#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LINC00937	389634	genome.wustl.edu	37	12	8519353	8519353	+	lincRNA	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr12:8519353C>A	ENST00000544461.1	-	0	1081				RP11-113C12.4_ENST00000537764.1_RNA|AC092865.1_ENST00000408177.1_RNA					long intergenic non-protein coding RNA 937																		aaagtaatggcaaaaacagca	0.388																																																	0								ENSG00000221104																																			AC092865.1			0			-	Clone_based_ensembl_gene	BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8519353C>A		Somatic	0	188	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	188	8.29		RNA	SNP	23	0.00	0	57	6.56	4	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			-	-		0.388	LINC00937-001	KNOWN	basic	lincRNA	ENSG00000221104	lincRNA	OTTHUMT00000400511.1	C		-		8519353	+1	no_errors	ENST00000408177	ensembl	human	novel	74_37	rna	SNP	0.342	A
FAM120C	54954	genome.wustl.edu	37	X	54160395	54160395	+	Silent	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:54160395A>T	ENST00000375180.2	-	8	1757	c.1701T>A	c.(1699-1701)acT>acA	p.T567T	FAM120C_ENST00000328235.4_Silent_p.T567T	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	567							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						CTGAAACTCCAGTATCAACAG	0.483													A|||	4	0.0010596	0.0	0.0	3775	,	,		15482	0.0		0.0	False		,,,				2504	0.0041																0								ENSG00000184083						104.0	76.0	85.0					X																	54160395		2203	4300	6503	FAM120C	SO:0001819	synonymous_variant	0			-	HGNC	AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.1701T>A	X.37:g.54160395A>T		Somatic	0	54	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	45	29.69	B2RMT7	Silent	SNP	34	0.00	0	49	31.94	23	NULL	p.T567	ENST00000375180.2	37	c.1701	CCDS14356.1	X																																																																																			-	NULL		0.483	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	protein_coding	OTTHUMT00000056795.2	A	NM_017848	-		54160395	-1	no_errors	ENST00000375180	ensembl	human	known	74_37	silent	SNP	0.075	T
NPBWR2	2832	genome.wustl.edu	37	20	62737859	62737859	+	Missense_Mutation	SNP	T	T	G	rs535564502		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr20:62737859T>G	ENST00000369768.1	-	1	665	c.326A>C	c.(325-327)tAc>tCc	p.Y109S		NM_005286.2	NP_005277.2	P48146	NPBW2_HUMAN	neuropeptides B/W receptor 2	109					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(38;2.58e-11)|all_epithelial(29;6.4e-13)|Lung NSC(23;1.25e-09)|all_lung(23;4.21e-09)					GAAGGGCCAGTACTGCAGCAG	0.602																																																	0								ENSG00000125522						42.0	36.0	38.0					20																	62737859		2202	4300	6502	NPBWR2	SO:0001583	missense	0			-	HGNC	U22492	CCDS13557.1	20q13.3	2012-08-08	2006-02-15	2006-02-15	ENSG00000125522	ENSG00000125522		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4530	protein-coding gene	gene with protein product		600731	"""G protein-coupled receptor 8"""	GPR8		12401809	Standard	NM_005286		Approved		uc011abt.2	P48146	OTTHUMG00000033032	ENST00000369768.1:c.326A>C	20.37:g.62737859T>G	ENSP00000358783:p.Tyr109Ser	Somatic	0	59	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	37	43.94	Q6NWQ6|Q9H4K3	Missense_Mutation	SNP	16	0.00	0	24	31.43	11	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt	p.Y109S	ENST00000369768.1	37	c.326	CCDS13557.1	20	.	.	.	.	.	.	.	.	.	.	T	2.739	-0.262749	0.05754	.	.	ENSG00000125522	ENST00000369768	T	0.71103	-0.54	3.9	-0.0541	0.13815	GPCR, rhodopsin-like superfamily (1);	0.265354	0.30999	U	0.008448	T	0.54695	0.1874	L	0.35341	1.055	0.33867	D	0.634435	B	0.24317	0.101	B	0.30251	0.113	T	0.50101	-0.8867	10	0.20519	T	0.43	.	8.7538	0.34633	0.0:0.1582:0.0:0.8418	.	109	P48146	NPBW2_HUMAN	S	109	ENSP00000358783:Y109S	ENSP00000358783:Y109S	Y	-	2	0	NPBWR2	62208303	0.196000	0.23350	0.881000	0.34555	0.017000	0.09413	0.509000	0.22707	-0.353000	0.08224	-0.415000	0.06103	TAC	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY_rcpt		0.602	NPBWR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPBWR2	protein_coding	OTTHUMT00000080300.1	T	NM_005286	-		62737859	-1	no_errors	ENST00000369768	ensembl	human	known	74_37	missense	SNP	0.976	G
PMP22	5376	genome.wustl.edu	37	17	15134197	15134197	+	3'UTR	SNP	T	T	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:15134197T>C	ENST00000395938.2	-	0	714				PMP22_ENST00000395936.1_3'UTR|PMP22_ENST00000312280.3_3'UTR|PMP22_ENST00000494511.1_Missense_Mutation_p.H114R	NM_001281455.1|NM_153321.1	NP_001268384.1|NP_696996.1	Q01453	PMP22_HUMAN	peripheral myelin protein 22						cell death (GO:0008219)|peripheral nervous system development (GO:0007422)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)	8				UCEC - Uterine corpus endometrioid carcinoma (92;0.0884)|BRCA - Breast invasive adenocarcinoma(8;4.92e-06)		CCCTTCCCTATGTACGCTCAG	0.527																																																	0								ENSG00000109099						54.0	58.0	56.0					17																	15134197		2203	4300	6503	PMP22	SO:0001624	3_prime_UTR_variant	0			-	HGNC	D11428	CCDS11168.1	17p12	2014-09-17			ENSG00000109099	ENSG00000109099			9118	protein-coding gene	gene with protein product		601097				8482547, 1497668	Standard	NM_001281456		Approved	HNPP, GAS-3, Sp110	uc002goj.3	Q01453	OTTHUMG00000058960	ENST00000395938.2:c.*37A>G	17.37:g.15134197T>C		Somatic	0	26	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	34	15.00	Q8WV01	Missense_Mutation	SNP	27	0.00	0	54	27.03	20	NULL	p.H114R	ENST00000395938.2	37	c.341	CCDS11168.1	17																																																																																			-	NULL		0.527	PMP22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMP22	protein_coding	OTTHUMT00000130378.1	T	NM_000304	-		15134197	-1	no_errors	ENST00000494511	ensembl	human	novel	74_37	missense	SNP	0.000	C
TCHH	7062	genome.wustl.edu	37	1	152080272	152080272	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr1:152080272C>A	ENST00000368804.1	-	2	5420	c.5421G>T	c.(5419-5421)agG>agT	p.R1807S		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1807	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGTTCTTCCCTCTCCTGGC	0.602																																																	0								ENSG00000159450						79.0	80.0	80.0					1																	152080272		2010	4181	6191	TCHH	SO:0001583	missense	0			-	HGNC	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5421G>T	1.37:g.152080272C>A	ENSP00000357794:p.Arg1807Ser	Somatic	0	80	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	59	19.18	Q5VUI3	Missense_Mutation	SNP	26	0.00	0	36	30.77	16	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.R1807S	ENST00000368804.1	37	c.5421	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	C	9.128	1.010703	0.19277	.	.	ENSG00000159450	ENST00000368804	T	0.04603	3.59	2.88	-3.03	0.05429	.	.	.	.	.	T	0.01558	0.0050	L	0.61218	1.895	0.09310	N	1	P	0.47762	0.9	B	0.43838	0.433	T	0.37384	-0.9708	9	0.12766	T	0.61	-3.3059	4.4778	0.11752	0.0:0.2864:0.3102:0.4034	.	1807	Q07283	TRHY_HUMAN	S	1807	ENSP00000357794:R1807S	ENSP00000357794:R1807S	R	-	3	2	TCHH	150346896	0.000000	0.05858	0.002000	0.10522	0.207000	0.24258	-0.278000	0.08490	-0.702000	0.05056	-0.688000	0.03733	AGG	-	NULL		0.602	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	protein_coding	OTTHUMT00000036671.2	C	NM_007113	-		152080272	-1	no_errors	ENST00000368804	ensembl	human	known	74_37	missense	SNP	0.014	A
MYBBP1A	10514	genome.wustl.edu	37	17	4448396	4448396	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:4448396C>G	ENST00000254718.4	-	17	2541	c.2235G>C	c.(2233-2235)gaG>gaC	p.E745D	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.E745D			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	745	Glu-rich.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						cgcgctcctcctcctcgctct	0.652																																																	0								ENSG00000132382						244.0	168.0	194.0					17																	4448396		2202	4299	6501	MYBBP1A	SO:0001583	missense	0			-	HGNC	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.2235G>C	17.37:g.4448396C>G	ENSP00000254718:p.Glu745Asp	Somatic	0	56	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	61	14.08	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	20	0.00	0	27	25.00	9	pfam_DNA_pol_V,superfamily_ARM-type_fold	p.E745D	ENST00000254718.4	37	c.2235	CCDS11046.1	17	.	.	.	.	.	.	.	.	.	.	c	12.01	1.809995	0.31961	.	.	ENSG00000132382	ENST00000381556;ENST00000254718	T;T	0.54866	0.55;0.55	5.22	3.03	0.35002	Armadillo-type fold (1);	0.229026	0.43747	D	0.000538	T	0.40119	0.1104	L	0.52364	1.645	0.43499	D	0.995749	B;B	0.29671	0.064;0.254	B;B	0.32211	0.041;0.142	T	0.12941	-1.0528	10	0.17832	T	0.49	-28.3423	4.8489	0.13528	0.0:0.5688:0.2349:0.1963	.	745;745	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	D	745	ENSP00000370968:E745D;ENSP00000254718:E745D	ENSP00000254718:E745D	E	-	3	2	MYBBP1A	4395145	0.987000	0.35691	0.996000	0.52242	0.579000	0.36224	0.196000	0.17176	1.345000	0.45676	0.542000	0.68232	GAG	-	pfam_DNA_pol_V,superfamily_ARM-type_fold		0.652	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBBP1A	protein_coding	OTTHUMT00000207488.2	C	NM_014520	-		4448396	-1	no_errors	ENST00000381556	ensembl	human	known	74_37	missense	SNP	1.000	G
FAM71F1	84691	genome.wustl.edu	37	7	128356956	128356956	+	Silent	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr7:128356956C>A	ENST00000315184.5	+	2	392	c.339C>A	c.(337-339)ctC>ctA	p.L113L	FAM71F1_ENST00000469348.1_3'UTR|FAM71F1_ENST00000485070.1_Missense_Mutation_p.P35T	NM_001282788.1|NM_032599.2	NP_001269717.1|NP_115988.1	Q96KD3	F71F1_HUMAN	family with sequence similarity 71, member F1	113										NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18						GCCTGCCCCTCCCCAACATCC	0.567																																																	0								ENSG00000135248						102.0	81.0	89.0					7																	128356956		2203	4300	6503	FAM71F1	SO:0001819	synonymous_variant	0			-	HGNC	AF367470	CCDS5804.1, CCDS64763.1	7q32.1	2007-11-20	2007-11-20	2007-11-20	ENSG00000135248	ENSG00000135248			30704	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member A"""	FAM137A		12477932	Standard	XM_005250645		Approved	NYD-SP18	uc003vno.1	Q96KD3	OTTHUMG00000158276	ENST00000315184.5:c.339C>A	7.37:g.128356956C>A		Somatic	0	24	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	37	32.73	Q8IY75|Q8NA48	Missense_Mutation	SNP	22	0.00	0	40	44.44	32	pfam_DUF3699	p.P35T	ENST00000315184.5	37	c.103	CCDS5804.1	7	.	.	.	.	.	.	.	.	.	.	C	18.03	3.532617	0.64972	.	.	ENSG00000135248	ENST00000485070	T	0.27104	1.69	5.54	-2.4	0.06583	.	.	.	.	.	T	0.23886	0.0578	.	.	.	0.80722	D	1	B;B	0.29481	0.245;0.149	B;B	0.35182	0.197;0.098	T	0.16100	-1.0414	8	0.87932	D	0	-13.164	11.0674	0.47982	0.0:0.5951:0.0:0.4049	.	38;35	B4DY15;Q8NA48	.;.	T	35	ENSP00000418192:P35T	ENSP00000418192:P35T	P	+	1	0	FAM71F1	128144192	0.945000	0.32115	0.990000	0.47175	0.972000	0.66771	-0.418000	0.07080	-0.435000	0.07264	-0.469000	0.05056	CCC	-	NULL		0.567	FAM71F1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71F1	protein_coding	OTTHUMT00000350544.2	C	NM_032599	-		128356956	+1	no_errors	ENST00000485070	ensembl	human	putative	74_37	missense	SNP	0.988	A
LRP2	4036	genome.wustl.edu	37	2	170089920	170089920	+	Splice_Site	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:170089920C>A	ENST00000263816.3	-	30	5384		c.e30+1			NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2						cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	GTATCACTCACAATTTGGTTG	0.448																																																	0								ENSG00000081479						96.0	89.0	92.0					2																	170089920		2203	4300	6503	LRP2	SO:0001630	splice_region_variant	0			-	HGNC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.5098+1G>T	2.37:g.170089920C>A		Somatic	0	80	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	58	12.12	O00711|Q16215	Splice_Site	SNP	42	0.00	0	43	31.75	20	-	e30+1	ENST00000263816.3	37	c.5098+1	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	16.63	3.176084	0.57692	.	.	ENSG00000081479	ENST00000263816	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.957	0.86262	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LRP2	169798166	0.997000	0.39634	0.905000	0.35620	0.255000	0.26057	3.712000	0.54875	2.526000	0.85167	0.650000	0.86243	.	-	-		0.448	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	C	NM_004525	-	Intron	170089920	-1	no_errors	ENST00000263816	ensembl	human	known	74_37	splice_site	SNP	0.966	A
DYTN	391475	genome.wustl.edu	37	2	207564924	207564924	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:207564924C>T	ENST00000452335.2	-	6	616	c.500G>A	c.(499-501)gGa>gAa	p.G167E	Y_RNA_ENST00000384589.1_RNA|DYTN_ENST00000477734.1_5'UTR	NM_001093730.1	NP_001087199.1	A2CJ06	DYTN_HUMAN	dystrotelin	167						plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(24)|ovary(1)|upper_aerodigestive_tract(1)	36				LUSC - Lung squamous cell carcinoma(261;0.082)|Epithelial(149;0.129)|Lung(261;0.153)		ACGACTCTCTCCCACGAAAGT	0.562																																																	0								ENSG00000232125						100.0	101.0	101.0					2																	207564924		1951	4152	6103	DYTN	SO:0001583	missense	0			-	HGNC	ABF55377	CCDS46502.1	2q33.3	2007-01-22			ENSG00000232125	ENSG00000232125			23279	protein-coding gene	gene with protein product						17233888	Standard	NM_001093730		Approved		uc002vbr.1	A2CJ06	OTTHUMG00000154729	ENST00000452335.2:c.500G>A	2.37:g.207564924C>T	ENSP00000396593:p.Gly167Glu	Somatic	0	23	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29		Missense_Mutation	SNP	33	0.00	0	29	46.30	25	pfam_EF-hand_dom_typ2,pfam_EF-hand_dom_typ1,pfam_Znf_ZZ,smart_Znf_ZZ,pfscan_Znf_ZZ	p.G167E	ENST00000452335.2	37	c.500	CCDS46502.1	2	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715012	0.89112	.	.	ENSG00000232125	ENST00000452335	T	0.74632	-0.86	6.04	6.04	0.98038	EF-hand domain, type 2 (1);	.	.	.	.	D	0.87501	0.6193	M	0.81614	2.55	0.41605	D	0.98887	D	0.89917	1.0	D	0.97110	1.0	D	0.88036	0.2778	9	0.72032	D	0.01	-11.7199	18.7597	0.91845	0.0:1.0:0.0:0.0	.	167	A2CJ06	DYTN_HUMAN	E	167	ENSP00000396593:G167E	ENSP00000396593:G167E	G	-	2	0	DYTN	207273169	0.890000	0.30428	0.544000	0.28141	0.988000	0.76386	3.784000	0.55416	2.873000	0.98535	0.561000	0.74099	GGA	-	pfam_EF-hand_dom_typ2		0.562	DYTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYTN	protein_coding	OTTHUMT00000336799.1	C		-		207564924	-1	no_errors	ENST00000452335	ensembl	human	known	74_37	missense	SNP	0.959	T
CACNA1G	8913	genome.wustl.edu	37	17	48703577	48703577	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:48703577C>A	ENST00000359106.5	+	38	6599	c.6599C>A	c.(6598-6600)cCa>cAa	p.P2200Q	CACNA1G_ENST00000515765.1_Missense_Mutation_p.P2144Q|CACNA1G_ENST00000507896.1_Intron|CACNA1G_ENST00000514079.1_Missense_Mutation_p.P2114Q|CACNA1G_ENST00000507336.1_Missense_Mutation_p.P2189Q|CTB-22K21.2_ENST00000502435.1_RNA|CACNA1G_ENST00000503485.1_Missense_Mutation_p.P2073Q|CACNA1G_ENST00000515411.1_Missense_Mutation_p.P2137Q|CACNA1G_ENST00000354983.4_Missense_Mutation_p.P2166Q|CACNA1G_ENST00000360761.4_Missense_Mutation_p.P2084Q|CACNA1G_ENST00000358244.5_Intron|CACNA1G_ENST00000510115.1_Missense_Mutation_p.P2121Q|CACNA1G_ENST00000514181.1_Missense_Mutation_p.P2082Q|CACNA1G_ENST00000429973.2_Missense_Mutation_p.P2089Q|CACNA1G_ENST00000352832.5_Missense_Mutation_p.P2073Q|CACNA1G_ENST00000512389.1_Missense_Mutation_p.P2096Q|CACNA1G_ENST00000515165.1_Missense_Mutation_p.P2107Q|CACNA1G_ENST00000513689.2_Missense_Mutation_p.P2110Q|CACNA1G_ENST00000510366.1_Missense_Mutation_p.P2055Q|CACNA1G_ENST00000442258.2_Missense_Mutation_p.P2066Q|CACNA1G_ENST00000513964.1_Missense_Mutation_p.P2062Q|CACNA1G_ENST00000505165.1_Intron|CACNA1G_ENST00000514717.1_Missense_Mutation_p.P2050Q|CACNA1G_ENST00000502264.1_Missense_Mutation_p.P2129Q|CACNA1G_ENST00000507510.2_Missense_Mutation_p.P2155Q|CACNA1G_ENST00000507609.1_Missense_Mutation_p.P2100Q	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	2200					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TGCCCAGGCCCAGAACCCAAC	0.627											OREG0024569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000006283						34.0	43.0	40.0					17																	48703577		2065	4206	6271	CACNA1G	SO:0001583	missense	0			-	HGNC	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.6599C>A	17.37:g.48703577C>A	ENSP00000352011:p.Pro2200Gln	Somatic	0	75	0.00	956	0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	85	16.67	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	21	0.00	0	42	23.64	13	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.P2200Q	ENST00000359106.5	37	c.6599	CCDS45730.1	17	.	.	.	.	.	.	.	.	.	.	c	0.013	-1.626266	0.00813	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000359106;ENST00000429973;ENST00000515411	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96619	-3.94;-3.94;-3.91;-3.95;-4.0;-3.95;-4.07;-4.04;-4.05;-4.06;-3.97;-3.93;-4.04;-3.92;-3.94;-3.95;-3.93;-3.96;-3.97;-3.94;-3.97;-3.95	5.32	-2.4	0.06583	.	0.872822	0.10014	N	0.726827	D	0.89287	0.6672	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.26635	0.07;0.001;0.155;0.155;0.042;0.075;0.155;0.075;0.155;0.039;0.042;0.041;0.155;0.0;0.023;0.068;0.042;0.012;0.07;0.023;0.041;0.001	B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.39531	0.079;0.007;0.302;0.302;0.082;0.177;0.302;0.221;0.302;0.056;0.102;0.043;0.247;0.001;0.147;0.165;0.025;0.063;0.079;0.056;0.058;0.002	T	0.82319	-0.0516	10	0.22706	T	0.39	.	2.2455	0.04030	0.1318:0.2411:0.1304:0.4967	.	2050;2062;2055;2137;2110;2082;2114;2073;2100;2129;2096;2189;2089;2144;2107;2177;2155;2073;2066;2121;2084;2200	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN	Q	2084;2073;2166;2066;2129;2096;2062;2050;2055;2073;2155;2189;2110;2100;2121;2107;2082;2144;2114;2200;2089;2137	ENSP00000353990:P2084Q;ENSP00000339302:P2073Q;ENSP00000347078:P2166Q;ENSP00000409759:P2066Q;ENSP00000425522:P2129Q;ENSP00000426261:P2096Q;ENSP00000425451:P2062Q;ENSP00000422407:P2050Q;ENSP00000426814:P2055Q;ENSP00000427238:P2073Q;ENSP00000423112:P2155Q;ENSP00000420918:P2189Q;ENSP00000426172:P2110Q;ENSP00000423045:P2100Q;ENSP00000427173:P2121Q;ENSP00000426098:P2107Q;ENSP00000425698:P2082Q;ENSP00000426232:P2144Q;ENSP00000423317:P2114Q;ENSP00000352011:P2200Q;ENSP00000414388:P2089Q;ENSP00000423155:P2137Q	ENSP00000339302:P2073Q	P	+	2	0	CACNA1G	46058576	0.032000	0.19561	0.012000	0.15200	0.043000	0.13939	0.289000	0.18957	-0.308000	0.08792	0.462000	0.41574	CCA	-	NULL		0.627	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	protein_coding	OTTHUMT00000367895.1	C	NM_018896	-		48703577	+1	no_errors	ENST00000359106	ensembl	human	known	74_37	missense	SNP	0.001	A
TCEB3CL	728929	genome.wustl.edu	37	18	44549187	44549187	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr18:44549187G>A	ENST00000451265.1	-	1	1347	c.1112C>T	c.(1111-1113)aCg>aTg	p.T371M	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron	NM_001100817.1	NP_001094287.1	Q3SY89	EA3L1_HUMAN	transcription elongation factor B polypeptide 3C-like	371	Activation domain. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T371M(1)		central_nervous_system(1)|lung(1)|prostate(1)	3						CTGATCGGGCGTCCACCCTTC	0.587																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000234298						260.0	221.0	234.0					18																	44549187		1740	3470	5210	TCEB3CL	SO:0001583	missense	0			-	HGNC			18q21.1	2007-07-10				ENSG00000275553			31007	protein-coding gene	gene with protein product							Standard	NM_001100817		Approved	HsT828		Q3SY89		ENST00000451265.1:c.1112C>T	18.37:g.44549187G>A	ENSP00000409932:p.Thr371Met	Somatic	0	160	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	115	9.45	Q3MI93	Missense_Mutation	SNP	63	0.00	0	138	8.61	13	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.T371M	ENST00000451265.1	37	c.1112	CCDS42433.1	18	.	.	.	.	.	.	.	.	.	.	G	12.62	1.991850	0.35131	.	.	ENSG00000234298	ENST00000451265	T	0.34859	1.34	1.5	0.603	0.17541	.	0.000000	0.52532	D	0.000078	T	0.47021	0.1423	M	0.63843	1.955	0.25300	N	0.989283	D	0.71674	0.998	P	0.61874	0.895	T	0.30357	-0.9981	10	0.56958	D	0.05	-24.5205	7.7008	0.28621	0.0:0.2651:0.7349:0.0	.	371	Q3SY89	EA3L1_HUMAN	M	371	ENSP00000409932:T371M	ENSP00000409932:T371M	T	-	2	0	TCEB3CL	42803185	0.992000	0.36948	0.000000	0.03702	0.000000	0.00434	2.511000	0.45476	0.221000	0.20879	-0.232000	0.12228	ACG	-	pfam_RNA_pol_II_trans_fac_SIII_A		0.587	TCEB3CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3CL	protein_coding	OTTHUMT00000451071.1	G	XM_001132059	-		44549187	-1	no_errors	ENST00000451265	ensembl	human	known	74_37	missense	SNP	0.212	A
HERC2	8924	genome.wustl.edu	37	15	28380807	28380807	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr15:28380807C>T	ENST00000261609.7	-	79	12155	c.12047G>A	c.(12046-12048)aGa>aAa	p.R4016K		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AATGCCTAGTCTGCCACCTGC	0.408																																																	0								ENSG00000128731						66.0	61.0	62.0					15																	28380807		2203	4300	6503	HERC2	SO:0001583	missense	0			-	HGNC	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.12047G>A	15.37:g.28380807C>T	ENSP00000261609:p.Arg4016Lys	Somatic	0	22	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	29	17.14		Missense_Mutation	SNP	34	0.00	0	42	20.75	11	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.R4016K	ENST00000261609.7	37	c.12047	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.461719	0.96240	.	.	ENSG00000128731	ENST00000261609	D	0.85484	-1.99	5.36	5.36	0.76844	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.90003	0.6879	M	0.76838	2.35	0.58432	D	0.999997	P	0.38280	0.625	P	0.47346	0.544	D	0.90460	0.4445	10	0.66056	D	0.02	.	19.4526	0.94873	0.0:1.0:0.0:0.0	.	4016	O95714	HERC2_HUMAN	K	4016	ENSP00000261609:R4016K	ENSP00000261609:R4016K	R	-	2	0	HERC2	26054402	0.982000	0.34865	0.989000	0.46669	0.996000	0.88848	7.762000	0.85270	2.670000	0.90874	0.563000	0.77884	AGA	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens		0.408	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	protein_coding	OTTHUMT00000251358.2	C	NM_004667	-		28380807	-1	no_errors	ENST00000261609	ensembl	human	known	74_37	missense	SNP	1.000	T
WIPF1	7456	genome.wustl.edu	37	2	175436734	175436734	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:175436734G>T	ENST00000392547.2	-	5	898	c.799C>A	c.(799-801)Cca>Aca	p.P267T	WIPF1_ENST00000409415.3_Missense_Mutation_p.P267T|WIPF1_ENST00000392546.2_Missense_Mutation_p.P267T|WIPF1_ENST00000467149.1_5'Flank|WIPF1_ENST00000409891.1_Missense_Mutation_p.P267T|AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000359761.3_Missense_Mutation_p.P267T|WIPF1_ENST00000272746.5_Missense_Mutation_p.P267T|AC018890.6_ENST00000442996.1_RNA	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	267	Pro-rich.				actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)			NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						GGAGGAGGTGGTGGAGGGGGT	0.652																																																	0								ENSG00000115935						21.0	22.0	22.0					2																	175436734		2202	4300	6502	WIPF1	SO:0001583	missense	0			-	HGNC	AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.799C>A	2.37:g.175436734G>T	ENSP00000376330:p.Pro267Thr	Somatic	0	45	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	40	18.37	B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	22	0.00	0	24	25.00	8	smart_WH2_dom,pfscan_WH2_dom	p.P267T	ENST00000392547.2	37	c.799	CCDS2260.1	2	.	.	.	.	.	.	.	.	.	.	G	12.54	1.967993	0.34754	.	.	ENSG00000115935	ENST00000392547;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891;ENST00000409415	T;T;T;T;T;T	0.57595	1.33;1.26;1.33;1.33;0.64;0.39	4.5	4.5	0.54988	.	0.261192	0.38164	N	0.001794	T	0.68238	0.2979	L	0.56769	1.78	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.998;0.997	D;D;D;D	0.68943	0.961;0.922;0.961;0.915	T	0.71600	-0.4544	10	0.56958	D	0.05	.	16.7885	0.85580	0.0:0.0:1.0:0.0	.	267;267;267;267	O43516-3;E9PB87;O43516-2;O43516	.;.;.;WIPF1_HUMAN	T	267	ENSP00000376330:P267T;ENSP00000272746:P267T;ENSP00000352802:P267T;ENSP00000376329:P267T;ENSP00000386431:P267T;ENSP00000387150:P267T	ENSP00000272746:P267T	P	-	1	0	WIPF1	175144980	0.997000	0.39634	0.060000	0.19600	0.022000	0.10575	2.942000	0.49018	2.050000	0.60909	0.436000	0.28706	CCA	-	NULL		0.652	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIPF1	protein_coding	OTTHUMT00000255453.1	G	NM_003387	-		175436734	-1	no_errors	ENST00000272746	ensembl	human	known	74_37	missense	SNP	0.764	T
SP140	11262	genome.wustl.edu	37	2	231152614	231152614	+	Silent	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:231152614G>A	ENST00000392045.3	+	18	1767	c.1653G>A	c.(1651-1653)aaG>aaA	p.K551K	SP140_ENST00000417495.3_Silent_p.K437K|SP140_ENST00000343805.6_Silent_p.K491K|SP140_ENST00000420434.3_Silent_p.K524K|SP140_ENST00000350136.5_Silent_p.K420K|SP140_ENST00000486687.2_Silent_p.K475K	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	551					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		CAGGGAGAAAGAGAGGCAAAC	0.358																																																	0								ENSG00000079263						48.0	46.0	47.0					2																	231152614		1812	4086	5898	SP140	SO:0001819	synonymous_variant	0			-	HGNC	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.1653G>A	2.37:g.231152614G>A		Somatic	0	27	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	22	40.54	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Silent	SNP	39	0.00	0	28	50.88	29	pfam_Sp100,pfam_SAND_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_SAND_dom-like,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_SAND_dom,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_SAND_dom,pfscan_Bromodomain	p.K551	ENST00000392045.3	37	c.1653	CCDS42831.1	2																																																																																			-	NULL		0.358	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SP140	protein_coding	OTTHUMT00000332015.1	G	NM_007237	-		231152614	+1	no_errors	ENST00000392045	ensembl	human	known	74_37	silent	SNP	0.004	A
BET1	10282	genome.wustl.edu	37	7	93605309	93605309	+	5'UTR	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr7:93605309C>T	ENST00000471446.1	-	0	160				AC006378.2_ENST00000426193.2_RNA|AC006378.2_ENST00000426634.1_RNA			O15155	BET1_HUMAN	Bet1 golgi vesicular membrane trafficking protein						ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)|vesicle fusion with Golgi apparatus (GO:0048280)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				large_intestine(2)|lung(1)|prostate(1)|skin(1)	5	all_cancers(62;2.22e-10)|all_epithelial(64;1.38e-09)|Lung NSC(181;0.218)	Breast(660;0.000162)|Ovarian(593;0.000626)	STAD - Stomach adenocarcinoma(171;0.000967)			TGAAAGTAAGCCTCCTTCTTT	0.398																																																	0								ENSG00000105829																																			BET1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF007551	CCDS5635.1	7q21.1-q22	2013-03-08	2013-03-08		ENSG00000105829	ENSG00000105829			14562	protein-coding gene	gene with protein product	"""Golgi vesicular membrane trafficking protein p18"", ""Bet1p homolog"""	605456	"""Bet1 (S. cerevisiae) homolog"", ""BET1 homolog (S. cerevisiae)"", ""blocked early in transport 1 homolog (S. cerevisiae)"""			9382863, 10449330	Standard	XM_005250109		Approved	hbet1	uc003unf.1	O15155	OTTHUMG00000023487	ENST00000471446.1:c.-375G>A	7.37:g.93605309C>T		Somatic	0	38	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	43	36.76	Q96EA0	Silent	SNP	31	0.00	0	45	45.78	38	pfam_T_SNARE_dom,pfscan_T_SNARE_dom	p.R113	ENST00000471446.1	37	c.339		7																																																																																			-	NULL		0.398	BET1-006	KNOWN	basic	processed_transcript	BET1	protein_coding	OTTHUMT00000341560.1	C	NM_005868	-		93605309	-1	no_errors	ENST00000357520	ensembl	human	known	74_37	silent	SNP	0.002	T
SYMPK	8189	genome.wustl.edu	37	19	46351034	46351034	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr19:46351034G>A	ENST00000245934.7	-	7	896	c.652C>T	c.(652-654)Cgt>Tgt	p.R218C		NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	218					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		GGGTGGTCACGAGGGATGCGG	0.602																																																	0								ENSG00000125755						104.0	88.0	93.0					19																	46351034		2203	4300	6503	SYMPK	SO:0001583	missense	0			-	HGNC	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.652C>T	19.37:g.46351034G>A	ENSP00000245934:p.Arg218Cys	Somatic	0	42	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	38	25.49	O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	24	0.00	0	33	25.00	11	pfam_DUF3453,pfam_Symplekin_C,superfamily_ARM-type_fold	p.R218C	ENST00000245934.7	37	c.652	CCDS12676.2	19	.	.	.	.	.	.	.	.	.	.	G	16.44	3.125217	0.56721	.	.	ENSG00000125755	ENST00000245934	T	0.33865	1.39	5.5	5.5	0.81552	Armadillo-type fold (1);	0.438355	0.24940	N	0.034393	T	0.37376	0.1001	L	0.43923	1.385	0.47737	D	0.999505	D;P	0.60575	0.988;0.717	P;B	0.49012	0.598;0.206	T	0.08848	-1.0702	10	0.54805	T	0.06	.	10.176	0.42939	0.0874:0.0:0.9126:0.0	.	233;218	Q4LE61;Q92797	.;SYMPK_HUMAN	C	218	ENSP00000245934:R218C	ENSP00000245934:R218C	R	-	1	0	SYMPK	51042874	0.712000	0.27916	0.995000	0.50966	0.989000	0.77384	2.577000	0.46042	2.854000	0.98071	0.655000	0.94253	CGT	-	pfam_DUF3453,superfamily_ARM-type_fold		0.602	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYMPK	protein_coding	OTTHUMT00000316581.1	G	NM_004819	-		46351034	-1	no_errors	ENST00000245934	ensembl	human	known	74_37	missense	SNP	0.963	A
