#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PLXND1	23129	genome.wustl.edu	37	3	129290655	129290655	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr3:129290655G>A	ENST00000324093.4	-	16	3288	c.3110C>T	c.(3109-3111)cCt>cTt	p.P1037L	PLXND1_ENST00000393239.1_Missense_Mutation_p.P1037L	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1037	IPT/TIG 2.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GGCCCCCTCAGGCATGGTGCA	0.667																																					Ovarian(97;366 1484 3738 22084 39045)												0								ENSG00000004399						27.0	27.0	27.0					3																	129290655		2200	4297	6497	PLXND1	SO:0001583	missense	0			-	HGNC	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3110C>T	3.37:g.129290655G>A	ENSP00000317128:p.Pro1037Leu	Somatic	0	58	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.P1037L	ENST00000324093.4	37	c.3110	CCDS33854.1	3	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828284	0.50845	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	D;D	0.86230	-2.09;-2.09	4.48	4.48	0.54585	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.068841	0.64402	D	0.000016	D	0.93779	0.8011	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94942	0.8092	10	0.87932	D	0	.	17.1864	0.86868	0.0:0.0:1.0:0.0	.	1037	Q9Y4D7	PLXD1_HUMAN	L	1037	ENSP00000317128:P1037L;ENSP00000376931:P1037L	ENSP00000317128:P1037L	P	-	2	0	PLXND1	130773345	1.000000	0.71417	0.653000	0.29593	0.043000	0.13939	5.275000	0.65575	2.057000	0.61298	0.555000	0.69702	CCT	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT		0.667	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	protein_coding	OTTHUMT00000356132.4	G	NM_015103	-		129290655	-1	no_errors	ENST00000324093	ensembl	human	known	74_37	missense	SNP	0.991	A
CCDC88A	55704	genome.wustl.edu	37	2	55561568	55561570	+	In_Frame_Del	DEL	GCA	GCA	-			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:55561568_55561570delGCA	ENST00000436346.1	-	15	3228_3230	c.2387_2389delTGC	c.(2386-2391)ttgcag>tag	p.796_797LQ>*	AC012358.8_ENST00000594078.1_RNA|AC012358.8_ENST00000599475.1_RNA|AC012358.8_ENST00000608103.1_RNA|CCDC88A_ENST00000263630.8_In_Frame_Del_p.796_797LQ>*|AC012358.8_ENST00000599352.1_RNA|CCDC88A_ENST00000413716.2_In_Frame_Del_p.796_797LQ>*|CCDC88A_ENST00000336838.6_In_Frame_Del_p.796_797LQ>*|AC012358.8_ENST00000600219.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	796					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						AGGTTTTTCTGCAATGTTTGATT	0.315																																																	0								ENSG00000115355																																			CCDC88A	SO:0001651	inframe_deletion	0				HGNC	AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.2387_2389delTGC	2.37:g.55561568_55561570delGCA	ENSP00000410608:p.Leu796_Gln797delins*	Somatic	0	64	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_t-SNARE	p.LQKNL796in_frame_del*	ENST00000436346.1	37	c.2389_2387		2																																																																																			-	superfamily_Prefoldin		0.315	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	protein_coding		GCA	NM_017571			55561570	-1	no_errors	ENST00000436346	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
CSRNP1	64651	genome.wustl.edu	37	3	39185356	39185356	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr3:39185356delT	ENST00000273153.5	-	5	1137	c.960delA	c.(958-960)ccafs	p.P321fs	CSRNP1_ENST00000514182.1_Frame_Shift_Del_p.P321fs	NM_033027.3	NP_149016.2	Q96S65	CSRN1_HUMAN	cysteine-serine-rich nuclear protein 1	321					apoptotic process (GO:0006915)|face morphogenesis (GO:0060325)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|skin(3)	24						CAGGGCTGGGTGGGCTGCCCT	0.612																																																	0								ENSG00000144655						36.0	36.0	36.0					3																	39185356		2203	4300	6503	CSRNP1	SO:0001589	frameshift_variant	0				HGNC	AB053121	CCDS2682.1	3p22	2009-04-17	2009-04-17	2009-04-17	ENSG00000144655	ENSG00000144655			14300	protein-coding gene	gene with protein product		606458	"""AXIN1 up-regulated 1"""	AXUD1		11526492, 17726538	Standard	NM_033027		Approved	URAX1, DKFZp566F164, FAM130B, TAIP-3	uc003cjg.3	Q96S65	OTTHUMG00000131293	ENST00000273153.5:c.960delA	3.37:g.39185356delT	ENSP00000273153:p.Pro321fs	Somatic	0	52	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	Q69YY5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	prints_Cys/Ser-rich_nuc_prot	p.S322fs	ENST00000273153.5	37	c.960	CCDS2682.1	3																																																																																			-	NULL		0.612	CSRNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP1	protein_coding	OTTHUMT00000254061.1	T	NM_033027			39185356	-1	no_errors	ENST00000273153	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
CACNA1F	778	genome.wustl.edu	37	X	49063082	49063082	+	Silent	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chrX:49063082G>T	ENST00000376265.2	-	46	5456	c.5395C>A	c.(5395-5397)Cgg>Agg	p.R1799R	CACNA1F_ENST00000323022.5_Silent_p.R1788R|CACNA1F_ENST00000376251.1_Silent_p.R1734R	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1799					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GAGGGCTTCCGACCTGGGGGT	0.617																																																	0								ENSG00000102001						36.0	36.0	36.0					X																	49063082		2203	4300	6503	CACNA1F	SO:0001819	synonymous_variant	0			-	HGNC	AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5395C>A	X.37:g.49063082G>T		Somatic	0	81	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.R1799	ENST00000376265.2	37	c.5395	CCDS35253.1	X																																																																																			-	NULL		0.617	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	protein_coding	OTTHUMT00000358157.1	G	NM_005183	-		49063082	-1	no_errors	ENST00000376265	ensembl	human	known	74_37	silent	SNP	0.054	T
COL1A1	1277	genome.wustl.edu	37	17	48274395	48274395	+	Silent	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr17:48274395G>A	ENST00000225964.5	-	11	898	c.780C>T	c.(778-780)ggC>ggT	p.G260G		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	260	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	TTCCAGGGAGGCCAGCTGTTC	0.527			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																																	Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0								ENSG00000108821						73.0	74.0	74.0					17																	48274395		2203	4300	6503	COL1A1	SO:0001819	synonymous_variant	0			-	HGNC	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.780C>T	17.37:g.48274395G>A		Somatic	0	113	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	59	9.23	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G260	ENST00000225964.5	37	c.780	CCDS11561.1	17																																																																																			-	pfam_Collagen		0.527	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	protein_coding	OTTHUMT00000309036.2	G		-		48274395	-1	no_errors	ENST00000225964	ensembl	human	known	74_37	silent	SNP	0.992	A
RGS12	6002	genome.wustl.edu	37	4	3314559	3314559	+	5'Flank	SNP	A	A	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr4:3314559A>G	ENST00000344733.5	+	0	0				RGS12_ENST00000336727.3_5'Flank|RGS12_ENST00000543385.1_Intron|RP11-357G3.2_ENST00000600073.1_RNA	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12						positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GGGCAACCACAGGTTCCAAGG	0.388																																																	0								ENSG00000248840																																			RP11-357G3.2	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277		4.37:g.3314559A>G	Exception_encountered	Somatic	0	29	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000344733.5	37	NULL	CCDS3366.1	4																																																																																			-	-		0.388	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000248840	protein_coding	OTTHUMT00000206602.1	A	NM_002926	-		3314559	+1	no_errors	ENST00000600073	ensembl	human	known	74_37	rna	SNP	0.001	G
COL4A2	1284	genome.wustl.edu	37	13	111114646	111114646	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr13:111114646T>C	ENST00000360467.5	+	24	1997	c.1691T>C	c.(1690-1692)gTc>gCc	p.V564A	COL4A2-AS2_ENST00000458403.2_RNA	NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	564	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CAGCCCGGCGTCCCAGGTGTG	0.672																																																	0								ENSG00000134871						46.0	56.0	53.0					13																	111114646		1966	4143	6109	COL4A2	SO:0001583	missense	0			-	HGNC	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.1691T>C	13.37:g.111114646T>C	ENSP00000353654:p.Val564Ala	Somatic	0	115	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	54	10.00	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.V564A	ENST00000360467.5	37	c.1691	CCDS41907.1	13	.	.	.	.	.	.	.	.	.	.	T	4.954	0.177282	0.09443	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93307	-3.2	5.48	4.25	0.50352	.	1.028630	0.07738	N	0.946311	D	0.84497	0.5485	N	0.10972	0.075	0.19575	N	0.999967	B	0.23377	0.084	B	0.19148	0.024	T	0.70651	-0.4813	10	0.09084	T	0.74	.	9.8873	0.41268	0.2466:0.0:0.0:0.7534	.	564	P08572	CO4A2_HUMAN	A	564	ENSP00000353654:V564A	ENSP00000257309:V564A	V	+	2	0	COL4A2	109912647	0.862000	0.29867	0.851000	0.33527	0.775000	0.43874	1.086000	0.30853	2.084000	0.62774	0.533000	0.62120	GTC	-	NULL		0.672	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	protein_coding	OTTHUMT00000045761.2	T	NM_001846	-		111114646	+1	no_errors	ENST00000360467	ensembl	human	known	74_37	missense	SNP	0.733	C
KHNYN	23351	genome.wustl.edu	37	14	24900739	24900739	+	Missense_Mutation	SNP	T	T	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr14:24900739T>A	ENST00000251343.5	+	3	411	c.272T>A	c.(271-273)aTc>aAc	p.I91N	CBLN3_ENST00000267406.6_5'Flank|CBLN3_ENST00000555436.1_5'Flank|KHNYN_ENST00000556842.1_Missense_Mutation_p.I91N|KHNYN_ENST00000554268.1_5'Flank|KHNYN_ENST00000553935.1_Missense_Mutation_p.I91N			O15037	KHNYN_HUMAN	KH and NYN domain containing	91							RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						CTGCACTGCATCTTTCTGGGA	0.597											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000100441						53.0	47.0	49.0					14																	24900739		2203	4300	6503	KHNYN	SO:0001583	missense	0			-	HGNC	AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.272T>A	14.37:g.24900739T>A	ENSP00000251343:p.Ile91Asn	Somatic	0	60	0.00	774	0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	20	35.48	Q86TZ6|Q8IUQ2|Q96BA9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_Zc3h12	p.I91N	ENST00000251343.5	37	c.272	CCDS32058.1	14	.	.	.	.	.	.	.	.	.	.	T	19.72	3.880195	0.72294	.	.	ENSG00000100441	ENST00000251343;ENST00000556842;ENST00000553935;ENST00000556510	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.03	3.88	0.44766	.	0.200125	0.41605	D	0.000860	T	0.52837	0.1759	M	0.65975	2.015	0.80722	D	1	D;D	0.60575	0.988;0.988	P;P	0.56398	0.797;0.797	T	0.54892	-0.8225	10	0.87932	D	0	.	8.9124	0.35561	0.0:0.0901:0.0:0.9099	.	132;91	D3DS77;O15037	.;KHNYN_HUMAN	N	91	ENSP00000251343:I91N;ENSP00000451106:I91N;ENSP00000450799:I91N;ENSP00000451004:I91N	ENSP00000251343:I91N	I	+	2	0	KHNYN	23970579	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.684000	0.68197	0.878000	0.35920	0.460000	0.39030	ATC	-	NULL		0.597	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KHNYN	protein_coding	OTTHUMT00000412928.1	T		-		24900739	+1	no_errors	ENST00000251343	ensembl	human	known	74_37	missense	SNP	1.000	A
NPIPB15	440348	genome.wustl.edu	37	16	74425621	74425622	+	In_Frame_Ins	INS	-	-	CCTCTTCCACCCTCT	rs141339834	byFrequency	TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr16:74425621_74425622insCCTCTTCCACCCTCT	ENST00000429990.1	+	7	1071_1072	c.975_976insCCTCTTCCACCCTCT	c.(976-978)cct>CCTCTTCCACCCTCTcct	p.326_326P>PLPPSP				A6NHN6	NPB15_HUMAN	nuclear pore complex interacting protein family, member B15	326	Pro-rich.					extracellular region (GO:0005576)											GTCTCTTTGTCCCTCTTCCACC	0.52																																																	0								ENSG00000196436																																			NPIPB15	SO:0001652	inframe_insertion	0				HGNC	BC160029		16q22.3	2013-06-11	2013-06-11	2013-06-11	ENSG00000196436	ENSG00000196436			34409	protein-coding gene	gene with protein product			"""nuclear pore complex interacting protein-like 2"""	NPIPL2			Standard	XM_005256273		Approved	LOC440348	uc010vmt.1	A6NHN6	OTTHUMG00000156916	ENST00000429990.1:c.976_990dupCCTCTTCCACCCTCT	16.37:g.74425621_74425622insCCTCTTCCACCCTCT	Exception_encountered	Somatic	NA	NA	NA		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J9U8	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.329in_frame_insSPLPP	ENST00000429990.1	37	c.975_976		16																																																																																			-	NULL		0.520	NPIPB15-001	KNOWN	basic|appris_principal	protein_coding	NPIPB15	protein_coding	OTTHUMT00000346597.2	-	NM_001018059			74425622	+1	no_errors	ENST00000429990	ensembl	human	known	74_37	in_frame_ins	INS	0.002:0.007	CCTCTTCCACCCTCT
