#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SLC29A4	222962	genome.wustl.edu	37	7	5336737	5336737	+	Silent	SNP	C	C	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr7:5336737C>A	ENST00000396872.3	+	7	951	c.790C>A	c.(790-792)Cgg>Agg	p.R264R	SLC29A4_ENST00000297195.4_Silent_p.R264R|SLC29A4_ENST00000406453.3_Silent_p.R250R			Q7RTT9	S29A4_HUMAN	solute carrier family 29 (equilibrative nucleoside transporter), member 4	264					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	nucleoside transmembrane transporter activity (GO:0005337)			breast(1)|cervix(2)|kidney(7)|large_intestine(1)|liver(1)|lung(7)|urinary_tract(1)	20		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0903)|OV - Ovarian serous cystadenocarcinoma(56;2.65e-15)	Metformin(DB00331)	CTATACCACACGGCCGCGTGA	0.652																																																	0								ENSG00000164638						38.0	38.0	38.0					7																	5336737		2200	4298	6498	SLC29A4	SO:0001819	synonymous_variant	0			-	HGNC	AK075422	CCDS5340.1, CCDS75561.1	7p22.2	2013-07-17	2013-07-17		ENSG00000164638	ENSG00000164638		"""Solute carriers"""	23097	protein-coding gene	gene with protein product		609149	"""solute carrier family 29 (nucleoside transporters), member 4"""			12838422	Standard	NM_153247		Approved	FLJ34923, ENT4	uc003soc.3	Q7RTT9	OTTHUMG00000023797	ENST00000396872.3:c.790C>A	7.37:g.5336737C>A		Somatic	0	97	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	36	36.84	Q6PJ08|Q86WY8|Q8NAR3|Q8NBM2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt,prints_Eqnu_transpt	p.R264	ENST00000396872.3	37	c.790	CCDS5340.1	7																																																																																			-	pfam_Eqnu_transpt,superfamily_MFS_dom_general_subst_transpt		0.652	SLC29A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC29A4	protein_coding	OTTHUMT00000060118.6	C	NM_153247	-		5336737	+1	no_errors	ENST00000297195	ensembl	human	known	74_37	silent	SNP	0.822	A
BRWD3	254065	genome.wustl.edu	37	X	80064059	80064059	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chrX:80064059G>C	ENST00000373275.4	-	4	375	c.159C>G	c.(157-159)caC>caG	p.H53Q		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	53					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						AGCTTCTTCGGTGCTCTTTCC	0.547																																																	0								ENSG00000165288						55.0	52.0	53.0					X																	80064059		2203	4300	6503	BRWD3	SO:0001583	missense	0			-	HGNC		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.159C>G	X.37:g.80064059G>C	ENSP00000362372:p.His53Gln	Somatic	0	32	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	87	13.86	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.H53Q	ENST00000373275.4	37	c.159	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	g	14.92	2.680129	0.47886	.	.	ENSG00000165288	ENST00000373275	T	0.28666	1.6	4.97	1.95	0.26073	.	0.071956	0.56097	D	0.000027	T	0.49712	0.1573	M	0.85197	2.74	0.27558	N	0.950273	D	0.76494	0.999	D	0.70487	0.969	T	0.43475	-0.9389	9	.	.	.	-16.0968	2.7093	0.05170	0.2553:0.0:0.5155:0.2292	.	53	Q6RI45	BRWD3_HUMAN	Q	53	ENSP00000362372:H53Q	.	H	-	3	2	BRWD3	79950715	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.614000	0.36911	0.486000	0.27676	0.495000	0.49567	CAC	-	NULL		0.547	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	protein_coding	OTTHUMT00000057344.1	G	NM_153252	-		80064059	-1	no_errors	ENST00000373275	ensembl	human	known	74_37	missense	SNP	0.998	C
CETN1	1068	genome.wustl.edu	37	18	580481	580481	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr18:580481C>A	ENST00000327228.3	+	1	115	c.73C>A	c.(73-75)Ctc>Atc	p.L25I		NM_004066.1	NP_004057.1	Q12798	CETN1_HUMAN	centrin, EF-hand protein, 1	25					cellular response to heat (GO:0034605)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|photoreceptor connecting cilium (GO:0032391)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|calcium ion binding (GO:0005509)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(3)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(2)	25						TAAGCCCGAGCTCACTGAGGA	0.602																																																	0								ENSG00000177143						48.0	36.0	40.0					18																	580481		2203	4300	6503	CETN1	SO:0001583	missense	0			-	HGNC	U03270	CCDS11820.1	18p11.32	2013-01-10			ENSG00000177143	ENSG00000177143		"""EF-hand domain containing"""	1866	protein-coding gene	gene with protein product		603187		CETN		8175926	Standard	NM_004066		Approved	CEN1	uc002kko.1	Q12798	OTTHUMG00000131471	ENST00000327228.3:c.73C>A	18.37:g.580481C>A	ENSP00000319052:p.Leu25Ile	Somatic	0	22	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	6	62.50	B2R536	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.L25I	ENST00000327228.3	37	c.73	CCDS11820.1	18	.	.	.	.	.	.	.	.	.	.	C	15.90	2.970180	0.53614	.	.	ENSG00000177143	ENST00000327228	T	0.44083	0.93	5.1	5.1	0.69264	EF-hand-like domain (1);	0.000000	0.64402	D	0.000004	T	0.29850	0.0746	N	0.08118	0	0.80722	D	1	B	0.32051	0.354	B	0.36989	0.238	T	0.24440	-1.0160	10	0.54805	T	0.06	.	16.4123	0.83722	0.0:1.0:0.0:0.0	.	25	Q12798	CETN1_HUMAN	I	25	ENSP00000319052:L25I	ENSP00000319052:L25I	L	+	1	0	CETN1	570481	1.000000	0.71417	0.976000	0.42696	0.137000	0.21094	5.814000	0.69208	2.825000	0.97269	0.655000	0.94253	CTC	-	NULL		0.602	CETN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CETN1	protein_coding	OTTHUMT00000254314.2	C	NM_004066	-		580481	+1	no_errors	ENST00000327228	ensembl	human	known	74_37	missense	SNP	1.000	A
SPECC1	92521	genome.wustl.edu	37	17	20224677	20224677	+	IGR	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:20224677G>A	ENST00000395530.2	+	0	8133				CCDC144CP_ENST00000340196.4_RNA|U6_ENST00000517027.1_RNA|AC004702.2_ENST00000580225.1_lincRNA	NM_001033555.2	NP_001028727.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1						cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AGGGGTCTCCGAAGCCGGCAG	0.647																																																	0								ENSG00000154898																																			CCDC144CP	SO:0001628	intergenic_variant	0			-	HGNC	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808		17.37:g.20224677G>A		Somatic	0	117	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	216	13.60	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395530.2	37	NULL	CCDS42281.1	17																																																																																			-	-		0.647	SPECC1-004	KNOWN	basic|CCDS	protein_coding	CCDC144CP	protein_coding	OTTHUMT00000132368.3	G	NM_152904	-		20224677	+1	no_errors	ENST00000340196	ensembl	human	known	74_37	rna	SNP	0.003	A
RUFY2	55680	genome.wustl.edu	37	10	70156583	70156583	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr10:70156583delT	ENST00000602465.1	-	4	452	c.352delA	c.(352-354)atgfs	p.M118fs	RUFY2_ENST00000388768.2_Frame_Shift_Del_p.M153fs|RUFY2_ENST00000342616.4_Frame_Shift_Del_p.M118fs|RUFY2_ENST00000399200.2_Intron|RUFY2_ENST00000454950.2_Frame_Shift_Del_p.M60fs|RUFY2_ENST00000472394.2_5'UTR			Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain containing 2	167	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)	20						TAATCGGCCATTTTTTTTTGC	0.398																																																	0								ENSG00000204130						81.0	80.0	81.0					10																	70156583		1832	4087	5919	RUFY2	SO:0001589	frameshift_variant	0				HGNC	AF461266	CCDS41534.1, CCDS44414.1, CCDS60544.1	10q22.2	2007-01-29			ENSG00000204130	ENSG00000204130		"""Zinc fingers, FYVE domain containing"""	19761	protein-coding gene	gene with protein product		610328				11877430	Standard	NM_001042417		Approved	RABIP4R, FLJ10063, KIAA1537, ZFYVE13	uc001job.3	Q8WXA3	OTTHUMG00000018353	ENST00000602465.1:c.352delA	10.37:g.70156583delT	ENSP00000473462:p.Met118fs	Somatic	0	22	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B3KXB2|B4DFR0|Q5TC48|Q8IW33|Q96P51|Q9P1Z1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Run,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Run,smart_Znf_FYVE,pfscan_Run,pfscan_Znf_FYVE-rel	p.M153fs	ENST00000602465.1	37	c.457		10																																																																																			-	pfam_Run,smart_Run,pfscan_Run		0.398	RUFY2-010	KNOWN	basic|appris_principal	protein_coding	RUFY2	protein_coding	OTTHUMT00000467567.1	T	NM_017987			70156583	-1	no_errors	ENST00000388768	ensembl	human	known	74_37	frame_shift_del	DEL	0.996	-
ANKRD26P1	124149	genome.wustl.edu	37	16	46584447	46584447	+	IGR	SNP	C	C	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr16:46584447C>A								ANKRD26P1 (32584 upstream) : RNU6-845P (5553 downstream)																							GATGTTCCTTCTGCCAAACAT	0.443																																																	0								ENSG00000261239																																			ANKRD26P1	SO:0001628	intergenic_variant	0			-	HGNC																													16.37:g.46584447C>A		Somatic	0	64	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00		Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	NULL		37	c.NULL		16	.	.	.	.	.	.	.	.	.	.	.	3.621	-0.077472	0.07184	.	.	ENSG00000255675	ENST00000543951	.	.	.	1.18	0.198	0.15168	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.7364	0.08512	0.0:0.5254:0.0:0.4746	.	.	.	.	.	-1	.	.	.	-	.	.	ANKRD26P1	45141948	0.013000	0.17824	0.001000	0.08648	0.079000	0.17450	0.234000	0.17930	0.088000	0.17205	0.563000	0.77884	.	-	-	0	0.443					ANKRD26P1			C		-		46584447	-1	no_errors	ENST00000566201	ensembl	human	known	74_37	splice_site	SNP	0.003	A
MAGI2	9863	genome.wustl.edu	37	7	77797353	77797353	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr7:77797353C>G	ENST00000354212.4	-	15	2729	c.2476G>C	c.(2476-2478)Gtg>Ctg	p.V826L	MAGI2_ENST00000419488.1_Missense_Mutation_p.V812L|MAGI2_ENST00000522391.1_Missense_Mutation_p.V826L	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	826	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				TCAACATACACAAGCTCATCT	0.542																																																	0								ENSG00000187391						142.0	129.0	133.0					7																	77797353		2203	4300	6503	MAGI2	SO:0001583	missense	0			-	HGNC	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2476G>C	7.37:g.77797353C>G	ENSP00000346151:p.Val826Leu	Somatic	0	88	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	83	30.83	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_WW_dom,pfam_GK/Ca_channel_bsu,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_PDZ,smart_GK/Ca_channel_bsu,smart_WW_dom,pfscan_PDZ,pfscan_WW_dom,pfscan_Guanylate_kin-like	p.V826L	ENST00000354212.4	37	c.2476	CCDS5594.1	7	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608802	0.46527	.	.	ENSG00000187391	ENST00000419488;ENST00000354212;ENST00000536298;ENST00000522391	T;T;T	0.20738	2.05;2.05;2.05	5.96	5.96	0.96718	PDZ/DHR/GLGF (4);	0.000000	0.32987	U	0.005402	T	0.09468	0.0233	N	0.01824	-0.7	0.80722	D	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.08055	0.002;0.003;0.002	T	0.28996	-1.0026	10	0.32370	T	0.25	.	14.2673	0.66126	0.1486:0.8514:0.0:0.0	.	826;812;826	E7EWI0;Q86UL8-2;Q86UL8	.;.;MAGI2_HUMAN	L	812;826;826;826	ENSP00000405766:V812L;ENSP00000346151:V826L;ENSP00000428389:V826L	ENSP00000346151:V826L	V	-	1	0	MAGI2	77635289	0.919000	0.31177	0.975000	0.42487	0.981000	0.71138	1.805000	0.38883	2.831000	0.97527	0.650000	0.86243	GTG	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.542	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	protein_coding	OTTHUMT00000253197.3	C	NM_012301	-		77797353	-1	no_errors	ENST00000354212	ensembl	human	known	74_37	missense	SNP	0.981	G
TIPIN	54962	genome.wustl.edu	37	15	66671819	66671819	+	5'UTR	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr15:66671819G>A	ENST00000561773.1	-	0	517							Q9BVW5	TIPIN_HUMAN	TIMELESS interacting protein						cell cycle phase transition (GO:0044770)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|regulation of nuclear cell cycle DNA replication (GO:0033262)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	7						TTCCTTCAAAGATTAATTCAT	0.388																																																	0								ENSG00000075131																																			TIPIN	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BK001386	CCDS10215.1	15q22.31	2012-03-02	2006-08-08		ENSG00000075131	ENSG00000075131			30750	protein-coding gene	gene with protein product	"""CSM3 homolog (S. cerevisiae)"""	610716				12875843, 17102137	Standard	NM_017858		Approved	FLJ20516	uc002apr.2	Q9BVW5	OTTHUMG00000133188	ENST00000561773.1:c.-212C>T	15.37:g.66671819G>A		Somatic	0	139	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	128	11.72	B2CW64|Q9NWZ6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561773.1	37	NULL		15																																																																																			-	-		0.388	TIPIN-006	KNOWN	mRNA_end_NF|basic	processed_transcript	TIPIN	protein_coding	OTTHUMT00000420721.1	G	NM_017858	-		66671819	-1	no_errors	ENST00000561773	ensembl	human	known	74_37	rna	SNP	0.961	A
PPP6R2	9701	genome.wustl.edu	37	22	50870702	50870702	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr22:50870702G>C	ENST00000216061.5	+	13	1714	c.1344G>C	c.(1342-1344)caG>caC	p.Q448H	PPP6R2_ENST00000395744.3_Missense_Mutation_p.Q448H|PPP6R2_ENST00000359139.3_Missense_Mutation_p.Q448H|PPP6R2_ENST00000395741.3_Missense_Mutation_p.Q449H			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	448						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						AGCTGTTCCAGAAGTGCTGCC	0.687																																																	0								ENSG00000100239						24.0	19.0	21.0					22																	50870702		2093	4059	6152	PPP6R2	SO:0001583	missense	0			-	HGNC	AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.1344G>C	22.37:g.50870702G>C	ENSP00000216061:p.Gln448His	Somatic	0	96	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	29	43.14	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SAPS,superfamily_ARM-type_fold	p.Q448H	ENST00000216061.5	37	c.1344		22	.	.	.	.	.	.	.	.	.	.	G	16.40	3.111884	0.56398	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.35048	1.38;1.38;1.38;1.33	5.44	4.42	0.53409	.	0.109922	0.64402	D	0.000005	T	0.35595	0.0937	L	0.52126	1.63	0.53688	D	0.999974	B;B;B;B;B;B	0.32918	0.39;0.151;0.183;0.175;0.151;0.09	B;B;B;B;B;B	0.35312	0.2;0.103;0.166;0.188;0.103;0.099	T	0.24190	-1.0167	10	0.59425	D	0.04	-13.6412	13.0008	0.58673	0.0796:0.0:0.9204:0.0	.	7;448;448;449;448;448	F2Z3M7;O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;.;PP6R2_HUMAN;.;.;.	H	448;449;448;448	ENSP00000352051:Q448H;ENSP00000379090:Q449H;ENSP00000379093:Q448H;ENSP00000216061:Q448H	ENSP00000216061:Q448H	Q	+	3	2	PPP6R2	49217568	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.147000	0.50639	1.301000	0.44836	0.563000	0.77884	CAG	-	pfam_SAPS		0.687	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	PPP6R2	protein_coding	OTTHUMT00000316809.1	G	NM_014678	-		50870702	+1	no_errors	ENST00000216061	ensembl	human	known	74_37	missense	SNP	1.000	C
MAP4	4134	genome.wustl.edu	37	3	47950560	47950560	+	Intron	SNP	T	T	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr3:47950560T>C	ENST00000360240.6	-	8	2518				MAP4_ENST00000264724.11_Missense_Mutation_p.E391G|MAP4_ENST00000426837.2_Missense_Mutation_p.E1801G|MAP4_ENST00000395734.3_Intron|MAP4_ENST00000383737.4_Missense_Mutation_p.E384G	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4						cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	TCTCTCTTGTTCCTGGATTGT	0.468																																																	0								ENSG00000047849						283.0	267.0	272.0					3																	47950560		1930	4140	6070	MAP4	SO:0001627	intron_variant	0			-	HGNC		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1999+5746A>G	3.37:g.47950560T>C		Somatic	0	116	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	134	14.65	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP_tubulin-bd_rpt	p.E391G	ENST00000360240.6	37	c.1172	CCDS33750.1	3	.	.	.	.	.	.	.	.	.	.	T	15.56	2.868613	0.51588	.	.	ENSG00000047849	ENST00000383737;ENST00000264724;ENST00000426837;ENST00000383736	T;T;T	0.37915	2.99;1.17;2.93	5.73	5.73	0.89815	.	.	.	.	.	T	0.52581	0.1743	.	.	.	0.23030	N	0.998404	D;D	0.63880	0.993;0.988	D;P	0.63033	0.91;0.76	T	0.46331	-0.9199	8	0.36615	T	0.2	.	12.6954	0.57001	0.0:0.0:0.0:1.0	.	391;391	P27816-4;E9PGM5	.;.	G	384;391;1801;391	ENSP00000373243:E384G;ENSP00000264724:E391G;ENSP00000407602:E1801G	ENSP00000264724:E391G	E	-	2	0	MAP4	47925564	0.993000	0.37304	0.939000	0.37840	0.578000	0.36192	3.029000	0.49712	2.313000	0.78055	0.454000	0.30748	GAA	-	NULL		0.468	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	protein_coding	OTTHUMT00000346085.1	T	NM_002375	-		47950560	-1	no_errors	ENST00000264724	ensembl	human	known	74_37	missense	SNP	0.971	C
FOXS1	2307	genome.wustl.edu	37	20	30433004	30433004	+	Silent	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr20:30433004G>A	ENST00000375978.3	-	1	416	c.342C>T	c.(340-342)ttC>ttT	p.F114F		NM_004118.3	NP_004109.1	O43638	FOXS1_HUMAN	forkhead box S1	114					blood vessel development (GO:0001568)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|positive regulation of multicellular organism growth (GO:0040018)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	9						TCTGCCGGGTGAAGCGGCGGC	0.701																																																	0								ENSG00000179772						15.0	17.0	17.0					20																	30433004		2192	4273	6465	FOXS1	SO:0001819	synonymous_variant	0			-	HGNC	AF042831	CCDS13192.1	20q11.1-q11.2	2008-04-10	2008-04-10	2008-04-10	ENSG00000179772	ENSG00000179772		"""Forkhead boxes"""	3735	protein-coding gene	gene with protein product		602939	"""forkhead (Drosophila)-like 18"", ""forkhead-like 18 (Drosophila)"""	FKHL18		9325056, 17062144	Standard	NM_004118		Approved	FREAC10	uc002wwt.1	O43638	OTTHUMG00000032183	ENST00000375978.3:c.342C>T	20.37:g.30433004G>A		Somatic	0	103	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	79	34.17	Q96D28	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.F114	ENST00000375978.3	37	c.342	CCDS13192.1	20																																																																																			-	NULL		0.701	FOXS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXS1	protein_coding	OTTHUMT00000078560.2	G	NM_004118	-		30433004	-1	no_errors	ENST00000375978	ensembl	human	known	74_37	silent	SNP	1.000	A
PATL1	219988	genome.wustl.edu	37	11	59426412	59426412	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr11:59426412G>C	ENST00000300146.9	-	4	437	c.353C>G	c.(352-354)cCa>cGa	p.P118R		NM_152716.2	NP_689929.2	Q86TB9	PATL1_HUMAN	protein associated with topoisomerase II homolog 1 (yeast)	118	Involved in nuclear foci localization.|Region N; interaction with decapping machinery.				cytoplasmic mRNA processing body assembly (GO:0033962)|deadenylation-dependent decapping of nuclear-transcribed mRNA (GO:0000290)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(2)|lung(5)|ovary(1)|prostate(2)	11						CAGACTTCCTGGTTGGGGCTA	0.428																																																	0								ENSG00000166889						52.0	51.0	51.0					11																	59426412		692	1591	2283	PATL1	SO:0001583	missense	0			-	HGNC	AK094193	CCDS44613.1	11q12.1	2012-06-07	2007-10-18		ENSG00000166889	ENSG00000166889			26721	protein-coding gene	gene with protein product		614660				17936923	Standard	NM_152716		Approved	FLJ36874, Pat1b	uc001noe.4	Q86TB9	OTTHUMG00000167423	ENST00000300146.9:c.353C>G	11.37:g.59426412G>C	ENSP00000300146:p.Pro118Arg	Somatic	0	24	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	27	27.03	B3KXT9|Q2TA86|Q6P166|Q8N9M6|Q8NI63	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Topo_II-assoc_PAT1	p.P118R	ENST00000300146.9	37	c.353	CCDS44613.1	11	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686496	0.47991	.	.	ENSG00000166889	ENST00000300146;ENST00000428532	T	0.53423	0.62	5.26	5.26	0.73747	.	0.119701	0.56097	D	0.000021	T	0.47097	0.1427	L	0.36672	1.1	0.37780	D	0.926976	P;P	0.49307	0.904;0.922	B;P	0.48030	0.429;0.564	T	0.48958	-0.8988	10	0.36615	T	0.2	-2.6894	16.7323	0.85438	0.0:0.0:1.0:0.0	.	118;118	Q86TB9-4;Q86TB9	.;PATL1_HUMAN	R	118	ENSP00000300146:P118R	ENSP00000300146:P118R	P	-	2	0	PATL1	59182988	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.605000	0.67634	2.469000	0.83416	0.644000	0.83932	CCA	-	pfam_Topo_II-assoc_PAT1		0.428	PATL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATL1	protein_coding	OTTHUMT00000394559.1	G	NM_152716	-		59426412	-1	no_errors	ENST00000300146	ensembl	human	known	74_37	missense	SNP	1.000	C
CTNND2	1501	genome.wustl.edu	37	5	11236827	11236827	+	Silent	SNP	A	A	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr5:11236827A>G	ENST00000304623.8	-	10	1926	c.1737T>C	c.(1735-1737)ttT>ttC	p.F579F	CTNND2_ENST00000359640.2_Silent_p.F579F|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Silent_p.F488F|CTNND2_ENST00000458100.2_Silent_p.F146F|CTNND2_ENST00000503622.1_Silent_p.F242F	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	579					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TGTTGTCTCCAAAACAGAGGT	0.473																																																	0								ENSG00000169862						115.0	120.0	119.0					5																	11236827		2203	4300	6503	CTNND2	SO:0001819	synonymous_variant	0			-	HGNC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1737T>C	5.37:g.11236827A>G		Somatic	0	27	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	62	27.91	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.F579	ENST00000304623.8	37	c.1737	CCDS3881.1	5																																																																																			-	superfamily_ARM-type_fold		0.473	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	protein_coding	OTTHUMT00000206999.1	A	NM_001332	-		11236827	-1	no_errors	ENST00000304623	ensembl	human	known	74_37	silent	SNP	0.952	G