KLHDC7B	113730	genome.wustl.edu	37	22	50986016	50986016	+	5'Flank	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr22:50986016T>A	ENST00000395676.2	+	0	0				CTA-384D8.31_ENST00000434237.1_RNA	NM_138433.3	NP_612442.2	Q96G42	KLD7B_HUMAN	kelch domain containing 7B											central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	14		all_cancers(38;1.53e-10)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		OV - Ovarian serous cystadenocarcinoma(4;7.49e-69)|all cancers(3;9.79e-66)|Epithelial(4;1.3e-63)|GBM - Glioblastoma multiforme(4;0.000399)|Lung(4;0.125)|BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCTGGAGGTTACCCAGGATC	0.652																																																	0								ENSG00000226738																																			CTA-384D8.31	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	BC009980	CCDS14097.2	22q13.33	2006-11-29		2005-12-13	ENSG00000130487	ENSG00000130487			25145	protein-coding gene	gene with protein product							Standard	NM_138433		Approved	MGC16635	uc003bmi.3	Q96G42	OTTHUMG00000150250		22.37:g.50986016T>A	Exception_encountered	Somatic	0	31	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00		RNA	SNP	21	0.00	0	31	20.51	8	-	NULL	ENST00000395676.2	37	NULL	CCDS14097.2	22																																																																																			-	-		0.652	KLHDC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000226738	protein_coding	OTTHUMT00000317089.2	T	NM_138433	-		50986016	+1	no_errors	ENST00000434237	ensembl	human	known	74_37	rna	SNP	0.010	A
USP6	9098	genome.wustl.edu	37	17	5041559	5041559	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:5041559C>T	ENST00000574788.1	+	21	3299	c.1069C>T	c.(1069-1071)Cca>Tca	p.P357S	USP6_ENST00000332776.4_Missense_Mutation_p.P357S|USP6_ENST00000250066.6_Missense_Mutation_p.P357S|USP6_ENST00000304328.5_5'UTR			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	357					cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						AGGGGACCTGCCACCCCCAGG	0.597			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0								ENSG00000129204						108.0	114.0	112.0					17																	5041559		2203	4300	6503	USP6	SO:0001583	missense	0			-	HGNC	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.1069C>T	17.37:g.5041559C>T	ENSP00000460380:p.Pro357Ser	Somatic	0	171	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	171	12.31	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	23	0.00	0	53	17.19	11	pfam_Peptidase_C19/C67,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Peptidase_C19/C67	p.P357S	ENST00000574788.1	37	c.1069	CCDS11069.2	17	.	.	.	.	.	.	.	.	.	.	C	18.03	3.533169	0.64972	.	.	ENSG00000129204	ENST00000332776;ENST00000250066	T;T	0.15017	2.46;2.93	0.862	0.862	0.19056	.	0.151754	0.56097	D	0.000021	T	0.26521	0.0648	L	0.60957	1.885	0.80722	D	1	D	0.57571	0.98	P	0.59424	0.857	T	0.02004	-1.1231	10	0.72032	D	0.01	.	5.4	0.16291	0.0:1.0:0.0:0.0	.	357	P35125	UBP6_HUMAN	S	357	ENSP00000328010:P357S;ENSP00000250066:P357S	ENSP00000250066:P357S	P	+	1	0	USP6	4982283	0.891000	0.30450	0.536000	0.28039	0.541000	0.35023	1.855000	0.39378	0.132000	0.18615	0.134000	0.15878	CCA	-	NULL		0.597	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	protein_coding	OTTHUMT00000438990.1	C	NM_004505	-		5041559	+1	no_errors	ENST00000250066	ensembl	human	known	74_37	missense	SNP	1.000	T
HSPG2	3339	genome.wustl.edu	37	1	22203080	22203080	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr1:22203080G>T	ENST00000374695.3	-	22	2830	c.2751C>A	c.(2749-2751)aaC>aaA	p.N917K		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	917	Laminin EGF-like 4; truncated. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	AGCCATCGGGGTTTCGGGTAC	0.597																																																	0								ENSG00000142798						106.0	81.0	89.0					1																	22203080		2203	4300	6503	HSPG2	SO:0001583	missense	0			-	HGNC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.2751C>A	1.37:g.22203080G>T	ENSP00000363827:p.Asn917Lys	Somatic	0	56	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	28	0.00	0	18	0.00	0	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA_dom,pfscan_Ig-like_dom,prints_LDrepeatLR_classA_rpt	p.N917K	ENST00000374695.3	37	c.2751	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	G	14.18	2.459950	0.43736	.	.	ENSG00000142798	ENST00000374695	T	0.63417	-0.04	4.92	2.98	0.34508	EGF-like, laminin (3);	0.000000	0.42294	D	0.000738	T	0.81408	0.4816	M	0.93507	3.425	0.48511	D	0.999663	D	0.76494	0.999	D	0.83275	0.996	T	0.82942	-0.0207	10	0.72032	D	0.01	.	8.7603	0.34669	0.0874:0.1509:0.7617:0.0	.	917	P98160	PGBM_HUMAN	K	917	ENSP00000363827:N917K	ENSP00000363827:N917K	N	-	3	2	HSPG2	22075667	0.999000	0.42202	0.947000	0.38551	0.128000	0.20619	2.040000	0.41203	1.051000	0.40369	-0.305000	0.09177	AAC	-	pfam_EGF_laminin,smart_EGF_laminin		0.597	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	protein_coding	OTTHUMT00000007598.1	G	NM_005529	-		22203080	-1	no_errors	ENST00000374695	ensembl	human	known	74_37	missense	SNP	1.000	T
SCN9A	6335	genome.wustl.edu	37	2	167159809	167159809	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:167159809A>G	ENST00000409435.1	-	6	691	c.692T>C	c.(691-693)cTg>cCg	p.L231P	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.L232P|SCN9A_ENST00000409672.1_Missense_Mutation_p.L231P|SCN9A_ENST00000375387.4_Missense_Mutation_p.L232P			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	231					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AATTGTCTTCAGGCCTGAAAA	0.383																																																	0								ENSG00000169432						67.0	66.0	67.0					2																	167159809		2195	4298	6493	SCN9A	SO:0001583	missense	0			-	HGNC	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.692T>C	2.37:g.167159809A>G	ENSP00000386330:p.Leu231Pro	Somatic	0	28	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	28	0.00	0	36	21.74	10	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.L232P	ENST00000409435.1	37	c.695	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	A	25.0	4.593738	0.86953	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.99150	-5.49;-5.49;-5.49;-5.49;-5.49;-5.49	5.96	5.96	0.96718	Ion transport (1);	0.000000	0.48767	D	0.000172	D	0.99691	0.9883	H	0.99675	4.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.99;0.999;0.999	D	0.97039	0.9756	10	0.87932	D	0	.	16.4282	0.83831	1.0:0.0:0.0:0.0	.	231;231;232	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	P	231;232;232;231;96;96	ENSP00000386306:L231P;ENSP00000364536:L232P;ENSP00000304748:L232P;ENSP00000386330:L231P;ENSP00000413212:L96P;ENSP00000393141:L96P	ENSP00000304748:L232P	L	-	2	0	SCN9A	166868055	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.335000	0.96500	2.274000	0.75844	0.477000	0.44152	CTG	-	pfam_Ion_trans_dom		0.383	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	protein_coding	OTTHUMT00000333639.1	A	NM_002977	-		167159809	-1	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	SNP	1.000	G
FRG1B	284802	genome.wustl.edu	37	20	29624093	29624093	+	Splice_Site	SNP	G	G	T	rs75468660		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr20:29624093G>T	ENST00000278882.3	+	4	496		c.e4+1		FRG1B_ENST00000439954.2_Splice_Site|FRG1B_ENST00000358464.4_Splice_Site			Q9BZ01	FRG1B_HUMAN	FSHD region gene 1 family, member B									p.?(6)		endometrium(10)|kidney(21)|lung(3)|pancreas(1)|prostate(9)|urinary_tract(9)	53						CTGATTCCAGGTGAGCTTATG	0.299																																																	6	Unknown(6)	kidney(4)|prostate(2)						ENSG00000149531																																			FRG1B	SO:0001630	splice_region_variant	0			-	HGNC			20q11.1	2013-03-18	2007-10-11	2007-10-11	ENSG00000149531	ENSG00000149531			15792	other	unknown			"""chromosome 20 open reading frame 80"""	C20orf80			Standard	NR_003579		Approved	bA348I14.2	uc010ztl.1	Q9BZ01	OTTHUMG00000032157	ENST00000278882.3:c.116+1G>T	20.37:g.29624093G>T		Somatic	0	52	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	57	12.31	C4AME5	Splice_Site	SNP	53	8.62	5	89	11.76	12	-	e2+1	ENST00000278882.3	37	c.116+1		20	.	.	.	.	.	.	.	.	.	.	.	11.58	1.679853	0.29783	.	.	ENSG00000149531	ENST00000278882;ENST00000439954;ENST00000358464	.	.	.	1.91	1.91	0.25777	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8627	0.41125	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FRG1B	28237754	1.000000	0.71417	0.991000	0.47740	0.586000	0.36452	7.759000	0.85235	1.383000	0.46405	0.184000	0.17185	.	-	-		0.299	FRG1B-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FRG1B	protein_coding	OTTHUMT00000078494.2	G	NR_003579	rs75468660	Intron	29624093	+1	no_errors	ENST00000278882	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ADCY2	108	genome.wustl.edu	37	5	7820784	7820784	+	Silent	SNP	A	A	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:7820784A>C	ENST00000338316.4	+	24	3194	c.3105A>C	c.(3103-3105)ggA>ggC	p.G1035G	ADCY2_ENST00000537121.1_Silent_p.G855G	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	1035					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						ACAGCACCGGAGTCCTGGACA	0.473																																																	0								ENSG00000078295						130.0	118.0	122.0					5																	7820784		2203	4300	6503	ADCY2	SO:0001819	synonymous_variant	0			-	HGNC	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.3105A>C	5.37:g.7820784A>C		Somatic	0	47	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	28	26.32	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	20	0.00	0	35	20.45	9	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.G1035	ENST00000338316.4	37	c.3105	CCDS3872.2	5																																																																																			-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase		0.473	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	protein_coding	OTTHUMT00000206930.2	A	NM_020546	-		7820784	+1	no_errors	ENST00000338316	ensembl	human	known	74_37	silent	SNP	0.741	C
FABP5P3	220832	genome.wustl.edu	37	7	152140121	152140121	+	RNA	DEL	T	T	-			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr7:152140121delT	ENST00000477993.1	+	0	876					NR_002935.1		A8MUU1	FB5L3_HUMAN	fatty acid binding protein 5 pseudogene 3								lipid binding (GO:0008289)|transporter activity (GO:0005215)										TGTTTCTTTCTTTTTTTTTTC	0.328																																																	0								ENSG00000241735																																			FABP5P3			0				HGNC			7q36.1	2010-10-12	2010-10-12	2010-10-12	ENSG00000241735	ENSG00000241735			22573	pseudogene	pseudogene			"""fatty acid binding protein 5-like 3"", ""fatty acid binding protein 5-like 3 (pseudogene)"""	FABP5L3			Standard	NR_002935		Approved	TCAG_1781704	uc003wlb.3	A8MUU1	OTTHUMG00000157257		7.37:g.152140121delT		Somatic	0	13	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43		RNA	DEL	30	0.00	0	86	0.00	0	-	NULL	ENST00000477993.1	37	NULL		7																																																																																			-	-		0.328	FABP5P3-001	KNOWN	basic	processed_transcript	FABP5P3	pseudogene	OTTHUMT00000348208.1	T	NR_002935			152140121	+1	no_errors	ENST00000477993	ensembl	human	known	74_37	rna	DEL	0.764	-
BIRC6	57448	genome.wustl.edu	37	2	32605333	32605333	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:32605333C>T	ENST00000421745.2	+	3	754	c.620C>T	c.(619-621)aCt>aTt	p.T207I	BIRC6-AS1_ENST00000455572.1_RNA	NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	207					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					TCTCATGAGACTGCAGCAAAC	0.358																																					Pancreas(94;175 1509 16028 18060 45422)												0								ENSG00000115760						59.0	58.0	58.0					2																	32605333		2203	4300	6503	BIRC6	SO:0001583	missense	0			-	HGNC	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.620C>T	2.37:g.32605333C>T	ENSP00000393596:p.Thr207Ile	Somatic	0	28	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	Q9ULD1	Missense_Mutation	SNP	50	0.00	0	52	14.75	9	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.T207I	ENST00000421745.2	37	c.620	CCDS33175.2	2	.	.	.	.	.	.	.	.	.	.	C	31	5.085610	0.94100	.	.	ENSG00000115760	ENST00000421745	T	0.75260	-0.92	5.26	5.26	0.73747	.	0.057720	0.64402	D	0.000002	T	0.77089	0.4079	L	0.29908	0.895	0.80722	D	1	D	0.65815	0.995	P	0.56278	0.795	T	0.79933	-0.1594	10	0.66056	D	0.02	.	18.8712	0.92315	0.0:1.0:0.0:0.0	.	207	Q9NR09	BIRC6_HUMAN	I	207	ENSP00000393596:T207I	ENSP00000393596:T207I	T	+	2	0	BIRC6	32458837	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.770000	0.85390	2.451000	0.82905	0.563000	0.77884	ACT	-	superfamily_WD40_repeat_dom		0.358	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	protein_coding	OTTHUMT00000318769.3	C	NM_016252	-		32605333	+1	no_errors	ENST00000421745	ensembl	human	known	74_37	missense	SNP	1.000	T
CPSF1	29894	genome.wustl.edu	37	8	145621845	145621845	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr8:145621845G>A	ENST00000349769.3	-	25	2888	c.2794C>T	c.(2794-2796)Cgc>Tgc	p.R932C	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	932					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			TCGAAGTAGCGGAAACGCGCC	0.612																																					NSCLC(133;1088 1848 27708 34777 35269)												0								ENSG00000071894						53.0	68.0	63.0					8																	145621845		2202	4298	6500	CPSF1	SO:0001583	missense	0			-	HGNC	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2794C>T	8.37:g.145621845G>A	ENSP00000339353:p.Arg932Cys	Somatic	0	24	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	5	75.00	Q96AF0	Missense_Mutation	SNP	27	0.00	0	14	71.43	35	pfam_Cleavage/polyA-sp_fac_asu_C	p.R932C	ENST00000349769.3	37	c.2794	CCDS34966.1	8	.	.	.	.	.	.	.	.	.	.	g	22.7	4.329124	0.81690	.	.	ENSG00000071894	ENST00000349769	T	0.51071	0.72	5.41	5.41	0.78517	.	0.061993	0.64402	N	0.000005	T	0.67420	0.2891	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.69479	0.964	T	0.70718	-0.4795	10	0.72032	D	0.01	-3.5553	14.7178	0.69284	0.0:0.0:1.0:0.0	.	932	Q10570	CPSF1_HUMAN	C	932	ENSP00000339353:R932C	ENSP00000339353:R932C	R	-	1	0	CPSF1	145592653	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	3.731000	0.55013	2.555000	0.86185	0.479000	0.44913	CGC	-	NULL		0.612	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	protein_coding	OTTHUMT00000382422.2	G	NM_013291	-		145621845	-1	no_errors	ENST00000349769	ensembl	human	known	74_37	missense	SNP	1.000	A
GLE1	2733	genome.wustl.edu	37	9	131296042	131296042	+	Silent	SNP	A	A	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr9:131296042A>G	ENST00000309971.4	+	11	1564	c.1458A>G	c.(1456-1458)aaA>aaG	p.K486K	RP11-216B9.6_ENST00000434999.1_RNA|GLE1_ENST00000372770.4_Silent_p.K486K|GLE1_ENST00000539582.1_Silent_p.K232K	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	486					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						GTTCTCAGAAACAAGGCGAGG	0.507																																																	0								ENSG00000119392						92.0	97.0	95.0					9																	131296042		2203	4300	6503	GLE1	SO:0001819	synonymous_variant	0			-	HGNC	AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.1458A>G	9.37:g.131296042A>G		Somatic	0	62	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	59	9.23	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Silent	SNP	29	0.00	0	61	8.96	6	pfam_GLE1	p.K486	ENST00000309971.4	37	c.1458	CCDS35154.1	9																																																																																			-	pfam_GLE1		0.507	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLE1	protein_coding	OTTHUMT00000054456.1	A	NM_001003722	-		131296042	+1	no_errors	ENST00000309971	ensembl	human	known	74_37	silent	SNP	1.000	G
P2RX3	5024	genome.wustl.edu	37	11	57135558	57135558	+	Silent	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr11:57135558C>T	ENST00000263314.2	+	9	952	c.918C>T	c.(916-918)gaC>gaT	p.D306D		NM_002559.3	NP_002550.2	P56373	P2RX3_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 3	306					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|regulation of synaptic plasticity (GO:0048167)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to cold (GO:0009409)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)|transport (GO:0006810)|urinary bladder smooth muscle contraction (GO:0014832)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|extracellular ATP-gated cation channel activity (GO:0004931)|purinergic nucleotide receptor activity (GO:0001614)			endometrium(4)|kidney(2)|large_intestine(4)|lung(15)|prostate(1)	26						TCCGCTTCGACGTGCTGGTAT	0.567																																																	0								ENSG00000109991						84.0	80.0	81.0					11																	57135558		2201	4296	6497	P2RX3	SO:0001819	synonymous_variant	0			-	HGNC	Y07683	CCDS7953.1	11q12	2012-01-17			ENSG00000109991	ENSG00000109991		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8534	protein-coding gene	gene with protein product		600843				9221902	Standard	NM_002559		Approved	P2X3	uc001nju.3	P56373	OTTHUMG00000167025	ENST00000263314.2:c.918C>T	11.37:g.57135558C>T		Somatic	0	35	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	16	42.86	Q6DK37|Q9UQB6	Silent	SNP	36	0.00	0	29	46.30	25	pfam_P2X_purnocptor,prints_P2X3_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.D306	ENST00000263314.2	37	c.918	CCDS7953.1	11																																																																																			-	pfam_P2X_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor		0.567	P2RX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX3	protein_coding	OTTHUMT00000392465.1	C	NM_002559	-		57135558	+1	no_errors	ENST00000263314	ensembl	human	known	74_37	silent	SNP	0.782	T
GPR98	84059	genome.wustl.edu	37	5	89968475	89968475	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:89968475A>G	ENST00000405460.2	+	22	4961	c.4865A>G	c.(4864-4866)tAc>tGc	p.Y1622C	GPR98_ENST00000450321.2_3'UTR	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1622	Calx-beta 11. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GGCATTAATTACCTTGTTGAT	0.408																																																	0								ENSG00000164199						200.0	184.0	189.0					5																	89968475		1890	4111	6001	GPR98	SO:0001583	missense	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.4865A>G	5.37:g.89968475A>G	ENSP00000384582:p.Tyr1622Cys	Somatic	0	48	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	28	0.00	0	46	17.86	10	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.Y1622C	ENST00000405460.2	37	c.4865	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	A	17.43	3.387176	0.61956	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	T	0.27256	1.68	6.07	6.07	0.98685	Na-Ca exchanger/integrin-beta4 (1);	0.443943	0.26556	N	0.023702	T	0.45994	0.1370	L	0.47716	1.5	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.31530	-0.9940	10	0.56958	D	0.05	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	1622	Q8WXG9	GPR98_HUMAN	C	1622	ENSP00000384582:Y1622C	ENSP00000296619:Y1622C	Y	+	2	0	GPR98	90004231	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.577000	0.60922	2.326000	0.78906	0.533000	0.62120	TAC	-	pfam_Calx_beta		0.408	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	A	NM_032119	-		89968475	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	SNP	1.000	G
MUC7	4589	genome.wustl.edu	37	4	71346984	71346984	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr4:71346984A>T	ENST00000304887.5	+	3	713	c.523A>T	c.(523-525)Act>Tct	p.T175S	MUC7_ENST00000514512.1_3'UTR|MUC7_ENST00000456088.1_Missense_Mutation_p.T175S|MUC7_ENST00000413702.1_Missense_Mutation_p.T175S	NM_152291.2	NP_689504.2	Q8TAX7	MUC7_HUMAN	mucin 7, secreted	175	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(2)|lung(23)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42			Lung(101;0.211)			ACCTTCTGCAACTACACCAGC	0.532																																																	0								ENSG00000171195						343.0	283.0	303.0					4																	71346984		2203	4300	6503	MUC7	SO:0001583	missense	0			-	HGNC	BC025688	CCDS3541.1	4q13.3	2008-02-05	2006-03-14		ENSG00000171195	ENSG00000171195		"""Mucins"""	7518	protein-coding gene	gene with protein product		158375	"""mucin 7, salivary"""			8838308	Standard	NM_152291		Approved	FLJ27047, MG2	uc003hfj.3	Q8TAX7	OTTHUMG00000129916	ENST00000304887.5:c.523A>T	4.37:g.71346984A>T	ENSP00000302021:p.Thr175Ser	Somatic	0	137	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	102	21.54	Q9UCD7|Q9UCD8	Missense_Mutation	SNP	28	0.00	0	38	24.00	12	NULL	p.T175S	ENST00000304887.5	37	c.523	CCDS3541.1	4	.	.	.	.	.	.	.	.	.	.	A	8.916	0.959997	0.18507	.	.	ENSG00000171195	ENST00000413702;ENST00000456088;ENST00000304887	T;T;T	0.57436	0.4;0.4;0.4	2.75	-5.51	0.02568	.	.	.	.	.	T	0.29491	0.0735	N	0.24115	0.695	0.09310	N	1	B	0.32573	0.376	B	0.32583	0.148	T	0.18524	-1.0334	8	.	.	.	2.9002	5.0485	0.14496	0.4337:0.0:0.4189:0.1475	.	175	Q8TAX7	MUC7_HUMAN	S	175	ENSP00000407422:T175S;ENSP00000400585:T175S;ENSP00000302021:T175S	.	T	+	1	0	MUC7	71381573	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.739000	0.04866	-1.328000	0.02261	-0.326000	0.08463	ACT	-	NULL		0.532	MUC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC7	protein_coding	OTTHUMT00000252168.2	A	NM_152291	-		71346984	+1	no_errors	ENST00000304887	ensembl	human	known	74_37	missense	SNP	0.000	T
BRINP3	339479	genome.wustl.edu	37	1	190067918	190067919	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr1:190067918_190067919GG>TT	ENST00000367462.3	-	8	1761_1762	c.1530_1531CC>AA	c.(1528-1533)gtCCat>gtAAat	p.H511N	BRINP3_ENST00000534846.1_Missense_Mutation_p.H409N	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	511					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AAAATGGCATGGACTTCTATTC	0.465																																																	0								ENSG00000162670																																			BRINP3	SO:0001583	missense	0			-	HGNC	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1530_1531delinsTT	1.37:g.190067918_190067919delinsTT	ENSP00000356432:p.His511Asn	Somatic	0	37|35	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	36|35	16.28|16.67	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation|Silent	SNP	30	0.00	0	42	16.00	8	pfam_MACPF,smart_MACPF	p.H511N|p.V510	ENST00000367462.3	37	c.1531|c.1530	CCDS1373.1	1																																																																																			-	NULL		0.465	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	protein_coding	OTTHUMT00000086278.1	G	NM_199051	-		190067918|190067919	-1	no_errors	ENST00000367462	ensembl	human	known	74_37	missense|silent	SNP	1.000|0.998	T
STK11IP	114790	genome.wustl.edu	37	2	220473312	220473312	+	Silent	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:220473312C>G	ENST00000456909.1	+	15	1701	c.1611C>G	c.(1609-1611)ctC>ctG	p.L537L	STK11IP_ENST00000295641.10_Silent_p.L548L			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	548	Glu-rich.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGCGGAACTCTGTCGCCCCT	0.637																																																	0								ENSG00000144589						41.0	45.0	44.0					2																	220473312		1973	4146	6119	STK11IP	SO:0001819	synonymous_variant	0			-	HGNC	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.1611C>G	2.37:g.220473312C>G		Somatic	0	45	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Silent	SNP	23	0.00	0	38	17.39	8	NULL	p.L537	ENST00000456909.1	37	c.1611		2																																																																																			-	NULL		0.637	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	STK11IP	protein_coding	OTTHUMT00000131432.1	C	NM_052902	-		220473312	+1	no_errors	ENST00000456909	ensembl	human	novel	74_37	silent	SNP	0.986	G
C14orf180	400258	genome.wustl.edu	37	14	105055650	105055650	+	3'UTR	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr14:105055650C>T	ENST00000557649.1	+	0	1349				RP11-614O9.1_ENST00000556073.1_RNA|C14orf180_ENST00000331952.2_3'UTR|C14orf180_ENST00000410013.1_3'UTR			Q8N912	NRAC_HUMAN	chromosome 14 open reading frame 180							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)							Melanoma(154;0.226)	all cancers(16;0.00405)|OV - Ovarian serous cystadenocarcinoma(23;0.0319)|Epithelial(46;0.0784)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.127)		ATGTGAGGTGCCATCCTCTGA	0.617																																																	0								ENSG00000259037																																			RP11-614O9.1	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene		CCDS32166.1, CCDS66722.1	14q32.33	2012-11-12	2012-11-12	2012-11-12	ENSG00000184601	ENSG00000184601			33795	protein-coding gene	gene with protein product	"""nutritionally-regulated adipose and cardiac-enriched"""		"""chromosome 14 open reading frame 77"""	C14orf77		23029450	Standard	XM_005267638		Approved	NRAC	uc001yow.1	Q8N912	OTTHUMG00000029806	ENST00000557649.1:c.*530C>T	14.37:g.105055650C>T		Somatic	0	27	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	27	20.59		RNA	SNP	22	0.00	0	29	17.14	6	-	NULL	ENST00000557649.1	37	NULL	CCDS32166.1	14																																																																																			-	-		0.617	C14orf180-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000259037	protein_coding	OTTHUMT00000410580.1	C	NM_001008404	-		105055650	-1	no_errors	ENST00000556073	ensembl	human	known	74_37	rna	SNP	0.000	T
ITGA2B	3674	genome.wustl.edu	37	17	42461715	42461715	+	Silent	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:42461715G>A	ENST00000262407.5	-	9	886	c.855C>T	c.(853-855)gtC>gtT	p.V285V	ITGA2B_ENST00000353281.4_Silent_p.V285V|ITGA2B_ENST00000377068.3_5'UTR	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	285					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GGGCACCGACGACATATTCTG	0.602																																																	0								ENSG00000005961						41.0	52.0	48.0					17																	42461715		2196	4296	6492	ITGA2B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.855C>T	17.37:g.42461715G>A		Somatic	0	47	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	41	37.88	B2RCY8|O95366|Q14443|Q17R67	Silent	SNP	14	0.00	0	31	39.22	20	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.V285	ENST00000262407.5	37	c.855	CCDS32665.1	17																																																																																			-	smart_Int_alpha_beta-p,prints_Integrin_alpha		0.602	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2B	protein_coding	OTTHUMT00000439823.1	G		-		42461715	-1	no_errors	ENST00000262407	ensembl	human	known	74_37	silent	SNP	0.080	A
FAM135B	51059	genome.wustl.edu	37	8	139164708	139164708	+	Silent	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr8:139164708T>A	ENST00000395297.1	-	13	2180	c.2010A>T	c.(2008-2010)tcA>tcT	p.S670S		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	670										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CGGATAGCACTGAGAGTTCCT	0.527										HNSCC(54;0.14)																																							0								ENSG00000147724						89.0	88.0	88.0					8																	139164708		1916	4124	6040	FAM135B	SO:0001819	synonymous_variant	0			-	HGNC	AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.2010A>T	8.37:g.139164708T>A		Somatic	0	45	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	36	21.28	B5MDB3|O95879|Q2WGJ7|Q3KP46	Silent	SNP	18	0.00	0	49	9.26	5	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.S670	ENST00000395297.1	37	c.2010	CCDS6375.2	8																																																																																			-	NULL		0.527	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	protein_coding	OTTHUMT00000313590.3	T	NM_015912	-		139164708	-1	no_errors	ENST00000395297	ensembl	human	known	74_37	silent	SNP	0.000	A
KRT76	51350	genome.wustl.edu	37	12	53164948	53164948	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr12:53164948A>T	ENST00000332411.2	-	7	1372	c.1319T>A	c.(1318-1320)cTc>cAc	p.L440H		NM_015848.4	NP_056932.2	Q01546	K22O_HUMAN	keratin 76	440	Coil 2.|Rod.				cytoskeleton organization (GO:0007010)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						GGCGTCCTTGAGGGCCATCTC	0.537																																																	0								ENSG00000185069						158.0	140.0	146.0					12																	53164948		2203	4300	6503	KRT76	SO:0001583	missense	0			-	HGNC	M99063	CCDS8838.1	12q13.13	2013-06-25			ENSG00000185069	ENSG00000185069		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24430	protein-coding gene	gene with protein product						1282112, 16831889	Standard	NM_015848		Approved	HUMCYT2A, KRT2B, KRT2P	uc001sax.3	Q01546	OTTHUMG00000169797	ENST00000332411.2:c.1319T>A	12.37:g.53164948A>T	ENSP00000330101:p.Leu440His	Somatic	0	74	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	63	23.17	B4DRR3|Q7Z795	Missense_Mutation	SNP	27	0.00	0	40	16.67	8	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.L440H	ENST00000332411.2	37	c.1319	CCDS8838.1	12	.	.	.	.	.	.	.	.	.	.	A	25.7	4.666186	0.88251	.	.	ENSG00000185069	ENST00000332411	D	0.84589	-1.87	5.13	5.13	0.70059	Filament (1);	0.178548	0.27096	N	0.020952	D	0.94640	0.8272	H	0.95294	3.65	0.53005	D	0.999962	D	0.89917	1.0	D	0.97110	1.0	D	0.96142	0.9101	10	0.87932	D	0	.	15.6444	0.77036	1.0:0.0:0.0:0.0	.	440	Q01546	K22O_HUMAN	H	440	ENSP00000330101:L440H	ENSP00000330101:L440H	L	-	2	0	KRT76	51451215	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.523000	0.81856	2.234000	0.73211	0.533000	0.62120	CTC	-	pfam_IF,prints_Keratin_II		0.537	KRT76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT76	protein_coding	OTTHUMT00000405928.1	A	NM_015848	-		53164948	-1	no_errors	ENST00000332411	ensembl	human	known	74_37	missense	SNP	1.000	T
C19orf57	79173	genome.wustl.edu	37	19	14000757	14000757	+	Silent	SNP	C	C	T	rs139071536	byFrequency	TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr19:14000757C>T	ENST00000586783.1	-	5	911	c.912G>A	c.(910-912)gtG>gtA	p.V304V	C19orf57_ENST00000346736.2_Silent_p.V304V|C19orf57_ENST00000591586.1_Intron|C19orf57_ENST00000454313.1_Silent_p.V304V			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	304					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			AGCCCTGGGCCACAGACCCGG	0.667													C|||	2	0.000399361	0.0	0.0	5008	,	,		17581	0.0		0.002	False		,,,				2504	0.0																0								ENSG00000132016	C		2,4402		0,2,2200	21.0	22.0	22.0		912	-3.5	0.0	19	dbSNP_134	22	16,8582		0,16,4283	no	coding-synonymous	C19orf57	NM_024323.3		0,18,6483	TT,TC,CC		0.1861,0.0454,0.1384		304/638	14000757	18,12984	2202	4299	6501	C19orf57	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.912G>A	19.37:g.14000757C>T		Somatic	0	47	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	57	24.00	Q13411|Q8N825|Q96D63|Q9BU49	Silent	SNP	24	0.00	0	56	18.84	13	NULL	p.V304	ENST00000586783.1	37	c.912		19																																																																																			-	NULL		0.667	C19orf57-003	NOVEL	basic	protein_coding	C19orf57	protein_coding	OTTHUMT00000457947.1	C	NM_024323	rs139071536		14000757	-1	no_errors	ENST00000454313	ensembl	human	known	74_37	silent	SNP	0.000	T