AFAP1L2	84632	genome.wustl.edu	37	10	116055237	116055251	+	3'UTR	DEL	GATGGTTTTACAGAT	GATGGTTTTACAGAT	-	rs147901415|rs369081437	byFrequency	TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	GATGGTTTTACAGAT	GATGGTTTTACAGAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr10:116055237_116055251delGATGGTTTTACAGAT	ENST00000304129.4	-	0	3036_3050				AFAP1L2_ENST00000369271.3_3'UTR|AFAP1L2_ENST00000491814.1_5'UTR			Q8N4X5	AF1L2_HUMAN	actin filament associated protein 1-like 2						inflammatory response (GO:0006954)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of interleukin-6 production (GO:0032675)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)	protein tyrosine kinase activator activity (GO:0030296)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(11)|ovary(1)|prostate(2)	21		Colorectal(252;0.175)|Breast(234;0.231)		Epithelial(162;0.0219)|all cancers(201;0.0561)		TCATGTCATAGATGGTTTTACAGATGATGGTTTTA	0.395														155	0.0309505	0.1082	0.0072	5008	,	,		21207	0.0		0.004	False		,,,				2504	0.0031																0								ENSG00000169129																																			AFAP1L2	SO:0001624	3_prime_UTR_variant	0				HGNC	BC024314	CCDS31286.1, CCDS31287.1	10q26.11	2013-01-10	2007-02-07	2007-02-07	ENSG00000169129	ENSG00000169129		"""Pleckstrin homology (PH) domain containing"""	25901	protein-coding gene	gene with protein product		612420	"""KIAA1914"""	KIAA1914		11572484, 17412687	Standard	XM_005270239		Approved	FLJ14564, Em:AC005383.4, XB130	uc001lbn.3	Q8N4X5	OTTHUMG00000019086	ENST00000304129.4:c.*564ATCTGTAAAACCATC>-	10.37:g.116055237_116055251delGATGGTTTTACAGAT		Somatic	NA	NA	NA		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K6P7|B3KVQ8|Q2UZW3|Q8TB54|Q96PX4|Q96SY5	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000304129.4	37	NULL	CCDS31286.1	10																																																																																			-	-		0.395	AFAP1L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFAP1L2	protein_coding	OTTHUMT00000050462.1	GATGGTTTTACAGAT	NM_032550			116055251	-1	no_errors	ENST00000491814	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.073:0.083:0.092:0.099:0.105:0.115:0.112:0.108:0.103	-
SYNPO2L	79933	genome.wustl.edu	37	10	75407274	75407274	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr10:75407274C>A	ENST00000394810.2	-	4	2285	c.2136G>T	c.(2134-2136)aaG>aaT	p.K712N	SYNPO2L_ENST00000372873.4_Missense_Mutation_p.K488N	NM_001114133.1	NP_001107605.1	Q9H987	SYP2L_HUMAN	synaptopodin 2-like	712	Pro-rich.					cytoskeleton (GO:0005856)|nucleus (GO:0005634)|Z disc (GO:0030018)				breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Prostate(51;0.0112)					GGGGCGGGGTCTTGGGAGCCA	0.622																																																	0								ENSG00000166317						50.0	62.0	58.0					10																	75407274		2203	4300	6503	SYNPO2L	SO:0001583	missense	0			-	HGNC	AK022983	CCDS7331.1, CCDS44438.1	10q22.3	2007-12-19			ENSG00000166317	ENSG00000166317			23532	protein-coding gene	gene with protein product							Standard	XM_005270158		Approved	FLJ12921	uc001jut.4	Q9H987	OTTHUMG00000018471	ENST00000394810.2:c.2136G>T	10.37:g.75407274C>A	ENSP00000378289:p.Lys712Asn	Somatic	0	15	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00	A5PKV9|Q68A20	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.K712N	ENST00000394810.2	37	c.2136	CCDS44438.1	10	.	.	.	.	.	.	.	.	.	.	C	12.57	1.977169	0.34848	.	.	ENSG00000166317	ENST00000372873;ENST00000394810	T;T	0.23552	1.9;2.24	5.16	4.25	0.50352	.	0.121946	0.37053	N	0.002279	T	0.29389	0.0732	L	0.44542	1.39	0.33783	D	0.624547	P;P	0.50617	0.671;0.937	B;P	0.50754	0.203;0.649	T	0.34527	-0.9825	10	0.19147	T	0.46	-9.4066	12.921	0.58232	0.0:0.9208:0.0:0.0792	.	712;488	Q9H987;Q9H987-2	SYP2L_HUMAN;.	N	488;712	ENSP00000361964:K488N;ENSP00000378289:K712N	ENSP00000361964:K488N	K	-	3	2	SYNPO2L	75077280	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	0.540000	0.23191	1.373000	0.46208	0.561000	0.74099	AAG	-	NULL		0.622	SYNPO2L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNPO2L	protein_coding	OTTHUMT00000316562.2	C	NM_024875	-		75407274	-1	no_errors	ENST00000394810	ensembl	human	known	74_37	missense	SNP	1.000	A
APBA1	320	genome.wustl.edu	37	9	72131055	72131055	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr9:72131055C>G	ENST00000265381.4	-	2	1294	c.1072G>C	c.(1072-1074)Gag>Cag	p.E358Q		NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	358					axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						TTCACCTCCTCGATGGCCTCC	0.662																																																	0								ENSG00000107282						128.0	97.0	108.0					9																	72131055		2203	4300	6503	APBA1	SO:0001583	missense	0			-	HGNC	AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1072G>C	9.37:g.72131055C>G	ENSP00000265381:p.Glu358Gln	Somatic	0	68	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	27	41.30	O14914|O60570|Q5VYR8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.E358Q	ENST00000265381.4	37	c.1072	CCDS6630.1	9	.	.	.	.	.	.	.	.	.	.	C	24.4	4.532240	0.85812	.	.	ENSG00000107282	ENST00000265381	T	0.05786	3.39	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.10208	0.0250	L	0.34521	1.04	0.80722	D	1	P	0.52577	0.954	P	0.48304	0.573	T	0.29088	-1.0023	10	0.22109	T	0.4	-19.4294	20.1772	0.98182	0.0:1.0:0.0:0.0	.	358	Q02410	APBA1_HUMAN	Q	358	ENSP00000265381:E358Q	ENSP00000265381:E358Q	E	-	1	0	APBA1	71320875	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.778000	0.95560	0.655000	0.94253	GAG	-	NULL		0.662	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA1	protein_coding	OTTHUMT00000052589.2	C	NM_001163	-		72131055	-1	no_errors	ENST00000265381	ensembl	human	known	74_37	missense	SNP	1.000	G
PIGS	94005	genome.wustl.edu	37	17	26883895	26883895	+	Missense_Mutation	SNP	C	C	T	rs35452097	byFrequency	TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr17:26883895C>T	ENST00000308360.7	-	9	1405	c.1030G>A	c.(1030-1032)Gct>Act	p.A344T	PIGS_ENST00000465444.1_5'Flank|PIGS_ENST00000395346.2_Missense_Mutation_p.A336T|PIGS_ENST00000543734.1_Missense_Mutation_p.A283T	NM_033198.3	NP_149975.1	Q96S52	PIGS_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class S	344					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(3)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Lung NSC(42;0.00431)					GCCACTGGAGCGCCATCCTTG	0.562																																																	0								ENSG00000087111						91.0	74.0	80.0					17																	26883895		2203	4300	6503	PIGS	SO:0001583	missense	0			-	HGNC		CCDS11235.1	17p13.2	2013-02-26	2006-06-28		ENSG00000087111	ENSG00000087111		"""Phosphatidylinositol glycan anchor biosynthesis"""	14937	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610271	"""phosphatidylinositol glycan, class S"""				Standard	NM_033198		Approved		uc002hbo.2	Q96S52	OTTHUMG00000132604	ENST00000308360.7:c.1030G>A	17.37:g.26883895C>T	ENSP00000309430:p.Ala344Thr	Somatic	0	51	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	Q6UVX6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PtdIno-glycan_biosynth_class_S	p.A344T	ENST00000308360.7	37	c.1030	CCDS11235.1	17	.	.	.	.	.	.	.	.	.	.	C	9.841	1.190967	0.21954	.	.	ENSG00000087111	ENST00000395346;ENST00000308360;ENST00000543734	T;T;T	0.41400	1.0;1.0;1.0	5.49	4.52	0.55395	.	0.496728	0.24703	N	0.036293	T	0.28001	0.0690	L	0.36672	1.1	0.20196	N	0.999924	B;B	0.14438	0.01;0.008	B;B	0.14023	0.01;0.006	T	0.18178	-1.0345	10	0.13853	T	0.58	-0.1878	6.8792	0.24163	0.1412:0.7142:0.0:0.1445	.	344;336	Q96S52;Q96S52-2	PIGS_HUMAN;.	T	336;344;283	ENSP00000378755:A336T;ENSP00000309430:A344T;ENSP00000438447:A283T	ENSP00000309430:A344T	A	-	1	0	PIGS	23908022	0.834000	0.29399	0.949000	0.38748	0.881000	0.50899	1.411000	0.34702	1.450000	0.47717	0.655000	0.94253	GCT	-	pfam_PtdIno-glycan_biosynth_class_S		0.562	PIGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGS	protein_coding	OTTHUMT00000255833.3	C	NM_033198	-		26883895	-1	no_errors	ENST00000308360	ensembl	human	known	74_37	missense	SNP	0.292	T
KRBOX1	100506243	genome.wustl.edu	37	3	42984102	42984102	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr3:42984102G>A	ENST00000418176.1	+	4	2384	c.350G>A	c.(349-351)cGa>cAa	p.R117Q	KRBOX1_ENST00000383748.4_Missense_Mutation_p.R117Q|KRBOX1_ENST00000418093.2_Intron|KRBOX1_ENST00000426937.1_Missense_Mutation_p.R117Q|KRBOX1_ENST00000443313.1_Intron			C9JBD0	KRBX1_HUMAN	KRAB box domain containing 1	117					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			lung(2)	2						AAAATTTTTCGAAATCGTCAA	0.348																																																	0								ENSG00000240747																																			KRBOX1	SO:0001583	missense	0			-	HGNC		CCDS54572.1	3p22.1	2014-02-12	2010-07-29		ENSG00000240747	ENSG00000240747		"""-"""	38708	protein-coding gene	gene with protein product							Standard	NM_001205272		Approved		uc003cmm.4	C9JBD0	OTTHUMG00000156448	ENST00000418176.1:c.350G>A	3.37:g.42984102G>A	ENSP00000388094:p.Arg117Gln	Somatic	0	181	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	64	8.57	B4DJE8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.R117Q	ENST00000418176.1	37	c.350	CCDS54572.1	3	.	.	.	.	.	.	.	.	.	.	G	0.208	-1.039076	0.02013	.	.	ENSG00000240747	ENST00000426937;ENST00000383748;ENST00000418176	T;T;T	0.01203	5.18;5.18;5.18	3.26	-4.2	0.03823	.	.	.	.	.	T	0.00552	0.0018	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46775	-0.9167	9	0.13108	T	0.6	.	1.0148	0.01505	0.3065:0.17:0.3444:0.1791	.	117	C9JBD0	KRBX1_HUMAN	Q	117	ENSP00000413859:R117Q;ENSP00000373254:R117Q;ENSP00000388094:R117Q	ENSP00000373254:R117Q	R	+	2	0	KRBOX1	42959106	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.552000	0.06020	-0.873000	0.04032	-1.669000	0.00746	CGA	-	NULL		0.348	KRBOX1-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KRBOX1	protein_coding	OTTHUMT00000344236.1	G	NM_001205272	-		42984102	+1	no_errors	ENST00000426937	ensembl	human	putative	74_37	missense	SNP	0.000	A
TRAPPC9	83696	genome.wustl.edu	37	8	141461086	141461086	+	Silent	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr8:141461086G>A	ENST00000438773.2	-	2	520	c.387C>T	c.(385-387)cgC>cgT	p.R129R	TRAPPC9_ENST00000389328.4_Silent_p.R227R|TRAPPC9_ENST00000389327.3_Silent_p.R129R	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	129					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CCACGTCGGTGCGCGGCTGCT	0.572																																																	0								ENSG00000167632						69.0	59.0	63.0					8																	141461086		2203	4300	6503	TRAPPC9	SO:0001819	synonymous_variant	0			-	HGNC	BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.387C>T	8.37:g.141461086G>A		Somatic	0	54	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	51	13.56	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TRAPP_II_complex_Trs120	p.R227	ENST00000438773.2	37	c.681	CCDS55278.1	8																																																																																			-	NULL		0.572	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	protein_coding	OTTHUMT00000377749.1	G	NM_031466	-		141461086	-1	no_errors	ENST00000389328	ensembl	human	known	74_37	silent	SNP	0.837	A
ZSCAN12	9753	genome.wustl.edu	37	6	28358731	28358731	+	Missense_Mutation	SNP	C	C	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr6:28358731C>G	ENST00000361028.1	-	4	1481	c.1336G>C	c.(1336-1338)Gaa>Caa	p.E446Q	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.E446Q			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	446					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						TTCCCACATTCCTTACACTGA	0.418																																																	0								ENSG00000158691						109.0	94.0	99.0					6																	28358731		692	1591	2283	ZSCAN12	SO:0001583	missense	0			-	HGNC	AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.1336G>C	6.37:g.28358731C>G	ENSP00000354305:p.Glu446Gln	Somatic	0	34	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	O43724	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E446Q	ENST00000361028.1	37	c.1336		6	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613148	0.46631	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.07444	3.19;3.19	3.45	3.45	0.39498	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05135	0.0137	N	0.16130	0.375	0.22330	N	0.999199	D;B	0.61697	0.99;0.002	P;B	0.55824	0.785;0.003	T	0.39440	-0.9614	9	0.49607	T	0.09	.	13.8207	0.63318	0.0:1.0:0.0:0.0	.	446;446	A8K187;O43309	.;ZSC12_HUMAN	Q	446	ENSP00000354305:E446Q;ENSP00000380039:E446Q	ENSP00000354305:E446Q	E	-	1	0	ZSCAN12	28466710	0.000000	0.05858	1.000000	0.80357	0.997000	0.91878	-0.025000	0.12413	1.755000	0.51935	0.650000	0.86243	GAA	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	protein_coding	OTTHUMT00000040190.1	C	NM_014724	-		28358731	-1	no_errors	ENST00000361028	ensembl	human	known	74_37	missense	SNP	0.900	G