ABCC12	94160	genome.wustl.edu	37	16	48122490	48122490	+	Silent	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr16:48122490C>T	ENST00000311303.3	-	24	3786	c.3441G>A	c.(3439-3441)ggG>ggA	p.G1147G	ABCC12_ENST00000532355.1_5'Flank|ABCC12_ENST00000448542.1_3'UTR|ABCC12_ENST00000416054.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	1147	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				CGACTGTCTGCCCACTTTGTA	0.493																																																	0								ENSG00000140798						120.0	108.0	112.0					16																	48122490		2201	4300	6501	ABCC12	SO:0001819	synonymous_variant	0			-	HGNC	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.3441G>A	16.37:g.48122490C>T		Somatic	0	68	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	27	28.95	Q49AL2|Q8TAF0|Q8TEY2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.G1147	ENST00000311303.3	37	c.3441	CCDS10730.1	16																																																																																			-	superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.493	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	protein_coding	OTTHUMT00000256837.1	C	NM_033226	-		48122490	-1	no_errors	ENST00000311303	ensembl	human	known	74_37	silent	SNP	1.000	T
DCHS1	8642	genome.wustl.edu	37	11	6652903	6652903	+	Missense_Mutation	SNP	T	T	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr11:6652903T>C	ENST00000299441.3	-	7	4030	c.3619A>G	c.(3619-3621)Aac>Gac	p.N1207D	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1207	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGGGGCTGTTGTCGTTGAGG	0.597																																																	0								ENSG00000166341						61.0	51.0	55.0					11																	6652903		2201	4296	6497	DCHS1	SO:0001583	missense	0			-	HGNC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3619A>G	11.37:g.6652903T>C	ENSP00000299441:p.Asn1207Asp	Somatic	0	45	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00	O15098	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N1207D	ENST00000299441.3	37	c.3619	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	T	21.0	4.076880	0.76415	.	.	ENSG00000166341	ENST00000299441	T	0.23552	1.9	5.37	4.22	0.49857	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.132693	0.33834	N	0.004505	T	0.45657	0.1353	M	0.93854	3.465	0.54753	D	0.99998	P	0.48694	0.914	P	0.46419	0.516	T	0.58165	-0.7684	10	0.62326	D	0.03	.	11.4164	0.49954	0.0:0.0:0.1877:0.8123	.	1207	Q96JQ0	PCD16_HUMAN	D	1207	ENSP00000299441:N1207D	ENSP00000299441:N1207D	N	-	1	0	DCHS1	6609479	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.657000	0.61490	0.993000	0.38866	0.533000	0.62120	AAC	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.597	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	protein_coding	OTTHUMT00000257258.1	T	NM_003737	-		6652903	-1	no_errors	ENST00000299441	ensembl	human	known	74_37	missense	SNP	1.000	C
HTR3A	3359	genome.wustl.edu	37	11	113857756	113857756	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr11:113857756G>T	ENST00000504030.2	+	8	1571	c.1126G>T	c.(1126-1128)Gat>Tat	p.D376Y	HTR3A_ENST00000375498.2_Missense_Mutation_p.D382Y|HTR3A_ENST00000535865.1_Missense_Mutation_p.D120Y|HTR3A_ENST00000506841.2_Missense_Mutation_p.D408Y|HTR3A_ENST00000299961.5_Missense_Mutation_p.D361Y|HTR3A_ENST00000355556.2_Missense_Mutation_p.D414Y			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	376					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	CACCAAGACTGATGACTGCTC	0.582																																																	0								ENSG00000166736						26.0	29.0	28.0					11																	113857756		2199	4291	6490	HTR3A	SO:0001583	missense	0			-	HGNC	D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.1126G>T	11.37:g.113857756G>T	ENSP00000424189:p.Asp376Tyr	Somatic	0	53	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	42	46.84	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_5HT3_rcpt_A,prints_5HT3_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.D414Y	ENST00000504030.2	37	c.1240		11	.	.	.	.	.	.	.	.	.	.	G	15.42	2.828104	0.50845	.	.	ENSG00000166736	ENST00000504030;ENST00000355556;ENST00000375498;ENST00000506841;ENST00000535865;ENST00000299961	T;T;T;T;T;T	0.22539	1.95;1.95;1.95;1.95;1.95;1.95	5.5	3.63	0.41609	.	0.794413	0.12513	N	0.462301	T	0.27134	0.0665	L	0.55990	1.75	0.33718	D	0.616606	P;P;P	0.36753	0.568;0.549;0.568	B;B;P	0.46758	0.398;0.36;0.526	T	0.34800	-0.9814	10	0.39692	T	0.17	-2.7306	5.1134	0.14821	0.21:0.169:0.6211:0.0	.	361;414;382	B4DSY6;G5E986;Q7KZM7	.;.;.	Y	376;414;382;408;120;361	ENSP00000424189:D376Y;ENSP00000347754:D414Y;ENSP00000364648:D382Y;ENSP00000424776:D408Y;ENSP00000437776:D120Y;ENSP00000299961:D361Y	ENSP00000299961:D361Y	D	+	1	0	HTR3A	113362966	0.633000	0.27181	0.162000	0.22713	0.060000	0.15804	1.737000	0.38197	0.796000	0.33947	0.655000	0.94253	GAT	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_5HT3_rcpt_A		0.582	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	HTR3A	protein_coding	OTTHUMT00000360822.2	G	NM_000869	-		113857756	+1	no_errors	ENST00000355556	ensembl	human	known	74_37	missense	SNP	0.582	T
TIPIN	54962	genome.wustl.edu	37	15	66671738	66671738	+	5'UTR	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr15:66671738G>A	ENST00000561773.1	-	0	598							Q9BVW5	TIPIN_HUMAN	TIMELESS interacting protein						cell cycle phase transition (GO:0044770)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|regulation of nuclear cell cycle DNA replication (GO:0033262)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	7						AAAATTTCCTGATATCCTTGT	0.368																																																	0								ENSG00000075131																																			TIPIN	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BK001386	CCDS10215.1	15q22.31	2012-03-02	2006-08-08		ENSG00000075131	ENSG00000075131			30750	protein-coding gene	gene with protein product	"""CSM3 homolog (S. cerevisiae)"""	610716				12875843, 17102137	Standard	NM_017858		Approved	FLJ20516	uc002apr.2	Q9BVW5	OTTHUMG00000133188	ENST00000561773.1:c.-131C>T	15.37:g.66671738G>A		Somatic	0	125	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	121	10.37	B2CW64|Q9NWZ6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561773.1	37	NULL		15																																																																																			-	-		0.368	TIPIN-006	KNOWN	mRNA_end_NF|basic	processed_transcript	TIPIN	protein_coding	OTTHUMT00000420721.1	G	NM_017858	-		66671738	-1	no_errors	ENST00000561773	ensembl	human	known	74_37	rna	SNP	1.000	A
FUT1	2523	genome.wustl.edu	37	19	49254184	49254184	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr19:49254184C>T	ENST00000310160.3	-	4	1329	c.355G>A	c.(355-357)Gcc>Acc	p.A119T	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	119					carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		GGGGCCAGGGCGGCATGCATG	0.657																																																	0								ENSG00000174951						43.0	51.0	49.0					19																	49254184		2202	4299	6501	FUT1	SO:0001583	missense	0			-	HGNC		CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.355G>A	19.37:g.49254184C>T	ENSP00000312021:p.Ala119Thr	Somatic	0	104	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	59	34.74	O14505|O14506|O14507	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_11	p.A119T	ENST00000310160.3	37	c.355	CCDS12733.1	19	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.747821	0.00669	.	.	ENSG00000174951	ENST00000310160;ENST00000539428	D	0.96200	-3.94	4.61	-9.21	0.00678	.	0.995923	0.08139	N	0.991910	T	0.81346	0.4803	N	0.02697	-0.525	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.74172	-0.3751	10	0.02654	T	1	-0.6454	9.9522	0.41645	0.0908:0.5436:0.0:0.3656	.	119	P19526	FUT1_HUMAN	T	119	ENSP00000312021:A119T	ENSP00000312021:A119T	A	-	1	0	FUT1	53945996	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.666000	0.00399	-1.966000	0.01009	-0.982000	0.02568	GCC	-	pfam_Glyco_trans_11		0.657	FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT1	protein_coding	OTTHUMT00000466194.1	C	NM_000148	-		49254184	-1	no_errors	ENST00000310160	ensembl	human	known	74_37	missense	SNP	0.000	T
COL4A3	1285	genome.wustl.edu	37	2	228110634	228110634	+	Intron	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr2:228110634G>A	ENST00000396578.3	+	6	486				AC097662.2_ENST00000606119.1_RNA|AC097662.2_ENST00000437673.1_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000396588.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		TGTTTCTTGGGATGACCCTCC	0.433																																																	0								ENSG00000236432						98.0	92.0	94.0					2																	228110634		1900	4123	6023	AC097662.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.325-36G>A	2.37:g.228110634G>A		Somatic	0	64	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	72	22.58	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396578.3	37	NULL	CCDS42829.1	2																																																																																			-	-		0.433	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000236432	protein_coding	OTTHUMT00000331409.2	G	NM_000091	-		228110634	-1	no_errors	ENST00000396588	ensembl	human	known	74_37	rna	SNP	0.000	A
NBEA	26960	genome.wustl.edu	37	13	36241588	36241588	+	Missense_Mutation	SNP	C	C	T	rs200699050		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr13:36241588C>T	ENST00000400445.3	+	56	9013	c.8479C>T	c.(8479-8481)Cgc>Tgc	p.R2827C	NBEA_ENST00000540320.1_Missense_Mutation_p.R2827C|NBEA_ENST00000310336.4_Missense_Mutation_p.R2827C|NBEA_ENST00000379939.2_Missense_Mutation_p.R2824C|NBEA_ENST00000537702.1_Missense_Mutation_p.R620C|NBEA_ENST00000379922.3_Missense_Mutation_p.R405C	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	2827					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CTTATTCCCACGCTTGATATC	0.473																																																	0								ENSG00000172915	C	CYS/ARG,CYS/ARG	2,3928		0,2,1963	133.0	135.0	134.0		1858,8479	4.9	0.9	13		134	1,8287		0,1,4143	yes	missense,missense	NBEA	NM_001204197.1,NM_015678.4	180,180	0,3,6106	TT,TC,CC		0.0121,0.0509,0.0246	probably-damaging,probably-damaging	620/740,2827/2947	36241588	3,12215	1965	4144	6109	NBEA	SO:0001583	missense	0			-	HGNC	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.8479C>T	13.37:g.36241588C>T	ENSP00000383295:p.Arg2827Cys	Somatic	0	76	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	11	63.33	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.R2827C	ENST00000400445.3	37	c.8479	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297237	0.60086	5.09E-4	1.21E-4	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518;ENST00000402346;ENST00000537702;ENST00000379922	T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51	5.73	4.86	0.63082	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.46737	0.1408	L	0.50333	1.59	0.80722	D	1	D;D;D	0.76494	0.993;0.999;0.992	D;P;P	0.64506	0.926;0.886;0.731	T	0.35699	-0.9778	10	0.56958	D	0.05	.	13.8647	0.63581	0.2737:0.7263:0.0:0.0	.	2827;405;2824	Q8NFP9;Q8NFP9-2;Q5T321	NBEA_HUMAN;.;.	C	2827;2827;2824;2827;1456;405;620;405	ENSP00000440951:R2827C;ENSP00000383295:R2827C;ENSP00000369271:R2824C;ENSP00000308534:R2827C;ENSP00000440233:R620C;ENSP00000369254:R405C	ENSP00000308534:R2827C	R	+	1	0	NBEA	35139588	0.997000	0.39634	0.929000	0.37066	0.972000	0.66771	3.643000	0.54374	2.700000	0.92200	0.655000	0.94253	CGC	-	superfamily_WD40_repeat_dom		0.473	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	protein_coding		C	NM_015678	rs200699050		36241588	+1	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	SNP	0.978	T
FAM86B1	85002	genome.wustl.edu	37	8	12044262	12044262	+	Silent	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr8:12044262G>A	ENST00000448228.2	-	4	370	c.321C>T	c.(319-321)gcC>gcT	p.A107A	FAM86B1_ENST00000533852.2_Silent_p.A141A|FAM86B1_ENST00000534520.1_Silent_p.A107A|FAM86B1_ENST00000321602.8_Missense_Mutation_p.P2L|FAM86B1_ENST00000533513.1_Silent_p.A141A	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1	107										kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		GGTAGAGGGCGGCATCCCATG	0.612																																																	0								ENSG00000186523						1.0	1.0	1.0					8																	12044262		473	1093	1566	FAM86B1	SO:0001819	synonymous_variant	0			-	HGNC	BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.321C>T	8.37:g.12044262G>A		Somatic	0	13	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	17	50.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P2L	ENST00000448228.2	37	c.5	CCDS59512.1	8	.	.	.	.	.	.	.	.	.	.	-	0.003	-2.469420	0.00169	.	.	ENSG00000186523	ENST00000321602;ENST00000526802	T	0.30714	1.52	1.17	-0.949	0.10376	.	.	.	.	.	T	0.19604	0.0471	.	.	.	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.08166	-1.0735	8	0.87932	D	0	.	2.4515	0.04519	0.3509:0.0:0.425:0.2241	.	2;39	F6QN85;Q4KMP3	.;.	L	2;103	ENSP00000439686:P2L	ENSP00000439686:P2L	P	-	2	0	FAM86B1	12081671	0.000000	0.05858	0.092000	0.20876	0.049000	0.14656	-3.087000	0.00610	-0.554000	0.06150	-1.169000	0.01745	CCG	-	NULL		0.612	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	protein_coding	OTTHUMT00000383317.1	G	NM_032916	-		12044262	-1	no_errors	ENST00000321602	ensembl	human	known	74_37	missense	SNP	0.966	A
SLC12A5	57468	genome.wustl.edu	37	20	44685180	44685180	+	Silent	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr20:44685180C>T	ENST00000454036.2	+	23	3205	c.3156C>T	c.(3154-3156)atC>atT	p.I1052I	SLC12A5_ENST00000243964.3_Silent_p.I1029I	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	1052					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CTGAGGGCATCAAGGACTTCT	0.592																																																	0								ENSG00000124140						47.0	45.0	46.0					20																	44685180		2203	4300	6503	SLC12A5	SO:0001819	synonymous_variant	0			-	HGNC	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.3156C>T	20.37:g.44685180C>T		Somatic	0	54	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	69	16.87	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.I1052	ENST00000454036.2	37	c.3156	CCDS46610.1	20																																																																																			-	tigrfam_Na/K/Cl_cotransptS		0.592	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	protein_coding	OTTHUMT00000471538.1	C		-		44685180	+1	no_errors	ENST00000454036	ensembl	human	known	74_37	silent	SNP	1.000	T
OR1B1	347169	genome.wustl.edu	37	9	125391322	125391322	+	Missense_Mutation	SNP	C	C	T	rs374643352		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr9:125391322C>T	ENST00000304833.3	-	1	530	c.493G>A	c.(493-495)Gtc>Atc	p.V165I	RP11-64P14.7_ENST00000419604.1_RNA|RP11-64P14.7_ENST00000431442.1_RNA	NM_001004450.1	NP_001004450.1	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B, member 1	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)	16						AGAGGCAGGACGAGTCCCACA	0.542																																																	0								ENSG00000171484	C	ILE/VAL	0,4406		0,0,2203	83.0	65.0	71.0		493	-0.1	0.1	9		71	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR1B1	NM_001004450.1	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	165/319	125391322	1,13005	2203	4300	6503	OR1B1	SO:0001583	missense	0			-	HGNC	AC006313	CCDS35126.1	9q33.2	2012-08-09			ENSG00000171484	ENSG00000171484		"""GPCR / Class A : Olfactory receptors"""	8181	protein-coding gene	gene with protein product							Standard	NM_001004450		Approved	OR9-B	uc011lyz.2	Q8NGR6	OTTHUMG00000020616	ENST00000304833.3:c.493G>A	9.37:g.125391322C>T	ENSP00000303151:p.Val165Ile	Somatic	0	32	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	47	12.96	Q6IFN3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V165I	ENST00000304833.3	37	c.493	CCDS35126.1	9	.	.	.	.	.	.	.	.	.	.	C	0.629	-0.818135	0.02776	0.0	1.16E-4	ENSG00000171484	ENST00000304833	T	0.00099	8.73	4.3	-0.0793	0.13711	GPCR, rhodopsin-like superfamily (1);	0.595213	0.13917	N	0.353858	T	0.00109	0.0003	N	0.16743	0.435	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.11616	-1.0580	10	0.48119	T	0.1	-1.8105	7.9984	0.30282	0.0:0.2544:0.3382:0.4074	.	165	Q8NGR6	OR1B1_HUMAN	I	165	ENSP00000303151:V165I	ENSP00000303151:V165I	V	-	1	0	OR1B1	124431143	0.000000	0.05858	0.112000	0.21494	0.001000	0.01503	-1.548000	0.02184	-0.361000	0.08125	-1.966000	0.00469	GTC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	OR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1B1	protein_coding	OTTHUMT00000053947.2	C	NM_001004450	-		125391322	-1	no_errors	ENST00000304833	ensembl	human	known	74_37	missense	SNP	0.001	T
IRAK2	3656	genome.wustl.edu	37	3	10261427	10261427	+	Missense_Mutation	SNP	G	G	A	rs200632552		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr3:10261427G>A	ENST00000256458.4	+	8	1057	c.967G>A	c.(967-969)Gtc>Atc	p.V323I	RNU6-814P_ENST00000410416.1_RNA	NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	323	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						GCTCTGTGCCGTCGAGTACCT	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		17475	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000134070						72.0	59.0	63.0					3																	10261427		2203	4300	6503	IRAK2	SO:0001583	missense	0			GMAF=0.0005	HGNC	AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.967G>A	3.37:g.10261427G>A	ENSP00000256458:p.Val323Ile	Somatic	0	93	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	64	11.11	B4DQZ6|Q08AG6|Q5K546	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V323I	ENST00000256458.4	37	c.967	CCDS33697.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	0.006	-2.055861	0.00390	.	.	ENSG00000134070	ENST00000256458	T	0.34072	1.38	4.92	2.8	0.32819	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.345446	0.20702	N	0.087247	T	0.11623	0.0283	N	0.04994	-0.135	0.09310	N	1	P	0.36086	0.536	B	0.26693	0.072	T	0.10660	-1.0620	10	0.17369	T	0.5	-18.5586	3.889	0.09111	0.1609:0.2945:0.5446:0.0	.	323	O43187	IRAK2_HUMAN	I	323	ENSP00000256458:V323I	ENSP00000256458:V323I	V	+	1	0	IRAK2	10236427	0.238000	0.23825	0.021000	0.16686	0.026000	0.11368	1.292000	0.33342	1.037000	0.40024	-0.311000	0.09066	GTC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.602	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK2	protein_coding	OTTHUMT00000339623.1	G		rs200632552		10261427	+1	no_errors	ENST00000256458	ensembl	human	known	74_37	missense	SNP	0.029	A
DNAJC13	23317	genome.wustl.edu	37	3	132186035	132186035	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr3:132186035A>G	ENST00000260818.6	+	20	2334	c.2086A>G	c.(2086-2088)Aaa>Gaa	p.K696E	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	696					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						AAAATTTAATAAAGTTCCAGA	0.338																																																	0								ENSG00000138246						58.0	64.0	62.0					3																	132186035		2203	4300	6503	DNAJC13	SO:0001583	missense	0			-	HGNC	AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.2086A>G	3.37:g.132186035A>G	ENSP00000260818:p.Lys696Glu	Somatic	0	37	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.K696E	ENST00000260818.6	37	c.2086	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	A	22.6	4.315318	0.81358	.	.	ENSG00000138246	ENST00000260818	T	0.36157	1.27	5.8	5.8	0.92144	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.45498	0.1345	N	0.24115	0.695	0.80722	D	1	B;P	0.52842	0.384;0.956	B;D	0.65010	0.088;0.931	T	0.36311	-0.9753	10	0.40728	T	0.16	.	16.4401	0.83898	1.0:0.0:0.0:0.0	.	696;696	A7E2Y5;O75165	.;DJC13_HUMAN	E	696	ENSP00000260818:K696E	ENSP00000260818:K696E	K	+	1	0	DNAJC13	133668725	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.027000	0.93706	2.340000	0.79590	0.528000	0.53228	AAA	-	superfamily_ARM-type_fold		0.338	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	protein_coding	OTTHUMT00000356807.2	A	NM_015268	-		132186035	+1	no_errors	ENST00000260818	ensembl	human	known	74_37	missense	SNP	1.000	G
LAMA5	3911	genome.wustl.edu	37	20	60937454	60937454	+	Splice_Site	SNP	A	A	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr20:60937454A>T	ENST00000252999.3	-	2	517		c.e2+1		LAMA5_ENST00000370677.3_Splice_Site|LAMA5_ENST00000370692.3_Splice_Site	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5						angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			AAGGGTCCCTACCTGGCCCAG	0.652																																																	0								ENSG00000130702						89.0	74.0	79.0					20																	60937454		2196	4293	6489	LAMA5	SO:0001630	splice_region_variant	0			-	HGNC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.450+1T>A	20.37:g.60937454A>T		Somatic	0	66	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	67	30.30	Q8TDF8|Q8WZA7|Q9H1P1	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e2+2	ENST00000252999.3	37	c.450+2	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	A	21.7	4.192536	0.78902	.	.	ENSG00000130702	ENST00000252999;ENST00000370692;ENST00000370677	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5162	0.67821	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LAMA5	60370849	1.000000	0.71417	0.986000	0.45419	0.713000	0.41058	9.118000	0.94355	1.843000	0.53566	0.459000	0.35465	.	-	-		0.652	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	protein_coding	OTTHUMT00000080014.2	A	NM_005560	-	Intron	60937454	-1	no_errors	ENST00000252999	ensembl	human	known	74_37	splice_site	SNP	1.000	T
