#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCA10	10349	genome.wustl.edu	37	17	67215820	67215820	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr17:67215820C>T	ENST00000269081.4	-	7	1305	c.396G>A	c.(394-396)atG>atA	p.M132I	ABCA10_ENST00000432313.2_Missense_Mutation_p.M132I|ABCA10_ENST00000416101.2_Missense_Mutation_p.M132I	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	132					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					ACCATTCATTCATAATTTCTC	0.303																																																	0								ENSG00000154263						70.0	74.0	72.0					17																	67215820		2202	4294	6496	ABCA10	SO:0001583	missense	0			-	HGNC	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.396G>A	17.37:g.67215820C>T	ENSP00000269081:p.Met132Ile	Somatic	0	41	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	39	25.00	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.M132I	ENST00000269081.4	37	c.396	CCDS11684.1	17	.	.	.	.	.	.	.	.	.	.	C	4.562	0.104416	0.08731	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	D;D;D	0.86497	-2.13;-2.13;-2.13	3.73	-3.28	0.05033	.	0.765734	0.10367	N	0.683315	T	0.59115	0.2170	N	0.01109	-1.01	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.53472	-0.8434	10	0.21014	T	0.42	.	4.7907	0.13247	0.0:0.308:0.2984:0.3936	.	132;132	E5RFP5;Q8WWZ4	.;ABCAA_HUMAN	I	132	ENSP00000269081:M132I;ENSP00000407772:M132I;ENSP00000387674:M132I	ENSP00000269081:M132I	M	-	3	0	ABCA10	64727415	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.202000	0.09451	-0.589000	0.05874	-1.205000	0.01647	ATG	-	NULL		0.303	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA10	protein_coding	OTTHUMT00000379881.4	C	NM_080282	-		67215820	-1	no_errors	ENST00000269081	ensembl	human	known	74_37	missense	SNP	0.000	T
LINC00636	285205	genome.wustl.edu	37	3	107647001	107647002	+	lincRNA	INS	-	-	A	rs34976355|rs201370847|rs200833950|rs35976982|rs66542766		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr3:107647001_107647002insA	ENST00000494231.1	+	0	511_512					NR_015394.1				long intergenic non-protein coding RNA 636																		aacagacaaacaaaaaaaaaac	0.495																																																	0								ENSG00000240423																																			LINC00636			0				HGNC			3q13.12	2012-10-12			ENSG00000240423	ENSG00000240423		"""Long non-coding RNAs"""	27702	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_015394		Approved		uc003dws.4		OTTHUMG00000159197		3.37:g.107647011_107647011dupA		Somatic	0	31	0.00		0.5992772487206903	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000494231.1	37	NULL		3																																																																																			-	-		0.495	LINC00636-001	KNOWN	basic|exp_conf	lincRNA	LINC00636	lincRNA	OTTHUMT00000353792.1	-	NR_015394			107647002	+1	no_errors	ENST00000494231	ensembl	human	known	74_37	rna	INS	0.004:0.003	A
HERC6	55008	genome.wustl.edu	37	4	89338623	89338623	+	Silent	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr4:89338623C>T	ENST00000264346.7	+	13	1664	c.1605C>T	c.(1603-1605)atC>atT	p.I535I	HERC6_ENST00000380265.5_Silent_p.I535I	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	535					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		ATCCGCTGATCCAGATGCTTA	0.408																																																	0								ENSG00000138642						72.0	66.0	68.0					4																	89338623		1872	4097	5969	HERC6	SO:0001819	synonymous_variant	0			-	HGNC	AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.1605C>T	4.37:g.89338623C>T		Somatic	0	68	0.00		0.5992772487206903	29	6.45	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	45	40.00	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_RCC1/BLIP-II,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.I535	ENST00000264346.7	37	c.1605	CCDS47098.1	4																																																																																			-	NULL		0.408	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HERC6	protein_coding	OTTHUMT00000363259.2	C		-		89338623	+1	no_errors	ENST00000264346	ensembl	human	known	74_37	silent	SNP	1.000	T
ADAM33	80332	genome.wustl.edu	37	20	3650540	3650541	+	Intron	INS	-	-	CACCACC	rs17513846|rs201776286	byFrequency	TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr20:3650540_3650541insCACCACC	ENST00000356518.2	-	20	2482				ADAM33_ENST00000466620.1_Intron|ADAM33_ENST00000350009.2_Intron|ADAM33_ENST00000379861.4_Intron	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33						proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						CCAGGCTCTGACAGCAGCCTGG	0.599														4162	0.83107	0.9236	0.7695	5008	,	,		18177	0.6438		0.8738	False		,,,				2504	0.8988																0								ENSG00000149451																																			ADAM33	SO:0001627	intron_variant	0				HGNC	AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.2241-256->GGTGGTG	20.37:g.3650540_3650541insCACCACC		Somatic	NA	NA	NA		0.5992772487206903	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000356518.2	37	NULL	CCDS13058.1	20																																																																																			-	-		0.599	ADAM33-001	KNOWN	basic|CCDS	protein_coding	ADAM33	protein_coding	OTTHUMT00000077763.2	-	NM_025220			3650541	-1	no_errors	ENST00000483362	ensembl	human	known	74_37	rna	INS	0.000:0.000	CACCACC
PCLO	27445	genome.wustl.edu	37	7	82583496	82583496	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr7:82583496C>A	ENST00000333891.9	-	5	7110	c.6773G>T	c.(6772-6774)aGt>aTt	p.S2258I	PCLO_ENST00000423517.2_Missense_Mutation_p.S2258I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ATGATCAGCACTAGCTCTACC	0.388																																																	0								ENSG00000186472						79.0	76.0	77.0					7																	82583496		1878	4101	5979	PCLO	SO:0001583	missense	0			-	HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6773G>T	7.37:g.82583496C>A	ENSP00000334319:p.Ser2258Ile	Somatic	0	48	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	19	52.50		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.S2258I	ENST00000333891.9	37	c.6773	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	3.222	-0.159397	0.06544	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16897	2.31;2.31	5.7	2.54	0.30619	.	.	.	.	.	T	0.12603	0.0306	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.005	T	0.28235	-1.0050	9	0.87932	D	0	.	3.541	0.07811	0.2418:0.5031:0.1078:0.1474	.	2258;2258	Q9Y6V0-5;Q9Y6V0-6	.;.	I	2189;2258;2258	ENSP00000334319:S2258I;ENSP00000388393:S2258I	ENSP00000334319:S2258I	S	-	2	0	PCLO	82421432	0.000000	0.05858	0.020000	0.16555	0.397000	0.30659	-0.036000	0.12185	0.731000	0.32448	-0.235000	0.12190	AGT	-	NULL		0.388	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	C	NM_014510	-		82583496	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	SNP	0.000	A
AC079610.1	0	genome.wustl.edu	37	2	213628318	213628325	+	RNA	DEL	TGTGTGTG	TGTGTGTG	-	rs57305053|rs34611679|rs76851700		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	TGTGTGTG	TGTGTGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr2:213628318_213628325delTGTGTGTG	ENST00000415387.1	-	0	381				AC093865.1_ENST00000408461.1_RNA																							tatatatatatgtgtgtgtatatatata	0.197																																																	0								ENSG00000221388																																			AC093865.1			0				Clone_based_ensembl_gene																													2.37:g.213628318_213628325delTGTGTGTG		Somatic	NA	NA	NA		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000415387.1	37	NULL		2																																																																																			-	-		0.197	AC079610.1-001	KNOWN	basic	sense_overlapping	ENSG00000221388	sense_overlapping	OTTHUMT00000337265.1	TGTGTGTG				213628325	-1	no_errors	ENST00000408461	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
YEATS2	55689	genome.wustl.edu	37	3	183520323	183520324	+	Intron	INS	-	-	TATATATATACACGTGTATATATATACACGTGTA	rs11276625|rs74710373	byFrequency	TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr3:183520323_183520324insTATATATATACACGTGTATATATATACACGTGTA	ENST00000305135.5	+	26	3697				AC131160.1_ENST00000401347.1_RNA	NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2						chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			atatacacgtgtatatacacac	0.332																																																	0								ENSG00000216166																																			AC131160.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.3503-720->TATATATATACACGTGTATATATATACACGTGTA	3.37:g.183520323_183520324insTATATATATACACGTGTATATATATACACGTGTA		Somatic	NA	NA	NA		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7E2B9|D3DNS9|Q641P6|Q9NW96	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305135.5	37	NULL	CCDS43175.1	3																																																																																			-	-		0.332	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216166	protein_coding	OTTHUMT00000346507.2	-	NM_018023			183520324	-1	no_errors	ENST00000401347	ensembl	human	novel	74_37	rna	INS	0.000:0.000	TATATATATACACGTGTATATATATACACGTGTA