MCM9	254394	genome.wustl.edu	37	6	119137161	119137161	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr6:119137161C>T	ENST00000316316.6	-	13	2544	c.2258G>A	c.(2257-2259)aGt>aAt	p.S753N		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	753					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		TTTAGGTTCACTCTGATGAGT	0.403																																																	0								ENSG00000111877																																			MCM9	SO:0001583	missense	0			-	HGNC	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.2258G>A	6.37:g.119137161C>T	ENSP00000314505:p.Ser753Asn	Somatic	0	38	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	42	12.50	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	32	0.00	0	52	10.34	6	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,prints_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase	p.S753N	ENST00000316316.6	37	c.2258	CCDS56447.1	6	.	.	.	.	.	.	.	.	.	.	C	9.861	1.196271	0.22037	.	.	ENSG00000111877	ENST00000316316;ENST00000243218	T	0.31510	1.49	6.17	-3.84	0.04256	.	.	.	.	.	T	0.05273	0.0140	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.36986	-0.9725	9	0.51188	T	0.08	.	2.8481	0.05549	0.3102:0.1066:0.3873:0.196	.	753	Q9NXL9	MCM9_HUMAN	N	753;372	ENSP00000314505:S753N	ENSP00000243218:S372N	S	-	2	0	MCM9	119243864	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.933000	0.03959	-0.952000	0.03649	-0.867000	0.03001	AGT	-	NULL		0.403	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	protein_coding	OTTHUMT00000042005.4	C	NM_153255	-		119137161	-1	no_errors	ENST00000316316	ensembl	human	known	74_37	missense	SNP	0.000	T
INF2	64423	genome.wustl.edu	37	14	105178793	105178793	+	Nonsense_Mutation	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr14:105178793C>G	ENST00000392634.4	+	17	2625	c.2513C>G	c.(2512-2514)tCa>tGa	p.S838*	INF2_ENST00000330634.7_Nonsense_Mutation_p.S838*	NM_022489.3	NP_071934.3	Q27J81	INF2_HUMAN	inverted formin, FH2 and WH2 domain containing	838	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|regulation of cellular component size (GO:0032535)|regulation of mitochondrial fission (GO:0090140)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		ATCATCCGCTCAGAGGCCAGC	0.647																																																	0								ENSG00000203485						30.0	33.0	32.0					14																	105178793		1973	4153	6126	INF2	SO:0001587	stop_gained	0			-	HGNC	AK025709	CCDS9989.2, CCDS45173.1	14q32.33	2009-09-07	2007-11-29	2007-11-29	ENSG00000203485	ENSG00000203485			23791	protein-coding gene	gene with protein product	"""inverted formin 2"""	610982	"""chromosome 14 open reading frame 151"", ""chromosome 14 open reading frame 173"""	C14orf151, C14orf173		16818491	Standard	NM_001031714		Approved	MGC13251	uc001ypb.2	Q27J81	OTTHUMG00000029811	ENST00000392634.4:c.2513C>G	14.37:g.105178793C>G	ENSP00000376410:p.Ser838*	Somatic	0	77	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	42	44.74	Q27J83|Q69YL8|Q6P1X7|Q6PK22|Q86TR7|Q9BRM1|Q9H6N1	Nonsense_Mutation	SNP	32	0.00	0	37	33.93	19	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,pfam_WH2_dom,superfamily_ARM-type_fold,smart_FH2_Formin,pfscan_WH2_dom	p.S838*	ENST00000392634.4	37	c.2513	CCDS9989.2	14	.	.	.	.	.	.	.	.	.	.	C	36	5.750667	0.96890	.	.	ENSG00000203485	ENST00000330634;ENST00000392634	.	.	.	4.46	3.57	0.40892	.	0.322034	0.30528	N	0.009433	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	10.5912	0.45310	0.0:0.9095:0.0:0.0905	.	.	.	.	X	838	.	ENSP00000252527:S306X	S	+	2	0	INF2	104249838	0.138000	0.22547	0.070000	0.20053	0.993000	0.82548	4.383000	0.59600	0.863000	0.35553	0.491000	0.48974	TCA	-	pfam_FH2_Formin,smart_FH2_Formin		0.647	INF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INF2	protein_coding	OTTHUMT00000074371.4	C	NM_022489	-		105178793	+1	no_errors	ENST00000392634	ensembl	human	known	74_37	nonsense	SNP	0.120	G
RP11-86L19.2	0	genome.wustl.edu	37	9	107038454	107038454	+	RNA	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr9:107038454T>A	ENST00000493279.1	+	0	1218																											CAAAGCAGTCTAAAAATACCC	0.423																																																	0								ENSG00000242111																																			RP11-86L19.2			0			-	Clone_based_vega_gene																													9.37:g.107038454T>A		Somatic	0	22	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	15	42.31		RNA	SNP	36	0.00	0	35	38.60	22	-	NULL	ENST00000493279.1	37	NULL		9																																																																																			-	-		0.423	RP11-86L19.2-002	KNOWN	basic	processed_transcript	ENSG00000242111	pseudogene	OTTHUMT00000337446.1	T		-		107038454	+1	no_errors	ENST00000493279	ensembl	human	known	74_37	rna	SNP	0.043	A
PM20D1	148811	genome.wustl.edu	37	1	205814604	205814604	+	Missense_Mutation	SNP	G	G	A	rs189235498	byFrequency	TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr1:205814604G>A	ENST00000367136.4	-	3	382	c.338C>T	c.(337-339)tCg>tTg	p.S113L	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	113					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GCTGGGGTCCGAGCCTTGGAT	0.552													G|||	2	0.000399361	0.0	0.0	5008	,	,		17813	0.002		0.0	False		,,,				2504	0.0																0								ENSG00000162877						103.0	101.0	102.0					1																	205814604		2203	4300	6503	PM20D1	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.338C>T	1.37:g.205814604G>A	ENSP00000356104:p.Ser113Leu	Somatic	0	58	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	37	24.49	Q6P4E3|Q96DM4	Missense_Mutation	SNP	27	0.00	0	42	27.59	16	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,superfamily_Peptidase_M20_dimer	p.S113L	ENST00000367136.4	37	c.338	CCDS1460.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	17.32	3.359026	0.61403	.	.	ENSG00000162877	ENST00000367136	T	0.09817	2.94	6.04	6.04	0.98038	.	0.176869	0.51477	D	0.000084	T	0.20901	0.0503	M	0.82823	2.61	0.80722	D	1	P	0.51653	0.947	B	0.39531	0.302	T	0.07424	-1.0773	10	0.87932	D	0	.	20.1743	0.98175	0.0:0.0:1.0:0.0	.	113	Q6GTS8	P20D1_HUMAN	L	113	ENSP00000356104:S113L	ENSP00000356104:S113L	S	-	2	0	PM20D1	204081227	1.000000	0.71417	0.934000	0.37439	0.169000	0.22640	9.175000	0.94831	2.873000	0.98535	0.561000	0.74099	TCG	-	NULL		0.552	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PM20D1	protein_coding	OTTHUMT00000087736.1	G	NM_152491	rs189235498		205814604	-1	no_errors	ENST00000367136	ensembl	human	known	74_37	missense	SNP	0.998	A
SPHKAP	80309	genome.wustl.edu	37	2	228884539	228884539	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:228884539G>T	ENST00000392056.3	-	7	1077	c.1031C>A	c.(1030-1032)gCt>gAt	p.A344D	SPHKAP_ENST00000344657.5_Missense_Mutation_p.A344D	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	344						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGAGAAATAAGCATCTTTTGG	0.423																																																	0								ENSG00000153820						145.0	138.0	141.0					2																	228884539		2203	4300	6503	SPHKAP	SO:0001583	missense	0			-	HGNC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1031C>A	2.37:g.228884539G>T	ENSP00000375909:p.Ala344Asp	Somatic	0	55	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	44	16.98	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	34	0.00	0	43	27.12	16	pfam_AKAP_110_C	p.A344D	ENST00000392056.3	37	c.1031	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	1.067	-0.670961	0.03403	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12039	2.72;2.72	5.25	3.38	0.38709	.	0.688391	0.14023	N	0.346680	T	0.22126	0.0533	M	0.62723	1.935	0.09310	N	1	D;B	0.59767	0.986;0.27	P;B	0.56343	0.796;0.079	T	0.09907	-1.0653	10	0.28530	T	0.3	.	4.7229	0.12927	0.2007:0.1952:0.6042:0.0	.	344;344	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	D	344	ENSP00000375909:A344D;ENSP00000339886:A344D	ENSP00000339886:A344D	A	-	2	0	SPHKAP	228592783	0.000000	0.05858	0.880000	0.34516	0.106000	0.19336	0.468000	0.22051	1.455000	0.47813	0.650000	0.86243	GCT	-	NULL		0.423	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	protein_coding	OTTHUMT00000331750.1	G	NM_030623	-		228884539	-1	no_errors	ENST00000392056	ensembl	human	known	74_37	missense	SNP	0.016	T
BOD1L1	259282	genome.wustl.edu	37	4	13602177	13602177	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr4:13602177T>A	ENST00000040738.5	-	10	6482	c.6347A>T	c.(6346-6348)gAg>gTg	p.E2116V		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2116						nucleus (GO:0005634)	DNA binding (GO:0003677)										CATGGGGGCCTCAAATTCTTC	0.488																																																	0								ENSG00000038219						67.0	62.0	64.0					4																	13602177		2203	4300	6503	BOD1L1	SO:0001583	missense	0			-	HGNC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.6347A>T	4.37:g.13602177T>A	ENSP00000040738:p.Glu2116Val	Somatic	0	40	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	27	37.21	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	35	0.00	0	36	33.33	18	NULL	p.E2116V	ENST00000040738.5	37	c.6347	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	T	16.30	3.083866	0.55861	.	.	ENSG00000038219	ENST00000040738	T	0.11821	2.74	5.5	5.5	0.81552	.	0.101382	0.43260	D	0.000590	T	0.37237	0.0996	M	0.78049	2.395	0.41630	D	0.989014	D	0.69078	0.997	D	0.66196	0.942	T	0.27157	-1.0082	10	0.87932	D	0	-7.7642	14.1665	0.65480	0.0:0.0:0.0:1.0	.	2116	Q8NFC6	BOD1L_HUMAN	V	2116	ENSP00000040738:E2116V	ENSP00000040738:E2116V	E	-	2	0	BOD1L	13211275	1.000000	0.71417	0.995000	0.50966	0.199000	0.23934	4.703000	0.61824	2.083000	0.62718	0.454000	0.30748	GAG	-	NULL		0.488	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	protein_coding	OTTHUMT00000207321.1	T	NM_148894	-		13602177	-1	no_errors	ENST00000040738	ensembl	human	known	74_37	missense	SNP	0.987	A
DNAJC22	79962	genome.wustl.edu	37	12	49745369	49745369	+	3'UTR	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr12:49745369C>T	ENST00000549441.2	+	0	2314				DNAJC22_ENST00000552651.1_3'UTR|DNAJC22_ENST00000395069.3_3'UTR			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22							integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						CGAATGGCATCCCAACAGAGT	0.567																																																	0								ENSG00000178401																																			DNAJC22	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.*84C>T	12.37:g.49745369C>T		Somatic	0	19	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25	B3KP54	RNA	SNP	21	0.00	0	39	38.10	24	-	NULL	ENST00000549441.2	37	NULL	CCDS8785.1	12																																																																																			-	-		0.567	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJC22	protein_coding	OTTHUMT00000404302.2	C	NM_024902	-		49745369	+1	no_errors	ENST00000552651	ensembl	human	known	74_37	rna	SNP	0.000	T
CTSE	1510	genome.wustl.edu	37	1	206327499	206327499	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr1:206327499G>A	ENST00000358184.2	+	6	806	c.688G>A	c.(688-690)Gag>Aag	p.E230K	CTSE_ENST00000432969.2_Missense_Mutation_p.E155K|CTSE_ENST00000468617.1_3'UTR|CTSE_ENST00000360218.2_Missense_Mutation_p.E230K|CTSE_ENST00000361052.3_Missense_Mutation_p.E235K	NM_001910.3	NP_001901.1	P14091	CATE_HUMAN	cathepsin E	235					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TGCGGGGAGCGAGCTGATTTT	0.537																																																	0								ENSG00000196188						171.0	172.0	172.0					1																	206327499		2203	4300	6503	CTSE	SO:0001583	missense	0			-	HGNC	BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000358184.2:c.688G>A	1.37:g.206327499G>A	ENSP00000350911:p.Glu230Lys	Somatic	0	99	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	63	30.00	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Missense_Mutation	SNP	34	0.00	0	44	27.87	17	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.E235K	ENST00000358184.2	37	c.703	CCDS1462.1	1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062252	0.76187	.	.	ENSG00000196188	ENST00000358184;ENST00000361052;ENST00000360218;ENST00000432969	T;T;T;T	0.59502	0.26;0.26;0.26;0.26	4.9	3.98	0.46160	.	0.000000	0.64402	D	0.000002	T	0.76449	0.3989	M	0.83774	2.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.998	T	0.80176	-0.1491	10	0.66056	D	0.02	.	13.3469	0.60578	0.0772:0.0:0.9228:0.0	.	155;230;230	B4DNU8;P14091-2;P14091-1	.;.;.	K	230;235;230;155	ENSP00000350911:E230K;ENSP00000354337:E235K;ENSP00000353350:E230K;ENSP00000394607:E155K	ENSP00000350911:E230K	E	+	1	0	CTSE	204494122	1.000000	0.71417	0.805000	0.32314	0.534000	0.34807	7.115000	0.77110	1.284000	0.44531	0.655000	0.94253	GAG	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase		0.537	CTSE-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CTSE	protein_coding	OTTHUMT00000087998.1	G	NM_001910	-		206327499	+1	no_errors	ENST00000361052	ensembl	human	known	74_37	missense	SNP	0.997	A
TMEM2	23670	genome.wustl.edu	37	9	74319671	74319671	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr9:74319671G>A	ENST00000377044.4	-	18	3573	c.3034C>T	c.(3034-3036)Cga>Tga	p.R1012*	TMEM2_ENST00000396272.3_Nonsense_Mutation_p.R5*|TMEM2_ENST00000377066.5_Nonsense_Mutation_p.R949*	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	1012					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TACTCATCTCGTGTAATGGTC	0.423																																																	0								ENSG00000135048						122.0	100.0	108.0					9																	74319671		2203	4300	6503	TMEM2	SO:0001587	stop_gained	0			-	HGNC		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.3034C>T	9.37:g.74319671G>A	ENSP00000366243:p.Arg1012*	Somatic	0	41	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	28	20.00	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Nonsense_Mutation	SNP	37	0.00	0	48	20.00	12	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.R1012*	ENST00000377044.4	37	c.3034	CCDS6638.1	9	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822219	0.90873	.	.	ENSG00000135048	ENST00000377044;ENST00000377066;ENST00000396272;ENST00000377055;ENST00000377043	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6845	0.69040	0.0:0.0:0.8549:0.1451	.	.	.	.	X	1012;949;5;41;113	.	ENSP00000366242:R113X	R	-	1	2	TMEM2	73509491	1.000000	0.71417	0.912000	0.35992	0.359000	0.29487	5.706000	0.68362	2.699000	0.92147	0.561000	0.74099	CGA	-	NULL		0.423	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM2	protein_coding	OTTHUMT00000052618.2	G	NM_013390	-		74319671	-1	no_errors	ENST00000377044	ensembl	human	known	74_37	nonsense	SNP	0.995	A
CPXCR1	53336	genome.wustl.edu	37	X	88009153	88009153	+	Silent	SNP	T	T	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:88009153T>C	ENST00000276127.4	+	3	997	c.738T>C	c.(736-738)agT>agC	p.S246S	CPXCR1_ENST00000373111.1_Silent_p.S246S	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	246							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						AAATTGAAAGTATTTTTAATA	0.328													T|||	1	0.000264901	0.0	0.0014	3775	,	,		12851	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000147183						33.0	30.0	31.0					X																	88009153		2202	4299	6501	CPXCR1	SO:0001819	synonymous_variant	0			-	HGNC	AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.738T>C	X.37:g.88009153T>C		Somatic	0	112	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	52	17.46	B2R9F9|D3DTE7|Q96RS3	Silent	SNP	43	0.00	0	34	26.09	12	pfscan_Znf_C2H2	p.S246	ENST00000276127.4	37	c.738	CCDS14458.1	X																																																																																			-	NULL		0.328	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXCR1	protein_coding	OTTHUMT00000057418.1	T	NM_033048	-		88009153	+1	no_errors	ENST00000276127	ensembl	human	known	74_37	silent	SNP	0.000	C
C3AR1	719	genome.wustl.edu	37	12	8211888	8211888	+	Silent	SNP	A	A	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr12:8211888A>G	ENST00000307637.4	-	2	1097	c.894T>C	c.(892-894)ccT>ccC	p.P298P		NM_004054.2	NP_004045.1	Q16581	C3AR_HUMAN	complement component 3a receptor 1	298					blood circulation (GO:0008015)|chemotaxis (GO:0006935)|complement receptor mediated signaling pathway (GO:0002430)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation vascular endothelial growth factor production (GO:0010575)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C3a anaphylatoxin receptor activity (GO:0004943)|complement component C3a receptor activity (GO:0004876)|G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)	20				Kidney(36;0.0893)		TAGAAGCGCTAGGGAACAGCT	0.438																																																	0								ENSG00000171860						109.0	111.0	111.0					12																	8211888		2203	4300	6503	C3AR1	SO:0001819	synonymous_variant	0			-	HGNC	U28488	CCDS8588.1	12p13.31	2012-08-10				ENSG00000171860		"""Complement system"", ""GPCR / Class A : Complement component receptors"""	1319	protein-coding gene	gene with protein product		605246				8605247	Standard	NM_004054		Approved	C3AR, AZ3B	uc001qtv.1	Q16581		ENST00000307637.4:c.894T>C	12.37:g.8211888A>G		Somatic	0	24	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	O43771|Q92868	Silent	SNP	29	0.00	0	41	31.67	19	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Anaphtx_C3AR1,prints_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_Formyl_pep_rcpt,prints_Anaphtx_C5AR1/C5AR2	p.P298	ENST00000307637.4	37	c.894	CCDS8588.1	12																																																																																			-	pfscan_GPCR_Rhodpsn_7TM		0.438	C3AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3AR1	protein_coding	OTTHUMT00000400254.1	A		-		8211888	-1	no_errors	ENST00000307637	ensembl	human	known	74_37	silent	SNP	0.000	G
TRIM66	9866	genome.wustl.edu	37	11	8665970	8665970	+	Intron	SNP	T	T	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr11:8665970T>C	ENST00000299550.6	-	8	864				TRIM66_ENST00000402157.2_Intron|TRIM66_ENST00000531498.1_5'UTR	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66							aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						cctcttattatcacctcctat	0.363																																																	0								ENSG00000166436																																			TRIM66	SO:0001627	intron_variant	0			-	HGNC	AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.670-1297A>G	11.37:g.8665970T>C		Somatic	0	24	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	16	27.27	Q9BQQ4	RNA	SNP	37	0.00	0	27	35.71	15	-	NULL	ENST00000299550.6	37	NULL		11																																																																																			-	-		0.363	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	TRIM66	protein_coding		T	XM_084529	-		8665970	-1	no_errors	ENST00000531498	ensembl	human	known	74_37	rna	SNP	0.871	C
CTNND2	1501	genome.wustl.edu	37	5	11236855	11236855	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:11236855G>A	ENST00000304623.8	-	10	1898	c.1709C>T	c.(1708-1710)gCg>gTg	p.A570V	CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000503622.1_Missense_Mutation_p.A233V|CTNND2_ENST00000511377.1_Missense_Mutation_p.A479V|CTNND2_ENST00000359640.2_Missense_Mutation_p.A570V|CTNND2_ENST00000458100.2_Missense_Mutation_p.A137V	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	570					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GTAGGCTGCCGCGTTAGACTG	0.473																																																	0								ENSG00000169862						123.0	126.0	125.0					5																	11236855		2203	4300	6503	CTNND2	SO:0001583	missense	0			-	HGNC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1709C>T	5.37:g.11236855G>A	ENSP00000307134:p.Ala570Val	Somatic	0	44	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	36	19.57	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	31	3.12	1	56	13.85	9	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A570V	ENST00000304623.8	37	c.1709	CCDS3881.1	5	.	.	.	.	.	.	.	.	.	.	G	26.0	4.699492	0.88830	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000458100;ENST00000503622	T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01	5.81	5.81	0.92471	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81574	0.4851	M	0.79926	2.475	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;P;D	0.75484	0.936;0.881;0.986	T	0.82914	-0.0221	10	0.87932	D	0	-11.3108	20.0734	0.97734	0.0:0.0:1.0:0.0	.	233;137;570	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	V	570;570;479;137;233	ENSP00000307134:A570V;ENSP00000352661:A570V;ENSP00000426510:A479V;ENSP00000391155:A137V;ENSP00000426887:A233V	ENSP00000307134:A570V	A	-	2	0	CTNND2	11289855	1.000000	0.71417	0.969000	0.41365	0.346000	0.29079	9.869000	0.99810	2.751000	0.94390	0.555000	0.69702	GCG	-	superfamily_ARM-type_fold		0.473	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	protein_coding	OTTHUMT00000206999.1	G	NM_001332	-		11236855	-1	no_errors	ENST00000304623	ensembl	human	known	74_37	missense	SNP	1.000	A
CHST12	55501	genome.wustl.edu	37	7	2473042	2473042	+	Silent	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr7:2473042C>A	ENST00000258711.6	+	2	903	c.768C>A	c.(766-768)cgC>cgA	p.R256R		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	256					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|chondroitin 4-sulfotransferase activity (GO:0047756)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		CCGCCTTCCGCAGCAAGTTCG	0.632																																																	0								ENSG00000136213						75.0	65.0	68.0					7																	2473042		2203	4297	6500	CHST12	SO:0001819	synonymous_variant	0			-	HGNC	AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129				10781601	Standard	NM_018641		Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.768C>A	7.37:g.2473042C>A		Somatic	0	34	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	42	32.26	A4D1Z9|Q502W3|Q9NXY7	Silent	SNP	23	0.00	0	32	20.00	8	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.R256	ENST00000258711.6	37	c.768	CCDS5333.1	7																																																																																			-	pfam_Sulfotransferase,superfamily_P-loop_NTPase		0.632	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST12	protein_coding	OTTHUMT00000060170.3	C	NM_018641	-		2473042	+1	no_errors	ENST00000258711	ensembl	human	known	74_37	silent	SNP	1.000	A
ZNF416	55659	genome.wustl.edu	37	19	58084054	58084054	+	Silent	SNP	T	T	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr19:58084054T>C	ENST00000196489.3	-	4	1440	c.1218A>G	c.(1216-1218)acA>acG	p.T406T		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	406					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		AAGGCCTTGCTGTAGTGTGAA	0.453																																																	0								ENSG00000083817						109.0	98.0	102.0					19																	58084054		2203	4300	6503	ZNF416	SO:0001819	synonymous_variant	0			-	HGNC	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.1218A>G	19.37:g.58084054T>C		Somatic	0	58	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	71	12.35	Q9NWW8	Silent	SNP	31	0.00	0	48	9.43	5	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T406	ENST00000196489.3	37	c.1218	CCDS12954.1	19																																																																																			-	pfscan_Znf_C2H2		0.453	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF416	protein_coding	OTTHUMT00000466787.1	T	NM_017879	-		58084054	-1	no_errors	ENST00000196489	ensembl	human	known	74_37	silent	SNP	0.000	C
ACAN	176	genome.wustl.edu	37	15	89402172	89402172	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr15:89402172C>T	ENST00000561243.1	+	11	6356	c.6356C>T	c.(6355-6357)gCc>gTc	p.A2119V	ACAN_ENST00000559004.1_Missense_Mutation_p.A2119V|ACAN_ENST00000439576.2_Missense_Mutation_p.A2119V|ACAN_ENST00000352105.7_Missense_Mutation_p.A2119V			P16112	PGCA_HUMAN	aggrecan	2004	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GCCCCTGAGGCCAGCAGAGAA	0.572																																																	0								ENSG00000157766						48.0	50.0	50.0					15																	89402172		1916	4122	6038	ACAN	SO:0001583	missense	0			-	HGNC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.6356C>T	15.37:g.89402172C>T	ENSP00000453342:p.Ala2119Val	Somatic	0	27	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	18	50.00	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	33	0.00	0	30	45.45	25	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.A2119V	ENST00000561243.1	37	c.6356	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	C	6.496	0.459705	0.12342	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02216	4.55;4.39	4.4	0.749	0.18381	.	0.260910	0.20336	N	0.094335	T	0.05090	0.0136	M	0.68317	2.08	0.09310	N	1	P;D	0.62365	0.568;0.991	B;P	0.55749	0.181;0.783	T	0.31806	-0.9930	10	0.33141	T	0.24	-10.4741	4.1575	0.10268	0.0:0.4993:0.1953:0.3054	.	2119;2119	E7ENV9;E7EX88	.;.	V	2119;2119;2005	ENSP00000387356:A2119V;ENSP00000341615:A2119V	ENSP00000268134:A2005V	A	+	2	0	ACAN	87203176	0.342000	0.24809	0.025000	0.17156	0.011000	0.07611	0.111000	0.15458	0.387000	0.25024	0.555000	0.69702	GCC	-	NULL		0.572	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	protein_coding	OTTHUMT00000416267.2	C	NM_001135	-		89402172	+1	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	SNP	0.043	T
ARFGEF1	10565	genome.wustl.edu	37	8	68179642	68179642	+	Missense_Mutation	SNP	T	T	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr8:68179642T>G	ENST00000262215.3	-	11	1997	c.1608A>C	c.(1606-1608)gaA>gaC	p.E536D	ARFGEF1_ENST00000520381.1_5'UTR	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	536					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TGGTAGAAGTTTCCAAAATGT	0.289																																																	0								ENSG00000066777						51.0	57.0	55.0					8																	68179642		2198	4294	6492	ARFGEF1	SO:0001583	missense	0			-	HGNC	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.1608A>C	8.37:g.68179642T>G	ENSP00000262215:p.Glu536Asp	Somatic	0	33	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	14	53.33	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	44	0.00	0	29	47.27	26	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.E536D	ENST00000262215.3	37	c.1608	CCDS6199.1	8	.	.	.	.	.	.	.	.	.	.	T	12.20	1.867756	0.32977	.	.	ENSG00000066777	ENST00000262215	T	0.47528	0.84	5.64	1.79	0.24919	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.62454	0.2429	M	0.70842	2.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58020	-0.7710	10	0.45353	T	0.12	.	9.3593	0.38186	0.0:0.2139:0.0:0.7861	.	536	Q9Y6D6	BIG1_HUMAN	D	536	ENSP00000262215:E536D	ENSP00000262215:E536D	E	-	3	2	ARFGEF1	68342196	1.000000	0.71417	1.000000	0.80357	0.015000	0.08874	3.003000	0.49505	0.064000	0.16427	-0.911000	0.02809	GAA	-	superfamily_ARM-type_fold		0.289	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	protein_coding	OTTHUMT00000379441.4	T	NM_006421	-		68179642	-1	no_errors	ENST00000262215	ensembl	human	known	74_37	missense	SNP	1.000	G
KCNA1	3736	genome.wustl.edu	37	12	5021875	5021875	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr12:5021875G>A	ENST00000382545.3	+	2	2438	c.1331G>A	c.(1330-1332)cGc>cAc	p.R444H	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	444					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.R444H(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CTCAGTCGCCGCAGTTCCTCT	0.468																																																	1	Substitution - Missense(1)	NS(1)						ENSG00000111262						200.0	197.0	198.0					12																	5021875		2203	4300	6503	KCNA1	SO:0001583	missense	0			-	HGNC	L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.1331G>A	12.37:g.5021875G>A	ENSP00000371985:p.Arg444His	Somatic	0	28	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	9	62.50	A6NM83|Q3MIQ9	Missense_Mutation	SNP	25	0.00	0	33	44.07	26	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.R444H	ENST00000382545.3	37	c.1331	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218385	0.58560	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.96491	-4.03	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.94670	0.8281	L	0.49126	1.545	0.80722	D	1	B	0.13145	0.007	B	0.09377	0.004	D	0.90960	0.4812	10	0.56958	D	0.05	.	18.5892	0.91202	0.0:0.0:1.0:0.0	.	444	Q09470	KCNA1_HUMAN	H	444	ENSP00000371985:R444H	ENSP00000228858:R444H	R	+	2	0	KCNA1	4892136	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	CGC	-	prints_K_chnl_volt-dep_Kv1.1		0.468	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	protein_coding	OTTHUMT00000103343.2	G	NM_000217	-		5021875	+1	no_errors	ENST00000382545	ensembl	human	known	74_37	missense	SNP	1.000	A
UNC13C	440279	genome.wustl.edu	37	15	54590064	54590064	+	Silent	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr15:54590064G>A	ENST00000260323.11	+	11	4044	c.4044G>A	c.(4042-4044)gtG>gtA	p.V1348V	UNC13C_ENST00000545554.1_Silent_p.V1348V|UNC13C_ENST00000537900.1_Silent_p.V1346V	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1348					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AAATCAATGTGGAGATAAAAG	0.323																																																	0								ENSG00000137766						74.0	72.0	72.0					15																	54590064		1843	4082	5925	UNC13C	SO:0001819	synonymous_variant	0			-	HGNC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4044G>A	15.37:g.54590064G>A		Somatic	0	17	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	11	42.11	Q0P613|Q8ND48|Q96NP3	Silent	SNP	29	0.00	0	21	50.00	21	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.V1348	ENST00000260323.11	37	c.4044	CCDS45264.1	15																																																																																			-	superfamily_C2_dom		0.323	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	G	NM_173166	-		54590064	+1	no_errors	ENST00000260323	ensembl	human	known	74_37	silent	SNP	1.000	A
