#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
TTBK2	146057	genome.wustl.edu	37	15	43045133	43045133	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr15:43045133C>G	ENST00000267890.6	-	14	2419	c.2311G>C	c.(2311-2313)Gaa>Caa	p.E771Q		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	771					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		GGGAGATTTTCAAATTCTCTC	0.393																																																	0								ENSG00000128881						189.0	174.0	179.0					15																	43045133		1837	4080	5917	TTBK2	SO:0001583	missense	0			-	HGNC	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.2311G>C	15.37:g.43045133C>G	ENSP00000267890:p.Glu771Gln	Somatic	0	62	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	42	42.47	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	40	0.00	0	48	43.53	37	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E771Q	ENST00000267890.6	37	c.2311	CCDS42029.1	15	.	.	.	.	.	.	.	.	.	.	C	13.01	2.108624	0.37242	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.42131	0.98	5.73	5.73	0.89815	.	0.488040	0.22850	N	0.054864	T	0.47173	0.1431	L	0.56769	1.78	0.80722	D	1	B;B	0.30361	0.277;0.181	B;B	0.34779	0.189;0.092	T	0.45440	-0.9261	10	0.62326	D	0.03	.	18.0859	0.89457	0.0:1.0:0.0:0.0	.	702;771	Q6IQ55-2;Q6IQ55	.;TTBK2_HUMAN	Q	771;701;1176	ENSP00000267890:E771Q	ENSP00000263802:E1176Q	E	-	1	0	TTBK2	40832425	1.000000	0.71417	0.955000	0.39395	0.555000	0.35460	3.435000	0.52849	2.698000	0.92095	0.655000	0.94253	GAA	-	NULL		0.393	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK2	protein_coding	OTTHUMT00000431106.2	C	NM_173500	-		43045133	-1	no_errors	ENST00000267890	ensembl	human	known	74_37	missense	SNP	0.997	G
DNAH17	8632	genome.wustl.edu	37	17	76446859	76446859	+	Missense_Mutation	SNP	G	G	A	rs568734889		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr17:76446859G>A	ENST00000585328.1	-	67	10913	c.10789C>T	c.(10789-10791)Cgt>Tgt	p.R3597C	DNAH17_ENST00000389840.5_Missense_Mutation_p.R3588C|DNAH17_ENST00000586052.1_5'UTR	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3588	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GCCGACAGACGGGCCAGGAGC	0.547													G|||	1	0.000199681	0.0	0.0	5008	,	,		20656	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000187775						79.0	80.0	80.0					17																	76446859		2203	4300	6503	DNAH17	SO:0001583	missense	0			-	HGNC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.10789C>T	17.37:g.76446859G>A	ENSP00000465516:p.Arg3597Cys	Somatic	0	62	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	27	47.06	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	34	0.00	0	36	46.27	31	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.R3588C	ENST00000585328.1	37	c.10762		17	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366234	0.82463	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.34072	1.38	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000005	T	0.61350	0.2340	M	0.91300	3.195	0.80722	D	1	D	0.58268	0.982	P	0.54889	0.763	T	0.71104	-0.4689	10	0.66056	D	0.02	.	14.7803	0.69760	0.0:0.0:0.8551:0.1449	.	3597	E7EUM8	.	C	3597;3588	ENSP00000374490:R3588C	ENSP00000300671:R3597C	R	-	1	0	DNAH17	73958454	1.000000	0.71417	0.987000	0.45799	0.997000	0.91878	4.571000	0.60879	2.494000	0.84150	0.650000	0.86243	CGT	-	superfamily_P-loop_NTPase		0.547	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	protein_coding	OTTHUMT00000318962.2	G	NM_173628	-		76446859	-1	no_errors	ENST00000389840	ensembl	human	known	74_37	missense	SNP	1.000	A
TTBK2	146057	genome.wustl.edu	37	15	43044957	43044957	+	Silent	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr15:43044957C>T	ENST00000267890.6	-	14	2595	c.2487G>A	c.(2485-2487)caG>caA	p.Q829Q		NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	829					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.Q829H(1)		NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		CACTAAAAGTCTGTGTTTTTG	0.403																																																	1	Substitution - Missense(1)	cervix(1)						ENSG00000128881						114.0	102.0	106.0					15																	43044957		1851	4096	5947	TTBK2	SO:0001819	synonymous_variant	0			-	HGNC	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.2487G>A	15.37:g.43044957C>T		Somatic	0	46	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	25	53.70	O94932|Q6ZN52|Q8IVV1	Silent	SNP	34	0.00	0	41	48.15	39	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q829	ENST00000267890.6	37	c.2487	CCDS42029.1	15																																																																																			-	NULL		0.403	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTBK2	protein_coding	OTTHUMT00000431106.2	C	NM_173500	-		43044957	-1	no_errors	ENST00000267890	ensembl	human	known	74_37	silent	SNP	1.000	T
TRAK1	22906	genome.wustl.edu	37	3	42251577	42251578	+	Intron	INS	-	-	GGA	rs10634555|rs35624871		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr3:42251577_42251578insGGA	ENST00000327628.5	+	14	2363				TRAK1_ENST00000341421.3_In_Frame_Ins_p.640_641insE|TRAK1_ENST00000396175.1_Intron|TRAK1_ENST00000487159.1_Intron	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1						endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.E640delE(1)		central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CCAGCGGCCACggaggaggagg	0.629																																					GBM(44;195 884 22595 31865 41850)												1	Deletion - In frame(1)	kidney(1)						ENSG00000182606																																			TRAK1	SO:0001627	intron_variant	0				HGNC		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.1963+100->GGA	3.37:g.42251584_42251586dupGGA		Somatic	0	23	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	28	17.65	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	In_Frame_Ins	INS	13	18.75	3	36	5.26	2	pfam_HAP1_N,pfam_Traffickng_kinesin-bd_prot_dom	p.634in_frame_insE	ENST00000327628.5	37	c.1889_1890	CCDS43072.1	3																																																																																			-	NULL		0.629	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TRAK1	protein_coding	OTTHUMT00000343413.1	-	NM_014965			42251578	+1	no_errors	ENST00000341421	ensembl	human	known	74_37	in_frame_ins	INS	0.010:0.044	GGA
MSH3	4437	genome.wustl.edu	37	5	79950712	79950738	+	In_Frame_Del	DEL	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA	-	rs2431220|rs2001675|rs2405876|rs2405877|rs201874762|rs144776112|rs1574197|rs148550291|rs201906899|rs535056167|rs60484572|rs70991168|rs201149584	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	GCGGCCGCAGCGGCCGCAGCGCCCCCA	GCGGCCGCAGCGGCCGCAGCGCCCCCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr5:79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENST00000265081.6	+	1	246_272	c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	c.(166-192)gcggccgcagcggccgcagcgcccccadel	p.AAAAAAAPP56del	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000511032.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	56	Poly-Ala.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		agcggctgcagcggccgcagcggccgcagcgCCCCCAGCGCCCCCAG	0.705								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)												0								ENSG00000113318																																			MSH3	SO:0001651	inframe_deletion	0				HGNC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.166_192delGCGGCCGCAGCGGCCGCAGCGCCCCCA	5.37:g.79950712_79950738delGCGGCCGCAGCGGCCGCAGCGCCCCCA	ENSP00000265081:p.Ala56_Pro64del	Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	13	0.00	0	28	0.00	0	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.AAAAAAPPA57in_frame_del	ENST00000265081.6	37	c.166_192	CCDS34195.1	5																																																																																			-	NULL		0.705	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	protein_coding	OTTHUMT00000369471.1	GCGGCCGCAGCGGCCGCAGCGCCCCCA	NM_002439			79950738	+1	no_errors	ENST00000265081	ensembl	human	known	74_37	in_frame_del	DEL	0.238:0.205:0.172:0.140:0.107:0.075:0.032:0.035:0.048:0.057:0.087:0.730:0.747:0.894:0.911:0.915:0.941:0.965:0.997:1.000:1.000:1.000:1.000:0.988:0.984:0.963:0.965	-
LIPM	340654	genome.wustl.edu	37	10	90572870	90572870	+	Silent	SNP	G	G	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:90572870G>T	ENST00000404743.4	+	3	449	c.282G>T	c.(280-282)gtG>gtT	p.V94V	LIPM_ENST00000539337.1_Silent_p.V54V	NM_001128215.1	NP_001121687.1	Q5VYY2	LIPM_HUMAN	lipase, family member M	94					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	hydrolase activity, acting on ester bonds (GO:0016788)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|pancreas(1)|skin(1)	7						GGCCTGTGGTGTTACTGCAGC	0.443																																																	0								ENSG00000173239						134.0	108.0	116.0					10																	90572870		692	1591	2283	LIPM	SO:0001819	synonymous_variant	0			-	HGNC		CCDS44457.1	10q23.31	2008-02-04	2007-02-27	2007-02-27	ENSG00000173239	ENSG00000173239			23455	protein-coding gene	gene with protein product		613923	"""lipase-like, ab-hydrolase domain containing 3"""	LIPL3			Standard	NM_001128215		Approved	bA304I5.1	uc009xtm.1	Q5VYY2	OTTHUMG00000018698	ENST00000404743.4:c.282G>T	10.37:g.90572870G>T		Somatic	0	38	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	A6PVS3|B2RXK7|B5MCR3	Silent	SNP	39	0.00	0	45	0.00	0	pfam_AB_hydrolase_lipase,pfam_AB_hydrolase_1	p.V94	ENST00000404743.4	37	c.282	CCDS44457.1	10																																																																																			-	pfam_AB_hydrolase_lipase		0.443	LIPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPM	protein_coding	OTTHUMT00000049261.3	G	XM_291663	-		90572870	+1	no_errors	ENST00000404743	ensembl	human	known	74_37	silent	SNP	0.895	T
MIR137HG	400765	genome.wustl.edu	37	1	98511783	98511783	+	lincRNA	SNP	C	C	T	rs552418648	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:98511783C>T	ENST00000580305.1	-	0	0				MIR137HG_ENST00000385223.1_lincRNA	NR_039604.1				MIR137 host gene (non-protein coding)																		ctgctactgccgccgccgccg	0.632													C|||	983	0.196286	0.3162	0.1009	5008	,	,		10817	0.1141		0.17	False		,,,				2504	0.2137																0								ENSG00000225206						4.0	8.0	7.0					1																	98511783		266	1004	1270	MIR137HG			0			-	HGNC	AK094607		1p21.3	2013-05-22			ENSG00000225206	ENSG00000225206		"""Long non-coding RNAs"""	42871	non-coding RNA	RNA, long non-coding							Standard	NR_046105		Approved		uc001drx.2		OTTHUMG00000010680		1.37:g.98511783C>T		Somatic	0	31	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	9	50.00		RNA	SNP	11	21.43	3	35	10.26	4	-	NULL	ENST00000580305.1	37	NULL		1																																																																																			-	-		0.632	MIR137HG-203	KNOWN	basic	miRNA	MIR137HG	lincRNA		C	NR_046105	-		98511783	-1	no_errors	ENST00000424528	ensembl	human	known	74_37	rna	SNP	0.909	T
MUC2	4583	genome.wustl.edu	37	11	1098687	1098687	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:1098687G>A	ENST00000441003.2	+	37	7084	c.7057G>A	c.(7057-7059)Gat>Aat	p.D2353N	MUC2_ENST00000361558.6_3'UTR	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	4715					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	GCACTACTACGATGCCTGCGT	0.647																																																	0								ENSG00000198788						23.0	28.0	27.0					11																	1098687		2117	4234	6351	MUC2	SO:0001583	missense	0			-	HGNC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.7057G>A	11.37:g.1098687G>A	ENSP00000415183:p.Asp2353Asn	Somatic	0	112	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	10	84.38	Q14878	Missense_Mutation	SNP	29	0.00	0	5	84.85	28	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.D2353N	ENST00000441003.2	37	c.7057		11	.	.	.	.	.	.	.	.	.	.	G	6.821	0.520618	0.13005	.	.	ENSG00000198788	ENST00000441003	T	0.77098	-1.07	4.09	4.09	0.47781	.	.	.	.	.	T	0.71451	0.3341	L	0.56124	1.755	0.09310	N	1	P	0.48407	0.91	B	0.40477	0.33	T	0.61496	-0.7051	9	0.23302	T	0.38	.	12.2354	0.54512	0.0:0.1719:0.8281:0.0	.	2353	E7EUV1	.	N	2353	ENSP00000415183:D2353N	ENSP00000415183:D2353N	D	+	1	0	MUC2	1088687	0.001000	0.12720	0.855000	0.33649	0.347000	0.29111	0.632000	0.24583	1.821000	0.53095	0.561000	0.74099	GAT	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.647	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	protein_coding	OTTHUMT00000345894.2	G	NM_002457	-		1098687	+1	no_errors	ENST00000441003	ensembl	human	known	74_37	missense	SNP	0.118	A
ELFN2	114794	genome.wustl.edu	37	22	37770666	37770666	+	Silent	SNP	G	G	A	rs201226596		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr22:37770666G>A	ENST00000402918.2	-	3	1694	c.909C>T	c.(907-909)caC>caT	p.H303H	ELFN2_ENST00000435824.1_5'Flank|RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	303	Fibronectin type-III.				negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					TGAACGTGACGTGGTGCAGCT	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		18628	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000166897	G		1,4405	2.1+/-5.4	0,1,2202	248.0	213.0	225.0		909	-3.4	1.0	22		225	0,8600		0,0,4300	no	coding-synonymous	ELFN2	NM_052906.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		303/821	37770666	1,13005	2203	4300	6503	ELFN2	SO:0001819	synonymous_variant	0			-	HGNC	BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.909C>T	22.37:g.37770666G>A		Somatic	0	94	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	14	76.27	Q96PY3	Silent	SNP	28	0.00	0	6	80.65	25	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,pfscan_LPXTG_anchor	p.H303	ENST00000402918.2	37	c.909	CCDS33642.1	22																																																																																			-	superfamily_Fibronectin_type3		0.607	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	protein_coding	OTTHUMT00000318900.2	G	NM_052906	rs201226596		37770666	-1	no_errors	ENST00000402918	ensembl	human	known	74_37	silent	SNP	0.337	A
ARHGEF11	9826	genome.wustl.edu	37	1	156950243	156950243	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:156950243C>T	ENST00000361409.2	-	4	1001	c.259G>A	c.(259-261)Gac>Aac	p.D87N	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.D87N	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	87	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					ATGATCCGGTCGCCCTCTTTC	0.572																																																	0								ENSG00000132694						121.0	75.0	91.0					1																	156950243		2203	4300	6503	ARHGEF11	SO:0001583	missense	0			-	HGNC	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.259G>A	1.37:g.156950243C>T	ENSP00000354644:p.Asp87Asn	Somatic	0	100	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	120	9.77	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	27	0.00	0	50	9.09	5	pfam_RGS-like_dom,pfam_DH-domain,pfam_PDZ,pfam_RGS_dom,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal_superfam,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal_superfam,pfscan_DH-domain	p.D87N	ENST00000361409.2	37	c.259	CCDS1162.1	1	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728238	0.89390	.	.	ENSG00000132694	ENST00000368194;ENST00000361409	T;T	0.74002	-0.8;-0.8	5.1	5.1	0.69264	PDZ/DHR/GLGF (4);	0.000000	0.53938	D	0.000041	D	0.89406	0.6706	H	0.95950	3.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.92087	0.5677	10	0.87932	D	0	-27.7894	15.5494	0.76137	0.0:1.0:0.0:0.0	.	87;87	O15085;O15085-2	ARHGB_HUMAN;.	N	87	ENSP00000357177:D87N;ENSP00000354644:D87N	ENSP00000354644:D87N	D	-	1	0	ARHGEF11	155216867	1.000000	0.71417	0.963000	0.40424	0.985000	0.73830	5.476000	0.66793	2.663000	0.90544	0.655000	0.94253	GAC	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.572	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	protein_coding	OTTHUMT00000098931.1	C	NM_198236	-		156950243	-1	no_errors	ENST00000368194	ensembl	human	known	74_37	missense	SNP	0.988	T
HSPA8	3312	genome.wustl.edu	37	11	122930678	122930678	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:122930678G>A	ENST00000532636.1	-	5	742	c.623C>T	c.(622-624)tCa>tTa	p.S208L	HSPA8_ENST00000534319.1_5'UTR|SNORD14D_ENST00000384390.1_RNA|HSPA8_ENST00000453788.2_Missense_Mutation_p.S208L|HSPA8_ENST00000526862.1_Intron|HSPA8_ENST00000227378.3_Missense_Mutation_p.S208L|HSPA8_ENST00000533540.1_Intron|SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000534624.1_Missense_Mutation_p.S208L|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000526110.1_Missense_Mutation_p.S189L			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	208	Interaction with BAG1.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AGTGAGGATTGACACATCAAA	0.428																																					Colon(21;486 594 5900 6733 14272)												0								ENSG00000109971						39.0	40.0	40.0					11																	122930678		2202	4299	6501	HSPA8	SO:0001583	missense	0			-	HGNC	Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.623C>T	11.37:g.122930678G>A	ENSP00000437125:p.Ser208Leu	Somatic	0	23	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	Q9H3R6	Missense_Mutation	SNP	35	0.00	0	79	0.00	0	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.S208L	ENST00000532636.1	37	c.623	CCDS8440.1	11	.	.	.	.	.	.	.	.	.	.	G	31	5.103612	0.94245	.	.	ENSG00000109971	ENST00000532636;ENST00000534624;ENST00000453788;ENST00000227378;ENST00000526110;ENST00000528292;ENST00000525463	T;T;T;T;T;T;T	0.02525	4.26;4.26;4.26;4.26;4.26;4.26;4.26	4.51	4.51	0.55191	Heat shock protein 70, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.39682	0.1087	H	0.99994	5.395	0.80722	D	1	D;D;D;D	0.89917	0.993;1.0;1.0;0.993	D;D;D;D	0.91635	0.962;0.999;0.998;0.962	T	0.74937	-0.3494	10	0.87932	D	0	-13.3314	17.5407	0.87846	0.0:0.0:1.0:0.0	.	208;208;208;208	Q53GZ6;E7ET08;P11142-2;P11142	.;.;.;HSP7C_HUMAN	L	208;208;208;208;189;148;167	ENSP00000437125:S208L;ENSP00000432083:S208L;ENSP00000404372:S208L;ENSP00000227378:S208L;ENSP00000433584:S189L;ENSP00000432884:S148L;ENSP00000436762:S167L	ENSP00000227378:S208L	S	-	2	0	HSPA8	122435888	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.786000	0.99046	2.181000	0.69327	0.561000	0.74099	TCA	-	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam		0.428	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	HSPA8	protein_coding	OTTHUMT00000387515.1	G		-		122930678	-1	no_errors	ENST00000534624	ensembl	human	known	74_37	missense	SNP	1.000	A
