#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TANGO6	79613	genome.wustl.edu	37	16	68894239	68894239	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr16:68894239G>T	ENST00000261778.1	+	2	559	c.547G>T	c.(547-549)Gtg>Ttg	p.V183L		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	183						integral component of membrane (GO:0016021)											TCAAGACGTGGTGTGTTTTGA	0.502																																																	0								ENSG00000103047						223.0	211.0	215.0					16																	68894239		2024	4206	6230	TANGO6	SO:0001583	missense	0			-	HGNC		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.547G>T	16.37:g.68894239G>T	ENSP00000261778:p.Val183Leu	Somatic	0	90	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	40	13.04	Q569F9|Q9H9K1	Missense_Mutation	SNP	30	0.00	0	24	0.00	0	pfam_DUF2435,pfam_DUF2411,superfamily_ARM-type_fold	p.V183L	ENST00000261778.1	37	c.547	CCDS45516.1	16	.	.	.	.	.	.	.	.	.	.	G	12.37	1.918525	0.33908	.	.	ENSG00000103047	ENST00000261778	T	0.65549	-0.16	5.01	5.01	0.66863	.	.	.	.	.	T	0.62551	0.2437	L	0.59436	1.845	0.25488	N	0.987679	D;D	0.53312	0.959;0.959	P;P	0.47744	0.556;0.556	T	0.55579	-0.8119	9	0.29301	T	0.29	-7.4953	10.7217	0.46044	0.089:0.0:0.911:0.0	.	183;22	Q9C0B7;B3KTB6	TMCO7_HUMAN;.	L	183	ENSP00000261778:V183L	ENSP00000261778:V183L	V	+	1	0	TMCO7	67451740	1.000000	0.71417	0.072000	0.20136	0.210000	0.24377	3.429000	0.52800	2.327000	0.79052	0.561000	0.74099	GTG	-	NULL		0.502	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANGO6	protein_coding	OTTHUMT00000433471.2	G	XM_928235.2	-		68894239	+1	no_errors	ENST00000261778	ensembl	human	known	74_37	missense	SNP	0.525	T
DOCK10	55619	genome.wustl.edu	37	2	225738817	225738817	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr2:225738817G>T	ENST00000258390.7	-	11	1220	c.1153C>A	c.(1153-1155)Cca>Aca	p.P385T	DOCK10_ENST00000409592.3_Missense_Mutation_p.P379T	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	385					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TCTTCAAATGGTTTGATCACA	0.353																																																	0								ENSG00000135905						115.0	98.0	103.0					2																	225738817		1821	4083	5904	DOCK10	SO:0001583	missense	0			-	HGNC	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.1153C>A	2.37:g.225738817G>T	ENSP00000258390:p.Pro385Thr	Somatic	0	57	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	30	0.00	0	61	0.00	0	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P385T	ENST00000258390.7	37	c.1153	CCDS46528.1	2	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874799	0.91664	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.46819	0.86;0.86	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.75206	0.3818	M	0.87971	2.92	0.53005	D	0.999961	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.991	T	0.78109	-0.2332	10	0.87932	D	0	.	20.3242	0.98691	0.0:0.0:1.0:0.0	.	385;385;379	Q96BY6;Q96BY6-2;B3FL70	DOC10_HUMAN;.;.	T	379;385	ENSP00000386694:P379T;ENSP00000258390:P385T	ENSP00000258390:P385T	P	-	1	0	DOCK10	225447061	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.093000	0.94163	2.882000	0.98803	0.655000	0.94253	CCA	-	NULL		0.353	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	protein_coding	OTTHUMT00000331246.1	G		-		225738817	-1	no_errors	ENST00000258390	ensembl	human	known	74_37	missense	SNP	1.000	T
ANK3	288	genome.wustl.edu	37	10	61833769	61833769	+	Silent	SNP	C	C	G			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr10:61833769C>G	ENST00000280772.2	-	37	7061	c.6870G>C	c.(6868-6870)ctG>ctC	p.L2290L	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2290					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						ACAGACCTGCCAGTTCTTTGG	0.498																																																	0								ENSG00000151150						121.0	119.0	120.0					10																	61833769		2203	4300	6503	ANK3	SO:0001819	synonymous_variant	0			-	HGNC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.6870G>C	10.37:g.61833769C>G		Somatic	0	76	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	25	19.35	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Silent	SNP	32	0.00	0	28	24.32	9	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.L2290	ENST00000280772.2	37	c.6870	CCDS7258.1	10																																																																																			-	NULL		0.498	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	C	NM_020987	-		61833769	-1	no_errors	ENST00000280772	ensembl	human	known	74_37	silent	SNP	1.000	G
ITGA5	3678	genome.wustl.edu	37	12	54798668	54798668	+	Silent	SNP	G	G	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr12:54798668G>T	ENST00000293379.4	-	13	1497	c.1236C>A	c.(1234-1236)atC>atA	p.I412I	RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)	412					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						AGGGAGCCCCGATGGCCACAT	0.577											OREG0021554	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000161638						13.0	15.0	14.0					12																	54798668		2201	4299	6500	ITGA5	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.1236C>A	12.37:g.54798668G>T		Somatic	0	22	0.00	1003	0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	Q96HA5	Silent	SNP	25	0.00	0	41	0.00	0	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.I412	ENST00000293379.4	37	c.1236	CCDS8880.1	12																																																																																			-	pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha		0.577	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA5	protein_coding	OTTHUMT00000406174.1	G		-		54798668	-1	no_errors	ENST00000293379	ensembl	human	known	74_37	silent	SNP	0.903	T
IL17RA	23765	genome.wustl.edu	37	22	17590484	17590484	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr22:17590484C>A	ENST00000319363.6	+	13	2508	c.2375C>A	c.(2374-2376)tCt>tAt	p.S792Y		NM_014339.5	NP_055154.3	Q96F46	I17RA_HUMAN	interleukin 17 receptor A	792					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|fibroblast activation (GO:0072537)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)|positive regulation of interleukin-23 production (GO:0032747)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	interleukin-17 receptor activity (GO:0030368)			endometrium(2)|large_intestine(8)|lung(16)|ovary(1)|skin(2)|stomach(1)	30		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		TCAGTGCAGTCTGACCAGGGC	0.662																																																	0								ENSG00000177663						21.0	19.0	19.0					22																	17590484		2198	4295	6493	IL17RA	SO:0001583	missense	0			-	HGNC	U58917	CCDS13739.1	22q11.1	2014-09-17	2006-04-26	2006-04-26	ENSG00000177663	ENSG00000177663		"""Interleukins and interleukin receptors"", ""CD molecules"""	5985	protein-coding gene	gene with protein product		605461	"""interleukin 17 receptor"""	IL17R		9367539, 10591208	Standard	NM_014339		Approved	hIL-17R, IL-17RA, CDw217, CD217	uc002zly.4	Q96F46	OTTHUMG00000150026	ENST00000319363.6:c.2375C>A	22.37:g.17590484C>A	ENSP00000320936:p.Ser792Tyr	Somatic	0	39	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	26	45.83	O43844|Q20WK1	Missense_Mutation	SNP	32	0.00	0	21	52.27	23	pfam_SEFIR	p.S792Y	ENST00000319363.6	37	c.2375	CCDS13739.1	22	.	.	.	.	.	.	.	.	.	.	C	24.4	4.524446	0.85600	.	.	ENSG00000177663	ENST00000425985;ENST00000319363	T	0.16073	2.37	4.55	4.55	0.56014	.	0.166559	0.41001	D	0.000961	T	0.42086	0.1187	M	0.65498	2.005	0.45205	D	0.99821	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.42155	-0.9468	10	0.87932	D	0	-25.4231	17.6726	0.88222	0.0:1.0:0.0:0.0	.	740;792	D3YTB4;Q96F46	.;I17RA_HUMAN	Y	740;792	ENSP00000320936:S792Y	ENSP00000320936:S792Y	S	+	2	0	IL17RA	15970484	1.000000	0.71417	0.943000	0.38184	0.964000	0.63967	6.591000	0.74090	2.227000	0.72691	0.655000	0.94253	TCT	-	NULL		0.662	IL17RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RA	protein_coding	OTTHUMT00000315820.1	C	NM_014339	-		17590484	+1	no_errors	ENST00000319363	ensembl	human	known	74_37	missense	SNP	0.999	A
CIDEA	1149	genome.wustl.edu	37	18	12254562	12254563	+	Intron	INS	-	-	CCGCGCACACACCCAT	rs71369912	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr18:12254562_12254563insCCGCGCACACACCCAT	ENST00000320477.9	+	1	103					NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a						apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						GCTCCGCGACCCCGCGCACACA	0.703														1926	0.384585	0.1082	0.3228	5008	,	,		14723	0.6359		0.4672	False		,,,				2504	0.4581																0								ENSG00000176194																																			CIDEA	SO:0001627	intron_variant	0				HGNC	AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.38+142->CCGCGCACACACCCAT	18.37:g.12254562_12254563insCCGCGCACACACCCAT		Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0YIY7|Q6UPR7	Frame_Shift_Ins	INS	22	12.00	3	23	17.86	5	NULL	p.H64fs	ENST00000320477.9	37	c.180_181	CCDS11856.1	18																																																																																			-	NULL		0.703	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CIDEA	protein_coding	OTTHUMT00000254599.2	-	NM_001279			12254563	+1	no_errors	ENST00000522713	ensembl	human	known	74_37	frame_shift_ins	INS	0.077:0.122	CCGCGCACACACCCAT
NSD1	64324	genome.wustl.edu	37	5	176673790	176673790	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr5:176673790G>T	ENST00000439151.2	+	10	4535	c.4490G>T	c.(4489-4491)gGc>gTc	p.G1497V	NSD1_ENST00000361032.4_Missense_Mutation_p.G1394V|NSD1_ENST00000354179.4_Missense_Mutation_p.G1228V|NSD1_ENST00000347982.4_Missense_Mutation_p.G1228V	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1497					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		GAGATTCCAGGCTCAGAGGTA	0.428			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0								ENSG00000165671						87.0	86.0	86.0					5																	176673790		2203	4300	6503	NSD1	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	-	HGNC	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.4490G>T	5.37:g.176673790G>T	ENSP00000395929:p.Gly1497Val	Somatic	0	48	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	Q96PD8|Q96RN7	Missense_Mutation	SNP	41	0.00	0	55	0.00	0	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.G1497V	ENST00000439151.2	37	c.4490	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	5.416	0.261858	0.10239	.	.	ENSG00000165671	ENST00000354179;ENST00000439151;ENST00000347982;ENST00000361032	D;D;D;D	0.95001	-3.58;-3.58;-3.58;-3.58	5.65	0.217	0.15264	.	1.026790	0.07678	N	0.936610	D	0.86422	0.5929	N	0.08118	0	0.09310	N	1	B;B;B	0.20988	0.047;0.05;0.012	B;B;B	0.21917	0.023;0.037;0.006	T	0.74765	-0.3554	10	0.30854	T	0.27	.	8.9721	0.35912	0.4551:0.0:0.5449:0.0	.	1228;1394;1497	Q96L73-2;Q96L73-3;Q96L73	.;.;NSD1_HUMAN	V	1228;1497;1228;1394	ENSP00000346111:G1228V;ENSP00000395929:G1497V;ENSP00000343209:G1228V;ENSP00000354310:G1394V	ENSP00000343209:G1228V	G	+	2	0	NSD1	176606396	0.000000	0.05858	0.002000	0.10522	0.005000	0.04900	0.178000	0.16820	0.142000	0.18901	0.650000	0.86243	GGC	-	NULL		0.428	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	protein_coding	OTTHUMT00000253412.2	G	NM_172349	-		176673790	+1	no_errors	ENST00000439151	ensembl	human	known	74_37	missense	SNP	0.000	T