TMEM106B	54664	genome.wustl.edu	37	7	12271553	12271553	+	Silent	SNP	T	T	C	rs151183990		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr7:12271553T>C	ENST00000396667.3	+	9	1099	c.777T>C	c.(775-777)taT>taC	p.Y259Y	TMEM106B_ENST00000396668.3_Silent_p.Y259Y	NM_018374.3	NP_060844.2	Q9NUM4	T106B_HUMAN	transmembrane protein 106B	259					cell death (GO:0008219)|dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				NS(1)|endometrium(8)|large_intestine(2)|lung(7)	18				UCEC - Uterine corpus endometrioid carcinoma (126;0.185)		ACACAACTTATCAGTTGGGGC	0.358													T|||	1	0.000199681	0.0008	0.0	5008	,	,		16729	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000106460	T	,	4,4402	8.1+/-20.4	0,4,2199	86.0	79.0	81.0		777,777	-3.1	1.0	7	dbSNP_134	81	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TMEM106B	NM_001134232.1,NM_018374.3	,	0,4,6499	CC,CT,TT		0.0,0.0908,0.0308	,	259/275,259/275	12271553	4,13002	2203	4300	6503	TMEM106B	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	BC033901	CCDS5358.1	7p21.3	2012-06-06			ENSG00000106460	ENSG00000106460			22407	protein-coding gene	gene with protein product		613413				20154673, 22511793	Standard	NM_018374		Approved	MGC33727, FLJ11273	uc003ssh.3	Q9NUM4	OTTHUMG00000125537	ENST00000396667.3:c.777T>C	7.37:g.12271553T>C		Somatic	0	30	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	20	37.50	A4D108|Q53FL9|Q8N4L0	Silent	SNP	40	0.00	0	24	53.85	28	pfam_DUF1356_TMEM106	p.Y259	ENST00000396667.3	37	c.777	CCDS5358.1	7																																																																																			-	NULL		0.358	TMEM106B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM106B	protein_coding	OTTHUMT00000246870.3	T	NM_018374	rs151183990		12271553	+1	no_errors	ENST00000396667	ensembl	human	known	74_37	silent	SNP	0.982	C
PCLO	27445	genome.wustl.edu	37	7	82545573	82545573	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr7:82545573T>A	ENST00000333891.9	-	7	12066	c.11729A>T	c.(11728-11730)gAg>gTg	p.E3910V	PCLO_ENST00000423517.2_Missense_Mutation_p.E3910V|PCLO_ENST00000437081.1_Missense_Mutation_p.E630V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						AGTTTGTTGCTCAAAATGAGA	0.458																																																	0								ENSG00000186472						434.0	431.0	432.0					7																	82545573		2026	4174	6200	PCLO	SO:0001583	missense	0			-	HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11729A>T	7.37:g.82545573T>A	ENSP00000334319:p.Glu3910Val	Somatic	0	147	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	93	149	38.43		Missense_Mutation	SNP	28	0.00	0	65	32.29	31	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.E3910V	ENST00000333891.9	37	c.11729	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	11.85	1.762961	0.31228	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.16073	2.37;2.37	5.51	5.51	0.81932	.	.	.	.	.	T	0.11495	0.0280	N	0.08118	0	0.26746	N	0.970286	B;B;B	0.22211	0.011;0.066;0.066	B;B;B	0.22753	0.014;0.041;0.041	T	0.21965	-1.0230	9	0.87932	D	0	.	14.1918	0.65644	0.0:0.0:0.0:1.0	.	3841;3910;3910	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	V	3910;3910;630	ENSP00000334319:E3910V;ENSP00000388393:E3910V	ENSP00000334319:E3910V	E	-	2	0	PCLO	82383509	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	5.382000	0.66213	2.105000	0.64084	0.460000	0.39030	GAG	-	NULL		0.458	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	T	NM_014510	-		82545573	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	SNP	1.000	A
TUBGCP3	10426	genome.wustl.edu	37	13	113213664	113213664	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr13:113213664C>T	ENST00000261965.3	-	4	488	c.302G>A	c.(301-303)aGt>aAt	p.S101N	TUBGCP3_ENST00000375669.3_Missense_Mutation_p.S101N	NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	101					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					TGGGTCCTCACTGAGGCTCAG	0.458																																																	0								ENSG00000126216						72.0	68.0	69.0					13																	113213664		2203	4300	6503	TUBGCP3	SO:0001583	missense	0			-	HGNC	AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.302G>A	13.37:g.113213664C>T	ENSP00000261965:p.Ser101Asn	Somatic	0	51	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	18	43.75	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	37	0.00	0	12	69.23	27	pfam_TUBGCP	p.S101N	ENST00000261965.3	37	c.302	CCDS9525.1	13	.	.	.	.	.	.	.	.	.	.	C	25.8	4.678481	0.88542	.	.	ENSG00000126216	ENST00000261965;ENST00000375669	T;T	0.33865	1.39;1.44	5.47	5.47	0.80525	.	0.127830	0.64402	D	0.000001	T	0.62780	0.2456	M	0.78049	2.395	0.38552	D	0.949476	D;D;D	0.76494	0.999;0.984;0.985	D;P;P	0.68353	0.957;0.806;0.677	T	0.67082	-0.5760	10	0.54805	T	0.06	-27.3927	19.4137	0.94687	0.0:1.0:0.0:0.0	.	101;101;101	Q96CW5-3;Q96CW5-2;Q96CW5	.;.;GCP3_HUMAN	N	101	ENSP00000261965:S101N;ENSP00000364821:S101N	ENSP00000261965:S101N	S	-	2	0	TUBGCP3	112261665	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.024000	0.64090	2.581000	0.87130	0.638000	0.83543	AGT	-	NULL		0.458	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	protein_coding	OTTHUMT00000045825.2	C	NM_006322	-		113213664	-1	no_errors	ENST00000261965	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC185	164127	genome.wustl.edu	37	1	223568250	223568250	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr1:223568250C>T	ENST00000366875.3	+	1	1536	c.1433C>T	c.(1432-1434)gCc>gTc	p.A478V		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		478										breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		AGGGAGAAGGCCCAGAAGGAG	0.602																																																	0								ENSG00000178395						60.0	68.0	65.0					1																	223568250		2203	4300	6503	C1orf65	SO:0001583	missense	0			-	HGNC																												ENST00000366875.3:c.1433C>T	1.37:g.223568250C>T	ENSP00000355840:p.Ala478Val	Somatic	0	17	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	14	46.15	Q8N746|Q8NA93	Missense_Mutation	SNP	29	0.00	0	36	40.00	24	NULL	p.A478V	ENST00000366875.3	37	c.1433	CCDS1537.1	1	.	.	.	.	.	.	.	.	.	.	C	14.65	2.599619	0.46318	.	.	ENSG00000178395	ENST00000366875	T	0.32515	1.45	5.48	2.49	0.30216	.	.	.	.	.	T	0.20618	0.0496	N	0.24115	0.695	0.45005	D	0.998025	D	0.55605	0.972	P	0.47075	0.536	T	0.05022	-1.0911	9	0.24483	T	0.36	.	5.3348	0.15951	0.1625:0.6584:0.0:0.1792	.	478	Q8N715	CA065_HUMAN	V	478	ENSP00000355840:A478V	ENSP00000355840:A478V	A	+	2	0	C1orf65	221634873	0.692000	0.27719	0.339000	0.25562	0.983000	0.72400	1.225000	0.32551	0.236000	0.21180	0.655000	0.94253	GCC	-	NULL		0.602	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf65	protein_coding	OTTHUMT00000092718.1	C		-		223568250	+1	no_errors	ENST00000366875	ensembl	human	known	74_37	missense	SNP	0.997	T
UNC13C	440279	genome.wustl.edu	37	15	54590065	54590065	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr15:54590065G>T	ENST00000260323.11	+	11	4045	c.4045G>T	c.(4045-4047)Gag>Tag	p.E1349*	UNC13C_ENST00000545554.1_Nonsense_Mutation_p.E1349*|UNC13C_ENST00000537900.1_Nonsense_Mutation_p.E1347*	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1349					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AATCAATGTGGAGATAAAAGG	0.328																																																	0								ENSG00000137766						73.0	71.0	72.0					15																	54590065		1843	4082	5925	UNC13C	SO:0001587	stop_gained	0			-	HGNC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4045G>T	15.37:g.54590065G>T	ENSP00000260323:p.Glu1349*	Somatic	0	16	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	10	44.44	Q0P613|Q8ND48|Q96NP3	Nonsense_Mutation	SNP	29	0.00	0	20	52.38	22	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.E1349*	ENST00000260323.11	37	c.4045	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	G	45	11.438828	0.99561	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	.	.	.	5.65	5.65	0.86999	.	0.231325	0.42294	D	0.000724	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	18.6988	0.91613	0.0:0.0:1.0:0.0	.	.	.	.	X	1349;1349;1347	.	ENSP00000260323:E1349X	E	+	1	0	UNC13C	52377357	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.640000	0.89533	0.650000	0.86243	GAG	-	superfamily_C2_dom		0.328	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	G	NM_173166	-		54590065	+1	no_errors	ENST00000260323	ensembl	human	known	74_37	nonsense	SNP	1.000	T
MALAT1	378938	genome.wustl.edu	37	11	65273644	65273648	+	lincRNA	DEL	CTTTG	CTTTG	-			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	CTTTG	CTTTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr11:65273644_65273648delCTTTG	ENST00000534336.1	+	0	8412_8416					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CCTGCGGCGTCTTTGCTTTGACTAC	0.449																																																	0								ENSG00000251562																																			MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65273649_65273653delCTTTG		Somatic	NA	NA	NA		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	35	0.00	0	45	0.00	0	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.449	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	CTTTG	NR_002819			65273648	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	DEL	1.000:1.000:1.000:1.000:1.000	-
PCMTD2	55251	genome.wustl.edu	37	20	62905090	62905091	+	3'UTR	INS	-	-	TTC	rs148085913|rs200008486|rs3077808|rs397697396	byFrequency	TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr20:62905090_62905091insTTC	ENST00000308824.6	+	0	1350_1351				PCMTD2_ENST00000369758.4_3'UTR|PCMTD2_ENST00000299468.7_Intron|PCMTD2_ENST00000266078.7_3'UTR|PCMTD2_ENST00000609372.1_3'UTR	NM_018257.2	NP_060727.2	Q9NV79	PCMD2_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2							cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|upper_aerodigestive_tract(1)	17	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					ACACCATGGTTTTCTTCTAGTT	0.446														1189	0.23742	0.5136	0.1902	5008	,	,		18350	0.0754		0.1998	False		,,,				2504	0.1033																0								ENSG00000203880																																			PCMTD2	SO:0001624	3_prime_UTR_variant	0				HGNC	AK001745	CCDS13559.1, CCDS46631.1	20q13.33	2012-10-02	2005-10-06	2005-10-06	ENSG00000203880	ENSG00000203880			15882	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 36"""	C20orf36			Standard	NM_018257		Approved	FLJ10883	uc002yil.4	Q9NV79	OTTHUMG00000033029	ENST00000308824.6:c.*138->TTC	20.37:g.62905094_62905096dupTTC		Somatic	0	9	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00	E1P5H3|Q8IW60|Q9H4K2	RNA	INS	22	29.03	9	30	37.50	18	-	NULL	ENST00000308824.6	37	NULL	CCDS13559.1	20																																																																																			-	-		0.446	PCMTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCMTD2	protein_coding	OTTHUMT00000080301.1	-	NM_018257			62905091	+1	no_errors	ENST00000266078	ensembl	human	known	74_37	rna	INS	0.000:0.000	TTC
MYH2	4620	genome.wustl.edu	37	17	10443920	10443921	+	Frame_Shift_Ins	INS	-	-	TG			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:10443920_10443921insTG	ENST00000245503.5	-	11	1382_1383	c.998_999insCA	c.(997-999)atgfs	p.M333fs	MYH2_ENST00000397183.2_Frame_Shift_Ins_p.M333fs|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000532183.2_Frame_Shift_Ins_p.M333fs	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	333	Myosin motor.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CATCTGTGGCCATCAGTTCTTC	0.401																																																	0								ENSG00000125414																																			MYH2	SO:0001589	frameshift_variant	0				HGNC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.998_999insCA	17.37:g.10443920_10443921insTG	ENSP00000245503:p.Met333fs	Somatic	0	50	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	51	12.07	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Frame_Shift_Ins	INS	35	0.00	0	52	10.34	6	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.M333fs	ENST00000245503.5	37	c.999_998	CCDS11156.1	17																																																																																			-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.401	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	protein_coding	OTTHUMT00000252726.3	-	NM_017534			10443921	-1	no_errors	ENST00000245503	ensembl	human	known	74_37	frame_shift_ins	INS	0.990:1.000	TG
LRRC17	10234	genome.wustl.edu	37	7	102584860	102584860	+	Missense_Mutation	SNP	T	T	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr7:102584860T>G	ENST00000339431.4	+	4	1427	c.1132T>G	c.(1132-1134)Tgc>Ggc	p.C378G	LRRC17_ENST00000485478.1_3'UTR|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000436908.1_Intron|FBXL13_ENST00000379306.3_Intron|LRRC17_ENST00000249377.4_3'UTR|FBXL13_ENST00000379308.3_Intron|FBXL13_ENST00000313221.4_Intron|FBXL13_ENST00000455112.2_Intron|FBXL13_ENST00000379305.3_Intron|FBXL13_ENST00000393772.2_Intron	NM_001031692.2	NP_001026862.1	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17	378	LRRCT 2.				bone marrow development (GO:0048539)|negative regulation of osteoclast differentiation (GO:0045671)|ossification (GO:0001503)	extracellular space (GO:0005615)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	17						TGGCCTGGAATGCAAAACGCC	0.413																																																	0								ENSG00000128606						114.0	108.0	110.0					7																	102584860		2203	4300	6503	LRRC17	SO:0001583	missense	0			-	HGNC	U32907	CCDS5727.1, CCDS34721.1	7q22.1	2009-05-26			ENSG00000128606	ENSG00000128606			16895	protein-coding gene	gene with protein product						8982252, 19336404	Standard	NM_005824		Approved	P37NB, H_RG318M05.3	uc003vau.3	Q8N6Y2	OTTHUMG00000157210	ENST00000339431.4:c.1132T>G	7.37:g.102584860T>G	ENSP00000344242:p.Cys378Gly	Somatic	0	43	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	35	46.15	Q13288|Q6UWA7|Q75MG5	Missense_Mutation	SNP	34	0.00	0	50	41.18	35	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.C378G	ENST00000339431.4	37	c.1132	CCDS34721.1	7	.	.	.	.	.	.	.	.	.	.	T	19.06	3.754100	0.69648	.	.	ENSG00000128606	ENST00000339431	D	0.84070	-1.8	5.79	5.79	0.91817	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.64402	D	0.000004	D	0.84857	0.5565	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	P	0.61874	0.895	D	0.87075	0.2162	10	0.87932	D	0	-24.8155	16.1303	0.81428	0.0:0.0:0.0:1.0	.	378	Q8N6Y2	LRC17_HUMAN	G	378	ENSP00000344242:C378G	ENSP00000344242:C378G	C	+	1	0	LRRC17	102372096	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.218000	0.71995	0.533000	0.62120	TGC	-	smart_Cys-rich_flank_reg_C		0.413	LRRC17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC17	protein_coding	OTTHUMT00000347930.1	T	NM_005824	-		102584860	+1	no_errors	ENST00000339431	ensembl	human	known	74_37	missense	SNP	1.000	G
PRX	57716	genome.wustl.edu	37	19	40900053	40900053	+	Silent	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr19:40900053G>T	ENST00000324001.7	-	7	4476	c.4206C>A	c.(4204-4206)ccC>ccA	p.P1402P	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	1402					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TCTCTCTGACGGGGGACTTGG	0.692																																																	0								ENSG00000105227						61.0	70.0	67.0					19																	40900053		2203	4300	6503	PRX	SO:0001819	synonymous_variant	0			-	HGNC	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.4206C>A	19.37:g.40900053G>T		Somatic	0	54	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	37	11.90	Q9BXL9|Q9HCF2	Silent	SNP	22	0.00	0	27	10.00	3	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P1402	ENST00000324001.7	37	c.4206	CCDS33028.1	19																																																																																			-	NULL		0.692	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	protein_coding	OTTHUMT00000462582.1	G	NM_020956	-		40900053	-1	no_errors	ENST00000324001	ensembl	human	known	74_37	silent	SNP	0.258	T
RBBP7	5931	genome.wustl.edu	37	X	16875794	16875794	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:16875794C>G	ENST00000380087.2	-	5	880	c.520G>C	c.(520-522)Ggt>Cgt	p.G174R	RBBP7_ENST00000380084.4_Missense_Mutation_p.G218R|RBBP7_ENST00000404022.1_Missense_Mutation_p.G165R			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	174					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					TTCTGGTGACCTCTTAATCTG	0.373																																																	0								ENSG00000102054						180.0	154.0	163.0					X																	16875794		2203	4300	6503	RBBP7	SO:0001583	missense	0			-	HGNC	U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.520G>C	X.37:g.16875794C>G	ENSP00000369427:p.Gly174Arg	Somatic	0	60	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43	Q5JP00	Missense_Mutation	SNP	32	0.00	0	63	10.00	7	pfam_WD40_repeat,pfam_Histone-bd_RBBP4_N,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G174R	ENST00000380087.2	37	c.520	CCDS14179.1	X	.	.	.	.	.	.	.	.	.	.	C	28.0	4.885409	0.91814	.	.	ENSG00000102054	ENST00000380087;ENST00000380084;ENST00000404022;ENST00000416035	T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51	5.3	5.3	0.74995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.88945	0.6575	H	0.95151	3.63	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.998;0.996	D;D;D;D	0.76071	0.961;0.987;0.979;0.963	D	0.92299	0.5848	10	0.87932	D	0	-0.4083	17.1671	0.86819	0.0:1.0:0.0:0.0	.	160;165;174;218	B0R0W4;E9PC52;Q16576;Q5JP00	.;.;RBBP7_HUMAN;.	R	174;218;165;94	ENSP00000369427:G174R;ENSP00000369424:G218R;ENSP00000386068:G165R;ENSP00000392714:G94R	ENSP00000369424:G218R	G	-	1	0	RBBP7	16785715	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.772000	0.85439	2.351000	0.79841	0.513000	0.50165	GGT	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.373	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP7	protein_coding	OTTHUMT00000055920.2	C	NM_002893	-		16875794	-1	no_errors	ENST00000380087	ensembl	human	known	74_37	missense	SNP	1.000	G
TENM1	10178	genome.wustl.edu	37	X	123518624	123518624	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:123518624A>T	ENST00000371130.3	-	29	6199	c.6136T>A	c.(6136-6138)Ttc>Atc	p.F2046I	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.F2053I	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2046					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GTGACTCGGAAATTGTTGTAG	0.433																																																	0								ENSG00000009694						103.0	83.0	90.0					X																	123518624		2203	4300	6503	TENM1	SO:0001583	missense	0			-	HGNC	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.6136T>A	X.37:g.123518624A>T	ENSP00000360171:p.Phe2046Ile	Somatic	0	74	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	49	18.33	B2RTR5|Q5JZ17	Missense_Mutation	SNP	41	0.00	0	34	30.61	15	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.F2053I	ENST00000371130.3	37	c.6157	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	A	22.8	4.341539	0.81911	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.86865	-2.18;-2.15	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.92260	0.7545	M	0.65975	2.015	0.80722	D	1	D;D;D	0.63880	0.993;0.976;0.983	D;P;P	0.72338	0.977;0.713;0.718	D	0.92892	0.6332	10	0.66056	D	0.02	.	14.5423	0.68005	1.0:0.0:0.0:0.0	.	2052;2053;2046	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	I	2046;2053	ENSP00000360171:F2046I;ENSP00000403954:F2053I	ENSP00000360171:F2046I	F	-	1	0	ODZ1	123346305	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.339000	0.96797	1.813000	0.52934	0.486000	0.48141	TTC	-	NULL		0.433	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	protein_coding	OTTHUMT00000058985.1	A	NM_014253	-		123518624	-1	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	SNP	1.000	T
NDST4	64579	genome.wustl.edu	37	4	115792054	115792054	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr4:115792054A>T	ENST00000264363.2	-	7	2267	c.1589T>A	c.(1588-1590)tTa>tAa	p.L530*		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	530	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AAAGGTATATAACCCTAGGCG	0.398																																																	0								ENSG00000138653						98.0	107.0	104.0					4																	115792054		2203	4300	6503	NDST4	SO:0001587	stop_gained	0			-	HGNC	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1589T>A	4.37:g.115792054A>T	ENSP00000264363:p.Leu530*	Somatic	0	27	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17	Q2KHM8	Nonsense_Mutation	SNP	43	0.00	0	46	14.81	8	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.L530*	ENST00000264363.2	37	c.1589	CCDS3706.1	4	.	.	.	.	.	.	.	.	.	.	A	39	7.381311	0.98248	.	.	ENSG00000138653	ENST00000264363	.	.	.	5.2	2.79	0.32731	.	0.163459	0.40908	D	0.000993	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.1022	0.36676	0.8514:0.0:0.1486:0.0	.	.	.	.	X	530	.	ENSP00000264363:L530X	L	-	2	0	NDST4	116011503	0.980000	0.34600	0.117000	0.21633	0.967000	0.64934	6.252000	0.72447	0.326000	0.23384	0.459000	0.35465	TTA	-	NULL		0.398	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST4	protein_coding	OTTHUMT00000256427.1	A	NM_022569	-		115792054	-1	no_errors	ENST00000264363	ensembl	human	known	74_37	nonsense	SNP	0.536	T
SIGLEC7	27036	genome.wustl.edu	37	19	51649285	51649285	+	Silent	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr19:51649285C>T	ENST00000317643.6	+	4	1003	c.934C>T	c.(934-936)Ctg>Ttg	p.L312L	SIGLEC7_ENST00000305628.7_Silent_p.L219L|SIGLEC7_ENST00000600577.1_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	312	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		GCAAGTGCACCTGGGGGATGA	0.587																																																	0								ENSG00000168995						104.0	98.0	100.0					19																	51649285		2203	4300	6503	SIGLEC7	SO:0001819	synonymous_variant	0			-	HGNC	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.934C>T	19.37:g.51649285C>T		Somatic	0	60	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	56	22.22	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Silent	SNP	29	0.00	0	43	17.31	9	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L312	ENST00000317643.6	37	c.934	CCDS12826.1	19																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.587	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC7	protein_coding	OTTHUMT00000464226.2	C	NM_016543	-		51649285	+1	no_errors	ENST00000317643	ensembl	human	known	74_37	silent	SNP	0.000	T
CRAT	1384	genome.wustl.edu	37	9	131862186	131862186	+	Silent	SNP	C	C	T	rs374221134		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr9:131862186C>T	ENST00000318080.2	-	8	1338	c.1044G>A	c.(1042-1044)ggG>ggA	p.G348G	CRAT_ENST00000464290.1_5'Flank|RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	348					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	CAATAGGGGGCCCCTCCGCTG	0.582																																																	0								ENSG00000095321	C		0,4406		0,0,2203	90.0	79.0	83.0		1044	-7.4	0.8	9		83	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CRAT	NM_000755.3		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		348/627	131862186	1,13005	2203	4300	6503	CRAT	SO:0001819	synonymous_variant	0			-	HGNC	X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.1044G>A	9.37:g.131862186C>T		Somatic	0	49	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	49	10.91	Q5T952|Q9BW16	Silent	SNP	29	0.00	0	46	14.81	8	pfam_Carn_acyl_trans	p.G348	ENST00000318080.2	37	c.1044	CCDS6919.1	9																																																																																			-	pfam_Carn_acyl_trans		0.582	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	protein_coding	OTTHUMT00000253700.1	C		-		131862186	-1	no_errors	ENST00000318080	ensembl	human	known	74_37	silent	SNP	0.275	T
WFS1	7466	genome.wustl.edu	37	4	6293088	6293088	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr4:6293088G>A	ENST00000226760.1	+	5	795	c.625G>A	c.(625-627)Gag>Aag	p.E209K	WFS1_ENST00000503569.1_Missense_Mutation_p.E209K	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	209					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		CCAGGTCAACGAGCACGGTGC	0.642																																																	0								ENSG00000109501						72.0	68.0	69.0					4																	6293088		2201	4300	6501	WFS1	SO:0001583	missense	0			-	HGNC	AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.625G>A	4.37:g.6293088G>A	ENSP00000226760:p.Glu209Lys	Somatic	0	29	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	14	0.00	0	36	18.18	8	NULL	p.E209K	ENST00000226760.1	37	c.625	CCDS3386.1	4	.	.	.	.	.	.	.	.	.	.	G	2.739	-0.262564	0.05754	.	.	ENSG00000109501	ENST00000503569;ENST00000226760	D;D	0.93133	-3.17;-3.17	4.72	2.88	0.33553	.	0.537895	0.20418	N	0.092734	T	0.82079	0.4959	N	0.22421	0.69	0.25225	N	0.989874	P	0.36465	0.554	B	0.23716	0.048	T	0.70565	-0.4837	10	0.15952	T	0.53	-21.8729	5.6307	0.17508	0.2049:0.1636:0.6315:0.0	.	209	O76024	WFS1_HUMAN	K	209	ENSP00000423337:E209K;ENSP00000226760:E209K	ENSP00000226760:E209K	E	+	1	0	WFS1	6343989	0.998000	0.40836	0.996000	0.52242	0.146000	0.21551	2.200000	0.42724	0.372000	0.24591	0.561000	0.74099	GAG	-	NULL		0.642	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFS1	protein_coding	OTTHUMT00000206863.1	G		-		6293088	+1	no_errors	ENST00000226760	ensembl	human	known	74_37	missense	SNP	0.977	A
PHACTR2	9749	genome.wustl.edu	37	6	144104390	144104390	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr6:144104390G>A	ENST00000427704.2	+	10	1777	c.1647G>A	c.(1645-1647)atG>atA	p.M549I	PHACTR2_ENST00000367582.3_Missense_Mutation_p.M480I|PHACTR2_ENST00000367584.4_Missense_Mutation_p.M537I|PHACTR2_ENST00000305766.6_Missense_Mutation_p.M469I|PHACTR2_ENST00000440869.2_Missense_Mutation_p.M560I	NM_001100166.1|NM_014721.2	NP_001093636.1|NP_055536.2	O75167	PHAR2_HUMAN	phosphatase and actin regulator 2	549							protein phosphatase inhibitor activity (GO:0004864)			NS(3)|breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30				OV - Ovarian serous cystadenocarcinoma(155;1.58e-05)|GBM - Glioblastoma multiforme(68;0.0386)		AAGCAAAAATGGAACTTAAAC	0.303																																					Pancreas(12;292 433 7358 48260 52635)|Ovarian(20;501 618 3485 36581 49208)												0								ENSG00000112419						65.0	66.0	66.0					6																	144104390		1968	4141	6109	PHACTR2	SO:0001583	missense	0			-	HGNC	AB014580	CCDS43512.1, CCDS47492.1, CCDS47493.1, CCDS47494.1	6q24.1	2013-01-24	2004-05-20	2004-05-20	ENSG00000112419	ENSG00000112419		"""Phosphatase and actin regulators"""	20956	protein-coding gene	gene with protein product		608724	"""chromosome 6 open reading frame 56"""	C6orf56		9734811, 15107502	Standard	NM_001100164		Approved	KIAA0680	uc010khi.3	O75167	OTTHUMG00000015732	ENST00000427704.2:c.1647G>A	6.37:g.144104390G>A	ENSP00000391763:p.Met549Ile	Somatic	0	24	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17	A6NKP5|A7MCZ5|A8MZC0|B2RWP7|B4DN76|B4DPB5|B4DTH7|Q5TFA0|Q68DM2	Missense_Mutation	SNP	35	0.00	0	42	16.00	8	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.M560I	ENST00000427704.2	37	c.1680	CCDS47492.1	6	.	.	.	.	.	.	.	.	.	.	G	20.7	4.037694	0.75617	.	.	ENSG00000112419	ENST00000367584;ENST00000427704;ENST00000305766;ENST00000440869;ENST00000367582	T;T;T;T;T	0.30182	1.54;1.97;1.56;1.97;1.56	6.16	6.16	0.99307	.	0.173187	0.64402	D	0.000005	T	0.19127	0.0459	N	0.14661	0.345	0.80722	D	1	P;P;D;P	0.53745	0.901;0.744;0.962;0.877	P;B;P;B	0.54499	0.754;0.359;0.496;0.32	T	0.02691	-1.1123	10	0.54805	T	0.06	.	10.3	0.43646	0.1786:0.0:0.8214:0.0	.	560;469;480;549	O75167-4;O75167-5;O75167-2;O75167	.;.;.;PHAR2_HUMAN	I	537;549;469;560;480	ENSP00000356556:M537I;ENSP00000391763:M549I;ENSP00000305530:M469I;ENSP00000417038:M560I;ENSP00000356554:M480I	ENSP00000305530:M469I	M	+	3	0	PHACTR2	144146083	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.087000	0.41653	2.937000	0.99478	0.650000	0.86243	ATG	-	NULL		0.303	PHACTR2-001	KNOWN	basic|CCDS	protein_coding	PHACTR2	protein_coding	OTTHUMT00000042528.2	G	NM_014721	-		144104390	+1	no_errors	ENST00000440869	ensembl	human	known	74_37	missense	SNP	1.000	A
NFIB	4781	genome.wustl.edu	37	9	14120501	14120501	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr9:14120501G>A	ENST00000380959.3	-	8	1656	c.1183C>T	c.(1183-1185)Cct>Tct	p.P395S	NFIB_ENST00000543693.1_Missense_Mutation_p.P143S|NFIB_ENST00000397579.2_Missense_Mutation_p.P395S|NFIB_ENST00000397575.3_Missense_Mutation_p.P395S|NFIB_ENST00000397581.2_Missense_Mutation_p.P395S|NFIB_ENST00000380953.1_Missense_Mutation_p.P395S|NFIB_ENST00000380934.4_Missense_Mutation_p.P421S|NFIB_ENST00000380924.1_Missense_Mutation_p.P143S	NM_005596.3	NP_005587.2	O00712	NFIB_HUMAN	nuclear factor I/B	395					anterior commissure morphogenesis (GO:0021960)|chondrocyte differentiation (GO:0002062)|Clara cell differentiation (GO:0060486)|commissural neuron axon guidance (GO:0071679)|DNA replication (GO:0006260)|glial cell differentiation (GO:0010001)|hindbrain development (GO:0030902)|lung ciliated cell differentiation (GO:0061141)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000795)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|principal sensory nucleus of trigeminal nerve development (GO:0021740)|transcription from RNA polymerase II promoter (GO:0006366)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)	cerebellar mossy fiber (GO:0044300)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		GTATCCTGAGGATTCAGGTGG	0.453			T	"""MYB, HGMA2"""	"""adenoid cystic carcinoma, lipoma"""																																Esophageal Squamous(132;921 1730 14828 40753 46471)			Dom	yes		9	9p24.1	4781	nuclear factor I/B		E	0								ENSG00000147862						231.0	221.0	224.0					9																	14120501		2203	4300	6503	NFIB	SO:0001583	missense	0			-	HGNC	U07810	CCDS6474.1, CCDS55291.1, CCDS55292.1, CCDS65007.1	9p24.1	2008-02-05			ENSG00000147862	ENSG00000147862			7785	protein-coding gene	gene with protein product		600728				7590749	Standard	NM_001190737		Approved	NFI-RED, NFIB2, NFIB3	uc003zlf.3	O00712	OTTHUMG00000021027	ENST00000380959.3:c.1183C>T	9.37:g.14120501G>A	ENSP00000370346:p.Pro395Ser	Somatic	0	108	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	39	42.65	G3V1P1|H7BYE8|O00166|Q12858|Q5VW29|Q63HM5|Q6ZNF9|Q96J45	Missense_Mutation	SNP	32	0.00	0	20	45.95	17	pfam_CTF/NFI,pfam_CTF/NFI_DNA-bd_N,pfam_MAD_homology1_Dwarfin-type,smart_MAD_homology1_Dwarfin-type,pfscan_CTF/NFI_DNA-bd-dom	p.P395S	ENST00000380959.3	37	c.1183	CCDS6474.1	9	.	.	.	.	.	.	.	.	.	.	G	18.72	3.685278	0.68157	.	.	ENSG00000147862	ENST00000380934;ENST00000380959;ENST00000380953;ENST00000397575;ENST00000397581;ENST00000397579;ENST00000543693;ENST00000380924	T;T;T;T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01;-0.01	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.76212	0.3956	L	0.50333	1.59	0.80722	D	1	B;D;D;D	0.69078	0.43;0.975;0.997;0.988	B;P;D;D	0.79108	0.252;0.731;0.992;0.986	T	0.75468	-0.3307	10	0.52906	T	0.07	.	19.8215	0.96599	0.0:0.0:1.0:0.0	.	395;395;395;143	Q5VW27;Q5VW29;O00712;G3V1P1	.;.;NFIB_HUMAN;.	S	421;395;395;395;395;395;143;143	ENSP00000370321:P421S;ENSP00000370346:P395S;ENSP00000370340:P395S;ENSP00000380705:P395S;ENSP00000380711:P395S;ENSP00000380709:P395S;ENSP00000442888:P143S;ENSP00000370311:P143S	ENSP00000370311:P143S	P	-	1	0	NFIB	14110501	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.180000	0.77674	2.679000	0.91253	0.650000	0.86243	CCT	-	pfam_CTF/NFI		0.453	NFIB-001	KNOWN	basic|CCDS	protein_coding	NFIB	protein_coding	OTTHUMT00000055468.1	G	NM_005596	-		14120501	-1	no_errors	ENST00000397581	ensembl	human	known	74_37	missense	SNP	1.000	A