E2F5	1875	genome.wustl.edu	37	8	86089854	86089854	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr8:86089854C>A	ENST00000416274.2	+	1	233	c.199C>A	c.(199-201)Cag>Aag	p.Q67K	RP11-219B4.7_ENST00000566000.1_RNA|RP11-219B4.7_ENST00000562577.1_RNA|RP11-219B4.3_ENST00000520129.1_RNA|E2F5_ENST00000256117.5_Missense_Mutation_p.Q67K|E2F5_ENST00000418930.2_Missense_Mutation_p.Q67K|E2F5_ENST00000519128.1_3'UTR	NM_001083588.1|NM_001951.3	NP_001077057.1|NP_001942.2	Q15329	E2F5_HUMAN	E2F transcription factor 5, p130-binding	67					gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)	8						GTCGCTGCTGCAGGAGGCCAA	0.736																																																	0								ENSG00000133740						14.0	16.0	15.0					8																	86089854		2187	4299	6486	E2F5	SO:0001583	missense	0			-	HGNC	X86097	CCDS47885.1, CCDS47886.1, CCDS55254.1	8q21.2	2004-01-29			ENSG00000133740	ENSG00000133740			3119	protein-coding gene	gene with protein product		600967				7892279	Standard	NM_001083588		Approved		uc003ycz.4	Q15329	OTTHUMG00000164785	ENST00000416274.2:c.199C>A	8.37:g.86089854C>A	ENSP00000398124:p.Gln67Lys	Somatic	0	30	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	E9PBN9|Q16601|Q92756	Missense_Mutation	SNP	21	0.00	0	57	0.00	0	pfam_E2F_TDP	p.Q67K	ENST00000416274.2	37	c.199	CCDS47885.1	8	.	.	.	.	.	.	.	.	.	.	C	16.71	3.199565	0.58126	.	.	ENSG00000133740	ENST00000418930;ENST00000256117;ENST00000416274	T;T;T	0.05580	3.43;3.42;3.43	3.65	2.74	0.32292	Transcription factor E2F/dimerisation partner (TDP) (1);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.160657	0.43110	U	0.000620	T	0.04588	0.0125	N	0.05259	-0.085	0.80722	D	1	P;P	0.50272	0.933;0.78	P;B	0.49477	0.612;0.431	T	0.56860	-0.7909	10	0.23302	T	0.38	-7.454	10.2563	0.43399	0.0:0.8958:0.0:0.1042	.	67;67	Q15329-2;Q15329	.;E2F5_HUMAN	K	67	ENSP00000414312:Q67K;ENSP00000256117:Q67K;ENSP00000398124:Q67K	ENSP00000256117:Q67K	Q	+	1	0	E2F5	86277106	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	4.854000	0.62918	1.850000	0.53721	0.462000	0.41574	CAG	-	pfam_E2F_TDP		0.736	E2F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	E2F5	protein_coding	OTTHUMT00000380274.1	C	NM_001951	-		86089854	+1	no_errors	ENST00000256117	ensembl	human	known	74_37	missense	SNP	1.000	A
MALAT1	378938	genome.wustl.edu	37	11	65268480	65268480	+	lincRNA	DEL	T	T	-	rs72004824|rs117197658	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:65268480delT	ENST00000534336.1	+	0	3248				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AGTTTGTGGGTTTTTTTTTTT	0.368																																																	0								ENSG00000251562						83.0	101.0	95.0					11																	65268480		874	1988	2862	MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268480delT		Somatic	0	29	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34		RNA	DEL	31	3.12	1	70	6.67	5	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.368	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	T	NR_002819			65268480	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	DEL	0.000	-
WDHD1	11169	genome.wustl.edu	37	14	55493472	55493472	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr14:55493472G>T	ENST00000360586.3	-	2	99	c.34C>A	c.(34-36)Cat>Aat	p.H12N	SOCS4_ENST00000339298.2_5'Flank|WDHD1_ENST00000421192.1_5'UTR|SOCS4_ENST00000555846.1_5'Flank|SOCS4_ENST00000395472.2_5'Flank|WDHD1_ENST00000420358.2_Intron	NM_007086.3	NP_009017.1	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	12					heterochromatin maintenance (GO:0070829)|regulation of chromosome organization (GO:0033044)|RNA processing (GO:0006396)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(2)	42						CCCTCTGTATGCCCATATCTC	0.378																																																	0								ENSG00000198554						170.0	166.0	167.0					14																	55493472		2203	4300	6503	WDHD1	SO:0001583	missense	0			-	HGNC	AJ006266	CCDS9721.1, CCDS41955.1	14q22.2	2013-01-09			ENSG00000198554	ENSG00000198554		"""WD repeat domain containing"""	23170	protein-coding gene	gene with protein product	"""CTF4, chromosome transmission fidelity factor 4 homolog (S. cerevisiae)"""	608126				9175701, 20028748	Standard	NM_007086		Approved	AND-1, CTF4, CHTF4	uc001xbm.2	O75717	OTTHUMG00000140304	ENST00000360586.3:c.34C>A	14.37:g.55493472G>T	ENSP00000353793:p.His12Asn	Somatic	0	77	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	C9JW18|F6W0U7	Missense_Mutation	SNP	36	0.00	0	56	0.00	0	pfam_WD40_repeat,pfam_DUF3639,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,superfamily_HMG_box_dom,smart_WD40_repeat,smart_HMG_box_dom,pfscan_HMG_box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H12N	ENST00000360586.3	37	c.34	CCDS9721.1	14	.	.	.	.	.	.	.	.	.	.	G	15.91	2.973125	0.53614	.	.	ENSG00000198554	ENST00000360586;ENST00000455555	T;T	0.81078	-1.45;-1.45	5.41	5.41	0.78517	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.90563	0.7042	M	0.91663	3.23	0.80722	D	1	D	0.59767	0.986	P	0.60173	0.87	D	0.92556	0.6054	10	0.87932	D	0	.	15.915	0.79508	0.0:0.0:1.0:0.0	.	12	O75717	WDHD1_HUMAN	N	12	ENSP00000353793:H12N;ENSP00000413435:H12N	ENSP00000353793:H12N	H	-	1	0	WDHD1	54563222	1.000000	0.71417	1.000000	0.80357	0.018000	0.09664	6.320000	0.72876	2.533000	0.85409	0.467000	0.42956	CAT	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.378	WDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDHD1	protein_coding	OTTHUMT00000276897.2	G	NM_007086	-		55493472	-1	no_errors	ENST00000360586	ensembl	human	known	74_37	missense	SNP	1.000	T
WDFY4	57705	genome.wustl.edu	37	10	49951200	49951200	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951200C>T	ENST00000325239.5	+	11	2093	c.2066C>T	c.(2065-2067)tCc>tTc	p.S689F	WDFY4_ENST00000413659.2_Missense_Mutation_p.S689F	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	689						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TGTGCTGTGTCCGCAGCGCTG	0.607																																																	0								ENSG00000128815						45.0	43.0	43.0					10																	49951200		692	1591	2283	WDFY4	SO:0001583	missense	0			-	HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2066C>T	10.37:g.49951200C>T	ENSP00000320563:p.Ser689Phe	Somatic	0	63	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	88	13.73	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	30	0.00	0	83	18.63	19	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S689F	ENST00000325239.5	37	c.2066	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	C	14.73	2.623554	0.46840	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T	0.57907	0.37;1.39	5.13	4.22	0.49857	Armadillo-type fold (1);	.	.	.	.	T	0.51126	0.1656	M	0.63428	1.95	0.29679	N	0.841832	P	0.45283	0.855	B	0.41571	0.36	T	0.54543	-0.8278	8	.	.	.	.	12.127	0.53922	0.0:0.917:0.0:0.083	.	689	Q6ZS81	WDFY4_HUMAN	F	698;689;689;689	ENSP00000320563:S689F;ENSP00000403789:S689F	.	S	+	2	0	WDFY4	49621206	0.890000	0.30428	0.989000	0.46669	0.097000	0.18754	3.440000	0.52886	2.407000	0.81776	0.563000	0.77884	TCC	-	superfamily_ARM-type_fold		0.607	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		C	XM_033379	-		49951200	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	SNP	0.991	T
EMP2	2013	genome.wustl.edu	37	16	10625606	10625613	+	3'UTR	DEL	ATGAATGA	ATGAATGA	-	rs151287012|rs111364972|rs149380057		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	ATGAATGA	ATGAATGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:10625606_10625613delATGAATGA	ENST00000359543.3	-	0	1862_1869				EMP2_ENST00000566033.1_5'UTR|RP11-27M24.1_ENST00000535363.1_RNA	NM_001424.4	NP_001415.1	P54851	EMP2_HUMAN	epithelial membrane protein 2						cell proliferation (GO:0008283)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|regulation of glomerular filtration (GO:0003093)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	integrin binding (GO:0005178)			NS(1)|endometrium(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	6						ATTTATGTTGatgaatgaatgaatgaat	0.471																																					GBM(158;2021 2691 14714 39478)												0								ENSG00000213853																																			EMP2	SO:0001624	3_prime_UTR_variant	0				HGNC	U52100	CCDS10541.1	16p13.2	2008-08-01			ENSG00000213853	ENSG00000213853			3334	protein-coding gene	gene with protein product		602334				8996089, 10331954, 16216233	Standard	NM_001424		Approved	XMP	uc002czx.3	P54851	OTTHUMG00000129752	ENST00000359543.3:c.*1156TCATTCAT>-	16.37:g.10625614_10625621delATGAATGA		Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R7V6|D3DUF8	RNA	DEL	25	16.67	5	52	20.00	13	-	NULL	ENST00000359543.3	37	NULL	CCDS10541.1	16																																																																																			-	-		0.471	EMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMP2	protein_coding	OTTHUMT00000251965.1	ATGAATGA	NM_001424			10625613	-1	no_errors	ENST00000566033	ensembl	human	putative	74_37	rna	DEL	0.092:0.092:0.091:0.090:0.088:0.085:0.082:0.078	-
PAPD5	64282	genome.wustl.edu	37	16	50263693	50263693	+	3'UTR	DEL	T	T	-			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:50263693delT	ENST00000561678.1	+	0	2295				PAPD5_ENST00000573002.1_3'UTR|PAPD5_ENST00000357464.3_3'UTR|PAPD5_ENST00000436909.3_3'UTR			Q8NDF8	PAPD5_HUMAN	PAP associated domain containing 5						histone mRNA catabolic process (GO:0071044)|mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)			endometrium(1)|kidney(1)|lung(2)	4		all_cancers(37;0.0452)		BRCA - Breast invasive adenocarcinoma(181;0.0843)|GBM - Glioblastoma multiforme(240;0.231)		TCTGTGCATGTTTTTTTTTTA	0.308																																																	0								ENSG00000121274																																			PAPD5	SO:0001624	3_prime_UTR_variant	0				HGNC	AF089897	CCDS54006.1	16q12.1	2010-11-18				ENSG00000121274			30758	protein-coding gene	gene with protein product	"""TUTase3"""	605540				10066793	Standard	NM_001040284		Approved	TRF4-2	uc010vgo.2	Q8NDF8		ENST00000561678.1:c.*454T>-	16.37:g.50263693delT		Somatic	0	34	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	B4DV38|Q9NW67|Q9Y6C0	RNA	DEL	25	3.85	1	44	0.00	0	-	NULL	ENST00000561678.1	37	NULL		16																																																																																			-	-		0.308	PAPD5-002	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	PAPD5	protein_coding	OTTHUMT00000423150.1	T	NM_022447			50263693	+1	no_errors	ENST00000573002	ensembl	human	known	74_37	rna	DEL	0.737	-
SMARCC2	6601	genome.wustl.edu	37	12	56557112	56557112	+	IGR	DEL	T	T	-	rs200590204	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:56557112delT	ENST00000267064.4	-	0	4076				RP11-977G19.5_ENST00000553176.1_RNA|MYL6_ENST00000551954.1_3'UTR|SMARCC2_ENST00000550164.1_3'UTR|SMARCC2_ENST00000394023.3_3'UTR	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2						ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TAAAATCTACTTTTTTTTTTT	0.348													|||unknown(HR)	1253	0.2502	0.1672	0.2233	5008	,	,		13772	0.1716		0.2903	False		,,,				2504	0.4213																0								ENSG00000092841																																			MYL6	SO:0001628	intergenic_variant	0				HGNC	U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288		12.37:g.56557112delT		Somatic	0	13	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	RNA	DEL	26	23.53	8	47	40.51	32	-	NULL	ENST00000267064.4	37	NULL	CCDS8907.1	12																																																																																			-	-		0.348	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYL6	protein_coding	OTTHUMT00000408370.1	T				56557112	+1	no_errors	ENST00000551954	ensembl	human	known	74_37	rna	DEL	0.826	-
CUX1	1523	genome.wustl.edu	37	7	101801856	101801856	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr7:101801856A>T	ENST00000292535.7	+	9	729	c.691A>T	c.(691-693)Atg>Ttg	p.M231L	CUX1_ENST00000550008.2_Missense_Mutation_p.M231L|CUX1_ENST00000425244.2_Missense_Mutation_p.M196L|CUX1_ENST00000556210.1_Missense_Mutation_p.M231L|CUX1_ENST00000546411.2_Missense_Mutation_p.M231L|CUX1_ENST00000547394.2_Missense_Mutation_p.M226L|CUX1_ENST00000292538.4_Missense_Mutation_p.M242L|CUX1_ENST00000560541.1_3'UTR|CUX1_ENST00000393824.3_Missense_Mutation_p.M205L|CUX1_ENST00000437600.4_Missense_Mutation_p.M242L|CUX1_ENST00000360264.3_Missense_Mutation_p.M242L|CUX1_ENST00000549414.2_Missense_Mutation_p.M231L	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	231					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CGAGATTGAAATGATCATGAC	0.552																																																	0								ENSG00000257923						92.0	83.0	86.0					7																	101801856		2203	4300	6503	CUX1	SO:0001583	missense	0			-	HGNC	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.691A>T	7.37:g.101801856A>T	ENSP00000292535:p.Met231Leu	Somatic	0	57	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	24	50.00	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	26	0.00	0	43	31.75	20	pfam_Hmoeo_CUT,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_LemA-like_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Hmoeo_CUT	p.M242L	ENST00000292535.7	37	c.724	CCDS5721.1	7	.	.	.	.	.	.	.	.	.	.	A	10.64	1.406481	0.25378	.	.	ENSG00000257923	ENST00000292538;ENST00000547394;ENST00000360264;ENST00000425244;ENST00000437600;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T;T;T;T;T	0.76316	1.22;1.22;1.22;2.44;1.06;1.22;-1.01;1.22;1.22;1.22	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.66076	0.2753	N	0.13235	0.315	0.43250	D	0.995177	P;B;B;B;B;B;B	0.40660	0.726;0.167;0.296;0.052;0.095;0.156;0.257	B;B;B;B;B;B;P	0.47786	0.191;0.354;0.046;0.058;0.015;0.041;0.557	T	0.64546	-0.6382	10	0.05620	T	0.96	-40.0631	12.6554	0.56784	1.0:0.0:0.0:0.0	.	205;231;196;226;242;242;242	B4DZZ2;P39880;B3KV79;G3V1Z6;Q13948-2;Q13948;P39880-3	.;CUX1_HUMAN;.;.;.;CASP_HUMAN;.	L	242;226;242;196;242;231;231;231;231;231	ENSP00000292538:M242L;ENSP00000449371:M226L;ENSP00000353401:M242L;ENSP00000409745:M196L;ENSP00000414091:M242L;ENSP00000292535:M231L;ENSP00000446630:M231L;ENSP00000447373:M231L;ENSP00000450125:M231L;ENSP00000451558:M231L	ENSP00000292535:M231L	M	+	1	0	CUX1	101588576	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.940000	0.70187	2.010000	0.58986	0.460000	0.39030	ATG	-	NULL		0.552	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	protein_coding	OTTHUMT00000347535.1	A	NM_001913	-		101801856	+1	no_errors	ENST00000360264	ensembl	human	known	74_37	missense	SNP	1.000	T
AL589743.1	0	genome.wustl.edu	37	14	19686757	19686757	+	lincRNA	SNP	A	A	G	rs61968598		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr14:19686757A>G	ENST00000418499.3	+	0	3868																											TGGCAGGCACACGGGGCCTCT	0.662																																																	0								ENSG00000225210																																			AL589743.1			0			-	Clone_based_vega_gene																													14.37:g.19686757A>G		Somatic	0	18	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	8	46.67		RNA	SNP	13	27.78	5	36	38.98	23	-	NULL	ENST00000418499.3	37	NULL		14																																																																																			-	-		0.662	AL589743.1-003	KNOWN	basic	lincRNA	LOC440157	lincRNA	OTTHUMT00000317887.3	A		-		19686757	+1	no_errors	ENST00000418499	ensembl	human	known	74_37	rna	SNP	0.130	G
ANGPTL3	27329	genome.wustl.edu	37	1	63070097	63070097	+	Intron	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:63070097C>T	ENST00000371129.3	+	6	1278				DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000404627.2_Intron|ANGPTL3_ENST00000493994.1_3'UTR	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3						acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						CTCTAATCTTCCTCAGATTTT	0.294																																																	0								ENSG00000132855																																			ANGPTL3	SO:0001627	intron_variant	0			-	HGNC	AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1198+191C>T	1.37:g.63070097C>T		Somatic	0	14	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	A0JLS0|B1ALJ0|B2RCW1	RNA	SNP	39	0.00	0	3	90.00	27	-	NULL	ENST00000371129.3	37	NULL	CCDS622.1	1																																																																																			-	-		0.294	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL3	protein_coding	OTTHUMT00000025344.1	C	NM_014495	-		63070097	+1	no_errors	ENST00000493994	ensembl	human	putative	74_37	rna	SNP	0.000	T
LOR	4014	genome.wustl.edu	37	1	153233991	153233992	+	In_Frame_Ins	INS	-	-	CTCTGGCGGCGG	rs11272549|rs547333583|rs561634896	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:153233991_153233992insCTCTGGCGGCGG	ENST00000368742.3	+	2	623_624	c.566_567insCTCTGGCGGCGG	c.(565-570)tactct>taCTCTGGCGGCGGctct	p.194_195insGGGS		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	194					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtctgcggctactctggcggcg	0.743														3247	0.648363	0.6664	0.7954	5008	,	,		5032	0.4563		0.7147	False		,,,				2504	0.6493																0								ENSG00000203782			178,190		86,6,92						-7.1	0.0		dbSNP_120	1	749,435		350,49,193	no	coding	LOR	NM_000427.2		436,55,285	A1A1,A1R,RR		36.7399,48.3696,40.2706				927,625				LOR	SO:0001652	inframe_insertion	0				HGNC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.567_578dupCTCTGGCGGCGG	1.37:g.153233991_153233992insCTCTGGCGGCGG	ENSP00000357731:p.Gly191_Ser194dup	Somatic	NA	NA	NA		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T869|Q5XKF8	In_Frame_Ins	INS	6	45.45	5	25	13.79	4	NULL	p.193in_frame_insGSGG	ENST00000368742.3	37	c.566_567	CCDS30870.1	1																																																																																			-	NULL		0.743	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOR	protein_coding	OTTHUMT00000039107.1	-	NM_000427			153233992	+1	no_errors	ENST00000368742	ensembl	human	known	74_37	in_frame_ins	INS	0.014:0.200	CTCTGGCGGCGG
ASTN1	460	genome.wustl.edu	37	1	177001821	177001821	+	Silent	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:177001821G>A	ENST00000367654.3	-	3	847	c.636C>T	c.(634-636)caC>caT	p.H212H	ASTN1_ENST00000424564.2_Silent_p.H212H|ASTN1_ENST00000367657.3_Silent_p.H212H|ASTN1_ENST00000361833.2_Silent_p.H212H|ASTN1_ENST00000281881.3_5'UTR	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	212					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						TCTCCCGTCCGTGCCCGCCGA	0.627																																																	0								ENSG00000152092						64.0	53.0	57.0					1																	177001821		2203	4300	6503	ASTN1	SO:0001819	synonymous_variant	0			-	HGNC	AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.636C>T	1.37:g.177001821G>A		Somatic	0	52	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	45	32.84	A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	18	0.00	0	49	35.53	27	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.H212	ENST00000367654.3	37	c.636		1																																																																																			-	NULL		0.627	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	protein_coding		G	NM_004319	-		177001821	-1	no_errors	ENST00000367654	ensembl	human	known	74_37	silent	SNP	0.099	A