KIAA0513	9764	genome.wustl.edu	37	16	85114948	85114948	+	Silent	SNP	C	C	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr16:85114948C>A	ENST00000566428.1	+	9	1561	c.930C>A	c.(928-930)gcC>gcA	p.A310A	KIAA0513_ENST00000538274.1_Silent_p.A310A|KIAA0513_ENST00000258180.3_Silent_p.A310A			O60268	K0513_HUMAN	KIAA0513	310						cytoplasm (GO:0005737)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(9)|pancreas(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.234)		GGAATGCAGCCTTTTTTGACG	0.577																																																	0								ENSG00000135709						70.0	53.0	58.0					16																	85114948		2198	4300	6498	KIAA0513	SO:0001819	synonymous_variant	0			-	HGNC	AB011085	CCDS32499.1, CCDS67091.1, CCDS73919.1	16q24.1	2012-11-29			ENSG00000135709	ENSG00000135709			29058	protein-coding gene	gene with protein product		611675				9628581	Standard	XM_005256265		Approved		uc002fiu.3	O60268	OTTHUMG00000176597	ENST00000566428.1:c.930C>A	16.37:g.85114948C>A		Somatic	0	57	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B4DSS5|D3DUM2|Q8N6G0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SBF2	p.A310	ENST00000566428.1	37	c.930	CCDS32499.1	16																																																																																			-	pfam_SBF2		0.577	KIAA0513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0513	protein_coding	OTTHUMT00000432736.1	C	NM_014732	-		85114948	+1	no_errors	ENST00000258180	ensembl	human	known	74_37	silent	SNP	0.963	A
LOC283299	283299	genome.wustl.edu	37	11	7904519	7904519	+	RNA	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr11:7904519C>T	ENST00000527847.1	-	0	353				RP11-35J10.5_ENST00000527565.1_lincRNA	NR_036678.1																						CAAAAATTGGCAAGGAACTGC	0.403																																																	0								ENSG00000254951																																			RP11-494M8.4			0			-	Clone_based_vega_gene																													11.37:g.7904519C>T		Somatic	0	34	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000527847.1	37	NULL		11																																																																																			-	-		0.403	RP11-494M8.4-001	KNOWN	basic	sense_overlapping	LOC283299	sense_overlapping	OTTHUMT00000385693.1	C		-		7904519	-1	no_errors	ENST00000529488	ensembl	human	known	74_37	rna	SNP	0.003	T
DSG2	1829	genome.wustl.edu	37	18	29126561	29126561	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr18:29126561C>A	ENST00000261590.8	+	15	3421	c.3212C>A	c.(3211-3213)gCt>gAt	p.A1071D	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	1071					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			TCTATGACGGCTAGGAACACC	0.473																																																	0								ENSG00000046604						90.0	86.0	87.0					18																	29126561		1900	4138	6038	DSG2	SO:0001583	missense	0			-	HGNC	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.3212C>A	18.37:g.29126561C>A	ENSP00000261590:p.Ala1071Asp	Somatic	0	68	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q4KKU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.A1071D	ENST00000261590.8	37	c.3212	CCDS42423.1	18	.	.	.	.	.	.	.	.	.	.	C	7.165	0.586387	0.13749	.	.	ENSG00000046604	ENST00000261590	T	0.81247	-1.47	5.23	2.14	0.27477	.	1.074500	0.07151	N	0.849183	T	0.64800	0.2631	N	0.22421	0.69	0.09310	N	0.999999	P	0.42409	0.779	B	0.34242	0.178	T	0.55283	-0.8165	10	0.48119	T	0.1	.	5.2932	0.15739	0.1369:0.5985:0.0:0.2645	.	1071	Q14126	DSG2_HUMAN	D	1071	ENSP00000261590:A1071D	ENSP00000261590:A1071D	A	+	2	0	DSG2	27380559	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.181000	0.16880	0.315000	0.23110	-0.140000	0.14226	GCT	-	NULL		0.473	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG2	protein_coding	OTTHUMT00000447506.1	C	NM_001943	-		29126561	+1	no_errors	ENST00000261590	ensembl	human	known	74_37	missense	SNP	0.000	A
WDR54	84058	genome.wustl.edu	37	2	74654698	74654698	+	IGR	SNP	C	C	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:74654698C>A	ENST00000348227.4	+	0	1147				RTKN_ENST00000272430.5_Nonsense_Mutation_p.E370*|RTKN_ENST00000305557.5_Nonsense_Mutation_p.E357*|RTKN_ENST00000233330.6_Nonsense_Mutation_p.E320*	NM_032118.2	NP_115494.1	Q9H977	WDR54_HUMAN	WD repeat domain 54											breast(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9						TGGTCCAGCTCCCCTGCCCGG	0.557																																																	0								ENSG00000114993						139.0	150.0	146.0					2																	74654698		2203	4300	6503	RTKN	SO:0001628	intergenic_variant	0			-	HGNC	AK023015	CCDS1940.1	2p13.1	2013-01-09			ENSG00000005448	ENSG00000005448		"""WD repeat domain containing"""	25770	protein-coding gene	gene with protein product						12477932	Standard	NM_032118		Approved	FLJ12953	uc002slb.3	Q9H977	OTTHUMG00000129951		2.37:g.74654698C>A		Somatic	0	56	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	D6W5I3|Q53H85|Q86V45	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pleckstrin_homology,pfam_HR1_rho-bd,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E370*	ENST00000348227.4	37	c.1108	CCDS1940.1	2	.	.	.	.	.	.	.	.	.	.	C	39	7.611410	0.98390	.	.	ENSG00000114993	ENST00000305557;ENST00000272430;ENST00000233330	.	.	.	4.6	3.71	0.42584	.	0.224032	0.45361	D	0.000378	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	10.2116	0.43145	0.1981:0.8019:0.0:0.0	.	.	.	.	X	357;370;320	.	ENSP00000233330:E320X	E	-	1	0	RTKN	74508206	1.000000	0.71417	0.980000	0.43619	0.292000	0.27327	5.065000	0.64344	1.267000	0.44247	0.561000	0.74099	GAG	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.557	WDR54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTKN	protein_coding	OTTHUMT00000252213.1	C	NM_032118	-		74654698	-1	no_errors	ENST00000272430	ensembl	human	known	74_37	nonsense	SNP	1.000	A
VWA5A	4013	genome.wustl.edu	37	11	123989074	123989074	+	Missense_Mutation	SNP	G	G	T	rs560933369		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr11:123989074G>T	ENST00000456829.2	+	5	676	c.425G>T	c.(424-426)cGc>cTc	p.R142L	VWA5A_ENST00000360334.4_Missense_Mutation_p.R142L|VWA5A_ENST00000361352.5_Missense_Mutation_p.R142L|VWA5A_ENST00000449321.1_Missense_Mutation_p.R142L|VWA5A_ENST00000392748.1_Missense_Mutation_p.R142L|VWA5A_ENST00000392744.4_Missense_Mutation_p.R158L	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	142								p.R142L(1)		autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						GGGGCTCTGCGCTTTGTGCTC	0.522																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)						ENSG00000110002						105.0	103.0	104.0					11																	123989074		2201	4299	6500	VWA5A	SO:0001583	missense	0			-	HGNC	AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.425G>T	11.37:g.123989074G>T	ENSP00000407726:p.Arg142Leu	Somatic	0	48	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	Q6UN19|Q6UN20|Q9BVF8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.R142L	ENST00000456829.2	37	c.425	CCDS8444.1	11	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189061	0.78789	.	.	ENSG00000110002	ENST00000456829;ENST00000360334;ENST00000392748;ENST00000524524;ENST00000530025;ENST00000361352;ENST00000449321;ENST00000392744	T;T;T;T;T;T	0.31247	3.29;1.5;3.29;1.89;1.89;1.85	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.58352	0.2116	M	0.81802	2.56	0.58432	D	0.999998	D;D	0.76494	0.998;0.999	D;D	0.72625	0.953;0.978	T	0.59616	-0.7421	10	0.48119	T	0.1	-20.9118	16.9454	0.86228	0.0:0.0:1.0:0.0	.	158;142	B4DHS6;O00534	.;VMA5A_HUMAN	L	142;142;142;142;142;142;142;158	ENSP00000407726:R142L;ENSP00000353485:R142L;ENSP00000376504:R142L;ENSP00000355070:R142L;ENSP00000404683:R142L;ENSP00000376501:R158L	ENSP00000353485:R142L	R	+	2	0	VWA5A	123494284	1.000000	0.71417	0.999000	0.59377	0.219000	0.24729	6.284000	0.72652	2.599000	0.87857	0.655000	0.94253	CGC	-	NULL		0.522	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5A	protein_coding	OTTHUMT00000387273.1	G	NM_014622	-		123989074	+1	no_errors	ENST00000392748	ensembl	human	known	74_37	missense	SNP	1.000	T
SFXN5	94097	genome.wustl.edu	37	2	73171852	73171852	+	3'UTR	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:73171852G>T	ENST00000272433.2	-	0	1452				SFXN5_ENST00000474528.1_5'UTR	NM_144579.2	NP_653180.1	Q8TD22	SFXN5_HUMAN	sideroflexin 5						iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)|citrate transmembrane transporter activity (GO:0015137)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9						CTACCCCATGGGCACTCTACA	0.363																																																	0								ENSG00000144040																																			SFXN5	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AY044437	CCDS1922.1	2p13	2008-05-21			ENSG00000144040	ENSG00000144040		"""Sideroflexins"""	16073	protein-coding gene	gene with protein product		615572				12039050, 12150972	Standard	XM_005264648		Approved	BBG-TCC	uc002siq.3	Q8TD22	OTTHUMG00000129775	ENST00000272433.2:c.*299C>A	2.37:g.73171852G>T		Somatic	0	72	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	A8K116|Q494Y3|Q53T29	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000272433.2	37	NULL	CCDS1922.1	2																																																																																			-	-		0.363	SFXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN5	protein_coding	OTTHUMT00000251991.1	G	NM_144579	-		73171852	-1	no_errors	ENST00000461352	ensembl	human	known	74_37	rna	SNP	0.627	T
GNPTAB	79158	genome.wustl.edu	37	12	102167086	102167096	+	Intron	DEL	CATGCTCTCCA	CATGCTCTCCA	-	rs377136936		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	CATGCTCTCCA	CATGCTCTCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr12:102167086_102167096delCATGCTCTCCA	ENST00000299314.7	-	8	1034				GNPTAB_ENST00000549940.1_Intron|RP11-511H9.3_ENST00000600133.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits						carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						CTTCACCCCCCATGCTCTCCACCTGCTCCCT	0.431																																																	0								ENSG00000258230																																			RP11-511H9.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.772-2151TGGAGAGCATG>-	12.37:g.102167086_102167096delCATGCTCTCCA		Somatic	NA	NA	NA		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000299314.7	37	NULL	CCDS9088.1	12																																																																																			-	-		0.431	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258230	protein_coding	OTTHUMT00000409182.1	CATGCTCTCCA				102167096	-1	no_errors	ENST00000600133	ensembl	human	known	74_37	rna	DEL	0.356:0.345:0.330:0.331:0.328:0.320:0.307:0.287:0.261:0.225:0.174	-
DMD	1756	genome.wustl.edu	37	X	32328228	32328228	+	Missense_Mutation	SNP	C	C	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chrX:32328228C>A	ENST00000357033.4	-	42	6294	c.6088G>T	c.(6088-6090)Gat>Tat	p.D2030Y	DMD_ENST00000378677.2_Missense_Mutation_p.D2026Y	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2030					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTAAAGAGATCTTCAAAGTCC	0.393																																																	0								ENSG00000198947						100.0	83.0	89.0					X																	32328228		2202	4300	6502	DMD	SO:0001583	missense	0			-	HGNC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.6088G>T	X.37:g.32328228C>A	ENSP00000354923:p.Asp2030Tyr	Somatic	0	94	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	23	32.35	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.D2030Y	ENST00000357033.4	37	c.6088	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455774	0.63401	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.51574	0.7;0.7	6.16	4.41	0.53225	.	0.000000	0.38164	U	0.001785	T	0.61476	0.2350	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.975;0.999;0.971;0.986	D;P;D;P;D	0.66847	0.912;0.832;0.947;0.837;0.923	T	0.64232	-0.6456	10	0.87932	D	0	.	9.7416	0.40422	0.0:0.7782:0.0:0.2218	.	2022;2030;2026;689;686	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	Y	2022;689;686;2026;2030;2030;1907	ENSP00000367948:D2026Y;ENSP00000354923:D2030Y	ENSP00000354923:D2030Y	D	-	1	0	DMD	32238149	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.339000	0.43965	1.356000	0.45884	-0.197000	0.12766	GAT	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.393	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	C	NM_004006	-		32328228	-1	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	SNP	1.000	A
TSPYL6	388951	genome.wustl.edu	37	2	54482087	54482087	+	Missense_Mutation	SNP	A	A	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:54482087A>G	ENST00000317802.7	-	1	1322	c.1202T>C	c.(1201-1203)aTc>aCc	p.I401T	ACYP2_ENST00000394666.3_Intron|ACYP2_ENST00000607452.1_Intron|ACYP2_ENST00000606865.1_Intron|ACYP2_ENST00000303536.4_Intron	NM_001003937.2	NP_001003937.2	Q8N831	TSYL6_HUMAN	TSPY-like 6	401					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(1)|ovary(1)|skin(1)|stomach(2)	20						GGGCCTGGGGATCTCCACTGG	0.537																																																	0								ENSG00000178021						68.0	74.0	72.0					2																	54482087		2153	4286	6439	TSPYL6	SO:0001583	missense	0			-	HGNC	AK097417	CCDS42682.1	2p16.3	2007-10-22			ENSG00000178021	ENSG00000178021			14521	protein-coding gene	gene with protein product							Standard	NM_001003937		Approved		uc002rxr.2	Q8N831	OTTHUMG00000151823	ENST00000317802.7:c.1202T>C	2.37:g.54482087A>G	ENSP00000417919:p.Ile401Thr	Somatic	0	90	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	38	36.67	Q6NUJ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.I401T	ENST00000317802.7	37	c.1202	CCDS42682.1	2	.	.	.	.	.	.	.	.	.	.	A	3.389	-0.124656	0.06795	.	.	ENSG00000178021	ENST00000317802	T	0.17854	2.25	1.83	0.638	0.17742	.	.	.	.	.	T	0.05593	0.0147	N	0.14661	0.345	0.09310	N	0.99999	P	0.37330	0.59	B	0.30251	0.113	T	0.22556	-1.0213	9	0.02654	T	1	.	3.6474	0.08189	0.7923:0.0:0.2077:0.0	.	401	Q8N831	TSYL6_HUMAN	T	401	ENSP00000417919:I401T	ENSP00000417919:I401T	I	-	2	0	TSPYL6	54335591	0.034000	0.19679	0.498000	0.27564	0.936000	0.57629	0.004000	0.13106	0.171000	0.19730	0.482000	0.46254	ATC	-	NULL		0.537	TSPYL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL6	protein_coding	OTTHUMT00000324069.3	A	XM_371494	-		54482087	-1	no_errors	ENST00000317802	ensembl	human	known	74_37	missense	SNP	0.613	G