GRIPAP1	56850	genome.wustl.edu	37	X	48832524	48832524	+	Splice_Site	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:48832524C>T	ENST00000376441.1	-	24	2219		c.e24-1		GRIPAP1_ENST00000473581.1_5'Flank|GRIPAP1_ENST00000376444.3_Splice_Site|GRIPAP1_ENST00000376425.3_Splice_Site	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1							blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GGTGCTTCACCTGCAAGATGG	0.602																																																	0								ENSG00000068400						50.0	35.0	40.0					X																	48832524		2203	4300	6503	GRIPAP1	SO:0001630	splice_region_variant	0			-	HGNC	AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.2185-1G>A	X.37:g.48832524C>T		Somatic	0	46	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Splice_Site	SNP	24	0.00	0	35	14.63	6	-	e24-1	ENST00000376441.1	37	c.2185-1	CCDS35248.1	X	.	.	.	.	.	.	.	.	.	.	C	19.40	3.820044	0.71028	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4533	0.67399	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GRIPAP1	48717468	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	6.951000	0.75983	2.107000	0.64212	0.534000	0.68092	.	-	-		0.602	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIPAP1	protein_coding	OTTHUMT00000080970.2	C	NM_207672	-	Intron	48832524	-1	no_errors	ENST00000376441	ensembl	human	known	74_37	splice_site	SNP	1.000	T
DNAH8	1769	genome.wustl.edu	37	6	38746237	38746237	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr6:38746237A>G	ENST00000359357.3	+	12	1639	c.1385A>G	c.(1384-1386)cAa>cGa	p.Q462R	DNAH8_ENST00000441566.1_Missense_Mutation_p.Q462R|DNAH8_ENST00000449981.2_Missense_Mutation_p.Q679R			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	462					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CAGCTACTTCAAAGGTATTCA	0.303																																																	0								ENSG00000124721						67.0	72.0	70.0					6																	38746237		2203	4297	6500	DNAH8	SO:0001583	missense	0			-	HGNC	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1385A>G	6.37:g.38746237A>G	ENSP00000352312:p.Gln462Arg	Somatic	0	39	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	34	19.05	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	39	0.00	0	49	7.55	4	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.Q462R	ENST00000359357.3	37	c.1385		6	.	.	.	.	.	.	.	.	.	.	A	9.231	1.035924	0.19590	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.55588	0.51;0.51;0.51	5.24	5.24	0.73138	Dynein heavy chain, domain-1 (1);	0.071961	0.56097	D	0.000037	T	0.15305	0.0369	N	0.05078	-0.115	0.40792	D	0.983264	B	0.10296	0.003	B	0.14023	0.01	T	0.10800	-1.0614	10	0.15952	T	0.53	.	13.7236	0.62745	1.0:0.0:0.0:0.0	.	462	Q96JB1	DYH8_HUMAN	R	667;667;462;462	ENSP00000333363:Q667R;ENSP00000352312:Q462R;ENSP00000402294:Q462R	ENSP00000333363:Q667R	Q	+	2	0	DNAH8	38854215	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	6.449000	0.73473	1.983000	0.57843	0.455000	0.32223	CAA	-	pfam_Dynein_heavy_dom-1		0.303	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	protein_coding	OTTHUMT00000043574.1	A	NM_001206927	-		38746237	+1	no_errors	ENST00000359357	ensembl	human	known	74_37	missense	SNP	1.000	G
DDX60	55601	genome.wustl.edu	37	4	169227760	169227760	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr4:169227760A>G	ENST00000393743.3	-	5	667	c.376T>C	c.(376-378)Tgc>Cgc	p.C126R		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	126					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		TTTGATAAGCATCTCGAAAAT	0.388																																																	0								ENSG00000137628						88.0	91.0	90.0					4																	169227760		2203	4300	6503	DDX60	SO:0001583	missense	0			-	HGNC	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.376T>C	4.37:g.169227760A>G	ENSP00000377344:p.Cys126Arg	Somatic	0	29	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q6PK35|Q9NVE3	Missense_Mutation	SNP	24	0.00	0	39	27.78	15	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.C126R	ENST00000393743.3	37	c.376	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	A	14.31	2.498238	0.44455	.	.	ENSG00000137628	ENST00000393743	T	0.18502	2.21	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000003	T	0.41627	0.1167	M	0.75264	2.295	0.58432	D	0.999997	D	0.89917	1.0	D	0.77557	0.99	T	0.24764	-1.0151	10	0.41790	T	0.15	.	14.8336	0.70166	1.0:0.0:0.0:0.0	.	126	Q8IY21	DDX60_HUMAN	R	126	ENSP00000377344:C126R	ENSP00000377344:C126R	C	-	1	0	DDX60	169464335	0.999000	0.42202	0.971000	0.41717	0.007000	0.05969	5.815000	0.69215	2.034000	0.60081	0.460000	0.39030	TGC	-	NULL		0.388	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	protein_coding	OTTHUMT00000364622.1	A	NM_017631	-		169227760	-1	no_errors	ENST00000393743	ensembl	human	known	74_37	missense	SNP	0.990	G
SASH1	23328	genome.wustl.edu	37	6	148869496	148869496	+	Silent	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr6:148869496G>T	ENST00000367467.3	+	20	4021	c.3546G>T	c.(3544-3546)gtG>gtT	p.V1182V		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	1182	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TTTCGTCTGTGTCAGATTGGC	0.517																																																	0								ENSG00000111961						128.0	124.0	126.0					6																	148869496		2203	4300	6503	SASH1	SO:0001819	synonymous_variant	0			-	HGNC	AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.3546G>T	6.37:g.148869496G>T		Somatic	0	48	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	25	39.02	Q5TGN5|Q8TAI0|Q9H7R7	Silent	SNP	34	0.00	0	27	47.06	24	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.V1182	ENST00000367467.3	37	c.3546	CCDS5212.1	6																																																																																			-	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.517	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH1	protein_coding	OTTHUMT00000042619.1	G	NM_015278	-		148869496	+1	no_errors	ENST00000367467	ensembl	human	known	74_37	silent	SNP	1.000	T
TC2N	123036	genome.wustl.edu	37	14	92278695	92278695	+	Missense_Mutation	SNP	T	T	C	rs138961717		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr14:92278695T>C	ENST00000435962.2	-	3	585	c.262A>G	c.(262-264)Agg>Ggg	p.R88G	TC2N_ENST00000340892.5_Missense_Mutation_p.R88G|TC2N_ENST00000556018.1_Missense_Mutation_p.R88G|TC2N_ENST00000360594.5_Missense_Mutation_p.R88G	NM_001128596.1	NP_001122068	Q8N9U0	TAC2N_HUMAN	tandem C2 domains, nuclear	88					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(5)|skin(1)|upper_aerodigestive_tract(2)	18				COAD - Colon adenocarcinoma(157;0.218)		TCTTGTGTCCTGGGTTGAATG	0.348																																																	0								ENSG00000165929						116.0	104.0	108.0					14																	92278695		2203	4300	6503	TC2N	SO:0001583	missense	0			-	HGNC	AA243837	CCDS9897.1, CCDS73679.1	14q32.12	2007-10-17	2007-08-17	2007-08-17		ENSG00000165929			19859	protein-coding gene	gene with protein product	"""C2 calcium-dependent domain containing 1"""		"""chromosome 14 open reading frame 47"", ""membrane targeting (tandem) C2 domain containing 1"""	C14orf47, MTAC2D1		11526914	Standard	NM_001128596		Approved	FLJ36557, Tac2-N, C2CD1	uc001xzt.4	Q8N9U0		ENST00000435962.2:c.262A>G	14.37:g.92278695T>C	ENSP00000387882:p.Arg88Gly	Somatic	0	65	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	41	19.61		Missense_Mutation	SNP	45	0.00	0	44	15.38	8	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R88G	ENST00000435962.2	37	c.262	CCDS9897.1	14	.	.	.	.	.	.	.	.	.	.	T	15.98	2.993484	0.54041	.	.	ENSG00000165929	ENST00000435962;ENST00000340892;ENST00000360594;ENST00000556018	T;T;T;T	0.17370	3.2;3.2;3.2;2.28	5.4	2.81	0.32909	.	0.254342	0.44285	D	0.000479	T	0.14743	0.0356	L	0.50333	1.59	0.39000	D	0.959331	B;P	0.36282	0.277;0.546	B;B	0.29267	0.079;0.1	T	0.09907	-1.0653	10	0.87932	D	0	-10.9103	11.6477	0.51271	0.0:0.0:0.2817:0.7183	.	88;88	Q8N9U0-2;Q8N9U0	.;TAC2N_HUMAN	G	88	ENSP00000387882:R88G;ENSP00000343199:R88G;ENSP00000353802:R88G;ENSP00000451317:R88G	ENSP00000343199:R88G	R	-	1	2	TC2N	91348448	0.923000	0.31300	0.979000	0.43373	0.654000	0.38779	1.837000	0.39201	0.846000	0.35142	0.533000	0.62120	AGG	-	NULL		0.348	TC2N-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TC2N	protein_coding	OTTHUMT00000411778.1	T	NM_152332	-		92278695	-1	no_errors	ENST00000340892	ensembl	human	known	74_37	missense	SNP	0.954	C
PELP1	27043	genome.wustl.edu	37	17	4578833	4578833	+	Intron	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:4578833G>A	ENST00000574876.1	-	10	1086				PELP1_ENST00000572293.1_Intron|PELP1_ENST00000436683.2_Intron|PELP1_ENST00000301396.4_Missense_Mutation_p.T442I|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000269230.7_Intron			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1						cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						TGGATGGAAGGTAAGAAGGAT	0.483																																																	0								ENSG00000141456																																			PELP1	SO:0001627	intron_variant	0			-	HGNC		CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.1069-176C>T	17.37:g.4578833G>A		Somatic	0	57	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	68	8.11	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	31	0.00	0	57	9.52	6	pfam_Uncharacterised_NUC202,superfamily_ARM-type_fold	p.T442I	ENST00000574876.1	37	c.1325	CCDS58503.1	17	.	.	.	.	.	.	.	.	.	.	G	6.665	0.491177	0.12702	.	.	ENSG00000141456	ENST00000301396	T	0.49432	0.78	3.94	1.8	0.24995	.	2.095460	0.02333	N	0.074133	T	0.40619	0.1124	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27706	-1.0066	7	0.48119	T	0.1	2.7734	4.13	0.10144	0.4522:0.0:0.5478:0.0	.	.	.	.	I	442	ENSP00000301396:T442I	ENSP00000301396:T442I	T	-	2	0	AC091153.1	4525582	0.000000	0.05858	0.001000	0.08648	0.048000	0.14542	-0.630000	0.05502	0.225000	0.20959	0.561000	0.74099	ACC	-	NULL		0.483	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PELP1	protein_coding	OTTHUMT00000439140.2	G	NM_014389	-		4578833	-1	no_errors	ENST00000301396	ensembl	human	known	74_37	missense	SNP	0.001	A
TNPO1	3842	genome.wustl.edu	37	5	72178316	72178316	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:72178316G>T	ENST00000337273.5	+	10	1369	c.943G>T	c.(943-945)Ggc>Tgc	p.G315C	TNPO1_ENST00000506351.2_Missense_Mutation_p.G307C|TNPO1_ENST00000454282.1_Missense_Mutation_p.G265C|TNPO1_ENST00000447967.2_3'UTR|TNPO1_ENST00000523768.1_Missense_Mutation_p.G265C	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	315					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		GTTAGTGAATGGCATGAAGTA	0.308																																																	0								ENSG00000083312						143.0	152.0	149.0					5																	72178316		2202	4297	6499	TNPO1	SO:0001583	missense	0			-	HGNC	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.943G>T	5.37:g.72178316G>T	ENSP00000336712:p.Gly315Cys	Somatic	0	53	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	40	13.04	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	37	0.00	0	55	5.17	3	pfam_HEAT,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.G315C	ENST00000337273.5	37	c.943	CCDS43329.1	5	.	.	.	.	.	.	.	.	.	.	G	17.09	3.299636	0.60195	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000523768;ENST00000506351	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65831	0.2729	L	0.60012	1.86	0.80722	D	1	B;B	0.20459	0.045;0.024	B;B	0.33339	0.162;0.063	T	0.59979	-0.7352	10	0.33940	T	0.23	-7.8837	19.8609	0.96783	0.0:0.0:1.0:0.0	.	265;315	Q92973-3;Q92973	.;TNPO1_HUMAN	C	315;265;265;307	ENSP00000336712:G315C;ENSP00000398524:G265C;ENSP00000428899:G265C;ENSP00000425118:G307C	ENSP00000336712:G315C	G	+	1	0	TNPO1	72214072	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.405000	0.97313	2.773000	0.95371	0.650000	0.86243	GGC	-	superfamily_ARM-type_fold		0.308	TNPO1-001	KNOWN	basic|CCDS	protein_coding	TNPO1	protein_coding	OTTHUMT00000218577.3	G	NM_002270	-		72178316	+1	no_errors	ENST00000337273	ensembl	human	known	74_37	missense	SNP	1.000	T
XIRP2	129446	genome.wustl.edu	37	2	168099842	168099842	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:168099842C>T	ENST00000409195.1	+	9	2029	c.1940C>T	c.(1939-1941)gCc>gTc	p.A647V	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.A425V|XIRP2_ENST00000295237.9_Missense_Mutation_p.A647V|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	472					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						CCTGAGCTAGCCAGAGGAGAT	0.428																																																	0								ENSG00000163092						62.0	62.0	62.0					2																	168099842		1894	4119	6013	XIRP2	SO:0001583	missense	0			-	HGNC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.1940C>T	2.37:g.168099842C>T	ENSP00000386840:p.Ala647Val	Somatic	0	41	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	30	14.29	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	50	0.00	0	35	32.69	17	pfam_Actin-binding_Xin_repeat	p.A647V	ENST00000409195.1	37	c.1940	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	C	18.37	3.609726	0.66558	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02944	4.1;4.1;4.11	5.93	5.93	0.95920	.	0.106321	0.64402	D	0.000006	T	0.09774	0.0240	L	0.32530	0.975	0.50171	D	0.999855	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.988;0.988	T	0.11518	-1.0584	10	0.46703	T	0.11	-10.18	17.2495	0.87038	0.0:0.8747:0.1253:0.0	.	472;472;425	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	V	647;647;425	ENSP00000386840:A647V;ENSP00000295237:A647V;ENSP00000387255:A425V	ENSP00000295237:A647V	A	+	2	0	XIRP2	167808088	0.738000	0.28186	1.000000	0.80357	0.998000	0.95712	1.476000	0.35420	2.814000	0.96858	0.655000	0.94253	GCC	-	NULL		0.428	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	protein_coding	OTTHUMT00000333547.1	C	NM_152381	-		168099842	+1	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	SNP	1.000	T
CSF1R	1436	genome.wustl.edu	37	5	149450109	149450109	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:149450109G>A	ENST00000286301.3	-	8	1399	c.1108C>T	c.(1108-1110)Cgc>Tgc	p.R370C	CSF1R_ENST00000543093.1_Silent_p.P305P	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	370	Ig-like C2-type 4.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)	p.R370fs*2(2)		NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	GGCTTCAGGCGGGGCAGAGAG	0.597																																																	2	Deletion - Frameshift(2)	large_intestine(2)						ENSG00000182578						23.0	23.0	23.0					5																	149450109		2170	4224	6394	CSF1R	SO:0001583	missense	0			-	HGNC	U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.1108C>T	5.37:g.149450109G>A	ENSP00000286301:p.Arg370Cys	Somatic	0	62	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	47	29.41	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	19	0.00	0	47	28.79	19	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R370C	ENST00000286301.3	37	c.1108	CCDS4302.1	5	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804253	0.90623	.	.	ENSG00000182578	ENST00000286301;ENST00000394307	T	0.28895	1.59	5.58	5.58	0.84498	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.116516	0.39146	N	0.001459	T	0.56396	0.1982	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.98	T	0.59241	-0.7491	10	0.87932	D	0	.	15.0575	0.71925	0.0:0.0:1.0:0.0	.	222;370	B4E2Y8;P07333	.;CSF1R_HUMAN	C	370;222	ENSP00000286301:R370C	ENSP00000286301:R370C	R	-	1	0	CSF1R	149430302	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.561000	0.67339	2.628000	0.89032	0.561000	0.74099	CGC	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,smart_Ig_sub		0.597	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF1R	protein_coding	OTTHUMT00000252329.2	G	NM_005211	-		149450109	-1	no_errors	ENST00000286301	ensembl	human	known	74_37	missense	SNP	1.000	A
XIRP2	129446	genome.wustl.edu	37	2	168099850	168099850	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:168099850G>T	ENST00000409195.1	+	9	2037	c.1948G>T	c.(1948-1950)Gat>Tat	p.D650Y	XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.D428Y|XIRP2_ENST00000295237.9_Missense_Mutation_p.D650Y|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	475					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AGCCAGAGGAGATGTCTGCAC	0.433																																																	0								ENSG00000163092						65.0	64.0	64.0					2																	168099850		1896	4126	6022	XIRP2	SO:0001583	missense	0			-	HGNC	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.1948G>T	2.37:g.168099850G>T	ENSP00000386840:p.Asp650Tyr	Somatic	0	41	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	27	15.62	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	48	0.00	0	38	32.14	18	pfam_Actin-binding_Xin_repeat	p.D650Y	ENST00000409195.1	37	c.1948	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.093298	0.76756	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.17370	2.32;2.32;2.28	5.93	5.93	0.95920	.	0.048340	0.85682	D	0.000000	T	0.48624	0.1510	M	0.84683	2.71	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.51060	-0.8753	10	0.87932	D	0	-19.7607	17.2821	0.87131	0.0:0.125:0.875:0.0	.	475;475;428	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Y	650;650;428	ENSP00000386840:D650Y;ENSP00000295237:D650Y;ENSP00000387255:D428Y	ENSP00000295237:D650Y	D	+	1	0	XIRP2	167808096	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.558000	0.82253	2.814000	0.96858	0.655000	0.94253	GAT	-	NULL		0.433	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	protein_coding	OTTHUMT00000333547.1	G	NM_152381	-		168099850	+1	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	SNP	1.000	T
DOCK6	57572	genome.wustl.edu	37	19	11354335	11354335	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr19:11354335G>A	ENST00000294618.7	-	11	1167	c.1156C>T	c.(1156-1158)Cgc>Tgc	p.R386C		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	386					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CGGCCCAGGCGGGTGCAGAAC	0.667											OREG0025252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000130158						31.0	44.0	39.0					19																	11354335		2124	4230	6354	DOCK6	SO:0001583	missense	0			-	HGNC		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.1156C>T	19.37:g.11354335G>A	ENSP00000294618:p.Arg386Cys	Somatic	0	19	0.00	671	0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	30	16.67	A6H8X5|Q7Z7P4|Q9P2F2	Missense_Mutation	SNP	22	0.00	0	66	10.81	8	pfam_DOCK_C,pfam_DOCK_C/D_N	p.R386C	ENST00000294618.7	37	c.1156	CCDS45975.1	19	.	.	.	.	.	.	.	.	.	.	G	25.6	4.650635	0.87958	.	.	ENSG00000130158	ENST00000294618	T	0.18960	2.18	4.48	3.4	0.38934	.	0.000000	0.64402	D	0.000001	T	0.51329	0.1668	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.60332	-0.7284	10	0.87932	D	0	-20.6242	12.1896	0.54264	0.0:0.0:0.8213:0.1787	.	386	Q96HP0	DOCK6_HUMAN	C	386	ENSP00000294618:R386C	ENSP00000294618:R386C	R	-	1	0	DOCK6	11215335	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	2.574000	0.46016	0.808000	0.34231	0.462000	0.41574	CGC	-	NULL		0.667	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	protein_coding	OTTHUMT00000453155.1	G	NM_020812	-		11354335	-1	no_errors	ENST00000294618	ensembl	human	known	74_37	missense	SNP	1.000	A
SERINC4	619189	genome.wustl.edu	37	15	44088358	44088358	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr15:44088358A>T	ENST00000319327.6	-	9	1369	c.1135T>A	c.(1135-1137)Ttt>Att	p.F379I	SERINC4_ENST00000249714.3_Missense_Mutation_p.F135I|SERF2_ENST00000409646.1_Intron|MIR1282_ENST00000408865.1_RNA|SERF2_ENST00000409291.1_Intron|RP11-296A16.1_ENST00000417761.2_3'UTR|SERINC4_ENST00000299969.6_Missense_Mutation_p.S304R|HYPK_ENST00000406925.1_5'UTR|SERF2_ENST00000594896.1_Intron	NM_001258031.1	NP_001244960.1	A6NH21	SERC4_HUMAN	serine incorporator 4	379					phospholipid biosynthetic process (GO:0008654)	integral component of membrane (GO:0016021)				central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	6		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		GBM - Glioblastoma multiforme(94;7.81e-07)		CTCACCTGAAACTCATAGCTG	0.478																																																	0								ENSG00000184716						118.0	115.0	116.0					15																	44088358		2198	4298	6496	SERINC4	SO:0001583	missense	0			-	HGNC	DQ103711	CCDS58360.1	15q15.3	2013-09-25			ENSG00000184716	ENSG00000184716			32237	protein-coding gene	gene with protein product		614550					Standard	NM_001258031		Approved	FLJ40363	uc031qrp.1	A6NH21	OTTHUMG00000060144	ENST00000319327.6:c.1135T>A	15.37:g.44088358A>T	ENSP00000319796:p.Phe379Ile	Somatic	0	49	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	36	29.41	B2RN41|Q3YL75	Missense_Mutation	SNP	36	0.00	0	30	33.33	15	pfam_TMS_TDE	p.F135I	ENST00000319327.6	37	c.403	CCDS58360.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.71|13.71	2.319664|2.319664	0.41096|0.41096	.|.	.|.	ENSG00000184716|ENSG00000184716	ENST00000319327;ENST00000249714|ENST00000299969	T;T|T	0.12569|0.29917	2.67;2.67|1.55	5.7|5.7	3.4|3.4	0.38934|0.38934	.|.	0.242945|.	0.42172|.	N|.	0.000750|.	T|T	0.28300|0.28300	0.0699|0.0699	L|L	0.58669|0.58669	1.825|1.825	0.80722|0.80722	D|D	1|1	P|B	0.40000|0.26445	0.698|0.149	B|B	0.33295|0.23419	0.161|0.046	T|T	0.12041|0.12041	-1.0563|-1.0563	10|9	0.32370|0.87932	T|D	0.25|0	-4.3126|-4.3126	7.7227|7.7227	0.28742|0.28742	0.7864:0.1411:0.0725:0.0|0.7864:0.1411:0.0725:0.0	.|.	135|304	A6NH21-2|A6NM42	.|.	I|R	379;135|304	ENSP00000319796:F379I;ENSP00000249714:F135I|ENSP00000299969:S304R	ENSP00000249714:F135I|ENSP00000299969:S304R	F|S	-|-	1|3	0|2	SERINC4|SERINC4	41875650|41875650	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.744000|0.744000	0.42396|0.42396	5.611000|5.611000	0.67674|0.67674	0.970000|0.970000	0.38263|0.38263	0.533000|0.533000	0.62120|0.62120	TTT|AGT	-	pfam_TMS_TDE		0.478	SERINC4-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SERINC4	protein_coding	OTTHUMT00000133485.2	A		-		44088358	-1	no_errors	ENST00000249714	ensembl	human	known	74_37	missense	SNP	1.000	T
RBM22	55696	genome.wustl.edu	37	5	150078185	150078185	+	Frame_Shift_Del	DEL	G	G	-	rs551467808		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:150078185delG	ENST00000199814.4	-	4	268	c.147delC	c.(145-147)gccfs	p.A49fs	RBM22_ENST00000540000.1_Intron|RBM22_ENST00000447771.2_Intron	NM_018047.2	NP_060517.1	Q9NW64	RBM22_HUMAN	RNA binding motif protein 22	49					cellular response to drug (GO:0035690)|mRNA cis splicing, via spliceosome (GO:0045292)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of RNA splicing (GO:0033120)|protein import into nucleus, translocation (GO:0000060)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium-dependent protein binding (GO:0048306)|metal ion binding (GO:0046872)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|snRNA binding (GO:0017069)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(4)|ovary(1)	17		Medulloblastoma(196;0.167)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGAATGGCCTGGCACAGATCT	0.478																																																	0								ENSG00000086589						76.0	72.0	73.0					5																	150078185		2203	4300	6503	RBM22	SO:0001589	frameshift_variant	0				HGNC	AL136933	CCDS34278.1	5q33.1	2013-02-12			ENSG00000086589	ENSG00000086589		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	25503	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 47"""	612430				20013661, 19133299	Standard	NM_018047		Approved	FLJ10290, ZC3H16, fSAP47, Cwc2	uc031slu.1	Q9NW64	OTTHUMG00000163589	ENST00000199814.4:c.147delC	5.37:g.150078185delG	ENSP00000199814:p.Ala49fs	Somatic	0	37	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	29	14.71	A6NDM5|B4DLI9|O95607	Frame_Shift_Del	DEL	26	0.00	0	46	17.86	10	pfam_RRM_dom,superfamily_Znf_CCHC,smart_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.R50fs	ENST00000199814.4	37	c.147	CCDS34278.1	5																																																																																			-	superfamily_Znf_CCHC		0.478	RBM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM22	protein_coding	OTTHUMT00000374431.2	G	NM_018047			150078185	-1	no_errors	ENST00000199814	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PHF3	23469	genome.wustl.edu	37	6	64422019	64422019	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr6:64422019A>G	ENST00000262043.3	+	16	4875	c.4535A>G	c.(4534-4536)aAt>aGt	p.N1512S	PHF3_ENST00000393387.1_Missense_Mutation_p.N1512S			Q92576	PHF3_HUMAN	PHD finger protein 3	1512					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AAAACAGATAATGTGGAAGTA	0.328																																					GBM(135;136 1820 29512 34071 46235)												0								ENSG00000118482						46.0	48.0	48.0					6																	64422019		2201	4297	6498	PHF3	SO:0001583	missense	0			-	HGNC	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.4535A>G	6.37:g.64422019A>G	ENSP00000262043:p.Asn1512Ser	Somatic	0	28	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	22	21.43	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	39	0.00	0	48	20.00	12	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.N1512S	ENST00000262043.3	37	c.4535	CCDS4966.1	6	.	.	.	.	.	.	.	.	.	.	A	0.081	-1.184498	0.01620	.	.	ENSG00000118482	ENST00000515594;ENST00000262043;ENST00000393387	T;T;T	0.40756	1.02;2.34;2.34	5.93	-1.49	0.08718	.	0.753768	0.11301	N	0.578188	T	0.06600	0.0169	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36792	-0.9733	10	0.32370	T	0.25	-4.1794	5.5532	0.17101	0.3121:0.4864:0.0726:0.1289	.	1512	Q92576	PHF3_HUMAN	S	781;1512;1512	ENSP00000425338:N781S;ENSP00000262043:N1512S;ENSP00000377048:N1512S	ENSP00000262043:N1512S	N	+	2	0	PHF3	64479978	0.098000	0.21812	0.055000	0.19348	0.011000	0.07611	0.713000	0.25794	-0.110000	0.12022	0.459000	0.35465	AAT	-	NULL		0.328	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF3	protein_coding	OTTHUMT00000041086.2	A		-		64422019	+1	no_errors	ENST00000262043	ensembl	human	known	74_37	missense	SNP	0.000	G
SERPINB3	6317	genome.wustl.edu	37	18	61328304	61328304	+	Silent	SNP	A	A	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr18:61328304A>C	ENST00000283752.5	-	2	290	c.147T>G	c.(145-147)acT>acG	p.T49T	SERPINB11_ENST00000489748.1_RNA|SERPINB3_ENST00000332821.8_Silent_p.T49T	NM_006919.2	NP_008850.1	P29508	SPB3_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 3	49					negative regulation of catalytic activity (GO:0043086)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of peptidase activity (GO:0010466)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle (GO:0031982)	serine-type endopeptidase inhibitor activity (GO:0004867)|virus receptor activity (GO:0001618)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	36						TCTGTTGTGCAGTGTTGTCTT	0.433																																																	0								ENSG00000057149						268.0	234.0	245.0					18																	61328304		2203	4300	6503	SERPINB3	SO:0001819	synonymous_variant	0			-	HGNC	U19568	CCDS11987.1	18q21.3	2014-02-18	2005-08-18		ENSG00000057149	ENSG00000057149		"""Serine (or cysteine) peptidase inhibitors"""	10569	protein-coding gene	gene with protein product		600517	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 3"""	SCC, SCCA1		7724531, 24172014	Standard	NM_006919		Approved	T4-A, HsT1196	uc002lji.3	P29508	OTTHUMG00000060403	ENST00000283752.5:c.147T>G	18.37:g.61328304A>C		Somatic	0	128	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	78	37.60	A6NDM2|B2RBT5|B3W5Y6|Q53H28|Q53YB5|Q86VF3|Q86W04|Q8IWL4|Q8IXI3|Q96J21|Q9BYF8	Silent	SNP	36	0.00	0	36	46.38	32	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.T49	ENST00000283752.5	37	c.147	CCDS11987.1	18																																																																																			-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.433	SERPINB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB3	protein_coding	OTTHUMT00000133791.1	A	NM_006919	-		61328304	-1	no_errors	ENST00000283752	ensembl	human	known	74_37	silent	SNP	0.970	C
CLDN1	9076	genome.wustl.edu	37	3	190027980	190027980	+	Missense_Mutation	SNP	G	G	T	rs181213282		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr3:190027980G>T	ENST00000295522.3	-	3	719	c.451C>A	c.(451-453)Cct>Act	p.P151T		NM_021101.4	NP_066924.1	O95832	CLD1_HUMAN	claudin 1	151					calcium-independent cell-cell adhesion (GO:0016338)|cell adhesion (GO:0007155)|cell-cell junction organization (GO:0045216)|establishment of skin barrier (GO:0061436)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			lung(9)	9	all_cancers(143;2.95e-10)|Ovarian(172;0.0512)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.015)		GGGGTCATAGGGTCATAGAAT	0.388																																																	0								ENSG00000163347						100.0	97.0	98.0					3																	190027980		2203	4300	6503	CLDN1	SO:0001583	missense	0			-	HGNC	AF101051	CCDS3295.1	3q28-q29	2008-07-18			ENSG00000163347	ENSG00000163347		"""Claudins"""	2032	protein-coding gene	gene with protein product	"""senescence-associated epithelial membrane protein 1"""	603718				10828592, 9892664	Standard	NM_021101		Approved	SEMP1, ILVASC	uc003fsh.3	O95832	OTTHUMG00000156214	ENST00000295522.3:c.451C>A	3.37:g.190027980G>T	ENSP00000295522:p.Pro151Thr	Somatic	0	38	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	36	23.40		Missense_Mutation	SNP	39	0.00	0	54	19.40	13	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin1,prints_Claudin14	p.P151T	ENST00000295522.3	37	c.451	CCDS3295.1	3	.	.	.	.	.	.	.	.	.	.	G	26.6	4.751272	0.89753	.	.	ENSG00000163347	ENST00000295522;ENST00000545382	D	0.88896	-2.44	5.81	5.81	0.92471	.	0.224753	0.47455	D	0.000234	D	0.94810	0.8324	M	0.86573	2.825	0.58432	D	0.999994	D	0.57571	0.98	P	0.62740	0.906	D	0.95185	0.8303	10	0.87932	D	0	.	17.5687	0.87928	0.0:0.0:1.0:0.0	.	151	O95832	CLD1_HUMAN	T	151;106	ENSP00000295522:P151T	ENSP00000295522:P151T	P	-	1	0	CLDN1	191510674	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	4.779000	0.62375	2.759000	0.94783	0.591000	0.81541	CCT	-	pfam_PMP22/EMP/MP20/Claudin		0.388	CLDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN1	protein_coding	OTTHUMT00000343516.2	G	NM_021101	-		190027980	-1	no_errors	ENST00000295522	ensembl	human	known	74_37	missense	SNP	0.999	T