NUMBL	9253	genome.wustl.edu	37	19	41173893	41173898	+	In_Frame_Del	DEL	TGCTGT	TGCTGT	-	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TGCTGT	TGCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr19:41173893_41173898delTGCTGT	ENST00000252891.4	-	10	1472_1477	c.1305_1310delACAGCA	c.(1303-1311)caacagcag>cag	p.435_437QQQ>Q	NUMBL_ENST00000540131.1_In_Frame_Del_p.394_396QQQ>Q|NUMBL_ENST00000598779.1_In_Frame_Del_p.394_396QQQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ctgctgctgctgctgttgctgttgct	0.66														2856	0.570288	0.7821	0.428	5008	,	,		15157	0.4653		0.5149	False		,,,				2504	0.5501																0								ENSG00000105245																																			NUMBL	SO:0001651	inframe_deletion	0				HGNC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305_1310delACAGCA	19.37:g.41173899_41173904delTGCTGT	ENSP00000252891:p.Gln445_Gln446del	Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q7Z4J9	In_Frame_Del	DEL	19	17.39	4	19	24.00	6	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.QQ439in_frame_del	ENST00000252891.4	37	c.1310_1305	CCDS12561.1	19																																																																																			-	pirsf_Numb/numb-like		0.660	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	protein_coding	OTTHUMT00000462749.2	TGCTGT	NM_004756			41173898	-1	no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:0.998	-
HSPBP1	23640	genome.wustl.edu	37	19	55790886	55790887	+	In_Frame_Ins	INS	-	-	GCCGCCGCC	rs199849782|rs10701478|rs3040014		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr19:55790886_55790887insGCCGCCGCC	ENST00000255631.5	-	3	400_401	c.90_91insGGCGGCGGC	c.(88-93)ggctcc>ggcGGCGGCGGCtcc	p.29_30insGGG	BRSK1_ENST00000590333.1_5'Flank|HSPBP1_ENST00000587922.1_In_Frame_Ins_p.29_30insGGG|HSPBP1_ENST00000433386.2_In_Frame_Ins_p.29_30insGGG|HSPBP1_ENST00000376343.3_In_Frame_Ins_p.29_30insGGG	NM_001130106.1|NM_012267.4	NP_001123578.1|NP_036399.3	Q9NZL4	HPBP1_HUMAN	HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1	29	Gly-rich.				negative regulation of catalytic activity (GO:0043086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)		enzyme inhibitor activity (GO:0004857)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	8			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCAGCCGAGGAGCCGCCGCCGC	0.713																																																	0								ENSG00000133265																																			HSPBP1	SO:0001652	inframe_insertion	0				HGNC		CCDS33111.1	19q13.42	2008-12-16			ENSG00000133265	ENSG00000133265			24989	protein-coding gene	gene with protein product	"""hsp70 interacting protein"", ""Hsp70 binding protein 1"""	612939				10786638, 9830037	Standard	NM_001130106		Approved	HspBP1, FES1	uc002qkd.3	Q9NZL4		ENST00000255631.5:c.82_90dupGGCGGCGGC	19.37:g.55790887_55790895dupGCCGCCGCC	ENSP00000255631:p.Gly27_Gly29dup	Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KQP0|B4DG11|O95351|Q6ZNU5	In_Frame_Ins	INS	23	17.86	5	19	38.71	12	superfamily_ARM-type_fold	p.30in_frame_insGGG	ENST00000255631.5	37	c.91_90	CCDS33111.1	19																																																																																			-	NULL		0.713	HSPBP1-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	HSPBP1	protein_coding	OTTHUMT00000452670.1	-	NM_012267			55790887	-1	no_errors	ENST00000255631	ensembl	human	known	74_37	in_frame_ins	INS	0.883:0.989	GCCGCCGCC
HNF1B	6928	genome.wustl.edu	37	17	36091772	36091772	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr17:36091772C>G	ENST00000225893.4	-	4	1220	c.859G>C	c.(859-861)Ggc>Cgc	p.G287R	HNF1B_ENST00000561193.1_Missense_Mutation_p.G261R|HNF1B_ENST00000427275.2_Missense_Mutation_p.G261R|HNF1B_ENST00000560016.1_Missense_Mutation_p.G287R	NM_000458.2|NM_001165923.1	NP_000449.1|NP_001159395.1	P35680	HNF1B_HUMAN	HNF1 homeobox B	287					anterior/posterior pattern specification (GO:0009952)|branching morphogenesis of an epithelial tube (GO:0048754)|embryonic digestive tract morphogenesis (GO:0048557)|endocrine pancreas development (GO:0031018)|endodermal cell fate specification (GO:0001714)|epithelial cell proliferation (GO:0050673)|genitalia development (GO:0048806)|hepatoblast differentiation (GO:0061017)|hindbrain development (GO:0030902)|inner cell mass cell differentiation (GO:0001826)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|mesonephric duct formation (GO:0072181)|negative regulation of mesenchymal cell apoptotic process involved in mesonephric nephron morphogenesis (GO:0061296)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric nephron tubule development (GO:0039020)|pronephros development (GO:0048793)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of endodermal cell fate specification (GO:0042663)|regulation of pronephros size (GO:0035565)|regulation of Wnt signaling pathway (GO:0030111)|response to glucose (GO:0009749)|ureteric bud elongation (GO:0060677)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(6)|kidney(3)|large_intestine(2)|liver(1)|lung(3)|ovary(3)|prostate(1)|skin(2)	28		Breast(25;0.00765)|Ovarian(249;0.15)	STAD - Stomach adenocarcinoma(1;0.0142)			AAGTTGGAGCCCAGGCCGTGG	0.612																																					Colon(71;102 1179 9001 27917 43397)												0								ENSG00000108753						109.0	99.0	102.0					17																	36091772		2203	4300	6503	HNF1B	SO:0001583	missense	0			-	HGNC	BC017714	CCDS11324.1, CCDS58538.1	17q12	2014-05-06	2007-08-24	2007-08-24	ENSG00000108753	ENSG00000275410		"""Homeoboxes / HNF class"""	11630	protein-coding gene	gene with protein product		189907	"""transcription factor 2, hepatic; LF-B3; variant hepatic nuclear factor"""	TCF2		1677179, 10484768	Standard	NM_000458		Approved	LFB3, VHNF1, HNF1beta, MODY5	uc002hok.4	P35680	OTTHUMG00000188478	ENST00000225893.4:c.859G>C	17.37:g.36091772C>G	ENSP00000225893:p.Gly287Arg	Somatic	0	34	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	15	57.14	B4DKM3|E0YMJ9	Missense_Mutation	SNP	28	0.00	0	24	53.85	28	pfam_HNF1b_C,pfam_HNF-1_N,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G287R	ENST00000225893.4	37	c.859	CCDS11324.1	17	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609582	0.87258	.	.	ENSG00000108753	ENST00000225893;ENST00000427275;ENST00000544593;ENST00000539087	D;D	0.95690	-3.78;-3.78	5.56	4.59	0.56863	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.090718	0.85682	D	0.000000	D	0.97247	0.9100	M	0.73598	2.24	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	D	0.97750	1.0214	10	0.72032	D	0.01	-23.5242	13.6975	0.62589	0.0:0.9266:0.0:0.0734	.	261;287;287	E0YMJ6;P35680-3;P35680	.;.;HNF1B_HUMAN	R	287;261;287;175	ENSP00000225893:G287R;ENSP00000412212:G261R	ENSP00000225893:G287R	G	-	1	0	HNF1B	33165885	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.320000	0.79064	1.591000	0.50007	0.655000	0.94253	GGC	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.612	HNF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1B	protein_coding	OTTHUMT00000256807.3	C	NM_000458	-		36091772	-1	no_errors	ENST00000225893	ensembl	human	known	74_37	missense	SNP	1.000	G
AC140481.2	0	genome.wustl.edu	37	2	131334335	131334335	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr2:131334335C>T	ENST00000409982.1	+	3	460	c.289C>T	c.(289-291)Ccc>Tcc	p.P97S	AC140481.2_ENST00000409793.1_Intron																							GCCCCAGTACCCCGGCCAGCC	0.587																																																	0								ENSG00000183292																																			AC140481.2	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000409982.1:c.289C>T	2.37:g.131334335C>T	ENSP00000387081:p.Pro97Ser	Somatic	0	10	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50		Missense_Mutation	SNP	6	40.00	4	19	32.14	9	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	p.P97S	ENST00000409982.1	37	c.289		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	6.864|6.864	0.528730|0.528730	0.13127|0.13127	.|.	.|.	ENSG00000183292|ENSG00000183292	ENST00000440359|ENST00000409982	.|D	.|0.88201	.|-2.35	2.26|2.26	-3.24|-3.24	0.05094|0.05094	.|.	.|.	.|.	.|.	.|.	T|T	0.69780|0.69780	0.3149|0.3149	.|.	.|.	.|.	.|.	.|.	.|.	.|B;B	.|0.32467	.|0.372;0.372	.|B;B	.|0.22880	.|0.042;0.042	T|T	0.62115|0.62115	-0.6922|-0.6922	3|7	.|0.12103	.|T	.|0.63	.|.	2.4035|2.4035	0.04407|0.04407	0.4038:0.3119:0.0:0.2843|0.4038:0.3119:0.0:0.2843	.|.	.|97;97	.|B9A030;B9A039	.|.;.	L|S	104|97	.|ENSP00000387081:P97S	.|ENSP00000387081:P97S	P|P	+|+	2|1	0|0	AC140481.2|AC140481.2	131050805|131050805	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.012000|0.012000	0.07955|0.07955	-1.479000|-1.479000	0.02327|0.02327	-1.173000|-1.173000	0.02758|0.02758	-0.450000|-0.450000	0.05554|0.05554	CCC|CCC	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.587	AC140481.2-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ENSG00000183292	protein_coding	OTTHUMT00000333364.2	C		-		131334335	+1	no_errors	ENST00000409982	ensembl	human	putative	74_37	missense	SNP	0.000	T
ADAM28	10863	genome.wustl.edu	37	8	24168921	24168921	+	Silent	SNP	C	C	T	rs144018592		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr8:24168921C>T	ENST00000265769.4	+	5	464	c.354C>T	c.(352-354)gaC>gaT	p.D118D	ADAM28_ENST00000540823.1_5'UTR|RP11-624C23.1_ENST00000523700.1_RNA|ADAM28_ENST00000437154.2_Silent_p.D118D|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000518988.1_RNA|ADAM28_ENST00000397649.3_5'UTR|RP11-624C23.1_ENST00000519689.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	118					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		AGGTTTCTGACGCTAGCATCA	0.373																																					NSCLC(193;488 2149 22258 34798 40734)												0								ENSG00000042980	C	,	1,4405	2.1+/-5.4	0,1,2202	123.0	121.0	122.0		354,354	-4.2	0.7	8	dbSNP_134	122	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ADAM28	NM_014265.4,NM_021777.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	118/776,118/541	24168921	1,13005	2203	4300	6503	ADAM28	SO:0001819	synonymous_variant	0			-	HGNC	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.354C>T	8.37:g.24168921C>T		Somatic	0	64	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	61	26.51	B2RMV5|Q9Y339|Q9Y3S0	Silent	SNP	35	0.00	0	55	24.66	18	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D118	ENST00000265769.4	37	c.354	CCDS34865.1	8																																																																																			-	pfam_Peptidase_M12B_N		0.373	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	protein_coding	OTTHUMT00000375441.2	C	NM_021778	rs144018592		24168921	+1	no_errors	ENST00000265769	ensembl	human	known	74_37	silent	SNP	0.730	T
AC093627.10	0	genome.wustl.edu	37	7	149458	149459	+	lincRNA	INS	-	-	CTCCT	rs5881879|rs111966368|rs66504224|rs200280223		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr7:149458_149459insCTCCT	ENST00000484550.1	+	0	0				AC093627.9_ENST00000462565.1_lincRNA																							ggagtcgctcgctcctctctgc	0.688																																																	0								ENSG00000242474																																			AC093627.9			0				Clone_based_vega_gene																													7.37:g.149459_149463dupCTCCT		Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	8	65.22	15	16	70.37	38	-	NULL	ENST00000484550.1	37	NULL		7																																																																																			-	-		0.688	AC093627.10-001	KNOWN	basic	lincRNA	ENSG00000242474	lincRNA	OTTHUMT00000322469.1	-				149459	-1	no_errors	ENST00000497320	ensembl	human	known	74_37	rna	INS	0.002:0.001	CTCCT
FAM151A	338094	genome.wustl.edu	37	1	55081801	55081801	+	Missense_Mutation	SNP	C	C	T	rs202087836		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:55081801C>T	ENST00000302250.2	-	3	467	c.307G>A	c.(307-309)Ggc>Agc	p.G103S	ACOT11_ENST00000371316.3_Intron|FAM151A_ENST00000371304.2_Missense_Mutation_p.G103S	NM_176782.2	NP_788954.2	Q8WW52	F151A_HUMAN	family with sequence similarity 151, member A	103						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	12						TTGGCTGTGCCGAGCCCTTCT	0.512													C|||	1	0.000199681	0.0	0.0	5008	,	,		16678	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000162391						119.0	95.0	103.0					1																	55081801		2203	4300	6503	FAM151A	SO:0001583	missense	0			GMAF=0.0005	HGNC	AK091901	CCDS594.1	1p32.3	2008-02-05	2007-12-18	2007-12-18	ENSG00000162391	ENSG00000162391			25032	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 179"""	C1orf179		17273976	Standard	NM_176782		Approved	MGC27169	uc001cxn.3	Q8WW52	OTTHUMG00000009888	ENST00000302250.2:c.307G>A	1.37:g.55081801C>T	ENSP00000306888:p.Gly103Ser	Somatic	0	41	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q5VUG5|Q6DKH5|Q6UWV0|Q8NAX9|Q96KY5	Missense_Mutation	SNP	28	0.00	0	34	0.00	0	pfam_DUF2181	p.G103S	ENST00000302250.2	37	c.307	CCDS594.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	12.69	2.014706	0.35511	.	.	ENSG00000162391	ENST00000302250;ENST00000371304;ENST00000294370	T;T	0.10763	2.84;2.84	3.95	-5.22	0.02806	.	1.796490	0.02156	N	0.058403	T	0.12305	0.0299	M	0.65975	2.015	0.09310	N	1	B	0.33477	0.413	B	0.28011	0.085	T	0.30909	-0.9962	10	0.51188	T	0.08	-1.3516	8.0804	0.30741	0.1147:0.1749:0.0:0.7104	.	103	Q8WW52	F151A_HUMAN	S	103	ENSP00000306888:G103S;ENSP00000360353:G103S	ENSP00000294370:G103S	G	-	1	0	FAM151A	54854389	0.199000	0.23386	0.003000	0.11579	0.922000	0.55478	0.106000	0.15354	-1.184000	0.02720	0.455000	0.32223	GGC	-	pfam_DUF2181		0.512	FAM151A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM151A	protein_coding	OTTHUMT00000027342.1	C	NM_176782	rs202087836		55081801	-1	no_errors	ENST00000302250	ensembl	human	known	74_37	missense	SNP	0.000	T
DZANK1	55184	genome.wustl.edu	37	20	18446050	18446051	+	Intron	INS	-	-	TGTGCACTTATAGC	rs111987137|rs142300310|rs201675160|rs71194240	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr20:18446050_18446051insTGTGCACTTATAGC	ENST00000262547.5	-	2	190				DZANK1_ENST00000357236.4_Intron|DZANK1_ENST00000329494.5_Intron|POLR3F_ENST00000377603.4_5'Flank|DZANK1_ENST00000358866.6_5'Flank	NM_001099407.1	NP_001092877.1	Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1								zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						ATAAATTCCAATGTACACAAAA	0.356														2671	0.533347	0.5166	0.5331	5008	,	,		15558	0.5645		0.5447	False		,,,				2504	0.5123																0								ENSG00000089091			3110,3,55		1534,1,41,1,0,7						1.2	0.0		dbSNP_134	8	7025,57,98		3455,27,88,15,0,5	no	intron	DZANK1	NM_001099407.1		4989,28,129,16,0,12	A1A1,A1A2,A1R,A2A2,A2R,RR		2.1588,1.8308,2.0584				10135,60,153				DZANK1	SO:0001627	intron_variant	0				HGNC	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000262547.5:c.19-29->GCTATAAGTGCACA	20.37:g.18446050_18446051insTGTGCACTTATAGC		Somatic	NA	NA	NA		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	RNA	INS	14	41.67	10	21	55.32	26	-	NULL	ENST00000262547.5	37	NULL	CCDS46582.1	20																																																																																			-	-		0.356	DZANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DZANK1	protein_coding		-	NM_001099407			18446051	-1	no_errors	ENST00000460891	ensembl	human	known	74_37	rna	INS	0.050:0.000	TGTGCACTTATAGC
FOXA2	3170	genome.wustl.edu	37	20	22562842	22562842	+	Silent	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr20:22562842C>G	ENST00000377115.4	-	3	1201	c.1020G>C	c.(1018-1020)ggG>ggC	p.G340G	FOXA2_ENST00000419308.2_Silent_p.G346G	NM_153675.2	NP_710141.1	Q9Y261	FOXA2_HUMAN	forkhead box A2	340					adult locomotory behavior (GO:0008344)|cell development (GO:0048468)|cell differentiation in hindbrain (GO:0021533)|cell fate specification (GO:0001708)|chromatin modification (GO:0016568)|connective tissue development (GO:0061448)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral neural tube patterning (GO:0021904)|ectoderm formation (GO:0001705)|endocrine pancreas development (GO:0031018)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|in utero embryonic development (GO:0001701)|lung epithelial cell differentiation (GO:0060487)|negative regulation of detection of glucose (GO:2000971)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of glucokinase activity (GO:0033132)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter by glucose (GO:0000433)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by glucose (GO:0000432)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|regulation of blood coagulation (GO:0030193)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in detection of glucose (GO:2000976)|response to interleukin-6 (GO:0070741)|signal transduction involved in regulation of gene expression (GO:0023019)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(2)|urinary_tract(1)	22	Lung NSC(19;0.188)					GCTGCTGCTGCCCGGGAGAGG	0.761																																																	0								ENSG00000125798						12.0	10.0	11.0					20																	22562842		1968	3749	5717	FOXA2	SO:0001819	synonymous_variant	0			-	HGNC	AF147787	CCDS13147.1, CCDS46585.1	20p11	2008-04-10		2002-09-20	ENSG00000125798	ENSG00000125798		"""Forkhead boxes"""	5022	protein-coding gene	gene with protein product		600288	"""hepatocyte nuclear factor 3, beta"""	HNF3B		9119385, 11875061	Standard	NM_153675		Approved		uc002wsm.3	Q9Y261	OTTHUMG00000032041	ENST00000377115.4:c.1020G>C	20.37:g.22562842C>G		Somatic	0	8	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	Q8WUW4|Q96DF7	Silent	SNP	28	0.00	0	21	42.11	16	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G346	ENST00000377115.4	37	c.1038	CCDS13147.1	20																																																																																			-	NULL		0.761	FOXA2-001	KNOWN	basic|CCDS	protein_coding	FOXA2	protein_coding	OTTHUMT00000078289.1	C		-		22562842	-1	no_errors	ENST00000419308	ensembl	human	known	74_37	silent	SNP	0.997	G
RP11-423O2.5	0	genome.wustl.edu	37	1	142803302	142803302	+	lincRNA	DEL	C	C	-	rs79529551	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:142803302delC	ENST00000423385.1	-	0	1663																											acaacaacaacaaACAGGATG	0.388																																																	0								ENSG00000234978																																			RP11-423O2.5			0				Clone_based_vega_gene																													1.37:g.142803302delC		Somatic	1	114	0.87		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	89	8.25		RNA	DEL	187	3.11	6	279	4.12	12	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			-	-		0.388	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	lincRNA	OTTHUMT00000193203.1	C				142803302	-1	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	DEL	0.003	-
MED12	9968	genome.wustl.edu	37	X	70361169	70361170	+	In_Frame_Ins	INS	-	-	CAC			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chrX:70361169_70361170insCAC	ENST00000374080.3	+	43	6389_6390	c.6357_6358insCAC	c.(6358-6360)cag>CACcag	p.2119_2120insH	MED12_ENST00000374102.1_In_Frame_Ins_p.2118_2119insH|AL590764.1_ENST00000579622.1_RNA|MED12_ENST00000333646.6_In_Frame_Ins_p.2122_2123insH			Q93074	MED12_HUMAN	mediator complex subunit 12	2119	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					accagcagcaacagcagcaaca	0.614			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0								ENSG00000184634			38,3266		2,32,2,1429,376						2.4	1.0			32	125,5433		3,78,41,2000,1355	no	coding	MED12	NM_005120.2		5,110,43,3429,1731	A1A1,A1R,A1,RR,R		2.249,1.1501,1.8393				163,8699				MED12	SO:0001652	inframe_insertion	0				HGNC	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	Exception_encountered	X.37:g.70361169_70361170insCAC	ENSP00000363193:p.Gln2119_Gln2120insHis	Somatic	0	59	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	O15410|O75557|Q9UHV6|Q9UND7	In_Frame_Ins	INS	13	0.00	0	30	9.09	3	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.2122in_frame_insH	ENST00000374080.3	37	c.6366_6367	CCDS43970.1	X																																																																																			-	NULL		0.614	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	protein_coding	OTTHUMT00000057105.1	-	NM_005120			70361170	+1	no_errors	ENST00000333646	ensembl	human	known	74_37	in_frame_ins	INS	1.000:1.000	CAC