LAMC3	10319	genome.wustl.edu	37	9	133967191	133967191	+	3'UTR	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr9:133967191C>T	ENST00000361069.4	+	0	4878				LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3						astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		CCCAGATCCCCGGCACACACT	0.637																																																	0								ENSG00000050555						30.0	30.0	30.0					9																	133967191		2203	4300	6503	LAMC3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.*17C>T	9.37:g.133967191C>T		Somatic	0	107	0.00		0.5992772487206903	26	35.00	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	49	40.24	B1APX9|B1APY0|Q59H72	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361069.4	37	NULL	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	C	6.557	0.471086	0.12461	.	.	ENSG00000050555	ENST00000320021	.	.	.	4.17	-2.26	0.06867	.	.	.	.	.	T	0.34978	0.0916	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.41034	-0.9531	5	0.62326	D	0.03	.	4.7924	0.13256	0.0:0.3009:0.1664:0.5327	.	.	.	.	W	520	.	ENSP00000325873:R520W	R	+	1	2	LAMC3	132957012	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.926000	0.01562	-0.333000	0.08476	-0.140000	0.14226	CGG	-	-		0.637	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	protein_coding	OTTHUMT00000054717.3	C	NM_006059	-		133967191	+1	no_errors	ENST00000462567	ensembl	human	known	74_37	rna	SNP	0.000	T
C10orf95	79946	genome.wustl.edu	37	10	104210112	104210112	+	3'UTR	SNP	G	G	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr10:104210112G>A	ENST00000239125.1	-	0	950				RP11-18I14.10_ENST00000473970.2_RNA|RP11-18I14.10_ENST00000596045.1_RNA|RP11-18I14.10_ENST00000494270.2_RNA|RP11-18I14.10_ENST00000492465.2_RNA|RP11-18I14.10_ENST00000594818.1_RNA|RP11-18I14.10_ENST00000596366.1_RNA	NM_024886.1	NP_079162.1	Q9H7T3	CJ095_HUMAN	chromosome 10 open reading frame 95											liver(1)	1		Colorectal(252;0.207)		Epithelial(162;8.34e-09)|all cancers(201;1.95e-07)|BRCA - Breast invasive adenocarcinoma(275;0.213)		CGCCTCCCGCGCACAGGTGAG	0.647																																																	0								ENSG00000269609																																			RP11-18I14.10	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AK024342	CCDS7534.1	10q24.32	2014-02-19	2014-02-19	2014-02-19	ENSG00000120055	ENSG00000120055			25880	protein-coding gene	gene with protein product							Standard	NM_024886		Approved	FLJ14280	uc001kvo.1	Q9H7T3	OTTHUMG00000018959	ENST00000239125.1:c.*102C>T	10.37:g.104210112G>A		Somatic	0	58	0.00		0.5992772487206903	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A0AVQ7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000239125.1	37	NULL	CCDS7534.1	10																																																																																			-	-		0.647	C10orf95-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100505761	protein_coding	OTTHUMT00000050065.1	G	NM_024886	-		104210112	+1	no_errors	ENST00000492465	ensembl	human	known	74_37	rna	SNP	0.000	A
UMOD	7369	genome.wustl.edu	37	16	20357585	20357585	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr16:20357585G>T	ENST00000570689.1	-	5	1191	c.1045C>A	c.(1045-1047)Ctg>Atg	p.L349M	UMOD_ENST00000396138.4_Missense_Mutation_p.L398M|UMOD_ENST00000424589.1_Missense_Mutation_p.L382M|UMOD_ENST00000396134.2_Missense_Mutation_p.L382M|UMOD_ENST00000396142.2_Missense_Mutation_p.L349M|UMOD_ENST00000302509.4_Missense_Mutation_p.L349M			P07911	UROM_HUMAN	uromodulin	349	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				cellular defense response (GO:0006968)|chemical homeostasis (GO:0048878)|excretion (GO:0007588)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte cell-cell adhesion (GO:0007159)|metanephric ascending thin limb development (GO:0072218)|metanephric distal convoluted tubule development (GO:0072221)|metanephric thick ascending limb development (GO:0072233)|negative regulation of cell proliferation (GO:0008285)|neutrophil migration (GO:1990266)|regulation of ion homeostasis (GO:2000021)|response to organic substance (GO:0010033)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|primary cilium (GO:0072372)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|IgG binding (GO:0019864)	p.L349M(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(20)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						AGACTCTTCAGCTGGCACTTG	0.557																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000169344						91.0	84.0	86.0					16																	20357585		2203	4300	6503	UMOD	SO:0001583	missense	0			-	HGNC	M17778	CCDS10583.1, CCDS61876.1	16p12.3	2008-06-23	2008-06-23		ENSG00000169344	ENSG00000169344			12559	protein-coding gene	gene with protein product	"""Tamm-Horsfall glycoprotein"", ""uromucoid"""	191845	"""uromodulin (uromucoid, Tamm-Horsfall glycoprotein)"""			8382593	Standard	NM_003361		Approved		uc002dha.3	P07911	OTTHUMG00000131488	ENST00000570689.1:c.1045C>A	16.37:g.20357585G>T	ENSP00000460548:p.Leu349Met	Somatic	0	42	0.00		0.5992772487206903	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B3KP48|B3KRN9|E9PEA4|Q540J6|Q6ZS84|Q8IYG0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZP_dom,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_ZP_dom,pfscan_EG-like_dom,pfscan_ZP_dom,prints_ZP_dom	p.L382M	ENST00000570689.1	37	c.1144	CCDS10583.1	16	.	.	.	.	.	.	.	.	.	.	G	17.26	3.343986	0.61073	.	.	ENSG00000169344	ENST00000396138;ENST00000396134;ENST00000424589;ENST00000302509;ENST00000429954;ENST00000396142	D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72	4.68	3.72	0.42706	Zona pellucida sperm-binding protein (3);	0.000000	0.37530	N	0.002056	D	0.91002	0.7170	M	0.86178	2.8	0.33786	D	0.624854	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.94094	0.7356	10	0.66056	D	0.02	-7.2891	12.7381	0.57236	0.0:0.1666:0.8334:0.0	.	382;349	E9PEA4;P07911	.;UROM_HUMAN	M	349;382;382;349;327;349	ENSP00000379438:L382M;ENSP00000416346:L382M;ENSP00000306279:L349M;ENSP00000379446:L349M	ENSP00000306279:L349M	L	-	1	2	UMOD	20265086	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.077000	0.50089	0.925000	0.37094	0.313000	0.20887	CTG	-	pfam_ZP_dom,smart_ZP_dom,pfscan_ZP_dom		0.557	UMOD-008	KNOWN	basic|appris_principal|CCDS	protein_coding	UMOD	protein_coding	OTTHUMT00000436862.1	G		-		20357585	-1	no_errors	ENST00000424589	ensembl	human	known	74_37	missense	SNP	1.000	T
EFNA5	1946	genome.wustl.edu	37	5	106763174	106763174	+	Silent	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr5:106763174G>T	ENST00000333274.6	-	2	443	c.162C>A	c.(160-162)atC>atA	p.I54I	EFNA5_ENST00000509503.1_Silent_p.I54I	NM_001962.2	NP_001953.1	P52803	EFNA5_HUMAN	ephrin-A5	54	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell-cell adhesion (GO:0022407)|regulation of focal adhesion assembly (GO:0051893)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rho GTPase activity (GO:0032319)|retinal ganglion cell axon guidance (GO:0031290)	anchored component of external side of plasma membrane (GO:0031362)|plasma membrane (GO:0005886)	chemorepellent activity (GO:0045499)|ephrin receptor binding (GO:0046875)			large_intestine(6)	6		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		GGTAGTCATTGATACAGACAT	0.413																																																	0								ENSG00000184349						125.0	125.0	125.0					5																	106763174		2202	4300	6502	EFNA5	SO:0001819	synonymous_variant	0			-	HGNC	U26403	CCDS4097.1	5q21	2011-03-09			ENSG00000184349	ENSG00000184349		"""Ephrins"""	3225	protein-coding gene	gene with protein product		601535		EPLG7		8661153, 9245480	Standard	NM_001962		Approved	AF1, LERK7	uc003kol.3	P52803	OTTHUMG00000128741	ENST00000333274.6:c.162C>A	5.37:g.106763174G>T		Somatic	0	34	0.00		0.5992772487206903	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.I54	ENST00000333274.6	37	c.162	CCDS4097.1	5																																																																																			-	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin		0.413	EFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNA5	protein_coding	OTTHUMT00000250652.1	G	NM_001962	-		106763174	-1	no_errors	ENST00000333274	ensembl	human	known	74_37	silent	SNP	1.000	T
SACS	26278	genome.wustl.edu	37	13	23906926	23906926	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr13:23906926G>C	ENST00000382292.3	-	9	11362	c.11089C>G	c.(11089-11091)Ctc>Gtc	p.L3697V	SACS_ENST00000402364.1_Missense_Mutation_p.L2947V|SACS_ENST00000382298.3_Missense_Mutation_p.L3697V			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3697					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		AACAGCTGGAGTACATCACAT	0.398																																																	0								ENSG00000151835						132.0	120.0	124.0					13																	23906926		2203	4300	6503	SACS	SO:0001583	missense	0			-	HGNC	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.11089C>G	13.37:g.23906926G>C	ENSP00000371729:p.Leu3697Val	Somatic	0	38	0.00		0.5992772487206903	31	24.39	10	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	43	24.56	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HEPN,pfam_Ubiquitin_dom,superfamily_HATPase_ATP-bd,superfamily_DnaJ_domain,smart_HEPN,pfscan_HEPN,pfscan_DnaJ_domain,pfscan_Ubiquitin_supergroup	p.L3697V	ENST00000382292.3	37	c.11089	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	11.80	1.746567	0.30955	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.87571	-2.12;-2.27;-2.12	5.8	2.64	0.31445	.	0.124501	0.52532	D	0.000079	T	0.64962	0.2646	N	0.08118	0	0.24694	N	0.993294	B	0.06786	0.001	B	0.06405	0.002	T	0.50816	-0.8783	10	0.06494	T	0.89	.	2.5292	0.04698	0.1106:0.1555:0.4173:0.3165	.	3697	Q9NZJ4	SACS_HUMAN	V	3697;2947;3697	ENSP00000371729:L3697V;ENSP00000385844:L2947V;ENSP00000371735:L3697V	ENSP00000371729:L3697V	L	-	1	0	SACS	22804926	1.000000	0.71417	0.459000	0.27081	0.610000	0.37248	3.472000	0.53114	0.759000	0.33084	0.563000	0.77884	CTC	-	NULL		0.398	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	protein_coding	OTTHUMT00000044148.3	G	NM_014363	-		23906926	-1	no_errors	ENST00000382292	ensembl	human	known	74_37	missense	SNP	0.713	C