FBN1	2200	genome.wustl.edu	37	15	48707925	48707925	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr15:48707925G>T	ENST00000316623.5	-	64	8314	c.7859C>A	c.(7858-7860)gCc>gAc	p.A2620D	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2620	EGF-like 46; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTGACAGGAGGCTCCTCCGCA	0.522																																																	0								ENSG00000166147						93.0	86.0	88.0					15																	48707925		2198	4296	6494	FBN1	SO:0001583	missense	0			-	HGNC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7859C>A	15.37:g.48707925G>T	ENSP00000325527:p.Ala2620Asp	Somatic	0	61	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.A2620D	ENST00000316623.5	37	c.7859	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	G	36	5.733250	0.96856	.	.	ENSG00000166147	ENST00000316623	D	0.87809	-2.3	5.81	5.81	0.92471	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.049117	0.85682	D	0.000000	D	0.93468	0.7916	M	0.74546	2.27	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.93356	0.6722	10	0.62326	D	0.03	.	18.8343	0.92155	0.0:0.0:1.0:0.0	.	2620	P35555	FBN1_HUMAN	D	2620	ENSP00000325527:A2620D	ENSP00000325527:A2620D	A	-	2	0	FBN1	46495217	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.745000	0.94114	0.655000	0.94253	GCC	-	pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.522	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	protein_coding	OTTHUMT00000417355.1	G		-		48707925	-1	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	SNP	1.000	T
AMOT	154796	genome.wustl.edu	37	X	112022705	112022705	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chrX:112022705C>T	ENST00000524145.1	-	11	2751	c.2677G>A	c.(2677-2679)Gct>Act	p.A893T	AMOT_ENST00000371959.3_Missense_Mutation_p.A893T|AMOT_ENST00000371962.1_Missense_Mutation_p.A661T|MIR4329_ENST00000582643.1_RNA|AMOT_ENST00000304758.1_Missense_Mutation_p.A484T			Q4VCS5	AMOT_HUMAN	angiomotin	893					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						atggcggcagcagtggcggca	0.597																																																	0								ENSG00000126016						57.0	32.0	41.0					X																	112022705		2132	4152	6284	AMOT	SO:0001583	missense	0			-	HGNC	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2677G>A	X.37:g.112022705C>T	ENSP00000429013:p.Ala893Thr	Somatic	0	23	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.A893T	ENST00000524145.1	37	c.2677	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	C	13.87	2.366066	0.41902	.	.	ENSG00000126016	ENST00000304758;ENST00000371959;ENST00000371962;ENST00000524145;ENST00000432214	T;T;T;T	0.38560	1.13;2.06;2.29;2.06	5.13	2.31	0.28768	.	0.536026	0.17276	N	0.180197	T	0.25754	0.0627	L	0.44542	1.39	0.26936	N	0.96635	B	0.15473	0.013	B	0.08055	0.003	T	0.12578	-1.0542	10	0.13853	T	0.58	-0.4587	1.8119	0.03092	0.1793:0.4853:0.1715:0.1639	.	893	Q4VCS5	AMOT_HUMAN	T	484;893;661;893;133	ENSP00000305557:A484T;ENSP00000361027:A893T;ENSP00000361030:A661T;ENSP00000429013:A893T	ENSP00000305557:A484T	A	-	1	0	AMOT	111909361	0.127000	0.22367	0.994000	0.49952	0.934000	0.57294	0.604000	0.24164	0.928000	0.37168	0.529000	0.55759	GCT	-	NULL		0.597	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	protein_coding	OTTHUMT00000378570.1	C	NM_133265	-		112022705	-1	no_errors	ENST00000371959	ensembl	human	known	74_37	missense	SNP	0.660	T
SLC5A2	6524	genome.wustl.edu	37	16	31501432	31501432	+	Missense_Mutation	SNP	G	G	A	rs369673274		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr16:31501432G>A	ENST00000330498.3	+	13	1692	c.1673G>A	c.(1672-1674)cGc>cAc	p.R558H	SLC5A2_ENST00000564197.1_Intron|C16orf58_ENST00000327237.2_3'UTR|AC026471.6_ENST00000565137.1_RNA|C16orf58_ENST00000570164.1_3'UTR	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	558					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)			endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	CAGCTCCACCGCCTGGTCTTC	0.622																																																	0								ENSG00000140675	G	HIS/ARG,	0,4394		0,0,2197	58.0	48.0	51.0		1673,	5.2	1.0	16		51	1,8599	1.2+/-3.3	0,1,4299	no	missense,utr-3	SLC5A2,C16orf58	NM_003041.3,NM_022744.2	29,	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,	558/673,	31501432	1,12993	2197	4300	6497	SLC5A2	SO:0001583	missense	0			-	HGNC		CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.1673G>A	16.37:g.31501432G>A	ENSP00000327943:p.Arg558His	Somatic	0	70	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	59	9.23	A2RRD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.R558H	ENST00000330498.3	37	c.1673	CCDS10714.1	16	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977132	0.92982	0.0	1.16E-4	ENSG00000140675	ENST00000330498	D	0.81821	-1.54	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.82660	0.5085	M	0.69523	2.12	0.80722	D	1	P	0.52061	0.95	P	0.46339	0.513	D	0.84734	0.0747	10	0.52906	T	0.07	.	16.2719	0.82626	0.0:0.0:1.0:0.0	.	558	P31639	SC5A2_HUMAN	H	558	ENSP00000327943:R558H	ENSP00000327943:R558H	R	+	2	0	SLC5A2	31408933	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.029000	0.93718	2.434000	0.82447	0.561000	0.74099	CGC	-	NULL		0.622	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A2	protein_coding	OTTHUMT00000255627.2	G		-		31501432	+1	no_errors	ENST00000330498	ensembl	human	known	74_37	missense	SNP	1.000	A
GUSBP11	91316	genome.wustl.edu	37	22	23980848	23980848	+	RNA	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr22:23980848G>A	ENST00000455485.1	-	0	3641				KB-1572G7.3_ENST00000390329.3_RNA|AP000347.4_ENST00000430707.2_RNA			Q6P575	BGP11_HUMAN	glucuronidase, beta pseudogene 11						carbohydrate metabolic process (GO:0005975)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										CTTCTCCACGGTGCTCCCTTC	0.622																																																	0								ENSG00000228315																																			GUSBP11			0			-	HGNC			22q11.23	2011-06-09			ENSG00000228315	ENSG00000228315			42325	pseudogene	pseudogene							Standard	NR_024448		Approved		uc011aiz.2	Q6P575	OTTHUMG00000150709		22.37:g.23980848G>A		Somatic	0	80	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	42	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000455485.1	37	NULL		22																																																																																			-	-		0.622	GUSBP11-005	KNOWN	basic|readthrough_transcript	processed_transcript	GUSBP11	processed_transcript	OTTHUMT00000319697.1	G		-		23980848	-1	no_errors	ENST00000422506	ensembl	human	known	74_37	rna	SNP	0.212	A
LRFN5	145581	genome.wustl.edu	37	14	42356845	42356845	+	Silent	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr14:42356845C>T	ENST00000298119.4	+	3	2206	c.1017C>T	c.(1015-1017)aaC>aaT	p.N339N	LRFN5_ENST00000554171.1_Silent_p.N339N|LRFN5_ENST00000554120.1_Silent_p.N339N	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	339	Ig-like.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGTATGATAACGGAACACTTG	0.448										HNSCC(30;0.082)																																							0								ENSG00000165379						126.0	122.0	124.0					14																	42356845		2203	4300	6503	LRFN5	SO:0001819	synonymous_variant	0			-	HGNC	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1017C>T	14.37:g.42356845C>T		Somatic	0	112	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	67	8.22	B3KU78|Q86XL2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.N339	ENST00000298119.4	37	c.1017	CCDS9678.1	14																																																																																			-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.448	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN5	protein_coding	OTTHUMT00000276786.1	C	NM_152447	-		42356845	+1	no_errors	ENST00000298119	ensembl	human	known	74_37	silent	SNP	0.999	T
NCOA4	8031	genome.wustl.edu	37	10	51585393	51585393	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr10:51585393C>T	ENST00000443446.1	+	8	1721	c.1492C>T	c.(1492-1494)Ctt>Ttt	p.L498F	NCOA4_ENST00000344348.6_Missense_Mutation_p.L498F|NCOA4_ENST00000414907.2_Missense_Mutation_p.L332F|NCOA4_ENST00000452682.1_Missense_Mutation_p.L514F|NCOA4_ENST00000438493.1_Missense_Mutation_p.L514F|NCOA4_ENST00000374087.4_Missense_Mutation_p.L498F|NCOA4_ENST00000430396.2_Missense_Mutation_p.L398F|NCOA4_ENST00000374082.1_Missense_Mutation_p.L498F	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	498					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						GTCGGAGTGGCTTATCAGGCC	0.443			T	RET	papillary thyroid																																			Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	0								ENSG00000138293						86.0	95.0	92.0					10																	51585393		2203	4300	6503	NCOA4	SO:0001583	missense	0			-	HGNC	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.1492C>T	10.37:g.51585393C>T	ENSP00000390713:p.Leu498Phe	Somatic	0	121	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	45	50.55	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARA70	p.L514F	ENST00000443446.1	37	c.1540	CCDS7237.1	10	.	.	.	.	.	.	.	.	.	.	C	17.94	3.512582	0.64522	.	.	ENSG00000138293	ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	T;T;T;T;T;T;T;T	0.35421	1.31;1.31;1.31;1.31;1.31;1.31;1.31;1.31	6.16	6.16	0.99307	.	0.210828	0.41938	D	0.000799	T	0.54029	0.1833	M	0.68952	2.095	0.47659	D	0.999482	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.68765	0.96;0.96;0.96;0.96	T	0.52756	-0.8533	9	.	.	.	-21.1684	9.8046	0.40786	0.1404:0.7906:0.0:0.069	.	398;514;514;498	B4DF87;B4E260;E9PAV7;Q13772	.;.;.;NCOA4_HUMAN	F	514;514;398;498;332;498;498;498	ENSP00000405146:L514F;ENSP00000395465:L514F;ENSP00000393053:L398F;ENSP00000363200:L498F;ENSP00000411018:L332F;ENSP00000344552:L498F;ENSP00000363195:L498F;ENSP00000390713:L498F	.	L	+	1	0	NCOA4	51255399	1.000000	0.71417	0.990000	0.47175	0.549000	0.35272	2.148000	0.42235	2.937000	0.99478	0.650000	0.86243	CTT	-	NULL		0.443	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA4	protein_coding	OTTHUMT00000048052.1	C	NM_005437	-		51585393	+1	no_errors	ENST00000452682	ensembl	human	known	74_37	missense	SNP	1.000	T
PMS1	5378	genome.wustl.edu	37	2	190660493	190660495	+	Splice_Site	DEL	AGG	AGG	-			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	AGG	AGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:190660493_190660495delAGG	ENST00000441310.2	+	3	365_366	c.132_133delAGG	c.(130-135)ctagga>ctga	p.G45del	PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000432292.3_Intron|PMS1_ENST00000409823.3_Splice_Site_p.G45del|PMS1_ENST00000418224.3_5'UTR|PMS1_ENST00000409985.1_Splice_Site_p.G45del|PMS1_ENST00000447232.2_Splice_Site_p.G45del|PMS1_ENST00000374826.4_Splice_Site_p.G45del	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	45					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			GACATTTTATAGGAGAACTATGG	0.31			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																															yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0								ENSG00000064933																																			PMS1	SO:0001630	splice_region_variant	0				HGNC		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.133-1AGG>-	2.37:g.190660493_190660495delAGG		Somatic	0	189	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	105	11.76	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e2-1	ENST00000441310.2	37	c.133-2_133-1	CCDS2302.1	2																																																																																			-	-		0.310	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	protein_coding	OTTHUMT00000255918.2	AGG			In_Frame_Del	190660495	+1	no_errors	ENST00000441310	ensembl	human	known	74_37	splice_site_del	DEL	0.998:1.000:1.000	-
SMG1P7	100506060	genome.wustl.edu	37	16	70268960	70268960	+	RNA	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr16:70268960G>A	ENST00000459379.1	-	0	0																											TAACATAATTGAGAAATGTTT	0.353																																																	0								ENSG00000261556																																			RP11-296I10.6			0			-	Clone_based_vega_gene																													16.37:g.70268960G>A		Somatic	0	496	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	304	11.11		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000459379.1	37	NULL		16																																																																																			-	-		0.353	snoU13.216-201	NOVEL	basic	snoRNA	LOC100506060	snoRNA		G		-		70268960	-1	no_errors	ENST00000568855	ensembl	human	known	74_37	rna	SNP	1.000	A