TSPAN6	7105	genome.wustl.edu	37	X	99890554	99890554	+	Splice_Site	SNP	C	C	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chrX:99890554C>A	ENST00000373020.4	-	2	388		c.e2+1		TSPAN6_ENST00000496771.1_Splice_Site	NM_001278740.1|NM_001278741.1|NM_003270.2	NP_001265669.1|NP_001265670.1|NP_003261.1	O43657	TSN6_HUMAN	tetraspanin 6						negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of viral-induced cytoplasmic pattern recognition receptor signaling pathway (GO:0039532)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|ovary(1)	12						CAAGGACTCACCAGTTTTAGC	0.403																																																	0								ENSG00000000003						34.0	30.0	31.0					X																	99890554		2203	4300	6503	TSPAN6	SO:0001630	splice_region_variant	0			-	HGNC	AF043906	CCDS14470.1, CCDS76001.1	Xq22	2013-02-14	2005-03-21	2005-03-21	ENSG00000000003	ENSG00000000003		"""Tetraspanins"""	11858	protein-coding gene	gene with protein product		300191	"""transmembrane 4 superfamily member 6"""	TM4SF6		9782095	Standard	NM_003270		Approved	T245, TSPAN-6	uc004ega.1	O43657	OTTHUMG00000022002	ENST00000373020.4:c.276+1G>T	X.37:g.99890554C>A		Somatic	0	41	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	Q54A42|Q6IAN9	Splice_Site	SNP	27	0.00	0	33	8.33	3	-	e2+1	ENST00000373020.4	37	c.276+1	CCDS14470.1	X	.	.	.	.	.	.	.	.	.	.	C	21.4	4.142104	0.77775	.	.	ENSG00000000003	ENST00000373020;ENST00000431386	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8251	0.85929	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TSPAN6	99777210	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.487000	0.81328	2.234000	0.73211	0.523000	0.50628	.	-	-		0.403	TSPAN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN6	protein_coding	OTTHUMT00000057483.1	C		-	Intron	99890554	-1	no_errors	ENST00000373020	ensembl	human	known	74_37	splice_site	SNP	1.000	A
SLC8A2	6543	genome.wustl.edu	37	19	47969326	47969326	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr19:47969326G>T	ENST00000236877.6	-	2	730	c.335C>A	c.(334-336)gCc>gAc	p.A112D	SLC8A2_ENST00000542837.1_Intron|SLC8A2_ENST00000539381.1_Intron	NM_015063.2	NP_055878.1	Q9UPR5	NAC2_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 2	112					blood coagulation (GO:0007596)|cell communication (GO:0007154)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(5)|stomach(1)	31		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		CTCACCGTTGGCCTTGGTGAT	0.577																																																	0								ENSG00000118160						137.0	85.0	103.0					19																	47969326		2203	4300	6503	SLC8A2	SO:0001583	missense	0			-	HGNC	AB029010	CCDS33065.1	19q13.32	2013-07-15	2008-09-02		ENSG00000118160	ENSG00000118160		"""Solute carriers"""	11069	protein-coding gene	gene with protein product		601901				8021246	Standard	NM_015063		Approved	NCX2, KIAA1087	uc002pgx.3	Q9UPR5	OTTHUMG00000183529	ENST00000236877.6:c.335C>A	19.37:g.47969326G>T	ENSP00000236877:p.Ala112Asp	Somatic	0	54	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	B4DYQ9	Missense_Mutation	SNP	28	0.00	0	37	2.63	1	pfam_Calx_beta,pfam_NaCa_Exmemb,smart_Calx_beta,prints_Na_Ca_Ex,tigrfam_Na_Ca_Ex	p.A112D	ENST00000236877.6	37	c.335	CCDS33065.1	19	.	.	.	.	.	.	.	.	.	.	G	19.42	3.824746	0.71143	.	.	ENSG00000118160	ENST00000236877	T	0.32753	1.44	4.25	3.15	0.36227	Sodium/calcium exchanger membrane region (1);	0.203981	0.41396	D	0.000887	T	0.26011	0.0634	N	0.10874	0.06	0.80722	D	1	P	0.51537	0.946	P	0.51550	0.673	T	0.27020	-1.0086	10	0.87932	D	0	.	14.1259	0.65219	0.0:0.1656:0.8344:0.0	.	112	Q9UPR5	NAC2_HUMAN	D	112	ENSP00000236877:A112D	ENSP00000236877:A112D	A	-	2	0	SLC8A2	52661138	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.417000	0.66423	2.210000	0.71456	0.462000	0.41574	GCC	-	pfam_NaCa_Exmemb,tigrfam_Na_Ca_Ex		0.577	SLC8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A2	protein_coding	OTTHUMT00000466997.1	G		-		47969326	-1	no_errors	ENST00000236877	ensembl	human	known	74_37	missense	SNP	1.000	T
GPR125	166647	genome.wustl.edu	37	4	22404357	22404357	+	Silent	SNP	G	G	T	rs61736467	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr4:22404357G>T	ENST00000334304.5	-	15	2567	c.2298C>A	c.(2296-2298)acC>acA	p.T766T	GPR125_ENST00000282943.5_5'UTR	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	766					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				GAATGATAGCGGTAGTATAAA	0.443																																																	0								ENSG00000152990						112.0	113.0	113.0					4																	22404357		2203	4300	6503	GPR125	SO:0001819	synonymous_variant	0			-	HGNC	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.2298C>A	4.37:g.22404357G>T		Somatic	0	51	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	41	0.00	0	65	0.00	0	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_GPCR_2_extracellular_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,pfscan_Ig-like_dom	p.T766	ENST00000334304.5	37	c.2298	CCDS33964.1	4																																																																																			-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.443	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR125	protein_coding	OTTHUMT00000362960.3	G		-		22404357	-1	no_errors	ENST00000334304	ensembl	human	known	74_37	silent	SNP	0.819	T
WDFY4	57705	genome.wustl.edu	37	10	49951225	49951225	+	Silent	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951225C>T	ENST00000325239.5	+	11	2118	c.2091C>T	c.(2089-2091)gtC>gtT	p.V697V	WDFY4_ENST00000413659.2_Silent_p.V697V	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	697						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GGGACCCTGTCAATGGCTACT	0.607																																																	0								ENSG00000128815						37.0	34.0	35.0					10																	49951225		692	1591	2283	WDFY4	SO:0001819	synonymous_variant	0			-	HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2091C>T	10.37:g.49951225C>T		Somatic	0	53	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	87	14.71	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	30	0.00	0	77	22.22	22	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V697	ENST00000325239.5	37	c.2091	CCDS44385.1	10																																																																																			-	superfamily_ARM-type_fold		0.607	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		C	XM_033379	-		49951225	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	silent	SNP	1.000	T
RP11-764K9.1	0	genome.wustl.edu	37	9	68400511	68400511	+	lincRNA	SNP	G	G	A	rs78515312	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr9:68400511G>A	ENST00000417843.2	-	0	1308																											atagaggaacgccacactttg	0.473																																																	0								ENSG00000225411																																			RP11-764K9.1			0			-	Clone_based_vega_gene																													9.37:g.68400511G>A		Somatic	0	12	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	7	46.15		RNA	SNP	239	15.55	44	357	20.27	91	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			-	-		0.473	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	lincRNA	OTTHUMT00000129817.2	G		rs78515312		68400511	-1	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	SNP	0.062	A
NDUFA4	4697	genome.wustl.edu	37	7	10978463	10978463	+	Missense_Mutation	SNP	G	G	T	rs373923920		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr7:10978463G>T	ENST00000339600.5	-	2	301	c.103C>A	c.(103-105)Cgt>Agt	p.R35S	NDUFA4_ENST00000492822.1_5'Flank|RP5-855F16.1_ENST00000604183.1_lincRNA	NM_002489.3	NP_002480.1	O00483	NDUA4_HUMAN	NDUFA4, mitochondrial complex associated	35					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrial respiratory chain complex IV (GO:0005751)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|protein complex binding (GO:0032403)			large_intestine(2)|lung(1)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.177)		AATGCCAGACGCAAGAGATAC	0.388																																																	0								ENSG00000189043						88.0	91.0	90.0					7																	10978463		2203	4300	6503	NDUFA4	SO:0001583	missense	0			-	HGNC	U94586	CCDS5357.1	7p21.3	2014-07-30	2014-07-30		ENSG00000189043	ENSG00000189043			7687	protein-coding gene	gene with protein product	"""complex I 9kDa subunit"", ""NADH-ubiquinone oxidoreductase MLRQ subunit"""	603833	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 (9kD, MLRQ)"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa"""			9352085	Standard	NM_002489		Approved	MLRQ, CI-9k	uc003srx.2	O00483	OTTHUMG00000023880	ENST00000339600.5:c.103C>A	7.37:g.10978463G>T	ENSP00000339720:p.Arg35Ser	Somatic	0	22	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	A4D109|Q6FHN5	Missense_Mutation	SNP	27	0.00	0	81	0.00	0	NULL	p.R35S	ENST00000339600.5	37	c.103	CCDS5357.1	7	.	.	.	.	.	.	.	.	.	.	G	11.01	1.512402	0.27123	.	.	ENSG00000189043	ENST00000339600	D	0.86769	-2.17	4.97	4.97	0.65823	.	0.053690	0.85682	D	0.000000	D	0.86514	0.5951	.	.	.	0.53005	D	0.999966	B	0.33549	0.417	B	0.40375	0.327	D	0.86216	0.1628	9	0.54805	T	0.06	-5.7026	13.9257	0.63961	0.0:0.0:1.0:0.0	.	35	O00483	NDUA4_HUMAN	S	35	ENSP00000339720:R35S	ENSP00000339720:R35S	R	-	1	0	NDUFA4	10944988	1.000000	0.71417	0.298000	0.25002	0.017000	0.09413	4.828000	0.62730	2.748000	0.94277	0.655000	0.94253	CGT	-	NULL		0.388	NDUFA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFA4	protein_coding	OTTHUMT00000207507.3	G	NM_002489	-		10978463	-1	no_errors	ENST00000339600	ensembl	human	known	74_37	missense	SNP	0.596	T
WDFY4	57705	genome.wustl.edu	37	10	49951426	49951426	+	Silent	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951426C>T	ENST00000325239.5	+	11	2319	c.2292C>T	c.(2290-2292)ctC>ctT	p.L764L	WDFY4_ENST00000413659.2_Silent_p.L764L	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	764						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						AGAGCTGCCTCCAGATCCTTG	0.617																																																	0								ENSG00000128815						28.0	30.0	29.0					10																	49951426		692	1591	2283	WDFY4	SO:0001819	synonymous_variant	0			-	HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2292C>T	10.37:g.49951426C>T		Somatic	0	42	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	87	18.69	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	26	0.00	0	103	17.60	22	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L764	ENST00000325239.5	37	c.2292	CCDS44385.1	10																																																																																			-	superfamily_ARM-type_fold		0.617	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		C	XM_033379	-		49951426	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	silent	SNP	0.014	T
MIR137HG	400765	genome.wustl.edu	37	1	98511780	98511780	+	lincRNA	SNP	T	T	C			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:98511780T>C	ENST00000580305.1	-	0	0				MIR137HG_ENST00000385223.1_lincRNA	NR_039604.1				MIR137 host gene (non-protein coding)																		ccgctgctactgccgccgccg	0.627																																																	0								ENSG00000225206						4.0	8.0	7.0					1																	98511780		264	992	1256	MIR137HG			0			-	HGNC	AK094607		1p21.3	2013-05-22			ENSG00000225206	ENSG00000225206		"""Long non-coding RNAs"""	42871	non-coding RNA	RNA, long non-coding							Standard	NR_046105		Approved		uc001drx.2		OTTHUMG00000010680		1.37:g.98511780T>C		Somatic	0	35	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	9	52.63		RNA	SNP	10	23.08	3	34	10.53	4	-	NULL	ENST00000580305.1	37	NULL		1																																																																																			-	-		0.627	MIR137HG-203	KNOWN	basic	miRNA	MIR137HG	lincRNA		T	NR_046105	-		98511780	-1	no_errors	ENST00000424528	ensembl	human	known	74_37	rna	SNP	0.007	C
WDFY4	57705	genome.wustl.edu	37	10	49951403	49951403	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951403C>T	ENST00000325239.5	+	11	2296	c.2269C>T	c.(2269-2271)Cca>Tca	p.P757S	WDFY4_ENST00000413659.2_Missense_Mutation_p.P757S	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	757						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CGGCTCACTCCCACCCCGGAT	0.617																																																	0								ENSG00000128815						30.0	32.0	31.0					10																	49951403		692	1591	2283	WDFY4	SO:0001583	missense	0			-	HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2269C>T	10.37:g.49951403C>T	ENSP00000320563:p.Pro757Ser	Somatic	0	42	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	74	17.78	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	25	0.00	0	94	18.97	22	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P757S	ENST00000325239.5	37	c.2269	CCDS44385.1	10	.	.	.	.	.	.	.	.	.	.	C	10.66	1.411927	0.25465	.	.	ENSG00000128815	ENST00000454161;ENST00000426033;ENST00000325239;ENST00000413659	T;T	0.57907	0.37;1.27	5.02	5.02	0.67125	Armadillo-type fold (1);	.	.	.	.	T	0.66056	0.2751	L	0.59436	1.845	0.41667	D	0.989217	D	0.89917	1.0	D	0.91635	0.999	T	0.66011	-0.6029	8	.	.	.	.	10.8933	0.47008	0.0:0.9135:0.0:0.0865	.	757	Q6ZS81	WDFY4_HUMAN	S	766;757;757;757	ENSP00000320563:P757S;ENSP00000403789:P757S	.	P	+	1	0	WDFY4	49621409	1.000000	0.71417	0.378000	0.26068	0.008000	0.06430	4.462000	0.60121	2.338000	0.79540	0.563000	0.77884	CCA	-	superfamily_ARM-type_fold		0.617	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		C	XM_033379	-		49951403	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC24A4	123041	genome.wustl.edu	37	14	92923649	92923650	+	Intron	INS	-	-	ACACCAGG	rs60368323|rs386780028|rs386780027|rs150261689|rs146511335	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr14:92923649_92923650insACACCAGG	ENST00000532405.1	+	12	1481				SLC24A4_ENST00000531433.1_Intron|SLC24A4_ENST00000351924.5_Intron|SLC24A4_ENST00000393265.2_Intron|SLC24A4_ENST00000298877.1_Intron|SLC24A4_ENST00000556739.1_3'UTR			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4						amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		attcctagaactgcgcacctgc	0.559														3402	0.679313	0.8374	0.5504	5008	,	,		14560	0.5933		0.6879	False		,,,				2504	0.637				NSCLC(10;315 435 10383 28450 38798)												0								ENSG00000140090																																			SLC24A4	SO:0001627	intron_variant	0				HGNC	AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1255+697->ACACCAGG	14.37:g.92923649_92923650insACACCAGG		Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	RNA	INS	29	3.33	1	17	5.56	1	-	NULL	ENST00000532405.1	37	NULL	CCDS9903.2	14																																																																																			-	-		0.559	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	SLC24A4	protein_coding	OTTHUMT00000395240.1	-	NM_153646			92923650	+1	no_errors	ENST00000556739	ensembl	human	known	74_37	rna	INS	0.000:0.000	ACACCAGG
TCTN1	79600	genome.wustl.edu	37	12	111065921	111065921	+	Intron	SNP	A	A	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:111065921A>G	ENST00000551590.1	+	4	628				TCTN1_ENST00000397655.3_Intron|HVCN1_ENST00000548312.1_3'UTR|TCTN1_ENST00000397659.4_Intron|TCTN1_ENST00000471804.2_3'UTR|RN7SL387P_ENST00000581015.1_RNA|TCTN1_ENST00000377654.3_Intron|TCTN1_ENST00000550703.2_Intron|TCTN1_ENST00000551555.2_Intron			Q2MV58	TECT1_HUMAN	tectonic family member 1						central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						TTTCATTCCCATAGCCATCCG	0.473																																																	0								ENSG00000204852																																			TCTN1	SO:0001627	intron_variant	0			-	HGNC	AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.473-651A>G	12.37:g.111065921A>G		Somatic	0	53	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	19	56.82	A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Silent	SNP	28	0.00	0	27	47.06	24	pfam_DUF1619	p.P179	ENST00000551590.1	37	c.537	CCDS41835.1	12																																																																																			-	NULL		0.473	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	TCTN1	protein_coding	OTTHUMT00000316016.2	A	NM_024549	-		111065921	+1	no_errors	ENST00000397656	ensembl	human	known	74_37	silent	SNP	0.000	G
LCT	3938	genome.wustl.edu	37	2	136579728	136579728	+	Intron	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr2:136579728G>A	ENST00000264162.2	-	5	918				AC011893.3_ENST00000437007.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	ATGCAAGTCTGAAATCAACAG	0.393																																																	0								ENSG00000226806						99.0	86.0	90.0					2																	136579728		692	1591	2283	AC011893.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.908-60C>T	2.37:g.136579728G>A		Somatic	0	28	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92	Q4ZG58	RNA	SNP	40	2.44	1	60	20.00	15	-	NULL	ENST00000264162.2	37	NULL	CCDS2178.1	2																																																																																			-	-		0.393	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100507600	protein_coding	OTTHUMT00000254657.1	G	NM_002299	-		136579728	+1	no_errors	ENST00000437007	ensembl	human	known	74_37	rna	SNP	0.002	A
MAPK8IP3	23162	genome.wustl.edu	37	16	1785034	1785034	+	Intron	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:1785034C>T	ENST00000250894.4	+	4	759				MIR3177_ENST00000578255.1_RNA|MAPK8IP3_ENST00000356010.5_Intron	NM_015133.3	NP_055948.2	Q9UPT6	JIP3_HUMAN	mitogen-activated protein kinase 8 interacting protein 3						activation of JUN kinase activity (GO:0007257)|axon guidance (GO:0007411)|forebrain development (GO:0030900)|in utero embryonic development (GO:0001701)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|positive regulation of neuron differentiation (GO:0045666)|post-embryonic development (GO:0009791)|protein localization (GO:0008104)|regulation of gene expression (GO:0010468)|regulation of JNK cascade (GO:0046328)|respiratory gaseous exchange (GO:0007585)|vesicle-mediated transport (GO:0016192)	axolemma (GO:0030673)|dendrite (GO:0030425)|Golgi membrane (GO:0000139)|smooth endoplasmic reticulum (GO:0005790)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	42						GAGACATTCGCGCAGTGCACG	0.612																																																	0								ENSG00000265820																																			MIR3177	SO:0001627	intron_variant	0			-	HGNC	AB028989	CCDS10442.2, CCDS45379.1	16p13.3	2009-11-23			ENSG00000138834	ENSG00000138834			6884	protein-coding gene	gene with protein product	"""homolog of Drosophila Sunday driver 2"""	605431				10523642, 10629060	Standard	XM_005255187		Approved	KIAA1066, JSAP1, JIP3, syd	uc002cmk.3	Q9UPT6	OTTHUMG00000128637	ENST00000250894.4:c.602+5455C>T	16.37:g.1785034C>T		Somatic	0	24	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	25	40.48	A2A2B3|A7E2B3|Q96RY4|Q9H4I4|Q9H7P1|Q9NUG0	RNA	SNP	34	0.00	0	41	32.79	20	-	NULL	ENST00000250894.4	37	NULL	CCDS10442.2	16																																																																																			-	-		0.612	MAPK8IP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR3177	protein_coding	OTTHUMT00000250508.2	C	NM_001040439	-		1785034	+1	no_errors	ENST00000578255	ensembl	human	known	74_37	rna	SNP	0.000	T