C1RL	51279	genome.wustl.edu	37	12	7252338	7252338	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr12:7252338G>A	ENST00000266542.4	-	5	727	c.635C>T	c.(634-636)aCc>aTc	p.T212I	C1RL_ENST00000504702.2_5'Flank|C1RL_ENST00000544702.1_Missense_Mutation_p.P228S|C1RL_ENST00000545280.1_Intron	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	212					complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGTCCCTGGGGTTGCACAGGT	0.557																																																	0								ENSG00000139178						67.0	48.0	55.0					12																	7252338		2200	4298	6498	C1RL	SO:0001583	missense	0			-	HGNC	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.635C>T	12.37:g.7252338G>A	ENSP00000266542:p.Thr212Ile	Somatic	0	120	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	45	16.67	Q53GX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_CUB_dom,superfamily_Trypsin-like_Pept_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.T212I	ENST00000266542.4	37	c.635	CCDS8573.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.724|4.724	0.134680|0.134680	0.09032|0.09032	.|.	.|.	ENSG00000139178|ENSG00000139178	ENST00000544702|ENST00000266542;ENST00000396661;ENST00000543933	T|T;T	0.37058|0.48522	1.22|0.81;2.03	3.86|3.86	-0.0406|-0.0406	0.13871|0.13871	.|Complement control module (1);	.|2.191600	.|0.01610	.|N	.|0.022502	T|T	0.32102|0.32102	0.0818|0.0818	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B|B	0.12013|0.25850	0.005|0.136	B|B	0.15870|0.18263	0.014|0.021	T|T	0.16070|0.16070	-1.0415|-1.0415	8|10	.|0.54805	.|T	.|0.06	.|.	2.5773|2.5773	0.04809|0.04809	0.1852:0.1443:0.5202:0.1502|0.1852:0.1443:0.5202:0.1502	.|.	228|212	F5GWF3|Q9NZP8	.|C1RL_HUMAN	S|I	228|212;212;170	ENSP00000441885:P228S|ENSP00000266542:T212I;ENSP00000437398:T170I	.|ENSP00000266542:T212I	P|T	-|-	1|2	0|0	C1RL|C1RL	7143480|7143480	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.010000|0.010000	0.13242|0.13242	-0.244000|-0.244000	0.09639|0.09639	-2.048000|-2.048000	0.00412|0.00412	CCC|ACC	-	superfamily_Sushi_SCR_CCP		0.557	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1RL	protein_coding	OTTHUMT00000398367.1	G	NM_016546	-		7252338	-1	no_errors	ENST00000266542	ensembl	human	known	74_37	missense	SNP	0.000	A
PSMB8	5696	genome.wustl.edu	37	6	32808751	32808751	+	Silent	SNP	C	C	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr6:32808751C>G	ENST00000374882.3	-	6	866	c.816G>C	c.(814-816)cgG>cgC	p.R272R	TAP2_ENST00000374899.4_5'Flank|PSMB8_ENST00000374881.2_Silent_p.R268R|TAP2_ENST00000374897.2_5'Flank|TAP2_ENST00000452392.2_5'Flank|PSMB8_ENST00000395339.3_Silent_p.R248R	NM_148919.3	NP_683720.2	P28062	PSB8_HUMAN	proteasome (prosome, macropain) subunit, beta type, 8	272					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	11					Carfilzomib(DB08889)	GATTGGCTTCCCGGTACTGGT	0.512																																					NSCLC(48;53 1172 10859 13624 22883)												0								ENSG00000204264						151.0	125.0	134.0					6																	32808751		2203	4300	6503	PSMB8	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4756.1, CCDS4757.1	6p21.3	2013-03-27	2013-03-27		ENSG00000204264	ENSG00000204264		"""Proteasome (prosome, macropain) subunits"""	9545	protein-coding gene	gene with protein product		177046	"""proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)"", ""large multifunctional peptidase 7"""	LMP7		1529427, 10329130	Standard	XM_005275000		Approved	RING10, D6S216E, PSMB5i, beta5i	uc003oce.3	P28062	OTTHUMG00000031285	ENST00000374882.3:c.816G>C	6.37:g.32808751C>G		Somatic	0	57	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	30	45.45	B0UZC0|Q29824|Q5JNW6|Q5QNR8|Q96J48	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.R272	ENST00000374882.3	37	c.816	CCDS4757.1	6																																																																																			-	NULL		0.512	PSMB8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB8	protein_coding	OTTHUMT00000076617.3	C	NM_148919	-		32808751	-1	no_errors	ENST00000374882	ensembl	human	known	74_37	silent	SNP	0.772	G
SPG11	80208	genome.wustl.edu	37	15	44876713	44876713	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr15:44876713G>T	ENST00000261866.7	-	30	5181	c.5165C>A	c.(5164-5166)tCa>tAa	p.S1722*	SPG11_ENST00000558253.1_5'Flank|SPG11_ENST00000535302.2_Nonsense_Mutation_p.S1722*|SPG11_ENST00000558319.1_Nonsense_Mutation_p.S1722*|SPG11_ENST00000427534.2_Nonsense_Mutation_p.S1722*	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1722					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TTGTTTTAGTGACCACTGTTC	0.328																																																	0								ENSG00000104133						42.0	46.0	45.0					15																	44876713		2198	4298	6496	SPG11	SO:0001587	stop_gained	0			-	HGNC		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.5165C>A	15.37:g.44876713G>T	ENSP00000261866:p.Ser1722*	Somatic	0	23	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	43	15.69	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S1722*	ENST00000261866.7	37	c.5165	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	44	10.623016	0.99439	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	.	.	.	5.74	3.78	0.43462	.	0.436821	0.23868	N	0.043766	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1476	0.59472	0.0:0.1003:0.7162:0.1835	.	.	.	.	X	1722	.	ENSP00000261866:S1722X	S	-	2	0	SPG11	42664005	0.989000	0.36119	1.000000	0.80357	0.902000	0.53008	1.170000	0.31883	2.716000	0.92895	0.557000	0.71058	TCA	-	NULL		0.328	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	protein_coding	OTTHUMT00000253927.1	G		-		44876713	-1	no_errors	ENST00000261866	ensembl	human	known	74_37	nonsense	SNP	0.871	T
NPTX2	4885	genome.wustl.edu	37	7	98256505	98256505	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr7:98256505A>G	ENST00000265634.3	+	4	1082	c.917A>G	c.(916-918)gAc>gGc	p.D306G		NM_002523.2	NP_002514.1	P47972	NPTX2_HUMAN	neuronal pentraxin II	306	Pentaxin.				synaptic transmission (GO:0007268)	extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(5)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18	all_cancers(62;2.28e-09)|all_epithelial(64;4.86e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0128)|all_lung(186;0.0142)		STAD - Stomach adenocarcinoma(171;0.215)			TTTGTCAGTGACGGCAAGTGG	0.637																																																	0								ENSG00000106236						83.0	70.0	74.0					7																	98256505		2203	4300	6503	NPTX2	SO:0001583	missense	0			-	HGNC		CCDS5657.1	7q21.3-q22.1	2008-04-30			ENSG00000106236	ENSG00000106236			7953	protein-coding gene	gene with protein product	"""apexin"""	600750				8530029	Standard	NM_002523		Approved		uc003upl.2	P47972	OTTHUMG00000154369	ENST00000265634.3:c.917A>G	7.37:g.98256505A>G	ENSP00000265634:p.Asp306Gly	Somatic	0	71	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	54	39.33	A4D267|Q86XV7|Q96G70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.D306G	ENST00000265634.3	37	c.917	CCDS5657.1	7	.	.	.	.	.	.	.	.	.	.	A	28.2	4.895556	0.91962	.	.	ENSG00000106236	ENST00000265634	T	0.62232	0.04	5.38	5.38	0.77491	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.82958	0.5150	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86768	0.1971	10	0.66056	D	0.02	-21.8799	14.8627	0.70392	1.0:0.0:0.0:0.0	.	306	P47972	NPTX2_HUMAN	G	306	ENSP00000265634:D306G	ENSP00000265634:D306G	D	+	2	0	NPTX2	98094441	1.000000	0.71417	0.912000	0.35992	0.971000	0.66376	9.287000	0.95975	2.163000	0.67991	0.528000	0.53228	GAC	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin		0.637	NPTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX2	protein_coding	OTTHUMT00000334982.1	A	NM_002523	-		98256505	+1	no_errors	ENST00000265634	ensembl	human	known	74_37	missense	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7578208	7578208	+	Missense_Mutation	SNP	T	T	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:7578208T>C	ENST00000269305.4	-	6	830	c.641A>G	c.(640-642)cAt>cGt	p.H214R	TP53_ENST00000413465.2_Missense_Mutation_p.H214R|TP53_ENST00000420246.2_Missense_Mutation_p.H214R|TP53_ENST00000445888.2_Missense_Mutation_p.H214R|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.H214R|TP53_ENST00000359597.4_Missense_Mutation_p.H214R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	214	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> P (in a sporadic cancer; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in sporadic cancers; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H214R(61)|p.0?(8)|p.?(5)|p.H82R(4)|p.H214fs*33(4)|p.H121R(4)|p.H214fs*5(2)|p.D208fs*1(1)|p.H82fs*>9(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213fs*32(1)|p.H121fs*33(1)|p.T211_S215delTFRHS(1)|p.R209fs*6(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACCACACTATGTCGAAAAGT	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	98	Substitution - Missense(69)|Deletion - Frameshift(12)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(3)|Complex - deletion inframe(1)	lung(27)|liver(12)|ovary(8)|biliary_tract(6)|oesophagus(6)|upper_aerodigestive_tract(5)|central_nervous_system(5)|large_intestine(5)|urinary_tract(5)|prostate(4)|bone(4)|stomach(3)|breast(3)|haematopoietic_and_lymphoid_tissue(2)|soft_tissue(1)|skin(1)|pancreas(1)						ENSG00000141510						127.0	114.0	119.0					17																	7578208		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.641A>G	17.37:g.7578208T>C	ENSP00000269305:p.His214Arg	Somatic	0	51	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	7	84.09	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.H214R	ENST00000269305.4	37	c.641	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	35	5.548167	0.96488	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99755	-6.64;-6.64;-6.64;-6.64;-6.64;-6.64;-6.64;-6.64	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.052737	0.85682	D	0.000000	D	0.99664	0.9875	M	0.75615	2.305	0.80722	D	1	D;D;P;D;D;D;D	0.76494	0.999;0.992;0.733;0.999;0.994;0.994;0.999	D;D;B;D;D;D;D	0.74674	0.984;0.947;0.376;0.982;0.95;0.968;0.962	D	0.97475	1.0043	10	0.72032	D	0.01	-26.1151	13.4753	0.61306	0.0:0.0:0.0:1.0	.	175;214;214;121;214;214;214	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	214;214;214;214;214;214;203;121;82;121;82	ENSP00000410739:H214R;ENSP00000352610:H214R;ENSP00000269305:H214R;ENSP00000398846:H214R;ENSP00000391127:H214R;ENSP00000391478:H214R;ENSP00000425104:H82R;ENSP00000423862:H121R	ENSP00000269305:H214R	H	-	2	0	TP53	7518933	1.000000	0.71417	0.283000	0.24790	0.961000	0.63080	7.996000	0.88334	2.128000	0.65567	0.460000	0.39030	CAT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	-		7578208	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	0.999	C
PLEKHM1P	440456	genome.wustl.edu	37	17	62788544	62788544	+	RNA	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:62788544C>T	ENST00000582986.1	-	0	2065					NR_024386.1		Q69YJ1	PKHMP_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene						intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)										GCTCCCGGCTCCTCCCAATGA	0.607																																																	0								ENSG00000214176																																			PLEKHM1P			0			-	HGNC			17q24.1	2012-10-03			ENSG00000214176	ENSG00000214176			35411	pseudogene	pseudogene							Standard	NR_024386		Approved	LOC440456	uc002jew.4	Q69YJ1	OTTHUMG00000179296		17.37:g.62788544C>T		Somatic	0	45	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	47	18.97		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000582986.1	37	NULL		17																																																																																			-	-		0.607	PLEKHM1P-002	KNOWN	basic	processed_transcript	PLEKHM1P	pseudogene	OTTHUMT00000445598.1	C	NR_024386	-		62788544	-1	no_errors	ENST00000578036	ensembl	human	known	74_37	rna	SNP	0.393	T
PARP4	143	genome.wustl.edu	37	13	25021323	25021323	+	Splice_Site	SNP	A	A	G	rs73172125		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr13:25021323A>G	ENST00000381989.3	-	26	3221	c.3116T>C	c.(3115-3117)aTa>aCa	p.I1039T		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1039	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.I1039T(2)		autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TTGGTCTTCTATCTATTTATA	0.408																																																	2	Substitution - Missense(2)	prostate(1)|stomach(1)						ENSG00000102699						40.0	41.0	41.0					13																	25021323		2203	4300	6503	PARP4	SO:0001630	splice_region_variant	0			-	HGNC	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3115-1T>C	13.37:g.25021323A>G		Somatic	0	33	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.I1039T	ENST00000381989.3	37	c.3116	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	A	17.08	3.297585	0.60086	.	.	ENSG00000102699	ENST00000381989	T	0.23147	1.92	4.69	4.69	0.59074	von Willebrand factor, type A (2);	0.215738	0.48767	D	0.000175	T	0.42177	0.1191	M	0.79475	2.455	0.40246	D	0.978015	P	0.45348	0.856	P	0.51055	0.657	T	0.48222	-0.9054	10	0.72032	D	0.01	-21.476	12.4624	0.55738	1.0:0.0:0.0:0.0	.	1039	Q9UKK3	PARP4_HUMAN	T	1039	ENSP00000371419:I1039T	ENSP00000371419:I1039T	I	-	2	0	PARP4	23919323	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.226000	0.58606	2.105000	0.64084	0.514000	0.50259	ATA	-	pfam_VWF_A,pfscan_VWF_A		0.408	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	protein_coding	OTTHUMT00000044189.1	A	NM_006437	rs73172125	Missense_Mutation	25021323	-1	no_errors	ENST00000381989	ensembl	human	known	74_37	missense	SNP	1.000	G
ALPK1	80216	genome.wustl.edu	37	4	113332167	113332167	+	Intron	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr4:113332167G>A	ENST00000458497.1	+	5	555				ALPK1_ENST00000504176.2_Intron|ALPK1_ENST00000505912.1_3'UTR|ALPK1_ENST00000177648.9_Intron	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1								ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		TTAGTGTGACGTCATTTACGT	0.368																																																	0								ENSG00000073331																																			ALPK1	SO:0001627	intron_variant	0			-	HGNC	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.277-816G>A	4.37:g.113332167G>A		Somatic	0	53	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	28	17.65	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000458497.1	37	NULL	CCDS3697.1	4																																																																																			-	-		0.368	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	protein_coding	OTTHUMT00000256421.2	G	NM_025144	-		113332167	+1	no_errors	ENST00000505912	ensembl	human	known	74_37	rna	SNP	0.002	A
POTEE	445582	genome.wustl.edu	37	2	131976101	131976101	+	Silent	SNP	C	C	T	rs558466498		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr2:131976101C>T	ENST00000356920.5	+	1	220	c.126C>T	c.(124-126)aaC>aaT	p.N42N	POTEE_ENST00000358087.5_Silent_p.N42N|PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	42					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GCAAGAGCAACGTGGGCACTT	0.592													c|||	1	0.000199681	0.0	0.0	5008	,	,		17826	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000188219						131.0	151.0	144.0					2																	131976101		2194	4298	6492	POTEE	SO:0001819	synonymous_variant	0			-	HGNC	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.126C>T	2.37:g.131976101C>T		Somatic	0	214	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	62	47.90	Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.N42	ENST00000356920.5	37	c.126	CCDS46414.1	2																																																																																			-	NULL		0.592	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	protein_coding		C	NM_001083538	-		131976101	+1	no_errors	ENST00000356920	ensembl	human	known	74_37	silent	SNP	0.028	T
CCDC103	388389	genome.wustl.edu	37	17	42978925	42978925	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:42978925C>T	ENST00000417826.2	+	3	276	c.181C>T	c.(181-183)Cgg>Tgg	p.R61W	FAM187A_ENST00000412523.2_Intron|CCDC103_ENST00000410027.1_Missense_Mutation_p.R61W|EFTUD2_ENST00000402521.3_5'Flank|FAM187A_ENST00000331733.4_5'UTR|AC015936.3_ENST00000441312.1_RNA|EFTUD2_ENST00000592576.1_5'Flank|EFTUD2_ENST00000426333.2_5'Flank|CCDC103_ENST00000410006.2_Missense_Mutation_p.R61W|EFTUD2_ENST00000591382.1_5'Flank	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	Q8IW40	CC103_HUMAN	coiled-coil domain containing 103	61					axonemal dynein complex assembly (GO:0070286)|cell projection organization (GO:0030030)|cilium movement (GO:0003341)|determination of digestive tract left/right asymmetry (GO:0071907)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|inner dynein arm assembly (GO:0036159)|outer dynein arm assembly (GO:0036158)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(3)|prostate(1)|skin(1)	7		Prostate(33;0.109)				GCCACTGGAGCGGAAGGATAA	0.517																																																	0								ENSG00000167131						150.0	127.0	135.0					17																	42978925		2203	4300	6503	CCDC103	SO:0001583	missense	0			-	HGNC	AK023156	CCDS11490.1, CCDS58554.1	17q21.31	2013-02-22			ENSG00000167131	ENSG00000167131			32700	protein-coding gene	gene with protein product		614677				22581229	Standard	NM_213607		Approved	FLJ13094, FLJ34211, PR46b, CILD17	uc031ray.1	Q8IW40	OTTHUMG00000154264	ENST00000417826.2:c.181C>T	17.37:g.42978925C>T	ENSP00000391692:p.Arg61Trp	Somatic	0	64	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	36	21.74	A8K145|B8ZZU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R61W	ENST00000417826.2	37	c.181	CCDS11490.1	17	.	.	.	.	.	.	.	.	.	.	C	21.5	4.164605	0.78339	.	.	ENSG00000167131	ENST00000357776;ENST00000410027;ENST00000417826;ENST00000410006	T;T;T	0.79033	-1.23;-1.23;-1.23	5.63	3.41	0.39046	.	0.652152	0.12226	U	0.487882	T	0.76018	0.3929	L	0.58810	1.83	0.35278	D	0.781083	D	0.67145	0.996	B	0.43623	0.425	T	0.82244	-0.0553	10	0.87932	D	0	-2.8181	13.5562	0.61761	0.4575:0.5425:0.0:0.0	.	61	Q8IW40	CC103_HUMAN	W	61	ENSP00000350420:R61W;ENSP00000391692:R61W;ENSP00000387252:R61W	ENSP00000350420:R61W	R	+	1	2	CCDC103	40334451	0.606000	0.26949	0.798000	0.32154	0.977000	0.68977	0.665000	0.25083	1.224000	0.43551	0.555000	0.69702	CGG	-	NULL		0.517	CCDC103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC103	protein_coding	OTTHUMT00000334578.1	C	NM_213607	-		42978925	+1	no_errors	ENST00000410006	ensembl	human	known	74_37	missense	SNP	0.742	T
KEL	3792	genome.wustl.edu	37	7	142643361	142643361	+	Missense_Mutation	SNP	G	G	A	rs371010057		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr7:142643361G>A	ENST00000355265.2	-	11	1721	c.1247C>T	c.(1246-1248)aCg>aTg	p.T416M	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	416					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					CTCGAAGAACGTGCCTGTCTC	0.582													G|||	1	0.000199681	0.0	0.0	5008	,	,		18518	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000197993	G	MET/THR	0,4406		0,0,2203	96.0	82.0	87.0		1247	3.6	0.0	7		87	1,8599	1.2+/-3.3	0,1,4299	no	missense	KEL	NM_000420.2	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	416/733	142643361	1,13005	2203	4300	6503	KEL	SO:0001583	missense	0			-	HGNC	BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1247C>T	7.37:g.142643361G>A	ENSP00000347409:p.Thr416Met	Somatic	0	51	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	43	24.56	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.T416M	ENST00000355265.2	37	c.1247	CCDS34766.1	7	.	.	.	.	.	.	.	.	.	.	G	12.50	1.956219	0.34565	0.0	1.16E-4	ENSG00000197993	ENST00000355265	T	0.74526	-0.85	4.48	3.59	0.41128	Peptidase M13 (1);	1.462760	0.04250	N	0.338467	T	0.77896	0.4199	L	0.36672	1.1	0.09310	N	1	D	0.65815	0.995	P	0.55545	0.778	T	0.62872	-0.6762	10	0.62326	D	0.03	-9.7875	9.6704	0.40008	0.0:0.0:0.7922:0.2078	.	416	P23276	KELL_HUMAN	M	416	ENSP00000347409:T416M	ENSP00000347409:T416M	T	-	2	0	KEL	142353483	0.662000	0.27439	0.038000	0.18304	0.071000	0.16799	1.703000	0.37846	1.074000	0.40909	0.462000	0.41574	ACG	-	pfam_Peptidase_M13_N		0.582	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEL	protein_coding	OTTHUMT00000347671.2	G	NM_000420	-		142643361	-1	no_errors	ENST00000355265	ensembl	human	known	74_37	missense	SNP	0.208	A
MAGEB1	4112	genome.wustl.edu	37	X	30269231	30269231	+	Silent	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chrX:30269231G>A	ENST00000378981.3	+	4	942	c.621G>A	c.(619-621)gtG>gtA	p.V207V	MAGEB1_ENST00000397548.2_Silent_p.V207V|MAGEB1_ENST00000397550.1_Silent_p.V207V	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	207	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						TCCTGGGTGTGATCTTCTTAA	0.488																																																	0								ENSG00000214107						80.0	60.0	67.0					X																	30269231		2202	4300	6502	MAGEB1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.621G>A	X.37:g.30269231G>A		Somatic	0	18	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	20	45.95	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.V207	ENST00000378981.3	37	c.621	CCDS14222.1	X																																																																																			-	pfam_MAGE,pfscan_MAGE		0.488	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB1	protein_coding	OTTHUMT00000056160.1	G	NM_002363	-		30269231	+1	no_errors	ENST00000378981	ensembl	human	known	74_37	silent	SNP	0.091	A
