7Z5L9;Q7Z5L9-2	I2BP2_HUMAN;.	S	394;410	ENSP00000355569:N394S;ENSP00000355568:N410S	ENSP00000355568:N410S	N	-	2	0	IRF2BP2	232810041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.596000	0.67570	2.073000	0.62155	0.533000	0.62120	AAC	-	pfam_Interferon_reg_fac2-bd1_2_Znf		0.587	IRF2BP2-002	NOVEL	basic|CCDS	protein_coding	IRF2BP2	protein_coding	OTTHUMT00000092705.1	T	NM_182972	-		234743418	-1	no_errors	ENST00000366609	ensembl	human	novel	74_37	missense	SNP	1.000	C
MUC16	94025	genome.wustl.edu	37	19	9071242	9071242	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr19:9071242T>A	ENST00000397910.4	-	3	16407	c.16204A>T	c.(16204-16206)Aga>Tga	p.R5402*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5404	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTGGCCGGTCTCTCATGAGTG	0.502																																																	0								ENSG00000181143						393.0	370.0	378.0					19																	9071242		2088	4228	6316	MUC16	SO:0001587	stop_gained	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16204A>T	19.37:g.9071242T>A	ENSP00000381008:p.Arg5402*	Somatic	0	77	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	37	46.38	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.R5402*	ENST00000397910.4	37	c.16204	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	t	56	27.128994	0.99970	.	.	ENSG00000181143	ENST00000397910	.	.	.	2.38	0.193	0.15139	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.5048	0.11881	0.0:0.3313:0.0:0.6687	.	.	.	.	X	5402	.	ENSP00000381008:R5402X	R	-	1	2	MUC16	8932242	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.103000	0.10940	-0.025000	0.13918	0.260000	0.18958	AGA	-	NULL		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	T	NM_024690	-		9071242	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	nonsense	SNP	0.000	A
ASAP3	55616	genome.wustl.edu	37	1	23763476	23763476	+	Silent	SNP	G	G	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:23763476G>A	ENST00000336689.3	-	15	1448	c.1404C>T	c.(1402-1404)caC>caT	p.H468H	ASAP3_ENST00000437606.2_Silent_p.H459H|ASAP3_ENST00000495646.1_5'Flank	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	468	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						CCAGTTCGCGGTGGACGCCCG	0.682																																																	0								ENSG00000088280						25.0	24.0	24.0					1																	23763476		2202	4299	6501	ASAP3	SO:0001819	synonymous_variant	0			-	HGNC	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.1404C>T	1.37:g.23763476G>A		Somatic	0	15	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.H468	ENST00000336689.3	37	c.1404	CCDS235.1	1																																																																																			-	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP		0.682	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP3	protein_coding	OTTHUMT00000008916.2	G	NM_017707	-		23763476	-1	no_errors	ENST00000336689	ensembl	human	known	74_37	silent	SNP	1.000	A
MRPL44	65080	genome.wustl.edu	37	2	224824624	224824624	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr2:224824624C>T	ENST00000258383.3	+	2	622	c.553C>T	c.(553-555)Cca>Tca	p.P185S		NM_022915.3	NP_075066.1	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44	185	RNase III.				mitochondrial translational elongation (GO:0070125)|RNA processing (GO:0006396)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		TGAAGAATTCCCAGTGCCCCC	0.483																																																	0								ENSG00000135900						117.0	114.0	115.0					2																	224824624		2203	4300	6503	MRPL44	SO:0001583	missense	0			-	HGNC	AK022763	CCDS2459.1	2p24.3-p24.1	2012-09-13			ENSG00000135900	ENSG00000135900		"""Mitochondrial ribosomal proteins / large subunits"""	16650	protein-coding gene	gene with protein product	"""39S ribosomal protein L44, mitochondrial"""	611849					Standard	NM_022915		Approved	FLJ12701, FLJ13990	uc002vnr.4	Q9H9J2	OTTHUMG00000133164	ENST00000258383.3:c.553C>T	2.37:g.224824624C>T	ENSP00000258383:p.Pro185Ser	Somatic	0	50	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	17	50.00	Q53S16|Q6IA62|Q9H821	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_RNase_III_dom,pfscan_dsRNA-bd_dom	p.P185S	ENST00000258383.3	37	c.553	CCDS2459.1	2	.	