SCN8A	6334	genome.wustl.edu	37	12	52162854	52162854	+	Missense_Mutation	SNP	A	A	C			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr12:52162854A>C	ENST00000354534.6	+	17	3285	c.3107A>C	c.(3106-3108)gAg>gCg	p.E1036A	SCN8A_ENST00000545061.1_Missense_Mutation_p.E1036A	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1036					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CCTCTGGATGAGTTGTATGAA	0.532																																																	0								ENSG00000196876						68.0	71.0	70.0					12																	52162854		2100	4235	6335	SCN8A	SO:0001583	missense	0			-	HGNC	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.3107A>C	12.37:g.52162854A>C	ENSP00000346534:p.Glu1036Ala	Somatic	0	43	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	36	14.29	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.E1036A	ENST00000354534.6	37	c.3107	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	A	14.97	2.692875	0.48202	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D	0.83914	-1.78;-1.78;-1.78	4.55	4.55	0.56014	Sodium ion transport-associated (1);	0.311519	0.35207	N	0.003369	D	0.85566	0.5726	M	0.75777	2.31	0.80722	D	1	P;P	0.48834	0.916;0.584	P;B	0.49708	0.62;0.393	D	0.84080	0.0384	10	0.24483	T	0.36	.	14.9638	0.71176	1.0:0.0:0.0:0.0	.	1036;1036	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	A	1036;1036;1036;949	ENSP00000346534:E1036A;ENSP00000440360:E1036A;ENSP00000347255:E1036A	ENSP00000346534:E1036A	E	+	2	0	SCN8A	50449121	1.000000	0.71417	0.994000	0.49952	0.984000	0.73092	8.916000	0.92745	2.272000	0.75746	0.460000	0.39030	GAG	-	pfam_Na_trans_assoc,prints_Na_channel_a8su		0.532	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	protein_coding	OTTHUMT00000404372.3	A	NM_014191	-		52162854	+1	no_errors	ENST00000354534	ensembl	human	known	74_37	missense	SNP	1.000	C
NKTR	4820	genome.wustl.edu	37	3	42684025	42684025	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr3:42684025G>T	ENST00000232978.8	+	14	4267	c.4079G>T	c.(4078-4080)gGa>gTa	p.G1360V	RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	1360					protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		CGGAGCAGAGGATGGTACAGC	0.408																																																	0								ENSG00000114857						107.0	106.0	106.0					3																	42684025		2203	4300	6503	NKTR	SO:0001583	missense	0			-	HGNC		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.4079G>T	3.37:g.42684025G>T	ENSP00000232978:p.Gly1360Val	Somatic	0	79	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.G1360V	ENST00000232978.8	37	c.4079	CCDS2702.1	3	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203321	0.58234	.	.	ENSG00000114857	ENST00000232978	T	0.13538	2.58	5.33	4.46	0.54185	.	0.149463	0.45361	D	0.000361	T	0.31979	0.0814	L	0.56769	1.78	0.80722	D	1	D;D	0.71674	0.998;0.996	D;P	0.69479	0.964;0.887	T	0.04090	-1.0978	10	0.87932	D	0	-10.4772	13.5828	0.61913	0.0749:0.0:0.9251:0.0	.	1060;1360	Q6M1B8;P30414	.;NKTR_HUMAN	V	1360	ENSP00000232978:G1360V	ENSP00000232978:G1360V	G	+	2	0	NKTR	42659029	1.000000	0.71417	0.989000	0.46669	0.988000	0.76386	7.192000	0.77771	1.246000	0.43901	0.655000	0.94253	GGA	-	NULL		0.408	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKTR	protein_coding	OTTHUMT00000256642.2	G	NM_005385	-		42684025	+1	no_errors	ENST00000232978	ensembl	human	known	74_37	missense	SNP	0.996	T
WNT2	7472	genome.wustl.edu	37	7	116960808	116960808	+	Silent	SNP	G	G	A	rs140391205		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr7:116960808G>A	ENST00000265441.3	-	2	422	c.123C>T	c.(121-123)tgC>tgT	p.C41C	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	41					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		GCACATTATCGCACATCACCC	0.597																																																	0								ENSG00000105989	G		1,4405	2.1+/-5.4	0,1,2202	53.0	45.0	48.0		123	2.9	1.0	7	dbSNP_134	48	0,8600		0,0,4300	no	coding-synonymous	WNT2	NM_003391.2		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		41/361	116960808	1,13005	2203	4300	6503	WNT2	SO:0001819	synonymous_variant	0			-	HGNC	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.123C>T	7.37:g.116960808G>A		Somatic	0	22	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50	A4D0V1|Q75N05|Q9UDP9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt2	p.C41	ENST00000265441.3	37	c.123	CCDS5771.1	7																																																																																			-	pfam_Wnt,prints_Wnt2		0.597	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2	protein_coding	OTTHUMT00000059749.3	G	NM_003391	rs140391205		116960808	-1	no_errors	ENST00000265441	ensembl	human	known	74_37	silent	SNP	1.000	A
SYNJ2BP	55333	genome.wustl.edu	37	14	70839377	70839377	+	3'UTR	SNP	C	C	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr14:70839377C>G	ENST00000256366.4	-	0	850				SYNJ2BP_ENST00000554216.1_5'UTR|SYNJ2BP-COX16_ENST00000555276.1_RNA	NM_018373.2	NP_060843.2	P57105	SYJ2B_HUMAN	synaptojanin 2 binding protein						intracellular distribution of mitochondria (GO:0048312)|negative regulation of activin receptor signaling pathway (GO:0032926)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of protein localization to cell surface (GO:2000010)|positive regulation of receptor internalization (GO:0002092)	cell surface (GO:0009986)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrion (GO:0005739)				central_nervous_system(1)|kidney(2)|large_intestine(1)|upper_aerodigestive_tract(1)	5				all cancers(60;0.00367)|BRCA - Breast invasive adenocarcinoma(234;0.00716)|OV - Ovarian serous cystadenocarcinoma(108;0.0377)		TATGGCATGCCAGCTAAGAAA	0.338																																																	0								ENSG00000213463																																			SYNJ2BP	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK002133	CCDS9803.1	14q24.2	2013-05-10			ENSG00000213463	ENSG00000213463			18955	protein-coding gene	gene with protein product	"""activin receptor interacting protein 5"""	609411				11882656	Standard	NM_018373		Approved	Arip2		P57105	OTTHUMG00000171240	ENST00000256366.4:c.*331G>C	14.37:g.70839377C>G		Somatic	0	82	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	54	18.18	Q49SH3|Q96IA4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000256366.4	37	NULL	CCDS9803.1	14																																																																																			-	-		0.338	SYNJ2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2BP	protein_coding	OTTHUMT00000412472.1	C	NM_018373	-		70839377	-1	no_errors	ENST00000554216	ensembl	human	putative	74_37	rna	SNP	0.479	G
RAB42	115273	genome.wustl.edu	37	1	28920653	28920653	+	3'UTR	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr1:28920653C>T	ENST00000373826.3	+	0	648				RAB42_ENST00000465518.1_3'UTR|TAF12_ENST00000471683.1_Intron	NM_152304.1	NP_689517.1	Q8N4Z0	RAB42_HUMAN	RAB42, member RAS oncogene family						small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)	5		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00618)|all_lung(284;0.00909)|Breast(348;0.0249)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0577)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00298)|KIRC - Kidney renal clear cell carcinoma(1967;0.00948)|BRCA - Breast invasive adenocarcinoma(304;0.0213)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGTTAAAGCAGTCCCAGCC	0.527																																																	0								ENSG00000188060						13.0	15.0	15.0					1																	28920653		2200	4296	6496	RAB42	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC033175	CCDS325.1	1p35.3	2014-02-12	2006-04-28		ENSG00000188060	ENSG00000188060		"""RAB, member RAS oncogene"""	28702	protein-coding gene	gene with protein product			"""RAB42, member RAS homolog family"""				Standard	NM_152304		Approved	MGC45806	uc001bqv.3	Q8N4Z0	OTTHUMG00000003656	ENST00000373826.3:c.*24C>T	1.37:g.28920653C>T		Somatic	0	66	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B2R5G2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373826.3	37	NULL	CCDS325.1	1																																																																																			-	-		0.527	RAB42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB42	protein_coding	OTTHUMT00000010371.1	C	NM_152304	-		28920653	+1	no_errors	ENST00000465518	ensembl	human	known	74_37	rna	SNP	0.003	T
TANGO6	79613	genome.wustl.edu	37	16	68894024	68894024	+	Missense_Mutation	SNP	G	G	A	rs199965791		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr16:68894024G>A	ENST00000261778.1	+	2	344	c.332G>A	c.(331-333)cGc>cAc	p.R111H		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	111						integral component of membrane (GO:0016021)											ACCATGATCCGCCTTGCAGCT	0.478													g|||	1	0.000199681	0.0	0.0	5008	,	,		19778	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000103047	T	HIS/ARG	5,3905		0,5,1950	189.0	182.0	185.0		332	-10.2	0.0	16		185	16,8292		0,16,4138	yes	missense	TMCO7	NM_024562.1	29	0,21,6088	AA,AG,GG		0.1926,0.1279,0.1719	benign	111/1095	68894024	21,12197	1955	4154	6109	TANGO6	SO:0001583	missense	0			-	HGNC		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.332G>A	16.37:g.68894024G>A	ENSP00000261778:p.Arg111His	Somatic	0	56	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	41	26.79	Q569F9|Q9H9K1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.R111H	ENST00000261778.1	37	c.332	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	g	0.033	-1.320855	0.01320	0.001279	0.001926	ENSG00000103047	ENST00000261778	.	.	.	5.41	-10.2	0.00374	.	.	.	.	.	T	0.13200	0.0320	N	0.04880	-0.145	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.29518	-1.0009	8	0.41790	T	0.15	0.4957	6.6906	0.23169	0.4194:0.0:0.2917:0.2888	.	111	Q9C0B7	TMCO7_HUMAN	H	111	.	ENSP00000261778:R111H	R	+	2	0	TMCO7	67451525	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.628000	0.05515	-2.002000	0.00963	-3.105000	0.00063	CGC	-	NULL		0.478	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	protein_coding	OTTHUMT00000433471.2	G	XM_928235.2	rs199965791		68894024	+1	no_errors	ENST00000261778	ensembl	human	known	74_37	missense	SNP	0.000	A
TCHH	7062	genome.wustl.edu	37	1	152085555	152085555	+	Splice_Site	SNP	C	C	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr1:152085555C>A	ENST00000368804.1	-	2	138		c.e2-1			NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin						keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGTGGTCTCTATAAAAATG	0.348																																																	0								ENSG00000159450						31.0	29.0	30.0					1																	152085555		1829	4095	5924	TCHH	SO:0001630	splice_region_variant	0			-	HGNC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.139-1G>T	1.37:g.152085555C>A		Somatic	0	35	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q5VUI3	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2-1	ENST00000368804.1	37	c.139-1	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	c	13.35	2.210827	0.39102	.	.	ENSG00000159450	ENST00000368804	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6251	0.56626	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TCHH	150352179	1.000000	0.71417	0.931000	0.37212	0.657000	0.38888	4.248000	0.58760	2.421000	0.82119	0.450000	0.29827	.	-	-		0.348	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	protein_coding	OTTHUMT00000036671.2	C	NM_007113	-	Intron	152085555	-1	no_errors	ENST00000368804	ensembl	human	known	74_37	splice_site	SNP	0.985	A
ZNF707	286075	genome.wustl.edu	37	8	144776688	144776688	+	Silent	SNP	C	C	T	rs371296133	byFrequency	TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr8:144776688C>T	ENST00000532205.1	+	8	2003	c.1104C>T	c.(1102-1104)caC>caT	p.H368H	RP11-429J17.2_ENST00000531565.1_RNA|ZNF707_ENST00000358656.4_Silent_p.H368H|ZNF707_ENST00000454097.1_Silent_p.H368H|ZNF707_ENST00000418203.2_Silent_p.H368H|ZNF707_ENST00000532158.1_Silent_p.H368H			Q96C28	ZN707_HUMAN	zinc finger protein 707	368					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H368H(1)		breast(1)	1	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;5.6e-41)|Epithelial(56;1.02e-39)|all cancers(56;9.65e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CTCACAGGCACGGGGAGGTGT	0.632													C|||	3	0.000599042	0.0023	0.0	5008	,	,		16201	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	endometrium(1)						ENSG00000181135	C	,,	3,4165		0,3,2081	19.0	22.0	21.0		1104,1104,1104	-5.4	0.0	8		21	6,8420		0,6,4207	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF707	NM_001100598.1,NM_001100599.1,NM_173831.3	,,	0,9,6288	TT,TC,CC		0.0712,0.072,0.0715	,,	368/372,368/372,368/372	144776688	9,12585	2084	4213	6297	ZNF707	SO:0001819	synonymous_variant	0			-	HGNC	AK001126	CCDS47932.1	8q24.3	2013-01-08				ENSG00000181135		"""Zinc fingers, C2H2-type"", ""-"""	27815	protein-coding gene	gene with protein product						12477932	Standard	NM_173831		Approved		uc010mfi.3	Q96C28		ENST00000532205.1:c.1104C>T	8.37:g.144776688C>T		Somatic	0	99	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	41	46.75	A8K317|B3KNY1|D3DWK7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H368	ENST00000532205.1	37	c.1104	CCDS47932.1	8																																																																																			-	NULL		0.632	ZNF707-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF707	protein_coding	OTTHUMT00000382197.1	C	NM_173831	-		144776688	+1	no_errors	ENST00000358656	ensembl	human	known	74_37	silent	SNP	0.000	T