COL4A3	1285	genome.wustl.edu	37	2	228110799	228110799	+	Intron	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr2:228110799G>A	ENST00000396578.3	+	6	549				AC097662.2_ENST00000606119.1_RNA|AC097662.2_ENST00000437673.1_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000396588.2_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		AAGGTGAAATGGCAATGAAAG	0.403																																																	0								ENSG00000236432						86.0	76.0	79.0					2																	228110799		692	1591	2283	AC097662.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.387+67G>A	2.37:g.228110799G>A		Somatic	0	43	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	38	19.15	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396578.3	37	NULL	CCDS42829.1	2																																																																																			-	-		0.403	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000236432	protein_coding	OTTHUMT00000331409.2	G	NM_000091	-		228110799	-1	no_errors	ENST00000396588	ensembl	human	known	74_37	rna	SNP	0.000	A
PREX2	80243	genome.wustl.edu	37	8	69058476	69058476	+	Missense_Mutation	SNP	C	C	T	rs267601977		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr8:69058476C>T	ENST00000288368.4	+	34	4397	c.4120C>T	c.(4120-4122)Cgg>Tgg	p.R1374W		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1374					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AGAAGGAAGTCGGCAAGCTCT	0.328																																																	0								ENSG00000046889						86.0	83.0	84.0					8																	69058476		2203	4300	6503	PREX2	SO:0001583	missense	0			-	HGNC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4120C>T	8.37:g.69058476C>T	ENSP00000288368:p.Arg1374Trp	Somatic	0	36	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	19	34.48	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R1374W	ENST00000288368.4	37	c.4120	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269838	0.80469	.	.	ENSG00000046889	ENST00000288368	T	0.50001	0.76	5.92	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.67730	0.2924	M	0.72118	2.19	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	T	0.72340	-0.4323	10	0.87932	D	0	.	15.6524	0.77108	0.2484:0.7516:0.0:0.0	.	1374	Q70Z35	PREX2_HUMAN	W	1374	ENSP00000288368:R1374W	ENSP00000288368:R1374W	R	+	1	2	PREX2	69221030	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.514000	0.53422	1.487000	0.48415	0.650000	0.86243	CGG	-	NULL		0.328	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	protein_coding	OTTHUMT00000378620.1	C	NM_025170	-		69058476	+1	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM74A7	100996582	genome.wustl.edu	37	9	40715674	40715674	+	lincRNA	SNP	G	G	A	rs11793262		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr9:40715674G>A	ENST00000432614.1	-	0	0				FAM74A3_ENST00000604146.1_lincRNA																							caaAAGCAGGGTAGGGCTCCA	0.483																																																	0								ENSG00000204844																																			FAM74A3			0			-	HGNC																													9.37:g.40715674G>A		Somatic	0	15	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	18	45.45		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000432614.1	37	NULL		9																																																																																			-	-		0.483	RP11-395E19.5-001	KNOWN	basic	lincRNA	FAM74A3	lincRNA	OTTHUMT00000143688.1	G		rs200737309		40715674	+1	no_errors	ENST00000604146	ensembl	human	known	74_37	rna	SNP	0.608	A
MUC19	283463	genome.wustl.edu	37	12	40812989	40812989	+	5'UTR	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr12:40812989C>T	ENST00000454784.4	+	0	374				RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						AAGGATCCCACATTCCAGAAG	0.313																																																	0								ENSG00000205592																																			MUC19	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.-360C>T	12.37:g.40812989C>T		Somatic	0	28	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	23	17.24	Q8NA85	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D	p.H107	ENST00000454784.4	37	c.321		12																																																																																			-	NULL		0.313	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	protein_coding	OTTHUMT00000384257.6	C	XM_003403524	-		40812989	+1	no_errors	ENST00000425730	ensembl	human	putative	74_37	silent	SNP	1.000	T
USO1	8615	genome.wustl.edu	37	4	76655122	76655122	+	Missense_Mutation	SNP	G	G	T	rs570185276	byFrequency	TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr4:76655122G>T	ENST00000538159.1	+	2	173	c.173G>T	c.(172-174)cGt>cTt	p.R58L	USO1_ENST00000514213.2_Missense_Mutation_p.R44L			O60763	USO1_HUMAN	USO1 vesicle transport factor	60	Globular head.				ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CATAGTTTTCGTTTAGTCAAG	0.294																																																	0								ENSG00000138768																																			USO1	SO:0001583	missense	0			-	HGNC	AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.173G>T	4.37:g.76655122G>T	ENSP00000440586:p.Arg58Leu	Somatic	0	45	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vesicle_Uso1_P115_head,pfam_Uso1_p115_C,superfamily_ARM-type_fold,superfamily_t-SNARE	p.R58L	ENST00000538159.1	37	c.173		4	.	.	.	.	.	.	.	.	.	.	G	4.101	0.016877	0.07959	.	.	ENSG00000138768	ENST00000538159;ENST00000514213	T	0.65549	-0.16	2.99	1.1	0.20463	.	1.871260	0.02651	N	0.106410	T	0.52240	0.1722	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.40098	-0.9581	7	0.25751	T	0.34	.	8.7364	0.34530	0.0:0.443:0.557:0.0	.	.	.	.	L	58;44	ENSP00000444850:R44L	ENSP00000444850:R44L	R	+	2	0	USO1	76874146	0.028000	0.19301	0.001000	0.08648	0.258000	0.26162	0.001000	0.13038	0.263000	0.21812	0.467000	0.42956	CGT	-	superfamily_ARM-type_fold		0.294	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	USO1	protein_coding		G	NM_003715	-		76655122	+1	no_errors	ENST00000538159	ensembl	human	known	74_37	missense	SNP	0.001	T
SALL1	6299	genome.wustl.edu	37	16	51175551	51175551	+	Silent	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr16:51175551G>A	ENST00000251020.4	-	2	615	c.582C>T	c.(580-582)aaC>aaT	p.N194N	SALL1_ENST00000440970.1_Silent_p.N97N|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	194					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CGATGATGACGTTGCTGTTGA	0.627																																					GBM(103;1352 1446 1855 4775 8890)												0								ENSG00000103449						95.0	89.0	91.0					16																	51175551		2198	4300	6498	SALL1	SO:0001819	synonymous_variant	0			-	HGNC	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.582C>T	16.37:g.51175551G>A		Somatic	0	152	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	46	36.99	Q99881|Q9NSC3|Q9P1R0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N194	ENST00000251020.4	37	c.582	CCDS10747.1	16																																																																																			-	NULL		0.627	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	protein_coding	OTTHUMT00000256883.2	G	NM_002968	-		51175551	-1	no_errors	ENST00000251020	ensembl	human	known	74_37	silent	SNP	1.000	A
LACTB	114294	genome.wustl.edu	37	15	63419128	63419128	+	Silent	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr15:63419128C>T	ENST00000261893.4	+	3	567	c.495C>T	c.(493-495)atC>atT	p.I165I	RPS27L_ENST00000559763.1_Intron|LACTB_ENST00000413507.2_Silent_p.I165I	NM_032857.3	NP_116246.2	P83111	LACTB_HUMAN	lactamase, beta	165						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(1)	12						TTGCTAGCATCAGCAAAAGTC	0.418																																					Melanoma(85;443 1381 6215 27308 35583)												0								ENSG00000103642						127.0	111.0	116.0					15																	63419128		2203	4300	6503	LACTB	SO:0001819	synonymous_variant	0			-	HGNC	AK027808	CCDS10182.1, CCDS45275.1	15q22.1	2012-11-14	2001-12-12	2001-12-14	ENSG00000103642	ENSG00000103642		"""Mitochondrial ribosomal proteins / large subunits"""	16468	protein-coding gene	gene with protein product		608440	"""mitochondrial ribosomal protein L56"""	MRPL56		11707067	Standard	NM_032857		Approved	FLJ14902	uc002alw.3	P83111	OTTHUMG00000132807	ENST00000261893.4:c.495C>T	15.37:g.63419128C>T		Somatic	0	53	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	57	10.94	P83096	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Beta-lactam-related,superfamily_Beta-lactam/transpept-like	p.I165	ENST00000261893.4	37	c.495	CCDS10182.1	15																																																																																			-	pfam_Beta-lactam-related,superfamily_Beta-lactam/transpept-like		0.418	LACTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LACTB	protein_coding	OTTHUMT00000256224.1	C	NM_032857	-		63419128	+1	no_errors	ENST00000261893	ensembl	human	known	74_37	silent	SNP	1.000	T
ZNF177	7730	genome.wustl.edu	37	19	9491685	9491685	+	Silent	SNP	T	T	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr19:9491685T>A	ENST00000589262.1	+	6	744	c.678T>A	c.(676-678)ccT>ccA	p.P226P	ZNF177_ENST00000590616.1_Intron|ZNF177_ENST00000602856.1_3'UTR|ZNF177_ENST00000446085.4_3'UTR|ZNF177_ENST00000434737.2_Silent_p.P226P|ZNF177_ENST00000602738.1_Intron|ZNF177_ENST00000343499.4_Intron|ZNF177_ENST00000541595.2_Intron	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	226					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						AGCAAATACCTACTGGAGAGA	0.443																																																	0								ENSG00000188629																																			ZNF177	SO:0001819	synonymous_variant	0			-	HGNC	U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.678T>A	19.37:g.9491685T>A		Somatic	0	55	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	37	43.94	B4DY57|E9PDG0|I3L0I4|Q96ER2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P226	ENST00000589262.1	37	c.678	CCDS54214.1	19																																																																																			-	NULL		0.443	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF177	protein_coding	OTTHUMT00000449028.1	T	NM_003451	-		9491685	+1	no_errors	ENST00000434737	ensembl	human	known	74_37	silent	SNP	0.410	A
DHX38	9785	genome.wustl.edu	37	16	72139995	72139995	+	Missense_Mutation	SNP	C	C	T	rs372311072		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr16:72139995C>T	ENST00000268482.3	+	19	3088	c.2579C>T	c.(2578-2580)aCg>aTg	p.T860M	DHX38_ENST00000536867.1_Missense_Mutation_p.T172M	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	860	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				GCCGGCAGGACGGGCCCAGGT	0.652																																					Melanoma(97;711 1442 7855 13832 28836)												0								ENSG00000140829	C	MET/THR	0,4396		0,0,2198	55.0	57.0	56.0		2579	5.9	1.0	16		56	1,8599	1.2+/-3.3	0,1,4299	no	missense	DHX38	NM_014003.3	81	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	860/1228	72139995	1,12995	2198	4300	6498	DHX38	SO:0001583	missense	0			-	HGNC	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.2579C>T	16.37:g.72139995C>T	ENSP00000268482:p.Thr860Met	Somatic	0	81	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	9	78.57	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.T860M	ENST00000268482.3	37	c.2579	CCDS10907.1	16	.	.	.	.	.	.	.	.	.	.	C	33	5.254576	0.95336	0.0	1.16E-4	ENSG00000140829	ENST00000268482;ENST00000536867	T;T	0.02863	4.13;4.13	5.88	5.88	0.94601	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.25306	0.0615	M	0.93550	3.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.08868	-1.0701	10	0.87932	D	0	.	19.8526	0.96746	0.0:1.0:0.0:0.0	.	172;860	B4DVG8;Q92620	.;PRP16_HUMAN	M	860;172	ENSP00000268482:T860M;ENSP00000437898:T172M	ENSP00000268482:T860M	T	+	2	0	DHX38	70697496	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.736000	0.84948	2.782000	0.95742	0.655000	0.94253	ACG	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.652	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX38	protein_coding	OTTHUMT00000269004.3	C	NM_014003	-		72139995	+1	no_errors	ENST00000268482	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF304	57343	genome.wustl.edu	37	19	57868276	57868276	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr19:57868276A>T	ENST00000282286.5	+	3	1212	c.1039A>T	c.(1039-1041)Agc>Tgc	p.S347C	ZNF304_ENST00000391705.3_Missense_Mutation_p.S347C|ZNF304_ENST00000598744.1_Missense_Mutation_p.S305C|ZNF304_ENST00000443917.2_Missense_Mutation_p.S394C			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		CTACAGCAGAAGCTCCCACCT	0.468																																																	0								ENSG00000131845						63.0	61.0	62.0					19																	57868276		2203	4300	6503	ZNF304	SO:0001583	missense	0			-	HGNC	AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.1039A>T	19.37:g.57868276A>T	ENSP00000282286:p.Ser347Cys	Somatic	0	42	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	23	43.90		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S347C	ENST00000282286.5	37	c.1039	CCDS12950.1	19	.	.	.	.	.	.	.	.	.	.	A	11.64	1.700307	0.30142	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	T;T;T	0.16743	2.32;2.32;5.16	3.51	2.49	0.30216	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12263	0.0298	L	0.47716	1.5	0.09310	N	1	D;D	0.61080	0.962;0.989	B;B	0.38264	0.256;0.269	T	0.21280	-1.0250	9	0.46703	T	0.11	.	4.7188	0.12909	0.6991:0.1932:0.1077:0.0	.	347;394	Q9HCX3;E7EQD3	ZN304_HUMAN;.	C	347;347;394	ENSP00000282286:S347C;ENSP00000375586:S347C;ENSP00000401642:S394C	ENSP00000282286:S347C	S	+	1	0	ZNF304	62560088	0.001000	0.12720	0.006000	0.13384	0.997000	0.91878	1.687000	0.37680	0.728000	0.32382	0.477000	0.44152	AGC	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.468	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF304	protein_coding	OTTHUMT00000465785.1	A		-		57868276	+1	no_errors	ENST00000282286	ensembl	human	known	74_37	missense	SNP	0.001	T
IQCF1	132141	genome.wustl.edu	37	3	51937043	51937043	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr3:51937043C>A	ENST00000310914.5	-	2	128	c.66G>T	c.(64-66)gaG>gaT	p.E22D		NM_152397.2	NP_689610.2	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	22										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GGGTTGGCATCTCCTTCTGCT	0.512																																																	0								ENSG00000173389						487.0	446.0	460.0					3																	51937043		2203	4300	6503	IQCF1	SO:0001583	missense	0			-	HGNC	BC029595	CCDS2836.1	3p21.31	2008-02-05			ENSG00000173389	ENSG00000173389			28607	protein-coding gene	gene with protein product						12477932	Standard	NM_152397		Approved	MGC39725	uc003dbv.3	Q8N6M8	OTTHUMG00000156908	ENST00000310914.5:c.66G>T	3.37:g.51937043C>A	ENSP00000307958:p.Glu22Asp	Somatic	0	161	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	160	9.09	Q8N711	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.E22D	ENST00000310914.5	37	c.66	CCDS2836.1	3	.	.	.	.	.	.	.	.	.	.	C	7.901	0.734310	0.15574	.	.	ENSG00000173389	ENST00000535733;ENST00000310914	T	0.40756	1.02	3.99	2.19	0.27852	.	2.919270	0.01905	N	0.039468	T	0.25457	0.0619	N	0.19112	0.55	0.09310	N	1	P	0.35011	0.48	B	0.27887	0.084	T	0.18209	-1.0344	10	0.13853	T	0.58	-14.7534	6.2377	0.20772	0.0:0.7732:0.0:0.2268	.	22	Q8N6M8	IQCF1_HUMAN	D	22	ENSP00000307958:E22D	ENSP00000307958:E22D	E	-	3	2	IQCF1	51912083	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.370000	0.20433	0.649000	0.30751	0.491000	0.48974	GAG	-	NULL		0.512	IQCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF1	protein_coding	OTTHUMT00000346568.1	C	NM_152397	-		51937043	-1	no_errors	ENST00000310914	ensembl	human	known	74_37	missense	SNP	0.000	A
AAK1	22848	genome.wustl.edu	37	2	69685840	69685841	+	IGR	DEL	CA	CA	-	rs550880792|rs542320825|rs142247580		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr2:69685840_69685841delCA	ENST00000409068.1	-	0	2606				RP11-427H3.3_ENST00000606389.2_lincRNA			Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1						endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						GATGAATGAGcacacacacaca	0.421																																																	0								ENSG00000188971																																			RP11-427H3.3	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648		2.37:g.69685850_69685851delCA		Somatic	0	33	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	Q4ZFZ3|Q53RX6|Q9UPV4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409068.1	37	NULL		2																																																																																			-	-		0.421	AAK1-011	PUTATIVE	basic	protein_coding	ENSG00000188971	protein_coding	OTTHUMT00000333994.1	CA	NM_014911			69685841	-1	no_errors	ENST00000606389	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
GTF2A2	2958	genome.wustl.edu	37	15	59931102	59931102	+	3'UTR	SNP	A	A	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr15:59931102A>C	ENST00000396060.2	-	0	740				GTF2A2_ENST00000396064.3_3'UTR|GTF2A2_ENST00000396063.1_3'UTR|GTF2A2_ENST00000267869.4_5'UTR	NM_004492.2	NP_004483.1	P52657	T2AG_HUMAN	general transcription factor IIA, 2, 12kDa						gene expression (GO:0010467)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			central_nervous_system(2)|kidney(2)|lung(1)	5						GAAGGTTCTTAGGAAGGCAAC	0.303																																																	0								ENSG00000140307																																			GTF2A2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC001919	CCDS10173.1	15q21.3	2010-03-23	2002-08-29		ENSG00000140307	ENSG00000140307		"""General transcription factors"""	4647	protein-coding gene	gene with protein product		600519	"""general transcription factor IIA, 2 (12kD subunit)"""			7958899	Standard	NM_004492		Approved	TFIIA, HsT18745	uc002agg.3	P52657	OTTHUMG00000132725	ENST00000396060.2:c.*229T>G	15.37:g.59931102A>C		Somatic	0	19	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	A8MYQ7|Q6FGB5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000396060.2	37	NULL	CCDS10173.1	15																																																																																			-	-		0.303	GTF2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF2A2	protein_coding	OTTHUMT00000256067.2	A	NM_004492	-		59931102	-1	no_errors	ENST00000267869	ensembl	human	known	74_37	rna	SNP	0.919	C
MICAL3	57553	genome.wustl.edu	37	22	18273498	18273498	+	Nonstop_Mutation	SNP	T	T	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr22:18273498T>C	ENST00000441493.2	-	32	6361	c.6009A>G	c.(6007-6009)tgA>tgG	p.*2003W	MICAL3_ENST00000580469.1_5'Flank|XXbac-B461K10.4_ENST00000476405.1_RNA	NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	0					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		GGGTGGGAGCTCAGGACCAGT	0.637																																																	0								ENSG00000243156						25.0	28.0	27.0					22																	18273498		2092	4209	6301	MICAL3	SO:0001578	stop_lost	0			-	HGNC	AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.6009A>G	22.37:g.18273498T>C	ENSP00000416015:p.*2003Cysext*27	Somatic	0	35	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	14.89	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.*2003W	ENST00000441493.2	37	c.6009	CCDS46659.1	22	.	.	.	.	.	.	.	.	.	.	T	18.88	3.718522	0.68844	.	.	ENSG00000093100	ENST00000441493	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9958	0.71431	0.0:0.0:0.0:1.0	.	.	.	.	W	2003	.	.	X	-	3	0	XXbac-B461K10.4	16653498	1.000000	0.71417	0.998000	0.56505	0.926000	0.56050	5.997000	0.70646	2.013000	0.59113	0.459000	0.35465	TGA	-	NULL		0.637	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	protein_coding	OTTHUMT00000447351.1	T		-		18273498	-1	no_errors	ENST00000441493	ensembl	human	known	74_37	nonstop	SNP	1.000	C
UBAP1	51271	genome.wustl.edu	37	9	34241448	34241449	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr9:34241448_34241449delAG	ENST00000297661.4	+	4	660_661	c.425_426delAG	c.(424-426)cagfs	p.Q142fs	UBAP1_ENST00000359544.2_Frame_Shift_Del_p.Q142fs|UBAP1_ENST00000545103.1_Frame_Shift_Del_p.Q206fs|UBAP1_ENST00000379186.4_Frame_Shift_Del_p.Q142fs|UBAP1_ENST00000543944.1_Frame_Shift_Del_p.Q178fs|UBAP1_ENST00000536252.1_Frame_Shift_Del_p.Q142fs|UBAP1_ENST00000540348.1_Frame_Shift_Del_p.Q142fs	NM_016525.4	NP_057609.2	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	142					protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)	ubiquitin binding (GO:0043130)			endometrium(4)|kidney(2)|lung(6)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(29;0.00272)			GCCACGAAACAGAAAGTTCTCA	0.47																																					NSCLC(109;1074 1634 14978 20375 39620)												0								ENSG00000165006																																			UBAP1	SO:0001589	frameshift_variant	0				HGNC	AF222043	CCDS6550.1	9p13.3	2008-05-15	2002-08-27	2002-08-30	ENSG00000165006	ENSG00000165006			12461	protein-coding gene	gene with protein product		609787	"""ubiquitin associated protein"""	UBAP			Standard	NM_001171201		Approved		uc011loj.2	Q9NZ09	OTTHUMG00000000430	ENST00000297661.4:c.425_426delAG	9.37:g.34241448_34241449delAG	ENSP00000297661:p.Gln142fs	Somatic	0	22	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	20	20.00	B7Z348|B7Z8N9|D3DRL7|F5GXE2|F5H0J8|Q4V759|Q53FP7|Q5T7B3|Q6FI75|Q8NC52|Q8NCG6|Q8NCH9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_UBA-like,pfscan_UBA/transl_elong_EF1B_N_euk	p.K207fs	ENST00000297661.4	37	c.617_618	CCDS6550.1	9																																																																																			-	NULL		0.470	UBAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP1	protein_coding	OTTHUMT00000001084.1	AG				34241449	+1	no_errors	ENST00000545103	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