.	.	.	.	.	.	.	.	.	C	18.12	3.554077	0.65425	.	.	ENSG00000135900	ENST00000258383	T	0.42513	0.97	5.7	5.7	0.88788	Ribonuclease III (3);	0.000000	0.85682	D	0.000000	T	0.67590	0.2909	M	0.88377	2.95	0.80722	D	1	D	0.76494	0.999	D	0.65010	0.931	T	0.67007	-0.5779	10	0.23302	T	0.38	-11.3184	17.3321	0.87268	0.0:1.0:0.0:0.0	.	185	Q9H9J2	RM44_HUMAN	S	185	ENSP00000258383:P185S	ENSP00000258383:P185S	P	+	1	0	MRPL44	224532868	1.000000	0.71417	0.995000	0.50966	0.299000	0.27559	7.338000	0.79269	2.683000	0.91414	0.650000	0.86243	CCA	-	superfamily_RNase_III_dom		0.483	MRPL44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL44	protein_coding	OTTHUMT00000256866.2	C	NM_022915	-		224824624	+1	no_errors	ENST00000258383	ensembl	human	known	74_37	missense	SNP	1.000	T
OR2T8	343172	genome.wustl.edu	37	1	248085156	248085156	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr1:248085156C>A	ENST00000319968.4	+	1	837	c.837C>A	c.(835-837)ttC>ttA	p.F279L		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	279						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ATACTATGTTCACCCCTTTAC	0.478																																																	0								ENSG00000177462						140.0	131.0	134.0					1																	248085156		2203	4298	6501	OR2T8	SO:0001583	missense	0			-	HGNC		CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.837C>A	1.37:g.248085156C>A	ENSP00000326225:p.Phe279Leu	Somatic	0	80	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F279L	ENST00000319968.4	37	c.837	CCDS31100.1	1	.	.	.	.	.	.	.	.	.	.	C	0.026	-1.367797	0.01225	.	.	ENSG00000177462	ENST00000319968	T	0.00027	8.93	3.56	1.53	0.23141	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34531	U	0.003884	T	0.00039	0.0001	N	0.00453	-1.485	0.09310	N	1	B	0.20052	0.041	B	0.26864	0.074	T	0.44034	-0.9354	10	0.02654	T	1	.	2.2641	0.04074	0.3126:0.284:0.306:0.0973	.	279	A6NH00	OR2T8_HUMAN	L	279	ENSP00000326225:F279L	ENSP00000326225:F279L	F	+	3	2	OR2T8	246151779	0.000000	0.05858	0.069000	0.20011	0.049000	0.14656	-0.284000	0.08422	0.162000	0.19483	0.404000	0.27445	TTC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.478	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	protein_coding	OTTHUMT00000096862.1	C	NM_001005522	-		248085156	+1	no_errors	ENST00000319968	ensembl	human	known	74_37	missense	SNP	0.022	A
LHX1	3975	genome.wustl.edu	37	17	35300495	35300495	+	3'UTR	DEL	A	A	-	rs35033250|rs372092253|rs369876115|rs138151008|rs368565148|rs397857212		TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr17:35300495delA	ENST00000254457.5	+	0	2699				RP11-445F12.2_ENST00000607336.1_RNA	NM_005568.3	NP_005559.2	P48742	LHX1_HUMAN	LIM homeobox 1						anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell signaling (GO:0007267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell-granule cell precursor cell signaling involved in regulation of granule cell precursor cell proliferation (GO:0021937)|cerebellum development (GO:0021549)|cervix development (GO:0060067)|comma-shaped body morphogenesis (GO:0072049)|dorsal/ventral pattern formation (GO:0009953)|ectoderm formation (GO:0001705)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|embryonic viscerocranium morphogenesis (GO:0048703)|endoderm formation (GO:0001706)|epithelium development (GO:0060429)|forebrain regionalization (GO:0021871)|gastrulation with mouth forming second (GO:0001702)|head development (GO:0060322)|horizontal cell localization (GO:0035852)|kidney development (GO:0001822)|lateral motor column neuron migration (GO:0097477)|mesonephric duct development (GO:0072177)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerulus development (GO:0072224)|metanephric part of ureteric bud development (GO:0035502)|metanephric renal vesicle morphogenesis (GO:0072283)|metanephric S-shaped body morphogenesis (GO:0072284)|motor neuron axon guidance (GO:0008045)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct elongation (GO:0035849)|nephric duct morphogenesis (GO:0072178)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|oviduct development (GO:0060066)|oviduct epithelium development (GO:0035846)|paramesonephric duct development (GO:0061205)|pattern specification process (GO:0007389)|positive regulation of anterior head development (GO:2000744)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primitive streak formation (GO:0090009)|pronephros development (GO:0048793)|regulation of gene expression (GO:0010468)|renal vesicle morphogenesis (GO:0072077)|retina layer formation (GO:0010842)|S-shaped body morphogenesis (GO:0072050)|somite rostral/caudal axis specification (GO:0032525)|spinal cord association neuron differentiation (GO:0021527)|telencephalon development (GO:0021537)|transcription from RNA polymerase II promoter (GO:0006366)|ureteric bud development (GO:0001657)|urogenital system development (GO:0001655)|uterine epithelium development (GO:0035847)|uterus development (GO:0060065)|vagina development (GO:0060068)|ventral spinal cord development (GO:0021517)	nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	16		Breast(25;0.00607)				AGAAAAATAGAAAAAAAAAAA	0.502																																																	0								ENSG00000272191																																			RP11-445F12.2	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	U14755	CCDS11316.1	17q12	2014-04-11			ENSG00000132130	ENSG00000273706		"""Homeoboxes / LIM class"""	6593	protein-coding gene	gene with protein product		601999				9212161	Standard	NM_005568		Approved	LIM-1, LIM1	uc002hnh.2	P48742	OTTHUMG00000188456	ENST00000254457.5:c.*67A>-	17.37:g.35300495delA		Somatic	0	28	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	4	60.00	Q3MIW0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000254457.5	37	NULL	CCDS11316.1	17																																																																																			-	-		0.502	LHX1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000272191	protein_coding	OTTHUMT00000256704.3	A	NM_005568			35300495	-1	no_errors	ENST00000607336	ensembl	human	known	74_37	rna	DEL	0.027	-
SETX	23064	genome.wustl.edu	37	9	135158547	135158548	+	Intron	INS	-	-	A	rs397960745|rs371692040|rs577168773	byFrequency	TCGA-DX-AB3A-01A-11D-A417-09	TCGA-DX-AB3A-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	8e9ab794-7d43-4210-8c9b-a4175ccb824e	8152de30-f110-467a-934b-9f92131bee55	g.chr9:135158547_135158548insA	ENST00000224140.5	-	19	6729				SETX_ENST00000393220.1_Intron|SETX_ENST00000372169.2_Intron	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin						cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		AAATCAGATGCAAAAAAAAAAA	0.376																																																	0								ENSG00000107290																																			SETX	SO:0001627	intron_variant	0				HGNC	AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.6546+102->T	9.37:g.135158558_135158558dupA		Somatic	0	32	0.00		0.6229446579004951	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000224140.5	37	NULL	CCDS6947.1	9																																																																																			-	-		0.376	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	protein_coding	OTTHUMT00000054774.3	-	NM_015046			135158548	-1	no_errors	ENST00000474172	ensembl	human	known	74_37	rna	INS	0.028:0.010	A