NCOA3	8202	genome.wustl.edu	37	20	46279860	46279860	+	Silent	SNP	G	G	A	rs151060280	byFrequency	TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr20:46279860G>A	ENST00000371998.3	+	20	3977	c.3786G>A	c.(3784-3786)caG>caA	p.Q1262Q	NCOA3_ENST00000341724.6_Silent_p.Q1188Q|NCOA3_ENST00000371997.3_Silent_p.Q1253Q|NCOA3_ENST00000372004.3_Silent_p.Q1258Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1262	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.Q1262Q(1)		breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcagcagcaacagc	0.567																																																	1	Substitution - coding silent(1)	endometrium(1)						ENSG00000124151	G	,,,	10,4396	11.4+/-27.6	1,8,2194	53.0	58.0	56.0		3783,3759,3774,3786	-0.1	0.1	20	dbSNP_134	56	12,8588	9.1+/-34.3	0,12,4288	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	NCOA3	NM_001174087.1,NM_001174088.1,NM_006534.3,NM_181659.2	,,,	1,20,6482	AA,AG,GG		0.1395,0.227,0.1692	,,,	1261/1424,1253/1416,1258/1421,1262/1425	46279860	22,12984	2203	4300	6503	NCOA3	SO:0001819	synonymous_variant	0			-	HGNC	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3786G>A	20.37:g.46279860G>A		Somatic	0	51	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.Q1262	ENST00000371998.3	37	c.3786	CCDS13407.1	20																																																																																			-	pirsf_Nuclear_rcpt_coactivator		0.567	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	protein_coding	OTTHUMT00000080405.1	G	NM_006534	rs151060280		46279860	+1	no_errors	ENST00000371998	ensembl	human	known	74_37	silent	SNP	0.996	A
GPR124	25960	genome.wustl.edu	37	8	37696483	37696483	+	Missense_Mutation	SNP	G	G	A	rs143113584		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr8:37696483G>A	ENST00000412232.2	+	15	2282	c.2269G>A	c.(2269-2271)Gcc>Acc	p.A757T	GPR124_ENST00000315215.7_Missense_Mutation_p.A540T	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	757	GPS. {ECO:0000255|PROSITE- ProRule:PRU00098}.				central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GGAGCTGAGCGCCTTTCCCAG	0.672																																																	0								ENSG00000020181	G	THR/ALA	0,4406		0,0,2203	33.0	36.0	35.0		2269	2.2	0.2	8	dbSNP_134	35	1,8599	1.2+/-3.3	0,1,4299	yes	missense	GPR124	NM_032777.9	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	757/1339	37696483	1,13005	2203	4300	6503	GPR124	SO:0001583	missense	0			-	HGNC	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.2269G>A	8.37:g.37696483G>A	ENSP00000406367:p.Ala757Thr	Somatic	0	70	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	50	18.03	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.A757T	ENST00000412232.2	37	c.2269	CCDS6097.2	8	.	.	.	.	.	.	.	.	.	.	G	6.071	0.381330	0.11466	0.0	1.16E-4	ENSG00000020181	ENST00000416514;ENST00000315215;ENST00000412232	T;T	0.58210	0.35;0.45	5.37	2.16	0.27623	GPS domain (2);	0.528406	0.20165	N	0.097878	T	0.22781	0.0550	N	0.02539	-0.55	0.09310	N	1	B;B	0.15473	0.013;0.001	B;B	0.09377	0.004;0.0	T	0.19353	-1.0308	10	0.14656	T	0.56	-13.0176	9.8117	0.40826	0.364:0.0:0.6359:0.0	.	540;757	Q96PE1-2;Q96PE1	.;GP124_HUMAN	T	750;540;757	ENSP00000323508:A540T;ENSP00000406367:A757T	ENSP00000323508:A540T	A	+	1	0	GPR124	37815641	0.078000	0.21339	0.241000	0.24154	0.108000	0.19459	0.717000	0.25851	0.670000	0.31165	-1.049000	0.02347	GCC	-	pfscan_GPS_dom		0.672	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR124	protein_coding	OTTHUMT00000343331.2	G		rs143113584		37696483	+1	no_errors	ENST00000412232	ensembl	human	known	74_37	missense	SNP	0.016	A
RAPGEF2	9693	genome.wustl.edu	37	4	160264507	160264507	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr4:160264507G>T	ENST00000264431.4	+	16	3141	c.2722G>T	c.(2722-2724)Ggc>Tgc	p.G908C		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	908	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		TCGTCACGTTGGCCGAATGGC	0.448																																																	0								ENSG00000109756						116.0	113.0	114.0					4																	160264507		1939	4141	6080	RAPGEF2	SO:0001583	missense	0			-	HGNC	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.2722G>T	4.37:g.160264507G>T	ENSP00000264431:p.Gly908Cys	Somatic	0	40	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	D3DP27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,pfam_PDZ,pfam_cNMP-bd_dom,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.G908C	ENST00000264431.4	37	c.2722	CCDS43277.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.52|16.52	3.146055|3.146055	0.57044|0.57044	.|.	.|.	ENSG00000109756|ENSG00000109756	ENST00000264431|ENST00000502485	T|.	0.29397|.	1.57|.	5.73|5.73	5.73|5.73	0.89815|0.89815	Guanine-nucleotide dissociation stimulator CDC25 (3);Ras guanine nucleotide exchange factor, domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.26268|0.26268	0.0641|0.0641	N|N	0.00583|0.00583	-1.355|-1.355	0.80722|0.80722	D|D	1|1	B|.	0.18968|.	0.032|.	B|.	0.17098|.	0.017|.	T|T	0.40251|0.40251	-0.9573|-0.9573	10|5	0.41790|.	T|.	0.15|.	.|.	19.8852|19.8852	0.96909|0.96909	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	908|.	Q9Y4G8|.	RPGF2_HUMAN|.	C|L	908|21	ENSP00000264431:G908C|.	ENSP00000264431:G908C|.	G|W	+|+	1|2	0|0	RAPGEF2|RAPGEF2	160483957|160483957	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.970000|0.970000	0.65996|0.65996	9.864000|9.864000	0.99589|0.99589	2.697000|2.697000	0.92050|0.92050	0.491000|0.491000	0.48974|0.48974	GGC|TGG	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.448	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	protein_coding	OTTHUMT00000364980.2	G	NM_014247	-		160264507	+1	no_errors	ENST00000264431	ensembl	human	known	74_37	missense	SNP	1.000	T
SCN2A	6326	genome.wustl.edu	37	2	166245201	166245201	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:166245201C>T	ENST00000375437.2	+	27	5175	c.4885C>T	c.(4885-4887)Cgt>Tgt	p.R1629C	SCN2A_ENST00000357398.3_Missense_Mutation_p.R1629C|SCN2A_ENST00000375427.2_Missense_Mutation_p.R1629C|SCN2A_ENST00000283256.6_Missense_Mutation_p.R1629C	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1629			R -> L (in EIEE11). {ECO:0000269|PubMed:23935176}.		intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CCGAGTGATCCGTCTTGCCAG	0.433																																																	0								ENSG00000136531						110.0	111.0	111.0					2																	166245201		2203	4300	6503	SCN2A	SO:0001583	missense	0			-	HGNC	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.4885C>T	2.37:g.166245201C>T	ENSP00000364586:p.Arg1629Cys	Somatic	0	220	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	132	14.84	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R1629C	ENST00000375437.2	37	c.4885	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	C	17.16	3.319556	0.60524	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.98617	-5.03;-5.03;-5.03;-5.03	5.49	5.49	0.81192	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99691	0.9883	H	0.99946	5.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.977	D	0.96880	0.9645	10	0.87932	D	0	.	19.8035	0.96518	0.0:1.0:0.0:0.0	.	1629;1629	Q99250-2;Q99250	.;SCN2A_HUMAN	C	1629	ENSP00000364586:R1629C;ENSP00000349973:R1629C;ENSP00000283256:R1629C;ENSP00000364576:R1629C	ENSP00000283256:R1629C	R	+	1	0	SCN2A	165953447	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.813000	0.55636	2.751000	0.94390	0.552000	0.68991	CGT	-	pfam_Ion_trans_dom		0.433	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	protein_coding	OTTHUMT00000102659.2	C	NM_021007	-		166245201	+1	no_errors	ENST00000283256	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC17A4	10050	genome.wustl.edu	37	6	25777120	25777120	+	Silent	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr6:25777120C>T	ENST00000377905.4	+	10	1320	c.1201C>T	c.(1201-1203)Ctg>Ttg	p.L401L	SLC17A4_ENST00000439485.2_Silent_p.L171L|SLC17A4_ENST00000397076.2_Silent_p.L199L	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	401					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						CTTCTTGGTGCTGTCTTCTGC	0.532																																																	0								ENSG00000146039						151.0	130.0	137.0					6																	25777120		2203	4300	6503	SLC17A4	SO:0001819	synonymous_variant	0			-	HGNC	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.1201C>T	6.37:g.25777120C>T		Somatic	0	38	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L401	ENST00000377905.4	37	c.1201	CCDS4564.1	6																																																																																			-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.532	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	protein_coding	OTTHUMT00000040068.1	C		-		25777120	+1	no_errors	ENST00000377905	ensembl	human	known	74_37	silent	SNP	0.000	T
PLA2G4E	123745	genome.wustl.edu	37	15	42302375	42302375	+	Missense_Mutation	SNP	G	G	A	rs535569211		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr15:42302375G>A	ENST00000413860.2	-	1	70	c.71C>T	c.(70-72)cCg>cTg	p.P24L	PLA2G4E_ENST00000399518.3_Intron|CTD-2382E5.2_ENST00000552704.1_RNA			Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	34					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		GTCTGTCTCCGGTACGCTGGG	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		14077	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000188089						74.0	84.0	81.0					15																	42302375		1874	4099	5973	PLA2G4E	SO:0001583	missense	0			-	HGNC		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000413860.2:c.71C>T	15.37:g.42302375G>A	ENSP00000413897:p.Pro24Leu	Somatic	0	161	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	136	11.61	Q6ZSC0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.P24L	ENST00000413860.2	37	c.71		15	.	.	.	.	.	.	.	.	.	.	G	9.180	1.023309	0.19433	.	.	ENSG00000188089	ENST00000413860	T	0.01484	4.84	3.51	1.18	0.20946	.	.	.	.	.	T	0.01523	0.0049	.	.	.	0.09310	N	1	B	0.24317	0.101	B	0.14578	0.011	T	0.47032	-0.9148	8	0.72032	D	0.01	.	3.8465	0.08937	0.0:0.1175:0.2228:0.6597	.	24	C9JK77	.	L	24	ENSP00000413897:P24L	ENSP00000413897:P24L	P	-	2	0	PLA2G4E	40089667	0.013000	0.17824	0.005000	0.12908	0.001000	0.01503	0.522000	0.22909	0.237000	0.21200	-0.364000	0.07487	CCG	-	NULL		0.602	PLA2G4E-201	KNOWN	basic	protein_coding	PLA2G4E	protein_coding		G	NM_198442	-		42302375	-1	no_errors	ENST00000413860	ensembl	human	known	74_37	missense	SNP	0.006	A
SP140	11262	genome.wustl.edu	37	2	231109717	231109717	+	Missense_Mutation	SNP	T	T	C			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:231109717T>C	ENST00000392045.3	+	6	700	c.586T>C	c.(586-588)Tct>Cct	p.S196P	SP140_ENST00000343805.6_Missense_Mutation_p.S196P|SP140_ENST00000417495.3_Missense_Mutation_p.S196P|SP140_ENST00000350136.5_Missense_Mutation_p.S176P|SP140_ENST00000486687.2_Missense_Mutation_p.S196P|SP140_ENST00000420434.3_Missense_Mutation_p.S196P	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	196					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CTCTTCAGAGTCTTGTGAGCA	0.493																																																	0								ENSG00000079263						136.0	127.0	130.0					2																	231109717		1949	4171	6120	SP140	SO:0001583	missense	0			-	HGNC	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.586T>C	2.37:g.231109717T>C	ENSP00000375899:p.Ser196Pro	Somatic	0	58	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	26	39.53	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.S196P	ENST00000392045.3	37	c.586	CCDS42831.1	2	.	.	.	.	.	.	.	.	.	.	T	9.250	1.040450	0.19669	.	.	ENSG00000079263	ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T;T	0.58940	0.67;0.73;0.59;0.3;0.54	2.48	1.25	0.21368	.	.	.	.	.	T	0.51363	0.1670	N	0.24115	0.695	0.09310	N	1	D;D;D;D;P	0.61080	0.963;0.978;0.987;0.989;0.808	B;B;P;P;B	0.56278	0.425;0.278;0.696;0.795;0.362	T	0.37337	-0.9710	9	0.62326	D	0.03	1.5666	4.6696	0.12682	0.2822:0.0:0.0:0.7178	.	196;196;196;196;196	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75	.;.;.;LY10_HUMAN;.	P	196;196;176;196;196;196;196	ENSP00000440107:S196P;ENSP00000345846:S176P;ENSP00000375899:S196P;ENSP00000342096:S196P;ENSP00000398210:S196P	ENSP00000342096:S196P	S	+	1	0	SP140	230817961	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.161000	0.16481	0.347000	0.23924	0.523000	0.50628	TCT	-	NULL		0.493	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SP140	protein_coding	OTTHUMT00000332015.1	T	NM_007237	-		231109717	+1	no_errors	ENST00000392045	ensembl	human	known	74_37	missense	SNP	0.001	C
VPS39	23339	genome.wustl.edu	37	15	42479973	42479973	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr15:42479973C>T	ENST00000348544.4	-	7	456	c.457G>A	c.(457-459)Gaa>Aaa	p.E153K	VPS39_ENST00000318006.5_Missense_Mutation_p.E142K			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	153	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		TCATGAAATTCCCTGTCCTTC	0.512																																																	0								ENSG00000166887						228.0	227.0	228.0					15																	42479973		2203	4299	6502	VPS39	SO:0001583	missense	0			-	HGNC	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.457G>A	15.37:g.42479973C>T	ENSP00000335193:p.Glu153Lys	Somatic	0	54	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Citron,pfam_VPS39/TGF_beta_rcpt-assoc_2,pfam_VPS39/TGF_beta_rcpt-assoc_1,pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,smart_Citron	p.E153K	ENST00000348544.4	37	c.457	CCDS10083.1	15	.	.	.	.	.	.	.	.	.	.	C	17.18	3.323359	0.60634	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.16597	2.33;2.33	4.95	4.95	0.65309	Citron-like (2);	0.056898	0.64402	D	0.000001	T	0.19087	0.0458	L	0.45581	1.43	0.80722	D	1	B;B	0.12013	0.005;0.001	B;B	0.15052	0.012;0.007	T	0.03000	-1.1084	10	0.30854	T	0.27	-10.1613	18.5746	0.91150	0.0:1.0:0.0:0.0	.	153;142	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	K	142;153	ENSP00000326534:E142K;ENSP00000335193:E153K	ENSP00000326534:E142K	E	-	1	0	VPS39	40267265	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.359000	0.79477	2.449000	0.82847	0.655000	0.94253	GAA	-	pfam_Citron,superfamily_WD40_repeat_dom,smart_Citron		0.512	VPS39-002	KNOWN	basic|CCDS	protein_coding	VPS39	protein_coding	OTTHUMT00000420472.1	C	NM_015289	-		42479973	-1	no_errors	ENST00000348544	ensembl	human	known	74_37	missense	SNP	1.000	T