TLE3	7090	genome.wustl.edu	37	15	70346883	70346883	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr15:70346883G>T	ENST00000558939.1	-	16	3106	c.1729C>A	c.(1729-1731)Ccc>Acc	p.P577T	TLE3_ENST00000440567.3_Missense_Mutation_p.P567T|TLE3_ENST00000560939.1_Missense_Mutation_p.P579T|TLE3_ENST00000557907.1_Missense_Mutation_p.P569T|TLE3_ENST00000559191.1_Missense_Mutation_p.P158T|TLE3_ENST00000558201.1_Missense_Mutation_p.P583T|TLE3_ENST00000559929.1_Missense_Mutation_p.P587T|TLE3_ENST00000557997.1_Missense_Mutation_p.P569T|TLE3_ENST00000539550.1_Missense_Mutation_p.P504T|TLE3_ENST00000559048.1_Missense_Mutation_p.P577T|TLE3_ENST00000560589.1_Missense_Mutation_p.P521T|TLE3_ENST00000317509.8_Missense_Mutation_p.P565T|TLE3_ENST00000442299.2_Missense_Mutation_p.P569T|TLE3_ENST00000558379.1_Missense_Mutation_p.P572T|TLE3_ENST00000451782.2_Missense_Mutation_p.P574T	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	577					Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TAACAGGCGGGAGCCGAGGAC	0.657																																																	0								ENSG00000140332						41.0	45.0	44.0					15																	70346883		2192	4296	6488	TLE3	SO:0001583	missense	0			-	HGNC	M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.1729C>A	15.37:g.70346883G>T	ENSP00000452871:p.Pro577Thr	Somatic	0	33	0.00		0.5992772487206903	36	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.P577T	ENST00000558939.1	37	c.1729	CCDS45293.1	15	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842898	0.71488	.	.	ENSG00000140332	ENST00000442299;ENST00000451782;ENST00000317509;ENST00000440567;ENST00000539550	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	4.83	3.88	0.44766	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.119998	0.64402	D	0.000019	T	0.66733	0.2819	L	0.37850	1.14	0.80722	D	1	D;D;D;D;D;P;D;P	0.76494	0.999;0.999;0.992;0.998;0.999;0.926;0.999;0.909	D;D;P;D;D;P;D;P	0.91635	0.986;0.994;0.882;0.986;0.999;0.783;0.998;0.741	T	0.69135	-0.5225	10	0.56958	D	0.05	0.8461	14.5753	0.68243	0.0:0.1473:0.8527:0.0	.	567;574;569;572;565;577;577;504	F8W964;E9PD64;Q04726-3;Q6PI57;Q04726-2;Q04726;Q04726-4;F5H7D6	.;.;.;.;.;TLE3_HUMAN;.;.	T	569;574;577;567;504	ENSP00000390007:P569T;ENSP00000394717:P574T;ENSP00000415057:P567T;ENSP00000442594:P504T	ENSP00000319233:P577T	P	-	1	0	TLE3	68133937	1.000000	0.71417	0.111000	0.21465	0.873000	0.50193	9.530000	0.98051	1.203000	0.43233	0.462000	0.41574	CCC	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.657	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE3	protein_coding	OTTHUMT00000416913.1	G	NM_005078	-		70346883	-1	no_errors	ENST00000558939	ensembl	human	known	74_37	missense	SNP	0.996	T
CFAP54	144535	genome.wustl.edu	37	12	96897758	96897758	+	Missense_Mutation	SNP	A	A	C			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr12:96897758A>C	ENST00000524981.4	+	3	541	c.518A>C	c.(517-519)aAa>aCa	p.K173T	C12orf55_ENST00000298953.3_Missense_Mutation_p.K173T			Q96N23	CL055_HUMAN		173																	ACTCAATTCAAAGCTACCTTT	0.338																																																	0								ENSG00000188596																																			C12orf55	SO:0001583	missense	0			-	HGNC																												ENST00000524981.4:c.518A>C	12.37:g.96897758A>C	ENSP00000431759:p.Lys173Thr	Somatic	0	75	0.00		0.5992772487206903	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	44	41.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3	p.K173T	ENST00000524981.4	37	c.518		12	.	.	.	.	.	.	.	.	.	.	A	14.37	2.515848	0.44763	.	.	ENSG00000188596	ENST00000524981;ENST00000298953	T	0.35048	1.33	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.55162	0.1903	M	0.70275	2.135	0.80722	D	1	.	.	.	.	.	.	T	0.58634	-0.7602	8	0.66056	D	0.02	-27.2342	15.5162	0.75826	1.0:0.0:0.0:0.0	.	.	.	.	T	173	ENSP00000298953:K173T	ENSP00000298953:K173T	K	+	2	0	C12orf63	95421889	0.993000	0.37304	0.917000	0.36280	0.008000	0.06430	3.290000	0.51755	2.206000	0.71126	0.533000	0.62120	AAA	-	NULL		0.338	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	protein_coding	OTTHUMT00000395046.4	A		-		96897758	+1	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	SNP	0.988	C
NAPRT	93100	genome.wustl.edu	37	8	144658831	144658831	+	Missense_Mutation	SNP	G	G	T	rs143378632		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr8:144658831G>T	ENST00000449291.2	-	6	1160	c.866C>A	c.(865-867)aCc>aAc	p.T289N	NAPRT1_ENST00000276844.7_Missense_Mutation_p.T289N|RP11-661A12.9_ENST00000531730.1_RNA|NAPRT1_ENST00000460623.1_5'Flank|RP11-661A12.7_ENST00000529247.1_RNA|NAPRT1_ENST00000426292.3_Missense_Mutation_p.T289N|NAPRT1_ENST00000435154.3_Missense_Mutation_p.T289N																endometrium(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	6	all_cancers(97;6.49e-11)|all_epithelial(106;4.73e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.014)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.146)			CACGCTGTAGGTGTCCAGGAG	0.642																																																	0								ENSG00000147813						17.0	19.0	18.0					8																	144658831		2199	4291	6490	NAPRT1	SO:0001583	missense	0			-	HGNC																												ENST00000449291.2:c.866C>A	8.37:g.144658831G>T	ENSP00000401508:p.Thr289Asn	Somatic	0	19	0.00		0.5992772487206903	68	34.91	37	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	17	41.38		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nic_PRibTrfase-Fam,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nic_PRibTrfase-Fam,tigrfam_Nic_PRibTrfase_pncB	p.T289N	ENST00000449291.2	37	c.866	CCDS6403.2	8	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916027	0.52546	.	.	ENSG00000147813	ENST00000435154;ENST00000449291;ENST00000340490;ENST00000426292;ENST00000276844	T;T;T;T;T	0.74209	-0.63;-0.65;-0.82;-0.75;-0.66	4.4	3.52	0.40303	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.222984	0.43919	D	0.000516	D	0.87661	0.6233	M	0.93763	3.455	0.24761	N	0.992927	P;D;B;B	0.76494	0.565;0.999;0.29;0.338	B;D;B;B	0.67900	0.239;0.954;0.154;0.239	T	0.80823	-0.1210	10	0.87932	D	0	-17.1985	11.0289	0.47761	0.0909:0.0:0.9091:0.0	.	289;289;289;289	C9J8U2;G5E977;Q6XQN6-3;Q6XQN6	.;.;.;PNCB_HUMAN	N	289	ENSP00000405670:T289N;ENSP00000401508:T289N;ENSP00000341136:T289N;ENSP00000390949:T289N;ENSP00000276844:T289N	ENSP00000276844:T289N	T	-	2	0	NAPRT1	144729974	1.000000	0.71417	0.942000	0.38095	0.564000	0.35744	3.863000	0.56016	1.042000	0.40150	0.643000	0.83706	ACC	-	pfam_Nic_PRibTrfase-Fam,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nic_PRibTrfase-Fam,tigrfam_Nic_PRibTrfase_pncB		0.642	NAPRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NAPRT1	protein_coding	OTTHUMT00000346708.3	G		-		144658831	-1	no_errors	ENST00000276844	ensembl	human	known	74_37	missense	SNP	0.999	T
TPT1	7178	genome.wustl.edu	37	13	45912841	45912841	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr13:45912841G>T	ENST00000530705.1	-	5	770	c.470C>A	c.(469-471)aCc>aAc	p.T157N	TPT1_ENST00000309246.5_Missense_Mutation_p.T157N|TPT1_ENST00000379060.4_Missense_Mutation_p.T145N|TPT1-AS1_ENST00000412946.2_RNA|TPT1_ENST00000379055.1_Missense_Mutation_p.T123N|RP11-290D2.6_ENST00000610057.1_RNA|TPT1-AS1_ENST00000523506.1_RNA|TPT1-AS1_ENST00000517509.1_RNA|SNORA31_ENST00000517242.1_RNA|TPT1-AS1_ENST00000520310.1_RNA|TPT1-AS1_ENST00000520590.1_RNA|TPT1_ENST00000529421.1_5'UTR|TPT1_ENST00000379056.1_Missense_Mutation_p.T123N|SNORA31_ENST00000362607.1_RNA|TPT1-AS1_ENST00000520622.1_RNA|TPT1-AS1_ENST00000521336.1_RNA			P13693	TCTP_HUMAN	tumor protein, translationally-controlled 1	157					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ectoderm development (GO:2000384)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|regulation of apoptotic process (GO:0042981)|response to virus (GO:0009615)|stem cell maintenance (GO:0019827)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|multivesicular body (GO:0005771)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			lung(1)	1		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000232)		CATATATGGGGTCACACCATC	0.338																																																	0								ENSG00000133112						75.0	71.0	72.0					13																	45912841		2203	4300	6503	TPT1	SO:0001583	missense	0			-	HGNC	X16064	CCDS9397.1, CCDS66538.1, CCDS73566.1	13q14	2010-08-18			ENSG00000133112	ENSG00000133112			12022	protein-coding gene	gene with protein product		600763				2813067, 10343127	Standard	NM_001286273		Approved	TCTP, fortilin	uc001uzy.1	P13693	OTTHUMG00000016845	ENST00000530705.1:c.470C>A	13.37:g.45912841G>T	ENSP00000431872:p.Thr157Asn	Somatic	0	43	0.00		0.5992772487206903	22151	0.18	39	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B2R7E5|Q6YLS2|Q7Z4J4|Q8TBK7|Q96EE2|Q9UC70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Translational_control_tumour_p,superfamily_Mss4-like,prints_Translational_control_tumour_p	p.T157N	ENST00000530705.1	37	c.470	CCDS9397.