ACTA2	59	genome.wustl.edu	37	10	90701022	90701025	+	Frame_Shift_Del	DEL	TCTT	TCTT	-			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TCTT	TCTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:90701022_90701025delTCTT	ENST00000458208.1	-	6	1051_1054	c.577_580delAAGA	c.(577-582)aagatcfs	p.KI193fs	ACTA2-AS1_ENST00000596007.1_RNA|ACTA2-AS1_ENST00000437930.4_RNA|STAMBPL1_ENST00000371927.3_Intron|ACTA2_ENST00000224784.6_Frame_Shift_Del_p.KI193fs|ACTA2_ENST00000480297.1_5'UTR	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta	193					glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		TCAGTCAGGATCTTCATGAGGTAG	0.549																																																	0								ENSG00000107796																																			ACTA2	SO:0001589	frameshift_variant	0				HGNC	X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.577_580delAAGA	10.37:g.90701022_90701025delTCTT	ENSP00000402373:p.Lys193fs	Somatic	0	75	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	10	72.22	B2R8A4|P03996|P04108|Q6FI19	Frame_Shift_Del	DEL	20	0.00	0	9	72.73	24	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.K193fs	ENST00000458208.1	37	c.580_577	CCDS7392.1	10																																																																																			-	pfam_Actin-related,smart_Actin-related		0.549	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA2	protein_coding	OTTHUMT00000049264.1	TCTT	NM_001613			90701025	-1	no_errors	ENST00000224784	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
DLGAP4	22839	genome.wustl.edu	37	20	35075162	35075162	+	Silent	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr20:35075162G>A	ENST00000373907.2	+	6	1669	c.1470G>A	c.(1468-1470)gcG>gcA	p.A490A	DLGAP4_ENST00000373913.3_Silent_p.A490A|DLGAP4_ENST00000401952.2_Silent_p.A490A|DLGAP4_ENST00000339266.5_Silent_p.A490A			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	490					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GCAGTGAAGCGGAGTCCACAG	0.642																																																	0								ENSG00000080845						48.0	34.0	39.0					20																	35075162		2203	4300	6503	DLGAP4	SO:0001819	synonymous_variant	0			-	HGNC	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.1470G>A	20.37:g.35075162G>A		Somatic	0	86	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	28	45.10	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Silent	SNP	19	0.00	0	38	38.71	24	pfam_GKAP	p.A490	ENST00000373907.2	37	c.1470		20																																																																																			-	NULL		0.642	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	protein_coding	OTTHUMT00000079025.2	G	NM_014902	-		35075162	+1	no_errors	ENST00000339266	ensembl	human	known	74_37	silent	SNP	0.001	A
TRPM3	80036	genome.wustl.edu	37	9	73391377	73391377	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr9:73391377C>G	ENST00000396283.1	-	9	1110	c.791G>C	c.(790-792)aGa>aCa	p.R264T	TRPM3_ENST00000396285.1_Intron|TRPM3_ENST00000423814.3_Intron|TRPM3_ENST00000360823.2_Intron|TRPM3_ENST00000396292.4_Intron|TRPM3_ENST00000358082.3_Intron|TRPM3_ENST00000377105.1_Intron|TRPM3_ENST00000396280.5_Intron|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000377101.1_Intron|TRPM3_ENST00000408909.2_Intron|TRPM3_ENST00000377110.3_Intron|TRPM3_ENST00000377106.1_Intron|TRPM3_ENST00000357533.2_Intron			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	0					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TTTTCTTTCTCTTTTTAGATT	0.363																																																	0								ENSG00000083067																																			TRPM3	SO:0001583	missense	0			-	HGNC	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000396283.1:c.791G>C	9.37:g.73391377C>G	ENSP00000379579:p.Arg264Thr	Somatic	0	57	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	25	47.92	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	33	2.86	1	43	36.76	25	NULL	p.R264T	ENST00000396283.1	37	c.791		9	.	.	.	.	.	.	.	.	.	.	C	8.416	0.845220	0.16963	.	.	ENSG00000083067	ENST00000396283	T	0.69306	-0.39	3.02	0.982	0.19762	.	.	.	.	.	T	0.58921	0.2156	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.52388	-0.8582	6	0.51188	T	0.08	.	5.1132	0.14821	0.0:0.6869:0.0:0.3131	.	.	.	.	T	264	ENSP00000379579:R264T	ENSP00000379579:R264T	R	-	2	0	TRPM3	72581197	0.087000	0.21565	0.003000	0.11579	0.033000	0.12548	-0.049000	0.11924	0.259000	0.21709	0.655000	0.94253	AGA	-	NULL		0.363	TRPM3-002	PUTATIVE	basic	protein_coding	TRPM3	protein_coding	OTTHUMT00000052611.3	C	NM_206945	-		73391377	-1	no_errors	ENST00000396283	ensembl	human	putative	74_37	missense	SNP	0.004	G
ASCC1	51008	genome.wustl.edu	37	10	73940732	73940733	+	Intron	INS	-	-	T	rs534461070	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:73940732_73940733insT	ENST00000342444.4	-	6	675				ASCC1_ENST00000394915.3_Intron|ASCC1_ENST00000317126.4_Intron|SNORA36_ENST00000363424.1_RNA|ASCC1_ENST00000545550.1_Intron|ASCC1_ENST00000394919.1_Intron|ASCC1_ENST00000317168.6_Intron	NM_001198799.2	NP_001185728.1	Q8N9N2	ASCC1_HUMAN	activating signal cointegrator 1 complex subunit 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|transcription factor complex (GO:0005667)	catalytic activity (GO:0003824)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	7						ATTCATTTGCCtttttttttgg	0.465																																																	0								ENSG00000200294																																			SNORA36	SO:0001627	intron_variant	0				RFAM	AY013290	CCDS31219.1, CCDS55713.1	10q22.1	2012-09-20			ENSG00000138303	ENSG00000138303			24268	protein-coding gene	gene with protein product		614215				10810093, 12077347	Standard	NM_001198799		Approved	CGI-18, ASC1p50, Em:AC022392.3	uc001jst.2	Q8N9N2	OTTHUMG00000018434	ENST00000342444.4:c.573+15835->A	10.37:g.73940741_73940741dupT		Somatic	0	13	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00	Q5SW06|Q5SW07|Q96EI8|Q9Y307	RNA	INS	33	0.00	0	29	0.00	0	-	NULL	ENST00000342444.4	37	NULL	CCDS55713.1	10																																																																																			-	-		0.465	ASCC1-004	KNOWN	basic|CCDS	protein_coding	ENSG00000200294	protein_coding	OTTHUMT00000048573.2	-	NM_015947			73940733	+1	no_errors	ENST00000363424	ensembl	human	novel	74_37	rna	INS	0.371:0.371	T
MAN1B1	11253	genome.wustl.edu	37	9	139998199	139998275	+	Intron	DEL	TGCAGGTCGGTGGTGTTACATTCACACTGTTGCAGGTGTGCAGGTTGGTGTTACACACATTCACACTGTTGCAGGCT	TGCAGGTCGGTGGTGTTACATTCACACTGTTGCAGGTGTGCAGGTTGGTGTTACACACATTCACACTGTTGCAGGCT	-	rs570715143|rs569837038|rs201010871|rs527754315|rs199895379|rs533075357|rs66670530|rs181706889	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TGCAGGTCGGTGGTGTTACATTCACACTGTTGCAGGTGTGCAGGTTGGTGTTACACACATTCACACTGTTGCAGGCT	TGCAGGTCGGTGGTGTTACATTCACACTGTTGCAGGTGTGCAGGTTGGTGTTACACACATTCACACTGTTGCAGGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr9:139998199_139998275delTGCAGGTCGGTGGTGTTACATTCACACTGTTGCAGGTGTGCAGGTTGGTGTTACACACATTCACACTGTTGCAGGCT	ENST00000371589.4	+	8	1327				MAN1B1_ENST00000474902.1_Intron|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		GTTGCAGGCGTGCAGGTCGGTGGTGTTACATTCACACTGTTGCAGGTGTGCAGGTTGGTGTTACACACATTCACACTGTTGCAGGCTTGCAGGTCGG	0.531																																																	0								ENSG00000177239																																			MAN1B1	SO:0001627	intron_variant	0				HGNC	AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1254+2075TGCAGGTCGGTGGTGTTACATTCACACTGTTGCAGGTGTGCAGGTTGGTGTTACACACATTCACACTGTTGCAGGCT>-	9.37:g.139998199_139998275delTGCAGGTCGGTGGTGTTACATTCACACTGTTGCAGGTGTGCAGGTTGGTGTTACACACATTCACACTGTTGCAGGCT		Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5VSG3|Q9BRS9|Q9Y5K7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																			-	-		0.531	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	protein_coding	OTTHUMT00000055294.2	TGCAGGTCGGTGGTGTTACATTCACACTGTTGCAGGTGTGCAGGTTGGTGTTACACACATTCACACTGTTGCAGGCT	NM_016219			139998275	+1	no_errors	ENST00000540391	ensembl	human	known	74_37	rna	DEL	0.010:0.009:0.006:0.003:0.010:0.019:0.038:0.083:0.102:0.151:0.269:0.372:0.513:0.732:0.783:0.926:0.952:0.968:0.980:0.978:0.961:0.940:0.549:0.524:0.521:0.570:0.645:0.728:0.786:0.818:0.845:0.987:0.996:0.996:0.992:0.985:0.971:0.974:0.973:0.970:0.969:0.973:0.982:0.986:0.987:0.990:0.990:0.989:0.985:0.983:0.980:0.985:0.990:0.995:0.994:0.991:0.974:0.875:0.836:0.776:0.752:0.605:0.494:0.326:0.305:0.317:0.322:0.330:0.175:0.158:0.139:0.114:0.096:0.096:0.104:0.112:0.126	-
ANKRD6	22881	genome.wustl.edu	37	6	90333179	90333179	+	Frame_Shift_Del	DEL	A	A	-			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr6:90333179delA	ENST00000522441.1	+	11	1589	c.948delA	c.(946-948)agafs	p.R316fs	ANKRD6_ENST00000447838.2_Frame_Shift_Del_p.R316fs|LYRM2_ENST00000520441.1_Intron|ANKRD6_ENST00000339746.4_Frame_Shift_Del_p.R316fs|ANKRD6_ENST00000520793.1_Frame_Shift_Del_p.R257fs|ANKRD6_ENST00000369408.5_Frame_Shift_Del_p.R281fs	NM_001242811.1	NP_001229740.1	Q9Y2G4	ANKR6_HUMAN	ankyrin repeat domain 6	316					negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of JNK cascade (GO:0046330)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(3)|large_intestine(7)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|stomach(2)	21		all_cancers(76;1.22e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.79e-07)|all_epithelial(107;1.83e-05)|Lung NSC(302;0.239)		BRCA - Breast invasive adenocarcinoma(108;0.0209)		CTGTGGCCAGAAAAGAAGAAG	0.537																																																	0								ENSG00000135299						37.0	42.0	41.0					6																	90333179		1888	4117	6005	ANKRD6	SO:0001589	frameshift_variant	0				HGNC	AB023174	CCDS47460.1, CCDS56441.1, CCDS56442.1, CCDS56443.1	6q14.2-q16.1	2013-03-20			ENSG00000135299	ENSG00000135299		"""Ankyrin repeat domain containing"""	17280	protein-coding gene	gene with protein product		610583					Standard	NM_001242809		Approved	KIAA0957	uc003pni.4	Q9Y2G4	OTTHUMG00000015202	ENST00000522441.1:c.948delA	6.37:g.90333179delA	ENSP00000430985:p.Arg316fs	Somatic	0	25	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	21	8.70	B3KUC3|Q5JUJ4|Q5JUJ5|Q8IUQ8|Q9NU24|Q9UFQ9	Frame_Shift_Del	DEL	25	0.00	0	51	0.00	0	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E318fs	ENST00000522441.1	37	c.948	CCDS56441.1	6																																																																																			-	NULL		0.537	ANKRD6-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ANKRD6	protein_coding	OTTHUMT00000376594.1	A				90333179	+1	no_errors	ENST00000339746	ensembl	human	known	74_37	frame_shift_del	DEL	0.046	-
ACP1	52	genome.wustl.edu	37	2	272145	272145	+	Silent	SNP	C	C	A	rs201625066		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr2:272145C>A	ENST00000272065.5	+	3	319	c.226C>A	c.(226-228)Cgg>Agg	p.R76R	ACP1_ENST00000272067.6_Intron|ACP1_ENST00000439645.2_Intron|ACP1_ENST00000405233.1_Intron|ACP1_ENST00000484464.1_3'UTR|ACP1_ENST00000407983.3_Silent_p.R76R	NM_004300.3	NP_004291.1	P24666	PPAC_HUMAN	acid phosphatase 1, soluble	76						cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	12	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)	Adenine(DB00173)	CCACGTTGCCCGGCAGGTACC	0.582																																																	0								ENSG00000143727						165.0	139.0	148.0					2																	272145		2203	4300	6503	ACP1	SO:0001819	synonymous_variant	0			-	HGNC	M87546	CCDS1639.1, CCDS1640.1, CCDS46217.1	2p25	2011-06-09			ENSG00000143727	ENSG00000143727	3.1.3.2	"""Protein tyrosine phosphatases / Class II Cys-based PTPs"""	122	protein-coding gene	gene with protein product		171500					Standard	NM_001040649		Approved		uc002qwf.3	P24666	OTTHUMG00000086933	ENST00000272065.5:c.226C>A	2.37:g.272145C>A		Somatic	0	111	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A8K1L9|B5MCC7|P24667|Q16035|Q16036|Q16725|Q3KQX8|Q53RU0	Silent	SNP	27	0.00	0	28	0.00	0	pfam_Ptyr_pPase_SF,superfamily_Ptyr_pPase_SF,smart_Ptyr_pPase_SF,prints_Tyr_Pase_low_mol_wt_mml,prints_Tyr_phospatase/Ars_reductase	p.R76	ENST00000272065.5	37	c.226	CCDS1639.1	2																																																																																			-	pfam_Ptyr_pPase_SF,superfamily_Ptyr_pPase_SF,smart_Ptyr_pPase_SF,prints_Tyr_Pase_low_mol_wt_mml		0.582	ACP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACP1	protein_coding	OTTHUMT00000195862.3	C		-		272145	+1	no_errors	ENST00000272065	ensembl	human	known	74_37	silent	SNP	1.000	A
GSN	2934	genome.wustl.edu	37	9	124045974	124045974	+	Intron	SNP	T	T	C	rs386738236|rs78220606|rs369237356		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr9:124045974T>C	ENST00000373823.3	+	9	896				GSN_ENST00000373808.2_Intron|GSN_ENST00000394353.2_Intron|GSN_ENST00000341272.2_Intron|GSN_ENST00000412819.1_Intron|GSN_ENST00000436847.1_Intron|GSN_ENST00000449733.1_Intron|GSN-AS1_ENST00000414544.1_RNA|GSN_ENST00000545652.1_5'Flank|RP11-477J21.6_ENST00000437135.1_RNA			P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						cattcattcattcattcattc	0.398																																																	0								ENSG00000235865																																			GSN-AS1	SO:0001627	intron_variant	0			-	HGNC	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373823.3:c.-10+2134T>C	9.37:g.124045974T>C		Somatic	0	20	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	9	35.71	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	SNP	19	29.63	8	41	14.58	7	-	NULL	ENST00000373823.3	37	NULL	CCDS6829.1	9																																																																																			-	-		0.398	GSN-013	KNOWN	basic|appris_principal|CCDS	protein_coding	GSN-AS1	protein_coding	OTTHUMT00000254323.3	T	NM_000177	rs78220606		124045974	-1	no_errors	ENST00000414544	ensembl	human	known	74_37	rna	SNP	0.000	C
DENND2A	27147	genome.wustl.edu	37	7	140280130	140280130	+	Intron	SNP	T	T	C	rs62485838		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr7:140280130T>C	ENST00000275884.6	-	4	1663				AC006452.1_ENST00000408805.1_RNA|DENND2A_ENST00000492720.1_Intron|DENND2A_ENST00000537639.1_Intron|DENND2A_ENST00000496613.1_Intron			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A						positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					tgcatgtatgtatgtatttat	0.368																																																	0								ENSG00000221732																																			AC006452.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1245+5258A>G	7.37:g.140280130T>C		Somatic	0	16	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	C9JUI3|Q1RMD5|Q86XY0	RNA	SNP	25	16.67	5	88	16.98	18	-	NULL	ENST00000275884.6	37	NULL	CCDS43659.1	7																																																																																			-	-		0.368	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221732	protein_coding	OTTHUMT00000348742.1	T	NM_015689	rs62485838		140280130	+1	no_errors	ENST00000408805	ensembl	human	novel	74_37	rna	SNP	0.057	C
FRA10AC1	118924	genome.wustl.edu	37	10	95433563	95433563	+	Intron	SNP	G	G	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:95433563G>T	ENST00000359204.4	-	12	1024				FRA10AC1_ENST00000371430.2_Intron|FRA10AC1_ENST00000536233.1_Intron|FRA10AC1_ENST00000394100.2_Missense_Mutation_p.T277N|FRA10AC1_ENST00000460752.1_5'UTR	NM_145246.4	NP_660289.2	Q70Z53	F10C1_HUMAN	fragile site, folic acid type, rare, fra(10)(q23.3) or fra(10)(q24.2) candidate 1							nucleus (GO:0005634)				NS(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(1)	14						aacgaagtaggtctctttata	0.333																																																	0								ENSG00000148690																																			FRA10AC1	SO:0001627	intron_variant	0			-	HGNC	AK090955	CCDS7430.1	10q23.33	2014-01-28	2010-05-25	2010-05-25	ENSG00000148690	ENSG00000148690			1162	protein-coding gene	gene with protein product		608866	"""chromosome 10 open reading frame 4"""	C10orf4		15203205	Standard	NM_145246		Approved		uc001kiz.2	Q70Z53	OTTHUMG00000018776	ENST00000359204.4:c.826+2846C>A	10.37:g.95433563G>T		Somatic	0	41	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	C9JCR4|C9JCR5|C9JMY4|Q70Z49|Q70Z50|Q70Z51|Q70Z52|Q8N293|Q8WVH5|Q96JQ8	Missense_Mutation	SNP	39	0.00	0	34	0.00	0	pfam_Folate-sensitive_fs_Fra10Ac1	p.T277N	ENST00000359204.4	37	c.830	CCDS7430.1	10	.	.	.	.	.	.	.	.	.	.	G	12.53	1.967051	0.34754	.	.	ENSG00000148690	ENST00000394100	T	0.23552	1.9	2.93	-0.0997	0.13623	.	.	.	.	.	T	0.10465	0.0256	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37079	-0.9721	6	0.10111	T	0.7	.	5.6595	0.17660	0.3951:0.0:0.6049:0.0	.	.	.	.	N	277	ENSP00000377660:T277N	ENSP00000377660:T277N	T	-	2	0	FRA10AC1	95423553	0.006000	0.16342	0.000000	0.03702	0.696000	0.40369	0.897000	0.28390	-0.018000	0.14079	-0.150000	0.13652	ACC	-	NULL		0.333	FRA10AC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRA10AC1	protein_coding	OTTHUMT00000049439.1	G	NM_145246	-		95433563	-1	no_errors	ENST00000394100	ensembl	human	known	74_37	missense	SNP	0.001	T
ENOSF1	55556	genome.wustl.edu	37	18	690729	690730	+	Intron	INS	-	-	T	rs201690054		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr18:690729_690730insT	ENST00000251101.7	-	8	624				ENOSF1_ENST00000580982.1_Intron|ENOSF1_ENST00000383578.3_Intron|ENOSF1_ENST00000340116.7_Intron|ENOSF1_ENST00000319815.6_5'Flank|ENOSF1_ENST00000583973.1_5'Flank	NM_017512.5	NP_059982.2	Q7L5Y1	ENOF1_HUMAN	enolase superfamily member 1						cellular amino acid catabolic process (GO:0009063)|cellular carbohydrate catabolic process (GO:0044275)	mitochondrion (GO:0005739)	isomerase activity (GO:0016853)|L-fuconate dehydratase activity (GO:0050023)|magnesium ion binding (GO:0000287)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	10						GAGTCCAGCTGTTCTCCTGATC	0.545																																																	0								ENSG00000132199																																			ENOSF1	SO:0001627	intron_variant	0				HGNC	X67098	CCDS11822.1, CCDS11823.1, CCDS45821.1	18p11.32	2005-01-26			ENSG00000132199	ENSG00000132199			30365	protein-coding gene	gene with protein product		607427				14508106	Standard	NM_001126123		Approved	HSRTSBETA, rTS, TYMSAS	uc002kku.4	Q7L5Y1	OTTHUMG00000131470	ENST00000251101.7:c.536-98->A	18.37:g.690731_690731dupT		Somatic	0	10	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	13	45.83	A6NMP3|A8K9R5|B3KSL6|B3KXE4|D3DUH0|Q15407|Q15594|Q15595|Q6ZS08|Q9HAS5|Q9HAS6	Frame_Shift_Ins	INS	24	11.11	3	52	11.86	7	pfam_Mandelate_racemase_N	p.T147fs	ENST00000251101.7	37	c.440_439	CCDS11822.1	18																																																																																			-	NULL		0.545	ENOSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOSF1	protein_coding	OTTHUMT00000254312.2	-	NM_017512			690730	-1	no_errors	ENST00000581475	ensembl	human	known	74_37	frame_shift_ins	INS	0.009:0.019	T