TULP2	7288	genome.wustl.edu	37	19	49399789	49399789	+	Missense_Mutation	SNP	G	G	C			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr19:49399789G>C	ENST00000221399.3	-	4	253	c.109C>G	c.(109-111)Cga>Gga	p.R37G		NM_003323.2	NP_003314.2	O00295	TULP2_HUMAN	tubby like protein 2	37					visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	protein complex binding (GO:0032403)			NS(1)|breast(2)|central_nervous_system(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(2)	22		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000259)|all cancers(93;0.000435)|Epithelial(262;0.0221)|GBM - Glioblastoma multiforme(486;0.0234)		CGCTTCTGTCGCTGCTTCTTT	0.612																																																	0								ENSG00000104804						37.0	38.0	37.0					19																	49399789		2203	4300	6503	TULP2	SO:0001583	missense	0			-	HGNC	U82469	CCDS12739.1	19q13.1	2009-08-06			ENSG00000104804	ENSG00000104804			12424	protein-coding gene	gene with protein product	"""cancer/testis antigen 65"""	602309				9096357	Standard	NM_003323		Approved	TUBL2, CT65	uc002pkz.2	O00295	OTTHUMG00000164406	ENST00000221399.3:c.109C>G	19.37:g.49399789G>C	ENSP00000221399:p.Arg37Gly	Somatic	0	111	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	90	23.08	Q8TC50	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C,prints_Tubby_N	p.R37G	ENST00000221399.3	37	c.109	CCDS12739.1	19	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793606	0.70452	.	.	ENSG00000104804	ENST00000221399;ENST00000518572;ENST00000522945;ENST00000520977	D;T;T;T	0.87887	-2.31;1.48;0.8;-0.32	5.03	3.93	0.45458	Tubby, N-terminal (1);	0.861105	0.10352	N	0.684980	D	0.91415	0.7291	L	0.54323	1.7	0.38078	D	0.936599	D	0.89917	1.0	D	0.87578	0.998	D	0.89897	0.4041	10	0.87932	D	0	-16.2267	11.4063	0.49900	0.0:0.0:0.7276:0.2724	.	37	O00295	TULP2_HUMAN	G	37;37;37;18	ENSP00000221399:R37G;ENSP00000428420:R37G;ENSP00000430040:R37G;ENSP00000428535:R18G	ENSP00000221399:R37G	R	-	1	2	TULP2	54091601	1.000000	0.71417	1.000000	0.80357	0.725000	0.41563	1.660000	0.37397	2.499000	0.84300	0.596000	0.82720	CGA	-	prints_Tubby_N		0.612	TULP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP2	protein_coding	OTTHUMT00000378633.1	G	NM_003323	-		49399789	-1	no_errors	ENST00000221399	ensembl	human	known	74_37	missense	SNP	1.000	C
POMC	5443	genome.wustl.edu	37	2	25384456	25384457	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs10654394	byFrequency	TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr2:25384456_25384457insGCCGCTGCT	ENST00000405623.1	-	3	752_753	c.297_298insAGCAGCGGC	c.(295-300)ggcgca>ggcAGCAGCGGCgca	p.98_99insGSS	RP11-509E16.1_ENST00000567599.1_lincRNA|POMC_ENST00000380794.1_In_Frame_Ins_p.98_99insGSS|POMC_ENST00000395826.2_In_Frame_Ins_p.98_99insGSS|POMC_ENST00000264708.3_In_Frame_Ins_p.98_99insGSS			P01189	COLI_HUMAN	proopiomelanocortin	98			Missing. {ECO:0000269|PubMed:11244459, ECO:0000269|PubMed:7828531, ECO:0000269|PubMed:9768693}.		cell-cell signaling (GO:0007267)|cellular pigmentation (GO:0033059)|cellular protein metabolic process (GO:0044267)|generation of precursor metabolites and energy (GO:0006091)|glucose homeostasis (GO:0042593)|negative regulation of tumor necrosis factor production (GO:0032720)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of appetite (GO:0032098)|regulation of blood pressure (GO:0008217)|regulation of corticosterone secretion (GO:2000852)|regulation of glycogen metabolic process (GO:0070873)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|peroxisomal matrix (GO:0005782)|secretory granule (GO:0030141)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|hormone activity (GO:0005179)|receptor binding (GO:0005102)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(5)|ovary(1)	12	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Loperamide(DB00836)	TTCTGCCCTGCgccgctgctgc	0.728														386	0.0770767	0.2027	0.0317	5008	,	,		17351	0.0		0.0427	False		,,,				2504	0.0542				Colon(110;1515 1566 8452 10082 43216)												0			GRCh37	CI042901|CI984063	POMC	I	rs10654394	ENSG00000115138		,	619,2251		169,281,985					,	2.6	0.6		dbSNP_119	5	273,5657		76,121,2768	no	coding,coding	POMC	NM_001035256.1,NM_000939.2	,	245,402,3753	A1A1,A1R,RR		4.6037,21.5679,10.1364	,	,		892,7908				POMC	SO:0001652	inframe_insertion	0				HGNC		CCDS1717.1	2p23	2013-02-25	2008-07-31		ENSG00000115138	ENSG00000115138		"""Endogenous ligands"""	9201	protein-coding gene	gene with protein product	"""adrenocorticotropin"", ""beta-lipotropin"", ""alpha-melanocyte stimulating hormone"", ""beta-melanocyte stimulating hormone"", ""beta-endorphin"", ""adrenocorticotropic hormone"", ""opiomelanocortin prepropeptide"""	176830				6254047, 9620771	Standard	NM_001035256		Approved	MSH, POC, CLIP, ACTH, NPP, LPH	uc002rfz.1	P01189	OTTHUMG00000094764	ENST00000405623.1:c.289_297dupAGCAGCGGC	2.37:g.25384457_25384465dupGCCGCTGCT	ENSP00000384092:p.Gly96_Ser98dup	Somatic	NA	NA	NA		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	P78442|Q53T23|Q9UD39|Q9UD40	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Mcrtin_ACTH_cent,pfam_Melanocortin_N,pfam_Opioid_neuropept,prints_Mcortin_ACTH	p.99in_frame_insSSG	ENST00000405623.1	37	c.298_297	CCDS1717.1	2																																																																																			-	NULL		0.728	POMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMC	protein_coding	OTTHUMT00000211573.3	-	NM_001035256			25384457	-1	no_errors	ENST00000264708	ensembl	human	known	74_37	in_frame_ins	INS	0.404:0.522	GCCGCTGCT
IPO9	55705	genome.wustl.edu	37	1	201844297	201844297	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr1:201844297G>T	ENST00000361565.4	+	23	3025	c.2956G>T	c.(2956-2958)Gat>Tat	p.D986Y		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	986					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						TTACTACGAGGATGATGAGGA	0.498																																																	0								ENSG00000198700						169.0	149.0	156.0					1																	201844297		2203	4300	6503	IPO9	SO:0001583	missense	0			-	HGNC	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.2956G>T	1.37:g.201844297G>T	ENSP00000354742:p.Asp986Tyr	Somatic	0	63	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.D986Y	ENST00000361565.4	37	c.2956	CCDS1415.1	1	.	.	.	.	.	.	.	.	.	.	G	18.17	3.563458	0.65651	.	.	ENSG00000198700	ENST00000361565;ENST00000456707	T	0.71817	-0.6	5.39	5.39	0.77823	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64349	0.2590	L	0.42245	1.32	0.80722	D	1	B	0.31503	0.326	B	0.26202	0.067	T	0.66756	-0.5843	10	0.72032	D	0.01	.	16.9969	0.86370	0.0:0.0:1.0:0.0	.	986	Q96P70	IPO9_HUMAN	Y	986;61	ENSP00000354742:D986Y	ENSP00000354742:D986Y	D	+	1	0	IPO9	200110920	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.308000	0.96247	2.676000	0.91093	0.655000	0.94253	GAT	-	superfamily_ARM-type_fold		0.498	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO9	protein_coding	OTTHUMT00000087088.1	G	NM_018085	-		201844297	+1	no_errors	ENST00000361565	ensembl	human	known	74_37	missense	SNP	1.000	T
ABTB2	25841	genome.wustl.edu	37	11	34194817	34194817	+	Missense_Mutation	SNP	G	G	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr11:34194817G>A	ENST00000435224.2	-	4	1706	c.1282C>T	c.(1282-1284)Cgc>Tgc	p.R428C	ABTB2_ENST00000298992.2_Missense_Mutation_p.R242C|ABTB2_ENST00000530814.1_5'UTR	NM_145804.2	NP_665803.2	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing 2	428					cellular response to toxic substance (GO:0097237)	nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				ATGGCCACGCGCATCCACTCC	0.692																																																	0								ENSG00000166016						16.0	17.0	17.0					11																	34194817		2201	4296	6497	ABTB2	SO:0001583	missense	0			-	HGNC	AK056863	CCDS7890.1, CCDS7890.2	11p13	2013-10-02			ENSG00000166016	ENSG00000166016		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23842	protein-coding gene	gene with protein product							Standard	NM_145804		Approved	DKFZP586C1619, BTBD22, ABTB2A	uc001mvl.2	Q8N961	OTTHUMG00000044382	ENST00000435224.2:c.1282C>T	11.37:g.34194817G>A	ENSP00000410157:p.Arg428Cys	Somatic	0	93	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	57	21.92	A8K6S9|E9PRW7|Q52LD6|Q6MZW4|Q8NB44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,pfam_Ankyrin_rpt,superfamily_Histone-fold,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.R428C	ENST00000435224.2	37	c.1282	CCDS7890.2	11	.	.	.	.	.	.	.	.	.	.	G	23.5	4.419560	0.83559	.	.	ENSG00000166016	ENST00000435224;ENST00000298992	T;T	0.71817	-0.56;-0.6	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.84023	0.5381	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86031	0.1513	10	0.87932	D	0	-15.3747	15.3726	0.74577	0.0:0.0:0.8601:0.1399	.	242	Q8N961	ABTB2_HUMAN	C	428;242	ENSP00000410157:R428C;ENSP00000298992:R242C	ENSP00000298992:R242C	R	-	1	0	ABTB2	34151393	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	2.500000	0.45381	2.481000	0.83766	0.561000	0.74099	CGC	-	NULL		0.692	ABTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABTB2	protein_coding	OTTHUMT00000388703.3	G	NM_145804	-		34194817	-1	no_errors	ENST00000435224	ensembl	human	known	74_37	missense	SNP	1.000	A
LIAS	11019	genome.wustl.edu	37	4	39482041	39482041	+	IGR	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr4:39482041C>T	ENST00000261434.3	+	0	1775				RP11-472B18.1_ENST00000513652.1_RNA	NM_006859.2	NP_006850.2			lipoic acid synthetase											breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(2)|ovary(2)	12						CGCAGCAGCCCGGCAGACTGC	0.647																																																	0								ENSG00000224097																																			RP11-472B18.1	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	AJ224162	CCDS3453.1, CCDS3454.1, CCDS63950.1	4p14	2008-02-05			ENSG00000121897	ENSG00000121897			16429	protein-coding gene	gene with protein product		607031				11124703	Standard	NM_006859		Approved	LAS	uc003guf.3	O43766	OTTHUMG00000099369		4.37:g.39482041C>T		Somatic	0	23	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261434.3	37	NULL	CCDS3453.1	4																																																																																			-	-		0.647	LIAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC401127	protein_coding	OTTHUMT00000216815.1	C	NM_194451	-		39482041	+1	no_errors	ENST00000513652	ensembl	human	known	74_37	rna	SNP	0.015	T
HIST1H3C	8352	genome.wustl.edu	37	6	26045798	26045798	+	Missense_Mutation	SNP	C	C	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr6:26045798C>T	ENST00000540144.1	+	1	160	c.160C>T	c.(160-162)Cgc>Tgc	p.R54C	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	54					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						CGAAATCCGTCGCTACCAGAA	0.622																																																	0								ENSG00000196532						48.0	51.0	50.0					6																	26045798		2203	4300	6503	HIST1H3C	SO:0001583	missense	0			-	HGNC	X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.160C>T	6.37:g.26045798C>T	ENSP00000439493:p.Arg54Cys	Somatic	0	91	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	58	18.31	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.R54C	ENST00000540144.1	37	c.160	CCDS4576.1	6	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452628	0.43531	.	.	ENSG00000196532	ENST00000540144	T	0.48201	0.82	4.53	4.53	0.55603	.	.	.	.	.	T	0.54854	0.1884	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.56426	-0.7981	6	0.49607	T	0.09	.	17.1289	0.86722	0.0:1.0:0.0:0.0	.	.	.	.	C	54	ENSP00000439493:R54C	ENSP00000439493:R54C	R	+	1	0	HIST1H3C	26153777	1.000000	0.71417	0.987000	0.45799	0.014000	0.08584	5.954000	0.70298	2.460000	0.83146	0.491000	0.48974	CGC	-	superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3		0.622	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3C	protein_coding	OTTHUMT00000040078.1	C	NM_003531	-		26045798	+1	no_errors	ENST00000540144	ensembl	human	known	74_37	missense	SNP	1.000	T
WNK1	65125	genome.wustl.edu	37	12	970296	970297	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr12:970296_970297insA	ENST00000315939.6	+	7	2381_2382	c.1738_1739insA	c.(1738-1740)gaafs	p.E580fs	WNK1_ENST00000535572.1_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000530271.2_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000537687.1_Frame_Shift_Ins_p.E580fs|WNK1_ENST00000540360.1_3'UTR|WNK1_ENST00000340908.4_Frame_Shift_Ins_p.E173fs	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	580					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GGAGGAGCAAGAAAAAAAAAAG	0.47																																					Colon(19;451 567 6672 12618 28860)												1	Unknown(1)	skin(1)						ENSG00000060237																																			WNK1	SO:0001589	frameshift_variant	0				HGNC	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1748dupA	12.37:g.970306_970306dupA	ENSP00000313059:p.Glu580fs	Somatic	0	58	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K584fs	ENST00000315939.6	37	c.1738_1739	CCDS8506.1	12																																																																																			-	NULL		0.470	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	protein_coding	OTTHUMT00000206683.1	-	NM_018979			970297	+1	no_errors	ENST00000530271	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