CRY1	1407	genome.wustl.edu	37	12	107395061	107395061	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr12:107395061T>A	ENST00000008527.5	-	5	1548	c.681A>T	c.(679-681)agA>agT	p.R227S		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	227					blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						ATCATACTTTTCTTTCCAAAT	0.323																																																	0								ENSG00000008405						92.0	94.0	94.0					12																	107395061		2203	4300	6503	CRY1	SO:0001583	missense	0			-	HGNC	BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.681A>T	12.37:g.107395061T>A	ENSP00000008527:p.Arg227Ser	Somatic	0	12	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	10	33.33		Missense_Mutation	SNP	40	0.00	0	28	54.84	34	pfam_Photolyase_FAD-bd/Cryptochr_C,pfam_DNA_photolyase_N,superfamily_Photolyase_FAD-bd/Cryptochr_C,superfamily_DNA_photolyase_N	p.R227S	ENST00000008527.5	37	c.681	CCDS9112.1	12	.	.	.	.	.	.	.	.	.	.	T	16.97	3.268011	0.59540	.	.	ENSG00000008405	ENST00000008527	.	.	.	5.72	5.72	0.89469	DNA photolyase, FAD-binding/Cryptochrome, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.52549	0.1741	L	0.52126	1.63	0.80722	D	1	B	0.31153	0.31	B	0.35114	0.196	T	0.52480	-0.8570	9	0.37606	T	0.19	-21.0442	10.3536	0.43950	0.0:0.0731:0.0:0.9269	.	227	Q16526	CRY1_HUMAN	S	227	.	ENSP00000008527:R227S	R	-	3	2	CRY1	105919191	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.640000	0.46579	2.176000	0.68965	0.455000	0.32223	AGA	-	pfam_Photolyase_FAD-bd/Cryptochr_C,superfamily_Photolyase_FAD-bd/Cryptochr_C		0.323	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRY1	protein_coding	OTTHUMT00000406827.1	T	NM_004075	-		107395061	-1	no_errors	ENST00000008527	ensembl	human	known	74_37	missense	SNP	1.000	A
PHF19	26147	genome.wustl.edu	37	9	123632017	123632017	+	Intron	DEL	A	A	-			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr9:123632017delA	ENST00000373896.3	-	5	718				PHF19_ENST00000487555.1_5'Flank|PHF19_ENST00000312189.6_Frame_Shift_Del_p.W191fs|PHF19_ENST00000419155.1_5'Flank	NM_015651.1	NP_056466.1	Q5T6S3	PHF19_HUMAN	PHD finger protein 19						chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K27 methylation (GO:0061087)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(3)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						tccaaagcccaggtgtggccc	0.577																																																	0								ENSG00000119403						42.0	33.0	36.0					9																	123632017		2193	4295	6488	PHF19	SO:0001627	intron_variant	0				HGNC	BX640713	CCDS35116.1, CCDS35117.1, CCDS69648.1, CCDS75889.1	9q34.11	2013-01-28			ENSG00000119403	ENSG00000119403		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24566	protein-coding gene	gene with protein product	"""polycomb-like 3"", ""tudor domain containing 19B"""	609740				15563832	Standard	XM_005251906		Approved	DKFZP727G051, PCL3, MTF2L1, TDRD19B	uc004bks.1	Q5T6S3	OTTHUMG00000020577	ENST00000373896.3:c.465+105T>-	9.37:g.123632017delA		Somatic	0	28	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	Q32NF2|Q5T6S4|Q6N038|Q8TBL6|Q9UFS9	Frame_Shift_Del	DEL	24	0.00	0	47	0.00	0	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Tudor,smart_Znf_PHD	p.W191fs	ENST00000373896.3	37	c.571	CCDS35116.1	9																																																																																			-	NULL		0.577	PHF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF19	protein_coding	OTTHUMT00000053838.3	A	XM_045308			123632017	-1	no_errors	ENST00000312189	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
GNPAT	8443	genome.wustl.edu	37	1	231411035	231411035	+	Silent	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:231411035C>T	ENST00000366647.4	+	13	1981	c.1812C>T	c.(1810-1812)gtC>gtT	p.V604V	GNPAT_ENST00000366646.3_Silent_p.V543V|GNPAT_ENST00000469332.1_3'UTR	NM_014236.3	NP_055051.1	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	604					cellular lipid metabolic process (GO:0044255)|cerebellum morphogenesis (GO:0021587)|ether lipid biosynthetic process (GO:0008611)|glycerophospholipid biosynthetic process (GO:0046474)|membrane organization (GO:0061024)|paranodal junction assembly (GO:0030913)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	glycerone-phosphate O-acyltransferase activity (GO:0016287)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	23	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TGGCTGCAGTCAGAAAATTCA	0.423																																																	0								ENSG00000116906						113.0	106.0	109.0					1																	231411035		2203	4300	6503	GNPAT	SO:0001819	synonymous_variant	0			-	HGNC	AF043937	CCDS1592.1	1q42	2008-02-05			ENSG00000116906	ENSG00000116906	2.3.1.42		4416	protein-coding gene	gene with protein product		602744				9459311, 9536089	Standard	NM_014236		Approved	DHAPAT, DAPAT, DAP-AT	uc001hup.4	O15228	OTTHUMG00000038024	ENST00000366647.4:c.1812C>T	1.37:g.231411035C>T		Somatic	0	70	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	46	44.58	B4DNM9|Q5TBH7|Q9BWC2	Silent	SNP	38	0.00	0	32	43.86	25	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	p.V604	ENST00000366647.4	37	c.1812	CCDS1592.1	1																																																																																			-	NULL		0.423	GNPAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GNPAT	protein_coding	OTTHUMT00000092871.1	C		-		231411035	+1	no_errors	ENST00000366647	ensembl	human	known	74_37	silent	SNP	0.782	T
SERPINA10	51156	genome.wustl.edu	37	14	94756550	94756567	+	In_Frame_Del	DEL	CCCTCTCTTGATCTGGGT	CCCTCTCTTGATCTGGGT	-			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	CCCTCTCTTGATCTGGGT	CCCTCTCTTGATCTGGGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr14:94756550_94756567delCCCTCTCTTGATCTGGGT	ENST00000393096.1	-	2	829_846	c.364_381delACCCAGATCAAGAGAGGG	c.(364-381)acccagatcaagagagggdel	p.TQIKRG122del	SERPINA10_ENST00000554173.1_In_Frame_Del_p.TQIKRG122del|SERPINA10_ENST00000261994.4_In_Frame_Del_p.TQIKRG122del|SERPINA10_ENST00000554723.1_In_Frame_Del_p.TQIKRG162del	NM_016186.2	NP_057270.1	Q9UK55	ZPI_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10	122					blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	33		all_cancers(154;0.105)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		GCAAGTGGAGCCCTCTCTTGATCTGGGTTTCAGTCGGC	0.587																																																	0								ENSG00000140093																																			SERPINA10	SO:0001651	inframe_deletion	0				HGNC	AF181467	CCDS9923.1	14q32.13	2014-02-18	2005-08-18		ENSG00000140093	ENSG00000140093		"""Serine (or cysteine) peptidase inhibitors"""	15996	protein-coding gene	gene with protein product		605271	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10"""			10460162, 9689066, 24172014	Standard	NM_016186		Approved	PZI, ZPI	uc001yct.3	Q9UK55	OTTHUMG00000171345	ENST00000393096.1:c.364_381delACCCAGATCAAGAGAGGG	14.37:g.94756550_94756567delCCCTCTCTTGATCTGGGT	ENSP00000376809:p.Thr122_Gly127del	Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A5Z2A5|Q6UWX9|Q86U20	In_Frame_Del	DEL	26	0.00	0	22	0.00	0	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.TQIKRG122in_frame_del	ENST00000393096.1	37	c.381_364	CCDS9923.1	14																																																																																			-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.587	SERPINA10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA10	protein_coding	OTTHUMT00000413061.1	CCCTCTCTTGATCTGGGT	NM_016186			94756567	-1	no_errors	ENST00000261994	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.001:0.005:0.000:0.000:0.000:0.000:0.006:0.004:0.020:0.889:0.896:0.983:0.984:0.952:0.432:0.014:0.001	-
UBE2I	7329	genome.wustl.edu	37	16	1371423	1371431	+	Intron	DEL	CTGAGGGGT	CTGAGGGGT	-	rs11274233|rs67668118	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	CTGAGGGGT	CTGAGGGGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr16:1371423_1371431delCTGAGGGGT	ENST00000355803.4	+	6	964				UBE2I_ENST00000403747.2_Intron|UBE2I_ENST00000402301.1_3'UTR|UBE2I_ENST00000397515.2_Intron|UBE2I_ENST00000397514.3_Intron|LA16c-358B7.3_ENST00000568106.1_RNA|UBE2I_ENST00000566587.1_Intron|UBE2I_ENST00000325437.5_Intron|LA16c-358B7.3_ENST00000567829.1_RNA|UBE2I_ENST00000406620.1_Intron	NM_194260.2	NP_919236.1	P63279	UBC9_HUMAN	ubiquitin-conjugating enzyme E2I						cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of intracellular steroid hormone receptor signaling pathway (GO:0033145)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein sumoylation (GO:0016925)|regulation of receptor activity (GO:0010469)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|fibrillar center (GO:0001650)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RING-like zinc finger domain binding (GO:0071535)|SUMO ligase activity (GO:0019789)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	5		Hepatocellular(780;0.00369)				AGGGGGGAGGCTGAGGGGTCCCGGTTGCC	0.656														4748	0.948083	0.9614	0.9323	5008	,	,		13936	1.0		0.8847	False		,,,				2504	0.953																0								ENSG00000261505																																			LA16c-358B7.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	D45050	CCDS10433.1	16p13.3	2011-05-19	2011-05-19		ENSG00000103275	ENSG00000103275	6.3.2.19	"""Ubiquitin-conjugating enzymes E2"""	12485	protein-coding gene	gene with protein product		601661	"""ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9)"", ""ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)"""			8565643	Standard	NM_003345		Approved	UBC9	uc002cld.2	P63279	OTTHUMG00000047845	ENST00000355803.4:c.413+905CTGAGGGGT>-	16.37:g.1371423_1371431delCTGAGGGGT		Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DU69|P50550|Q15698|Q59GX1|Q86VB3	RNA	DEL	4	75.00	12	6	0.00	0	-	NULL	ENST00000355803.4	37	NULL	CCDS10433.1	16																																																																																			-	-		0.656	UBE2I-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000261505	protein_coding	OTTHUMT00000250317.2	CTGAGGGGT	NM_003345			1371431	-1	no_errors	ENST00000568106	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.001:0.000:0.001:0.001:0.000	-