LHX2	9355	genome.wustl.edu	37	9	126777694	126777694	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr9:126777694C>T	ENST00000373615.4	+	3	1356	c.617C>T	c.(616-618)gCc>gTc	p.A206V		NM_004789.3	NP_004780.3	P50458	LHX2_HUMAN	LIM homeobox 2	206					axon extension (GO:0048675)|axon guidance (GO:0007411)|cerebral cortex development (GO:0021987)|dorsal/ventral pattern formation (GO:0009953)|mesoderm development (GO:0007498)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural tube closure (GO:0001843)|olfactory bulb development (GO:0021772)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|retina development in camera-type eye (GO:0060041)|telencephalon regionalization (GO:0021978)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)	10						GCAGCAGGGGCCAACCCTCTG	0.716																																																	0								ENSG00000106689						12.0	16.0	15.0					9																	126777694		2169	4207	6376	LHX2	SO:0001583	missense	0			-	HGNC	U11701	CCDS6853.1	9q33.3	2011-06-20			ENSG00000106689	ENSG00000106689		"""Homeoboxes / LIM class"""	6594	protein-coding gene	gene with protein product		603759				8649822, 10051612	Standard	NM_004789		Approved	LH-2, hLhx2	uc004boe.1	P50458	OTTHUMG00000020647	ENST00000373615.4:c.617C>T	9.37:g.126777694C>T	ENSP00000362717:p.Ala206Val	Somatic	0	27	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	14	33.33	O95860|Q52M57|Q8N1Z3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.A206V	ENST00000373615.4	37	c.617	CCDS6853.1	9	.	.	.	.	.	.	.	.	.	.	C	13.64	2.298242	0.40694	.	.	ENSG00000106689	ENST00000373615	D	0.84223	-1.82	5.15	4.25	0.50352	.	0.061294	0.64402	D	0.000004	T	0.76478	0.3993	L	0.36672	1.1	0.42323	D	0.992267	B;B	0.20887	0.02;0.049	B;B	0.19946	0.027;0.026	T	0.69833	-0.5038	10	0.14656	T	0.56	.	12.1616	0.54107	0.0:0.9176:0.0:0.0824	.	206;206	B3KNJ5;P50458	.;LHX2_HUMAN	V	206	ENSP00000362717:A206V	ENSP00000362717:A206V	A	+	2	0	LHX2	125817515	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	4.657000	0.61490	2.388000	0.81334	0.462000	0.41574	GCC	-	NULL		0.716	LHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX2	protein_coding	OTTHUMT00000054010.2	C		-		126777694	+1	no_errors	ENST00000373615	ensembl	human	known	74_37	missense	SNP	1.000	T
TEX2	55852	genome.wustl.edu	37	17	62290410	62290410	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:62290410G>C	ENST00000583097.1	-	2	1340	c.1168C>G	c.(1168-1170)Ctg>Gtg	p.L390V	TEX2_ENST00000258991.3_Missense_Mutation_p.L390V|TEX2_ENST00000584379.1_Missense_Mutation_p.L390V			Q8IWB9	TEX2_HUMAN	testis expressed 2	390					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		AAATCCTTCAGACTGCTCCCC	0.463																																																	0								ENSG00000136478						75.0	77.0	77.0					17																	62290410		2203	4300	6503	TEX2	SO:0001583	missense	0			-	HGNC	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.1168C>G	17.37:g.62290410G>C	ENSP00000462665:p.Leu390Val	Somatic	0	86	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	101	13.68	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF2404	p.L390V	ENST00000583097.1	37	c.1168		17	.	.	.	.	.	.	.	.	.	.	G	4.478	0.088595	0.08583	.	.	ENSG00000136478	ENST00000258991	T	0.43688	0.94	6.17	-0.0612	0.13786	.	0.638405	0.15718	N	0.248067	T	0.20455	0.0492	N	0.25647	0.755	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.06405	0.002;0.001	T	0.10847	-1.0612	10	0.17369	T	0.5	-1.025	1.3518	0.02174	0.1607:0.2117:0.3787:0.2489	.	390;390	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	V	390	ENSP00000258991:L390V	ENSP00000258991:L390V	L	-	1	2	TEX2	59644142	0.607000	0.26958	0.104000	0.21259	0.878000	0.50629	0.730000	0.26043	0.443000	0.26582	0.655000	0.94253	CTG	-	NULL		0.463	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	TEX2	protein_coding	OTTHUMT00000443745.1	G	NM_018469	-		62290410	-1	no_errors	ENST00000258991	ensembl	human	known	74_37	missense	SNP	0.080	C
NUMBL	9253	genome.wustl.edu	37	19	41173893	41173898	+	In_Frame_Del	DEL	TGCTGT	TGCTGT	-	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	TGCTGT	TGCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr19:41173893_41173898delTGCTGT	ENST00000252891.4	-	10	1472_1477	c.1305_1310delACAGCA	c.(1303-1311)caacagcag>cag	p.435_437QQQ>Q	NUMBL_ENST00000540131.1_In_Frame_Del_p.394_396QQQ>Q|NUMBL_ENST00000598779.1_In_Frame_Del_p.394_396QQQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ctgctgctgctgctgttgctgttgct	0.66														2856	0.570288	0.7821	0.428	5008	,	,		15157	0.4653		0.5149	False		,,,				2504	0.5501																0								ENSG00000105245																																			NUMBL	SO:0001651	inframe_deletion	0				HGNC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305_1310delACAGCA	19.37:g.41173899_41173904delTGCTGT	ENSP00000252891:p.Gln445_Gln446del	Somatic	NA	NA	NA		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q7Z4J9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.QQ439in_frame_del	ENST00000252891.4	37	c.1310_1305	CCDS12561.1	19																																																																																			-	pirsf_Numb/numb-like		0.660	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	protein_coding	OTTHUMT00000462749.2	TGCTGT	NM_004756			41173898	-1	no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:0.998	-
ITGA8	8516	genome.wustl.edu	37	10	15719609	15719609	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr10:15719609C>A	ENST00000378076.3	-	6	1011	c.658G>T	c.(658-660)Ggg>Tgg	p.G220W		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	220					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						TAGAAACTCCCAGGTCCTCCC	0.373																																																	0								ENSG00000077943						120.0	112.0	115.0					10																	15719609		2203	4300	6503	ITGA8	SO:0001583	missense	0			-	HGNC	L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.658G>T	10.37:g.15719609C>A	ENSP00000367316:p.Gly220Trp	Somatic	0	45	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	30	23.08	B0YJ31|Q5VX94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.G220W	ENST00000378076.3	37	c.658	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457616	0.84317	.	.	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.30448	1.53	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.68192	0.2974	M	0.93594	3.435	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.76710	-0.2859	10	0.72032	D	0.01	.	19.582	0.95471	0.0:1.0:0.0:0.0	.	220;220	F5H818;P53708	.;ITA8_HUMAN	W	220	ENSP00000367316:G220W	ENSP00000367316:G220W	G	-	1	0	ITGA8	15759615	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.084000	0.76866	2.638000	0.89438	0.557000	0.71058	GGG	-	smart_Int_alpha_beta-p		0.373	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	protein_coding	OTTHUMT00000046987.1	C	NM_003638	-		15719609	-1	no_errors	ENST00000378076	ensembl	human	known	74_37	missense	SNP	1.000	A
LINC00273	649159	genome.wustl.edu	37	16	33961806	33961806	+	lincRNA	DEL	C	C	-			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr16:33961806delC	ENST00000539813.1	-	0	697				AC136932.1_ENST00000385251.1_RNA	NR_038368.1				long intergenic non-protein coding RNA 273											lung(1)	1						GGTGCCCTTGCCCTTGCGGTC	0.701																																																	0								ENSG00000256642																																			LINC00273			0				HGNC	AY587847		16p11.2	2013-06-03	2011-08-11	2011-08-11	ENSG00000256642	ENSG00000256642		"""Long non-coding RNAs"""	38595	other	unknown	"""non-protein coding RNA 273-1"""		"""non-protein coding RNA 273"""	NCRNA00273			Standard	NR_038368		Approved	TOP, NCRNA00273-1	uc021thl.1		OTTHUMG00000176379		16.37:g.33961806delC		Somatic	0	51	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000539813.1	37	NULL		16																																																																																			-	-		0.701	LINC00273-001	KNOWN	basic	lincRNA	LINC00273	lincRNA	OTTHUMT00000431840.1	C	NR_038368			33961806	-1	no_errors	ENST00000539813	ensembl	human	known	74_37	rna	DEL	0.004	-
ZCCHC13	389874	genome.wustl.edu	37	X	73524388	73524388	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chrX:73524388G>C	ENST00000339534.2	+	1	364	c.287G>C	c.(286-288)aGa>aCa	p.R96T		NM_203303.2	NP_976048.1	Q8WW36	ZCH13_HUMAN	zinc finger, CCHC domain containing 13	96							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	8						ACCTGCGGCAGACTAGGACAT	0.517																																																	0								ENSG00000187969						113.0	92.0	99.0					X																	73524388		2203	4300	6503	ZCCHC13	SO:0001583	missense	0			-	HGNC	BC021176	CCDS14425.1	Xq13.2	2008-02-05			ENSG00000187969	ENSG00000187969		"""Zinc fingers, CCHC domain containing"""	31749	protein-coding gene	gene with protein product							Standard	NM_203303		Approved	4930513O09RIK, Cnbp2, ZNF9L	uc004ebs.4	Q8WW36	OTTHUMG00000021851	ENST00000339534.2:c.287G>C	X.37:g.73524388G>C	ENSP00000345633:p.Arg96Thr	Somatic	0	27	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	53	14.52		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.R96T	ENST00000339534.2	37	c.287	CCDS14425.1	X	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594479	0.28445	.	.	ENSG00000187969	ENST00000339534	.	.	.	4.32	-2.86	0.05717	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (3);	0.219039	0.36591	U	0.002520	T	0.34308	0.0893	L	0.39085	1.19	0.09310	N	1	B	0.20550	0.046	B	0.22880	0.042	T	0.23119	-1.0197	9	0.87932	D	0	.	11.9661	0.53035	0.7266:0.0:0.2734:0.0	.	96	Q8WW36	ZCH13_HUMAN	T	96	.	ENSP00000345633:R96T	R	+	2	0	ZCCHC13	73441113	1.000000	0.71417	0.000000	0.03702	0.036000	0.12997	1.813000	0.38962	-0.925000	0.03775	0.529000	0.55759	AGA	-	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC		0.517	ZCCHC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC13	protein_coding	OTTHUMT00000057260.1	G	NM_203303	-		73524388	+1	no_errors	ENST00000339534	ensembl	human	known	74_37	missense	SNP	0.026	C
MMP10	4319	genome.wustl.edu	37	11	102647069	102647069	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr11:102647069C>A	ENST00000279441.4	-	6	910	c.874G>T	c.(874-876)Gct>Tct	p.A292S		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	292					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	AAGGACAAAGCAGGATCACAC	0.463																																																	0								ENSG00000166670						97.0	93.0	94.0					11																	102647069		2203	4299	6502	MMP10	SO:0001583	missense	0			-	HGNC	X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.874G>T	11.37:g.102647069C>A	ENSP00000279441:p.Ala292Ser	Somatic	0	24	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B2R9X9|Q53HH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.A292S	ENST00000279441.4	37	c.874	CCDS8321.1	11	.	.	.	.	.	.	.	.	.	.	C	4.096	0.015866	0.07959	.	.	ENSG00000166670	ENST00000279441	T	0.12984	2.63	4.43	-0.442	0.12253	Hemopexin/matrixin (2);	1.438130	0.04420	N	0.367507	T	0.06690	0.0171	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.15052	0.012	T	0.36672	-0.9738	10	0.17369	T	0.5	.	5.5454	0.17061	0.0:0.3001:0.1522:0.5477	.	292	P09238	MMP10_HUMAN	S	292	ENSP00000279441:A292S	ENSP00000279441:A292S	A	-	1	0	MMP10	102152279	0.000000	0.05858	0.003000	0.11579	0.065000	0.16274	-1.517000	0.02248	0.028000	0.15324	0.644000	0.83932	GCT	-	pirsf_Pept_M10A_Metazoans,superfamily_Hemopexin-like_dom		0.463	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP10	protein_coding	OTTHUMT00000398014.1	C		-		102647069	-1	no_errors	ENST00000279441	ensembl	human	known	74_37	missense	SNP	0.000	A
USO1	8615	genome.wustl.edu	37	4	76722251	76722251	+	Missense_Mutation	SNP	T	T	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr4:76722251T>G	ENST00000538159.1	+	18	1911	c.1911T>G	c.(1909-1911)atT>atG	p.I637M	USO1_ENST00000514213.2_Missense_Mutation_p.I613M			O60763	USO1_HUMAN	USO1 vesicle transport factor	628	Globular head.				ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CTAAGGCTATTTATAAGTCCA	0.259																																																	0								ENSG00000138768						48.0	42.0	44.0					4																	76722251		1789	4049	5838	USO1	SO:0001583	missense	0			-	HGNC	AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.1911T>G	4.37:g.76722251T>G	ENSP00000440586:p.Ile637Met	Somatic	0	26	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vesicle_Uso1_P115_head,pfam_Uso1_p115_C,superfamily_ARM-type_fold,superfamily_t-SNARE	p.I637M	ENST00000538159.1	37	c.1911		4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.89|15.89	2.967962|2.967962	0.53507|0.53507	.|.	.|.	ENSG00000138768|ENSG00000138768	ENST00000441296|ENST00000508939;ENST00000538159;ENST00000514213;ENST00000264904	.|T;T	.|0.69435	.|-0.4;-0.4	5.6|5.6	4.41|4.41	0.53225|0.53225	.|Vesicle tethering protein Uso1/P115-like , head domain (1);Armadillo-type fold (1);	.|0.050767	.|0.85682	.|D	.|0.000000	T|T	0.68247|0.68247	0.2980|0.2980	L|L	0.34521|0.34521	1.04|1.04	0.41510|0.41510	D|D	0.988331|0.988331	.|P;P	.|0.52170	.|0.951;0.686	.|P;P	.|0.60682	.|0.8;0.878	T|T	0.69591|0.69591	-0.5104|-0.5104	5|10	.|0.72032	.|D	.|0.01	.|.	8.5608|8.5608	0.33509|0.33509	0.0:0.2156:0.0:0.7844|0.0:0.2156:0.0:0.7844	.|.	.|637;628	.|F5GYR8;O60763	.|.;USO1_HUMAN	C|M	304|463;637;613;556	.|ENSP00000440586:I637M;ENSP00000444850:I613M	.|ENSP00000264904:I556M	F|I	+|+	2|3	0|3	USO1|USO1	76941275|76941275	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.014000|1.014000	0.29950|0.29950	0.951000|0.951000	0.37770|0.37770	0.455000|0.455000	0.32223|0.32223	TTT|ATT	-	pfam_Vesicle_Uso1_P115_head,superfamily_ARM-type_fold		0.259	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	USO1	protein_coding		T	NM_003715	-		76722251	+1	no_errors	ENST00000538159	ensembl	human	known	74_37	missense	SNP	1.000	G
RIPK2	8767	genome.wustl.edu	37	8	90796327	90796327	+	Missense_Mutation	SNP	A	A	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr8:90796327A>C	ENST00000220751.4	+	8	1303	c.989A>C	c.(988-990)gAa>gCa	p.E330A	RIPK2_ENST00000540020.1_Missense_Mutation_p.E193A	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	330					activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			AAGAAAATGGAATTATCTCTG	0.284																																																	0								ENSG00000104312						69.0	72.0	71.0					8																	90796327		2203	4296	6499	RIPK2	SO:0001583	missense	0			-	HGNC	AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.989A>C	8.37:g.90796327A>C	ENSP00000220751:p.Glu330Ala	Somatic	0	40	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	B7Z748|Q6UWF0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CARD,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Rcpt-int_Ser/Thr_kinase-2,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_CARD,pfscan_Prot_kinase_dom	p.E330A	ENST00000220751.4	37	c.989	CCDS6247.1	8	.	.	.	.	.	.	.	.	.	.	A	11.45	1.643287	0.29246	.	.	ENSG00000104312	ENST00000220751;ENST00000540020	T;T	0.81247	-1.24;-1.47	5.73	0.185	0.15096	.	0.158787	0.29185	N	0.012883	T	0.60560	0.2278	N	0.17082	0.46	0.09310	N	0.999998	B	0.14438	0.01	B	0.09377	0.004	T	0.45527	-0.9255	10	0.29301	T	0.29	-9.2712	6.9903	0.24751	0.4624:0.4563:0.0813:0.0	.	330	O43353	RIPK2_HUMAN	A	330;193	ENSP00000220751:E330A;ENSP00000441623:E193A	ENSP00000220751:E330A	E	+	2	0	RIPK2	90865468	0.870000	0.30015	0.144000	0.22314	0.879000	0.50718	1.497000	0.35649	0.145000	0.18977	0.533000	0.62120	GAA	-	pirsf_Rcpt-int_Ser/Thr_kinase-2		0.284	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK2	protein_coding	OTTHUMT00000375686.1	A		-		90796327	+1	no_errors	ENST00000220751	ensembl	human	known	74_37	missense	SNP	0.153	C
CASP12	100506742	genome.wustl.edu	37	11	104761968	104761968	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr11:104761968A>G	ENST00000422698.2	-	4	614	c.596T>C	c.(595-597)aTt>aCt	p.I199T	CASP12_ENST00000433738.1_Intron|CASP12_ENST00000446862.1_Missense_Mutation_p.I199T|CASP12_ENST00000508062.1_Missense_Mutation_p.I115T|CASP12_ENST00000447913.1_Intron|CASP12_ENST00000494737.1_Intron|CASP12_ENST00000441710.1_Missense_Mutation_p.I199T|CASP12_ENST00000448103.1_Intron|CASP12_ENST00000375726.2_Missense_Mutation_p.I199T	NM_001191016.1	NP_001177945.1	Q6UXS9	CASPC_HUMAN	caspase 12 (gene/pseudogene)	199					endoplasmic reticulum unfolded protein response (GO:0030968)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)			breast(1)	1						GTTGTTGAAAATTTCAAAGAT	0.458																																																	0								ENSG00000204403																																			CASP12	SO:0001583	missense	0			-	HGNC	AF464191		11q22.3	2011-02-14	2007-12-17	2006-02-17	ENSG00000204403	ENSG00000204403		"""Caspases"""	19004	protein-coding gene	gene with protein product		608633	"""caspase 12 pseudogene 1"", ""caspase 12"""	CASP12P1		12054529, 9038361, 16917906, 16532395	Standard	NM_001191016		Approved		uc031qdo.1	Q6UXS9	OTTHUMG00000154965	ENST00000422698.2:c.596T>C	11.37:g.104761968A>G	ENSP00000427128:p.Ile199Thr	Somatic	0	80	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	77	14.44	D6RBN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.I199T	ENST00000422698.2	37	c.596	CCDS55785.1	11	.	.	.	.	.	.	.	.	.	.	A	9.388	1.074655	0.20227	.	.	ENSG00000204403	ENST00000422698;ENST00000375726;ENST00000446862;ENST00000441710;ENST00000508062	T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05	4.25	4.25	0.50352	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.314863	0.32671	N	0.005799	T	0.29093	0.0723	M	0.63428	1.95	0.26443	N	0.975746	B;P	0.42908	0.417;0.793	B;P	0.46885	0.261;0.53	T	0.09952	-1.0651	10	0.46703	T	0.11	.	11.6335	0.51189	1.0:0.0:0.0:0.0	.	199;199	Q6UXS9;D6RBN7	CASPC_HUMAN;.	T	199;199;199;199;115	ENSP00000427128:I199T;ENSP00000424038:I199T;ENSP00000425652:I199T;ENSP00000423970:I199T;ENSP00000426566:I115T	ENSP00000424038:I199T	I	-	2	0	CASP12	104267178	0.020000	0.18652	0.972000	0.41901	0.043000	0.13939	0.814000	0.27239	1.916000	0.55485	0.491000	0.48974	ATT	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_ICE_p20		0.458	CASP12-008	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CASP12	protein_coding	OTTHUMT00000337832.2	A	NM_001191016	-		104761968	-1	no_errors	ENST00000375726	ensembl	human	known	74_37	missense	SNP	0.759	G
EPM2A	7957	genome.wustl.edu	37	6	145956349	145956349	+	Intron	SNP	C	C	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr6:145956349C>G	ENST00000367519.3	-	3	1244				EPM2A_ENST00000496228.1_Intron	NM_005670.3	NP_005661.1	O95278	EPM2A_HUMAN	epilepsy, progressive myoclonus type 2A, Lafora disease (laforin)						autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|habituation (GO:0046959)|inositol phosphate dephosphorylation (GO:0046855)|nervous system development (GO:0007399)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polysome (GO:0005844)	carbohydrate phosphatase activity (GO:0019203)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|starch binding (GO:2001070)			kidney(1)|large_intestine(2)|lung(2)|pancreas(1)|skin(1)	7		Ovarian(120;0.162)		OV - Ovarian serous cystadenocarcinoma(155;3.38e-07)|GBM - Glioblastoma multiforme(68;0.0203)		CTCTGAAATACAGCAAGGAGG	0.353																																																	0								ENSG00000112425						74.0	72.0	73.0					6																	145956349		2203	4300	6503	EPM2A	SO:0001627	intron_variant	0			-	HGNC	AF284580	CCDS5206.1	6q24	2011-06-09			ENSG00000112425	ENSG00000112425		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	3413	protein-coding gene	gene with protein product		607566	"""epilepsy, progressive myoclonus type 2, Lafora disease (laforin)"""			9222970, 7485240	Standard	XM_006715564		Approved	LDE, LD	uc003qkw.3	B3EWF7	OTTHUMG00000015747	ENST00000367519.3:c.718+31G>C	6.37:g.145956349C>G		Somatic	0	39	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	11	50.00	B3KMU5|B4DRZ2|O95483|Q5T3F5|Q6IS15|Q8IU96|Q8IX24|Q8IX25|Q9BS66|Q9UEN2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367519.3	37	NULL	CCDS5206.1	6																																																																																			-	-		0.353	EPM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPM2A	protein_coding	OTTHUMT00000042564.1	C		-		145956349	-1	no_errors	ENST00000489412	ensembl	human	known	74_37	rna	SNP	0.000	G
MRGPRX3	117195	genome.wustl.edu	37	11	18159469	18159469	+	Silent	SNP	C	C	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr11:18159469C>G	ENST00000396275.2	+	3	1081	c.720C>G	c.(718-720)tcC>tcG	p.S240S		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CCCTGTTTTCCAGGATCCACC	0.512																																																	0								ENSG00000179826						101.0	97.0	98.0					11																	18159469		2200	4293	6493	MRGPRX3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.720C>G	11.37:g.18159469C>G		Somatic	0	57	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	33	42.11	B0M0L1|Q8TDE0|Q8TDE1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.S240	ENST00000396275.2	37	c.720	CCDS7830.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.512	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX3	protein_coding	OTTHUMT00000389767.1	C	NM_054031	-		18159469	+1	no_errors	ENST00000396275	ensembl	human	known	74_37	silent	SNP	0.170	G