MTMR3	8897	genome.wustl.edu	37	22	30387566	30387566	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr22:30387566A>T	ENST00000401950.2	+	7	709	c.367A>T	c.(367-369)Aaa>Taa	p.K123*	MTMR3_ENST00000415511.1_3'UTR|MTMR3_ENST00000333027.3_Nonsense_Mutation_p.K123*|MTMR3_ENST00000351488.3_Nonsense_Mutation_p.K123*|MTMR3_ENST00000406629.1_Nonsense_Mutation_p.K123*|MTMR3_ENST00000323630.5_5'UTR	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	123					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			ACCACCTGCTAAAATAGAAGA	0.458																																																	0								ENSG00000100330						114.0	101.0	105.0					22																	30387566		2203	4300	6503	MTMR3	SO:0001587	stop_gained	0			-	HGNC	U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.367A>T	22.37:g.30387566A>T	ENSP00000384651:p.Lys123*	Somatic	0	56	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Nonsense_Mutation	SNP	28	0.00	0	46	29.23	19	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Tyr_Pase_cat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.K123*	ENST00000401950.2	37	c.367	CCDS13870.1	22	.	.	.	.	.	.	.	.	.	.	A	31	5.090327	0.94149	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000445401;ENST00000351488;ENST00000406629	.	.	.	5.83	5.83	0.93111	.	0.094494	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3877	0.49796	0.8489:0.1511:0.0:0.0	.	.	.	.	X	123	.	ENSP00000331649:K123X	K	+	1	0	MTMR3	28717566	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	5.283000	0.65621	2.225000	0.72522	0.533000	0.62120	AAA	-	NULL		0.458	MTMR3-001	KNOWN	basic|CCDS	protein_coding	MTMR3	protein_coding	OTTHUMT00000322066.1	A	NM_021090	-		30387566	+1	no_errors	ENST00000401950	ensembl	human	known	74_37	nonsense	SNP	1.000	T
GABRR1	2569	genome.wustl.edu	37	6	89890035	89890035	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr6:89890035C>G	ENST00000454853.2	-	9	1232	c.1122G>C	c.(1120-1122)agG>agC	p.R374S	GABRR1_ENST00000369451.3_Missense_Mutation_p.R287S|GABRR1_ENST00000435811.1_Missense_Mutation_p.R357S	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	374					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	TCTGTTCCTTCCTCTCCTGCA	0.557																																																	0								ENSG00000146276						136.0	98.0	111.0					6																	89890035		2203	4300	6503	GABRR1	SO:0001583	missense	0			-	HGNC		CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.1122G>C	6.37:g.89890035C>G	ENSP00000412673:p.Arg374Ser	Somatic	0	63	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	61	19.74	A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Missense_Mutation	SNP	25	0.00	0	38	33.33	19	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAa_rho1_rcpt,prints_Neur_channel,prints_GABAAa_rho_rcpt,tigrfam_Neur_channel	p.R374S	ENST00000454853.2	37	c.1122	CCDS5019.2	6	.	.	.	.	.	.	.	.	.	.	C	15.78	2.933632	0.52866	.	.	ENSG00000146276	ENST00000454853;ENST00000435811;ENST00000369451;ENST00000436331	D;D;D	0.83992	-1.79;-1.79;-1.79	5.25	1.17	0.20885	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	T	0.69441	0.3111	L	0.52364	1.645	0.53005	D	0.999966	P;P	0.41848	0.534;0.763	B;P	0.46208	0.373;0.507	T	0.65191	-0.6228	9	.	.	.	-9.6682	7.4892	0.27452	0.0:0.4581:0.3986:0.1433	.	357;374	P24046-2;P24046	.;GBRR1_HUMAN	S	374;357;287;287	ENSP00000412673:R374S;ENSP00000394687:R357S;ENSP00000358463:R287S	.	R	-	3	2	GABRR1	89946754	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	0.771000	0.26633	0.198000	0.20407	-0.312000	0.09012	AGG	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.557	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRR1	protein_coding	OTTHUMT00000041479.2	C		-		89890035	-1	no_errors	ENST00000454853	ensembl	human	known	74_37	missense	SNP	1.000	G
ANKRD20A11P	391267	genome.wustl.edu	37	21	15304557	15304557	+	IGR	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr21:15304557C>A								CYP4F29P (83872 upstream) : ANKRD20A11P (11532 downstream)																							ACTTGACTTTCCACTTGAAAT	0.338																																																	0								ENSG00000215559																																			ANKRD20A11P	SO:0001628	intergenic_variant	0			-	HGNC																													21.37:g.15304557C>A		Somatic	0	107	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	53	27.40		RNA	SNP	23	0.00	0	48	26.15	17	-	NULL		37	NULL		21																																																																																			-	-	0	0.338					ANKRD20A11P			C		-		15304557	-1	no_errors	ENST00000442192	ensembl	human	known	74_37	rna	SNP	0.156	A
SREK1	140890	genome.wustl.edu	37	5	65475111	65475111	+	IGR	SNP	A	A	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:65475111A>C	ENST00000380918.3	+	0	2433				SREK1_ENST00000334121.6_3'UTR|SREK1_ENST00000284041.3_3'UTR	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						TTTTTATTTCAATATATACAG	0.299																																					GBM(10;31 347 27684 38976 41583)												0								ENSG00000153914																																			SREK1	SO:0001628	intergenic_variant	0			-	HGNC	AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809		5.37:g.65475111A>C		Somatic	0	39	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	31	34.04	A4FTW3|Q2M1J0|Q86X37	RNA	SNP	21	0.00	0	53	27.40	20	-	NULL	ENST00000380918.3	37	NULL	CCDS3991.1	5																																																																																			-	-		0.299	SREK1-002	KNOWN	basic|CCDS	protein_coding	SREK1	protein_coding	OTTHUMT00000381118.1	A	NM_001077199	-		65475111	+1	no_errors	ENST00000284041	ensembl	human	known	74_37	rna	SNP	0.011	C
LINC01105	150622	genome.wustl.edu	37	2	6112272	6112272	+	Silent	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:6112272T>A	ENST00000391666.2	+	1	561	c.216T>A	c.(214-216)tcT>tcA	p.S72S	AC073479.1_ENST00000431188.1_RNA																							CTAAACCATCTGGCAGTGGGG	0.547																																																	0								ENSG00000272268																																			FLJ30594	SO:0001819	synonymous_variant	0			-	Uniprot_gn																												ENST00000391666.2:c.216T>A	2.37:g.6112272T>A		Somatic	0	45	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	39	22.00		Silent	SNP	27	0.00	0	58	9.38	6	NULL	p.S72	ENST00000391666.2	37	c.216		2																																																																																			-	NULL		0.547	FLJ30594-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000272268	protein_coding		T		-		6112272	+1	no_errors	ENST00000391666	ensembl	human	known	74_37	silent	SNP	0.003	A
GDI1	2664	genome.wustl.edu	37	X	153668462	153668462	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:153668462C>G	ENST00000447750.2	+	5	898	c.563C>G	c.(562-564)gCc>gGc	p.A188G		NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	188					negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					ACTGGCCATGCCCTGGCGCTC	0.647																																																	0								ENSG00000203879						203.0	182.0	189.0					X																	153668462		2203	4300	6503	GDI1	SO:0001583	missense	0			-	HGNC	X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.563C>G	X.37:g.153668462C>G	ENSP00000394071:p.Ala188Gly	Somatic	0	57	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	38	19.15	P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Missense_Mutation	SNP	22	0.00	0	31	24.39	10	pfam_GDP_dissociation_inhibitor,prints_RabGDI,prints_GDP_dissociation_inhibitor	p.A188G	ENST00000447750.2	37	c.563	CCDS35452.1	X	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979960	0.74360	.	.	ENSG00000203879	ENST00000447750;ENST00000369741	D	0.91464	-2.85	4.78	4.78	0.61160	.	0.099426	0.64402	D	0.000002	D	0.93939	0.8060	M	0.84773	2.715	0.80722	D	1	P;B	0.36392	0.551;0.175	P;B	0.48840	0.592;0.33	D	0.94447	0.7664	10	0.59425	D	0.04	-12.1045	14.161	0.65446	0.0:1.0:0.0:0.0	.	188;188	B4DH24;P31150	.;GDIA_HUMAN	G	188;172	ENSP00000394071:A188G	ENSP00000358756:A172G	A	+	2	0	GDI1	153321656	1.000000	0.71417	0.910000	0.35882	0.873000	0.50193	7.630000	0.83225	2.212000	0.71576	0.529000	0.55759	GCC	-	pfam_GDP_dissociation_inhibitor,prints_RabGDI		0.647	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDI1	protein_coding	OTTHUMT00000081649.2	C	NM_001493	-		153668462	+1	no_errors	ENST00000447750	ensembl	human	known	74_37	missense	SNP	1.000	G
LAMTOR4	389541	genome.wustl.edu	37	7	99746558	99746558	+	5'UTR	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr7:99746558C>G	ENST00000341942.5	+	0	29				LAMTOR4_ENST00000441173.1_5'Flank	NM_001008395.2	NP_001008396.1	Q0VGL1	LTOR4_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 4						cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)											CGGAAGCTACCTATCTGGTAG	0.647																																																	0								ENSG00000188186						74.0	74.0	74.0					7																	99746558		2203	4300	6503	LAMTOR4	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS34702.1	7q22	2012-09-24	2012-09-24	2012-09-24	ENSG00000188186	ENSG00000188186			33772	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 59"""	C7orf59		22980980	Standard	NM_001008395		Approved		uc003utq.2	Q0VGL1	OTTHUMG00000154854	ENST00000341942.5:c.-38C>G	7.37:g.99746558C>G		Somatic	0	92	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	81	42.96		RNA	SNP	13	0.00	0	44	42.86	33	-	NULL	ENST00000341942.5	37	NULL	CCDS34702.1	7																																																																																			-	-		0.647	LAMTOR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMTOR4	protein_coding	OTTHUMT00000337373.2	C	NM_001008395	-		99746558	+1	no_errors	ENST00000460732	ensembl	human	known	74_37	rna	SNP	0.060	G
HTT	3064	genome.wustl.edu	37	4	3237472	3237472	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr4:3237472G>C	ENST00000355072.5	+	63	8897	c.8752G>C	c.(8752-8754)Gct>Cct	p.A2918P		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2918					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GGCCATGGCGGCTCTGGGCCT	0.612																																																	0								ENSG00000197386						26.0	31.0	29.0					4																	3237472		2126	4239	6365	HTT	SO:0001583	missense	0			-	HGNC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.8752G>C	4.37:g.3237472G>C	ENSP00000347184:p.Ala2918Pro	Somatic	0	22	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	Q9UQB7	Missense_Mutation	SNP	36	0.00	0	38	26.92	14	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.A2918P	ENST00000355072.5	37	c.8752	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.221006	0.95139	.	.	ENSG00000197386	ENST00000355072	T	0.71817	-0.6	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	D	0.84447	0.5474	M	0.79475	2.455	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.86487	0.1795	10	0.87932	D	0	.	17.3306	0.87262	0.0:0.0:1.0:0.0	.	2918	P42858	HD_HUMAN	P	2918	ENSP00000347184:A2918P	ENSP00000347184:A2918P	A	+	1	0	HTT	3207270	1.000000	0.71417	0.957000	0.39632	0.910000	0.53928	9.263000	0.95617	2.571000	0.86741	0.561000	0.74099	GCT	-	NULL		0.612	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	protein_coding	OTTHUMT00000358234.2	G	NM_002111	-		3237472	+1	no_errors	ENST00000355072	ensembl	human	known	74_37	missense	SNP	1.000	C
MPV17	4358	genome.wustl.edu	37	2	27535900	27535900	+	Silent	SNP	G	G	A	rs397507438		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:27535900G>A	ENST00000380044.1	-	3	202	c.147C>T	c.(145-147)ggC>ggT	p.G49G	MPV17_ENST00000405983.1_Silent_p.G64G|MPV17_ENST00000402310.1_Silent_p.G49G|MPV17_ENST00000405076.1_Silent_p.G49G|MPV17_ENST00000233545.2_Silent_p.G49G|MPV17_ENST00000357186.6_Intron|MPV17_ENST00000403262.2_Silent_p.G49G|MPV17_ENST00000402722.1_Missense_Mutation_p.P38S	NM_002437.4	NP_002428.1	P39210	MPV17_HUMAN	MpV17 mitochondrial inner membrane protein	49					cellular response to reactive oxygen species (GO:0034614)|glomerular basement membrane development (GO:0032836)|homeostatic process (GO:0042592)|inner ear development (GO:0048839)|mitochondrial genome maintenance (GO:0000002)|reactive oxygen species metabolic process (GO:0072593)|regulation of reactive oxygen species metabolic process (GO:2000377)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)				lung(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAGAGTCCGGCCTCTCTGGT	0.567																																																	0								ENSG00000115204						112.0	112.0	112.0					2																	27535900		2203	4300	6503	MPV17	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1748.1	2p23.3	2008-02-05	2006-05-12		ENSG00000115204	ENSG00000115204			7224	protein-coding gene	gene with protein product	"""glomerulosclerosis"""	137960	"""MpV17 transgene, murine homolog, glomerulosclerosis"""			8281143, 16582910	Standard	XM_005264326		Approved	SYM1	uc002rjs.3	P39210	OTTHUMG00000097074	ENST00000380044.1:c.147C>T	2.37:g.27535900G>A		Somatic	0	28	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	11.76	D6W555|Q53SY2|Q96B08	Missense_Mutation	SNP	23	0.00	0	39	20.41	10	NULL	p.P38S	ENST00000380044.1	37	c.112	CCDS1748.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.64|11.64	1.699360|1.699360	0.30142|0.30142	.|.	.|.	ENSG00000115204|ENSG00000115204	ENST00000430991|ENST00000402722	.|T	.|0.80738	.|-1.41	5.37|5.37	4.36|4.36	0.52297|0.52297	.|.	.|.	.|.	.|.	.|.	D|D	0.83170|0.83170	0.5196|0.5196	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	D|D	0.83539|0.83539	0.0095|0.0095	4|6	.|0.87932	.|D	.|0	.|.	7.7893|7.7893	0.29110|0.29110	0.1396:0.0:0.8604:0.0|0.1396:0.0:0.8604:0.0	.|.	.|.	.|.	.|.	V|S	26|38	.|ENSP00000386000:P38S	.|ENSP00000386000:P38S	A|P	-|-	2|1	0|0	MPV17|MPV17	27389404|27389404	0.911000|0.911000	0.30947|0.30947	0.978000|0.978000	0.43139|0.43139	0.738000|0.738000	0.42128|0.42128	1.362000|1.362000	0.34148|0.34148	1.247000|1.247000	0.43917|0.43917	0.609000|0.609000	0.83330|0.83330	GCC|CCG	-	NULL		0.567	MPV17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MPV17	protein_coding	OTTHUMT00000214193.1	G	NM_002437	-		27535900	-1	no_errors	ENST00000426513	ensembl	human	known	74_37	missense	SNP	0.993	A
SMYD4	114826	genome.wustl.edu	37	17	1686394	1686394	+	Silent	SNP	G	G	C	rs376113356		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:1686394G>C	ENST00000305513.7	-	10	2363	c.2196C>G	c.(2194-2196)cgC>cgG	p.R732R		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	732							metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						ACGGCCCGTGGCGAACCTCCA	0.512																																																	0								ENSG00000186532						71.0	76.0	74.0					17																	1686394		2203	4300	6503	SMYD4	SO:0001819	synonymous_variant	0			-	HGNC	AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.2196C>G	17.37:g.1686394G>C		Somatic	0	36	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	31	16.22	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Silent	SNP	16	0.00	0	36	25.00	12	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.R732	ENST00000305513.7	37	c.2196	CCDS11013.1	17																																																																																			-	NULL		0.512	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	protein_coding	OTTHUMT00000207108.4	G	XM_056082	-		1686394	-1	no_errors	ENST00000305513	ensembl	human	known	74_37	silent	SNP	0.989	C
CNGA3	1261	genome.wustl.edu	37	2	99013672	99013672	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:99013672G>C	ENST00000272602.2	+	7	2078	c.2039G>C	c.(2038-2040)gGg>gCg	p.G680A	CNGA3_ENST00000409937.1_Missense_Mutation_p.G684A|CNGA3_ENST00000436404.2_Missense_Mutation_p.G662A|CNGA3_ENST00000393504.1_Missense_Mutation_p.G680A			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	680					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						CTGGCTGATGGGGAAGTTCCC	0.552																																																	0								ENSG00000144191						36.0	38.0	37.0					2																	99013672		2202	4300	6502	CNGA3	SO:0001583	missense	0			-	HGNC	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.2039G>C	2.37:g.99013672G>C	ENSP00000272602:p.Gly680Ala	Somatic	0	17	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	10	28.57	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	26	0.00	0	42	32.26	20	pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.G680A	ENST00000272602.2	37	c.2039	CCDS2034.1	2	.	.	.	.	.	.	.	.	.	.	G	9.999	1.232935	0.22626	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97710	-4.37;-4.24;-4.37;-4.5	5.25	1.65	0.23941	.	0.522472	0.21249	N	0.077669	D	0.94228	0.8147	L	0.52364	1.645	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.08055	0.002;0.003;0.003	T	0.81278	-0.1005	10	0.06757	T	0.87	.	11.2096	0.48790	0.0742:0.4355:0.4903:0.0	.	684;662;680	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	A	680;662;680;684	ENSP00000377140:G680A;ENSP00000410070:G662A;ENSP00000272602:G680A;ENSP00000386761:G684A	ENSP00000272602:G680A	G	+	2	0	CNGA3	98380104	0.345000	0.24835	0.000000	0.03702	0.176000	0.22953	0.913000	0.28611	0.451000	0.26802	0.563000	0.77884	GGG	-	NULL		0.552	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNGA3	protein_coding	OTTHUMT00000252986.1	G	NM_001298	-		99013672	+1	no_errors	ENST00000272602	ensembl	human	known	74_37	missense	SNP	0.000	C
MYH1	4619	genome.wustl.edu	37	17	10404994	10404994	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:10404994A>T	ENST00000226207.5	-	26	3359	c.3265T>A	c.(3265-3267)Ttt>Att	p.F1089I	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1089					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTCATTTCAAACTCTTTCCTA	0.358																																																	0								ENSG00000109061						94.0	89.0	91.0					17																	10404994		2203	4299	6502	MYH1	SO:0001583	missense	0			-	HGNC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3265T>A	17.37:g.10404994A>T	ENSP00000226207:p.Phe1089Ile	Somatic	0	35	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	65	17.72	Q14CA4|Q9Y622	Missense_Mutation	SNP	42	0.00	0	61	27.38	23	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F1089I	ENST00000226207.5	37	c.3265	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	A	24.9	4.581058	0.86748	.	.	ENSG00000109061	ENST00000226207	D	0.82526	-1.62	5.51	5.51	0.81932	Myosin tail (1);	0.000000	0.44688	U	0.000440	D	0.90352	0.6981	M	0.85041	2.73	0.80722	D	1	P	0.49696	0.927	P	0.56916	0.809	D	0.91526	0.5238	10	0.59425	D	0.04	.	15.9255	0.79611	1.0:0.0:0.0:0.0	.	1089	P12882	MYH1_HUMAN	I	1089	ENSP00000226207:F1089I	ENSP00000226207:F1089I	F	-	1	0	MYH1	10345719	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.124000	0.77185	2.221000	0.72209	0.528000	0.53228	TTT	-	pfam_Myosin_tail		0.358	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	protein_coding	OTTHUMT00000252725.1	A	NM_005963	-		10404994	-1	no_errors	ENST00000226207	ensembl	human	known	74_37	missense	SNP	1.000	T
COL20A1	57642	genome.wustl.edu	37	20	61956638	61956638	+	Intron	SNP	C	C	A	rs561476739	byFrequency	TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr20:61956638C>A	ENST00000358894.6	+	28	3394				COL20A1_ENST00000326996.6_Silent_p.P1104P|COL20A1_ENST00000435874.1_Intron|COL20A1_ENST00000422202.1_Intron	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					CCGGGCCACCCGGACAGATGG	0.697																																																	0								ENSG00000101203																																			COL20A1	SO:0001627	intron_variant	0			-	HGNC	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.3295-155C>A	20.37:g.61956638C>A		Somatic	0	26	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	11	42.11	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Silent	SNP	17	0.00	0	26	25.71	9	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.P1104	ENST00000358894.6	37	c.3312	CCDS46628.1	20																																																																																			-	pfam_Collagen		0.697	COL20A1-006	KNOWN	basic|CCDS	protein_coding	COL20A1	protein_coding	OTTHUMT00000144595.2	C	NM_020882	-		61956638	+1	no_errors	ENST00000326996	ensembl	human	known	74_37	silent	SNP	0.855	A
NPAS3	64067	genome.wustl.edu	37	14	34243561	34243561	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr14:34243561C>T	ENST00000356141.4	+	8	871	c.871C>T	c.(871-873)Cgg>Tgg	p.R291W	NPAS3_ENST00000551492.1_Missense_Mutation_p.R296W|NPAS3_ENST00000346562.2_Missense_Mutation_p.R259W|NPAS3_ENST00000548645.1_Missense_Mutation_p.R261W|NPAS3_ENST00000357798.5_Missense_Mutation_p.R278W			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	291					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CATAACAGGCCGGCTACGCCT	0.483																																																	0								ENSG00000151322						112.0	96.0	102.0					14																	34243561		2203	4300	6503	NPAS3	SO:0001583	missense	0			-	HGNC	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.871C>T	14.37:g.34243561C>T	ENSP00000348460:p.Arg291Trp	Somatic	0	55	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	37	20.41	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	29	0.00	0	37	19.57	9	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pfscan_PAS,pfscan_bHLH_dom	p.R291W	ENST00000356141.4	37	c.871	CCDS53891.1	14	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966730	0.74131	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73;1.73	5.79	3.86	0.44501	.	0.000000	0.85682	D	0.000000	T	0.53190	0.1781	M	0.83223	2.63	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.79108	0.992;0.982;0.992;0.992	T	0.62478	-0.6846	10	0.87932	D	0	.	14.2703	0.66147	0.3762:0.6238:0.0:0.0	.	261;291;259;278	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	W	268;296;259;261;291;278	ENSP00000448373:R268W;ENSP00000450392:R296W;ENSP00000319610:R259W;ENSP00000448916:R261W;ENSP00000348460:R291W;ENSP00000350446:R278W	ENSP00000319610:R259W	R	+	1	2	NPAS3	33313312	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.659000	0.54489	1.440000	0.47531	0.655000	0.94253	CGG	-	NULL		0.483	NPAS3-004	KNOWN	basic|CCDS	protein_coding	NPAS3	protein_coding	OTTHUMT00000276645.1	C		-		34243561	+1	no_errors	ENST00000356141	ensembl	human	known	74_37	missense	SNP	1.000	T
PTPRH	5794	genome.wustl.edu	37	19	55711640	55711640	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr19:55711640C>A	ENST00000376350.3	-	7	1406	c.1384G>T	c.(1384-1386)Gca>Tca	p.A462S	PTPRH_ENST00000588559.1_5'UTR|PTPRH_ENST00000263434.5_Missense_Mutation_p.A284S	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	462	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		GAGCCACGTGCTCCATTTTTT	0.527																																																	0								ENSG00000080031						153.0	129.0	138.0					19																	55711640		2203	4300	6503	PTPRH	SO:0001583	missense	0			-	HGNC		CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.1384G>T	19.37:g.55711640C>A	ENSP00000365528:p.Ala462Ser	Somatic	0	98	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	86	17.31	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	28	0.00	0	43	23.21	13	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A462S	ENST00000376350.3	37	c.1384	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	C	3.676	-0.066441	0.07273	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	T;T	0.52983	0.64;0.64	2.79	0.476	0.16779	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.28566	0.0707	N	0.14661	0.345	0.09310	N	1	B;B;B	0.23540	0.087;0.071;0.012	B;B;B	0.31101	0.124;0.047;0.029	T	0.31586	-0.9938	9	0.22706	T	0.39	.	7.2725	0.26264	0.4778:0.5222:0.0:0.0	.	284;284;462	C9JCH2;Q9HD43-2;Q9HD43	.;.;PTPRH_HUMAN	S	462;284	ENSP00000365528:A462S;ENSP00000263434:A284S	ENSP00000263434:A284S	A	-	1	0	PTPRH	60403452	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.024000	0.03603	0.208000	0.20626	0.549000	0.68633	GCA	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.527	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	protein_coding	OTTHUMT00000452649.1	C		-		55711640	-1	no_errors	ENST00000376350	ensembl	human	known	74_37	missense	SNP	0.000	A
CNTD1	124817	genome.wustl.edu	37	17	40962300	40962300	+	3'UTR	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:40962300G>A	ENST00000588408.1	+	0	2016				BECN1_ENST00000590099.1_3'UTR|CNTD1_ENST00000315066.5_3'UTR|BECN1_ENST00000361523.4_3'UTR	NM_173478.2	NP_775749.2	Q8N815	CNTD1_HUMAN	cyclin N-terminal domain containing 1											central_nervous_system(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		TAAATTTCAAGCATCTGATCA	0.378																																																	0								ENSG00000176563																																			CNTD1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK097456	CCDS11440.1	17q21.31	2014-07-03	2006-03-31	2006-03-31	ENSG00000176563	ENSG00000176563			26847	protein-coding gene	gene with protein product			"""cyclin N-terminal domain containing"""	CNTD		24891606	Standard	NM_173478		Approved	FLJ40137	uc002ibm.4	Q8N815		ENST00000588408.1:c.*747G>A	17.37:g.40962300G>A		Somatic	0	26	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22	Q658Q6|Q8NEP1	RNA	SNP	36	0.00	0	64	12.16	9	-	NULL	ENST00000588408.1	37	NULL	CCDS11440.1	17																																																																																			-	-		0.378	CNTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTD1	protein_coding	OTTHUMT00000452398.1	G	NM_173478	-		40962300	+1	no_errors	ENST00000315066	ensembl	human	known	74_37	rna	SNP	0.997	A
KDM3B	51780	genome.wustl.edu	37	5	137756482	137756482	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:137756482C>T	ENST00000314358.5	+	15	4003	c.3803C>T	c.(3802-3804)cCg>cTg	p.P1268L	KDM3B_ENST00000394866.1_Missense_Mutation_p.P924L|KDM3B_ENST00000542866.1_Missense_Mutation_p.P300L	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1268					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						AAGGTCTCTCCGCTGACTCCA	0.527																																																	0								ENSG00000120733						93.0	92.0	92.0					5																	137756482		2203	4300	6503	KDM3B	SO:0001583	missense	0			-	HGNC	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.3803C>T	5.37:g.137756482C>T	ENSP00000326563:p.Pro1268Leu	Somatic	0	34	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	50	12.28	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	31	0.00	0	40	16.67	8	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.P1268L	ENST00000314358.5	37	c.3803	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	C	18.60	3.658305	0.67586	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.70631	0.09;-0.5;-0.43	5.76	5.76	0.90799	.	0.209202	0.49916	D	0.000129	T	0.57755	0.2075	N	0.22421	0.69	0.52099	D	0.999947	P;P	0.48640	0.894;0.913	B;B	0.37239	0.244;0.223	T	0.64542	-0.6383	10	0.54805	T	0.06	-14.1501	18.1389	0.89631	0.0:1.0:0.0:0.0	.	924;1268	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	L	1268;1058;924;300	ENSP00000326563:P1268L;ENSP00000378335:P924L;ENSP00000439462:P300L	ENSP00000326563:P1268L	P	+	2	0	KDM3B	137784381	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.027000	0.57239	2.717000	0.92951	0.655000	0.94253	CCG	-	NULL		0.527	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	protein_coding	OTTHUMT00000373597.1	C	NM_016604	-		137756482	+1	no_errors	ENST00000314358	ensembl	human	known	74_37	missense	SNP	1.000	T
C5	727	genome.wustl.edu	37	9	123722535	123722535	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr9:123722535T>A	ENST00000223642.1	-	38	4698	c.4669A>T	c.(4669-4671)Att>Ttt	p.I1557F		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1557	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	CCATATGCAATCTCTGGTTTA	0.333																																																	0								ENSG00000106804						156.0	134.0	142.0					9																	123722535		2203	4300	6503	C5	SO:0001583	missense	0			-	HGNC	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.4669A>T	9.37:g.123722535T>A	ENSP00000223642:p.Ile1557Phe	Somatic	0	38	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	16	30.43	Q14CJ0|Q27I61	Missense_Mutation	SNP	36	0.00	0	37	41.27	26	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_Netrin_module_non-TIMP,pfam_A2M_N,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_TIMP-like_OB-fold,superfamily_A-macroglobulin_rcpt-bd,superfamily_Anaphylatoxin_comp_syst,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn_comp_syst_dom	p.I1557F	ENST00000223642.1	37	c.4669	CCDS6826.1	9	.	.	.	.	.	.	.	.	.	.	T	19.47	3.833586	0.71258	.	.	ENSG00000106804	ENST00000223642	T	0.58506	0.33	5.92	4.78	0.61160	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.152084	0.64402	D	0.000013	T	0.73071	0.3540	M	0.84433	2.695	0.33231	D	0.555946	D	0.58970	0.984	P	0.60541	0.876	T	0.81856	-0.0740	10	0.72032	D	0.01	.	8.7495	0.34607	0.0:0.0851:0.0:0.9149	.	1557	P01031	CO5_HUMAN	F	1557	ENSP00000223642:I1557F	ENSP00000223642:I1557F	I	-	1	0	C5	122762356	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.429000	0.59901	1.062000	0.40625	0.533000	0.62120	ATT	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain		0.333	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5	protein_coding	OTTHUMT00000053844.1	T	NM_001735	-		123722535	-1	no_errors	ENST00000223642	ensembl	human	known	74_37	missense	SNP	1.000	A
ARAP2	116984	genome.wustl.edu	37	4	36166640	36166640	+	Missense_Mutation	SNP	T	T	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr4:36166640T>C	ENST00000303965.4	-	11	2558	c.2069A>G	c.(2068-2070)aAg>aGg	p.K690R		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	690	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						GAACCAAATCTTCTCAGCTAC	0.433																																																	0								ENSG00000047365						141.0	138.0	139.0					4																	36166640		2203	4300	6503	ARAP2	SO:0001583	missense	0			-	HGNC	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.2069A>G	4.37:g.36166640T>C	ENSP00000302895:p.Lys690Arg	Somatic	0	33	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	31	0.00	0	40	21.57	11	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.K690R	ENST00000303965.4	37	c.2069	CCDS3441.1	4	.	.	.	.	.	.	.	.	.	.	T	19.30	3.800401	0.70567	.	.	ENSG00000047365	ENST00000303965	T	0.44083	0.93	6.17	6.17	0.99709	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.56717	0.2004	L	0.39514	1.22	0.40494	D	0.980572	B;D	0.89917	0.201;1.0	B;D	0.87578	0.17;0.998	T	0.53521	-0.8427	10	0.35671	T	0.21	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	620;690	A7E2A5;Q8WZ64	.;ARAP2_HUMAN	R	690	ENSP00000302895:K690R	ENSP00000302895:K690R	K	-	2	0	ARAP2	35843035	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.371000	0.80710	0.533000	0.62120	AAG	-	pfam_ArfGAP,smart_ArfGAP,pfscan_ArfGAP		0.433	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	protein_coding	OTTHUMT00000215074.2	T	NM_015230	-		36166640	-1	no_errors	ENST00000303965	ensembl	human	known	74_37	missense	SNP	1.000	C