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	22.6|22.6	4.317647|4.317647	0.81469|0.81469	.|.	.|.	ENSG00000133112|ENSG00000133112	ENST00000528619;ENST00000530245|ENST00000379056;ENST00000530705;ENST00000379060;ENST00000379055;ENST00000309246;ENST00000527226	.|T;T;T;T;T;T	.|0.49139	.|0.79;0.79;0.79;0.79;0.79;0.79	4.52|4.52	4.52|4.52	0.55395|0.55395	.|Mss4-like (1);Mss4/translationally controlled tumour-associated TCTP (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.58481|0.58481	0.2125|0.2125	M|M	0.77406|0.77406	2.37|2.37	0.80722|0.80722	D|D	1|1	.|B	.|0.15473	.|0.013	.|B	.|0.35655	.|0.207	T|T	0.63395|0.63395	-0.6647|-0.6647	5|10	.|0.66056	.|D	.|0.02	.|.	16.6908|16.6908	0.85321|0.85321	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|157	.|P13693	.|TCTP_HUMAN	E|N	36|123;157;145;123;157;156	.|ENSP00000368345:T123N;ENSP00000431872:T157N;ENSP00000368350:T145N;ENSP00000368344:T123N;ENSP00000339051:T157N;ENSP00000433738:T156N	.|ENSP00000339051:T157N	D|T	-|-	3|2	2|0	TPT1|TPT1	44810841|44810841	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.505000|9.505000	0.97989|0.97989	2.241000|2.241000	0.73720|0.73720	0.650000|0.650000	0.86243|0.86243	GAC|ACC	-	pfam_Translational_control_tumour_p,superfamily_Mss4-like		0.338	TPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPT1	protein_coding	OTTHUMT00000044758.3	G		-		45912841	-1	no_errors	ENST00000530705	ensembl	human	known	74_37	missense	SNP	1.000	T
NCKAP5	344148	genome.wustl.edu	37	2	133542322	133542322	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr2:133542322C>A	ENST00000409261.1	-	14	2435	c.2062G>T	c.(2062-2064)Gtt>Ttt	p.V688F	NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.V688F	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	688										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						ACAGTGACAACCCCAGTCTGG	0.438																																																	0								ENSG00000176771						136.0	129.0	131.0					2																	133542322		1881	4119	6000	NCKAP5	SO:0001583	missense	0			-	HGNC	AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.2062G>T	2.37:g.133542322C>A	ENSP00000387128:p.Val688Phe	Somatic	0	52	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	26	53.57	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V688F	ENST00000409261.1	37	c.2062	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	c	12.06	1.825776	0.32237	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.44083	0.93;0.93	5.64	-3.01	0.05463	.	0.587199	0.12636	U	0.451715	T	0.23926	0.0579	L	0.29908	0.895	0.23386	N	0.997789	B	0.33212	0.402	B	0.33521	0.165	T	0.16041	-1.0416	10	0.72032	D	0.01	.	2.1889	0.03893	0.1046:0.2571:0.3254:0.3129	.	688	O14513	NCKP5_HUMAN	F	688	ENSP00000387128:V688F;ENSP00000380603:V688F	ENSP00000380603:V688F	V	-	1	0	NCKAP5	133258792	0.640000	0.27243	0.024000	0.17045	0.927000	0.56198	-0.083000	0.11286	-0.877000	0.04012	-0.155000	0.13514	GTT	-	NULL		0.438	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	protein_coding	OTTHUMT00000331663.1	C	NM_207481	-		133542322	-1	no_errors	ENST00000317721	ensembl	human	known	74_37	missense	SNP	0.217	A
LRRC31	79782	genome.wustl.edu	37	3	169571430	169571430	+	Intron	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr3:169571430C>T	ENST00000316428.5	-	6	1049				LRRC31_ENST00000264676.5_Intron|LRRC31_ENST00000397805.2_5'UTR|LRRC31_ENST00000523069.1_Intron	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31											cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			TAATGCTCCACGCAAAGCTCA	0.388																																																	0								ENSG00000114248																																			LRRC31	SO:0001627	intron_variant	0			-	HGNC	AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.991+1170G>A	3.37:g.169571430C>T		Somatic	0	47	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	38	43.28	B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000316428.5	37	NULL	CCDS43167.1	3																																																																																			-	-		0.388	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC31	protein_coding	OTTHUMT00000378699.1	C	NM_024727	-		169571430	-1	no_errors	ENST00000397805	ensembl	human	known	74_37	rna	SNP	0.000	T
SNAI1	6615	genome.wustl.edu	37	20	48600585	48600585	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr20:48600585C>A	ENST00000244050.2	+	2	368	c.307C>A	c.(307-309)Ccc>Acc	p.P103T		NM_005985.3	NP_005976.2	O95863	SNAI1_HUMAN	snail family zinc finger 1	103	Ser-rich.				cartilage morphogenesis (GO:0060536)|cell migration (GO:0016477)|epithelial to mesenchymal transition (GO:0001837)|hair follicle morphogenesis (GO:0031069)|left/right pattern formation (GO:0060972)|mesoderm formation (GO:0001707)|negative regulation of cell differentiation involved in embryonic placenta development (GO:0060806)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|Notch signaling involved in heart development (GO:0061314)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of tight junction assembly (GO:2000810)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	kinase binding (GO:0019900)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)	17			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CTCCCAGCCCCCCAGCCCACC	0.642																																																	0								ENSG00000124216						51.0	61.0	58.0					20																	48600585		2203	4300	6503	SNAI1	SO:0001583	missense	0			-	HGNC	AF125377	CCDS13423.1	20q13.2	2013-05-23	2013-05-23		ENSG00000124216	ENSG00000124216		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11128	protein-coding gene	gene with protein product		604238	"""snail 1 (drosophila homolog), zinc finger protein"", ""snail homolog 1 (Drosophila)"""			10585766	Standard	NM_005985		Approved	SNA, SLUGH2, SNAH, SNAIL1, SNAIL	uc002xuz.3	O95863	OTTHUMG00000033048	ENST00000244050.2:c.307C>A	20.37:g.48600585C>A	ENSP00000244050:p.Pro103Thr	Somatic	0	29	0.00		0.5992772487206903	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B2R842|Q9P113|Q9UBP7|Q9UHH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P103T	ENST00000244050.2	37	c.307	CCDS13423.1	20	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537358	0.85812	.	.	ENSG00000124216	ENST00000244050	T	0.23348	1.91	4.62	4.62	0.57501	.	0.117965	0.64402	D	0.000013	T	0.45637	0.1352	L	0.50333	1.59	0.53005	D	0.999966	D	0.89917	1.0	D	0.66716	0.946	T	0.47407	-0.9120	10	0.87932	D	0	-35.2263	17.8227	0.88655	0.0:1.0:0.0:0.0	.	103	O95863	SNAI1_HUMAN	T	103	ENSP00000244050:P103T	ENSP00000244050:P103T	P	+	1	0	SNAI1	48033992	0.996000	0.38824	0.992000	0.48379	0.945000	0.59286	4.029000	0.57253	2.281000	0.76405	0.557000	0.71058	CCC	-	NULL		0.642	SNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI1	protein_coding	OTTHUMT00000080350.1	C		-		48600585	+1	no_errors	ENST00000244050	ensembl	human	known	74_37	missense	SNP	1.000	A
USP48	84196	genome.wustl.edu	37	1	22033386	22033386	+	Intron	DEL	A	A	-	rs532575338		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:22033386delA	ENST00000308271.9	-	16	2612				USP48_ENST00000529637.1_Frame_Shift_Del_p.S659fs|USP48_ENST00000374732.3_Intron|USP48_ENST00000400301.1_Intron	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48						ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		ATATATTTGGAAAAAAAAAAA	0.318																																																	0								ENSG00000090686			84,768,607,2779		2,14,5,61,20,62,652,9,522,772						-8.9	0.0		dbSNP_132	28	46,923,1465,5796		1,1,2,41,3,30,886,34,1365,1752	no	intron	USP48	NM_032236.5		3,15,7,102,23,92,1538,43,1887,2524	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		29.5747,34.4266,31.2239				130,1691,2072,8575				USP48	SO:0001627	intron_variant	0				HGNC	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.1964-25T>-	1.37:g.22033386delA		Somatic	0	50	0.00		0.5992772487206903	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	43	12.24	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67,pfscan_Ubiquitin_supergroup	p.S659fs	ENST00000308271.9	37	c.1975	CCDS30623.1	1																																																																																			-	NULL		0.318	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP48	protein_coding	OTTHUMT00000021372.1	A	NM_032236			22033386	-1	no_errors	ENST00000529637	ensembl	human	novel	74_37	frame_shift_del	DEL	0.000	-
EPHB6	2051	genome.wustl.edu	37	7	142562051	142562052	+	In_Frame_Ins	INS	-	-	CCTCCT	rs143667567|rs372769362	byFrequency	TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr7:142562051_142562052insCCTCCT	ENST00000392957.2	+	7	1280_1281	c.493_494insCCTCCT	c.(493-495)ccc>cCCTCCTcc	p.175_176insSS	EPHB6_ENST00000411471.2_Intron|EPHB6_ENST00000442129.1_In_Frame_Ins_p.175_176insSS	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	175	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CGAGAGCTTTCcctcctcctcc	0.624														633	0.126398	0.3563	0.0764	5008	,	,		23274	0.0238		0.0746	False		,,,				2504	0.0102																0								ENSG00000106123																																			EPHB6	SO:0001652	inframe_insertion	0				HGNC	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.512_517dupCCTCCT	7.37:g.142562052_142562057dupCCTCCT	ENSP00000376684:p.Ser174_Ser175dup	Somatic	NA	NA	NA		0.5992772487206903	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.169in_frame_insSS	ENST00000392957.2	37	c.493_494	CCDS5873.2	7																																																																																			-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom		0.624	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB6	protein_coding	OTTHUMT00000341329.1	-				142562052	+1	no_errors	ENST00000392957	ensembl	human	known	74_37	in_frame_ins	INS	0.998:0.978	CCTCCT