BCORL1	63035	genome.wustl.edu	37	X	129168446	129168446	+	Intron	SNP	G	G	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chrX:129168446G>T	ENST00000218147.7	+	9	4502				BCORL1_ENST00000303743.5_Missense_Mutation_p.S1441I|BCORL1_ENST00000540052.1_Intron|BCORL1_ENST00000359304.2_Intron			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1						chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GGTCGTTGGAGCCAGCAGAAG	0.572																																																	0								ENSG00000085185																																			BCORL1	SO:0001627	intron_variant	0			-	HGNC	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.4306-2896G>T	X.37:g.129168446G>T		Somatic	0	27	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	11	0.00	0	8	0.00	0	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S1441I	ENST00000218147.7	37	c.4322	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	G	15.34	2.804584	0.50315	.	.	ENSG00000085185	ENST00000303743;ENST00000456822	T;T	0.36340	1.26;1.31	5.6	-1.33	0.09172	.	.	.	.	.	T	0.21145	0.0509	.	.	.	0.80722	D	1	B	0.26195	0.144	B	0.27608	0.081	T	0.08006	-1.0743	8	0.22109	T	0.4	.	6.513	0.22232	0.5105:0.2258:0.2637:0.0	.	1441	Q5H9F3-3	.	I	1441;1041	ENSP00000307541:S1441I;ENSP00000399483:S1041I	ENSP00000307541:S1441I	S	+	2	0	BCORL1	128996127	0.996000	0.38824	0.991000	0.47740	0.986000	0.74619	0.603000	0.24149	-0.298000	0.08921	-0.176000	0.13171	AGC	-	NULL		0.572	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	protein_coding	OTTHUMT00000058223.1	G	NM_021946	-		129168446	+1	no_errors	ENST00000303743	ensembl	human	known	74_37	missense	SNP	0.875	T
SLC6A12	6539	genome.wustl.edu	37	12	306031	306031	+	Missense_Mutation	SNP	T	T	C			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr12:306031T>C	ENST00000428720.1	-	11	1836	c.1093A>G	c.(1093-1095)Atc>Gtc	p.I365V	RP11-283I3.1_ENST00000544067.1_RNA|SLC6A12_ENST00000536824.1_Missense_Mutation_p.I365V|SLC6A12_ENST00000397296.2_Missense_Mutation_p.I365V|SLC6A12_ENST00000424061.2_Missense_Mutation_p.I365V|SLC6A12_ENST00000538272.1_5'Flank|SLC6A12_ENST00000359674.4_Missense_Mutation_p.I365V	NM_001122848.2	NP_001116320.1	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 12	365					amino acid transport (GO:0006865)|cellular hyperosmotic response (GO:0071474)|cellular water homeostasis (GO:0009992)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|response to organic substance (GO:0010033)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(8)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GGGAAGGCGATGAAGGCCAGC	0.582																																																	0								ENSG00000111181						95.0	86.0	89.0					12																	306031		2203	4300	6503	SLC6A12	SO:0001583	missense	0			-	HGNC	L42300	CCDS8501.1	12p13	2013-07-19	2013-07-19		ENSG00000111181	ENSG00000111181		"""Solute carriers"""	11045	protein-coding gene	gene with protein product	"""betaine/GABA transporter-1"""	603080	"""solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12"""			7589472	Standard	NM_003044		Approved	BGT-1	uc009zdh.2	P48065	OTTHUMG00000090309	ENST00000428720.1:c.1093A>G	12.37:g.306031T>C	ENSP00000388184:p.Ile365Val	Somatic	0	48	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	26	16.13	A0AV52|B2R992|D3DUN8	Missense_Mutation	SNP	22	0.00	0	28	9.68	3	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_betaine	p.I365V	ENST00000428720.1	37	c.1093	CCDS8501.1	12	.	.	.	.	.	.	.	.	.	.	T	15.79	2.936360	0.52972	.	.	ENSG00000111181	ENST00000359674;ENST00000397296;ENST00000428720;ENST00000424061;ENST00000536824	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	4.26	4.26	0.50523	.	0.061973	0.64402	D	0.000011	D	0.83101	0.5181	M	0.66506	2.035	0.47905	D	0.999546	D	0.76494	0.999	D	0.77557	0.99	T	0.82224	-0.0563	10	0.33940	T	0.23	.	13.5481	0.61715	0.0:0.0:0.0:1.0	.	365	P48065	S6A12_HUMAN	V	365	ENSP00000352702:I365V;ENSP00000380464:I365V;ENSP00000388184:I365V;ENSP00000399136:I365V;ENSP00000444268:I365V	ENSP00000352702:I365V	I	-	1	0	SLC6A12	176292	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	1.511000	0.35801	1.782000	0.52362	0.391000	0.25812	ATC	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.582	SLC6A12-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A12	protein_coding	OTTHUMT00000206671.2	T	NM_003044	-		306031	-1	no_errors	ENST00000359674	ensembl	human	known	74_37	missense	SNP	1.000	C
RP5-1158E12.1	0	genome.wustl.edu	37	X	45772969	45772969	+	lincRNA	SNP	A	A	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chrX:45772969A>T	ENST00000420585.1	-	0	499																											TTGCGGAGCAAAGGTCGATCA	0.468																																																	0								ENSG00000234613																																			RP5-1158E12.1			0			-	Clone_based_vega_gene																													X.37:g.45772969A>T		Somatic	0	9	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	0	100.00		RNA	SNP	14	0.00	0	5	83.87	26	-	NULL	ENST00000420585.1	37	NULL		X																																																																																			-	-		0.468	RP5-1158E12.1-001	KNOWN	basic	lincRNA	ENSG00000234613	lincRNA	OTTHUMT00000056345.1	A		-		45772969	-1	no_errors	ENST00000420585	ensembl	human	known	74_37	rna	SNP	0.988	T
ARHGAP5	394	genome.wustl.edu	37	14	32561313	32561313	+	Nonsense_Mutation	SNP	C	C	T	rs201986816	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr14:32561313C>T	ENST00000345122.3	+	2	1753	c.1438C>T	c.(1438-1440)Cga>Tga	p.R480*	ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.R480*|ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.R480*|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.R480*|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	480	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		TAGGCATCAGCGAGAAATAGT	0.383																																					NSCLC(9;77 350 3443 29227 41353)												0								ENSG00000100852						70.0	72.0	71.0					14																	32561313		2203	4298	6501	ARHGAP5	SO:0001587	stop_gained	0			-	HGNC	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1438C>T	14.37:g.32561313C>T	ENSP00000371897:p.Arg480*	Somatic	0	52	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	46	9.80	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Nonsense_Mutation	SNP	43	2.27	1	62	1.59	1	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.R480*	ENST00000345122.3	37	c.1438	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	C	39	7.554307	0.98355	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	.	.	.	6.02	5.11	0.69529	.	0.057780	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	14.0719	0.64865	0.3873:0.6127:0.0:0.0	.	.	.	.	X	480	.	ENSP00000371897:R480X	R	+	1	2	ARHGAP5	31631064	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.567000	0.45956	1.483000	0.48342	0.650000	0.86243	CGA	-	superfamily_FF_domain,smart_FF_domain		0.383	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	protein_coding	OTTHUMT00000409735.1	C	NM_001030055	rs201986816		32561313	+1	no_errors	ENST00000345122	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RGS2	5997	genome.wustl.edu	37	1	192778205	192778205	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:192778205C>T	ENST00000235382.5	+	1	35	c.4C>T	c.(4-6)Caa>Taa	p.Q2*	RGS2_ENST00000483295.1_3'UTR	NM_002923.3	NP_002914.1	P41220	RGS2_HUMAN	regulator of G-protein signaling 2	2					brown fat cell differentiation (GO:0050873)|cell cycle (GO:0007049)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phospholipase activity (GO:0010519)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of microtubule polymerization (GO:0031116)|regulation of adrenergic receptor signaling pathway (GO:0071877)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of translation (GO:0006417)|relaxation of cardiac muscle (GO:0055119)|relaxation of vascular smooth muscle (GO:0060087)|spermatogenesis (GO:0007283)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.Q2*(1)		large_intestine(3)|lung(1)|urinary_tract(1)	5						AACGATAATGCAAAGTGCTAT	0.612																																					Pancreas(71;51 2183 4981)												1	Substitution - Nonsense(1)	large_intestine(1)						ENSG00000116741						133.0	121.0	125.0					1																	192778205		2203	4300	6503	RGS2	SO:0001587	stop_gained	0			-	HGNC	L13463	CCDS1377.1	1q31	2014-06-19	2014-06-19		ENSG00000116741	ENSG00000116741		"""Regulators of G-protein signaling"", ""Endogenous ligands"""	9998	protein-coding gene	gene with protein product		600861	"""regulator of G-protein signalling 2, 24kD"", ""regulator of G-protein signalling 2, 24kDa"", ""regulator of G-protein signaling 2, 24kDa"""	G0S8		8179820	Standard	NM_002923		Approved		uc001gsl.3	P41220	OTTHUMG00000035600	ENST00000235382.5:c.4C>T	1.37:g.192778205C>T	ENSP00000235382:p.Gln2*	Somatic	0	60	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	42	22.22	Q6I9U5	Nonsense_Mutation	SNP	22	0.00	0	30	18.92	7	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.Q2*	ENST00000235382.5	37	c.4	CCDS1377.1	1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350249	0.82132	.	.	ENSG00000116741	ENST00000235382	.	.	.	4.62	3.71	0.42584	.	0.110419	0.40222	N	0.001143	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	10.632	0.45543	0.0:0.9057:0.0:0.0943	.	.	.	.	X	2	.	ENSP00000235382:Q2X	Q	+	1	0	RGS2	191044828	1.000000	0.71417	0.995000	0.50966	0.321000	0.28281	3.207000	0.51106	1.305000	0.44909	0.591000	0.81541	CAA	-	NULL		0.612	RGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS2	protein_coding	OTTHUMT00000086396.1	C	NM_002923	-		192778205	+1	no_errors	ENST00000235382	ensembl	human	known	74_37	nonsense	SNP	1.000	T