NFASC	23114	genome.wustl.edu	37	1	204987181	204987181	+	3'UTR	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr1:204987181G>A	ENST00000401399.1	+	0	5436				NFASC_ENST00000339876.6_3'UTR|NFASC_ENST00000367172.4_3'UTR|NFASC_ENST00000495396.1_3'UTR|NFASC_ENST00000367171.4_3'UTR|NFASC_ENST00000360049.4_3'UTR|NFASC_ENST00000539706.1_3'UTR|NFASC_ENST00000338586.6_3'UTR|NFASC_ENST00000404076.1_3'UTR|NFASC_ENST00000404907.1_3'UTR|NFASC_ENST00000367169.4_3'UTR|NFASC_ENST00000367170.4_3'UTR|NFASC_ENST00000338515.6_3'UTR			O94856	NFASC_HUMAN	neurofascin						axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GGAGACACTCGCAGACCTGCA	0.542																																																	0								ENSG00000163531																																			NFASC	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.*1514G>A	1.37:g.204987181G>A		Somatic	0	27	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401399.1	37	NULL	CCDS53460.1	1																																																																																			-	-		0.542	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	protein_coding	OTTHUMT00000131237.1	G	NM_001005388	-		204987181	+1	no_errors	ENST00000495396	ensembl	human	known	74_37	rna	SNP	0.000	A
TIPIN	54962	genome.wustl.edu	37	15	66671790	66671790	+	5'UTR	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr15:66671790G>A	ENST00000561773.1	-	0	546							Q9BVW5	TIPIN_HUMAN	TIMELESS interacting protein						cell cycle phase transition (GO:0044770)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|mitotic nuclear division (GO:0007067)|positive regulation of cell proliferation (GO:0008284)|regulation of nuclear cell cycle DNA replication (GO:0033262)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	7						CGCTGAATTTGAAACAAGCTC	0.398																																																	0								ENSG00000075131																																			TIPIN	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BK001386	CCDS10215.1	15q22.31	2012-03-02	2006-08-08		ENSG00000075131	ENSG00000075131			30750	protein-coding gene	gene with protein product	"""CSM3 homolog (S. cerevisiae)"""	610716				12875843, 17102137	Standard	NM_017858		Approved	FLJ20516	uc002apr.2	Q9BVW5	OTTHUMG00000133188	ENST00000561773.1:c.-183C>T	15.37:g.66671790G>A		Somatic	0	127	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	124	11.35	B2CW64|Q9NWZ6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000561773.1	37	NULL		15																																																																																			-	-		0.398	TIPIN-006	KNOWN	mRNA_end_NF|basic	processed_transcript	TIPIN	protein_coding	OTTHUMT00000420721.1	G	NM_017858	-		66671790	-1	no_errors	ENST00000561773	ensembl	human	known	74_37	rna	SNP	1.000	A
IRS1	3667	genome.wustl.edu	37	2	227662528	227662528	+	Silent	SNP	G	G	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr2:227662528G>T	ENST00000305123.5	-	1	1947	c.927C>A	c.(925-927)acC>acA	p.T309T	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	309	Ser-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGGAGGTGGCGGTGATGCTCT	0.701											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000169047						45.0	54.0	51.0					2																	227662528		2196	4291	6487	IRS1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.927C>A	2.37:g.227662528G>T		Somatic	0	69	0.00	2321	0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	82	15.46		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.T309	ENST00000305123.5	37	c.927	CCDS2463.1	2																																																																																			-	NULL		0.701	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	protein_coding	OTTHUMT00000256886.3	G	NM_005544	-		227662528	-1	no_errors	ENST00000305123	ensembl	human	known	74_37	silent	SNP	0.000	T
LRTM2	654429	genome.wustl.edu	37	12	1944811	1944811	+	3'UTR	SNP	G	G	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr12:1944811G>T	ENST00000543818.1	+	0	2879				CACNA2D4_ENST00000585732.1_Intron|LRTM2_ENST00000543730.1_3'UTR|CACNA2D4_ENST00000585708.1_Intron|CACNA2D4_ENST00000588077.1_Intron|LRTM2_ENST00000299194.1_3'UTR|LRTM2_ENST00000535041.1_3'UTR|CACNA2D4_ENST00000382722.5_Intron|CACNA2D4_ENST00000586184.1_Intron|CACNA2D4_ENST00000587995.1_Intron	NM_001039029.2|NM_001163925.1|NM_001163926.1	NP_001034118.1|NP_001157397.1|NP_001157398.1	Q8N967	LRTM2_HUMAN	leucine-rich repeats and transmembrane domains 2							integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	20	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000834)			CCCTGGAGGAGCCCTCCTGTC	0.577																																																	0								ENSG00000166159																																			LRTM2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK095610	CCDS31726.1	12p13.33	2008-02-05				ENSG00000166159			32443	protein-coding gene	gene with protein product							Standard	NM_001039029		Approved		uc010sdx.1	Q8N967		ENST00000543818.1:c.*924G>T	12.37:g.1944811G>T		Somatic	0	86	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	40	16.67	A7E2U6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000543818.1	37	NULL	CCDS31726.1	12																																																																																			-	-		0.577	LRTM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM2	protein_coding	OTTHUMT00000398055.1	G		-		1944811	+1	no_errors	ENST00000543730	ensembl	human	putative	74_37	rna	SNP	0.000	T
CCDC144NL	339184	genome.wustl.edu	37	17	20796708	20796708	+	Missense_Mutation	SNP	G	G	A	rs143403787		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:20796708G>A	ENST00000327925.5	-	2	531	c.412C>T	c.(412-414)Cca>Tca	p.P138S	RP11-344E13.3_ENST00000582324.1_RNA|RNU6-1178P_ENST00000516674.1_RNA|RP11-344E13.3_ENST00000439794.2_RNA|RP11-344E13.3_ENST00000577537.1_RNA|RP11-344E13.3_ENST00000417232.2_RNA|RP11-344E13.3_ENST00000583962.1_RNA|RP11-344E13.3_ENST00000577860.1_RNA	NM_001004306.1	NP_001004306.1	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family, N-terminal like	138										large_intestine(3)|lung(3)|skin(1)	7						GTCTTACCTGGATTGTTATTT	0.313																																																	0								ENSG00000205212						36.0	37.0	37.0					17																	20796708		2192	4272	6464	CCDC144NL	SO:0001583	missense	0			-	HGNC		CCDS32591.1	17p11.2	2009-01-15			ENSG00000205212	ENSG00000205212			33735	protein-coding gene	gene with protein product							Standard	NM_001004306		Approved	MGC87631	uc002gyf.3	Q6NUI1	OTTHUMG00000132271	ENST00000327925.5:c.412C>T	17.37:g.20796708G>A	ENSP00000328054:p.Pro138Ser	Somatic	0	89	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	126	23.64		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P138S	ENST00000327925.5	37	c.412	CCDS32591.1	17	.	.	.	.	.	.	.	.	.	.	g	11.56	1.675626	0.29783	.	.	ENSG00000205212	ENST00000327925	T	0.39056	1.1	0.9	-0.356	0.12583	.	.	.	.	.	T	0.38026	0.1025	N	0.14661	0.345	0.09310	N	1	D	0.60575	0.988	D	0.65140	0.932	T	0.20907	-1.0261	9	0.59425	D	0.04	.	4.5829	0.12267	0.0:0.4145:0.5855:0.0	.	138	Q6NUI1	C144L_HUMAN	S	138	ENSP00000328054:P138S	ENSP00000328054:P138S	P	-	1	0	CCDC144NL	20737300	0.669000	0.27502	0.200000	0.23457	0.259000	0.26198	0.731000	0.26058	-0.078000	0.12730	0.281000	0.19383	CCA	-	NULL		0.313	CCDC144NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC144NL	protein_coding	OTTHUMT00000255361.2	G	NM_001004306	-		20796708	-1	no_errors	ENST00000327925	ensembl	human	known	74_37	missense	SNP	0.299	A
CNTNAP3	79937	genome.wustl.edu	37	9	39171379	39171379	+	Silent	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr9:39171379C>T	ENST00000297668.6	-	8	1393	c.1320G>A	c.(1318-1320)agG>agA	p.R440R	CNTNAP3_ENST00000377653.2_5'Flank|CNTNAP3_ENST00000377656.2_Silent_p.R440R|CNTNAP3_ENST00000323947.7_Silent_p.R440R|CNTNAP3_ENST00000358144.2_Silent_p.R352R|CNTNAP3_ENST00000377659.1_Silent_p.R440R	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	440	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CTGTGACATTCCTTGGTGACT	0.473																																																	0								ENSG00000106714						139.0	131.0	134.0					9																	39171379		2203	4300	6503	CNTNAP3	SO:0001819	synonymous_variant	0			-	HGNC	AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.1320G>A	9.37:g.39171379C>T		Somatic	0	178	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	128	15.79	B1AMA0|Q9C0E9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R440	ENST00000297668.6	37	c.1320	CCDS6616.1	9																																																																																			-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.473	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3	protein_coding	OTTHUMT00000052511.1	C	NM_033655	-		39171379	-1	no_errors	ENST00000297668	ensembl	human	known	74_37	silent	SNP	0.001	T
CR1	1378	genome.wustl.edu	37	1	207760910	207760910	+	Splice_Site	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr1:207760910C>T	ENST00000367049.4	+	34	5710	c.5710C>T	c.(5710-5712)Cga>Tga	p.R1904*	CR1_ENST00000367051.1_Splice_Site_p.R1454*|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000400960.2_Splice_Site_p.R1454*|CR1_ENST00000367052.1_Splice_Site_p.R1454*|CR1_ENST00000367053.1_Splice_Site_p.R1454*|RP11-78B10.2_ENST00000597497.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1454	Sushi 29. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						CAACTGTAGACGTGAGTAACC	0.478																																																	0								ENSG00000203710						100.0	94.0	96.0					1																	207760910		1880	4098	5978	CR1	SO:0001630	splice_region_variant	0			-	HGNC	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5710+1C>T	1.37:g.207760910C>T		Somatic	0	78	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	39	27.78	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R1904*	ENST00000367049.4	37	c.5710	CCDS44308.1	1	.	.	.	.	.	.	.	.	.	.	C	41	9.019639	0.99038	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	.	.	.	3.29	0.157	0.14915	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	2.936	0.05815	0.2384:0.5137:0.0:0.2479	.	.	.	.	X	1454;1454;1454;1454;1004;1904	.	ENSP00000356016:R1904X	R	+	1	2	CR1	205827533	0.775000	0.28604	0.501000	0.27601	0.516000	0.34256	-0.008000	0.12788	0.026000	0.15269	0.655000	0.94253	CGA	-	pfscan_Sushi_SCR_CCP		0.478	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	protein_coding	OTTHUMT00000382527.1	C	NM_000573	-	Nonsense_Mutation	207760910	+1	no_errors	ENST00000367049	ensembl	human	known	74_37	nonsense	SNP	0.669	T
RP11-640N20.6	0	genome.wustl.edu	37	17	30422196	30422196	+	RNA	SNP	A	A	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:30422196A>G	ENST00000358484.4	+	0	260				RP11-640N20.8_ENST00000581225.1_RNA																							TCTTGGACAGACGATGCCAGT	0.383																																																	0								ENSG00000264164																																			RP11-640N20.6			0			-	Clone_based_vega_gene																													17.37:g.30422196A>G		Somatic	0	51	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	39	51.25		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000358484.4	37	NULL		17																																																																																			-	-		0.383	RP11-640N20.6-002	KNOWN	basic	processed_transcript	ENSG00000264164	pseudogene	OTTHUMT00000447090.1	A		-		30422196	+1	no_errors	ENST00000358484	ensembl	human	known	74_37	rna	SNP	0.048	G
IL32	9235	genome.wustl.edu	37	16	3119356	3119356	+	Nonstop_Mutation	SNP	A	A	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr16:3119356A>G	ENST00000534507.1	+	6	916	c.705A>G	c.(703-705)tgA>tgG	p.*235W	IL32_ENST00000548476.1_Nonstop_Mutation_p.*235W|IL32_ENST00000530890.1_Nonstop_Mutation_p.*169W|IL32_ENST00000548246.1_Nonstop_Mutation_p.*149W|IL32_ENST00000444393.3_Nonstop_Mutation_p.*189W|RNU1-125P_ENST00000516752.1_RNA|IL32_ENST00000528163.2_Nonstop_Mutation_p.*189W|IL32_ENST00000525643.2_Nonstop_Mutation_p.*189W|IL32_ENST00000529699.1_Nonstop_Mutation_p.*169W|IL32_ENST00000008180.9_Nonstop_Mutation_p.*169W|IL32_ENST00000548652.1_Nonstop_Mutation_p.*180W|IL32_ENST00000551122.1_Nonstop_Mutation_p.*132W|IL32_ENST00000552664.1_Nonstop_Mutation_p.*189W|IL32_ENST00000396887.3_Nonstop_Mutation_p.*132W|IL32_ENST00000549213.1_Nonstop_Mutation_p.*132W|IL32_ENST00000552936.1_Nonstop_Mutation_p.*213W|IL32_ENST00000526464.2_Nonstop_Mutation_p.*189W|IL32_ENST00000529550.1_Nonstop_Mutation_p.*189W|IL32_ENST00000551513.1_Nonstop_Mutation_p.*226W|IL32_ENST00000396890.2_Nonstop_Mutation_p.*235W|IL32_ENST00000531965.1_Nonstop_Mutation_p.*179W|IL32_ENST00000382213.3_Nonstop_Mutation_p.*180W|IL32_ENST00000552356.1_Nonstop_Mutation_p.*169W|IL32_ENST00000440815.3_Nonstop_Mutation_p.*189W|IL32_ENST00000533097.2_Nonstop_Mutation_p.*189W|IL32_ENST00000325568.5_Nonstop_Mutation_p.*189W|IL32_ENST00000530538.2_Nonstop_Mutation_p.*189W			P24001	IL32_HUMAN	interleukin 32	0					cell adhesion (GO:0007155)|defense response (GO:0006952)|immune response (GO:0006955)	extracellular space (GO:0005615)|membrane (GO:0016020)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	15						CCTCAAAATGAAGATACTGAC	0.622																																																	0								ENSG00000008517						73.0	89.0	83.0					16																	3119356		2197	4300	6497	IL32	SO:0001578	stop_lost	0			-	HGNC	M59807	CCDS32377.1, CCDS32378.1, CCDS32379.1, CCDS45394.1	16p13.3	2011-07-21			ENSG00000008517	ENSG00000008517		"""Interleukins and interleukin receptors"""	16830	protein-coding gene	gene with protein product	"""natural killer cell transcript 4"""	606001				1729377, 9653642	Standard	XM_005255686		Approved	NK4, TAIF, TAIFb, TAIFd	uc002ctn.3	P24001	OTTHUMG00000167498	ENST00000534507.1:c.705A>G	16.37:g.3119356A>G	ENSP00000431775:p.*235Trpext*3	Somatic	0	48	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	A6NNM0|A8MPX0|B4DJM1|B8Q191|D3DUB0|D3DUB2|Q5VFH7|Q5VFH8|Q8WV38|Q96GK9	Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.*235W	ENST00000534507.1	37	c.705		16	.	.	.	.	.	.	.	.	.	.	A	4.382	0.070455	0.08436	.	.	ENSG00000008517	ENST00000325568;ENST00000534507;ENST00000531965;ENST00000396887;ENST00000529699;ENST00000526464;ENST00000440815;ENST00000529550;ENST00000551122;ENST00000525643;ENST00000528163;ENST00000530890;ENST00000444393;ENST00000533097;ENST00000008180;ENST00000396890;ENST00000548652;ENST00000530538;ENST00000549213;ENST00000552936;ENST00000548476;ENST00000552664;ENST00000552356;ENST00000551513;ENST00000382213;ENST00000548246	.	.	.	1.0	-0.305	0.12784	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.7451	0.08545	0.5946:0.4054:0.0:0.0	.	.	.	.	W	189;235;179;132;169;189;189;189;132;189;189;169;189;189;169;235;180;189;132;213;235;189;169;226;180;149	.	.	X	+	3	0	IL32	3059357	0.002000	0.14202	0.001000	0.08648	0.002000	0.02628	0.142000	0.16096	-0.080000	0.12685	0.444000	0.29173	TGA	-	NULL		0.622	IL32-002	KNOWN	basic	protein_coding	IL32	protein_coding	OTTHUMT00000394812.2	A	NM_004221	-		3119356	+1	no_errors	ENST00000396890	ensembl	human	known	74_37	nonstop	SNP	0.001	G
GALNT12	79695	genome.wustl.edu	37	9	101589137	101589137	+	Silent	SNP	G	G	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr9:101589137G>C	ENST00000375011.3	+	3	645	c.645G>C	c.(643-645)ggG>ggC	p.G215G		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	215	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				GGCTGCTGGGGGCGTCTGCGG	0.662																																																	0								ENSG00000119514						29.0	28.0	29.0					9																	101589137		2202	4299	6501	GALNT12	SO:0001819	synonymous_variant	0			-	HGNC	AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.645G>C	9.37:g.101589137G>C		Somatic	0	55	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	31	35.42	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.G215	ENST00000375011.3	37	c.645	CCDS6737.1	9																																																																																			-	pfam_Glyco_trans_2		0.662	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT12	protein_coding	OTTHUMT00000053382.1	G	NM_024642	-		101589137	+1	no_errors	ENST00000375011	ensembl	human	known	74_37	silent	SNP	0.934	C
SLC2A4	6517	genome.wustl.edu	37	17	7189830	7189830	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:7189830C>T	ENST00000317370.8	+	11	1680	c.1412C>T	c.(1411-1413)aCt>aTt	p.T471I	RP1-4G17.2_ENST00000576271.1_RNA	NM_001042.2	NP_001033.1	P14672	GTR4_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 4	471					amylopectin biosynthetic process (GO:0010021)|brown fat cell differentiation (GO:0050873)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|cellular response to osmotic stress (GO:0071470)|glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|membrane organization (GO:0061024)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|endomembrane system (GO:0012505)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|trans-Golgi network transport vesicle (GO:0030140)|vesicle membrane (GO:0012506)	D-glucose transmembrane transporter activity (GO:0055056)|glucose transmembrane transporter activity (GO:0005355)			breast(1)|endometrium(3)|large_intestine(7)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	17						GTACCTGAAACTCGAGGCCGG	0.537																																																	0								ENSG00000181856						285.0	285.0	285.0					17																	7189830		2203	4300	6503	SLC2A4	SO:0001583	missense	0			-	HGNC	M20747	CCDS11097.1	17p13	2013-05-22			ENSG00000181856	ENSG00000181856		"""Solute carriers"""	11009	protein-coding gene	gene with protein product		138190		GLUT4			Standard	NM_001042		Approved		uc002gfp.3	P14672	OTTHUMG00000102181	ENST00000317370.8:c.1412C>T	17.37:g.7189830C>T	ENSP00000320935:p.Thr471Ile	Somatic	0	70	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	121	12.32	Q05BQ3|Q14CX2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glc_transpt_4,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.T471I	ENST00000317370.8	37	c.1412	CCDS11097.1	17	.	.	.	.	.	.	.	.	.	.	C	27.2	4.805367	0.90623	.	.	ENSG00000181856	ENST00000317370	T	0.80994	-1.44	5.11	5.11	0.69529	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.93628	0.7965	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95437	0.8522	10	0.87932	D	0	.	16.4157	0.83732	0.0:1.0:0.0:0.0	.	471	P14672	GTR4_HUMAN	I	471	ENSP00000320935:T471I	ENSP00000320935:T471I	T	+	2	0	SLC2A4	7130554	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.228000	0.78079	2.826000	0.97356	0.655000	0.94253	ACT	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt		0.537	SLC2A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A4	protein_coding	OTTHUMT00000220031.3	C		-		7189830	+1	no_errors	ENST00000317370	ensembl	human	known	74_37	missense	SNP	1.000	T
CNTNAP2	26047	genome.wustl.edu	37	7	148113753	148113753	+	3'UTR	SNP	T	T	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr7:148113753T>C	ENST00000361727.3	+	0	5557				CNTNAP2_ENST00000463592.2_3'UTR	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2						adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CAGTGTCCTGTAAATGGACAC	0.348										HNSCC(39;0.1)																																							0								ENSG00000174469																																			CNTNAP2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.*1045T>C	7.37:g.148113753T>C		Somatic	0	43	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	41	18.00	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361727.3	37	NULL	CCDS5889.1	7																																																																																			-	-		0.348	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	protein_coding	OTTHUMT00000327668.1	T		-		148113753	+1	no_errors	ENST00000463592	ensembl	human	known	74_37	rna	SNP	0.034	C
MVB12B	89853	genome.wustl.edu	37	9	129268634	129268635	+	3'UTR	INS	-	-	GA	rs397720909|rs34122227|rs3841408	byFrequency	TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr9:129268634_129268635insGA	ENST00000361171.3	+	0	4133_4134				MVB12B_ENST00000485886.1_3'UTR	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B						protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										ttgaagaggctgaCTTGGCCCA	0.55														2555	0.510184	0.7095	0.4294	5008	,	,		19805	0.3472		0.4761	False		,,,				2504	0.501																0								ENSG00000196814																																			MVB12B	SO:0001624	3_prime_UTR_variant	0				HGNC	AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.*3093->GA	9.37:g.129268635_129268636dupGA		Somatic	0	57	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q8N6S7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361171.3	37	NULL	CCDS35142.1	9																																																																																			-	-		0.550	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVB12B	protein_coding	OTTHUMT00000054110.1	-	XM_088525			129268635	+1	no_errors	ENST00000485886	ensembl	human	known	74_37	rna	INS	0.000:0.000	GA