DNM1P47	100216544	genome.wustl.edu	37	15	102291831	102291831	+	RNA	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr15:102291831C>A	ENST00000561463.1	+	0	597									DNM1 pseudogene 47																		CACCCAGAACCTGGTGGACTC	0.537																																																	0								ENSG00000259660																																			DNM1P47			0			-	HGNC	AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102291831C>A		Somatic	0	209	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	208	12.24		RNA	SNP	19	0.00	0	37	13.95	6	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			-	-		0.537	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	pseudogene	OTTHUMT00000417589.1	C	NG_009149	-		102291831	+1	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	SNP	1.000	A
GPC4	2239	genome.wustl.edu	37	X	132458181	132458181	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:132458181C>A	ENST00000370828.3	-	3	1227	c.703G>T	c.(703-705)Gtc>Ttc	p.V235F	GPC4_ENST00000535467.1_Missense_Mutation_p.V165F	NM_001448.2	NP_001439.2	O75487	GPC4_HUMAN	glypican 4	235					anatomical structure morphogenesis (GO:0009653)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;0.000127)					ACCACGGAGACCTTGCTCACG	0.428																																																	0								ENSG00000076716						74.0	66.0	69.0					X																	132458181		2203	4300	6503	GPC4	SO:0001583	missense	0			-	HGNC	AF030186	CCDS14637.1	Xq26.1	2008-02-05			ENSG00000076716	ENSG00000076716		"""Proteoglycans / Cell Surface : Glypicans"""	4452	protein-coding gene	gene with protein product	"""glypican proteoglycan 4"""	300168				9787072	Standard	NM_001448		Approved	K-glypican	uc004exc.1	O75487	OTTHUMG00000022434	ENST00000370828.3:c.703G>T	X.37:g.132458181C>A	ENSP00000359864:p.Val235Phe	Somatic	0	26	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B2R6J7|B4E2C0|Q6ZMA6|Q96L43|Q9NU08|Q9UJN1|Q9UPD9	Missense_Mutation	SNP	29	0.00	0	48	26.15	17	pfam_Glypican	p.V235F	ENST00000370828.3	37	c.703	CCDS14637.1	X	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284323	0.80803	.	.	ENSG00000076716	ENST00000370828;ENST00000536418;ENST00000535467	T;T	0.55413	0.52;0.52	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.76884	0.4050	M	0.86268	2.805	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.80042	-0.1548	10	0.87932	D	0	-32.3707	18.3623	0.90379	0.0:1.0:0.0:0.0	.	235	O75487	GPC4_HUMAN	F	235;233;165	ENSP00000359864:V235F;ENSP00000444959:V165F	ENSP00000359864:V235F	V	-	1	0	GPC4	132285847	1.000000	0.71417	1.000000	0.80357	0.576000	0.36127	7.478000	0.81082	2.562000	0.86427	0.600000	0.82982	GTC	-	pfam_Glypican		0.428	GPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC4	protein_coding	OTTHUMT00000058338.1	C	NM_001448	-		132458181	-1	no_errors	ENST00000370828	ensembl	human	known	74_37	missense	SNP	1.000	A
GPR128	84873	genome.wustl.edu	37	3	100356177	100356177	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr3:100356177A>G	ENST00000273352.3	+	6	897	c.629A>G	c.(628-630)cAa>cGa	p.Q210R	GPR128_ENST00000475887.1_5'UTR	NM_032787.2	NP_116176.2	Q96K78	GP128_HUMAN	G protein-coupled receptor 128	210					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	56						ACAGTGAGTCAACTCCTAGAT	0.378																																					Pancreas(87;185 1975 7223 18722)												0								ENSG00000144820						154.0	136.0	142.0					3																	100356177		2203	4300	6503	GPR128	SO:0001583	missense	0			-	HGNC	AK027360	CCDS2938.1	3q12.3	2014-08-08			ENSG00000144820	ENSG00000144820		"""-"", ""GPCR / Class B : Orphans"""	19241	protein-coding gene	gene with protein product		612307					Standard	NM_032787		Approved	FLJ14454	uc003duc.3	Q96K78	OTTHUMG00000159083	ENST00000273352.3:c.629A>G	3.37:g.100356177A>G	ENSP00000273352:p.Gln210Arg	Somatic	0	39	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q14D94|Q86SQ2	Missense_Mutation	SNP	30	0.00	0	51	3.77	2	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.Q210R	ENST00000273352.3	37	c.629	CCDS2938.1	3	.	.	.	.	.	.	.	.	.	.	A	23.5	4.420056	0.83559	.	.	ENSG00000144820	ENST00000273352	T	0.41065	1.01	5.99	5.99	0.97316	.	0.000000	0.56097	D	0.000026	T	0.62853	0.2462	M	0.72118	2.19	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.64597	-0.6370	10	0.52906	T	0.07	.	12.8804	0.58014	1.0:0.0:0.0:0.0	.	210	Q96K78	GP128_HUMAN	R	210	ENSP00000273352:Q210R	ENSP00000273352:Q210R	Q	+	2	0	GPR128	101838867	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.248000	0.58760	2.293000	0.77203	0.528000	0.53228	CAA	-	NULL		0.378	GPR128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR128	protein_coding	OTTHUMT00000353236.1	A		-		100356177	+1	no_errors	ENST00000273352	ensembl	human	known	74_37	missense	SNP	1.000	G
PITPNM3	83394	genome.wustl.edu	37	17	6367059	6367059	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:6367059C>A	ENST00000262483.8	-	17	2386	c.2299G>T	c.(2299-2301)Gtt>Ttt	p.V767F	PITPNM3_ENST00000576664.1_5'UTR|PITPNM3_ENST00000421306.3_Missense_Mutation_p.V731F	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	767					phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CACCGGACAACATCCACTGCA	0.587																																																	0								ENSG00000091622						39.0	36.0	37.0					17																	6367059		2203	4300	6503	PITPNM3	SO:0001583	missense	0			-	HGNC	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.2299G>T	17.37:g.6367059C>A	ENSP00000262483:p.Val767Phe	Somatic	0	42	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	48	29.41	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Missense_Mutation	SNP	28	0.00	0	47	24.19	15	pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD	p.V767F	ENST00000262483.8	37	c.2299	CCDS11076.1	17	.	.	.	.	.	.	.	.	.	.	C	29.4	5.007082	0.93287	.	.	ENSG00000091622	ENST00000262483;ENST00000421306	T;T	0.79653	-1.29;-1.29	5.09	5.09	0.68999	HAD-like domain (2);LNS2, Lipin/Ned1/Smp2 (2);	0.000000	0.85682	D	0.000000	D	0.91064	0.7188	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.92750	0.6215	10	0.87932	D	0	.	15.9863	0.80155	0.0:1.0:0.0:0.0	.	731;767	F8WEW5;Q9BZ71	.;PITM3_HUMAN	F	767;731	ENSP00000262483:V767F;ENSP00000407882:V731F	ENSP00000262483:V767F	V	-	1	0	PITPNM3	6307783	1.000000	0.71417	0.992000	0.48379	0.944000	0.59088	7.770000	0.85390	2.378000	0.81104	0.561000	0.74099	GTT	-	pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2		0.587	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PITPNM3	protein_coding	OTTHUMT00000219824.2	C	NM_031220	-		6367059	-1	no_errors	ENST00000262483	ensembl	human	known	74_37	missense	SNP	1.000	A
PEG3	5178	genome.wustl.edu	37	19	57333112	57333112	+	Silent	SNP	C	C	T	rs550751491	byFrequency	TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr19:57333112C>T	ENST00000326441.9	-	7	939	c.576G>A	c.(574-576)ccG>ccA	p.P192P	ZIM2_ENST00000599935.1_Silent_p.P67P|PEG3_ENST00000593695.1_Silent_p.P66P|ZIM2_ENST00000221722.5_Silent_p.P67P|ZIM2_ENST00000601070.1_Silent_p.P67P|PEG3_ENST00000594706.1_5'Flank|ZIM2_ENST00000593711.1_Silent_p.P67P|ZIM2_ENST00000391708.3_Silent_p.P67P|PEG3_ENST00000423103.2_Silent_p.P192P|PEG3_ENST00000598410.1_Silent_p.P67P	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	192					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AAAGATCCCGCGGAGGCATCC	0.547													C|||	5	0.000998403	0.0008	0.0	5008	,	,		17577	0.0		0.0	False		,,,				2504	0.0041																0								ENSG00000198300						124.0	114.0	118.0					19																	57333112		2203	4300	6503	PEG3	SO:0001819	synonymous_variant	0			-	HGNC	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.576G>A	19.37:g.57333112C>T		Somatic	0	42	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	31	22.50	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	33	0.00	0	42	17.31	9	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.P192	ENST00000326441.9	37	c.576	CCDS12948.1	19																																																																																			-	NULL		0.547	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	protein_coding	OTTHUMT00000416099.2	C		-		57333112	-1	no_errors	ENST00000326441	ensembl	human	known	74_37	silent	SNP	0.038	T
TMEM132C	92293	genome.wustl.edu	37	12	129190514	129190514	+	Missense_Mutation	SNP	G	G	A	rs528438138	byFrequency	TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr12:129190514G>A	ENST00000435159.2	+	9	3001	c.3001G>A	c.(3001-3003)Gga>Aga	p.G1001R	TMEM132C_ENST00000315208.8_Missense_Mutation_p.G617R|TMEM132C_ENST00000537538.1_Missense_Mutation_p.G386R	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	1001						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						CATAGACCGCGGACCGGGGGC	0.657													G|||	2	0.000399361	0.0008	0.0	5008	,	,		15612	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000181234						19.0	28.0	25.0					12																	129190514		692	1591	2283	TMEM132C	SO:0001583	missense	0			-	HGNC	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.3001G>A	12.37:g.129190514G>A	ENSP00000410852:p.Gly1001Arg	Somatic	0	52	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	41	32.79	Q69YX8	Missense_Mutation	SNP	26	0.00	0	17	29.17	7	NULL	p.G1001R	ENST00000435159.2	37	c.3001		12	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700574	0.48307	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.10382	3.66;3.32;2.88	4.62	3.73	0.42828	.	0.089625	0.47093	N	0.000243	T	0.30166	0.0756	M	0.75264	2.295	0.45567	D	0.998511	D	0.89917	1.0	D	0.85130	0.997	T	0.02138	-1.1207	10	0.31617	T	0.26	.	12.5472	0.56206	0.082:0.0:0.918:0.0	.	1001	Q8N3T6	T132C_HUMAN	R	1001;617;386	ENSP00000410852:G1001R;ENSP00000324458:G617R;ENSP00000438477:G386R	ENSP00000324458:G617R	G	+	1	0	TMEM132C	127756467	1.000000	0.71417	0.341000	0.25589	0.325000	0.28411	4.220000	0.58567	0.938000	0.37419	0.561000	0.74099	GGA	-	NULL		0.657	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	TMEM132C	protein_coding		G	XM_044062	-		129190514	+1	no_errors	ENST00000435159	ensembl	human	known	74_37	missense	SNP	0.996	A
ANK3	288	genome.wustl.edu	37	10	61932115	61932115	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr10:61932115G>A	ENST00000280772.2	-	21	2620	c.2429C>T	c.(2428-2430)tCa>tTa	p.S810L	ANK3_ENST00000373827.2_Missense_Mutation_p.S804L|ANK3_ENST00000503366.1_Missense_Mutation_p.S793L	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	810					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTCCACTACTGAGATGTAGCC	0.483																																																	0								ENSG00000151150						124.0	115.0	118.0					10																	61932115		2203	4300	6503	ANK3	SO:0001583	missense	0			-	HGNC	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.2429C>T	10.37:g.61932115G>A	ENSP00000280772:p.Ser810Leu	Somatic	0	41	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	9	67.86	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	29	0.00	0	11	73.17	30	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.S810L	ENST00000280772.2	37	c.2429	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	G	33	5.285386	0.95517	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000536348	T;T;T	0.25749	2.33;1.78;1.78	5.78	5.78	0.91487	Ankyrin repeat-containing domain (3);	0.000000	0.33382	N	0.004964	T	0.44265	0.1285	L	0.34521	1.04	0.80722	D	1	B;D;D;D;D	0.89917	0.379;0.994;1.0;1.0;1.0	B;D;D;D;D	0.91635	0.171;0.974;0.994;0.999;0.997	T	0.32561	-0.9902	10	0.87932	D	0	.	20.0175	0.97485	0.0:0.0:1.0:0.0	.	793;471;354;804;810	E9PE32;E7EMJ1;Q59G01;Q5CZH9;Q12955	.;.;.;.;ANK3_HUMAN	L	810;804;793;772;45;471;466;354	ENSP00000280772:S810L;ENSP00000362933:S804L;ENSP00000425236:S793L	ENSP00000280772:S810L	S	-	2	0	ANK3	61602121	1.000000	0.71417	0.991000	0.47740	0.801000	0.45260	9.799000	0.99117	2.730000	0.93505	0.650000	0.86243	TCA	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.483	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	protein_coding	OTTHUMT00000048201.4	G	NM_020987	-		61932115	-1	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	SNP	1.000	A
EML5	161436	genome.wustl.edu	37	14	89202895	89202895	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr14:89202895T>A	ENST00000380664.5	-	7	861	c.862A>T	c.(862-864)Agt>Tgt	p.S288C	EML5_ENST00000554922.1_Missense_Mutation_p.S288C|EML5_ENST00000352093.5_Missense_Mutation_p.S288C			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	288						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CAACACACACTCCTTACAGAC	0.368																																																	0								ENSG00000165521						115.0	110.0	112.0					14																	89202895		1860	4087	5947	EML5	SO:0001583	missense	0			-	HGNC	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.862A>T	14.37:g.89202895T>A	ENSP00000370039:p.Ser288Cys	Somatic	0	36	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	22.22	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	31	0.00	0	42	10.64	5	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S288C	ENST00000380664.5	37	c.862	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	T	23.1	4.371468	0.82573	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.01505	4.82;4.82;4.97	5.15	5.15	0.70609	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.09555	0.0235	M	0.77820	2.39	0.58432	D	0.999997	D	0.71674	0.998	D	0.64595	0.927	T	0.01382	-1.1369	10	0.51188	T	0.08	-20.6239	15.1382	0.72586	0.0:0.0:0.0:1.0	.	288	Q05BV3	EMAL5_HUMAN	C	288	ENSP00000451998:S288C;ENSP00000298315:S288C;ENSP00000370039:S288C	ENSP00000298315:S288C	S	-	1	0	EML5	88272648	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.525000	0.81892	2.166000	0.68216	0.533000	0.62120	AGT	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.368	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	protein_coding	OTTHUMT00000410491.1	T		-		89202895	-1	no_errors	ENST00000554922	ensembl	human	known	74_37	missense	SNP	1.000	A
PCDHB4	56131	genome.wustl.edu	37	5	140502563	140502563	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:140502563G>T	ENST00000194152.1	+	1	983	c.983G>T	c.(982-984)gGa>gTa	p.G328V	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	328	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCCTTTCTGGAAAAGGCACT	0.418																																																	0								ENSG00000081818						165.0	179.0	174.0					5																	140502563		2203	4300	6503	PCDHB4	SO:0001583	missense	0			-	HGNC	AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.983G>T	5.37:g.140502563G>T	ENSP00000194152:p.Gly328Val	Somatic	0	15	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32	Q4V761	Missense_Mutation	SNP	28	0.00	0	47	12.96	7	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G328V	ENST00000194152.1	37	c.983	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508572	0.44660	.	.	ENSG00000081818	ENST00000194152	T	0.55413	0.52	4.41	4.41	0.53225	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.73705	0.3621	M	0.85462	2.755	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.77384	-0.2608	9	0.56958	D	0.05	.	13.4541	0.61189	0.0:0.2701:0.7299:0.0	.	328	Q9Y5E5	PCDB4_HUMAN	V	328	ENSP00000194152:G328V	ENSP00000194152:G328V	G	+	2	0	PCDHB4	140482747	0.010000	0.17322	0.994000	0.49952	0.990000	0.78478	1.202000	0.32271	2.449000	0.82847	0.650000	0.86243	GGA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin		0.418	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	protein_coding	OTTHUMT00000251812.2	G	NM_018938	-		140502563	+1	no_errors	ENST00000194152	ensembl	human	known	74_37	missense	SNP	0.879	T
KRT16P6	353194	genome.wustl.edu	37	17	16725652	16725652	+	RNA	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:16725652A>T	ENST00000417510.1	-	0	241																											GGAGGAGGAGACAGACAGGCC	0.697																																																	0								ENSG00000226145																																			AC022596.6			0			-	Clone_based_vega_gene																													17.37:g.16725652A>T		Somatic	0	180	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	386	10.60		RNA	SNP	38	0.00	0	101	6.48	7	-	NULL	ENST00000417510.1	37	NULL		17																																																																																			-	-		0.697	AC022596.6-002	KNOWN	basic	processed_transcript	ENSG00000226145	pseudogene	OTTHUMT00000131123.1	A		-		16725652	-1	no_errors	ENST00000417510	ensembl	human	known	74_37	rna	SNP	0.778	T
TMEM99	147184	genome.wustl.edu	37	17	38991131	38991131	+	Silent	SNP	T	T	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:38991131T>C	ENST00000301665.3	+	3	667	c.363T>C	c.(361-363)caT>caC	p.H121H		NM_001195386.1|NM_001195387.1|NM_145274.3	NP_001182315.1|NP_001182316.1|NP_660317.2	Q8N816	TMM99_HUMAN	transmembrane protein 99	121						integral component of membrane (GO:0016021)				cervix(1)|large_intestine(1)|lung(5)|skin(2)|urinary_tract(1)	10		Breast(137;0.000301)				TTTCTCTTCATCTTCAACAAG	0.507																																																	0								ENSG00000167920						127.0	126.0	126.0					17																	38991131		1936	4142	6078	TMEM99	SO:0001819	synonymous_variant	0			-	HGNC	AK097454	CCDS42319.1	17q21.2	2008-11-06			ENSG00000167920	ENSG00000167920			28305	protein-coding gene	gene with protein product						12477932	Standard	NM_001195386		Approved	MGC21518	uc021txc.1	Q8N816	OTTHUMG00000133579	ENST00000301665.3:c.363T>C	17.37:g.38991131T>C		Somatic	0	42	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	B4DQ34|Q96BP9	Silent	SNP	20	0.00	0	42	22.22	12	NULL	p.H121	ENST00000301665.3	37	c.363	CCDS42319.1	17																																																																																			-	NULL		0.507	TMEM99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM99	protein_coding	OTTHUMT00000257681.1	T	NM_145274	-		38991131	+1	no_errors	ENST00000301665	ensembl	human	known	74_37	silent	SNP	0.073	C
RIOK2	55781	genome.wustl.edu	37	5	96512975	96512975	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:96512975C>T	ENST00000283109.3	-	4	411	c.343G>A	c.(343-345)Gaa>Aaa	p.E115K	RIOK2_ENST00000508447.1_Missense_Mutation_p.E115K|RNU1-73P_ENST00000383971.1_RNA|CTD-2215E18.1_ENST00000509481.1_Intron	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	115							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TGTCCTTCTTCATTTGCAACA	0.299																																																	0								ENSG00000058729						116.0	120.0	119.0					5																	96512975		2202	4299	6501	RIOK2	SO:0001583	missense	0			-	HGNC	AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.343G>A	5.37:g.96512975C>T	ENSP00000283109:p.Glu115Lys	Somatic	0	39	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	20	39.39	D6RDI3|Q9NUT0	Missense_Mutation	SNP	44	0.00	0	44	41.33	31	pfam_RIO-like_kinase,pfam_RIO2_kinase_winged_hlx_N,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase	p.E115K	ENST00000283109.3	37	c.343	CCDS4089.1	5	.	.	.	.	.	.	.	.	.	.	C	26.9	4.783545	0.90282	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.06933	3.24;3.24	5.62	4.75	0.60458	Protein kinase-like domain (1);RIO-like kinase (1);	0.102386	0.64402	D	0.000003	T	0.27278	0.0669	M	0.75615	2.305	0.53005	D	0.999961	P;D	0.67145	0.89;0.996	P;D	0.66979	0.649;0.948	T	0.01648	-1.1304	10	0.51188	T	0.08	-16.4628	14.3674	0.66815	0.0:0.9279:0.0:0.0721	.	115;115	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	K	115	ENSP00000283109:E115K;ENSP00000420932:E115K	ENSP00000283109:E115K	E	-	1	0	RIOK2	96538731	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.552000	0.53705	1.374000	0.46228	0.557000	0.71058	GAA	-	pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase		0.299	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK2	protein_coding	OTTHUMT00000250628.1	C	NM_018343	-		96512975	-1	no_errors	ENST00000283109	ensembl	human	known	74_37	missense	SNP	1.000	T
AGTR2	186	genome.wustl.edu	37	X	115303840	115303840	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:115303840T>A	ENST00000371906.4	+	3	497	c.307T>A	c.(307-309)Tat>Aat	p.Y103N		NM_000686.4	NP_000677.2	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	103					aldosterone secretion (GO:0035932)|angiotensin-activated signaling pathway (GO:0038166)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|brain renin-angiotensin system (GO:0002035)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell surface receptor signaling pathway (GO:0007166)|cellular response to dexamethasone stimulus (GO:0071549)|cellular sodium ion homeostasis (GO:0006883)|cerebellar cortex development (GO:0021695)|dopamine biosynthetic process (GO:0042416)|exploration behavior (GO:0035640)|extracellular negative regulation of signal transduction (GO:1900116)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of heart rate (GO:0010459)|negative regulation of icosanoid secretion (GO:0032304)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of norepinephrine secretion (GO:0010700)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasodilation (GO:0045909)|regulation of blood pressure (GO:0008217)|regulation of metanephros size (GO:0035566)|regulation of systemic arterial blood pressure by circulatory renin-angiotensin (GO:0001991)|regulation of transcription factor import into nucleus (GO:0042990)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to organonitrogen compound (GO:0010243)|vasodilation by angiotensin involved in regulation of systemic arterial blood pressure (GO:0002033)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	angiotensin type II receptor activity (GO:0004945)|peptide hormone binding (GO:0017046)|receptor antagonist activity (GO:0048019)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|skin(1)	24					Tasosartan(DB01349)	ATGGGCAACCTATTATTCTTA	0.383																																																	0								ENSG00000180772						175.0	171.0	172.0					X																	115303840		2203	4300	6503	AGTR2	SO:0001583	missense	0			-	HGNC	AY324607	CCDS14569.1	Xq22-q23	2012-08-08			ENSG00000180772	ENSG00000180772		"""GPCR / Class A : Angiotensin receptors"""	338	protein-coding gene	gene with protein product		300034	"""angiotensin receptor 2"""			1550596	Standard	NM_000686		Approved	AT2, MRX88	uc004eqh.4	P50052	OTTHUMG00000022243	ENST00000371906.4:c.307T>A	X.37:g.115303840T>A	ENSP00000360973:p.Tyr103Asn	Somatic	0	57	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	22	31.25	B2R9V1|Q13016|Q6FGY7	Missense_Mutation	SNP	36	0.00	0	44	29.03	18	pfam_GPCR_Rhodpsn,prints_ATII_AT2_rcpt,prints_GPCR_Rhodpsn,prints_ATII_rcpt,prints_Brdyknn_rcpt,prints_Chemokine_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.Y103N	ENST00000371906.4	37	c.307	CCDS14569.1	X	.	.	.	.	.	.	.	.	.	.	T	17.37	3.371963	0.61624	.	.	ENSG00000180772	ENST00000371906	T	0.73152	-0.72	4.48	4.48	0.54585	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.79058	0.4382	L	0.53617	1.68	0.54753	D	0.999984	D	0.89917	1.0	D	0.81914	0.995	T	0.80643	-0.1291	10	0.87932	D	0	-8.1472	10.7502	0.46205	0.0:0.0:0.0:1.0	.	103	P50052	AGTR2_HUMAN	N	103	ENSP00000360973:Y103N	ENSP00000360973:Y103N	Y	+	1	0	AGTR2	115217868	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.746000	0.85057	1.659000	0.50751	0.412000	0.27726	TAT	-	pfam_GPCR_Rhodpsn,prints_ATII_rcpt,prints_Brdyknn_rcpt,prints_Chemokine_rcpt,pfscan_GPCR_Rhodpsn_7TM		0.383	AGTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGTR2	protein_coding	OTTHUMT00000057984.1	T	NM_000686	-		115303840	+1	no_errors	ENST00000371906	ensembl	human	known	74_37	missense	SNP	0.986	A
TENM1	10178	genome.wustl.edu	37	X	123780640	123780640	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:123780640T>A	ENST00000371130.3	-	9	1663	c.1600A>T	c.(1600-1602)Acc>Tcc	p.T534S	TENM1_ENST00000422452.2_Missense_Mutation_p.T534S	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	534	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TTGCAATTGGTTGAACAGTCA	0.373																																																	0								ENSG00000009694						100.0	76.0	84.0					X																	123780640		2203	4300	6503	TENM1	SO:0001583	missense	0			-	HGNC	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.1600A>T	X.37:g.123780640T>A	ENSP00000360171:p.Thr534Ser	Somatic	0	35	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	22	37.14	B2RTR5|Q5JZ17	Missense_Mutation	SNP	35	0.00	0	31	38.00	19	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.T534S	ENST00000371130.3	37	c.1600	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	T	14.94	2.685506	0.47991	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.65732	-0.17;-0.17	5.75	5.75	0.90469	EGF, extracellular (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.124122	0.53938	D	0.000056	T	0.34629	0.0904	N	0.02334	-0.595	0.47698	D	0.999497	B;B;B	0.25719	0.132;0.031;0.012	B;B;B	0.20767	0.031;0.015;0.008	T	0.36065	-0.9763	10	0.09338	T	0.73	.	15.0069	0.71519	0.0:0.0:0.0:1.0	.	533;534;534	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	S	534	ENSP00000360171:T534S;ENSP00000403954:T534S	ENSP00000360171:T534S	T	-	1	0	ODZ1	123608321	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	4.040000	0.57333	1.926000	0.55796	0.481000	0.45027	ACC	-	pfam_EGF_extracell,smart_EG-like_dom		0.373	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	protein_coding	OTTHUMT00000058985.1	T	NM_014253	-		123780640	-1	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	SNP	0.997	A
IRS1	3667	genome.wustl.edu	37	2	227660538	227660538	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:227660538C>G	ENST00000305123.5	-	1	3937	c.2917G>C	c.(2917-2919)Gct>Cct	p.A973P	IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	973					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CAAATGCTAGCAGCCCCGGGA	0.662																																																	0								ENSG00000169047						43.0	49.0	47.0					2																	227660538		2202	4300	6502	IRS1	SO:0001583	missense	0			-	HGNC		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.2917G>C	2.37:g.227660538C>G	ENSP00000304895:p.Ala973Pro	Somatic	0	28	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.67		Missense_Mutation	SNP	25	0.00	0	34	19.05	8	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.A973P	ENST00000305123.5	37	c.2917	CCDS2463.1	2	.	.	.	.	.	.	.	.	.	.	C	10.32	1.316731	0.23908	.	.	ENSG00000169047	ENST00000305123	T	0.59083	0.29	5.39	0.474	0.16768	.	0.782790	0.11189	N	0.590064	T	0.27663	0.0680	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14172	-1.0482	10	0.20046	T	0.44	-0.6831	0.3946	0.00416	0.2667:0.2974:0.13:0.3059	.	973	P35568	IRS1_HUMAN	P	973	ENSP00000304895:A973P	ENSP00000304895:A973P	A	-	1	0	IRS1	227368782	0.000000	0.05858	0.001000	0.08648	0.835000	0.47333	-1.072000	0.03434	-0.094000	0.12374	-0.150000	0.13652	GCT	-	NULL		0.662	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	protein_coding	OTTHUMT00000256886.3	C	NM_005544	-		227660538	-1	no_errors	ENST00000305123	ensembl	human	known	74_37	missense	SNP	0.000	G
PRSS35	167681	genome.wustl.edu	37	6	84234250	84234250	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr6:84234250C>G	ENST00000369700.3	+	2	1267	c.1090C>G	c.(1090-1092)Cgc>Ggc	p.R364G	PRSS35_ENST00000536636.1_Missense_Mutation_p.R364G	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	364	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		GAATTGGAAGCGCAAAATCAT	0.512																																																	0								ENSG00000146250						79.0	76.0	77.0					6																	84234250		2203	4300	6503	PRSS35	SO:0001583	missense	0			-	HGNC	BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.1090C>G	6.37:g.84234250C>G	ENSP00000358714:p.Arg364Gly	Somatic	0	26	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	13	38.10	A8K7B3|Q9BQP6	Missense_Mutation	SNP	28	0.00	0	35	31.37	16	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom	p.R364G	ENST00000369700.3	37	c.1090	CCDS4999.1	6	.	.	.	.	.	.	.	.	.	.	C	18.24	3.579383	0.65878	.	.	ENSG00000146250	ENST00000536636;ENST00000369700	T;T	0.26810	1.71;1.71	5.91	4.99	0.66335	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (1);	0.000000	0.85682	D	0.000000	T	0.45518	0.1346	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.45086	-0.9285	10	0.87932	D	0	-24.5883	13.7183	0.62712	0.2695:0.7305:0.0:0.0	.	364	Q8N3Z0	PRS35_HUMAN	G	364	ENSP00000440870:R364G;ENSP00000358714:R364G	ENSP00000358714:R364G	R	+	1	0	PRSS35	84290969	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	2.248000	0.43160	2.804000	0.96469	0.462000	0.41574	CGC	-	superfamily_Trypsin-like_Pept_dom		0.512	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS35	protein_coding	OTTHUMT00000041352.1	C	NM_153362	-		84234250	+1	no_errors	ENST00000369700	ensembl	human	known	74_37	missense	SNP	1.000	G
OR4A5	81318	genome.wustl.edu	37	11	51412386	51412386	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr11:51412386T>A	ENST00000319760.6	-	1	62	c.10A>T	c.(10-12)Aat>Tat	p.N4Y		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				ATATTGTTATTCTGTCTCATT	0.388																																																	0								ENSG00000221840						22.0	21.0	21.0					11																	51412386		2197	4289	6486	OR4A5	SO:0001583	missense	0			-	HGNC	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.10A>T	11.37:g.51412386T>A	ENSP00000367664:p.Asn4Tyr	Somatic	0	18	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	Q6IF84	Missense_Mutation	SNP	31	0.00	0	40	35.48	22	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N4Y	ENST00000319760.6	37	c.10	CCDS31497.1	11	.	.	.	.	.	.	.	.	.	.	.	4.342	0.062993	0.08388	.	.	ENSG00000221840	ENST00000319760	T	0.00518	6.86	2.0	0.844	0.18943	.	0.384197	0.21974	N	0.066411	T	0.00356	0.0011	L	0.33339	1.005	0.09310	N	1	B	0.33212	0.402	B	0.32211	0.142	T	0.49428	-0.8941	10	0.66056	D	0.02	.	5.2415	0.15473	0.0:0.1672:0.0:0.8328	.	4	Q8NH83	OR4A5_HUMAN	Y	4	ENSP00000367664:N4Y	ENSP00000367664:N4Y	N	-	1	0	OR4A5	51268962	0.000000	0.05858	0.014000	0.15608	0.166000	0.22503	0.212000	0.17497	0.236000	0.21180	0.136000	0.15936	AAT	-	NULL		0.388	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	protein_coding	OTTHUMT00000391399.1	T	NM_001005272	-		51412386	-1	no_errors	ENST00000319760	ensembl	human	known	74_37	missense	SNP	0.129	A