LAMA1	284217	genome.wustl.edu	37	18	7050762	7050762	+	Silent	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr18:7050762G>T	ENST00000389658.3	-	4	612	c.519C>A	c.(517-519)acC>acA	p.T173T		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	173	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CAGCCCTGTAGGTGGGTGGCC	0.522																																																	0								ENSG00000101680						124.0	102.0	110.0					18																	7050762		2203	4300	6503	LAMA1	SO:0001819	synonymous_variant	0			-	HGNC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.519C>A	18.37:g.7050762G>T		Somatic	0	85	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	41	39.71		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.T173	ENST00000389658.3	37	c.519	CCDS32787.1	18																																																																																			-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N		0.522	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	protein_coding	OTTHUMT00000257369.1	G	NM_005559	-		7050762	-1	no_errors	ENST00000389658	ensembl	human	known	74_37	silent	SNP	0.000	T
N4BP1	9683	genome.wustl.edu	37	16	48594851	48594851	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr16:48594851G>T	ENST00000262384.3	-	2	1939	c.1703C>A	c.(1702-1704)cCc>cAc	p.P568H	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	568					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				TAACAGCTGGGGCAGTGGCAT	0.433																																																	0								ENSG00000102921						122.0	121.0	122.0					16																	48594851		1936	4138	6074	N4BP1	SO:0001583	missense	0			-	HGNC	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.1703C>A	16.37:g.48594851G>T	ENSP00000262384:p.Pro568His	Somatic	0	53	0.00		0.5992772487206903	38	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	A7MD49|Q2YDX1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_Zc3h12	p.P568H	ENST00000262384.3	37	c.1703	CCDS45479.1	16	.	.	.	.	.	.	.	.	.	.	G	9.709	1.156533	0.21454	.	.	ENSG00000102921	ENST00000262384	T	0.44482	0.92	5.95	3.89	0.44902	.	0.302414	0.30979	N	0.008481	T	0.36468	0.0968	L	0.29908	0.895	0.20703	N	0.999862	D	0.53151	0.958	P	0.50791	0.65	T	0.10776	-1.0615	10	0.38643	T	0.18	-7.8216	7.7542	0.28915	0.14:0.1347:0.7252:0.0	.	568	O75113	N4BP1_HUMAN	H	568	ENSP00000262384:P568H	ENSP00000262384:P568H	P	-	2	0	N4BP1	47152352	0.988000	0.35896	0.031000	0.17742	0.492000	0.33523	3.570000	0.53834	1.528000	0.49103	0.491000	0.48974	CCC	-	NULL		0.433	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	protein_coding	OTTHUMT00000429920.1	G	NM_014664	-		48594851	-1	no_errors	ENST00000262384	ensembl	human	known	74_37	missense	SNP	0.257	T
NEFM	4741	genome.wustl.edu	37	8	24775916	24775916	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr8:24775916G>T	ENST00000221166.5	+	3	3330	c.2548G>T	c.(2548-2550)Gag>Tag	p.E850*	NEFM_ENST00000433454.2_Nonsense_Mutation_p.E474*|NEFM_ENST00000437366.2_Nonsense_Mutation_p.E811*|NEFM_ENST00000521540.1_3'UTR|NEFM_ENST00000518131.1_Nonsense_Mutation_p.E632*			P07197	NFM_HUMAN	neurofilament, medium polypeptide	850	Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		TAAAAGTGAGGAGAAAGTGGT	0.478																																																	0								ENSG00000104722						58.0	66.0	64.0					8																	24775916		2203	4300	6503	NEFM	SO:0001587	stop_gained	0			-	HGNC	BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.2548G>T	8.37:g.24775916G>T	ENSP00000221166:p.Glu850*	Somatic	0	27	0.00		0.5992772487206903	794	0.13	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B4DGN2|E9PBF7|Q4QRK6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin,prints_Keratin_I	p.E850*	ENST00000221166.5	37	c.2548	CCDS6046.1	8	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646288	0.87958	.	.	ENSG00000104722	ENST00000221166;ENST00000518131;ENST00000437366;ENST00000433454	.	.	.	4.41	4.41	0.53225	.	0.144196	0.30565	N	0.009359	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	12.8404	0.57800	0.0:0.1643:0.8356:0.0	.	.	.	.	X	850;632;811;474	.	ENSP00000221166:E850X	E	+	1	0	NEFM	24831821	1.000000	0.71417	0.740000	0.30986	0.083000	0.17756	4.590000	0.61013	1.996000	0.58369	0.467000	0.42956	GAG	-	NULL		0.478	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEFM	protein_coding	OTTHUMT00000254954.2	G	NM_005382	-		24775916	+1	no_errors	ENST00000221166	ensembl	human	known	74_37	nonsense	SNP	0.945	T
PPIAL4G	644591	genome.wustl.edu	37	1	143767744	143767744	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:143767744G>T	ENST00000419275.1	-	1	137	c.105C>A	c.(103-105)aaC>aaA	p.N35K		NM_001123068.1	NP_001116540.1	A2BFH1	PAL4G_HUMAN	peptidylprolyl isomerase A (cyclophilin A)-like 4G	35	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				protein folding (GO:0006457)	cytoplasm (GO:0005737)	peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(1)|endometrium(2)|kidney(1)|lung(8)|ovary(1)|skin(1)	14						GAGCACGAAAGTTTTCTGCTG	0.468																																																	0								ENSG00000236334						112.0	105.0	107.0					1																	143767744		1568	3578	5146	PPIAL4G	SO:0001583	missense	0			-	HGNC		CCDS41375.1, CCDS41375.2	1q21.1	2010-06-03			ENSG00000236334	ENSG00000236334			33996	protein-coding gene	gene with protein product							Standard	NM_001123068		Approved		uc001ejt.3	A2BFH1	OTTHUMG00000013629	ENST00000419275.1:c.105C>A	1.37:g.143767744G>T	ENSP00000393845:p.Asn35Lys	Somatic	0	327	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	85	258	24.78	A1L431	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.N35K	ENST00000419275.1	37	c.105	CCDS41375.1	1	.	.	.	.	.	.	.	.	.	.	.	19.15	3.771747	0.69992	.	.	ENSG00000236334	ENST00000419275	T	0.32753	1.44	0.523	0.523	0.17060	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.055346	0.64402	N	0.000002	T	0.50922	0.1644	H	0.98068	4.14	0.25060	N	0.99107	D	0.57899	0.981	D	0.67900	0.954	T	0.36553	-0.9743	10	0.59425	D	0.04	.	6.9309	0.24442	1.0E-4:0.0:0.9999:0.0	.	35	A2BFH1	PAL4G_HUMAN	K	35	ENSP00000393845:N35K	ENSP00000393845:N35K	N	-	3	2	PPIAL4G	142559267	1.000000	0.71417	0.966000	0.40874	0.890000	0.51754	0.920000	0.28705	0.587000	0.29643	0.403000	0.27427	AAC	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom		0.468	PPIAL4G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIAL4G	protein_coding	OTTHUMT00000037969.1	G	NM_001123068	-		143767744	-1	no_errors	ENST00000419275	ensembl	human	known	74_37	missense	SNP	1.000	T
HSPA13	6782	genome.wustl.edu	37	21	15750522	15750522	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr21:15750522G>T	ENST00000285667.3	-	3	645	c.578C>A	c.(577-579)gCa>gAa	p.A193E	HSPA13_ENST00000478035.1_5'Flank|HSPA13_ENST00000544452.1_Intron	NM_006948.4	NP_008879.3	P48723	HSP13_HUMAN	heat shock protein 70kDa family, member 13	193						endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						ACTGTTACCTGCAAGGTTAGC	0.403																																																	0								ENSG00000155304						74.0	67.0	69.0					21																	15750522		2203	4300	6503	HSPA13	SO:0001583	missense	0			-	HGNC		CCDS13567.1	21q11.1	2011-09-02	2008-06-17	2008-06-17	ENSG00000155304	ENSG00000155304		"""Heat shock proteins / HSP70"""	11375	protein-coding gene	gene with protein product		601100	"""stress 70 protein chaperone, microsome-associated, 60kD"", ""stress 70 protein chaperone, microsome-associated, 60kDa"""	STCH		8825657	Standard	NM_006948		Approved		uc002yjt.3	P48723	OTTHUMG00000074261	ENST00000285667.3:c.578C>A	21.37:g.15750522G>T	ENSP00000285667:p.Ala193Glu	Somatic	0	46	0.00		0.5992772487206903	49	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B2R616|Q8NE40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.A193E	ENST00000285667.3	37	c.578	CCDS13567.1	21	.	.	.	.	.	.	.	.	.	.	G	31	5.073202	0.94000	.	.	ENSG00000155304	ENST00000285667	T	0.02067	4.47	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.26484	0.0647	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.49995	-0.8879	10	0.87932	D	0	-18.3453	19.6378	0.95744	0.0:0.0:1.0:0.0	.	193	P48723	HSP13_HUMAN	E	193	ENSP00000285667:A193E	ENSP00000285667:A193E	A	-	2	0	HSPA13	14672393	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.252000	0.95491	2.631000	0.89168	0.655000	0.94253	GCA	-	pfam_Hsp_70_fam,pfam_MreB_Mrl		0.403	HSPA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA13	protein_coding	OTTHUMT00000157815.1	G		-		15750522	-1	no_errors	ENST00000285667	ensembl	human	known	74_37	missense	SNP	1.000	T