LINC01287	103724390	genome.wustl.edu	37	7	153109949	153109949	+	lincRNA	SNP	A	A	G			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr7:153109949A>G	ENST00000416982.1	-	0	1099																											ctaaaatggcagcagagaaaa	0.498																																																	0								ENSG00000234722						50.0	56.0	54.0					7																	153109949		692	1591	2283	AC073236.3			0			-	Clone_based_vega_gene																													7.37:g.153109949A>G		Somatic	0	30	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	31	18.42		RNA	SNP	24	0.00	0	56	1.75	1	-	NULL	ENST00000416982.1	37	NULL		7																																																																																			-	-		0.498	AC073236.3-001	KNOWN	basic	lincRNA	ENSG00000234722	lincRNA	OTTHUMT00000280517.1	A		-		153109949	-1	no_errors	ENST00000416982	ensembl	human	known	74_37	rna	SNP	0.044	G
MEF2A	4205	genome.wustl.edu	37	15	100252710	100252715	+	In_Frame_Del	DEL	CAGCAG	CAGCAG	-	rs3138597|rs58424802|rs373652230		TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	CAGCAG	CAGCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr15:100252710_100252715delCAGCAG	ENST00000557785.1	+	11	1577_1582	c.1228_1233delCAGCAG	c.(1228-1233)cagcagdel	p.QQ418del	MEF2A_ENST00000558812.1_In_Frame_Del_p.QQ358del|MEF2A_ENST00000453228.2_In_Frame_Del_p.QQ418del|MEF2A_ENST00000557942.1_In_Frame_Del_p.QQ426del|MEF2A_ENST00000338042.6_In_Frame_Del_p.QQ427del|MEF2A_ENST00000354410.5_In_Frame_Del_p.QQ420del|MEF2A_ENST00000449277.2_In_Frame_Del_p.QQ350del	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	428					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			ATCGGGCTTCcagcagcagcagcagc	0.607																																																	0								ENSG00000068305																																			MEF2A	SO:0001651	inframe_deletion	0				HGNC		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.1228_1233delCAGCAG	15.37:g.100252716_100252721delCAGCAG	ENSP00000453441:p.Gln418_Gln419del	Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	In_Frame_Del	DEL	8	0.00	0	22	0.00	0	pfam_TF_MADSbox,pfam_HJURP_C,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.QQ422in_frame_del	ENST00000557785.1	37	c.1255_1260	CCDS53978.1	15																																																																																			-	NULL		0.607	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MEF2A	protein_coding	OTTHUMT00000415985.1	CAGCAG				100252715	+1	no_errors	ENST00000338042	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000	-
BCLAF1	9774	genome.wustl.edu	37	6	136599100	136599100	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr6:136599100G>A	ENST00000531224.1	-	4	1171	c.919C>T	c.(919-921)Cca>Tca	p.P307S	BCLAF1_ENST00000392348.2_Missense_Mutation_p.P305S|BCLAF1_ENST00000527536.1_Missense_Mutation_p.P307S|BCLAF1_ENST00000530767.1_Missense_Mutation_p.P307S|BCLAF1_ENST00000527759.1_Missense_Mutation_p.P305S|BCLAF1_ENST00000353331.4_Missense_Mutation_p.P305S	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	307					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GCATTCTGTGGTGCGATTGTC	0.453																																					Colon(142;1534 1789 5427 7063 28491)												0								ENSG00000029363						85.0	80.0	81.0					6																	136599100		2203	4300	6503	BCLAF1	SO:0001583	missense	0			-	HGNC	AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.919C>T	6.37:g.136599100G>A	ENSP00000435210:p.Pro307Ser	Somatic	0	255	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	196	17.65	A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Missense_Mutation	SNP	55	0.00	0	53	32.05	25	NULL	p.P307S	ENST00000531224.1	37	c.919	CCDS5177.1	6	.	.	.	.	.	.	.	.	.	.	G	9.895	1.205289	0.22205	.	.	ENSG00000029363	ENST00000531224;ENST00000353331;ENST00000527536;ENST00000530767;ENST00000527759;ENST00000392348;ENST00000529826	T;T;T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9;2.9;2.9	5.82	4.95	0.65309	.	0.216399	0.34628	N	0.003818	T	0.02970	0.0088	L	0.34521	1.04	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.35968	-0.9767	10	0.37606	T	0.19	-9.6741	4.057	0.09821	0.158:0.0:0.6237:0.2183	.	305;305;307;307	Q9NYF8-2;Q9NYF8-3;Q9NYF8;Q9NYF8-4	.;.;BCLF1_HUMAN;.	S	307;305;307;307;305;305;307	ENSP00000435210:P307S;ENSP00000229446:P305S;ENSP00000435441:P307S;ENSP00000436501:P307S;ENSP00000434826:P305S;ENSP00000376159:P305S;ENSP00000431734:P307S	ENSP00000229446:P305S	P	-	1	0	BCLAF1	136640793	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.833000	0.39161	2.754000	0.94517	0.650000	0.86243	CCA	-	NULL		0.453	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	protein_coding	OTTHUMT00000042375.2	G	NM_014739	-		136599100	-1	no_errors	ENST00000531224	ensembl	human	known	74_37	missense	SNP	1.000	A
PLOD3	8985	genome.wustl.edu	37	7	100854936	100854936	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr7:100854936delG	ENST00000223127.3	-	12	1692	c.1294delC	c.(1294-1296)ctgfs	p.L432fs		NM_001084.4	NP_001075.1	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3	432					basement membrane assembly (GO:0070831)|cellular protein modification process (GO:0006464)|cellular response to hormone stimulus (GO:0032870)|collagen fibril organization (GO:0030199)|endothelial cell morphogenesis (GO:0001886)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|in utero embryonic development (GO:0001701)|lung morphogenesis (GO:0060425)|neural tube development (GO:0021915)|protein localization (GO:0008104)|vasodilation (GO:0042311)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen galactosyltransferase activity (GO:0050211)|procollagen glucosyltransferase activity (GO:0033823)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	31	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	TCGGGGCTCAGGGCGCCCCAG	0.697																																																	0								ENSG00000106397						28.0	26.0	27.0					7																	100854936		2202	4300	6502	PLOD3	SO:0001589	frameshift_variant	0				HGNC	AF046889	CCDS5715.1	7q22.1	2011-08-24			ENSG00000106397	ENSG00000106397	1.14.11.4		9083	protein-coding gene	gene with protein product	"""lysyl hydroxlase 3"""	603066				9724729, 9582318	Standard	NM_001084		Approved	LH3	uc003uyd.3	O60568	OTTHUMG00000157111	ENST00000223127.3:c.1294delC	7.37:g.100854936delG	ENSP00000223127:p.Leu432fs	Somatic	0	118	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	55	39.56	B2R6W6|Q540C3	Frame_Shift_Del	DEL	20	0.00	0	22	0.00	0	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.L432fs	ENST00000223127.3	37	c.1294	CCDS5715.1	7																																																																																			-	NULL		0.697	PLOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLOD3	protein_coding	OTTHUMT00000347470.1	G				100854936	-1	no_errors	ENST00000223127	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SIX5	147912	genome.wustl.edu	37	19	46265047	46265048	+	IGR	INS	-	-	TCCAGC	rs139434566|rs59054027		TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr19:46265047_46265048insTCCAGC	ENST00000317578.6	-	0	3318				AC074212.5_ENST00000559756.1_RNA|AC074212.3_ENST00000457052.2_In_Frame_Ins_p.453_453S>SSS	NM_175875.4	NP_787071	Q8N196	SIX5_HUMAN	SIX homeobox 5						lens development in camera-type eye (GO:0002088)|negative regulation of cell proliferation (GO:0008285)|regulation of transcription, DNA-templated (GO:0006355)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00783)|GBM - Glioblastoma multiforme(486;0.0802)|Epithelial(262;0.235)		GCAAGGCGCCAtccagctccag	0.658																																																	0								ENSG00000237452																																			AC074212.3	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	L08835	CCDS12673.1	19q13.32	2011-06-20	2007-07-13			ENSG00000177045		"""Homeoboxes / SINE class"""	10891	protein-coding gene	gene with protein product		600963	"""sine oculis homeobox (Drosophila) homolog 5"", ""sine oculis homeobox homolog 5 (Drosophila)"""	DMAHP		8595416	Standard	NM_175875		Approved		uc002pdb.3	Q8N196			19.37:g.46265048_46265053dupTCCAGC		Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Ins	INS	13	31.58	6	22	12.00	3	pfam_HMG_box_dom,pfam_bHLH_dom,superfamily_HMG_box_dom,superfamily_bHLH_dom,smart_HMG_box_dom,pfscan_bHLH_dom,pfscan_HMG_box_dom	p.456in_frame_insSS	ENST00000317578.6	37	c.1356_1357	CCDS12673.1	19																																																																																			-	NULL		0.658	SIX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237452	protein_coding	OTTHUMT00000417341.3	-	NM_175875			46265048	+1	no_errors	ENST00000457052	ensembl	human	putative	74_37	in_frame_ins	INS	0.000:0.004	TCCAGC
INTS3	65123	genome.wustl.edu	37	1	153734135	153734135	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:153734135C>G	ENST00000318967.2	+	14	2067	c.1499C>G	c.(1498-1500)cCc>cGc	p.P500R	INTS3_ENST00000476843.1_3'UTR|INTS3_ENST00000435409.2_Missense_Mutation_p.P500R|INTS3_ENST00000456435.1_Missense_Mutation_p.P294R|INTS3_ENST00000512605.1_Missense_Mutation_p.P294R	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3	501					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGCAGCTCACCCTCCCCACCT	0.552																																																	0								ENSG00000143624						89.0	77.0	81.0					1																	153734135		2203	4300	6503	INTS3	SO:0001583	missense	0			-	HGNC	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.1499C>G	1.37:g.153734135C>G	ENSP00000318641:p.Pro500Arg	Somatic	0	35	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	32	33.33	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Missense_Mutation	SNP	31	0.00	0	26	35.00	14	pfam_Int_cplx_su3	p.P500R	ENST00000318967.2	37	c.1499	CCDS1052.1	1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.771037	0.69992	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	5.0	4.09	0.47781	.	0.060591	0.64402	D	0.000002	T	0.47377	0.1442	L	0.43152	1.355	0.58432	D	0.999999	P;P;P	0.45176	0.852;0.769;0.693	P;B;B	0.50896	0.653;0.248;0.431	T	0.54384	-0.8302	9	0.72032	D	0.01	.	11.1907	0.48683	0.0:0.9106:0.0:0.0894	.	294;501;500	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	R	500;294;500;294	.	ENSP00000318641:P500R	P	+	2	0	INTS3	152000759	1.000000	0.71417	0.838000	0.33150	0.989000	0.77384	5.438000	0.66550	1.347000	0.45714	0.455000	0.32223	CCC	-	NULL		0.552	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	protein_coding	OTTHUMT00000090045.2	C	NM_023015	-		153734135	+1	no_errors	ENST00000318967	ensembl	human	known	74_37	missense	SNP	1.000	G