MSH3	4437	genome.wustl.edu	37	5	79950742	79950750	+	In_Frame_Del	DEL	CCCCCAGCT	CCCCCAGCT	-	rs144629981|rs3045983|rs557874766|rs1047489	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	CCCCCAGCT	CCCCCAGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr5:79950742_79950750delCCCCCAGCT	ENST00000265081.6	+	1	276_284	c.196_204delCCCCCAGCT	c.(196-204)cccccagctdel	p.PPA66del	DHFR_ENST00000504396.1_5'Flank|DHFR_ENST00000513048.1_5'Flank|DHFR_ENST00000439211.2_5'UTR|DHFR_ENST00000505337.1_5'Flank|DHFR_ENST00000511032.1_5'Flank	NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	66					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		gCCCCCAGCGCCCCCAGCTCCCGCCTTCC	0.732								Mismatch excision repair (MMR)						1174	0.234425	0.2874	0.2061	5008	,	,		7173	0.0565		0.2535	False		,,,				2504	0.3466				Melanoma(88;1010 1399 13793 26548 36275)												0								ENSG00000113318		,	1105,2179		342,421,879					,	4.0	1.0		dbSNP_102	4	1941,4615		567,807,1904	no	coding,utr-5	DHFR,MSH3	NM_002439.3,NM_000791.3	,	909,1228,2783	A1A1,A1R,RR		29.6065,33.648,30.9553	,	,		3046,6794				MSH3	SO:0001651	inframe_deletion	0				HGNC	U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.196_204delCCCCCAGCT	5.37:g.79950742_79950750delCCCCCAGCT	ENSP00000265081:p.Pro66_Ala68del	Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	In_Frame_Del	DEL	14	22.22	4	29	25.64	10	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.PAP67in_frame_del	ENST00000265081.6	37	c.196_204	CCDS34195.1	5																																																																																			-	NULL		0.732	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	protein_coding	OTTHUMT00000369471.1	CCCCCAGCT	NM_002439			79950750	+1	no_errors	ENST00000265081	ensembl	human	known	74_37	in_frame_del	DEL	0.890:0.802:0.715:0.628:0.541:0.455:0.369:0.282:0.196	-
ADAMTS18	170692	genome.wustl.edu	37	16	77325184	77325184	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:77325184C>A	ENST00000282849.5	-	21	3799	c.3381G>T	c.(3379-3381)tgG>tgT	p.W1127C	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1127	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						GCAATGAATACCATCCAGCTA	0.493																																																	0								ENSG00000140873						104.0	96.0	99.0					16																	77325184		2198	4300	6498	ADAMTS18	SO:0001583	missense	0			-	HGNC	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3381G>T	16.37:g.77325184C>A	ENSP00000282849:p.Trp1127Cys	Somatic	0	72	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	11	65.62	Q6P4R5|Q6ZWJ9	Missense_Mutation	SNP	29	0.00	0	20	45.95	17	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.W1127C	ENST00000282849.5	37	c.3381	CCDS10926.1	16	.	.	.	.	.	.	.	.	.	.	C	19.66	3.869767	0.72065	.	.	ENSG00000140873	ENST00000282849	T	0.69435	-0.4	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	D	0.90683	0.7077	H	0.99726	4.73	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.94729	0.7908	10	0.87932	D	0	.	18.5635	0.91110	0.0:1.0:0.0:0.0	.	1127	Q8TE60	ATS18_HUMAN	C	1127	ENSP00000282849:W1127C	ENSP00000282849:W1127C	W	-	3	0	ADAMTS18	75882685	1.000000	0.71417	0.997000	0.53966	0.525000	0.34531	6.797000	0.75150	2.641000	0.89580	0.563000	0.77884	TGG	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.493	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	protein_coding	OTTHUMT00000269037.1	C		-		77325184	-1	no_errors	ENST00000282849	ensembl	human	known	74_37	missense	SNP	1.000	A
DMD	1756	genome.wustl.edu	37	X	32407656	32407656	+	Frame_Shift_Del	DEL	C	C	-	rs369118010		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chrX:32407656delC	ENST00000357033.4	-	32	4686	c.4480delG	c.(4480-4482)gaafs	p.E1494fs	DMD_ENST00000378677.2_Frame_Shift_Del_p.E1490fs	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1494	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				ACTTCCTGTTCCACACTCTTT	0.408																																																	0								ENSG00000198947						210.0	158.0	176.0					X																	32407656		2202	4300	6502	DMD	SO:0001589	frameshift_variant	0				HGNC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.4480delG	X.37:g.32407656delC	ENSP00000354923:p.Glu1494fs	Somatic	0	56	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Frame_Shift_Del	DEL	30	0.00	0	17	0.00	0	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.E1494fs	ENST00000357033.4	37	c.4480	CCDS14233.1	X																																																																																			-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.408	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	C	NM_004006			32407656	-1	no_errors	ENST00000357033	ensembl	human	known	74_37	frame_shift_del	DEL	0.965	-
KIAA1429	25962	genome.wustl.edu	37	8	95547168	95547168	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr8:95547168A>T	ENST00000297591.5	-	5	458	c.383T>A	c.(382-384)gTg>gAg	p.V128E	KIAA1429_ENST00000421249.2_Missense_Mutation_p.V128E|KIAA1429_ENST00000437199.1_Missense_Mutation_p.V128E|RP11-267M23.3_ENST00000521010.1_RNA	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	128					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CACTCTATCCACTGATCCATA	0.463																																																	0								ENSG00000164944						129.0	113.0	119.0					8																	95547168		2203	4300	6503	KIAA1429	SO:0001583	missense	0			-	HGNC	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.383T>A	8.37:g.95547168A>T	ENSP00000297591:p.Val128Glu	Somatic	0	32	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	30	33.33	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	21	0.00	0	29	32.56	14	superfamily_ARM-type_fold	p.V128E	ENST00000297591.5	37	c.383	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472696	0.84640	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.44482	0.93;0.92;0.92	5.35	5.35	0.76521	.	0.124113	0.53938	D	0.000048	T	0.48241	0.1489	N	0.14661	0.345	0.52099	D	0.999942	D;D	0.64830	0.994;0.994	D;D	0.73380	0.98;0.98	T	0.56774	-0.7923	10	0.87932	D	0	-12.9387	15.6297	0.76893	1.0:0.0:0.0:0.0	.	128;128	Q69YN4-4;Q69YN4	.;VIR_HUMAN	E	128	ENSP00000297591:V128E;ENSP00000395600:V128E;ENSP00000398390:V128E	ENSP00000297591:V128E	V	-	2	0	KIAA1429	95616344	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.124000	0.77185	2.144000	0.66660	0.482000	0.46254	GTG	-	NULL		0.463	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	protein_coding	OTTHUMT00000378720.2	A	NM_015496	-		95547168	-1	no_errors	ENST00000297591	ensembl	human	known	74_37	missense	SNP	1.000	T
FBXO38	81545	genome.wustl.edu	37	5	147806999	147806999	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr5:147806999C>G	ENST00000340253.5	+	15	2310	c.2142C>G	c.(2140-2142)aaC>aaG	p.N714K	FBXO38_ENST00000513826.1_Intron|FBXO38_ENST00000394370.3_Missense_Mutation_p.N714K|CTD-2283N19.1_ENST00000520980.2_RNA|FBXO38_ENST00000296701.6_Intron			Q6PIJ6	FBX38_HUMAN	F-box protein 38	714					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)			ATG4C/FBXO38(2)	NS(1)|breast(2)|endometrium(7)|kidney(5)|large_intestine(9)|lung(15)|ovary(5)|prostate(2)|skin(2)|stomach(2)|urinary_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGTGGGAAACTCCAGCTCAC	0.512																																																	0								ENSG00000145868						55.0	47.0	50.0					5																	147806999		2203	4300	6503	FBXO38	SO:0001583	missense	0			-	HGNC	BC005873	CCDS43384.1, CCDS64285.1	5q33.1	2008-02-05			ENSG00000145868	ENSG00000145868		"""F-boxes /  ""other"""""	28844	protein-coding gene	gene with protein product		608533				12477932	Standard	NM_030793		Approved	MOKA, SP329, FLJ13962, Fbx38	uc003lpg.2	Q6PIJ6	OTTHUMG00000129929	ENST00000340253.5:c.2142C>G	5.37:g.147806999C>G	ENSP00000342023:p.Asn714Lys	Somatic	0	10	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50	Q6PK72|Q7Z2U0|Q86VN3|Q9BXY6|Q9H837|Q9HC40	Missense_Mutation	SNP	32	0.00	0	38	39.68	25	superfamily_F-box_dom	p.N714K	ENST00000340253.5	37	c.2142		5	.	.	.	.	.	.	.	.	.	.	C	11.98	1.801683	0.31869	.	.	ENSG00000145868	ENST00000340253;ENST00000394370	T;T	0.29917	1.55;1.57	5.63	4.75	0.60458	.	0.785760	0.12822	N	0.436343	T	0.17365	0.0417	N	0.24115	0.695	0.80722	D	1	B;B	0.27732	0.11;0.187	B;B	0.22601	0.025;0.04	T	0.10291	-1.0636	10	0.18276	T	0.48	-2.6714	6.0471	0.19766	0.1547:0.6902:0.0:0.1551	.	714;714	Q6PIJ6-2;Q6PIJ6	.;FBX38_HUMAN	K	714	ENSP00000342023:N714K;ENSP00000377895:N714K	ENSP00000342023:N714K	N	+	3	2	FBXO38	147787192	0.979000	0.34478	1.000000	0.80357	0.998000	0.95712	0.969000	0.29370	2.644000	0.89710	0.655000	0.94253	AAC	-	NULL		0.512	FBXO38-002	KNOWN	basic|appris_principal	protein_coding	FBXO38	protein_coding	OTTHUMT00000252185.2	C	NM_030793	-		147806999	+1	no_errors	ENST00000340253	ensembl	human	known	74_37	missense	SNP	0.980	G
HMGCLL1	54511	genome.wustl.edu	37	6	55406543	55406543	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr6:55406543G>C	ENST00000398661.2	-	4	502	c.371C>G	c.(370-372)tCc>tGc	p.S124C	HMGCLL1_ENST00000274901.4_Missense_Mutation_p.S94C|HMGCLL1_ENST00000508459.1_Missense_Mutation_p.S94C|HMGCLL1_ENST00000370850.2_Missense_Mutation_p.S94C|HMGCLL1_ENST00000428842.1_Missense_Mutation_p.S94C|HMGCLL1_ENST00000308161.4_Missense_Mutation_p.S94C	NM_019036.2	NP_061909.2	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase-like 1	124					ketone body biosynthetic process (GO:0046951)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			TACCCATCTGGAAGACACAAA	0.318																																					Ovarian(35;840 893 7837 15538 42887)												0								ENSG00000146151						85.0	83.0	83.0					6																	55406543		1808	4073	5881	HMGCLL1	SO:0001583	missense	0			-	HGNC	AK055075	CCDS43474.1, CCDS43475.1, CCDS75472.1, CCDS75473.1	6p12.1	2010-04-30	2010-04-30		ENSG00000146151	ENSG00000146151			21359	protein-coding gene	gene with protein product			"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1"""			8619474, 9110174	Standard	NM_001042406		Approved	DKFZP434G1411, bA418P12.1	uc003pcn.3	Q8TB92	OTTHUMG00000014902	ENST00000398661.2:c.371C>G	6.37:g.55406543G>C	ENSP00000381654:p.Ser124Cys	Somatic	0	69	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	41	54.44	B1AQ42|B3KNV0|B7Z1S7|F8W793|Q6ZSA9	Missense_Mutation	SNP	46	0.00	0	33	41.07	23	pfam_PYR_CT,pfscan_PYR_CT	p.S124C	ENST00000398661.2	37	c.371	CCDS43475.1	6	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315658	0.81469	.	.	ENSG00000146151	ENST00000274901;ENST00000398661;ENST00000370850;ENST00000508459;ENST00000308161;ENST00000428842	D;D;D;D;D;D	0.98329	-4.73;-4.73;-4.48;-4.73;-4.87;-4.73	5.97	5.97	0.96955	Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.98670	0.9554	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.996;0.998;0.996;0.997	D;D;D;D;D;D	0.80764	0.98;0.994;0.951;0.973;0.951;0.971	D	0.99851	1.1071	10	0.87932	D	0	-18.5351	20.4387	0.99107	0.0:0.0:1.0:0.0	.	94;94;94;94;94;124	B7Z4D4;B7Z212;F8W793;G5E9S9;Q8TB92-2;Q8TB92	.;.;.;.;.;HMGC2_HUMAN	C	94;124;94;94;94;94	ENSP00000274901:S94C;ENSP00000381654:S124C;ENSP00000359887:S94C;ENSP00000424309:S94C;ENSP00000309737:S94C;ENSP00000412924:S94C	ENSP00000274901:S94C	S	-	2	0	HMGCLL1	55514502	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	8.795000	0.91872	2.836000	0.97738	0.655000	0.94253	TCC	-	pfam_PYR_CT,pfscan_PYR_CT		0.318	HMGCLL1-004	KNOWN	basic|CCDS	protein_coding	HMGCLL1	protein_coding	OTTHUMT00000360290.1	G	XM_166383	-		55406543	-1	no_errors	ENST00000398661	ensembl	human	known	74_37	missense	SNP	1.000	C
KNTC1	9735	genome.wustl.edu	37	12	123070191	123070191	+	Silent	SNP	T	T	C	rs546067080	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:123070191T>C	ENST00000333479.7	+	37	3720	c.3543T>C	c.(3541-3543)ttT>ttC	p.F1181F	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1181					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AGGCTTCTTTTGGGACACATA	0.383													T|||	3	0.000599042	0.0	0.0	5008	,	,		20512	0.0		0.0	False		,,,				2504	0.0031																0								ENSG00000184445						147.0	135.0	138.0					12																	123070191		1864	4105	5969	KNTC1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.3543T>C	12.37:g.123070191T>C		Somatic	0	92	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	56	38.46	A7E2C4|B3KSG2	Silent	SNP	24	4.00	1	44	49.43	43	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.F1181	ENST00000333479.7	37	c.3543	CCDS45002.1	12																																																																																			-	NULL		0.383	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	protein_coding	OTTHUMT00000396110.2	T		-		123070191	+1	no_errors	ENST00000333479	ensembl	human	known	74_37	silent	SNP	0.989	C
KLC4	89953	genome.wustl.edu	37	6	43041689	43041689	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr6:43041689G>A	ENST00000394056.2	+	16	2290	c.1795G>A	c.(1795-1797)Gca>Aca	p.A599T	KLC4_ENST00000347162.5_Missense_Mutation_p.A599T|PTK7_ENST00000476760.1_5'Flank|KLC4_ENST00000479388.1_Missense_Mutation_p.A599T|PTK7_ENST00000352931.2_5'Flank|KLC4_ENST00000259708.3_Missense_Mutation_p.A617T|PTK7_ENST00000481273.1_5'Flank|RP11-387M24.5_ENST00000606123.1_RNA|KLC4_ENST00000394058.1_Missense_Mutation_p.A599T|PTK7_ENST00000345201.2_5'Flank|KLC4_ENST00000453940.2_Missense_Mutation_p.A522T|PTK7_ENST00000471863.1_5'Flank|PTK7_ENST00000349241.2_5'Flank|PTK7_ENST00000230419.4_5'Flank			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	599						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			CCAACCTAGTGCAGCACCCCT	0.527																																																	0								ENSG00000137171						131.0	113.0	119.0					6																	43041689		2203	4300	6503	KLC4	SO:0001583	missense	0			-	HGNC	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1795G>A	6.37:g.43041689G>A	ENSP00000377620:p.Ala599Thr	Somatic	0	127	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	76	34.75	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	27	0.00	0	48	31.43	22	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Kinesin_light	p.A617T	ENST00000394056.2	37	c.1849	CCDS4883.1	6	.	.	.	.	.	.	.	.	.	.	G	9.486	1.099428	0.20552	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	T;T;T;T;T;T	0.77750	-1.11;-1.12;-1.12;-1.11;-1.11;-1.11	5.44	3.65	0.41850	.	0.696719	0.13520	N	0.381766	T	0.35711	0.0941	N	0.14661	0.345	0.25762	N	0.984934	B;B;B	0.29716	0.255;0.0;0.0	B;B;B	0.24394	0.053;0.001;0.0	T	0.12372	-1.0550	10	0.23302	T	0.38	-24.0412	6.9889	0.24743	0.0884:0.0:0.7402:0.1714	.	522;617;599	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	T	599;522;617;599;599;599	ENSP00000340221:A599T;ENSP00000395806:A522T;ENSP00000259708:A617T;ENSP00000418031:A599T;ENSP00000377620:A599T;ENSP00000377622:A599T	ENSP00000259708:A617T	A	+	1	0	KLC4	43149667	1.000000	0.71417	0.737000	0.30932	0.599000	0.36880	2.895000	0.48648	0.656000	0.30886	-0.258000	0.10820	GCA	-	NULL		0.527	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLC4	protein_coding	OTTHUMT00000040579.2	G	NM_138343	-		43041689	+1	no_errors	ENST00000259708	ensembl	human	known	74_37	missense	SNP	0.909	A
UCHL3	7347	genome.wustl.edu	37	13	76178919	76178919	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr13:76178919delT	ENST00000377595.3	+	8	595	c.565delT	c.(565-567)tttfs	p.F189fs	RP11-173B14.5_ENST00000568302.1_RNA|RP11-29G8.3_ENST00000563635.1_RNA|UCHL3_ENST00000606347.1_3'UTR|RP11-173B14.5_ENST00000568735.1_RNA	NM_001270952.1|NM_006002.4	NP_001257881.1|NP_005993.1	P15374	UCHL3_HUMAN	ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase)	189					protein catabolic process (GO:0030163)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|ubiquitin binding (GO:0043130)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(2)|lung(3)|skin(1)	7				GBM - Glioblastoma multiforme(99;0.0125)		GCGGAAGCCATTTCCAATTAA	0.373																																																	0								ENSG00000118939						124.0	123.0	124.0					13																	76178919		2203	4300	6503	UCHL3	SO:0001589	frameshift_variant	0				HGNC	M30496	CCDS9453.1, CCDS73586.1	13q21.33	2008-02-05			ENSG00000118939	ENSG00000118939	3.2.1.15		12515	protein-coding gene	gene with protein product		603090				2530630	Standard	NM_001270952		Approved		uc001vjq.4	P15374	OTTHUMG00000017090	ENST00000377595.3:c.565delT	13.37:g.76178919delT	ENSP00000366819:p.Phe189fs	Somatic	0	30	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	7	22.22	B2R970|Q5TBK8|Q6IBE9	Frame_Shift_Del	DEL	38	0.00	0	38	0.00	0	pfam_Peptidase_C12,prints_Peptidase_C12	p.P190fs	ENST00000377595.3	37	c.565	CCDS9453.1	13																																																																																			-	pfam_Peptidase_C12,prints_Peptidase_C12		0.373	UCHL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCHL3	protein_coding	OTTHUMT00000045292.2	T	NM_006002			76178919	+1	no_errors	ENST00000377595	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
WDR11	55717	genome.wustl.edu	37	10	122648750	122648751	+	3'UTR	INS	-	-	TTTTGTTTTG	rs71019800|rs369445236|rs141904743	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:122648750_122648751insTTTTGTTTTG	ENST00000604509.1	+	0	2177_2178				WDR11_ENST00000263461.6_Intron			Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						AAATGAAATCtttttgttttgt	0.411														1378	0.27516	0.3154	0.3271	5008	,	,		15252	0.3899		0.1581	False		,,,				2504	0.1861																0								ENSG00000120008																																			WDR11	SO:0001624	3_prime_UTR_variant	0				HGNC	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000604509.1:c.*2175->TTTTGTTTTG	10.37:g.122648751_122648760dupTTTTGTTTTG		Somatic	NA	NA	NA		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	RNA	INS	25	19.35	6	53	24.29	17	-	NULL	ENST00000604509.1	37	NULL		10																																																																																			-	-		0.411	WDR11-006	KNOWN	non_canonical_U12|basic	processed_transcript	WDR11	protein_coding	OTTHUMT00000468479.1	-				122648751	+1	no_errors	ENST00000604509	ensembl	human	known	74_37	rna	INS	0.024:0.006	TTTTGTTTTG
GPRIN3	285513	genome.wustl.edu	37	4	90168982	90168982	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr4:90168982G>C	ENST00000609438.1	-	2	2798	c.2280C>G	c.(2278-2280)ttC>ttG	p.F760L	GPRIN3_ENST00000333209.4_Missense_Mutation_p.F760L	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	760										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		TGGGGCGTCGGAAGTTCTGCA	0.468																																																	0								ENSG00000185477						114.0	117.0	116.0					4																	90168982		2203	4300	6503	GPRIN3	SO:0001583	missense	0			-	HGNC	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.2280C>G	4.37:g.90168982G>C	ENSP00000476603:p.Phe760Leu	Somatic	0	46	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	26	51.85	Q8IVE4	Missense_Mutation	SNP	40	0.00	0	42	41.67	30	NULL	p.F760L	ENST00000609438.1	37	c.2280	CCDS34030.1	4	.	.	.	.	.	.	.	.	.	.	G	17.58	3.423958	0.62733	.	.	ENSG00000185477	ENST00000333209	T	0.18338	2.22	5.26	-10.5	0.00291	.	0.000000	0.35151	N	0.003417	T	0.05868	0.0153	N	0.04090	-0.28	0.23150	N	0.998215	B	0.24043	0.096	B	0.25614	0.062	T	0.22347	-1.0219	10	0.52906	T	0.07	-6.5429	12.9534	0.58413	0.6275:0.2128:0.1597:0.0	.	760	Q6ZVF9	GRIN3_HUMAN	L	760	ENSP00000328672:F760L	ENSP00000328672:F760L	F	-	3	2	GPRIN3	90388005	0.016000	0.18221	0.003000	0.11579	0.985000	0.73830	-0.763000	0.04740	-3.183000	0.00221	0.655000	0.94253	TTC	-	NULL		0.468	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN3	protein_coding	OTTHUMT00000363540.2	G	NM_198281	-		90168982	-1	no_errors	ENST00000333209	ensembl	human	known	74_37	missense	SNP	0.015	C