PORCN	64840	genome.wustl.edu	37	X	48374461	48374461	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chrX:48374461G>A	ENST00000326194.6	+	12	1143	c.1100G>A	c.(1099-1101)cGc>cAc	p.R367H	PORCN_ENST00000367574.4_Missense_Mutation_p.R285H|PORCN_ENST00000359882.4_Missense_Mutation_p.R361H|PORCN_ENST00000355961.4_Missense_Mutation_p.R362H|PORCN_ENST00000355092.3_Missense_Mutation_p.R361H|PORCN_ENST00000537758.1_Missense_Mutation_p.R367H|PORCN_ENST00000361988.3_Missense_Mutation_p.R356H	NM_203475.1	NP_982301.1	Q9H237	PORCN_HUMAN	porcupine homolog (Drosophila)	367					glycoprotein metabolic process (GO:0009100)|Wnt signaling pathway (GO:0016055)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|integral component of endoplasmic reticulum membrane (GO:0030176)	transferase activity, transferring acyl groups (GO:0016746)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CTCCGGAAGCGCCTGGCTCGG	0.627																																																	0								ENSG00000102312						64.0	57.0	59.0					X																	48374461		2203	4300	6503	PORCN	SO:0001583	missense	0			-	HGNC	AF317058	CCDS14296.1, CCDS14297.1, CCDS14298.1, CCDS14299.1	Xp11.23	2014-02-05			ENSG00000102312	ENSG00000102312			17652	protein-coding gene	gene with protein product		300651	"""dermal hypoplasia, focal"""	DHOF		10866835, 12034504, 17546030	Standard	NM_203474		Approved	MG61, PORC, PPN, por	uc004djv.1	Q9H237	OTTHUMG00000024116	ENST00000326194.6:c.1100G>A	X.37:g.48374461G>A	ENSP00000322304:p.Arg367His	Somatic	0	51	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	98	20	80.99	B2RBN8|B7ZAR3|Q14829|Q9H234|Q9H235|Q9H236|Q9UJU7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MBOAT_fam	p.R367H	ENST00000326194.6	37	c.1100	CCDS14299.1	X	.	.	.	.	.	.	.	.	.	.	G	22.2	4.251635	0.80135	.	.	ENSG00000102312	ENST00000359882;ENST00000537758;ENST00000367574;ENST00000355961;ENST00000361988;ENST00000326194;ENST00000355092	T;T;T;T;T;T;T	0.75260	-0.92;-0.92;-0.92;-0.92;-0.92;-0.92;-0.92	5.53	4.67	0.58626	.	0.045012	0.85682	D	0.000000	T	0.79441	0.4446	L	0.48642	1.525	0.54753	D	0.99998	D;D;P;D;D	0.89917	1.0;0.998;0.636;1.0;1.0	D;D;B;D;D	0.68765	0.96;0.954;0.206;0.96;0.96	T	0.76088	-0.3087	10	0.29301	T	0.29	-4.5693	11.4586	0.50197	0.09:0.0:0.91:0.0	.	361;367;285;356;362	Q9H237-3;Q9H237;B7ZAR3;Q9H237-4;Q9H237-2	.;PORCN_HUMAN;.;.;.	H	361;367;285;362;356;367;361	ENSP00000352946:R361H;ENSP00000446401:R367H;ENSP00000356546:R285H;ENSP00000348233:R362H;ENSP00000354978:R356H;ENSP00000322304:R367H;ENSP00000347207:R361H	ENSP00000322304:R367H	R	+	2	0	PORCN	48259405	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.096000	0.76960	1.100000	0.41517	0.529000	0.55759	CGC	-	pfam_MBOAT_fam		0.627	PORCN-011	KNOWN	basic|CCDS	protein_coding	PORCN	protein_coding	OTTHUMT00000356990.1	G	NM_022825	-		48374461	+1	no_errors	ENST00000326194	ensembl	human	known	74_37	missense	SNP	1.000	A
SRPK2	6733	genome.wustl.edu	37	7	104946954	104946954	+	Intron	SNP	T	T	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr7:104946954T>C	ENST00000393651.3	-	2	159				RP4-778K6.3_ENST00000476569.1_RNA	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						AACACTTCCTTTGAAATCTCA	0.378																																																	0								ENSG00000135250																																			SRPK2	SO:0001627	intron_variant	0			-	HGNC	U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.71+82140A>G	7.37:g.104946954T>C		Somatic	0	45	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	21	43.24		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K46E	ENST00000393651.3	37	c.136	CCDS34724.1	7																																																																																			-	NULL		0.378	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	protein_coding	OTTHUMT00000348723.1	T	NM_182691	-		104946954	-1	no_errors	ENST00000465112	ensembl	human	known	74_37	missense	SNP	0.072	C
EPHA6	285220	genome.wustl.edu	37	3	97198209	97198209	+	Splice_Site	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr3:97198209G>A	ENST00000514100.1	+	6	492		c.e6+1		EPHA6_ENST00000442602.2_Splice_Site|EPHA6_ENST00000389672.5_Splice_Site|EPHA6_ENST00000502694.1_Splice_Site	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6							integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AATGGGCATTGTAAGTAGCGC	0.328																																																	0								ENSG00000080224						161.0	178.0	173.0					3																	97198209		1846	4097	5943	EPHA6	SO:0001630	splice_region_variant	0			-	HGNC	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.250+1G>A	3.37:g.97198209G>A		Somatic	0	54	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	7	53.33	D6RAL5	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e9+1	ENST00000514100.1	37	c.2074+1		3	.	.	.	.	.	.	.	.	.	.	G	19.76	3.887282	0.72410	.	.	ENSG00000080224	ENST00000389672;ENST00000514100;ENST00000502694;ENST00000442602	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2936	0.98544	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EPHA6	98680899	1.000000	0.71417	0.984000	0.44739	0.754000	0.42855	8.923000	0.92808	2.801000	0.96364	0.655000	0.94253	.	-	-		0.328	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	protein_coding	OTTHUMT00000359997.1	G	NM_001080448	-	Intron	97198209	+1	no_errors	ENST00000389672	ensembl	human	known	74_37	splice_site	SNP	1.000	A
ADD1	118	genome.wustl.edu	37	4	2929906	2929906	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr4:2929906C>T	ENST00000398129.1	+	14	1890	c.1870C>T	c.(1870-1872)Ccg>Tcg	p.P624S	ADD1_ENST00000398123.2_3'UTR|ADD1_ENST00000398125.1_3'UTR|ADD1_ENST00000503455.2_3'UTR|ADD1_ENST00000264758.7_Missense_Mutation_p.P655S|ADD1_ENST00000513328.2_3'UTR|ADD1_ENST00000355842.3_3'UTR|ADD1_ENST00000446856.1_Missense_Mutation_p.P624S			P35611	ADDA_HUMAN	adducin 1 (alpha)	624					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AGACCTTGTGCCGGAGCCGAC	0.557																																					Esophageal Squamous(71;505 1201 20414 34538 37449)												0								ENSG00000087274						212.0	239.0	230.0					4																	2929906		2203	4300	6503	ADD1	SO:0001583	missense	0			-	HGNC	L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.1870C>T	4.37:g.2929906C>T	ENSP00000381197:p.Pro624Ser	Somatic	0	48	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.P655S	ENST00000398129.1	37	c.1963	CCDS43205.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.575|3.575	-0.086872|-0.086872	0.07097|0.07097	.|.	.|.	ENSG00000087274|ENSG00000087274	ENST00000541843|ENST00000264758;ENST00000446856;ENST00000398129	.|T;T;T	.|0.05081	.|3.5;3.56;3.56	4.7|4.7	4.7|4.7	0.59300|0.59300	.|.	.|0.644790	.|0.15841	.|N	.|0.242059	T|T	0.04815|0.04815	0.0130|0.0130	N|N	0.22421|0.22421	0.69|0.69	0.33060|0.33060	D|D	0.53399|0.53399	.|B;P	.|0.34724	.|0.002;0.465	.|B;B	.|0.28011	.|0.007;0.085	T|T	0.19679|0.19679	-1.0298|-1.0298	5|10	.|0.09338	.|T	.|0.73	-3.1438|-3.1438	17.0122|17.0122	0.86409|0.86409	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|624;655	.|P35611;P35611-3	.|ADDA_HUMAN;.	V|S	80|655;624;624	.|ENSP00000264758:P655S;ENSP00000399828:P624S;ENSP00000381197:P624S	.|ENSP00000264758:P655S	A|P	+|+	2|1	0|0	ADD1|ADD1	2899704|2899704	1.000000|1.000000	0.71417|0.71417	0.207000|0.207000	0.23584|0.23584	0.066000|0.066000	0.16364|0.16364	4.006000|4.006000	0.57083|0.57083	2.315000|2.315000	0.78130|0.78130	0.655000|0.655000	0.94253|0.94253	GCC|CCG	-	NULL		0.557	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADD1	protein_coding	OTTHUMT00000242840.1	C	NM_014189	-		2929906	+1	no_errors	ENST00000264758	ensembl	human	known	74_37	missense	SNP	0.981	T
PCDHA3	56145	genome.wustl.edu	37	5	140180904	140180904	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr5:140180904A>T	ENST00000522353.2	+	1	122	c.122A>T	c.(121-123)cAt>cTt	p.H41L	PCDHA2_ENST00000520672.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000532566.2_Missense_Mutation_p.H41L	NM_018906.2	NP_061729.1	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3	41	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(16)|kidney(3)|large_intestine(19)|lung(36)|ovary(7)|prostate(8)|skin(3)|stomach(1)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGCCAAGCATGGCACCTTC	0.672																																																	0								ENSG00000255408						58.0	66.0	63.0					5																	140180904		2203	4300	6503	PCDHA3	SO:0001583	missense	0			-	HGNC	AF152481	CCDS54915.1	5q31	2010-11-26				ENSG00000255408		"""Cadherins / Protocadherins : Clustered"""	8669	other	complex locus constituent	"""KIAA0345-like 11"""	606309				10380929	Standard	NM_018906		Approved	PCDH-ALPHA3		Q9Y5H8		ENST00000522353.2:c.122A>T	5.37:g.140180904A>T	ENSP00000429808:p.His41Leu	Somatic	0	105	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	83	33.33	O75286	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.H41L	ENST00000522353.2	37	c.122	CCDS54915.1	5	.	.	.	.	.	.	.	.	.	.	a	15.40	2.823204	0.50739	.	.	ENSG00000255408	ENST00000522353;ENST00000532566	T;T	0.27104	1.69;1.69	4.48	4.48	0.54585	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.000000	0.41194	U	0.000930	T	0.37348	0.1000	M	0.72576	2.205	0.28086	N	0.93199	P;D	0.57257	0.943;0.979	B;P	0.50590	0.349;0.645	T	0.36841	-0.9731	10	0.72032	D	0.01	.	11.1226	0.48300	0.8338:0.1662:0.0:0.0	.	41;41	Q9Y5H8-2;Q9Y5H8	.;PCDA3_HUMAN	L	41	ENSP00000429808:H41L;ENSP00000434086:H41L	ENSP00000429808:H41L	H	+	2	0	PCDHA3	140161088	0.000000	0.05858	1.000000	0.80357	0.760000	0.43138	-0.241000	0.08940	1.807000	0.52817	0.477000	0.44152	CAT	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin		0.672	PCDHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA3	protein_coding	OTTHUMT00000372848.2	A	NM_018906	-		140180904	+1	no_errors	ENST00000522353	ensembl	human	known	74_37	missense	SNP	1.000	T
ABCA6	23460	genome.wustl.edu	37	17	67109805	67109805	+	Missense_Mutation	SNP	T	T	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:67109805T>G	ENST00000284425.2	-	14	2030	c.1856A>C	c.(1855-1857)cAg>cCg	p.Q619P		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	619	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					CTTTCTTTTCTGTCCTTCACT	0.358																																																	0								ENSG00000154262						160.0	144.0	150.0					17																	67109805		2203	4300	6503	ABCA6	SO:0001583	missense	0			-	HGNC	U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.1856A>C	17.37:g.67109805T>G	ENSP00000284425:p.Gln619Pro	Somatic	0	70	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	49	32.88	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Q619P	ENST00000284425.2	37	c.1856	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	T	19.89	3.911245	0.72983	.	.	ENSG00000154262	ENST00000284425	D	0.95205	-3.64	4.96	4.96	0.65561	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.49305	D	0.000148	D	0.97920	0.9316	H	0.95504	3.68	0.80722	D	1	D	0.71674	0.998	D	0.70016	0.967	D	0.99029	1.0820	10	0.87932	D	0	.	14.2404	0.65954	0.0:0.0:0.0:1.0	.	619	Q8N139	ABCA6_HUMAN	P	619	ENSP00000284425:Q619P	ENSP00000284425:Q619P	Q	-	2	0	ABCA6	64621400	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.625000	0.74248	2.209000	0.71365	0.477000	0.44152	CAG	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.358	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	protein_coding	OTTHUMT00000450463.1	T	NM_080284	-		67109805	-1	no_errors	ENST00000284425	ensembl	human	known	74_37	missense	SNP	1.000	G
WIF1	11197	genome.wustl.edu	37	12	65456299	65456299	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr12:65456299A>G	ENST00000286574.4	-	7	1162	c.788T>C	c.(787-789)aTt>aCt	p.I263T		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	263	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		TGGAGGGCAAATACATTTTCC	0.458			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)			Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	0								ENSG00000156076						110.0	96.0	101.0					12																	65456299		2203	4300	6503	WIF1	SO:0001583	missense	0			-	HGNC	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.788T>C	12.37:g.65456299A>G	ENSP00000286574:p.Ile263Thr	Somatic	0	49	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	30	40.00	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WIF,pfam_EGF_extracell,smart_WIF,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_WIF,prints_Wnt-inh	p.I263T	ENST00000286574.4	37	c.788	CCDS8971.1	12	.	.	.	.	.	.	.	.	.	.	A	11.05	1.525450	0.27299	.	.	ENSG00000156076	ENST00000286574;ENST00000543094	T;T	0.44482	3.87;0.92	5.28	5.28	0.74379	Epidermal growth factor-like (1);EGF-like region, conserved site (1);Epidermal growth factor-like, type 3 (1);	0.117350	0.56097	D	0.000030	T	0.31451	0.0797	N	0.04768	-0.165	0.58432	D	0.999998	P	0.41008	0.735	P	0.47075	0.536	T	0.16988	-1.0384	9	.	.	.	.	15.9322	0.79672	1.0:0.0:0.0:0.0	.	263	Q9Y5W5	WIF1_HUMAN	T	263;26	ENSP00000286574:I263T;ENSP00000439024:I26T	.	I	-	2	0	WIF1	63742566	1.000000	0.71417	0.999000	0.59377	0.871000	0.50021	5.931000	0.70113	2.307000	0.77673	0.528000	0.53228	ATT	-	smart_EG-like_dom		0.458	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIF1	protein_coding	OTTHUMT00000401258.2	A		-		65456299	-1	no_errors	ENST00000286574	ensembl	human	known	74_37	missense	SNP	1.000	G
CTNND1	1500	genome.wustl.edu	37	11	57575922	57575922	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr11:57575922C>T	ENST00000399050.4	+	14	2688	c.2152C>T	c.(2152-2154)Ctc>Ttc	p.L718F	CTNND1_ENST00000526772.1_Missense_Mutation_p.L389F|CTNND1_ENST00000530748.1_Missense_Mutation_p.L664F|CTNND1_ENST00000533667.1_Missense_Mutation_p.L389F|CTNND1_ENST00000415361.2_Missense_Mutation_p.L617F|CTNND1_ENST00000426142.2_Missense_Mutation_p.L611F|CTNND1_ENST00000526357.1_Missense_Mutation_p.L658F|CTNND1_ENST00000361332.4_Missense_Mutation_p.L712F|CTNND1_ENST00000529526.1_Missense_Mutation_p.L658F|CTNND1_ENST00000529919.1_Missense_Mutation_p.L718F|CTNND1_ENST00000529986.1_Missense_Mutation_p.L611F|CTNND1_ENST00000534579.1_Missense_Mutation_p.L658F|CTNND1_ENST00000528232.1_Missense_Mutation_p.L617F|CTNND1_ENST00000532844.1_Missense_Mutation_p.L664F|CTNND1_ENST00000532649.1_Missense_Mutation_p.L658F|CTNND1_ENST00000525902.1_Missense_Mutation_p.L395F|CTNND1_ENST00000361391.6_Missense_Mutation_p.L712F|CTNND1_ENST00000528621.1_Missense_Mutation_p.L658F|CTNND1_ENST00000524630.1_Missense_Mutation_p.L712F|CTNND1_ENST00000399039.4_Missense_Mutation_p.L718F|CTNND1_ENST00000527467.1_Missense_Mutation_p.L395F|CTNND1_ENST00000361796.4_Missense_Mutation_p.L712F|CTNND1_ENST00000360682.6_Missense_Mutation_p.L718F|CTNND1_ENST00000530094.1_Missense_Mutation_p.L611F|CTNND1_ENST00000358694.6_Missense_Mutation_p.L712F|CTNND1_ENST00000532245.1_Missense_Mutation_p.L611F|CTNND1_ENST00000529873.1_Missense_Mutation_p.L658F|CTNND1_ENST00000428599.2_Missense_Mutation_p.L712F|CTNND1_ENST00000531014.1_Missense_Mutation_p.L389F|CTNND1_ENST00000526938.1_Missense_Mutation_p.L718F|CTNND1_ENST00000532787.1_Missense_Mutation_p.L611F|CTNND1_ENST00000532463.1_Missense_Mutation_p.L611F	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	718					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				CATAGCTGACCTCCTGACTAA	0.458																																																	0								ENSG00000198561						104.0	107.0	106.0					11																	57575922		2050	4204	6254	CTNND1	SO:0001583	missense	0			-	HGNC	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.2152C>T	11.37:g.57575922C>T	ENSP00000382004:p.Leu718Phe	Somatic	0	72	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	61	18.67	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.L718F	ENST00000399050.4	37	c.2152	CCDS44604.1	11	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753581	0.89753	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000533667;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000527467;ENST00000528232;ENST00000531014;ENST00000526772;ENST00000529873;ENST00000525902;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.83673	-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75;-1.75	5.44	5.44	0.79542	Armadillo-like helical (1);Armadillo-type fold (1);	0.068746	0.64402	D	0.000014	D	0.89157	0.6635	L	0.49126	1.545	0.54753	D	0.999986	D;D;D;D;D;D;D;D;D	0.76494	0.998;0.998;0.998;0.998;0.998;0.998;0.999;0.998;0.998	P;P;D;P;P;P;D;P;D	0.74348	0.876;0.876;0.924;0.876;0.876;0.876;0.983;0.876;0.924	D	0.89897	0.4041	10	0.87932	D	0	-0.7327	18.8697	0.92308	0.0:1.0:0.0:0.0	.	718;712;718;611;658;658;712;718;718	O60716-3;O60716-2;O60716;O60716-18;O60716-14;O60716-10;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.;.;.;.	F	712;718;718;718;712;658;611;718;712;712;611;611;712;611;389;658;658;664;712;395;617;389;389;658;395;664;658;611;617;611;658;718	ENSP00000436543:L712F;ENSP00000434808:L718F;ENSP00000381996:L718F;ENSP00000353902:L718F;ENSP00000354907:L712F;ENSP00000436323:L658F;ENSP00000409930:L611F;ENSP00000382004:L718F;ENSP00000354785:L712F;ENSP00000354823:L712F;ENSP00000432075:L611F;ENSP00000437156:L611F;ENSP00000351527:L712F;ENSP00000434949:L611F;ENSP00000437051:L389F;ENSP00000435379:L658F;ENSP00000432243:L658F;ENSP00000436744:L664F;ENSP00000413586:L712F;ENSP00000434900:L395F;ENSP00000435266:L617F;ENSP00000432623:L389F;ENSP00000433158:L389F;ENSP00000435494:L658F;ENSP00000434672:L395F;ENSP00000433276:L664F;ENSP00000433334:L658F;ENSP00000437327:L611F;ENSP00000403518:L617F;ENSP00000434017:L611F;ENSP00000435789:L658F;ENSP00000432041:L718F	ENSP00000351527:L712F	L	+	1	0	CTNND1	57332498	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.765000	0.68834	2.570000	0.86706	0.467000	0.42956	CTC	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo		0.458	CTNND1-006	KNOWN	basic|CCDS	protein_coding	CTNND1	protein_coding	OTTHUMT00000393944.1	C	NM_001331	-		57575922	+1	no_errors	ENST00000399050	ensembl	human	known	74_37	missense	SNP	1.000	T
PPP1CA	5499	genome.wustl.edu	37	11	67168488	67168488	+	Intron	SNP	G	G	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr11:67168488G>C	ENST00000376745.4	-	2	336				TBC1D10C_ENST00000312390.5_5'Flank|PPP1CA_ENST00000532446.1_Intron|TBC1D10C_ENST00000526387.1_5'Flank|PPP1CA_ENST00000312989.7_Intron|PPP1CA_ENST00000358239.4_Intron	NM_001008709.1|NM_002708.3	NP_001008709.1|NP_002699.1	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha isozyme						branching morphogenesis of an epithelial tube (GO:0048754)|cell cycle (GO:0007049)|cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|lung development (GO:0030324)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)|ribonucleoprotein complex binding (GO:0043021)			breast(1)|lung(2)|pancreas(1)|urinary_tract(3)	7			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			GAACTCTGTGGGGTCCAGTGC	0.622																																																	0								ENSG00000172531						29.0	33.0	32.0					11																	67168488		2200	4295	6495	PPP1CA	SO:0001627	intron_variant	0			-	HGNC		CCDS8160.1, CCDS8161.1, CCDS31618.1	11q13	2013-01-18	2010-03-05			ENSG00000172531	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9281	protein-coding gene	gene with protein product		176875	"""protein phosphatase 1, catalytic subunit, alpha isoform"""	PPP1A			Standard	NM_002708		Approved	PP1A, PP-1A, PP1alpha	uc001oku.1	P62136		ENST00000376745.4:c.187+50C>G	11.37:g.67168488G>C		Somatic	0	50	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	9	83.33	A6NNR3|B2R908|P08129|P20653|P22802|Q07161	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376745.4	37	NULL	CCDS8160.1	11																																																																																			-	-		0.622	PPP1CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1CA	protein_coding	OTTHUMT00000395487.1	G	NM_002708	-		67168488	-1	no_errors	ENST00000529724	ensembl	human	putative	74_37	rna	SNP	0.000	C
ANP32BP1	646791	genome.wustl.edu	37	15	75614967	75614971	+	RNA	DEL	GCGGC	GCGGC	-	rs563222844	byFrequency	TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	GCGGC	GCGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr15:75614967_75614971delGCGGC	ENST00000564205.1	-	0	63_67									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		GCAGAGGCCGGCGGCGCGGTCCTGG	0.62																																																	0								ENSG00000259790																																			ANP32BP1			0				HGNC			15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614967_75614971delGCGGC		Somatic	NA	NA	NA		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			-	-		0.620	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	pseudogene	OTTHUMT00000419801.1	GCGGC				75614971	-1	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	DEL	0.012:0.007:0.001:0.002:0.000	-