MAP1B	4131	genome.wustl.edu	37	5	71489794	71489794	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr5:71489794C>A	ENST00000296755.7	+	5	910	c.612C>A	c.(610-612)caC>caA	p.H204Q		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	204					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TTGACAGACACAATCTCCAAG	0.448																																					Melanoma(17;367 822 11631 31730 47712)												0								ENSG00000131711						102.0	98.0	99.0					5																	71489794		2203	4300	6503	MAP1B	SO:0001583	missense	0			-	HGNC	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.612C>A	5.37:g.71489794C>A	ENSP00000296755:p.His204Gln	Somatic	0	63	0.00		0.5992772487206903	13	48.00	12	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	42	40.85	A2BDK5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP1B_neuraxin	p.H204Q	ENST00000296755.7	37	c.612	CCDS4012.1	5	.	.	.	.	.	.	.	.	.	.	C	12.10	1.836840	0.32421	.	.	ENSG00000131711	ENST00000296755;ENST00000511641;ENST00000504492	T;T;T	0.04706	3.57;3.57;3.57	6.08	2.94	0.34122	.	0.000000	0.64402	D	0.000001	T	0.11879	0.0289	L	0.45228	1.405	0.51233	D	0.999915	D;D	0.76494	0.999;0.999	D;D	0.73708	0.981;0.981	T	0.17531	-1.0366	10	0.20046	T	0.44	-16.1611	12.0035	0.53246	0.0:0.7356:0.0:0.2644	.	78;204	A2BDK6;P46821	.;MAP1B_HUMAN	Q	204;221;78	ENSP00000296755:H204Q;ENSP00000423444:H221Q;ENSP00000423416:H78Q	ENSP00000296755:H204Q	H	+	3	2	MAP1B	71525550	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.460000	0.35244	0.908000	0.36671	0.591000	0.81541	CAC	-	NULL		0.448	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	protein_coding	OTTHUMT00000218561.6	C	NM_005909	-		71489794	+1	no_errors	ENST00000296755	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC22A8	9376	genome.wustl.edu	37	11	62763277	62763277	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr11:62763277G>T	ENST00000336232.2	-	7	1035	c.900C>A	c.(898-900)aaC>aaA	p.N300K	SLC22A8_ENST00000535878.1_Missense_Mutation_p.N177K|SLC22A8_ENST00000430500.2_Missense_Mutation_p.N300K|SLC22A8_ENST00000311438.8_Missense_Mutation_p.N300K|SLC22A8_ENST00000545207.1_Missense_Mutation_p.N209K|SLC22A8_ENST00000542795.1_5'Flank	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	300					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CCTTCTGCAGGTTGAGTTTGA	0.587																																																	0								ENSG00000149452						128.0	121.0	123.0					11																	62763277		2201	4298	6499	SLC22A8	SO:0001583	missense	0			-	HGNC	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.900C>A	11.37:g.62763277G>T	ENSP00000337335:p.Asn300Lys	Somatic	0	40	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.N300K	ENST00000336232.2	37	c.900	CCDS8042.1	11	.	.	.	.	.	.	.	.	.	.	G	13.24	2.179460	0.38511	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7	5.07	5.07	0.68467	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.196500	0.05907	N	0.631081	T	0.56673	0.2001	N	0.16368	0.405	0.30827	N	0.73709	B;B	0.12630	0.004;0.006	B;B	0.16289	0.015;0.014	T	0.30736	-0.9968	10	0.07175	T	0.84	.	13.97	0.64233	0.0:0.0:1.0:0.0	.	300;300	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	K	300;286;209;177;300;300	ENSP00000337335:N300K;ENSP00000441658:N209K;ENSP00000443368:N177K;ENSP00000311463:N300K;ENSP00000398548:N300K	ENSP00000311463:N300K	N	-	3	2	SLC22A8	62519853	0.999000	0.42202	0.935000	0.37517	0.971000	0.66376	4.209000	0.58493	2.341000	0.79615	0.455000	0.32223	AAC	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp		0.587	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A8	protein_coding	OTTHUMT00000396191.1	G	NM_004254	-		62763277	-1	no_errors	ENST00000336232	ensembl	human	known	74_37	missense	SNP	0.998	T
RNF217	154214	genome.wustl.edu	37	6	125330619	125330620	+	Intron	INS	-	-	A	rs112538609	byFrequency	TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr6:125330619_125330620insA	ENST00000521654.2	+	2	882				RNF217_ENST00000454842.2_Intron|RNF217_ENST00000560949.1_Intron|RNF217_ENST00000359704.2_Intron|RNF217_ENST00000368414.2_Intron			Q8TC41	RN217_HUMAN	ring finger protein 217						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		TAAGAAGGCAGAAAAAAAAAAG	0.351																																																	0								ENSG00000146373																																			RNF217	SO:0001627	intron_variant	0				HGNC	BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.883-35737->A	6.37:g.125330629_125330629dupA		Somatic	0	15	0.00		0.5992772487206903	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	H7C5V4|Q5TCA4|Q9BX48	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000521654.2	37	NULL		6																																																																																			-	-		0.351	RNF217-002	NOVEL	basic|appris_principal	protein_coding	RNF217	protein_coding	OTTHUMT00000042063.3	-	NM_152553			125330620	+1	no_errors	ENST00000431104	ensembl	human	known	74_37	rna	INS	0.000:0.000	A
MARK3	4140	genome.wustl.edu	37	14	103946821	103946821	+	Frame_Shift_Del	DEL	A	A	-			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr14:103946821delA	ENST00000429436.2	+	14	2090	c.1580delA	c.(1579-1581)gaafs	p.E527fs	MARK3_ENST00000553942.1_Frame_Shift_Del_p.E527fs|MARK3_ENST00000303622.9_Frame_Shift_Del_p.E527fs|MARK3_ENST00000335102.5_Frame_Shift_Del_p.E550fs|MARK3_ENST00000216288.7_Frame_Shift_Del_p.E511fs|MARK3_ENST00000561071.1_Intron|MARK3_ENST00000416682.2_Frame_Shift_Del_p.E550fs|MARK3_ENST00000440884.3_Frame_Shift_Del_p.E448fs	NM_001128918.1|NM_001128919.1	NP_001122390.1|NP_001122391.1	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	527						plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30		Melanoma(154;0.155)	Epithelial(46;0.241)			AATGGCAAAGAAAACAGGTAG	0.363																																																	0								ENSG00000075413						122.0	120.0	121.0					14																	103946821		1844	4097	5941	MARK3	SO:0001589	frameshift_variant	0				HGNC	M80359	CCDS41993.1, CCDS45165.1, CCDS45166.1, CCDS45167.1, CCDS55947.1	14q32.32	2014-04-07			ENSG00000075413	ENSG00000075413			6897	protein-coding gene	gene with protein product		602678				9533022	Standard	NM_002376		Approved	CTAK1, KP78, PAR-1A	uc001ymz.4	P27448	OTTHUMG00000171789	ENST00000429436.2:c.1580delA	14.37:g.103946821delA	ENSP00000411397:p.Glu527fs	Somatic	0	32	0.00		0.5992772487206903	106	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	21	8.70	O60219|Q86TT8|Q8TB41|Q8WX83|Q96RG1|Q9UMY9|Q9UN34	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.N528fs	ENST00000429436.2	37	c.1580	CCDS45165.1	14																																																																																			-	NULL		0.363	MARK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK3	protein_coding	OTTHUMT00000415144.1	A	NM_001128918			103946821	+1	no_errors	ENST00000429436	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
FMOD	2331	genome.wustl.edu	37	1	203311601	203311601	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:203311601C>T	ENST00000354955.4	-	3	1464	c.1001G>A	c.(1000-1002)tGc>tAc	p.C334Y	FMOD_ENST00000493296.1_5'UTR	NM_002023.4	NP_002014.2	Q06828	FMOD_HUMAN	fibromodulin	334					carbohydrate metabolic process (GO:0005975)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor complex assembly (GO:0007181)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	17			BRCA - Breast invasive adenocarcinoma(75;0.171)			CACCACGGTGCAGAAGCTGCT	0.602											OREG0014119	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000122176						38.0	35.0	36.0					1																	203311601		2203	4300	6503	FMOD	SO:0001583	missense	0			-	HGNC	U05291	CCDS30976.1	1q32	2008-02-05			ENSG00000122176	ENSG00000122176		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	3774	protein-coding gene	gene with protein product	"""fibromodulin proteoglycan"""	600245				7851907	Standard	NM_002023		Approved	SLRR2E	uc001gzr.3	Q06828	OTTHUMG00000035910	ENST00000354955.4:c.1001G>A	1.37:g.203311601C>T	ENSP00000347041:p.Cys334Tyr	Somatic	0	19	0.00	2136	0.5992772487206903	72	65.05	134	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	7	53.33	Q15331|Q8IV47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.C334Y	ENST00000354955.4	37	c.1001	CCDS30976.1	1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020963	0.93462	.	.	ENSG00000122176	ENST00000435105;ENST00000354955	T	0.04119	3.7	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.18923	0.0454	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00069	-1.2136	10	0.87932	D	0	-11.2657	17.7886	0.88546	0.0:1.0:0.0:0.0	.	334	Q06828	FMOD_HUMAN	Y	321;334	ENSP00000347041:C334Y	ENSP00000347041:C334Y	C	-	2	0	FMOD	201578224	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.459000	0.80802	2.532000	0.85374	0.655000	0.94253	TGC	-	pfam_Leu-rich_rpt		0.602	FMOD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMOD	protein_coding	OTTHUMT00000087472.1	C	NM_002023	-		203311601	-1	no_errors	ENST00000354955	ensembl	human	known	74_37	missense	SNP	1.000	T
RBMXL3	139804	genome.wustl.edu	37	X	114426788	114426788	+	Silent	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chrX:114426788C>T	ENST00000424776.3	+	1	2826	c.2784C>T	c.(2782-2784)cgC>cgT	p.R928R	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	928	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GCGGGGGCCGCGGCCTCAACA	0.637																																																	0								ENSG00000175718						13.0	15.0	15.0					X																	114426788		691	1591	2282	RBMXL3	SO:0001819	synonymous_variant	0			-	HGNC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2784C>T	X.37:g.114426788C>T		Somatic	0	84	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	43	38.89	B4DXC0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R928	ENST00000424776.3	37	c.2784	CCDS55478.1	X																																																																																			-	NULL		0.637	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	protein_coding	OTTHUMT00000057968.3	C	NM_001145346	-		114426788	+1	no_errors	ENST00000424776	ensembl	human	known	74_37	silent	SNP	0.374	T