TM2D1	83941	genome.wustl.edu	37	1	62190776	62190776	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:62190776G>A	ENST00000606498.1	-	1	37	c.17C>T	c.(16-18)cCg>cTg	p.P6L	TM2D1_ENST00000371180.2_Missense_Mutation_p.P68L|TM2D1_ENST00000294613.5_Missense_Mutation_p.P6L|TM2D1_ENST00000371177.2_Missense_Mutation_p.P6L			Q9BX74	TM2D1_HUMAN	TM2 domain containing 1	6					apoptotic signaling pathway (GO:0097190)	integral component of plasma membrane (GO:0005887)	beta-amyloid binding (GO:0001540)|G-protein coupled receptor activity (GO:0004930)			large_intestine(2)|lung(3)|ovary(1)	6						CGGACCAGACGGCCAGGCGGC	0.662																																																	0								ENSG00000162604						35.0	42.0	40.0					1																	62190776		1913	4090	6003	TM2D1	SO:0001583	missense	0			-	HGNC	AF353990	CCDS65554.1	1p32.1	2008-02-05			ENSG00000162604	ENSG00000162604			24142	protein-coding gene	gene with protein product		610080				11278849, 12553667	Standard	NM_032027		Approved	BBP	uc001czz.1	Q9BX74	OTTHUMG00000008466	ENST00000606498.1:c.17C>T	1.37:g.62190776G>A	ENSP00000475700:p.Pro6Leu	Somatic	0	56	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	5	82.76	A6NDA8	Missense_Mutation	SNP	30	0.00	0	5	85.71	30	pfam_TM2	p.P68L	ENST00000606498.1	37	c.203		1	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686813	0.48097	.	.	ENSG00000162604	ENST00000371180;ENST00000294613;ENST00000371178;ENST00000371177	.	.	.	4.69	3.7	0.42460	.	1.025170	0.07796	N	0.955791	T	0.35393	0.0930	L	0.44542	1.39	0.09310	N	1	B	0.27971	0.196	B	0.14578	0.011	T	0.16719	-1.0393	9	0.72032	D	0.01	-1.8948	9.5646	0.39391	0.0:0.0:0.7907:0.2093	.	6	Q9BX74	TM2D1_HUMAN	L	68;6;6;6	.	ENSP00000294613:P6L	P	-	2	0	TM2D1	61963364	0.015000	0.18098	0.016000	0.15963	0.024000	0.10985	2.006000	0.40874	2.581000	0.87130	0.462000	0.41574	CCG	-	NULL		0.662	TM2D1-012	KNOWN	non_canonical_U12|basic|appris_principal	protein_coding	TM2D1	protein_coding	OTTHUMT00000470779.2	G	NM_032027	-		62190776	-1	no_errors	ENST00000371180	ensembl	human	known	74_37	missense	SNP	0.004	A
ARFGEF1	10565	genome.wustl.edu	37	8	68188215	68188215	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr8:68188215G>A	ENST00000262215.3	-	9	1722	c.1333C>T	c.(1333-1335)Cca>Tca	p.P445S		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	445					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			ACTTACTTTGGATCTGGTGGT	0.358																																																	0								ENSG00000066777						86.0	78.0	81.0					8																	68188215		2203	4300	6503	ARFGEF1	SO:0001583	missense	0			-	HGNC	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.1333C>T	8.37:g.68188215G>A	ENSP00000262215:p.Pro445Ser	Somatic	0	58	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	54	12.90	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	37	0.00	0	66	8.33	6	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.P445S	ENST00000262215.3	37	c.1333	CCDS6199.1	8	.	.	.	.	.	.	.	.	.	.	G	19.66	3.869703	0.72065	.	.	ENSG00000066777	ENST00000262215	T	0.39997	1.05	5.53	5.53	0.82687	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59404	0.2191	M	0.85945	2.785	0.80722	D	1	B	0.32324	0.364	B	0.41646	0.362	T	0.60296	-0.7291	10	0.44086	T	0.13	.	19.8389	0.96675	0.0:0.0:1.0:0.0	.	445	Q9Y6D6	BIG1_HUMAN	S	445	ENSP00000262215:P445S	ENSP00000262215:P445S	P	-	1	0	ARFGEF1	68350769	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.715000	0.98748	2.755000	0.94549	0.650000	0.86243	CCA	-	superfamily_ARM-type_fold		0.358	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	protein_coding	OTTHUMT00000379441.4	G	NM_006421	-		68188215	-1	no_errors	ENST00000262215	ensembl	human	known	74_37	missense	SNP	1.000	A
MRGPRX3	117195	genome.wustl.edu	37	11	18159001	18159001	+	Silent	SNP	G	G	A	rs148328055	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:18159001G>A	ENST00000396275.2	+	3	613	c.252G>A	c.(250-252)ccG>ccA	p.P84P		NM_054031.3	NP_473372.3	Q96LB0	MRGX3_HUMAN	MAS-related GPR, member X3	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TATGTTCGCCGTTACGCCTCA	0.542																																																	0								ENSG00000179826	G		0,4400		0,0,2200	103.0	98.0	100.0		252	0.5	0.0	11	dbSNP_134	100	4,8582	3.0+/-9.4	0,4,4289	no	coding-synonymous	MRGPRX3	NM_054031.3		0,4,6489	AA,AG,GG		0.0466,0.0,0.0308		84/323	18159001	4,12982	2200	4293	6493	MRGPRX3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS7830.1	11p15.1	2013-10-10			ENSG00000179826	ENSG00000179826		"""GPCR / Class A : Orphans"""	17980	protein-coding gene	gene with protein product		607229				11551509	Standard	NM_054031		Approved	MRGX3	uc001mnu.3	Q96LB0	OTTHUMG00000166435	ENST00000396275.2:c.252G>A	11.37:g.18159001G>A		Somatic	0	57	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	12	67.57	B0M0L1|Q8TDE0|Q8TDE1	Silent	SNP	34	0.00	0	6	77.42	24	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.P84	ENST00000396275.2	37	c.252	CCDS7830.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.542	MRGPRX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX3	protein_coding	OTTHUMT00000389767.1	G	NM_054031	rs148328055		18159001	+1	no_errors	ENST00000396275	ensembl	human	known	74_37	silent	SNP	0.000	A
KDM6B	23135	genome.wustl.edu	37	17	7751859	7751864	+	In_Frame_Del	DEL	CACCAC	CACCAC	-	rs59627144|rs377654044	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	CACCAC	CACCAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr17:7751859_7751864delCACCAC	ENST00000448097.2	+	11	2584_2589	c.2253_2258delCACCAC	c.(2251-2259)gtcaccacc>gtc	p.TT760del	KDM6B_ENST00000254846.5_In_Frame_Del_p.TT760del			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	760	Pro-rich.|Thr-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CTGTCGCCGTcaccaccaccaccacc	0.65														750	0.14976	0.0068	0.255	5008	,	,		8183	0.2827		0.0686	False		,,,				2504	0.2147																0								ENSG00000132510																																			KDM6B	SO:0001651	inframe_deletion	0				HGNC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.2253_2258delCACCAC	17.37:g.7751865_7751870delCACCAC	ENSP00000412513:p.Thr760_Thr761del	Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9IZ40|Q96G33	In_Frame_Del	DEL	9	40.00	6	16	27.27	6	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.TT755in_frame_del	ENST00000448097.2	37	c.2253_2258		17																																																																																			-	NULL		0.650	KDM6B-002	KNOWN	basic	protein_coding	KDM6B	protein_coding	OTTHUMT00000440248.1	CACCAC	XM_043272			7751864	+1	no_errors	ENST00000254846	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.006:0.963:0.964:0.935:0.971	-
TRIAP1	51499	genome.wustl.edu	37	12	120884315	120884324	+	5'Flank	DEL	GGGCCCCTCT	GGGCCCCTCT	-			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	GGGCCCCTCT	GGGCCCCTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:120884315_120884324delGGGCCCCTCT	ENST00000546954.1	-	0	0				AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_Frame_Shift_Del_p.RAPL11fs|TRIAP1_ENST00000302432.3_5'Flank	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CTGGGCCTTCGGGCCCCTCTGGGCGGGCGC	0.69																																																	0								ENSG00000257218																																			GATC	SO:0001631	upstream_gene_variant	0				HGNC		CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787		12.37:g.120884315_120884324delGGGCCCCTCT	Exception_encountered	Somatic	NA	NA	NA		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R4Z7|Q5RKS5|Q6LCA7	Frame_Shift_Del	DEL	19	0.00	0	62	0.00	0	pfam_Asp/Glu-ADT_csu,tigrfam_Asp/Glu-ADT_csu	p.P13fs	ENST00000546954.1	37	c.32_41	CCDS9198.1	12																																																																																			-	NULL		0.690	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATC	protein_coding	OTTHUMT00000108980.3	GGGCCCCTCT	NM_016399			120884324	+1	no_errors	ENST00000551765	ensembl	human	known	74_37	frame_shift_del	DEL	0.002:0.002:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
SP100	6672	genome.wustl.edu	37	2	231334505	231334508	+	Intron	DEL	AAAG	AAAG	-	rs80274362|rs369389783|rs139756804|rs72983752	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	AAAG	AAAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr2:231334505_231334508delAAAG	ENST00000264052.5	+	15	1700				SP100_ENST00000409112.1_Intron|SP100_ENST00000409824.1_Intron|SP100_ENST00000409341.1_Intron|SP100_ENST00000341950.4_Frame_Shift_Del_p.KK455fs|SP100_ENST00000340126.4_Intron|SP100_ENST00000427101.2_Intron|SP100_ENST00000409897.1_Intron	NM_003113.3	NP_003104.2	P23497	SP100_HUMAN	SP100 nuclear antigen						cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cellular component movement (GO:0051271)|negative regulation of DNA binding (GO:0043392)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of protein export from nucleus (GO:0046826)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral transcription (GO:0032897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of angiogenesis (GO:0045765)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|regulation of Fas signaling pathway (GO:1902044)|response to cytokine (GO:0034097)|response to interferon-gamma (GO:0034341)|response to retinoic acid (GO:0032526)|response to type I interferon (GO:0034340)|retinoic acid receptor signaling pathway (GO:0048384)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear periphery (GO:0034399)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(4)|upper_aerodigestive_tract(1)	25		Renal(207;0.0112)|all_lung(227;0.0335)|all_hematologic(139;0.0749)|Lung NSC(271;0.142)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		TAAAAAAAAAAAAGAAGAAGAAAC	0.382														921	0.183906	0.0809	0.1729	5008	,	,		16844	0.0635		0.3241	False		,,,				2504	0.3108																0								ENSG00000067066																																			SP100	SO:0001627	intron_variant	0				HGNC	AF056322	CCDS2477.1, CCDS42832.1, CCDS56170.1, CCDS56171.1, CCDS56172.1, CCDS56173.1	2q37.1	2013-01-28	2005-11-30		ENSG00000067066	ENSG00000067066		"""Zinc fingers, PHD-type"""	11206	protein-coding gene	gene with protein product		604585	"""nuclear antigen Sp100"""			2258622, 8695863	Standard	NM_001080391		Approved		uc002vqu.1	P23497	OTTHUMG00000133203	ENST00000264052.5:c.1346-222AAAG>-	2.37:g.231334505_231334508delAAAG		Somatic	0	10	0.00		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	16	40.74	B4DDX5|B8ZZD8|E7EUA7|E9PH61|F8WFE2|O75450|Q13343|Q8TE34|Q96F70|Q96T24|Q96T95|Q9NP33|Q9UE32	Frame_Shift_Del	DEL	20	33.33	10	47	36.49	27	pfam_Sp100	p.K454fs	ENST00000264052.5	37	c.1359_1362	CCDS2477.1	2																																																																																			-	NULL		0.382	SP100-001	KNOWN	basic|CCDS	protein_coding	SP100	protein_coding	OTTHUMT00000256914.2	AAAG	NM_003113			231334508	+1	no_errors	ENST00000341950	ensembl	human	known	74_37	frame_shift_del	DEL	0.006:0.006:0.010:0.013	-
PHF20L1	51105	genome.wustl.edu	37	8	133854715	133854715	+	Intron	DEL	T	T	-			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr8:133854715delT	ENST00000395386.2	+	19	2686				PHF20L1_ENST00000220847.7_Intron|AF230666.2_ENST00000429151.1_RNA|PHF20L1_ENST00000395390.2_Intron|AF230666.2_ENST00000608375.1_RNA	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1								zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TGTTAATAGATTTTTTTTTTT	0.353																																																	0								ENSG00000223697			771,404,58,2217		4,7,7,749,7,1,382,4,42,522	29.0	27.0	28.0			1.7	0.0	8	dbSNP_130	30	1671,958,90,5033		27,10,2,1605,5,4,934,0,84,1205	no	intron	PHF20L1	NM_016018.4		31,17,9,2354,12,5,1316,4,126,1727	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		35.0748,35.7391,35.2794			133854715	2442,1362,148,7250	1781	4050	5831	AF230666.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2388-45T>-	8.37:g.133854715delT		Somatic	0	20	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	RNA	DEL	30	3.23	1	52	8.77	5	-	NULL	ENST00000395386.2	37	NULL	CCDS6367.2	8																																																																																			-	-		0.353	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ENSG00000223697	protein_coding	OTTHUMT00000308949.3	T	NM_016018			133854715	-1	no_errors	ENST00000608375	ensembl	human	known	74_37	rna	DEL	0.003	-
HSD17B12	51144	genome.wustl.edu	37	11	43819959	43819959	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:43819959C>T	ENST00000278353.4	+	4	492	c.373C>T	c.(373-375)Ctt>Ttt	p.L125F	HSD17B12_ENST00000529261.1_3'UTR	NM_016142.2	NP_057226.1	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12	125					cellular lipid metabolic process (GO:0044255)|estrogen biosynthetic process (GO:0006703)|extracellular matrix organization (GO:0030198)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cell-substrate adhesion (GO:0010811)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|heparin binding (GO:0008201)			endometrium(2)|large_intestine(4)|lung(4)	10						CTTGGCTGGTCTTGAAATCGG	0.318																																					Ovarian(58;548 1143 13948 16572 34258)												0								ENSG00000149084						95.0	99.0	98.0					11																	43819959		2203	4300	6503	HSD17B12	SO:0001583	missense	0			-	HGNC	AF078850	CCDS7905.1	11q11	2011-09-20				ENSG00000149084	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18646	protein-coding gene	gene with protein product	"""3-ketoacyl-CoA reductase"", ""short chain dehydrogenase/reductase family 12C, member 1"""	609574				12482854, 19027726	Standard	NM_016142		Approved	KAR, SDR12C1	uc001mxq.4	Q53GQ0		ENST00000278353.4:c.373C>T	11.37:g.43819959C>T	ENSP00000278353:p.Leu125Phe	Somatic	0	47	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	18	41.94	A8K9B0|D3DR23|Q96EA9|Q96JU2|Q9Y6G8	Missense_Mutation	SNP	42	0.00	0	47	37.33	28	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.L125F	ENST00000278353.4	37	c.373	CCDS7905.1	11	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848206	0.71603	.	.	ENSG00000149084	ENST00000531185;ENST00000278353	D;D	0.93019	-3.15;-2.27	5.09	5.09	0.68999	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95862	0.8653	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96210	0.9152	10	0.72032	D	0.01	-13.1904	15.4364	0.75149	0.0:1.0:0.0:0.0	.	125	Q53GQ0	DHB12_HUMAN	F	84;125	ENSP00000436582:L84F;ENSP00000278353:L125F	ENSP00000278353:L125F	L	+	1	0	HSD17B12	43776535	1.000000	0.71417	0.933000	0.37362	0.824000	0.46624	3.433000	0.52834	2.360000	0.80028	0.655000	0.94253	CTT	-	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR		0.318	HSD17B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B12	protein_coding	OTTHUMT00000389594.1	C		-		43819959	+1	no_errors	ENST00000278353	ensembl	human	known	74_37	missense	SNP	0.999	T
WDFY4	57705	genome.wustl.edu	37	10	49951504	49951504	+	Silent	SNP	C	C	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:49951504C>T	ENST00000325239.5	+	11	2397	c.2370C>T	c.(2368-2370)acC>acT	p.T790T	WDFY4_ENST00000413659.2_Silent_p.T790T	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	790						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCCTGAGGACCAAGCAGGGGC	0.602																																																	0								ENSG00000128815						16.0	19.0	18.0					10																	49951504		692	1591	2283	WDFY4	SO:0001819	synonymous_variant	0			-	HGNC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.2370C>T	10.37:g.49951504C>T		Somatic	0	39	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	60	23.08	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	26	0.00	0	87	19.44	21	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T790	ENST00000325239.5	37	c.2370	CCDS44385.1	10																																																																																			-	superfamily_ARM-type_fold		0.602	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	protein_coding		C	XM_033379	-		49951504	+1	no_errors	ENST00000325239	ensembl	human	known	74_37	silent	SNP	0.000	T
GLI1	2735	genome.wustl.edu	37	12	57864284	57864284	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:57864284C>A	ENST00000228682.2	+	12	1852	c.1761C>A	c.(1759-1761)taC>taA	p.Y587*	GLI1_ENST00000546141.1_Nonsense_Mutation_p.Y546*|GLI1_ENST00000543426.1_Nonsense_Mutation_p.Y459*	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	587					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CCCAGCACTACCTGCTTCGGG	0.627																																					Pancreas(157;841 1936 10503 41495 50368)												0								ENSG00000111087						64.0	55.0	58.0					12																	57864284		2203	4300	6503	GLI1	SO:0001587	stop_gained	0			-	HGNC		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1761C>A	12.37:g.57864284C>A	ENSP00000228682:p.Tyr587*	Somatic	0	60	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	34	32.00	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Nonsense_Mutation	SNP	25	0.00	0	32	45.76	27	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y587*	ENST00000228682.2	37	c.1761	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	C	28.8	4.947592	0.92593	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	.	.	.	3.86	2.97	0.34412	.	0.000000	0.41823	D	0.000805	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.7525	0.28904	0.0:0.7988:0.0:0.2011	.	.	.	.	X	459;587;546;546	.	ENSP00000228682:Y587X	Y	+	3	2	GLI1	56150551	0.995000	0.38212	1.000000	0.80357	0.912000	0.54170	1.834000	0.39171	1.198000	0.43158	0.491000	0.48974	TAC	-	NULL		0.627	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	protein_coding	OTTHUMT00000394197.1	C	NM_005269	-		57864284	+1	no_errors	ENST00000228682	ensembl	human	known	74_37	nonsense	SNP	1.000	A
TRIAP1	51499	genome.wustl.edu	37	12	120884319	120884319	+	5'Flank	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:120884319C>G	ENST00000546954.1	-	0	0				AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_Silent_p.A12A|TRIAP1_ENST00000302432.3_5'Flank	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCCTTCGGGCCCCTCTGGGCG	0.687																																																	0								ENSG00000257218						50.0	56.0	54.0					12																	120884319		2203	4298	6501	GATC	SO:0001631	upstream_gene_variant	0			-	HGNC		CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787		12.37:g.120884319C>G	Exception_encountered	Somatic	0	110	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	62	24.39	B2R4Z7|Q5RKS5|Q6LCA7	Silent	SNP	21	0.00	0	42	31.15	19	pfam_Asp/Glu-ADT_csu,tigrfam_Asp/Glu-ADT_csu	p.A12	ENST00000546954.1	37	c.36	CCDS9198.1	12																																																																																			-	NULL		0.687	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATC	protein_coding	OTTHUMT00000108980.3	C	NM_016399	-		120884319	+1	no_errors	ENST00000551765	ensembl	human	known	74_37	silent	SNP	0.000	G