PLD5	200150	genome.wustl.edu	37	1	242253161	242253161	+	Missense_Mutation	SNP	C	C	G	rs376520582		TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:242253161C>G	ENST00000536534.2	-	10	1847	c.1606G>C	c.(1606-1608)Gta>Cta	p.V536L	PLD5_ENST00000442594.2_Missense_Mutation_p.V444L|PLD5_ENST00000427495.1_Missense_Mutation_p.V474L			Q8N7P1	PLD5_HUMAN	phospholipase D family, member 5	536						integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(22)|ovary(6)|skin(3)|urinary_tract(1)	55	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			TCATGTTATACGTTCCGGGGA	0.418																																																	0								ENSG00000180287						202.0	198.0	200.0					1																	242253161		2203	4300	6503	PLD5	SO:0001583	missense	0			-	HGNC	AK098092	CCDS1621.1, CCDS1621.2, CCDS55692.1	1q43	2008-02-05			ENSG00000180287	ENSG00000180287			26879	protein-coding gene	gene with protein product							Standard	NM_001195811		Approved	FLJ40773	uc001hzn.2	Q8N7P1	OTTHUMG00000039867	ENST00000536534.2:c.1606G>C	1.37:g.242253161C>G	ENSP00000440896:p.Val536Leu	Somatic	0	141	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	70	65	51.85	A1KXV0|B7Z324|Q494U9|Q8NB22	Missense_Mutation	SNP	37	0.00	0	30	47.37	27	smart_PLipase_D/transphosphatidylase	p.V536L	ENST00000536534.2	37	c.1606	CCDS1621.2	1	.	.	.	.	.	.	.	.	.	.	C	3.421	-0.118222	0.06838	.	.	ENSG00000180287	ENST00000427495;ENST00000442594;ENST00000536534	T;T;T	0.42900	0.99;0.98;0.96	5.34	4.41	0.53225	.	0.571972	0.14426	N	0.320341	T	0.29458	0.0734	N	0.16478	0.41	0.09310	N	1	B;B;B	0.15930	0.015;0.002;0.015	B;B;B	0.16289	0.015;0.007;0.015	T	0.22452	-1.0216	10	0.54805	T	0.06	.	12.2641	0.54668	0.0:0.9195:0.0:0.0805	.	444;536;474	Q8N7P1-2;Q8N7P1;Q8N7P1-4	.;PLD5_HUMAN;.	L	474;444;536	ENSP00000401285:V474L;ENSP00000414188:V444L;ENSP00000440896:V536L	ENSP00000401285:V474L	V	-	1	0	PLD5	240319784	0.001000	0.12720	0.001000	0.08648	0.021000	0.10359	1.377000	0.34317	1.227000	0.43598	0.655000	0.94253	GTA	-	NULL		0.418	PLD5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PLD5	protein_coding	OTTHUMT00000397213.2	C	NM_152666	-		242253161	-1	no_errors	ENST00000536534	ensembl	human	known	74_37	missense	SNP	0.013	G
ACADSB	36	genome.wustl.edu	37	10	124800090	124800090	+	Missense_Mutation	SNP	T	T	G			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr10:124800090T>G	ENST00000358776.4	+	4	426	c.412T>G	c.(412-414)Ttt>Gtt	p.F138V	ACADSB_ENST00000368869.4_Missense_Mutation_p.F36V|ACADSB_ENST00000496730.2_3'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	138					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	TGTGGCTGTCTTTTGTGAGAT	0.403																																																	0								ENSG00000196177						134.0	133.0	133.0					10																	124800090		2203	4300	6503	ACADSB	SO:0001583	missense	0			-	HGNC	U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.412T>G	10.37:g.124800090T>G	ENSP00000357873:p.Phe138Val	Somatic	0	102	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	12	77.78	B4DQ51|Q5SQN6|Q96CX7	Missense_Mutation	SNP	34	0.00	0	8	75.76	25	pfam_AcylCo_DH/oxidase_C,pfam_AcylCoA_DH/ox_N,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase_NM_dom,superfamily_AcylCo_DH/oxidase_C	p.F138V	ENST00000358776.4	37	c.412	CCDS7634.1	10	.	.	.	.	.	.	.	.	.	.	T	0.048	-1.259425	0.01445	.	.	ENSG00000196177	ENST00000368869;ENST00000358776	D;D	0.99671	-6.35;-6.35	5.68	-11.4	0.00090	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	1.090830	0.07085	N	0.837655	D	0.95130	0.8422	N	0.04655	-0.195	0.09310	N	0.999999	B	0.02656	0.0	B	0.10450	0.005	T	0.80162	-0.1497	10	0.24483	T	0.36	.	1.0526	0.01583	0.2999:0.3111:0.2153:0.1736	.	138	P45954	ACDSB_HUMAN	V	36;138	ENSP00000357862:F36V;ENSP00000357873:F138V	ENSP00000357873:F138V	F	+	1	0	ACADSB	124790080	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.203000	0.01234	-6.524000	0.00003	-2.025000	0.00428	TTT	-	pfam_AcylCoA_DH/ox_N,superfamily_AcylCoA_DH/oxidase_NM_dom		0.403	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADSB	protein_coding	OTTHUMT00000050843.1	T	NM_001609	-		124800090	+1	no_errors	ENST00000358776	ensembl	human	known	74_37	missense	SNP	0.000	G
DMXL2	23312	genome.wustl.edu	37	15	51751092	51751097	+	Intron	DEL	AGCAGC	AGCAGC	-	rs76476368|rs111734926|rs28362472|rs578027761|rs370429483|rs555701753	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	AGCAGC	AGCAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr15:51751092_51751097delAGCAGC	ENST00000251076.5	-	34	8211				RP11-707P17.2_ENST00000559173.1_RNA|DMXL2_ENST00000543779.2_Intron|RP11-707P17.2_ENST00000559977.1_RNA|RP11-707P17.1_ENST00000561007.1_RNA|RP11-707P17.2_ENST00000560727.1_RNA|DMXL2_ENST00000449909.3_Intron	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AAGAAAATGTagcagcagcagcagca	0.369																																																	0								ENSG00000259668																																			RP11-707P17.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7924-100GCTGCT>-	15.37:g.51751098_51751103delAGCAGC		Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RTR3|B7ZMH3|F5GWF1|O94938	RNA	DEL	23	30.30	10	32	0.00	0	-	NULL	ENST00000251076.5	37	NULL	CCDS10141.1	15																																																																																			-	-		0.369	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	ENSG00000259668	protein_coding	OTTHUMT00000254671.2	AGCAGC	NM_015263			51751097	+1	no_errors	ENST00000559173	ensembl	human	known	74_37	rna	DEL	0.994:0.992:0.991:0.990:0.990:0.990	-
CEP170B	283638	genome.wustl.edu	37	14	105352885	105352890	+	In_Frame_Del	DEL	GCAGGA	GCAGGA	-	rs60001925|rs150426191	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	GCAGGA	GCAGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr14:105352885_105352890delGCAGGA	ENST00000414716.3	+	12	2537_2542	c.2309_2314delGCAGGA	c.(2308-2316)cgcaggagc>cgc	p.RS771del	CEP170B_ENST00000453495.1_In_Frame_Del_p.RS772del|CEP170B_ENST00000556508.1_In_Frame_Del_p.RS701del|CEP170B_ENST00000418279.1_In_Frame_Del_p.RS701del	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	771						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GACAGCAGACGCAGGAGCCCCCAGGA	0.694														358	0.0714856	0.0061	0.1196	5008	,	,		13278	0.1091		0.0775	False		,,,				2504	0.0808																0								ENSG00000099814		,	62,3458		5,52,1703					,	3.2	0.0		dbSNP_129	9	575,7107		59,457,3325	no	coding,coding	KIAA0284	NM_015005.2,NM_001112726.2	,	64,509,5028	A1A1,A1R,RR		7.485,1.7614,5.6865	,	,		637,10565				CEP170B	SO:0001651	inframe_deletion	0				HGNC	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.2309_2314delGCAGGA	14.37:g.105352885_105352890delGCAGGA	ENSP00000404151:p.Arg771_Ser772del	Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q2KHR7|Q86TI7	In_Frame_Del	DEL	13	45.83	11	24	0.00	0	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.RS772in_frame_del	ENST00000414716.3	37	c.2312_2317	CCDS45175.1	14																																																																																			-	NULL		0.694	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CEP170B	protein_coding	OTTHUMT00000410289.2	GCAGGA	NM_001112726			105352890	+1	no_errors	ENST00000453495	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.000:0.000:0.003:0.103:0.181	-
ADORA1	134	genome.wustl.edu	37	1	203121710	203121728	+	Intron	DEL	TTTTTCCTGTCCCACGGGA	TTTTTCCTGTCCCACGGGA	-	rs199739953|rs72372371|rs113002357|rs201476514|rs369015691|rs59505275|rs149200581	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	TTTTTCCTGTCCCACGGGA	TTTTTCCTGTCCCACGGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:203121710_203121728delTTTTTCCTGTCCCACGGGA	ENST00000367236.4	+	3	1262				ADORA1_ENST00000367235.1_Intron|ADORA1_ENST00000337894.4_Intron|ADORA1_ENST00000309502.3_Intron|ADORA1_ENST00000472535.1_Intron|RP11-335O13.8_ENST00000434265.1_RNA	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor						activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	ATGGGATGGTTTTTTCCTGTCCCACGGGATGAGTCAGAA	0.511																																																	0								ENSG00000224671																																			RP11-335O13.8	SO:0001627	intron_variant	0				Clone_based_vega_gene	BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.342-12661TTTTTCCTGTCCCACGGGA>-	1.37:g.203121710_203121728delTTTTTCCTGTCCCACGGGA		Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	RNA	DEL	8	57.89	11	10	72.97	27	-	NULL	ENST00000367236.4	37	NULL	CCDS1434.1	1																																																																																			-	-		0.511	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000224671	protein_coding	OTTHUMT00000100273.1	TTTTTCCTGTCCCACGGGA	NM_000674			203121728	-1	no_errors	ENST00000434265	ensembl	human	known	74_37	rna	DEL	0.002:0.027:0.036:0.047:0.024:0.003:0.003:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.002:0.160:0.554	-
ZNF300P1	134466	genome.wustl.edu	37	5	150323571	150323571	+	RNA	SNP	T	T	C			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr5:150323571T>C	ENST00000520773.1	-	0	1050									zinc finger protein 300 pseudogene 1 (functional)																		TTGACCCTTATAGCAAACACC	0.443																																																	0								ENSG00000197083																																			ZNF300P1			0			-	HGNC	AK096536		5q33.1	2014-09-11	2014-01-16		ENSG00000197083	ENSG00000197083		"""-"""	27032	pseudogene	pseudogene			"""zinc finger protein 300 pseudogene 1"""			24393131	Standard	NR_026867		Approved		uc003lsz.1		OTTHUMG00000154830		5.37:g.150323571T>C		Somatic	0	10	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	5	58.33		RNA	SNP	33	0.00	0	22	54.17	26	-	NULL	ENST00000520773.1	37	NULL		5																																																																																			-	-		0.443	ZNF300P1-002	KNOWN	basic	processed_transcript	ZNF300P1	pseudogene	OTTHUMT00000374771.1	T	NR_026867	-		150323571	-1	no_errors	ENST00000520773	ensembl	human	known	74_37	rna	SNP	0.000	C