ING1	3621	genome.wustl.edu	37	13	111371715	111371715	+	Silent	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr13:111371715G>T	ENST00000375774.3	+	2	1167	c.705G>T	c.(703-705)gtG>gtT	p.V235V	ING1_ENST00000338450.7_Silent_p.V48V|ING1_ENST00000333219.7_Silent_p.V92V|ING1_ENST00000464141.1_3'UTR|ING1_ENST00000375775.3_Silent_p.V23V	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	235					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			TCCAGATCGTGAGCCAGATGG	0.672																																																	0								ENSG00000153487						48.0	59.0	55.0					13																	111371715		2203	4299	6502	ING1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.705G>T	13.37:g.111371715G>T		Somatic	0	73	0.00		0.5992772487206903	80	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.V235	ENST00000375774.3	37	c.705	CCDS9517.1	13																																																																																			-	NULL		0.672	ING1-004	KNOWN	basic|CCDS	protein_coding	ING1	protein_coding	OTTHUMT00000045770.2	G	NM_005537	-		111371715	+1	no_errors	ENST00000375774	ensembl	human	known	74_37	silent	SNP	0.688	T
PRKACA	5566	genome.wustl.edu	37	19	14211650	14211650	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr19:14211650A>T	ENST00000308677.4	-	5	603	c.407T>A	c.(406-408)aTc>aAc	p.I136N	PRKACA_ENST00000589994.1_Missense_Mutation_p.I128N|PRKACA_ENST00000590853.1_Intron|PRKACA_ENST00000350356.3_5'UTR	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha	136	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						GAACCTTCCGATCCGCCGTAG	0.602																																																	0								ENSG00000072062						109.0	82.0	91.0					19																	14211650		2203	4300	6503	PRKACA	SO:0001583	missense	0			-	HGNC		CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.407T>A	19.37:g.14211650A>T	ENSP00000309591:p.Ile136Asn	Somatic	0	69	0.00		0.5992772487206903	437	0.90	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	58	10.77	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I136N	ENST00000308677.4	37	c.407	CCDS12304.1	19	.	.	.	.	.	.	.	.	.	.	A	7.001	0.554839	0.13436	.	.	ENSG00000072062	ENST00000308677;ENST00000350356;ENST00000535695;ENST00000536649	T	0.63096	-0.02	4.93	4.93	0.64822	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47093	D	0.000248	T	0.37265	0.0997	N	0.03154	-0.405	0.52501	D	0.99995	B;B;B;B	0.10296	0.002;0.003;0.0;0.002	B;B;B;B	0.17433	0.008;0.008;0.01;0.018	T	0.23762	-1.0179	10	0.18276	T	0.48	.	12.5745	0.56355	1.0:0.0:0.0:0.0	.	78;119;136;128	B7Z708;Q15136;P17612;P17612-2	.;.;KAPCA_HUMAN;.	N	136;128;136;78	ENSP00000309591:I136N	ENSP00000309591:I136N	I	-	2	0	PRKACA	14072650	1.000000	0.71417	0.974000	0.42286	0.139000	0.21198	9.217000	0.95160	1.878000	0.54408	0.378000	0.23410	ATC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.602	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	protein_coding	OTTHUMT00000459004.1	A	NM_002730	-		14211650	-1	no_errors	ENST00000308677	ensembl	human	known	74_37	missense	SNP	1.000	T
USP38	84640	genome.wustl.edu	37	4	144107117	144107117	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr4:144107117G>C	ENST00000307017.4	+	1	1020	c.514G>C	c.(514-516)Gtt>Ctt	p.V172L	RP11-284M14.1_ENST00000507486.1_RNA|RP11-284M14.1_ENST00000507826.1_RNA|USP38_ENST00000510377.1_Missense_Mutation_p.V172L	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	172					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					TCAACAGCTGGTTCGAACGAT	0.542																																																	0								ENSG00000170185						102.0	99.0	100.0					4																	144107117		2203	4300	6503	USP38	SO:0001583	missense	0			-	HGNC	AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.514G>C	4.37:g.144107117G>C	ENSP00000303434:p.Val172Leu	Somatic	0	26	0.00		0.5992772487206903	25	3.85	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.V172L	ENST00000307017.4	37	c.514	CCDS3758.1	4	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737698	0.89573	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.62105	0.05;0.11	5.12	4.28	0.50868	.	0.000000	0.64402	D	0.000001	T	0.64571	0.2610	L	0.34521	1.04	0.80722	D	1	D;D	0.55800	0.973;0.973	P;P	0.55871	0.729;0.786	T	0.68685	-0.5343	10	0.72032	D	0.01	-5.2924	13.9186	0.63916	0.073:0.0:0.9269:0.0	.	172;172	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	L	172	ENSP00000427647:V172L;ENSP00000303434:V172L	ENSP00000303434:V172L	V	+	1	0	USP38	144326567	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.040000	0.57333	1.401000	0.46761	0.561000	0.74099	GTT	-	NULL		0.542	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP38	protein_coding	OTTHUMT00000364869.1	G	NM_032557	-		144107117	+1	no_errors	ENST00000307017	ensembl	human	known	74_37	missense	SNP	1.000	C
SOX5	6660	genome.wustl.edu	37	12	23998945	23998945	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr12:23998945C>A	ENST00000451604.2	-	3	554	c.453G>T	c.(451-453)atG>atT	p.M151I	SOX5_ENST00000309359.1_Missense_Mutation_p.M138I|SOX5_ENST00000541536.1_Missense_Mutation_p.M138I|SOX5_ENST00000381381.2_Missense_Mutation_p.M138I|SOX5_ENST00000545921.1_Missense_Mutation_p.M141I|SOX5_ENST00000441133.2_Missense_Mutation_p.M116I|SOX5_ENST00000541847.1_Missense_Mutation_p.M141I|SOX5_ENST00000537393.1_Missense_Mutation_p.M116I|SOX5_ENST00000546136.1_Missense_Mutation_p.M138I			P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5	151					cartilage development (GO:0051216)|cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system neuron differentiation (GO:0021953)|in utero embryonic development (GO:0001701)|negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte differentiation (GO:0048709)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of timing of neuron differentiation (GO:0060164)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear transcription factor complex (GO:0044798)	sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.M151I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(25)|ovary(5)|skin(2)|upper_aerodigestive_tract(3)	57						TGAGCTCTTCCATTTTCCTCT	0.443																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000134532						116.0	106.0	109.0					12																	23998945		2203	4300	6503	SOX5	SO:0001583	missense	0			-	HGNC	AB081589	CCDS8699.1, CCDS41761.1, CCDS44844.1, CCDS58216.1, CCDS58217.1	12p12.1	2010-04-20			ENSG00000134532	ENSG00000134532		"""SRY (sex determining region Y)-boxes"""	11201	protein-coding gene	gene with protein product		604975				8812465	Standard	NM_006940		Approved	L-SOX5, MGC35153	uc001rfw.3	P35711	OTTHUMG00000169026	ENST00000451604.2:c.453G>T	12.37:g.23998945C>A	ENSP00000398273:p.Met151Ile	Somatic	0	45	0.00		0.5992772487206903	10	16.67	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	25	16.67	B7Z8V0|F5H5B0|Q86UK8|Q8J017|Q8J018|Q8J019|Q8J020|Q8N1D9|Q8N7E0|Q8TEA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.M151I	ENST00000451604.2	37	c.453	CCDS8699.1	12	.	.	.	.	.	.	.	.	.	.	C	31	5.095561	0.94197	.	.	ENSG00000134532	ENST00000546136;ENST00000309359;ENST00000381381;ENST00000451604;ENST00000435266;ENST00000537393;ENST00000541536;ENST00000545921;ENST00000541847;ENST00000441133;ENST00000538083	D;D;D;D;D;D;D	0.96992	-4.17;-4.17;-4.2;-4.17;-4.16;-4.2;-4.17	5.79	5.79	0.91817	.	0.040904	0.85682	D	0.000000	D	0.96297	0.8792	M	0.67953	2.075	0.80722	D	1	P;B;B;B	0.46859	0.885;0.371;0.048;0.255	P;B;B;B	0.45577	0.486;0.157;0.024;0.155	D	0.95912	0.8924	10	0.49607	T	0.09	.	20.0349	0.97554	0.0:1.0:0.0:0.0	.	116;116;138;151	G3V0H1;F5H0I3;P35711-4;P35711	.;.;.;SOX5_HUMAN	I	138;138;138;151;103;116;138;141;141;116;138	ENSP00000437487:M138I;ENSP00000308927:M138I;ENSP00000370788:M138I;ENSP00000398273:M151I;ENSP00000439832:M116I;ENSP00000441973:M138I;ENSP00000443520:M141I	ENSP00000308927:M138I	M	-	3	0	SOX5	23890212	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.474000	0.81024	2.744000	0.94065	0.650000	0.86243	ATG	-	NULL		0.443	SOX5-002	KNOWN	basic|CCDS	protein_coding	SOX5	protein_coding	OTTHUMT00000402006.2	C	NM_006940	-		23998945	-1	no_errors	ENST00000451604	ensembl	human	known	74_37	missense	SNP	1.000	A
GOLGA2P7	388152	genome.wustl.edu	37	15	84868716	84868729	+	RNA	DEL	GGGGGGGGAGGGGT	GGGGGGGGAGGGGT	-	rs372945855|rs111618525|rs200105620		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	GGGGGGGGAGGGGT	GGGGGGGGAGGGGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr15:84868716_84868729delGGGGGGGGAGGGGT	ENST00000559668.1	-	0	3586_3599					NR_049748.1																						TGCGGGGGGGGGGGGGGGAGGGGTGGGATGTTCT	0.701																																																	0								ENSG00000225151																																			AC103965.1			0				Clone_based_vega_gene																													15.37:g.84868716_84868729delGGGGGGGGAGGGGT		Somatic	NA	NA	NA		0.5992772487206903	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000559668.1	37	NULL		15																																																																																			-	-		0.701	AC103965.1-008	KNOWN	basic	processed_transcript	LOC101929847	pseudogene	OTTHUMT00000418802.1	GGGGGGGGAGGGGT				84868729	-1	no_errors	ENST00000316967	ensembl	human	known	74_37	rna	DEL	0.370:0.357:0.300:0.305:0.291:0.276:0.262:0.247:0.207:0.187:0.139:0.134:0.116:0.121	-