CDH15	1013	genome.wustl.edu	37	16	89249976	89249976	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:89249976delC	ENST00000289746.2	+	4	443	c.378delC	c.(376-378)gacfs	p.D126fs	CDH15_ENST00000521087.1_3'UTR	NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	126	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		TTGCCCTGGACCTGGGAGGAT	0.582																																																	0								ENSG00000129910						81.0	78.0	79.0					16																	89249976		2198	4300	6498	CDH15	SO:0001589	frameshift_variant	0				HGNC	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.378delC	16.37:g.89249976delC	ENSP00000289746:p.Asp126fs	Somatic	0	78	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53		Frame_Shift_Del	DEL	40	0.00	0	35	0.00	0	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L127fs	ENST00000289746.2	37	c.378	CCDS10976.1	16																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.582	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH15	protein_coding	OTTHUMT00000269920.1	C	NM_004933			89249976	+1	no_errors	ENST00000289746	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
HAVCR1	26762	genome.wustl.edu	37	5	156479558	156479572	+	In_Frame_Del	DEL	TTGGAACAGTCGTCA	TTGGAACAGTCGTCA	-	rs386693994|rs139041445|rs6149307|rs10068551|rs141023871|rs77147640|rs376729615|rs183130208|rs2862716	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TTGGAACAGTCGTCA	TTGGAACAGTCGTCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr5:156479558_156479572delTTGGAACAGTCGTCA	ENST00000339252.3	-	3	1005_1019	c.473_487delTGACGACTGTTCCAA	c.(472-489)atgacgactgttccaacg>acg	p.MTTVP158del	HAVCR1_ENST00000522693.1_In_Frame_Del_p.MTTVP158del|HAVCR1_ENST00000425854.1_In_Frame_Del_p.MTTVP158del|HAVCR1_ENST00000544197.1_In_Frame_Del_p.MTTVP158del|HAVCR1_ENST00000523175.1_In_Frame_Del_p.MTTVP158del	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	11 X 6 AA approximate tandem repeats of V-P-T-T-T-T].|Thr-rich.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)	p.T160_V161insT(1)		endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACAGTTGTCGTTGGAACAGTCGTCATTGGAACAGT	0.488														2916	0.582268	0.2579	0.6787	5008	,	,		26558	0.7629		0.6282	False		,,,				2504	0.7188																1	Insertion - In frame(1)	ovary(1)						ENSG00000113249		,,	1966,2046		278,1410,318					,,	-1.5	0.0		dbSNP_127	595	4901,3081		1333,2235,423	no	coding,coding,coding	HAVCR1	NM_012206.2,NM_001173393.1,NM_001099414.1	,,	1611,3645,741	A1A1,A1R,RR		38.5993,49.003,42.7464	,,	,,		6867,5127				HAVCR1	SO:0001651	inframe_deletion	0				HGNC	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.473_487delTGACGACTGTTCCAA	5.37:g.156479558_156479572delTTGGAACAGTCGTCA	ENSP00000344844:p.Met158_Pro162del	Somatic	NA	NA	NA		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O43656	In_Frame_Del	DEL	25	7.41	2	42	20.75	11	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.MTTVP158in_frame_del	ENST00000339252.3	37	c.487_473	CCDS43392.1	5																																																																																			-	NULL		0.488	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HAVCR1	protein_coding	OTTHUMT00000373698.1	TTGGAACAGTCGTCA				156479572	-1	no_errors	ENST00000425854	ensembl	human	known	74_37	in_frame_del	DEL	0.011:0.025:0.031:0.006:0.001:0.001:0.002:0.007:0.020:0.018:0.001:0.000:0.000:0.000:0.000	-
TRIAP1	51499	genome.wustl.edu	37	12	120884322	120884331	+	5'Flank	DEL	TCTGGGCGGG	TCTGGGCGGG	-	rs2235217|rs199833922|rs368556877	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TCTGGGCGGG	TCTGGGCGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:120884322_120884331delTCTGGGCGGG	ENST00000546954.1	-	0	0				AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_Frame_Shift_Del_p.PLGG13fs|TRIAP1_ENST00000302432.3_5'Flank	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TTCGGGCCCCTCTGGGCGGGCGCCAGGGCT	0.7																																																	0								ENSG00000257218																																			GATC	SO:0001631	upstream_gene_variant	0				HGNC		CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787		12.37:g.120884322_120884331delTCTGGGCGGG	Exception_encountered	Somatic	NA	NA	NA		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2R4Z7|Q5RKS5|Q6LCA7	Frame_Shift_Del	DEL	20	0.00	0	44	27.87	17	pfam_Asp/Glu-ADT_csu,tigrfam_Asp/Glu-ADT_csu	p.L14fs	ENST00000546954.1	37	c.39_48	CCDS9198.1	12																																																																																			-	NULL		0.700	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATC	protein_coding	OTTHUMT00000108980.3	TCTGGGCGGG	NM_016399			120884331	+1	no_errors	ENST00000551765	ensembl	human	known	74_37	frame_shift_del	DEL	0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000	-
OR10S1	219873	genome.wustl.edu	37	11	123847411	123847411	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr11:123847411G>T	ENST00000531945.1	-	1	1077	c.988C>A	c.(988-990)Ccc>Acc	p.P330T		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	330						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GACTATGGGGGTGGGCTGCCT	0.468																																																	0								ENSG00000196248						47.0	45.0	45.0					11																	123847411		2202	4299	6501	OR10S1	SO:0001583	missense	0			-	HGNC	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.988C>A	11.37:g.123847411G>T	ENSP00000431914:p.Pro330Thr	Somatic	0	16	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	26	0.00	0	41	48.75	39	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P330T	ENST00000531945.1	37	c.988	CCDS31701.1	11	.	.	.	.	.	.	.	.	.	.	G	10.35	1.325578	0.24080	.	.	ENSG00000196248	ENST00000531945	T	0.00036	8.86	4.82	0.233	0.15386	.	.	.	.	.	T	0.00109	0.0003	N	0.14661	0.345	0.09310	N	1	B	0.13145	0.007	B	0.14578	0.011	T	0.14755	-1.0461	9	0.72032	D	0.01	-5.7104	7.9196	0.29837	0.1736:0.5637:0.2626:0.0	.	330	Q8NGN2	O10S1_HUMAN	T	330	ENSP00000431914:P330T	ENSP00000431914:P330T	P	-	1	0	OR10S1	123352621	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	-1.551000	0.02178	-0.137000	0.11455	-0.222000	0.12452	CCC	-	NULL		0.468	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10S1	protein_coding	OTTHUMT00000387265.2	G	NM_001004474	-		123847411	-1	no_errors	ENST00000531945	ensembl	human	known	74_37	missense	SNP	0.014	T
ACTA2	59	genome.wustl.edu	37	10	90701026	90701026	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr10:90701026C>A	ENST00000458208.1	-	6	1050	c.576G>T	c.(574-576)atG>atT	p.M192I	ACTA2-AS1_ENST00000596007.1_RNA|ACTA2-AS1_ENST00000437930.4_RNA|STAMBPL1_ENST00000371927.3_Intron|ACTA2_ENST00000224784.6_Missense_Mutation_p.M192I|ACTA2_ENST00000480297.1_5'UTR	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta	192					glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		TCAGGATCTTCATGAGGTAGT	0.547																																																	0								ENSG00000107796						138.0	107.0	118.0					10																	90701026		2203	4300	6503	ACTA2	SO:0001583	missense	0			-	HGNC	X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.576G>T	10.37:g.90701026C>A	ENSP00000402373:p.Met192Ile	Somatic	0	73	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	9	76.92	B2R8A4|P03996|P04108|Q6FI19	Missense_Mutation	SNP	20	0.00	0	9	71.43	25	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.M192I	ENST00000458208.1	37	c.576	CCDS7392.1	10	.	.	.	.	.	.	.	.	.	.	C	17.69	3.453070	0.63290	.	.	ENSG00000107796	ENST00000224784;ENST00000458208;ENST00000544901	D;D	0.97352	-4.35;-4.35	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.95956	0.8683	L	0.49699	1.58	0.80722	D	1	B	0.12630	0.006	B	0.26770	0.073	D	0.92733	0.6201	10	0.87932	D	0	.	18.7419	0.91777	0.0:1.0:0.0:0.0	.	192	P62736	ACTA_HUMAN	I	192;192;147	ENSP00000224784:M192I;ENSP00000402373:M192I	ENSP00000224784:M192I	M	-	3	0	ACTA2	90691006	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.769000	0.85360	2.762000	0.94881	0.655000	0.94253	ATG	-	pfam_Actin-related,smart_Actin-related		0.547	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA2	protein_coding	OTTHUMT00000049264.1	C	NM_001613	-		90701026	-1	no_errors	ENST00000224784	ensembl	human	known	74_37	missense	SNP	1.000	A
IL21R	50615	genome.wustl.edu	37	16	27459684	27459684	+	Intron	SNP	G	G	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr16:27459684G>T	ENST00000337929.3	+	9	1340				IL21R_ENST00000395755.1_Intron|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000564089.1_Intron|IL21R_ENST00000395754.4_Intron|IL21R_ENST00000564583.1_Intron	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor						interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						gctgaggcaggagaatcactt	0.522			T	BCL6	NHL																																			Dom	yes		16	16p11	50615	interleukin 21 receptor		L	0								ENSG00000259954																																			IL21R-AS1	SO:0001627	intron_variant	0			-	HGNC	AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.868-171G>T	16.37:g.27459684G>T		Somatic	0	13	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	5	61.54	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	RNA	SNP	33	0.00	0	37	36.21	21	-	NULL	ENST00000337929.3	37	NULL	CCDS10630.1	16																																																																																			-	-		0.522	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL21R-AS1	protein_coding	OTTHUMT00000254578.2	G	NM_181078	-		27459684	-1	no_errors	ENST00000563191	ensembl	human	known	74_37	rna	SNP	0.004	T
ANP32E	81611	genome.wustl.edu	37	1	150199040	150199045	+	In_Frame_Del	DEL	TCCTCT	TCCTCT	-	rs56692627|rs28594165|rs68136184|rs28460085	byFrequency	TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TCCTCT	TCCTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr1:150199040_150199045delTCCTCT	ENST00000314136.8	-	5	945_950	c.576_581delAGAGGA	c.(574-582)gaagaggag>gag	p.192_194EEE>E	ANP32E_ENST00000369116.4_In_Frame_Del_p.60_62EEE>E|ANP32E_ENST00000369119.3_In_Frame_Del_p.144_146EEE>E|ANP32E_ENST00000533654.1_In_Frame_Del_p.KR137del|ANP32E_ENST00000369115.2_In_Frame_Del_p.60_62EEE>E|ANP32E_ENST00000369114.5_Intron|ANP32E_ENST00000436748.2_In_Frame_Del_p.151_153EEE>E	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	192	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			atcctcatcctcctcttcctcttcct	0.437														1756	0.350639	0.1596	0.3559	5008	,	,		19419	0.5446		0.2753	False		,,,				2504	0.4826																0								ENSG00000143401		,,	627,3639		79,469,1585					,,	-6.5	0.0		dbSNP_130	261	1908,6340		294,1320,2510	no	coding,coding,coding	ANP32E	NM_030920.3,NM_001136479.1,NM_001136478.2	,,	373,1789,4095	A1A1,A1R,RR		23.1329,14.6976,20.2573	,,	,,		2535,9979				ANP32E	SO:0001651	inframe_deletion	0				HGNC	AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.576_581delAGAGGA	1.37:g.150199046_150199051delTCCTCT	ENSP00000324074:p.Glu192_Glu193del	Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	In_Frame_Del	DEL	25	28.57	10	56	23.29	17	pfam_Leu-rich_rpt	p.EE193in_frame_del	ENST00000314136.8	37	c.581_576	CCDS946.1	1																																																																																			-	NULL		0.437	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32E	protein_coding	OTTHUMT00000035056.1	TCCTCT	NM_030920			150199045	-1	no_errors	ENST00000314136	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.006:0.000:0.058:0.106:0.091	-
UBAC2	337867	genome.wustl.edu	37	13	100038221	100038221	+	IGR	SNP	C	C	G			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr13:100038221C>G	ENST00000403766.3	+	0	1375				UBAC2_ENST00000460562.1_3'UTR|UBAC2_ENST00000376440.2_3'UTR	NM_001144072.1	NP_001137544.1	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2						protein localization to endoplasmic reticulum (GO:0070972)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)	10	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GTTAATTTTGCTCAGAGTATC	0.483																																																	0								ENSG00000134882																																			UBAC2	SO:0001628	intergenic_variant	0			-	HGNC	AK055110	CCDS9490.1, CCDS45064.1	13q32.3	2012-02-01	2007-04-20	2007-04-20	ENSG00000134882	ENSG00000134882			20486	protein-coding gene	gene with protein product			"""phosphoglycerate dehydrogenase like 1"""	PHGDHL1			Standard	NM_177967		Approved	FLJ30548, RP11-178C10.1	uc001voa.4	Q8NBM4	OTTHUMG00000017267		13.37:g.100038221C>G		Somatic	0	12	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	3	72.73	B3KNV7|Q0VAB5|Q5W0W6|Q5W0W9|Q6GQR2|Q6P4B0|Q8N2E8|Q96NW2	RNA	SNP	29	0.00	0	7	81.08	30	-	NULL	ENST00000403766.3	37	NULL	CCDS45064.1	13																																																																																			-	-		0.483	UBAC2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	UBAC2	protein_coding	OTTHUMT00000045588.1	C	NM_177967	-		100038221	+1	no_errors	ENST00000460562	ensembl	human	known	74_37	rna	SNP	0.685	G
SLC17A4	10050	genome.wustl.edu	37	6	25771211	25771211	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr6:25771211T>A	ENST00000377905.4	+	6	796	c.677T>A	c.(676-678)aTa>aAa	p.I226K	SLC17A4_ENST00000439485.2_Intron|SLC17A4_ENST00000397076.2_Intron	NM_005495.2	NP_005486.1	Q9Y2C5	S17A4_HUMAN	solute carrier family 17, member 4	226					phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	sodium:phosphate symporter activity (GO:0005436)			breast(4)|endometrium(1)|kidney(4)|large_intestine(3)|lung(21)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						TGCCAGACCATAGGATGGCCT	0.458																																																	0								ENSG00000146039						310.0	291.0	297.0					6																	25771211		2203	4300	6503	SLC17A4	SO:0001583	missense	0			-	HGNC	AB020527	CCDS4564.1, CCDS75411.1	6p22.2	2013-07-18	2013-07-18		ENSG00000146039	ENSG00000146039		"""Solute carriers"""	10932	protein-coding gene	gene with protein product		604216	"""solute carrier family 17 (sodium phosphate), member 4"""			10319585	Standard	NM_005495		Approved	KIAA2138	uc003nfe.3	Q9Y2C5	OTTHUMG00000014410	ENST00000377905.4:c.677T>A	6.37:g.25771211T>A	ENSP00000367137:p.Ile226Lys	Somatic	0	128	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	6	87.76	B4DDV9|E7EPE8|E7EU17|Q32MB7|Q32MB8	Missense_Mutation	SNP	41	0.00	0	6	85.71	36	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.I226K	ENST00000377905.4	37	c.677	CCDS4564.1	6	.	.	.	.	.	.	.	.	.	.	T	18.38	3.610253	0.66558	.	.	ENSG00000146039	ENST00000377905	T	0.59364	0.27	5.69	1.9	0.25705	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.283730	0.05320	N	0.526459	T	0.26882	0.0658	L	0.42744	1.35	0.09310	N	1	B	0.15473	0.013	B	0.19148	0.024	T	0.23048	-1.0199	10	0.44086	T	0.13	.	4.2972	0.10908	0.1508:0.1684:0.0:0.6807	.	226	Q9Y2C5	S17A4_HUMAN	K	226	ENSP00000367137:I226K	ENSP00000367137:I226K	I	+	2	0	SLC17A4	25879190	0.160000	0.22878	0.003000	0.11579	0.956000	0.61745	2.253000	0.43205	0.500000	0.27991	0.533000	0.62120	ATA	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.458	SLC17A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A4	protein_coding	OTTHUMT00000040068.1	T		-		25771211	+1	no_errors	ENST00000377905	ensembl	human	known	74_37	missense	SNP	0.004	A
PREP	5550	genome.wustl.edu	37	6	105726234	105726234	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr6:105726234G>T	ENST00000369110.3	-	15	2110	c.1918C>A	c.(1918-1920)Cat>Aat	p.H640N	RP3-355L5.4_ENST00000452363.1_RNA	NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	640					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	CGGTCATCATGGTCAGCAGTG	0.522																																																	0								ENSG00000085377						116.0	109.0	111.0					6																	105726234		2203	4300	6503	PREP	SO:0001583	missense	0			-	HGNC		CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.1918C>A	6.37:g.105726234G>T	ENSP00000358106:p.His640Asn	Somatic	0	36	0.00		NA	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q8N6D4	Missense_Mutation	SNP	32	0.00	0	72	0.00	0	pfam_Pept_S9A_N,pfam_Peptidase_S9,prints_Peptidase_S9A	p.H640N	ENST00000369110.3	37	c.1918	CCDS5053.1	6	.	.	.	.	.	.	.	.	.	.	G	28.1	4.888714	0.91814	.	.	ENSG00000085377	ENST00000369110	T	0.30714	1.52	5.88	5.88	0.94601	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.51635	0.1686	M	0.70842	2.15	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.50939	-0.8768	10	0.66056	D	0.02	-29.5648	20.2279	0.98344	0.0:0.0:1.0:0.0	.	640	P48147	PPCE_HUMAN	N	640	ENSP00000358106:H640N	ENSP00000358106:H640N	H	-	1	0	PREP	105832927	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	9.476000	0.97823	2.778000	0.95560	0.655000	0.94253	CAT	-	pfam_Peptidase_S9,prints_Peptidase_S9A		0.522	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREP	protein_coding	OTTHUMT00000041658.1	G		-		105726234	-1	no_errors	ENST00000369110	ensembl	human	known	74_37	missense	SNP	1.000	T
PLCZ1	89869	genome.wustl.edu	37	12	18854541	18854549	+	In_Frame_Del	DEL	TCCTCCTCC	TCCTCCTCC	-	rs71064021|rs11279217|rs531863439|rs76947474		TCGA-FX-A48G-01A-11D-A24N-09	TCGA-FX-A48G-11A-12D-A24N-09	TCCTCCTCC	TCCTCCTCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cb5e1546-cda6-4991-911c-f3dd9f1a475a	9ff2246f-8c56-445f-b2d9-aeeff5ce527a	g.chr12:18854541_18854549delTCCTCCTCC	ENST00000538330.1	-	5	630_638	c.249_257delGGAGGAGGA	c.(247-258)gaggaggaggat>gat	p.EEE83del	PLCZ1_ENST00000542762.1_Intron|PLCZ1_ENST00000447925.2_Intron|PLCZ1_ENST00000266505.7_Intron|PLCZ1_ENST00000435379.1_Intron|PLCZ1_ENST00000541695.1_Intron|PLCZ1_ENST00000539875.1_Intron					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					TTTGAATTTAtcctcctcctcctcctcct	0.44																																																	0								ENSG00000139151																																			PLCZ1	SO:0001651	inframe_deletion	0				HGNC	AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.249_257delGGAGGAGGA	12.37:g.18854550_18854558delTCCTCCTCC	ENSP00000445880:p.Glu83_Glu85del	Somatic	NA	NA	NA		0.6935361084970166	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	11	15.38	2	22	12.00	3	pfam_PLipase_C_Pinositol-sp_Y,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.EEE83in_frame_del	ENST00000538330.1	37	c.257_249		12																																																																																			-	superfamily_PLC-like_Pdiesterase_TIM-brl		0.440	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	PLCZ1	protein_coding	OTTHUMT00000401666.3	TCCTCCTCC	NM_033123			18854549	-1	no_errors	ENST00000538330	ensembl	human	putative	74_37	in_frame_del	DEL	0.019:0.025:0.029:0.032:0.034:0.034:0.032:0.029:0.024	-