GC	2638	genome.wustl.edu	37	4	72620173	72620173	+	Missense_Mutation	SNP	A	A	C			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr4:72620173A>C	ENST00000273951.8	-	10	1560	c.1217T>G	c.(1216-1218)cTa>cGa	p.L406R	GC_ENST00000503472.1_5'UTR|GC_ENST00000504199.1_Missense_Mutation_p.L425R|GC_ENST00000513476.1_Missense_Mutation_p.L406R	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	406	Albumin 3. {ECO:0000255|PROSITE- ProRule:PRU00769}.				small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	ATCTGCACATAGTTCTTGTCC	0.308																																																	0								ENSG00000145321						77.0	76.0	76.0					4																	72620173		2203	4299	6502	GC	SO:0001583	missense	0			-	HGNC	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.1217T>G	4.37:g.72620173A>C	ENSP00000273951:p.Leu406Arg	Somatic	0	82	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	41	42.25	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	46	0.00	0	29	44.23	23	pfam_Serum_albumin_N,pfam_VitD-bind_III,superfamily_Serum_albumin-like,smart_Serum_albumin_N,prints_VitD-bd,prints_ALB/AFP/VDB	p.L406R	ENST00000273951.8	37	c.1217	CCDS3550.1	4	.	.	.	.	.	.	.	.	.	.	A	17.26	3.343517	0.61073	.	.	ENSG00000145321	ENST00000273951;ENST00000504199;ENST00000513476	T;T;T	0.33438	1.41;1.41;1.41	5.35	5.35	0.76521	.	0.572095	0.17283	N	0.179905	T	0.51839	0.1698	M	0.61703	1.905	0.39867	D	0.97345	D;D	0.89917	1.0;1.0	D;D	0.80764	0.993;0.994	T	0.55159	-0.8184	10	0.87932	D	0	.	12.0044	0.53251	1.0:0.0:0.0:0.0	.	425;406	D6RAK8;D6RF35	.;.	R	406;425;406	ENSP00000273951:L406R;ENSP00000421725:L425R;ENSP00000426683:L406R	ENSP00000273951:L406R	L	-	2	0	GC	72839037	0.832000	0.29368	0.906000	0.35671	0.759000	0.43091	4.517000	0.60503	2.135000	0.66039	0.533000	0.62120	CTA	-	pfam_VitD-bind_III,superfamily_Serum_albumin-like,prints_VitD-bd		0.308	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GC	protein_coding	OTTHUMT00000252167.2	A		-		72620173	-1	no_errors	ENST00000273951	ensembl	human	known	74_37	missense	SNP	0.950	C
MCM3AP	8888	genome.wustl.edu	37	21	47662900	47662900	+	Intron	DEL	A	A	-	rs56371413|rs75544878		TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr21:47662900delA	ENST00000397708.1	-	26	5551				MCM3AP-AS1_ENST00000421927.1_RNA|MCM3AP_ENST00000467026.1_Intron|MCM3AP-AS1_ENST00000591223.1_RNA|MCM3AP-AS1_ENST00000444998.1_RNA|MCM3AP-AS1_ENST00000590829.1_RNA|MCM3AP-AS1_ENST00000588753.1_RNA|MCM3AP-AS1_ENST00000455567.1_RNA|MCM3AP-AS1_ENST00000432735.1_RNA|MCM3AP-AS1_ENST00000414659.1_RNA|MCM3AP_ENST00000291688.1_Intron			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein						DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					ACCCTGTCTCAAAAAAAAAAA	0.348																																																	0								ENSG00000215424																																			MCM3AP-AS1	SO:0001627	intron_variant	0				HGNC	AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.5297-55T>-	21.37:g.47662900delA		Somatic	0	12	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	6	57.14	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	RNA	DEL	29	29.27	12	37	0.00	0	-	NULL	ENST00000397708.1	37	NULL	CCDS13734.1	21																																																																																			-	-		0.348	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP-AS1	protein_coding	OTTHUMT00000207254.1	A	NM_003906			47662900	+1	no_errors	ENST00000421927	ensembl	human	known	74_37	rna	DEL	0.000	-
COL27A1	85301	genome.wustl.edu	37	9	117031280	117031281	+	Intron	INS	-	-	TGGTGT	rs71492772|rs74965078|rs112255284	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr9:117031280_117031281insTGGTGT	ENST00000356083.3	+	35	3892				COL27A1_ENST00000477421.2_3'UTR	NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1						extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						taataggatgatggtGTTGGTG	0.441														2505	0.5002	0.8669	0.3804	5008	,	,		20945	0.2331		0.4354	False		,,,				2504	0.4315																0								ENSG00000196739																																			COL27A1	SO:0001627	intron_variant	0				HGNC	AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3502-240->TGGTGT	9.37:g.117031281_117031286dupTGGTGT		Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q66K43|Q96JF7	RNA	INS	20	41.18	14	49	22.22	14	-	NULL	ENST00000356083.3	37	NULL	CCDS6802.1	9																																																																																			-	-		0.441	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	protein_coding	OTTHUMT00000053763.1	-	NM_032888			117031281	+1	no_errors	ENST00000477421	ensembl	human	known	74_37	rna	INS	0.010:0.009	TGGTGT
DNM1P46	196968	genome.wustl.edu	37	15	100347042	100347042	+	5'Flank	SNP	A	A	G			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr15:100347042A>G	ENST00000560059.1	+	0	0				DNM1P46_ENST00000341853.1_RNA|CTD-2054N24.2_ENST00000558188.1_5'Flank|CTD-2054N24.2_ENST00000559714.1_5'Flank																							CTCACGCTCCACTGCAACAGA	0.672																																																	0								ENSG00000182397																																			DNM1P46	SO:0001631	upstream_gene_variant	0			-	HGNC																													15.37:g.100347042A>G	Exception_encountered	Somatic	0	16	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	20	25.93		RNA	SNP	10	9.09	1	9	30.77	4	-	NULL	ENST00000560059.1	37	NULL		15																																																																																			-	-		0.672	CTD-2054N24.2-002	PUTATIVE	basic|appris_principal	protein_coding	DNM1P46	protein_coding	OTTHUMT00000416905.2	A		-		100347042	-1	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	SNP	0.637	G
PSMG4	389362	genome.wustl.edu	37	6	3263936	3263936	+	Missense_Mutation	SNP	A	A	G	rs374935109	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr6:3263936A>G	ENST00000438998.2	+	2	322	c.193A>G	c.(193-195)Acc>Gcc	p.T65A	PSMG4_ENST00000473000.2_Missense_Mutation_p.T65A|PSMG4_ENST00000451246.2_Intron|PSMG4_ENST00000419065.2_Missense_Mutation_p.T65A|PSMG4_ENST00000380305.4_Intron|PSMG4_ENST00000380306.4_Intron	NM_001128591.1	NP_001122063.1	Q5JS54	PSMG4_HUMAN	proteasome (prosome, macropain) assembly chaperone 4	65										endometrium(1)	1						CCCCGTGTCTACCTCCCTCCT	0.612													A|||	7	0.00139776	0.0045	0.0014	5008	,	,		17813	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000180822	A	ALA/THR,ALA/THR,ALA/THR	4,1380		0,4,688	96.0	103.0	101.0		193,193,193	4.6	1.0	6		101	0,3182		0,0,1591	no	missense,missense,missense	PSMG4	NM_001128591.1,NM_001128592.1,NM_001135750.1	58,58,58	0,4,2279	GG,GA,AA		0.0,0.289,0.0876	probably-damaging,probably-damaging,probably-damaging	65/124,65/163,65/105	3263936	4,4562	692	1591	2283	PSMG4	SO:0001583	missense	0			-	HGNC		CCDS47360.1, CCDS47361.1, CCDS47362.1	6p25.2	2010-06-23	2008-02-25	2008-02-25	ENSG00000180822	ENSG00000180822			21108	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 86"""	C6orf86		17707236	Standard	NM_001128591		Approved	PAC4	uc010jnl.1	Q5JS54	OTTHUMG00000014142	ENST00000438998.2:c.193A>G	6.37:g.3263936A>G	ENSP00000413353:p.Thr65Ala	Somatic	0	87	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	37	40.62	C9J2F8|F8WBZ2|Q5JS53|Q5JS56	Missense_Mutation	SNP	21	0.00	0	25	39.02	16	NULL	p.T65A	ENST00000438998.2	37	c.193	CCDS47361.1	6	.	.	.	.	.	.	.	.	.	.	A	19.14	3.769877	0.69992	0.00289	0.0	ENSG00000180822	ENST00000438998;ENST00000419065;ENST00000473000	.	.	.	5.78	4.59	0.56863	.	0.326694	0.27159	N	0.020654	T	0.62575	0.2439	M	0.62266	1.93	0.80722	D	1	D;D;D	0.76494	0.996;0.999;0.999	D;D;D	0.83275	0.99;0.996;0.996	T	0.65207	-0.6224	9	0.48119	T	0.1	-30.5964	11.2308	0.48912	0.8464:0.1536:0.0:0.0	.	65;65;65	Q5JS54;C9J2F8;F8WBZ2	PSMG4_HUMAN;.;.	A	65	.	ENSP00000424330:T65A	T	+	1	0	PSMG4	3208935	1.000000	0.71417	0.979000	0.43373	0.757000	0.42996	6.635000	0.74295	0.975000	0.38392	0.460000	0.39030	ACC	-	NULL		0.612	PSMG4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMG4	protein_coding	OTTHUMT00000039678.2	A		-		3263936	+1	no_errors	ENST00000419065	ensembl	human	known	74_37	missense	SNP	0.998	G
OR5G5P	81191	genome.wustl.edu	37	11	56569579	56569579	+	RNA	SNP	G	G	A	rs137945535		TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr11:56569579G>A	ENST00000378368.2	-	0	691									olfactory receptor, family 5, subfamily G, member 5 pseudogene																		TTTGCGTCTCGCGTCAGCAGA	0.478													G|||	1	0.000199681	0.0	0.0	5008	,	,		20731	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000205025																																			OR5G5P			0			GMAF=0.0005	HGNC			11q12.1	2014-03-20			ENSG00000205025	ENSG00000205025		"""GPCR / Class A : Olfactory receptors"""	15289	pseudogene	pseudogene							Standard	NG_004191		Approved				OTTHUMG00000154297		11.37:g.56569579G>A		Somatic	0	25	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67		RNA	SNP	32	0.00	0	29	44.23	23	-	NULL	ENST00000378368.2	37	NULL		11																																																																																			-	-		0.478	OR5G5P-003	KNOWN	basic	processed_transcript	OR5G5P	pseudogene	OTTHUMT00000392444.1	G		rs137945535		56569579	-1	no_errors	ENST00000378368	ensembl	human	known	74_37	rna	SNP	0.004	A
C22orf29	79680	genome.wustl.edu	37	22	19839506	19839506	+	Silent	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr22:19839506C>T	ENST00000405640.1	-	2	947	c.279G>A	c.(277-279)agG>agA	p.R93R	C22orf29_ENST00000484072.1_Intron|C22orf29_ENST00000407472.1_Silent_p.R93R|GNB1L_ENST00000403325.1_Intron|GNB1L_ENST00000460402.1_Intron|C22orf29_ENST00000328554.4_Silent_p.R93R|GNB1L_ENST00000405009.1_Intron|GNB1L_ENST00000329517.6_Intron			Q7L3V2	BOP_HUMAN	chromosome 22 open reading frame 29	93					mitochondrial outer membrane permeabilization (GO:0097345)|regulation of mitochondrial membrane potential (GO:0051881)	mitochondrion (GO:0005739)				NS(1)|large_intestine(1)|lung(3)|prostate(1)|urinary_tract(1)	7	Colorectal(54;0.0993)					AGAAGTCCACCCTGTGGGGTC	0.617																																																	0								ENSG00000215012						50.0	56.0	54.0					22																	19839506		2203	4300	6503	C22orf29	SO:0001819	synonymous_variant	0			-	HGNC	BX640998	CCDS13769.1	22q11.21	2006-07-05			ENSG00000215012	ENSG00000215012			26112	protein-coding gene	gene with protein product						12477932	Standard	NM_024627		Approved	FLJ21125	uc002zqh.3	Q7L3V2	OTTHUMG00000030314	ENST00000405640.1:c.279G>A	22.37:g.19839506C>T		Somatic	0	33	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	10	60.00	A8K5E7|D3DX21|Q6MZM8|Q6N000|Q9H7A0	Silent	SNP	25	0.00	0	17	62.22	28	NULL	p.R93	ENST00000405640.1	37	c.279	CCDS13769.1	22																																																																																			-	NULL		0.617	C22orf29-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C22orf29	protein_coding	OTTHUMT00000317290.2	C	NM_024627	-		19839506	-1	no_errors	ENST00000328554	ensembl	human	known	74_37	silent	SNP	0.031	T