MUS81	80198	genome.wustl.edu	37	11	65633285	65633285	+	Silent	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr11:65633285C>T	ENST00000308110.4	+	15	1858	c.1509C>T	c.(1507-1509)ctC>ctT	p.L503L	MUS81_ENST00000533035.1_Silent_p.L428L|EFEMP2_ENST00000532648.1_5'Flank	NM_025128.4	NP_079404.3	Q96NY9	MUS81_HUMAN	MUS81 structure-specific endonuclease subunit	503					DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	intercellular bridge (GO:0045171)|nucleus (GO:0005634)	3'-flap endonuclease activity (GO:0048257)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	13				READ - Rectum adenocarcinoma(159;0.166)		CCCCCAGCCTCCTGGCCGCCT	0.612								Homologous recombination																																									0								ENSG00000172732						70.0	78.0	75.0					11																	65633285		2201	4296	6497	MUS81	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8115.1	11q13	2013-07-03	2013-07-03			ENSG00000172732			29814	protein-coding gene	gene with protein product	"""SLX3 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	606591	"""MUS81 endonuclease homolog (yeast)"", ""MUS81 endonuclease homolog (S. cerevisiae)"""			11741546, 12374758	Standard	NM_025128		Approved	FLJ44872, SLX3	uc001ofv.4	Q96NY9		ENST00000308110.4:c.1509C>T	11.37:g.65633285C>T		Somatic	0	26	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q9H7D9	Silent	SNP	30	0.00	0	43	15.69	8	pfam_ERCC4_domain,superfamily_Restrct_endonuc-II-like,superfamily_DNA_pol_b-like_N,smart_ERCC4_domain	p.L503	ENST00000308110.4	37	c.1509	CCDS8115.1	11																																																																																			-	NULL		0.612	MUS81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUS81	protein_coding	OTTHUMT00000390941.3	C	NM_025128	-		65633285	+1	no_errors	ENST00000308110	ensembl	human	known	74_37	silent	SNP	0.966	T
VPS37B	79720	genome.wustl.edu	37	12	123351947	123351947	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr12:123351947G>C	ENST00000267202.2	-	4	955	c.574C>G	c.(574-576)Cct>Gct	p.P192A	RP11-463O12.3_ENST00000537827.2_lincRNA	NM_024667.2	NP_078943.1	Q9H9H4	VP37B_HUMAN	vacuolar protein sorting 37 homolog B (S. cerevisiae)	192	Pro-rich.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)				breast(1)|central_nervous_system(1)|large_intestine(1)|skin(1)|urinary_tract(1)	5	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.08e-05)|Epithelial(86;0.000197)|BRCA - Breast invasive adenocarcinoma(302;0.205)		TCTGGGGCAGGGTAGGGAAGG	0.716																																																	0								ENSG00000139722						20.0	25.0	23.0					12																	123351947		2197	4284	6481	VPS37B	SO:0001583	missense	0			-	HGNC	AK022812	CCDS9239.1	12q24.31	2008-02-05	2006-04-04		ENSG00000139722	ENSG00000139722			25754	protein-coding gene	gene with protein product		610037	"""vacuolar protein sorting 37B (yeast)"""			15218037	Standard	NM_024667		Approved	FLJ12750	uc001udl.3	Q9H9H4	OTTHUMG00000168767	ENST00000267202.2:c.574C>G	12.37:g.123351947G>C	ENSP00000267202:p.Pro192Ala	Somatic	0	16	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	18	37.93		Missense_Mutation	SNP	14	0.00	0	17	26.09	6	pfam_Mod_r	p.P192A	ENST00000267202.2	37	c.574	CCDS9239.1	12	.	.	.	.	.	.	.	.	.	.	G	5.505	0.278064	0.10403	.	.	ENSG00000139722	ENST00000267202;ENST00000535765	T;T	0.59364	0.27;0.31	5.03	3.2	0.36748	.	0.492695	0.23235	N	0.050417	T	0.51770	0.1694	M	0.67953	2.075	0.32457	N	0.544562	B	0.12630	0.006	B	0.08055	0.003	T	0.55256	-0.8169	10	0.37606	T	0.19	-9.8141	8.6452	0.34000	0.0859:0.1533:0.7609:0.0	.	192	Q9H9H4	VP37B_HUMAN	A	192;190	ENSP00000267202:P192A;ENSP00000446075:P190A	ENSP00000267202:P192A	P	-	1	0	VPS37B	121917900	0.998000	0.40836	0.943000	0.38184	0.119000	0.20118	1.471000	0.35365	0.512000	0.28257	-0.165000	0.13383	CCT	-	NULL		0.716	VPS37B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS37B	protein_coding	OTTHUMT00000400946.1	G	NM_024667	-		123351947	-1	no_errors	ENST00000267202	ensembl	human	known	74_37	missense	SNP	0.960	C
TFAP2A	7020	genome.wustl.edu	37	6	10400725	10400725	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr6:10400725A>T	ENST00000482890.1	-	7	1333	c.981T>A	c.(979-981)gaT>gaA	p.D327E	TFAP2A_ENST00000319516.4_Missense_Mutation_p.D323E|TFAP2A_ENST00000379604.2_Missense_Mutation_p.D327E|TFAP2A_ENST00000379608.3_Missense_Mutation_p.D321E|TFAP2A_ENST00000497266.1_5'UTR|TFAP2A_ENST00000379613.3_Missense_Mutation_p.D329E			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	327	H-S-H (helix-span-helix), dimerization.				anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				GCTCATTGGGATCGGAATGTT	0.473																																																	0								ENSG00000137203						162.0	144.0	150.0					6																	10400725		2203	4300	6503	TFAP2A	SO:0001583	missense	0			-	HGNC	X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.981T>A	6.37:g.10400725A>T	ENSP00000418541:p.Asp327Glu	Somatic	0	43	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	31	18.42	Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	25	0.00	0	60	15.49	11	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_alpha_N	p.D327E	ENST00000482890.1	37	c.981	CCDS4510.1	6	.	.	.	.	.	.	.	.	.	.	A	13.20	2.166035	0.38217	.	.	ENSG00000137203	ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890	D;D;D;D;D	0.96522	-4.04;-4.04;-4.04;-4.04;-4.04	5.29	5.29	0.74685	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92355	0.7574	N	0.22421	0.69	0.80722	D	1	P;P;D	0.59357	0.78;0.625;0.985	B;B;P	0.60068	0.386;0.192;0.868	D	0.90218	0.4269	10	0.13853	T	0.58	-6.5309	9.7177	0.40284	0.9226:0.0:0.0774:0.0	.	323;327;321	Q5TAV5;P05549;Q8N1C6	.;AP2A_HUMAN;.	E	329;327;323;321;327	ENSP00000368933:D329E;ENSP00000368924:D327E;ENSP00000316516:D323E;ENSP00000368928:D321E;ENSP00000418541:D327E	ENSP00000316516:D323E	D	-	3	2	TFAP2A	10508711	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.210000	0.51129	1.995000	0.58328	0.533000	0.62120	GAT	-	pfam_TF_AP2_C		0.473	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	TFAP2A	protein_coding	OTTHUMT00000353619.2	A	NM_003220	-		10400725	-1	no_errors	ENST00000379604	ensembl	human	known	74_37	missense	SNP	1.000	T
CRB1	23418	genome.wustl.edu	37	1	197398674	197398674	+	Silent	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr1:197398674G>A	ENST00000367400.3	+	8	2907	c.2772G>A	c.(2770-2772)gaG>gaA	p.E924E	CRB1_ENST00000367397.1_Silent_p.E305E|CRB1_ENST00000535699.1_Silent_p.E900E|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000544212.1_Silent_p.E405E|CRB1_ENST00000367399.2_Silent_p.E812E	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	924	EGF-like 14. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CCTGTGAGGAGGTTCAGTGGT	0.552																																																	0								ENSG00000134376						148.0	128.0	135.0					1																	197398674		2203	4300	6503	CRB1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2772G>A	1.37:g.197398674G>A		Somatic	0	59	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Silent	SNP	24	0.00	0	45	21.05	12	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.E924	ENST00000367400.3	37	c.2772	CCDS1390.1	1																																																																																			-	NULL		0.552	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	protein_coding	OTTHUMT00000086565.2	G	NM_201253	-		197398674	+1	no_errors	ENST00000367400	ensembl	human	known	74_37	silent	SNP	0.020	A
CEACAM18	729767	genome.wustl.edu	37	19	51981777	51981777	+	5'Flank	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr19:51981777C>T	ENST00000396477.4	+	0	0				CEACAM18_ENST00000451626.1_Silent_p.L22L	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18											breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		AAAGGCCGCCCTGAAGGCTGG	0.622																																																	0								ENSG00000213822						12.0	15.0	14.0					19																	51981777		1941	4129	6070	CEACAM18	SO:0001631	upstream_gene_variant	0			-	HGNC			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9			19.37:g.51981777C>T	Exception_encountered	Somatic	0	57	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	55	20.29	C9JN24	Silent	SNP	18	0.00	0	31	18.42	7	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L22	ENST00000396477.4	37	c.64		19																																																																																			-	NULL		0.622	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	protein_coding	OTTHUMT00000323114.2	C		-		51981777	+1	no_errors	ENST00000451626	ensembl	human	known	74_37	silent	SNP	0.002	T
PVRL3	25945	genome.wustl.edu	37	3	110912071	110912071	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr3:110912071G>C	ENST00000493615.1	+	9	1561	c.1309G>C	c.(1309-1311)Gac>Cac	p.D437H		NM_001243288.1	NP_001230217.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	0					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						CAGGAGTTTTGACTATGAAGA	0.413																																																	0								ENSG00000177707																																			PVRL3	SO:0001583	missense	0			-	HGNC	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000493615.1:c.1309G>C	3.37:g.110912071G>C	ENSP00000420579:p.Asp437His	Somatic	0	52	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	25	0.00	0	45	27.42	17	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.D437H	ENST00000493615.1	37	c.1309	CCDS58843.1	3	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614003	0.66672	.	.	ENSG00000177707	ENST00000493615	T	0.17854	2.25	5.53	5.53	0.82687	.	.	.	.	.	T	0.13372	0.0324	.	.	.	0.30432	N	0.777021	P	0.40000	0.698	B	0.40329	0.326	T	0.03354	-1.1045	8	0.12430	T	0.62	.	14.8344	0.70172	0.0:0.0:1.0:0.0	.	437	E9PFR0	.	H	437	ENSP00000420579:D437H	ENSP00000420579:D437H	D	+	1	0	PVRL3	112394761	0.989000	0.36119	0.969000	0.41365	0.989000	0.77384	2.593000	0.46180	2.882000	0.98803	0.655000	0.94253	GAC	-	NULL		0.413	PVRL3-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	PVRL3	protein_coding	OTTHUMT00000354046.1	G	NM_015480	-		110912071	+1	no_errors	ENST00000493615	ensembl	human	putative	74_37	missense	SNP	0.985	C
PIEZO2	63895	genome.wustl.edu	37	18	10789250	10789250	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr18:10789250C>A	ENST00000503781.3	-	15	1995	c.1996G>T	c.(1996-1998)Gaa>Taa	p.E666*	PIEZO2_ENST00000580640.1_Nonsense_Mutation_p.E666*|PIEZO2_ENST00000383408.2_5'Flank|PIEZO2_ENST00000302079.6_Nonsense_Mutation_p.E666*	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	666	Glu-rich.				cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										TGCTCAtcttcttcttcagct	0.483																																																	0								ENSG00000154864						628.0	520.0	553.0					18																	10789250		692	1591	2283	PIEZO2	SO:0001587	stop_gained	0			-	HGNC	AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.1996G>T	18.37:g.10789250C>A	ENSP00000421377:p.Glu666*	Somatic	0	91	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	60	36.84	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Nonsense_Mutation	SNP	36	0.00	0	59	25.32	20	NULL	p.E666*	ENST00000503781.3	37	c.1996		18	.	.	.	.	.	.	.	.	.	.	C	40	8.309089	0.98752	.	.	ENSG00000154864	ENST00000302079	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	19.67	0.95909	0.0:1.0:0.0:0.0	.	.	.	.	X	666	.	ENSP00000303316:E666X	E	-	1	0	FAM38B	10779250	0.746000	0.28272	0.082000	0.20525	0.941000	0.58515	5.690000	0.68241	2.655000	0.90218	0.655000	0.94253	GAA	-	NULL		0.483	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	protein_coding	OTTHUMT00000442385.4	C	NM_022068	-		10789250	-1	no_errors	ENST00000582913	ensembl	human	known	74_37	nonsense	SNP	0.647	A
BANK1	55024	genome.wustl.edu	37	4	102791783	102791783	+	Silent	SNP	A	A	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr4:102791783A>T	ENST00000322953.4	+	5	1159	c.885A>T	c.(883-885)tcA>tcT	p.S295S	BANK1_ENST00000508653.1_Silent_p.S162S|BANK1_ENST00000504592.1_Silent_p.S280S|BANK1_ENST00000428908.1_Silent_p.S162S|BANK1_ENST00000444316.2_Silent_p.S265S	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	295	DBB. {ECO:0000255|PROSITE- ProRule:PRU00707}.				B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TGGCAGATTCAGGAGAGAGTT	0.378																																																	0								ENSG00000153064						98.0	85.0	89.0					4																	102791783		2203	4300	6503	BANK1	SO:0001819	synonymous_variant	0			-	HGNC	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.885A>T	4.37:g.102791783A>T		Somatic	0	46	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	16	46.67	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Silent	SNP	35	0.00	0	43	30.65	19	superfamily_Ankyrin_rpt-contain_dom	p.S295	ENST00000322953.4	37	c.885	CCDS34038.1	4																																																																																			-	NULL		0.378	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BANK1	protein_coding	OTTHUMT00000363161.1	A	NM_017935	-		102791783	+1	no_errors	ENST00000322953	ensembl	human	known	74_37	silent	SNP	0.000	T
SPOCD1	90853	genome.wustl.edu	37	1	32256805	32256805	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr1:32256805T>A	ENST00000360482.2	-	16	3179	c.3050A>T	c.(3049-3051)aAg>aTg	p.K1017M	SPOCD1_ENST00000533231.1_Missense_Mutation_p.K1004M|SPOCD1_ENST00000257100.3_Missense_Mutation_p.K497M|SPOCD1_ENST00000373648.2_3'UTR|RP11-84A19.3_ENST00000527035.1_RNA	NM_144569.4	NP_653170.3	Q6ZMY3	SPOC1_HUMAN	SPOC domain containing 1	1017					negative regulation of phosphatase activity (GO:0010923)|transcription, DNA-templated (GO:0006351)					NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|liver(1)|lung(7)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	37		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)|Ovarian(437;0.199)		STAD - Stomach adenocarcinoma(196;0.18)		AAGCCCTTCCTTGGGGAGCAG	0.562																																																	0								ENSG00000134668						26.0	29.0	28.0					1																	32256805		2203	4300	6503	SPOCD1	SO:0001583	missense	0			-	HGNC	AK058077	CCDS347.1, CCDS60066.1, CCDS72748.1	1p35.1	2014-06-13			ENSG00000134668	ENSG00000134668			26338	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 146"""					12477932	Standard	NM_144569		Approved	FLJ25348, PPP1R146	uc001bts.1	Q6ZMY3	OTTHUMG00000003879	ENST00000360482.2:c.3050A>T	1.37:g.32256805T>A	ENSP00000353670:p.Lys1017Met	Somatic	0	30	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00	Q24JU3|Q6PI90|Q8N869|Q8N8U0|Q8NBC6|Q96LN6	Missense_Mutation	SNP	31	0.00	0	15	53.12	17	pfam_TFIIS_cen_dom,pfam_SPOC_C,superfamily_TFIIS_cen_dom,smart_TFS2M	p.K1017M	ENST00000360482.2	37	c.3050	CCDS347.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.22|16.22	3.062041|3.062041	0.55432|0.55432	.|.	.|.	ENSG00000134668|ENSG00000134668	ENST00000257100;ENST00000360482;ENST00000452755;ENST00000533231|ENST00000294514	T;T;T;T|.	0.55052|.	0.54;1.18;0.54;1.48|.	4.88|4.88	1.2|1.2	0.21068|0.21068	.|.	.|.	.|.	.|.	.|.	T|T	0.26666|0.26666	0.0652|0.0652	L|L	0.27053|0.27053	0.805|0.805	0.21967|0.21967	N|N	0.999442|0.999442	D;D;D|.	0.89917|.	1.0;0.999;0.999|.	D;D;D|.	0.69479|.	0.964;0.921;0.921|.	T|T	0.25710|0.25710	-1.0124|-1.0124	9|6	0.87932|0.72032	D|D	0|0.01	-14.4331|-14.4331	4.8876|4.8876	0.13710|0.13710	0.0:0.0985:0.3834:0.5181|0.0:0.0985:0.3834:0.5181	.|.	1004;440;1017|.	Q6ZMY3-2;E9PPM7;Q6ZMY3|.	.;.;SPOC1_HUMAN|.	M|W	497;1017;440;1004|302	ENSP00000257100:K497M;ENSP00000353670:K1017M;ENSP00000399778:K440M;ENSP00000435851:K1004M|.	ENSP00000257100:K497M|ENSP00000294514:R302W	K|R	-|-	2|1	0|2	SPOCD1|SPOCD1	32029392|32029392	0.311000|0.311000	0.24536|0.24536	0.546000|0.546000	0.28166|0.28166	0.872000|0.872000	0.50106|0.50106	0.508000|0.508000	0.22692|0.22692	0.362000|0.362000	0.24319|0.24319	0.533000|0.533000	0.62120|0.62120	AAG|AGG	-	NULL		0.562	SPOCD1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPOCD1	protein_coding	OTTHUMT00000381912.1	T	NM_144569	-		32256805	-1	no_errors	ENST00000360482	ensembl	human	known	74_37	missense	SNP	0.396	A
NINL	22981	genome.wustl.edu	37	20	25457263	25457263	+	Silent	SNP	C	C	T	rs377035866		TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr20:25457263C>T	ENST00000278886.6	-	17	2737	c.2664G>A	c.(2662-2664)acG>acA	p.T888T	NINL_ENST00000422516.1_Intron	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	888					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CCGGGCTCTGCGTAGCTTCTG	0.697																																																	0								ENSG00000101004	C		0,4264		0,0,2132	6.0	9.0	8.0		2664	-5.1	0.0	20		8	1,8343		0,1,4171	no	coding-synonymous	NINL	NM_025176.4		0,1,6303	TT,TC,CC		0.012,0.0,0.0079		888/1383	25457263	1,12607	2132	4172	6304	NINL	SO:0001819	synonymous_variant	0			-	HGNC		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.2664G>A	20.37:g.25457263C>T		Somatic	0	27	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Silent	SNP	10	0.00	0	23	25.81	8	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.T888	ENST00000278886.6	37	c.2664	CCDS33452.1	20																																																																																			-	NULL		0.697	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	protein_coding	OTTHUMT00000078445.3	C	NM_025176	-		25457263	-1	no_errors	ENST00000278886	ensembl	human	known	74_37	silent	SNP	0.000	T
CAMTA2	23125	genome.wustl.edu	37	17	4884615	4884615	+	Missense_Mutation	SNP	T	T	C			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr17:4884615T>C	ENST00000348066.3	-	8	728	c.605A>G	c.(604-606)gAg>gGg	p.E202G	CAMTA2_ENST00000414043.3_Missense_Mutation_p.E225G|CAMTA2_ENST00000361571.5_Missense_Mutation_p.E201G|CAMTA2_ENST00000358183.4_Missense_Mutation_p.E202G|CAMTA2_ENST00000572543.1_Missense_Mutation_p.E207G|CAMTA2_ENST00000381311.5_Missense_Mutation_p.E204G|CAMTA2_ENST00000571831.1_5'Flank	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	202					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						TACAGAGAACTCTTCTGTTCC	0.562											OREG0024111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000108509						145.0	134.0	137.0					17																	4884615		2203	4300	6503	CAMTA2	SO:0001583	missense	0			-	HGNC	AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.605A>G	17.37:g.4884615T>C	ENSP00000321813:p.Glu202Gly	Somatic	0	70	0.00	622	0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	81	10.99	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	24	0.00	0	58	15.94	11	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.E225G	ENST00000348066.3	37	c.674	CCDS11063.1	17	.	.	.	.	.	.	.	.	.	.	T	12.18	1.859286	0.32884	.	.	ENSG00000108509	ENST00000414043;ENST00000381311;ENST00000361571;ENST00000358183;ENST00000348066	T;T;T;T;T	0.36340	2.51;1.52;1.26;1.52;1.3	5.08	5.08	0.68730	.	0.000000	0.64402	D	0.000001	T	0.20292	0.0488	N	0.12182	0.205	0.37520	D	0.917501	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.13953	-1.0490	10	0.14656	T	0.56	-17.8704	12.8542	0.57876	0.0:0.0:0.0:1.0	.	225;204;202;201	E7EWU5;O94983-3;O94983;O94983-4	.;.;CMTA2_HUMAN;.	G	225;204;201;202;202	ENSP00000412886:E225G;ENSP00000370712:E204G;ENSP00000354828:E201G;ENSP00000350910:E202G;ENSP00000321813:E202G	ENSP00000321813:E202G	E	-	2	0	CAMTA2	4825339	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	2.652000	0.46682	2.129000	0.65627	0.459000	0.35465	GAG	-	NULL		0.562	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	protein_coding	OTTHUMT00000216876.1	T	NM_015099	-		4884615	-1	no_errors	ENST00000414043	ensembl	human	known	74_37	missense	SNP	1.000	C
WDFY2	115825	genome.wustl.edu	37	13	52277758	52277758	+	Silent	SNP	C	C	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr13:52277758C>T	ENST00000298125.5	+	4	486	c.306C>T	c.(304-306)aaC>aaT	p.N102N		NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	102							metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		AAGATTATAACAAGATGACTC	0.323																																																	0								ENSG00000139668						48.0	50.0	50.0					13																	52277758		2203	4299	6502	WDFY2	SO:0001819	synonymous_variant	0			-	HGNC	AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.306C>T	13.37:g.52277758C>T		Somatic	0	48	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	9	50.00	B1AL86|Q96CS1	Silent	SNP	28	0.00	0	18	41.94	13	pfam_WD40_repeat,pfam_Znf_FYVE,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,smart_WD40_repeat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.N102	ENST00000298125.5	37	c.306	CCDS9429.1	13																																																																																			-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.323	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY2	protein_coding	OTTHUMT00000045985.3	C	NM_052950	-		52277758	+1	no_errors	ENST00000298125	ensembl	human	known	74_37	silent	SNP	1.000	T
APOB	338	genome.wustl.edu	37	2	21228405	21228405	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:21228405A>G	ENST00000233242.1	-	26	11462	c.11335T>C	c.(11335-11337)Ttt>Ctt	p.F3779L		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	3779					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGAGGGCAAATGATGAAGTT	0.403																																																	0								ENSG00000084674						113.0	117.0	115.0					2																	21228405		2203	4300	6503	APOB	SO:0001583	missense	0			-	HGNC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.11335T>C	2.37:g.21228405A>G	ENSP00000233242:p.Phe3779Leu	Somatic	0	24	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	10	50.00	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	25	0.00	0	41	33.87	21	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.F3779L	ENST00000233242.1	37	c.11335	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	A	17.86	3.493199	0.64186	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.01821	4.62	5.57	5.57	0.84162	.	0.106703	0.41938	N	0.000798	T	0.04048	0.0113	L	0.50333	1.59	0.80722	D	1	P	0.36753	0.568	B	0.42522	0.39	T	0.50074	-0.8870	10	0.52906	T	0.07	.	15.7265	0.77763	1.0:0.0:0.0:0.0	.	3779	P04114	APOB_HUMAN	L	3779	ENSP00000233242:F3779L	ENSP00000233242:F3779L	F	-	1	0	APOB	21081910	1.000000	0.71417	0.723000	0.30687	0.753000	0.42808	8.595000	0.90840	2.115000	0.64714	0.533000	0.62120	TTT	-	NULL		0.403	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	protein_coding	OTTHUMT00000207571.1	A		-		21228405	-1	no_errors	ENST00000233242	ensembl	human	known	74_37	missense	SNP	1.000	G
ANKRD36C	400986	genome.wustl.edu	37	2	96648006	96648006	+	Silent	SNP	G	G	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr2:96648006G>A	ENST00000456556.1	-	4	675	c.591C>T	c.(589-591)ggC>ggT	p.G197G				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	197							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						GTCTGTACCTGCCAAGATAAT	0.338																																																	0								ENSG00000174501																																			ANKRD36C	SO:0001819	synonymous_variant	0			-	HGNC	AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.591C>T	2.37:g.96648006G>A		Somatic	0	70	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	71	8.97	C9JZ08|Q15694|Q53S06|Q658V2	Silent	SNP	34	0.00	0	59	4.84	3	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G197	ENST00000456556.1	37	c.591		2																																																																																			-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.338	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	protein_coding	OTTHUMT00000338799.2	G	NM_001010914	-		96648006	-1	no_errors	ENST00000456556	ensembl	human	known	74_37	silent	SNP	0.078	A
ZMAT1	84460	genome.wustl.edu	37	X	101153192	101153192	+	Splice_Site	SNP	C	C	A			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chrX:101153192C>A	ENST00000372782.3	-	4	277	c.230G>T	c.(229-231)gGt>gTt	p.G77V	ZMAT1_ENST00000458570.1_5'UTR|ZMAT1_ENST00000540921.1_Splice_Site_p.G77V	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	77						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.G77D(1)		endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						ATGTTTTTCACCCTGAAAAAA	0.299																																																	1	Substitution - Missense(1)	kidney(1)						ENSG00000166432						61.0	52.0	55.0					X																	101153192		2202	4297	6499	ZMAT1	SO:0001630	splice_region_variant	0			-	HGNC	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.229-1G>T	X.37:g.101153192C>A		Somatic	0	47	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	24	20.00	Q8NDS3|Q96JN6	Missense_Mutation	SNP	51	0.00	0	45	26.23	16	superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Znf_U1,smart_Znf_C2H2-like	p.G77V	ENST00000372782.3	37	c.230	CCDS35348.1	X	.	.	.	.	.	.	.	.	.	.	C	15.02	2.709094	0.48517	.	.	ENSG00000166432	ENST00000372782;ENST00000540921	T;T	0.71461	-0.57;-0.57	4.48	3.6	0.41247	Zinc finger, C2H2-like (1);Zinc finger, U1-type (1);Zinc finger, C2H2 (1);	0.136304	0.34291	N	0.004092	T	0.61173	0.2326	N	0.16656	0.425	0.80722	D	1	D	0.54772	0.968	P	0.49999	0.628	T	0.62895	-0.6757	10	0.49607	T	0.09	-5.2666	10.9475	0.47310	0.1881:0.8119:0.0:0.0	.	77	Q5H9K5	ZMAT1_HUMAN	V	77	ENSP00000361868:G77V;ENSP00000437529:G77V	ENSP00000361868:G77V	G	-	2	0	ZMAT1	101039848	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	5.352000	0.66028	1.030000	0.39839	0.279000	0.19357	GGT	-	smart_Znf_U1,smart_Znf_C2H2-like		0.299	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT1	protein_coding	OTTHUMT00000057598.1	C		-	Missense_Mutation	101153192	-1	no_errors	ENST00000372782	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC1A3	6507	genome.wustl.edu	37	5	36677165	36677165	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr5:36677165G>T	ENST00000265113.4	+	6	1215	c.739G>T	c.(739-741)Gtt>Ttt	p.V247F	CTD-2353F22.1_ENST00000510740.1_RNA|SLC1A3_ENST00000381918.3_Missense_Mutation_p.V247F	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	247					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CCTGGGTCTAGTTGTCTTCTC	0.488																																																	0								ENSG00000079215						176.0	165.0	169.0					5																	36677165		2203	4300	6503	SLC1A3	SO:0001583	missense	0			-	HGNC		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.739G>T	5.37:g.36677165G>T	ENSP00000265113:p.Val247Phe	Somatic	0	71	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	68	9.33	B2R5T3|Q4JCQ8	Missense_Mutation	SNP	30	0.00	0	57	5.00	3	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.V247F	ENST00000265113.4	37	c.739	CCDS3919.1	5	.	.	.	.	.	.	.	.	.	.	G	27.0	4.795463	0.90453	.	.	ENSG00000079215	ENST00000265113;ENST00000427100;ENST00000381918	T;T	0.64618	-0.11;-0.11	5.92	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.85017	0.5601	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.81914	0.992;0.995	D	0.89850	0.4009	10	0.87932	D	0	-24.954	17.2519	0.87045	0.0:0.1256:0.8744:0.0	.	247;247	Q4JCQ8;P43003	.;EAA1_HUMAN	F	247;195;247	ENSP00000265113:V247F;ENSP00000371343:V247F	ENSP00000265113:V247F	V	+	1	0	SLC1A3	36712922	1.000000	0.71417	0.498000	0.27564	0.950000	0.60333	9.860000	0.99555	1.502000	0.48669	0.655000	0.94253	GTT	-	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter		0.488	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A3	protein_coding	OTTHUMT00000207579.2	G	NM_004172	-		36677165	+1	no_errors	ENST00000265113	ensembl	human	known	74_37	missense	SNP	1.000	T
P2RX2	22953	genome.wustl.edu	37	12	133197082	133197082	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3RE-01A-11D-A228-09	TCGA-FX-A3RE-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cdbbd701-9c05-4f9e-923d-06039dd8a04d	833ec0aa-f61e-49fc-acf0-ddd1a0a1f5c4	g.chr12:133197082C>G	ENST00000389110.3	+	7	724	c.687C>G	c.(685-687)caC>caG	p.H229Q	P2RX2_ENST00000351222.4_Missense_Mutation_p.H137Q|P2RX2_ENST00000348800.5_Missense_Mutation_p.H229Q|P2RX2_ENST00000352418.4_Missense_Mutation_p.H157Q|P2RX2_ENST00000343948.4_Missense_Mutation_p.H229Q|P2RX2_ENST00000350048.5_Missense_Mutation_p.H205Q|P2RX2_ENST00000449132.2_Missense_Mutation_p.R194G	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	229					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		GCACGTTCCACGAGGCCTCCG	0.632																																																	0								ENSG00000187848						75.0	69.0	71.0					12																	133197082		2203	4300	6503	P2RX2	SO:0001583	missense	0			-	HGNC	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.687C>G	12.37:g.133197082C>G	ENSP00000373762:p.His229Gln	Somatic	0	30	0.00		0.5765646803344642	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	39	0.00	0	36	21.74	10	pfam_P2X_purnocptor,prints_P2X2_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.H229Q	ENST00000389110.3	37	c.687	CCDS31931.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.34|13.34	2.208118|2.208118	0.39003|0.39003	.|.	.|.	ENSG00000187848|ENSG00000187848	ENST00000389110;ENST00000343948;ENST00000352418;ENST00000350048;ENST00000351222;ENST00000348800|ENST00000449132	T;T;T;T;T;T|T	0.04360|0.10382	3.64;3.64;3.64;3.64;3.64;3.64|2.88	5.58|5.58	-6.47|-6.47	0.01902|0.01902	.|.	0.639773|.	0.16229|.	N|.	0.223691|.	T|T	0.11410|0.11410	0.0278|0.0278	M|M	0.73217|0.73217	2.22|2.22	0.09310|0.09310	N|N	1|1	P;P;P;P;P;P;P|B	0.52577|0.13594	0.691;0.923;0.954;0.626;0.769;0.8;0.642|0.008	B;B;P;B;B;B;B|B	0.49012|0.08055	0.338;0.304;0.598;0.31;0.228;0.338;0.152|0.003	T|T	0.30679|0.30679	-0.9970|-0.9970	10|9	0.62326|0.24483	D|T	0.03|0.36	-7.3192|-7.3192	11.7302|11.7302	0.51732|0.51732	0.0:0.6676:0.0999:0.2325|0.0:0.6676:0.0999:0.2325	.|.	229;137;157;205;229;229;229|194	Q32MC3;Q9UBL9-5;Q9UBL9-6;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2|Q9UBL9-7	.;.;.;.;.;P2RX2_HUMAN;.|.	Q|G	229;229;157;205;137;229|194	ENSP00000373762:H229Q;ENSP00000343339:H229Q;ENSP00000341419:H157Q;ENSP00000343904:H205Q;ENSP00000344502:H137Q;ENSP00000345095:H229Q|ENSP00000405531:R194G	ENSP00000343339:H229Q|ENSP00000405531:R194G	H|R	+|+	3|1	2|2	P2RX2|P2RX2	131707155|131707155	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.085000|0.085000	0.17905|0.17905	-1.985000|-1.985000	0.01485|0.01485	-1.177000|-1.177000	0.02744|0.02744	-0.266000|-0.266000	0.10368|0.10368	CAC|CGA	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor		0.632	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P2RX2	protein_coding	OTTHUMT00000397542.1	C		-		133197082	+1	no_errors	ENST00000343948	ensembl	human	known	74_37	missense	SNP	0.000	G