SEZ6L	23544	genome.wustl.edu	37	22	26707840	26707840	+	Silent	SNP	C	C	T	rs150994059		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr22:26707840C>T	ENST00000248933.6	+	8	1883	c.1788C>T	c.(1786-1788)ccC>ccT	p.P596P	SEZ6L_ENST00000343706.4_Silent_p.P596P|SEZ6L_ENST00000360929.3_Silent_p.P596P|SEZ6L_ENST00000402979.1_Silent_p.P369P|SEZ6L_ENST00000403121.1_Silent_p.P369P|SEZ6L_ENST00000529632.2_Silent_p.P596P|SEZ6L_ENST00000404234.3_Silent_p.P596P			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	596	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						CCTGCGACCCCGGCCACTCCC	0.567																																																	0								ENSG00000100095	C	,,,,,	3,4403	6.2+/-15.9	0,3,2200	158.0	156.0	156.0		1788,1788,1788,1788,1788,1788	-4.8	1.0	22	dbSNP_134	156	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	SEZ6L	NM_001184773.1,NM_001184774.1,NM_001184775.1,NM_001184776.1,NM_001184777.1,NM_021115.4	,,,,,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,,,,,	596/1024,596/1014,596/1012,596/950,596/949,596/1025	26707840	3,13003	2203	4300	6503	SEZ6L	SO:0001819	synonymous_variant	0			-	HGNC	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1788C>T	22.37:g.26707840C>T		Somatic	0	28	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P596	ENST00000248933.6	37	c.1788	CCDS13833.1	22																																																																																			-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.567	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L	protein_coding	OTTHUMT00000320359.3	C		rs150994059		26707840	+1	no_errors	ENST00000248933	ensembl	human	known	74_37	silent	SNP	0.327	T
ATP2A3	489	genome.wustl.edu	37	17	3839703	3839703	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:3839703C>T	ENST00000352011.3	-	16	2436	c.2382G>A	c.(2380-2382)tgG>tgA	p.W794*	ATP2A3_ENST00000397035.3_Nonsense_Mutation_p.W794*|ATP2A3_ENST00000309890.7_Nonsense_Mutation_p.W794*|ATP2A3_ENST00000359983.3_Nonsense_Mutation_p.W794*|ATP2A3_ENST00000397043.3_Nonsense_Mutation_p.W794*|ATP2A3_ENST00000397039.1_5'UTR|ATP2A3_ENST00000397041.3_Nonsense_Mutation_p.W794*			Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous	794					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	36				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CCAGGTTCACCCAGAGCAGCT	0.637																																					GBM(32;29 774 15719 37967)												0								ENSG00000074370						81.0	81.0	81.0					17																	3839703		2203	4300	6503	ATP2A3	SO:0001587	stop_gained	0			-	HGNC		CCDS11041.1, CCDS11042.1, CCDS42234.1, CCDS45579.1, CCDS45580.1	17p13.3	2012-10-22			ENSG00000074370	ENSG00000074370	3.6.3.8	"""ATPases / P-type"""	813	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 3"", ""calcium pump 3"""	601929				8809064	Standard	NM_005173		Approved	SERCA3	uc002fwy.2	Q93084		ENST00000352011.3:c.2382G>A	17.37:g.3839703C>T	ENSP00000301387:p.Trp794*	Somatic	0	139	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	227	12.98	A8MZG0|D3DTJ8|O60900|O60901|O75501|O75502|Q16115|Q6JHX1|Q8TEX5|Q8TEX6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_IIA,tigrfam_Cation_transp_P_typ_ATPase	p.W794*	ENST00000352011.3	37	c.2382	CCDS11041.1	17	.	.	.	.	.	.	.	.	.	.	C	42	9.165998	0.99087	.	.	ENSG00000074370	ENST00000397043;ENST00000352011;ENST00000359983;ENST00000397041;ENST00000397045;ENST00000309890;ENST00000397035	.	.	.	4.16	4.16	0.48862	.	0.059204	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.725	0.85419	0.0:1.0:0.0:0.0	.	.	.	.	X	794	.	ENSP00000312577:W794X	W	-	3	0	ATP2A3	3786452	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.651000	0.83577	2.607000	0.88179	0.561000	0.74099	TGG	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_Ca-transp_IIA		0.637	ATP2A3-015	KNOWN	basic|CCDS	protein_coding	ATP2A3	protein_coding	OTTHUMT00000438401.1	C	NM_174953	-		3839703	-1	no_errors	ENST00000359983	ensembl	human	known	74_37	nonsense	SNP	1.000	T
LOC100289656	100289656	genome.wustl.edu	37	15	29037119	29037119	+	RNA	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr15:29037119G>A	ENST00000430589.1	+	0	895				RP11-578F21.12_ENST00000562423.1_RNA	NR_036475.2																						TGCAACTGACGCAGTCACTGC	0.383																																																	0								ENSG00000261377																																			RP11-578F21.12			0			-	Clone_based_vega_gene																													15.37:g.29037119G>A		Somatic	0	47	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	35	31.37		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000430589.1	37	NULL		15																																																																																			-	-		0.383	RP11-578F21.10-002	PUTATIVE	basic	processed_transcript	LOC101929232	pseudogene	OTTHUMT00000431786.1	G		-		29037119	+1	no_errors	ENST00000562423	ensembl	human	putative	74_37	rna	SNP	0.997	A
C12orf57	113246	genome.wustl.edu	37	12	7053350	7053378	+	Intron	DEL	TAGTCAAGGCATAGGCTGCTGGCCTGGGG	TAGTCAAGGCATAGGCTGCTGGCCTGGGG	-	rs372251126|rs368203841|rs377422594|rs375558430|rs372201342|rs372989237|rs915997|rs370246021|rs375320005	byFrequency	TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	TAGTCAAGGCATAGGCTGCTGGCCTGGGG	TAGTCAAGGCATAGGCTGCTGGCCTGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr12:7053350_7053378delTAGTCAAGGCATAGGCTGCTGGCCTGGGG	ENST00000229281.5	+	1	151				C12orf57_ENST00000542222.1_Intron|RNU7-1_ENST00000458811.1_RNA|U47924.31_ENST00000607421.1_RNA|PTPN6_ENST00000447931.2_5'Flank|C12orf57_ENST00000537087.1_Intron|C12orf57_ENST00000540506.2_Intron|C12orf57_ENST00000544681.1_Intron|PTPN6_ENST00000399448.1_5'Flank	NM_138425.2	NP_612434.1	Q99622	C10_HUMAN	chromosome 12 open reading frame 57							cytoplasm (GO:0005737)				kidney(1)|large_intestine(1)	2						AGAATCGTCCTAGTCAAGGCATAGGCTGCTGGCCTGGGGTAGTCAAGGC	0.633											OREG0021642	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		44	0.00878594	0.0	0.0101	5008	,	,		22611	0.005		0.0149	False		,,,				2504	0.0174																0								ENSG00000272173																																			U47924.31	SO:0001627	intron_variant	0				Clone_based_vega_gene	U47924	CCDS8571.1	12p13.31	2012-05-30			ENSG00000111678	ENSG00000111678			29521	protein-coding gene	gene with protein product		615140				9445485	Standard	NM_138425		Approved	GRCC10, C10	uc009zfj.2	Q99622	OTTHUMG00000169017	ENST00000229281.5:c.52+14TAGTCAAGGCATAGGCTGCTGGCCTGGGG>-	12.37:g.7053350_7053378delTAGTCAAGGCATAGGCTGCTGGCCTGGGG		Somatic	NA	NA	NA	638	0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R4Q6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000229281.5	37	NULL	CCDS8571.1	12																																																																																			-	-		0.633	C12orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNU7-1	protein_coding	OTTHUMT00000401959.1	TAGTCAAGGCATAGGCTGCTGGCCTGGGG	NM_138425			7053378	-1	no_errors	ENST00000607421	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.018:0.080:0.087:0.094:0.101:0.107:0.113:0.119:0.125:0.130:0.136:0.141:0.146:0.151:0.155:0.160:0.164:0.169:0.173	-
ARMC8	25852	genome.wustl.edu	37	3	137991910	137991910	+	Silent	SNP	G	G	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr3:137991910G>T	ENST00000469044.1	+	17	1852	c.1581G>T	c.(1579-1581)gtG>gtT	p.V527V	NME9_ENST00000341790.5_Intron|NME9_ENST00000484930.1_Intron|NME9_ENST00000383180.2_Intron|NME9_ENST00000536478.1_Intron|ARMC8_ENST00000461822.1_Silent_p.V460V|ARMC8_ENST00000485396.1_Silent_p.V454V|ARMC8_ENST00000491704.1_Silent_p.V485V|NME9_ENST00000317876.4_Intron|ARMC8_ENST00000481646.1_Silent_p.V513V|ARMC8_ENST00000393058.3_Silent_p.V517V|ARMC8_ENST00000538260.1_Silent_p.V496V	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	527										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						ATTTGAATGTGCTGATGAAGA	0.393																																																	0								ENSG00000114098						134.0	129.0	131.0					3																	137991910		1848	4092	5940	ARMC8	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.1581G>T	3.37:g.137991910G>T		Somatic	0	40	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	33	29.79	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.V527	ENST00000469044.1	37	c.1581		3																																																																																			-	superfamily_ARM-type_fold,smart_Armadillo		0.393	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	ARMC8	protein_coding	OTTHUMT00000357560.1	G	NM_015396	-		137991910	+1	no_errors	ENST00000469044	ensembl	human	known	74_37	silent	SNP	1.000	T
ENO2	2026	genome.wustl.edu	37	12	7026257	7026257	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr12:7026257G>C	ENST00000535366.1	+	4	922	c.296G>C	c.(295-297)gGg>gCg	p.G99A	ENO2_ENST00000229277.1_Missense_Mutation_p.G99A|ENO2_ENST00000541477.1_Missense_Mutation_p.G99A|ENO2_ENST00000544774.1_Intron|ENO2_ENST00000538763.1_Intron|ENO2_ENST00000545045.2_Missense_Mutation_p.G99A			P09104	ENOG_HUMAN	enolase 2 (gamma, neuronal)	99					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perikaryon (GO:0043204)|phosphopyruvate hydratase complex (GO:0000015)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						GAGTTGGATGGGACTGAGAAC	0.607																																																	0								ENSG00000111674						100.0	99.0	100.0					12																	7026257		2203	4300	6503	ENO2	SO:0001583	missense	0			-	HGNC	M22349	CCDS8570.1	12p13	2012-10-02				ENSG00000111674	4.2.1.11		3353	protein-coding gene	gene with protein product		131360					Standard	NM_001975		Approved		uc001qru.1	P09104		ENST00000535366.1:c.296G>C	12.37:g.7026257G>C	ENSP00000437402:p.Gly99Ala	Somatic	0	40	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	11	66.67	B7Z2X9|Q96J33	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.G99A	ENST00000535366.1	37	c.296	CCDS8570.1	12	.	.	.	.	.	.	.	.	.	.	g	21.3	4.131436	0.77549	.	.	ENSG00000111674	ENST00000537688;ENST00000540580;ENST00000541477;ENST00000229277;ENST00000539713;ENST00000535366;ENST00000545045;ENST00000544430	T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.16	5.16	0.70880	Enolase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73225	0.3560	H	0.99261	4.49	0.80722	D	1	B	0.25272	0.122	B	0.40477	0.33	T	0.79850	-0.1629	10	0.72032	D	0.01	-21.1966	17.7777	0.88514	0.0:0.0:1.0:0.0	.	99	P09104	ENOG_HUMAN	A	99	ENSP00000445788:G99A;ENSP00000443117:G99A;ENSP00000438873:G99A;ENSP00000229277:G99A;ENSP00000441740:G99A;ENSP00000437402:G99A;ENSP00000438062:G99A	ENSP00000229277:G99A	G	+	2	0	ENO2	6896518	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.866000	0.99616	2.567000	0.86603	0.556000	0.70494	GGG	-	pfam_Enolase_N,pirsf_Enolase,tigrfam_Enolase		0.607	ENO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO2	protein_coding	OTTHUMT00000401786.1	G		-		7026257	+1	no_errors	ENST00000229277	ensembl	human	known	74_37	missense	SNP	1.000	C
FANCA	2175	genome.wustl.edu	37	16	89837022	89837022	+	Silent	SNP	C	C	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr16:89837022C>T	ENST00000389301.3	-	24	2202	c.2172G>A	c.(2170-2172)acG>acA	p.T724T	FANCA_ENST00000568369.1_Silent_p.T724T|FANCA_ENST00000567284.2_5'UTR	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	724					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GACAGAAAGACGTCAGCAGGA	0.662			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0								ENSG00000187741						62.0	46.0	51.0					16																	89837022		2198	4299	6497	FANCA	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	HGNC	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.2172G>A	16.37:g.89837022C>T		Somatic	0	82	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	6	73.91	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fanconia,prints_Fanconia	p.T724	ENST00000389301.3	37	c.2172	CCDS32515.1	16																																																																																			-	NULL		0.662	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	protein_coding	OTTHUMT00000421927.1	C		-		89837022	-1	no_errors	ENST00000389301	ensembl	human	known	74_37	silent	SNP	0.287	T
NLRP1	22861	genome.wustl.edu	37	17	5418160	5418160	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr17:5418160delG	ENST00000572272.1	-	17	4335	c.4336delC	c.(4336-4338)caafs	p.Q1446fs	NLRP1_ENST00000345221.3_Frame_Shift_Del_p.Q1402fs|NLRP1_ENST00000354411.3_Frame_Shift_Del_p.Q1416fs|NLRP1_ENST00000262467.5_Intron|RNU7-31P_ENST00000517262.1_RNA|NLRP1_ENST00000269280.4_Frame_Shift_Del_p.Q1402fs|NLRP1_ENST00000577119.1_Frame_Shift_Del_p.Q1372fs			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	1446	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				TTCAGGGCTTGGTAGAGTCCA	0.562																																																	0								ENSG00000091592						91.0	95.0	93.0					17																	5418160		2022	4180	6202	NLRP1	SO:0001589	frameshift_variant	0				HGNC	AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.4336delC	17.37:g.5418160delG	ENSP00000460475:p.Gln1446fs	Somatic	0	127	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	152	15.08	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.Q1446fs	ENST00000572272.1	37	c.4336	CCDS42246.1	17																																																																																			-	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD		0.562	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	protein_coding	OTTHUMT00000439517.1	G	NM_033004			5418160	-1	no_errors	ENST00000572272	ensembl	human	known	74_37	frame_shift_del	DEL	0.924	-
PDLIM5	10611	genome.wustl.edu	37	4	95508214	95508214	+	Intron	SNP	G	G	A			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr4:95508214G>A	ENST00000317968.4	+	7	1056				PDLIM5_ENST00000380180.3_Missense_Mutation_p.R229H|PDLIM5_ENST00000542407.1_Intron|PDLIM5_ENST00000318007.5_Missense_Mutation_p.R209H|PDLIM5_ENST00000538141.1_Missense_Mutation_p.R209H|PDLIM5_ENST00000437932.1_Intron|PDLIM5_ENST00000450793.1_Missense_Mutation_p.R229H|PDLIM5_ENST00000508216.1_Missense_Mutation_p.R229H|PDLIM5_ENST00000380176.3_Intron|PDLIM5_ENST00000514743.1_Intron	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5						regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)	p.R229H(1)		central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		GTTTCAGCACGTGCTCTTAAC	0.378																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000163110						60.0	58.0	59.0					4																	95508214		1878	4110	5988	PDLIM5	SO:0001627	intron_variant	0			-	HGNC	AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.920+619G>A	4.37:g.95508214G>A		Somatic	0	60	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	15	54.55	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R229H	ENST00000317968.4	37	c.686	CCDS3641.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.82|17.82	3.482999|3.482999	0.63962|0.63962	.|.	.|.	ENSG00000163110|ENSG00000163110	ENST00000380180;ENST00000318007;ENST00000450793;ENST00000538141;ENST00000508216|ENST00000513341	T;T;T;T;T|.	0.37235|.	1.69;1.48;1.69;1.21;1.69|.	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	.|.	.|.	.|.	.|.	T|T	0.59059|0.59059	0.2166|0.2166	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	D;B|.	0.76494|.	0.999;0.045|.	D;B|.	0.78314|.	0.991;0.016|.	T|T	0.52555|0.52555	-0.8560|-0.8560	9|5	0.30854|.	T|.	0.27|.	.|.	19.4745|19.4745	0.94982|0.94982	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	229;209|.	Q96HC4-2;Q96HC4-3|.	.;.|.	H|M	229;209;229;209;229|191	ENSP00000369527:R229H;ENSP00000322021:R209H;ENSP00000401579:R229H;ENSP00000439795:R209H;ENSP00000426804:R229H|.	ENSP00000322021:R209H|.	R|V	+|+	2|1	0|0	PDLIM5|PDLIM5	95727237|95727237	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.420000|9.420000	0.97426|0.97426	2.677000|2.677000	0.91161|0.91161	0.585000|0.585000	0.79938|0.79938	CGT|GTG	-	NULL		0.378	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM5	protein_coding	OTTHUMT00000253586.1	G		-		95508214	+1	no_errors	ENST00000380180	ensembl	human	known	74_37	missense	SNP	1.000	A
C1RL	51279	genome.wustl.edu	37	12	7252337	7252337	+	Silent	SNP	G	G	C	rs563886171		TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr12:7252337G>C	ENST00000266542.4	-	5	728	c.636C>G	c.(634-636)acC>acG	p.T212T	C1RL_ENST00000504702.2_5'Flank|C1RL_ENST00000544702.1_Missense_Mutation_p.P228R|C1RL_ENST00000545280.1_Intron	NM_016546.2	NP_057630.2	Q9NZP8	C1RL_HUMAN	complement component 1, r subcomponent-like	212					complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AGGTCCCTGGGGTTGCACAGG	0.552																																																	0								ENSG00000139178						66.0	48.0	54.0					12																	7252337		2200	4296	6496	C1RL	SO:0001819	synonymous_variant	0			-	HGNC	AF178985	CCDS8573.1, CCDS73431.1	12p13.31	2008-02-05				ENSG00000139178			21265	protein-coding gene	gene with protein product		608974				12838346	Standard	XM_005253385		Approved	C1r-LP, C1RL1	uc001qsn.3	Q9NZP8		ENST00000266542.4:c.636C>G	12.37:g.7252337G>C		Somatic	0	119	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	45	11.76	Q53GX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	p.P228R	ENST00000266542.4	37	c.683	CCDS8573.1	12	.	.	.	.	.	.	.	.	.	.	G	9.874	1.199836	0.22121	.	.	ENSG00000139178	ENST00000544702	T	0.37752	1.18	3.86	0.918	0.19386	.	.	.	.	.	T	0.25791	0.0628	.	.	.	0.09310	N	1	P	0.36837	0.571	B	0.40228	0.323	T	0.15925	-1.0420	7	.	.	.	.	4.6243	0.12470	0.1062:0.0:0.5079:0.3859	.	228	F5GWF3	.	R	228	ENSP00000441885:P228R	.	P	-	2	0	C1RL	7143479	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	0.170000	0.16663	0.191000	0.20236	0.462000	0.41574	CCC	-	NULL		0.552	C1RL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1RL	protein_coding	OTTHUMT00000398367.1	G	NM_016546	-		7252337	-1	no_errors	ENST00000544702	ensembl	human	putative	74_37	missense	SNP	0.000	C
HERC4	26091	genome.wustl.edu	37	10	69832684	69832684	+	Missense_Mutation	SNP	T	T	C			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr10:69832684T>C	ENST00000395198.3	-	3	429	c.182A>G	c.(181-183)aAt>aGt	p.N61S	HERC4_ENST00000492996.2_Missense_Mutation_p.N61S|HERC4_ENST00000373700.4_Missense_Mutation_p.N61S|HERC4_ENST00000412272.2_Missense_Mutation_p.N61S|HERC4_ENST00000395187.2_Missense_Mutation_p.N61S	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	61					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						TCCTAGATCATTACATCCACA	0.323																																																	0								ENSG00000148634						117.0	113.0	114.0					10																	69832684		2203	4300	6503	HERC4	SO:0001583	missense	0			-	HGNC	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.182A>G	10.37:g.69832684T>C	ENSP00000378624:p.Asn61Ser	Somatic	0	92	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	20	53.49	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Reg_chr_condens,pfam_HECT,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.N61S	ENST00000395198.3	37	c.182	CCDS41533.1	10	.	.	.	.	.	.	.	.	.	.	T	23.0	4.357609	0.82243	.	.	ENSG00000148634	ENST00000412272;ENST00000395198;ENST00000373700;ENST00000395187;ENST00000513996;ENST00000492996	D;D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-1.96;-2.33;-1.96	4.78	4.78	0.61160	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.110748	0.64402	D	0.000012	D	0.92861	0.7729	M	0.80982	2.52	0.80722	D	1	P;D;P;P;P	0.63880	0.518;0.993;0.92;0.648;0.698	B;D;P;P;P	0.77557	0.147;0.99;0.742;0.523;0.654	D	0.93055	0.6469	9	.	.	.	.	12.9004	0.58123	0.0:0.0:0.0:1.0	.	61;61;61;61;61	Q5GLZ8-3;Q5GLZ8-4;A8K9U4;Q5GLZ8-2;Q5GLZ8	.;.;.;.;HERC4_HUMAN	S	61	ENSP00000416504:N61S;ENSP00000378624:N61S;ENSP00000362804:N61S;ENSP00000378614:N61S;ENSP00000427191:N61S;ENSP00000422383:N61S	.	N	-	2	0	HERC4	69502690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.671000	0.83941	1.780000	0.52325	0.533000	0.62120	AAT	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens		0.323	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC4	protein_coding	OTTHUMT00000359262.1	T	NM_015601	-		69832684	-1	no_errors	ENST00000395198	ensembl	human	known	74_37	missense	SNP	1.000	C
FZR1	51343	genome.wustl.edu	37	19	3534432	3534432	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A3TO-01A-11D-A228-09	TCGA-FX-A3TO-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	e1c07e88-920e-4b30-8c6d-207e72f77f25	fcdad24d-eab3-4b5d-98a2-470456e019cf	g.chr19:3534432A>T	ENST00000395095.3	+	12	1361	c.1361A>T	c.(1360-1362)gAt>gTt	p.D454V	FZR1_ENST00000441788.2_Missense_Mutation_p.D454V|FZR1_ENST00000313639.8_Missense_Mutation_p.D365V	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	454					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		ATGTCCCCTGATGGGGAGGCC	0.592																																																	0								ENSG00000105325						92.0	73.0	79.0					19																	3534432		2197	4297	6494	FZR1	SO:0001583	missense	0			-	HGNC	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.1361A>T	19.37:g.3534432A>T	ENSP00000378529:p.Asp454Val	Somatic	0	90	0.00		0.6554336292151233	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	46	44.58	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D454V	ENST00000395095.3	37	c.1361	CCDS45916.1	19	.	.	.	.	.	.	.	.	.	.	A	25.7	4.661431	0.88154	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.64438	1.1;1.1;-0.1	5.12	5.12	0.69794	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82632	0.5079	M	0.90870	3.155	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.997;0.998;1.0	D	0.86729	0.1947	10	0.87932	D	0	-29.8112	13.7565	0.62940	1.0:0.0:0.0:0.0	.	454;365;454	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	V	454;454;365	ENSP00000410369:D454V;ENSP00000378529:D454V;ENSP00000321800:D365V	ENSP00000321800:D365V	D	+	2	0	FZR1	3485432	1.000000	0.71417	0.983000	0.44433	0.960000	0.62799	8.983000	0.93477	1.929000	0.55896	0.459000	0.35465	GAT	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.592	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FZR1	protein_coding	OTTHUMT00000452869.2	A	NM_016263	-		3534432	+1	no_errors	ENST00000395095	ensembl	human	known	74_37	missense	SNP	0.998	T