NCOR2	9612	genome.wustl.edu	37	12	124824721	124824722	+	In_Frame_Ins	INS	-	-	GCCGCTGCT	rs61519723|rs112797765|rs143952466	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr12:124824721_124824722insGCCGCTGCT	ENST00000405201.1	-	37	5517_5518	c.5517_5518insAGCAGCGGC	c.(5515-5520)ggcggg>ggcAGCAGCGGCggg	p.1838_1839insGSS	NCOR2_ENST00000404621.1_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000404121.2_In_Frame_Ins_p.1399_1400insGSS|NCOR2_ENST00000397355.1_In_Frame_Ins_p.1829_1830insGSS|NCOR2_ENST00000429285.2_In_Frame_Ins_p.1828_1829insGSS|NCOR2_ENST00000356219.3_In_Frame_Ins_p.1845_1846insGSS			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1849					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		cccccacccccgccgctgctgc	0.713														4762	0.950879	0.8979	0.9496	5008	,	,		14227	0.9633		0.9672	False		,,,				2504	0.9939																0								ENSG00000196498																																			NCOR2	SO:0001652	inframe_insertion	0				HGNC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.5509_5517dupAGCAGCGGC	12.37:g.124824722_124824730dupGCCGCTGCT	ENSP00000384018:p.Gly1836_Ser1838dup	Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	In_Frame_Ins	INS	11	45.00	9	18	10.00	2	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.1846in_frame_insSSG	ENST00000405201.1	37	c.5539_5538	CCDS41858.2	12																																																																																			-	NULL		0.713	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	protein_coding	OTTHUMT00000318173.2	-	NM_006312			124824722	-1	no_errors	ENST00000356219	ensembl	human	known	74_37	in_frame_ins	INS	1.000:0.999	GCCGCTGCT
DHX58	79132	genome.wustl.edu	37	17	40259674	40259674	+	Silent	SNP	G	G	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr17:40259674G>T	ENST00000251642.3	-	8	1167	c.945C>A	c.(943-945)gtC>gtA	p.V315V		NM_024119.2	NP_077024.2	Q96C10	DHX58_HUMAN	DEXH (Asp-Glu-X-His) box polypeptide 58	315					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of innate immune response (GO:0045824)|negative regulation of MDA-5 signaling pathway (GO:0039534)|negative regulation of RIG-I signaling pathway (GO:0039536)|negative regulation of type I interferon production (GO:0032480)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|positive regulation of type I interferon production (GO:0032481)|regulation of innate immune response (GO:0045088)|response to virus (GO:0009615)|viral process (GO:0016032)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(22;9.73e-07)|all_epithelial(22;3.58e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGGTTTTAGTGACGTGCTCCC	0.637																																																	0								ENSG00000108771						42.0	40.0	41.0					17																	40259674		2203	4300	6503	DHX58	SO:0001819	synonymous_variant	0			-	HGNC	BC014949	CCDS11416.1	17q21.2	2008-02-05			ENSG00000108771	ENSG00000108771			29517	protein-coding gene	gene with protein product	"""RNA helicase LGP2"""	608588				11735219	Standard	NM_024119		Approved	LGP2, D11LGP2	uc002hyw.3	Q96C10	OTTHUMG00000133493	ENST00000251642.3:c.945C>A	17.37:g.40259674G>T		Somatic	0	51	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q9HAM6	Silent	SNP	25	0.00	0	31	0.00	0	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V315	ENST00000251642.3	37	c.945	CCDS11416.1	17																																																																																			-	superfamily_P-loop_NTPase		0.637	DHX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX58	protein_coding	OTTHUMT00000257396.1	G	NM_024119	-		40259674	-1	no_errors	ENST00000251642	ensembl	human	known	74_37	silent	SNP	0.638	T
SHANK3	85358	genome.wustl.edu	37	22	51121777	51121777	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr22:51121777G>T	ENST00000414786.2	+	8	1122	c.895G>T	c.(895-897)Gct>Tct	p.A299S	SHANK3_ENST00000262795.3_Missense_Mutation_p.A299S|SHANK3_ENST00000445220.2_Missense_Mutation_p.A299S			Q9BYB0	SHAN3_HUMAN	SH3 and multiple ankyrin repeat domains 3	299					adult behavior (GO:0030534)|alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|brain morphogenesis (GO:0048854)|dendritic spine morphogenesis (GO:0060997)|guanylate kinase-associated protein clustering (GO:0097117)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of actin filament bundle assembly (GO:0032232)|negative regulation of cell volume (GO:0045794)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of glutamate receptor signaling pathway (GO:1900451)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse structural plasticity (GO:0051835)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density assembly (GO:0097107)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of long term synaptic depression (GO:1900452)|regulation of long-term synaptic potentiation (GO:1900271)|social behavior (GO:0035176)|striatal medium spiny neuron differentiation (GO:0021773)|synapse assembly (GO:0007416)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(5)	8		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		GGAGAGCTGTGCTCGTGTCCT	0.582																																																	0								ENSG00000251322						57.0	67.0	64.0					22																	51121777		2127	4219	6346	SHANK3	SO:0001583	missense	0			-	HGNC	AB051437		22q13.3	2013-11-14			ENSG00000251322	ENSG00000251322		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14294	protein-coding gene	gene with protein product	"""proline rich synapse associated protein 2"", ""shank postsynaptic density protein"""	606230				11258795, 11431708, 10806096, 17173049	Standard	NM_033517		Approved	SPANK-2, prosap2, KIAA1650, PSAP2	uc031ryd.1	Q9BYB0	OTTHUMG00000150169	ENST00000414786.2:c.895G>T	22.37:g.51121777G>T	ENSP00000464552:p.Ala299Ser	Somatic	0	33	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	D7UT47|Q8TET3	Missense_Mutation	SNP	26	0.00	0	46	0.00	0	pfam_SAM_type1,pfam_Ankyrin_rpt,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.A299S	ENST00000414786.2	37	c.895		22	.	.	.	.	.	.	.	.	.	.	G	25.6	4.649779	0.87958	.	.	ENSG00000251322	ENST00000262795;ENST00000445220	T;T	0.67523	-0.27;-0.27	4.8	4.8	0.61643	.	.	.	.	.	T	0.80276	0.4593	M	0.66506	2.035	0.33637	D	0.606755	D	0.89917	1.0	D	0.87578	0.998	D	0.85835	0.1394	9	0.87932	D	0	.	15.4269	0.75059	0.0:0.0:1.0:0.0	.	299	F2Z3L0	.	S	299	ENSP00000442518:A299S;ENSP00000446078:A299S	ENSP00000442518:A299S	A	+	1	0	SHANK3	49468643	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.666000	0.91149	2.495000	0.84180	0.645000	0.84053	GCT	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.582	SHANK3-001	KNOWN	non_canonical_polymorphism|basic|appris_candidate	protein_coding	SHANK3	protein_coding	OTTHUMT00000316674.2	G	NM_001080420	-		51121777	+1	no_errors	ENST00000262795	ensembl	human	known	74_37	missense	SNP	1.000	T
FMO9P	116123	genome.wustl.edu	37	1	166592934	166592934	+	RNA	SNP	G	G	T	rs182628168	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr1:166592934G>T	ENST00000477875.1	+	0	958					NR_002925.2				flavin containing monooxygenase 9 pseudogene																		CAAAAGTCCCGAGGACTTTTC	0.398																																																	0								ENSG00000215834																																			FMO9P			0			-	HGNC	BC014341		1q24.1	2011-08-04			ENSG00000215834	ENSG00000215834			32210	pseudogene	pseudogene						15077013	Standard	NR_002925		Approved	RP11-45J16.2	uc010pld.2		OTTHUMG00000078309		1.37:g.166592934G>T		Somatic	0	35	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29		RNA	SNP	56	0.00	0	53	0.00	0	-	NULL	ENST00000477875.1	37	NULL		1																																																																																			-	-		0.398	FMO9P-002	KNOWN	basic	processed_transcript	FMO9P	pseudogene	OTTHUMT00000081454.1	G	NR_002925	-		166592934	+1	no_errors	ENST00000477875	ensembl	human	known	74_37	rna	SNP	0.036	T
ARHGAP5	394	genome.wustl.edu	37	14	32561316	32561316	+	Nonsense_Mutation	SNP	G	G	T	rs200628183	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr14:32561316G>T	ENST00000345122.3	+	2	1756	c.1441G>T	c.(1441-1443)Gaa>Taa	p.E481*	ARHGAP5_ENST00000556611.1_Nonsense_Mutation_p.E481*|ARHGAP5_ENST00000539826.2_Nonsense_Mutation_p.E481*|ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000432921.1_Nonsense_Mutation_p.E481*|ARHGAP5_ENST00000396582.2_Intron	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	481	FF 3.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GCATCAGCGAGAAATAGTTGA	0.373																																					NSCLC(9;77 350 3443 29227 41353)												0								ENSG00000100852						69.0	70.0	70.0					14																	32561316		2203	4297	6500	ARHGAP5	SO:0001587	stop_gained	0			-	HGNC	U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.1441G>T	14.37:g.32561316G>T	ENSP00000371897:p.Glu481*	Somatic	0	55	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Nonsense_Mutation	SNP	43	2.27	1	61	1.61	1	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.E481*	ENST00000345122.3	37	c.1441	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	40	8.091676	0.98648	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000345122;ENST00000432921	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	20.547	0.99278	0.0:0.0:1.0:0.0	.	.	.	.	X	481	.	ENSP00000371897:E481X	E	+	1	0	ARHGAP5	31631067	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.850000	0.98022	0.650000	0.86243	GAA	-	superfamily_FF_domain,smart_FF_domain		0.373	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	protein_coding	OTTHUMT00000409735.1	G	NM_001030055	rs200628183		32561316	+1	no_errors	ENST00000345122	ensembl	human	known	74_37	nonsense	SNP	1.000	T