KMT2C	58508	genome.wustl.edu	37	7	151833996	151833996	+	Missense_Mutation	SNP	T	T	G			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr7:151833996T>G	ENST00000262189.6	-	59	14875	c.14657A>C	c.(14656-14658)tAt>tCt	p.Y4886S	KMT2C_ENST00000355193.2_Missense_Mutation_p.Y4943S|KMT2C_ENST00000485655.2_Missense_Mutation_p.Y91S	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4886	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GTCAAACTTATAGTCATAGCA	0.473																																																	0								ENSG00000055609						94.0	80.0	85.0					7																	151833996		2203	4300	6503	KMT2C	SO:0001583	missense	0			-	HGNC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14657A>C	7.37:g.151833996T>G	ENSP00000262189:p.Tyr4886Ser	Somatic	0	44	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Y4943S	ENST00000262189.6	37	c.14828	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	T	13.67	2.307398	0.40795	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000485655;ENST00000424877	D;D;D;D	0.98968	-5.28;-5.28;-5.28;-5.28	5.19	5.19	0.71726	SET domain (3);	0.000000	0.39083	U	0.001480	D	0.99573	0.9846	H	0.99545	4.62	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97507	1.0064	10	0.87932	D	0	.	15.3533	0.74405	0.0:0.0:0.0:1.0	.	4886;4000	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	S	4886;4943;91;1499	ENSP00000262189:Y4886S;ENSP00000347325:Y4943S;ENSP00000439909:Y91S;ENSP00000410411:Y1499S	ENSP00000262189:Y4886S	Y	-	2	0	MLL3	151464929	1.000000	0.71417	0.995000	0.50966	0.998000	0.95712	7.870000	0.87175	2.072000	0.62099	0.533000	0.62120	TAT	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom		0.473	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	protein_coding	OTTHUMT00000318887.3	T		-		151833996	-1	no_errors	ENST00000355193	ensembl	human	known	74_37	missense	SNP	1.000	G
ALKBH3	221120	genome.wustl.edu	37	11	43908185	43908185	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr11:43908185C>A	ENST00000302708.4	+	5	659	c.248C>A	c.(247-249)tCa>tAa	p.S83*	ALKBH3_ENST00000532410.1_3'UTR|ALKBH3_ENST00000378840.4_Nonsense_Mutation_p.S82*	NM_139178.3	NP_631917.1	Q96Q83	ALKB3_HUMAN	alkB, alkylation repair homolog 3 (E. coli)	83					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)|oxidative single-stranded DNA demethylation (GO:0035552)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)			endometrium(2)|kidney(1)|lung(4)|prostate(1)	8					Vitamin C(DB00126)	ATCAGCCTGTCACCCACAGGT	0.388								Direct reversal of damage																																									0								ENSG00000166199						150.0	133.0	139.0					11																	43908185		2203	4300	6503	ALKBH3	SO:0001587	stop_gained	0			-	HGNC	AB042029	CCDS7906.1	11p11.2	2013-10-11			ENSG00000166199	ENSG00000166199		"""Alkylation repair homologs"""	30141	protein-coding gene	gene with protein product		610603				22055184	Standard	NM_139178		Approved	DEPC-1	uc001mxs.2	Q96Q83	OTTHUMG00000166417	ENST00000302708.4:c.248C>A	11.37:g.43908185C>A	ENSP00000302232:p.Ser83*	Somatic	0	112	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A6NDJ1|Q3SYI0|Q6NX57|Q96BU8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Oxoglu/Fe-dep_dioxygenase	p.S83*	ENST00000302708.4	37	c.248	CCDS7906.1	11	.	.	.	.	.	.	.	.	.	.	C	40	8.329133	0.98762	.	.	ENSG00000166199	ENST00000302708;ENST00000378840;ENST00000529366	.	.	.	5.54	4.63	0.57726	.	0.520100	0.20634	N	0.088526	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.0611	10.2077	0.43122	0.0:0.9086:0.0:0.0914	.	.	.	.	X	83;82;82	.	ENSP00000302232:S83X	S	+	2	0	ALKBH3	43864761	0.045000	0.20229	0.995000	0.50966	0.947000	0.59692	0.304000	0.19228	1.335000	0.45486	0.650000	0.86243	TCA	-	NULL		0.388	ALKBH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH3	protein_coding	OTTHUMT00000389693.1	C	NM_139178	-		43908185	+1	no_errors	ENST00000302708	ensembl	human	known	74_37	nonsense	SNP	0.924	A
TBC1D4	9882	genome.wustl.edu	37	13	75915685	75915685	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr13:75915685G>T	ENST00000377636.3	-	6	1793	c.1447C>A	c.(1447-1449)Cat>Aat	p.H483N	TBC1D4_ENST00000431480.2_Missense_Mutation_p.H483N|TBC1D4_ENST00000377625.2_Missense_Mutation_p.H483N|TBC1D4_ENST00000425511.1_5'UTR	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	483					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		GATGAGAGATGCCTCTGTATC	0.423																																																	0								ENSG00000136111						99.0	93.0	95.0					13																	75915685		1955	4160	6115	TBC1D4	SO:0001583	missense	0			-	HGNC	AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.1447C>A	13.37:g.75915685G>T	ENSP00000366863:p.His483Asn	Somatic	0	37	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTB/PI_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTB/PI_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTB/PI_dom,pfscan_Rab-GTPase-TBC_dom	p.H483N	ENST00000377636.3	37	c.1447	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	G	21.4	4.146715	0.77888	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625	T;T;T	0.03801	3.82;3.8;3.85	5.78	5.78	0.91487	.	0.350840	0.27388	N	0.019588	T	0.14787	0.0357	M	0.62723	1.935	0.80722	D	1	P;P;P	0.44521	0.837;0.835;0.745	P;P;B	0.49637	0.617;0.571;0.276	T	0.00015	-1.2397	10	0.72032	D	0.01	-27.4662	20.3681	0.98887	0.0:0.0:1.0:0.0	.	483;483;483	O60343-2;O60343-3;O60343	.;.;TBCD4_HUMAN	N	483	ENSP00000366863:H483N;ENSP00000395986:H483N;ENSP00000366852:H483N	ENSP00000366852:H483N	H	-	1	0	TBC1D4	74813686	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.708000	0.68377	2.890000	0.99128	0.655000	0.94253	CAT	-	NULL		0.423	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	protein_coding	OTTHUMT00000045283.1	G	NM_014832	-		75915685	-1	no_errors	ENST00000377636	ensembl	human	known	74_37	missense	SNP	1.000	T
ARMCX1	51309	genome.wustl.edu	37	X	100808828	100808828	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chrX:100808828G>T	ENST00000372829.3	+	4	1286	c.915G>T	c.(913-915)caG>caT	p.Q305H		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	305						integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						CAGCTGTGCAGATGGCTGGGC	0.423																																																	0								ENSG00000126947						146.0	99.0	115.0					X																	100808828		2203	4300	6503	ARMCX1	SO:0001583	missense	0			-	HGNC	AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	ENST00000372829.3:c.915G>T	X.37:g.100808828G>T	ENSP00000361917:p.Gln305His	Somatic	0	53	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	Q53HK2|Q9H2Q0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Q305H	ENST00000372829.3	37	c.915	CCDS14487.1	X	.	.	.	.	.	.	.	.	.	.	g	13.87	2.366709	0.41902	.	.	ENSG00000126947	ENST00000372829;ENST00000538894	T	0.58358	0.34	3.21	2.34	0.29019	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64034	0.2562	M	0.66939	2.045	0.42436	D	0.992698	D	0.89917	1.0	D	0.91635	0.999	T	0.62718	-0.6795	10	0.56958	D	0.05	-7.4303	5.558	0.17127	0.1573:0.0:0.8427:0.0	.	305	Q9P291	ARMX1_HUMAN	H	305;10	ENSP00000361917:Q305H	ENSP00000361917:Q305H	Q	+	3	2	ARMCX1	100695484	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.300000	0.33436	0.741000	0.32674	0.544000	0.68410	CAG	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold		0.423	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX1	protein_coding	OTTHUMT00000057561.1	G	NM_016608	-		100808828	+1	no_errors	ENST00000372829	ensembl	human	known	74_37	missense	SNP	1.000	T
CEP162	22832	genome.wustl.edu	37	6	84928931	84928931	+	Intron	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr6:84928931G>T	ENST00000403245.3	-	3	287				KIAA1009_ENST00000257766.4_Intron	NM_014895.2	NP_055710.2														breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	43		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		tcataataatgcctagtattt	0.418																																																	0								ENSG00000135315																																			KIAA1009	SO:0001627	intron_variant	0			-	HGNC																												ENST00000403245.3:c.172+1843C>A	6.37:g.84928931G>T		Somatic	0	63	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	10.81		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G58	ENST00000403245.3	37	c.174	CCDS34494.2	6																																																																																			-	NULL		0.418	KIAA1009-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1009	protein_coding	OTTHUMT00000317315.1	G		-		84928931	-1	no_errors	ENST00000435955	ensembl	human	known	74_37	silent	SNP	0.006	T
CCDC82	79780	genome.wustl.edu	37	11	96116635	96116635	+	Missense_Mutation	SNP	G	G	T			TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr11:96116635G>T	ENST00000278520.5	-	4	1217	c.789C>A	c.(787-789)gaC>gaA	p.D263E	CCDC82_ENST00000423339.2_Missense_Mutation_p.D263E|CCDC82_ENST00000542662.1_Missense_Mutation_p.D263E			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	263										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		CCTTTTCAGAGTCCTAATTAA	0.308																																																	0								ENSG00000149231						64.0	60.0	62.0					11																	96116635		2196	4296	6492	CCDC82	SO:0001583	missense	0			-	HGNC	AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.789C>A	11.37:g.96116635G>T	ENSP00000278520:p.Asp263Glu	Somatic	0	62	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D263E	ENST00000278520.5	37	c.789	CCDS8307.1	11	.	.	.	.	.	.	.	.	.	.	G	7.801	0.713612	0.15306	.	.	ENSG00000149231	ENST00000278520;ENST00000542662;ENST00000423339	T;T;T	0.20881	2.04;2.04;2.04	5.77	1.35	0.21983	.	0.494853	0.20701	N	0.087276	T	0.14399	0.0348	L	0.45581	1.43	0.22531	N	0.999014	B;B	0.29590	0.25;0.036	B;B	0.30572	0.117;0.016	T	0.12760	-1.0535	10	0.28530	T	0.3	-4.7787	2.9379	0.05820	0.3501:0.0:0.4559:0.1939	.	263;263	Q8N4S0-2;Q8N4S0	.;CCD82_HUMAN	E	263	ENSP00000278520:D263E;ENSP00000444010:D263E;ENSP00000397156:D263E	ENSP00000278520:D263E	D	-	3	2	CCDC82	95756283	1.000000	0.71417	0.998000	0.56505	0.297000	0.27493	1.227000	0.32576	0.785000	0.33685	0.579000	0.79373	GAC	-	NULL		0.308	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC82	protein_coding	OTTHUMT00000395542.2	G	NM_024725	-		96116635	-1	no_errors	ENST00000278520	ensembl	human	known	74_37	missense	SNP	0.998	T
LAMA1	284217	genome.wustl.edu	37	18	7015825	7015825	+	Missense_Mutation	SNP	C	C	A	rs201891641		TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr18:7015825C>A	ENST00000389658.3	-	22	3115	c.3022G>T	c.(3022-3024)Gac>Tac	p.D1008Y		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1008	Laminin EGF-like 11. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GTTTCTGGGTCGCAGGTATTC	0.532																																																	0								ENSG00000101680						117.0	110.0	112.0					18																	7015825		2203	4300	6503	LAMA1	SO:0001583	missense	0			-	HGNC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.3022G>T	18.37:g.7015825C>A	ENSP00000374309:p.Asp1008Tyr	Somatic	0	45	0.00		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.D1008Y	ENST00000389658.3	37	c.3022	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	12.03	1.814980	0.32053	.	.	ENSG00000101680	ENST00000389658	T	0.58797	0.31	5.09	4.21	0.49690	EGF-like, laminin (3);	0.205916	0.39341	N	0.001383	T	0.78336	0.4267	H	0.94847	3.59	0.47819	D	0.999525	D	0.71674	0.998	D	0.67900	0.954	T	0.80455	-0.1375	10	0.87932	D	0	.	6.7961	0.23727	0.0:0.6895:0.1562:0.1543	.	1008	P25391	LAMA1_HUMAN	Y	1008	ENSP00000374309:D1008Y	ENSP00000374309:D1008Y	D	-	1	0	LAMA1	7005825	0.935000	0.31712	0.933000	0.37362	0.022000	0.10575	0.853000	0.27777	1.254000	0.44035	0.643000	0.83706	GAC	-	pfam_EGF_laminin,smart_EG-like_dom,smart_EGF_laminin,pfscan_EGF_laminin		0.532	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	protein_coding	OTTHUMT00000257369.1	C	NM_005559	-		7015825	-1	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	SNP	1.000	A
EMC1	23065	genome.wustl.edu	37	1	19545484	19545485	+	3'UTR	INS	-	-	AAAAC	rs200361810|rs370415955|rs71716681|rs113921390	byFrequency	TCGA-DX-AB3B-01A-11D-A417-09	TCGA-DX-AB3B-10A-01D-A41A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e9b24025-5517-4601-92e6-ac6efaa9a84e	3b8655dd-4366-43f9-bac6-f57cc09f3ea4	g.chr1:19545484_19545485insAAAAC	ENST00000477853.1	-	0	3336_3337				EMC1_ENST00000375208.3_3'UTR|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375199.3_3'UTR|EMC1_ENST00000480380.1_5'UTR	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1							ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											TCTTATTAAAAAAAACAAAACA	0.366														2517	0.502596	0.5182	0.4971	5008	,	,		23597	0.6865		0.3946	False		,,,				2504	0.407																0								ENSG00000127463																																			EMC1	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.*313->GTTTT	1.37:g.19545490_19545494dupAAAAC		Somatic	NA	NA	NA		0.5814107088245994	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000477853.1	37	NULL	CCDS190.1	1																																																																																			-	-		0.366	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	protein_coding	OTTHUMT00000007076.2	-	NM_015047			19545485	-1	no_errors	ENST00000461353	ensembl	human	known	74_37	rna	INS	0.002:0.000	AAAAC