AMZ1	155185	genome.wustl.edu	37	7	2741852	2741906	+	Intron	DEL	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	-	rs798471|rs540419422|rs191436847|rs10624226|rs33915832|rs35358739|rs10694020|rs397762646	byFrequency	TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr7:2741852_2741906delTGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	ENST00000312371.4	+	3	672				AMZ1_ENST00000407112.1_Intron	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		CCTGCACCCTTGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTCTGTGTCCTGC	0.624																																																	0								ENSG00000174945																																			AMZ1	SO:0001627	intron_variant	0				HGNC	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.305-450TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC>-	7.37:g.2741852_2741906delTGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC		Somatic	NA	NA	NA		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KRS0|Q8TF51	RNA	DEL	35	0.00	0	49	0.00	0	-	NULL	ENST00000312371.4	37	NULL	CCDS34589.1	7																																																																																			-	-		0.624	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ1	protein_coding	OTTHUMT00000325244.1	TGTGTGCTACTCTGCCCCAGCCAGGCTGGCATTTTGCAGCCATGCAGCCTGGCTC	NM_133463			2741906	+1	no_errors	ENST00000485540	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.001:0.002:0.002:0.003:0.004:0.003:0.001:0.000:0.000:0.004:0.003:0.003:0.002:0.002:0.002:0.003:0.003:0.001:0.005:0.071:0.077:0.080:0.076:0.071:0.067:0.056:0.014:0.004:0.001:0.002:0.002:0.000:0.001:0.002:0.003:0.004:0.005:0.002:0.002:0.002:0.002:0.002:0.002:0.003:0.000:0.001:0.001:0.000:0.000:0.000:0.001:0.000:0.000	-
PGM5P2	595135	genome.wustl.edu	37	9	69113643	69113643	+	RNA	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr9:69113643C>T	ENST00000591037.1	-	0	1002					NR_002836.2				phosphoglucomutase 5 pseudogene 2																		TCATTGCTTCCAGAAGAGTCA	0.483																																																	0								ENSG00000227558																																			PGM5P2			0			-	HGNC	BC007887, BC025351		9q12	2014-01-23			ENSG00000227558	ENSG00000277778			18965	pseudogene	pseudogene						12421752, 15233989	Standard	NR_002836		Approved		uc004aff.4		OTTHUMG00000013322		9.37:g.69113643C>T		Somatic	0	118	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	60	52.00		RNA	SNP	20	0.00	0	24	42.86	18	-	NULL	ENST00000591037.1	37	NULL		9																																																																																			-	-		0.483	PGM5P2-002	KNOWN	basic	processed_transcript	PGM5P2	pseudogene	OTTHUMT00000460890.1	C	NR_002836	-		69113643	-1	no_errors	ENST00000591037	ensembl	human	known	74_37	rna	SNP	1.000	T
MUC4	4585	genome.wustl.edu	37	3	195516546	195516546	+	Silent	SNP	G	G	A			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr3:195516546G>A	ENST00000463781.3	-	2	2364	c.1905C>T	c.(1903-1905)tcC>tcT	p.S635S	MUC4_ENST00000475231.1_Silent_p.S635S|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	640					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACCCCTTTGGGAAACAGCTG	0.502																																																	0								ENSG00000145113						320.0	322.0	321.0					3																	195516546		2057	4211	6268	MUC4	SO:0001819	synonymous_variant	0			-	HGNC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.1905C>T	3.37:g.195516546G>A		Somatic	0	91	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	43	51.14	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	30	0.00	0	28	46.15	24	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S635	ENST00000463781.3	37	c.1905	CCDS54700.1	3																																																																																			-	NULL		0.502	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	G	NM_018406	-		195516546	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	silent	SNP	0.000	A
C19orf45	374877	genome.wustl.edu	37	19	7572028	7572028	+	Splice_Site	SNP	G	G	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr19:7572028G>T	ENST00000361664.2	+	8	1434		c.e8+1		CTD-2207O23.12_ENST00000599312.1_Splice_Site	NM_198534.2	NP_940936.2	Q8NA69	CS045_HUMAN	chromosome 19 open reading frame 45											endometrium(1)|kidney(1)|liver(1)|lung(2)|ovary(2)|stomach(1)	8						GCTACAGCGGGTAAGGGAGGC	0.522																																																	0								ENSG00000198723						33.0	37.0	36.0					19																	7572028		2203	4300	6503	C19orf45	SO:0001630	splice_region_variant	0			-	HGNC	BC029824	CCDS12179.2	19p13.2	2008-02-05			ENSG00000198723	ENSG00000198723			24745	protein-coding gene	gene with protein product						12477932	Standard	NM_198534		Approved	FLJ35784	uc002mgm.2	Q8NA69	OTTHUMG00000157183	ENST00000361664.2:c.1293+1G>T	19.37:g.7572028G>T		Somatic	0	48	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q8N115	Splice_Site	SNP	25	0.00	0	40	2.44	1	-	e7+1	ENST00000361664.2	37	c.1293+1	CCDS12179.2	19	.	.	.	.	.	.	.	.	.	.	G	13.29	2.193531	0.38707	.	.	ENSG00000198723	ENST00000361664	.	.	.	3.28	3.28	0.37604	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2942	0.43613	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C19orf45	7478028	1.000000	0.71417	0.960000	0.40013	0.190000	0.23558	3.812000	0.55628	2.143000	0.66587	0.313000	0.20887	.	-	-		0.522	C19orf45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf45	protein_coding	OTTHUMT00000347808.1	G	NM_198534	-	Intron	7572028	+1	no_errors	ENST00000361664	ensembl	human	known	74_37	splice_site	SNP	0.962	T
TAF6L	10629	genome.wustl.edu	37	11	62543260	62543260	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr11:62543260C>T	ENST00000294168.3	+	2	206	c.5C>T	c.(4-6)tCa>tTa	p.S2L	TMEM223_ENST00000527073.1_Intron	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	2					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						GGGGCCATGTCAGAGCGAGAA	0.642																																																	0								ENSG00000162227						55.0	60.0	58.0					11																	62543260		2201	4299	6500	TAF6L	SO:0001583	missense	0			-	HGNC	BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.5C>T	11.37:g.62543260C>T	ENSP00000294168:p.Ser2Leu	Somatic	0	44	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	22	35.29	B2RAT0|Q96HA6	Missense_Mutation	SNP	38	0.00	0	17	51.43	18	pfam_TAF_TATA-bd,pfam_DUF1546,superfamily_Histone-fold,smart_TAF_TATA-bd	p.S2L	ENST00000294168.3	37	c.5	CCDS8035.1	11	.	.	.	.	.	.	.	.	.	.	C	16.27	3.074962	0.55646	.	.	ENSG00000162227	ENST00000294168;ENST00000526261;ENST00000529509	T;T	0.50813	0.73;0.82	4.53	4.53	0.55603	.	0.268410	0.30285	N	0.009971	T	0.32852	0.0843	N	0.14661	0.345	0.80722	D	1	B;B	0.24186	0.035;0.099	B;B	0.19391	0.012;0.025	T	0.24657	-1.0154	10	0.72032	D	0.01	-31.1238	15.1558	0.72739	0.0:1.0:0.0:0.0	.	2;2	B4DVM4;Q9Y6J9	.;TAF6L_HUMAN	L	2	ENSP00000294168:S2L;ENSP00000434662:S2L	ENSP00000294168:S2L	S	+	2	0	TAF6L	62299836	1.000000	0.71417	0.948000	0.38648	0.722000	0.41435	4.711000	0.61881	2.517000	0.84864	0.561000	0.74099	TCA	-	NULL		0.642	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF6L	protein_coding	OTTHUMT00000395352.1	C	NM_006473	-		62543260	+1	no_errors	ENST00000294168	ensembl	human	known	74_37	missense	SNP	0.970	T
E2F4	1874	genome.wustl.edu	37	16	67229794	67229796	+	In_Frame_Del	DEL	CAG	CAG	-	rs3830472|rs562856782		TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr16:67229794_67229796delCAG	ENST00000379378.3	+	7	977_979	c.918_920delCAG	c.(916-921)gacagc>gac	p.S319del		NM_001950.3	NP_001941.2	Q16254	E2F4_HUMAN	E2F transcription factor 4, p107/p130-binding	319	Poly-Ser.		S -> SSSS.		blood circulation (GO:0008015)|cell volume homeostasis (GO:0006884)|cilium assembly (GO:0042384)|epithelial cell development (GO:0002064)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of cell size (GO:0008361)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.S319_N320insS(1)		breast(4)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)	11		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000697)|Epithelial(162;0.00303)|all cancers(182;0.0325)		CCCTGCTGGAcagcagcagcagc	0.601																																																	1	Insertion - In frame(1)	breast(1)						ENSG00000205250																																			E2F4	SO:0001651	inframe_deletion	0				HGNC	BC021050	CCDS32464.1	16q22.1	2014-05-06			ENSG00000205250	ENSG00000205250			3118	protein-coding gene	gene with protein product		600659				7958924, 7892279	Standard	NM_001950		Approved	E2F-4	uc002erz.3	Q16254	OTTHUMG00000172975	ENST00000379378.3:c.918_920delCAG	16.37:g.67229803_67229805delCAG	ENSP00000368686:p.Ser319del	Somatic	0	73	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A6NGR8|B5BU56|Q12991|Q15328	In_Frame_Del	DEL	23	0.00	0	19	0.00	0	pfam_E2F_TDP	p.S310in_frame_del	ENST00000379378.3	37	c.918_920	CCDS32464.1	16																																																																																			-	NULL		0.601	E2F4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	E2F4	protein_coding	OTTHUMT00000421565.1	CAG	NM_001950			67229796	+1	no_errors	ENST00000379378	ensembl	human	known	74_37	in_frame_del	DEL	0.995:0.995:0.995	-
RTN3	10313	genome.wustl.edu	37	11	63486877	63486877	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3NJ-01A-11D-A21Q-09	TCGA-FX-A3NJ-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	408ed640-75f6-4346-bdd0-3b93c51adae5	5925ff29-ab11-4a35-957f-0e6198757944	g.chr11:63486877G>T	ENST00000377819.5	+	3	1057	c.903G>T	c.(901-903)gaG>gaT	p.E301D	RTN3_ENST00000356000.3_Intron|RTN3_ENST00000540798.1_Missense_Mutation_p.E189D|RTN3_ENST00000537981.1_Intron|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000339997.4_Missense_Mutation_p.E282D|RTN3_ENST00000354497.4_Intron	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	301					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						GAAATAAAGAGGCAGGACGTT	0.433																																																	0								ENSG00000133318						85.0	86.0	86.0					11																	63486877		2201	4298	6499	RTN3	SO:0001583	missense	0			-	HGNC	AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.903G>T	11.37:g.63486877G>T	ENSP00000367050:p.Glu301Asp	Somatic	0	42	0.00		0.5950849449618895	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	43	0.00	0	65	0.00	0	pfam_Reticulon,pfscan_Reticulon	p.E301D	ENST00000377819.5	37	c.903	CCDS58141.1	11	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885458	0.72410	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798	T;T;T	0.18657	2.2;2.2;2.2	5.98	4.03	0.46877	.	0.000000	0.47455	D	0.000225	T	0.30039	0.0752	L	0.32530	0.975	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.998	D;D;D	0.77557	0.99;0.978;0.99	T	0.03945	-1.0990	10	0.56958	D	0.05	-21.829	6.9178	0.24369	0.0916:0.0:0.7374:0.171	.	189;301;282	F5H774;O95197;O95197-2	.;RTN3_HUMAN;.	D	301;282;189	ENSP00000367050:E301D;ENSP00000344106:E282D;ENSP00000442733:E189D	ENSP00000344106:E282D	E	+	3	2	RTN3	63243453	0.941000	0.31946	1.000000	0.80357	0.993000	0.82548	0.825000	0.27393	1.496000	0.48567	0.591000	0.81541	GAG	-	NULL		0.433	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	protein_coding	OTTHUMT00000397846.1	G	NM_006054	-		63486877	+1	no_errors	ENST00000377819	ensembl	human	known	74_37	missense	SNP	0.998	T