ZNF512B	57473	genome.wustl.edu	37	20	62642677	62642677	+	Intron	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr20:62642677G>T	ENST00000450537.1	-	1	56				PRPF6_ENST00000535781.1_Missense_Mutation_p.A449S|ZNF512B_ENST00000217130.3_Intron			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CTATGAAAATGCCCGCAAGGT	0.567																																																	0								ENSG00000101161						71.0	66.0	68.0					20																	62642677		2203	4300	6503	PRPF6	SO:0001627	intron_variant	0			-	HGNC	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+37380C>A	20.37:g.62642677G>T		Somatic	0	60	0.00		0.5992772487206903	243	0.41	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	Q08AK9|Q9ULM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.A449S	ENST00000450537.1	37	c.1345	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519346	0.85495	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.47869	0.83;0.83	5.46	5.46	0.80206	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.63988	0.2558	M	0.85542	2.76	0.80722	D	1	P;B	0.36837	0.571;0.216	P;B	0.44732	0.459;0.437	T	0.66260	-0.5968	10	0.45353	T	0.12	.	19.2933	0.94112	0.0:0.0:1.0:0.0	.	449;449	O94906-2;O94906	.;PRP6_HUMAN	S	449	ENSP00000266079:A449S;ENSP00000446216:A449S	ENSP00000266079:A449S	A	+	1	0	PRPF6	62113121	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.220000	0.95180	2.563000	0.86464	0.609000	0.83330	GCC	-	smart_HAT		0.567	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	protein_coding	OTTHUMT00000080246.1	G	NM_020713	-		62642677	+1	no_errors	ENST00000266079	ensembl	human	known	74_37	missense	SNP	1.000	T
ARAP2	116984	genome.wustl.edu	37	4	36069535	36069535	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr4:36069535C>A	ENST00000303965.4	-	33	5598	c.5109G>T	c.(5107-5109)ttG>ttT	p.L1703F		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1703					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						TTTCCTACTTCAAAATCTGCT	0.318																																																	0								ENSG00000047365						53.0	56.0	55.0					4																	36069535		2203	4300	6503	ARAP2	SO:0001583	missense	0			-	HGNC	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.5109G>T	4.37:g.36069535C>A	ENSP00000302895:p.Leu1703Phe	Somatic	0	46	0.00		0.5992772487206903	13	38.10	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	17	59.52	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.L1703F	ENST00000303965.4	37	c.5109	CCDS3441.1	4	.	.	.	.	.	.	.	.	.	.	C	3.500	-0.101955	0.06967	.	.	ENSG00000047365	ENST00000303965	T	0.10960	2.82	4.93	1.2	0.21068	.	0.990092	0.08211	N	0.980772	T	0.07683	0.0193	N	0.24115	0.695	0.09310	N	1	B	0.29085	0.232	B	0.24701	0.055	T	0.38308	-0.9667	10	0.66056	D	0.02	.	6.7242	0.23346	0.0:0.6004:0.0:0.3996	.	1703	Q8WZ64	ARAP2_HUMAN	F	1703	ENSP00000302895:L1703F	ENSP00000302895:L1703F	L	-	3	2	ARAP2	35745930	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.187000	0.09656	0.078000	0.16900	0.650000	0.86243	TTG	-	NULL		0.318	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	protein_coding	OTTHUMT00000215074.2	C	NM_015230	-		36069535	-1	no_errors	ENST00000303965	ensembl	human	known	74_37	missense	SNP	0.000	A
FRMD6	122786	genome.wustl.edu	37	14	52156445	52156445	+	5'UTR	SNP	T	T	G			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr14:52156445T>G	ENST00000344768.5	+	0	87				FRMD6_ENST00000356218.4_5'UTR|FRMD6_ENST00000395718.2_5'UTR			Q96NE9	FRMD6_HUMAN	FERM domain containing 6						apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GTGATGCTTCTCCTGCAGGGC	0.577																																																	0								ENSG00000139926																																			FRMD6	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.-110T>G	14.37:g.52156445T>G		Somatic	0	78	0.00		0.5992772487206903	63	54.93	78	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	33	52.86	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000344768.5	37	NULL	CCDS58318.1	14																																																																																			-	-		0.577	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	protein_coding	OTTHUMT00000276881.1	T	NM_152330	-		52156445	+1	no_errors	ENST00000556137	ensembl	human	known	74_37	rna	SNP	0.000	G
HTR5A	3361	genome.wustl.edu	37	7	154863029	154863029	+	Silent	SNP	C	C	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr7:154863029C>T	ENST00000287907.2	+	1	996	c.420C>T	c.(418-420)taC>taT	p.Y140Y	HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000395731.2_5'UTR|HTR5A-AS1_ENST00000543018.1_5'UTR	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	140					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	TGGACCGCTACTGGTCCATCA	0.627																																																	0								ENSG00000157219						86.0	64.0	71.0					7																	154863029		2203	4300	6503	HTR5A	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.420C>T	7.37:g.154863029C>T		Somatic	0	36	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	12	62.50	Q2M2D2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_5HT5A_rcpt,prints_5HT_rcpt	p.Y140	ENST00000287907.2	37	c.420	CCDS5936.1	7																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.627	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR5A	protein_coding	OTTHUMT00000322240.1	C	NM_024012	-		154863029	+1	no_errors	ENST00000287907	ensembl	human	known	74_37	silent	SNP	1.000	T
TCEB3	6924	genome.wustl.edu	37	1	24080854	24080854	+	Splice_Site	SNP	A	A	G			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:24080854A>G	ENST00000418390.2	+	7	2044	c.1773A>G	c.(1771-1773)tcA>tcG	p.S591S	TCEB3_ENST00000609199.1_Splice_Site_p.S565S	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	591	Activation domain. {ECO:0000250}.				gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TCTCTGCAGCAATCTTTGAAG	0.478																																																	0								ENSG00000011007						161.0	145.0	150.0					1																	24080854		2203	4300	6503	TCEB3	SO:0001630	splice_region_variant	0			-	HGNC	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1772-1A>G	1.37:g.24080854A>G		Somatic	0	39	0.00		0.5992772487206903	46	41.03	32	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	34	34.62	B2R7Q8|Q8IXH1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,pfscan_F-box_dom	p.S591	ENST00000418390.2	37	c.1773	CCDS239.2	1																																																																																			-	NULL		0.478	TCEB3-001	KNOWN	basic|CCDS	protein_coding	TCEB3	protein_coding	OTTHUMT00000008230.2	A	NM_003198	-	Silent	24080854	+1	no_errors	ENST00000418390	ensembl	human	known	74_37	silent	SNP	0.831	G
PRODH	5625	genome.wustl.edu	37	22	18904407	18904407	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr22:18904407G>A	ENST00000357068.6	-	12	1787	c.1522C>T	c.(1522-1524)Cgc>Tgc	p.R508C	PRODH_ENST00000420436.1_Missense_Mutation_p.R400C|PRODH_ENST00000334029.2_Missense_Mutation_p.R400C	NM_016335.4	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase (oxidase) 1	508					4-hydroxyproline catabolic process (GO:0019470)|cellular nitrogen compound metabolic process (GO:0034641)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|proline catabolic process (GO:0006562)|proline catabolic process to glutamate (GO:0010133)|proline metabolic process (GO:0006560)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)	FAD binding (GO:0071949)|proline dehydrogenase activity (GO:0004657)			breast(1)|endometrium(3)|lung(4)|upper_aerodigestive_tract(1)	9					L-Proline(DB00172)	ACCTACCTGCGCAGTGCAAAG	0.637																																																	0								ENSG00000100033						102.0	57.0	72.0					22																	18904407		2203	4297	6500	PRODH	SO:0001583	missense	0			-	HGNC	AF010310	CCDS13754.1, CCDS56223.1	22q11.2	2014-07-10	2001-12-05		ENSG00000100033	ENSG00000100033	1.5.5.2		9453	protein-coding gene	gene with protein product		606810	"""proline dehydrogenase (proline oxidase )"""			9385373, 10192398	Standard	NM_001195226		Approved	HSPOX2, PRODH1, PIG6, PRODH2, TP53I6	uc002zok.4	O43272	OTTHUMG00000150163	ENST00000357068.6:c.1522C>T	22.37:g.18904407G>A	ENSP00000349577:p.Arg508Cys	Somatic	0	49	0.00		0.5992772487206903	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	18	41.94	A6NF53|O14680|Q0P507|Q147W8|Q504W1|Q59FI8|Q6NV86|Q9UF13	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Proline_DH	p.R508C	ENST00000357068.6	37	c.1522	CCDS13754.1	22	.	.	.	.	.	.	.	.	.	.	g	7.471	0.646598	0.14516	.	.	ENSG00000100033	ENST00000357068;ENST00000313755	T	0.35236	1.32	4.43	-5.63	0.02474	Proline dehydrogenase (1);	0.824595	0.11311	N	0.577137	T	0.25005	0.0607	L	0.61036	1.89	0.09310	N	0.999998	B;B;B	0.21905	0.062;0.058;0.031	B;B;B	0.17098	0.006;0.017;0.01	T	0.31223	-0.9951	10	0.45353	T	0.12	.	1.332	0.02137	0.1848:0.1418:0.2172:0.4563	.	424;508;400	O43272-1;O43272;E7EQL6	.;PROD_HUMAN;.	C	508;153	ENSP00000349577:R508C	ENSP00000318329:R153C	R	-	1	0	PRODH	17284407	0.000000	0.05858	0.013000	0.15412	0.039000	0.13416	0.238000	0.18004	-1.000000	0.03438	-0.465000	0.05216	CGC	-	pfam_Proline_DH		0.637	PRODH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRODH	protein_coding	OTTHUMT00000316637.2	G	NM_016335	-		18904407	-1	no_errors	ENST00000357068	ensembl	human	known	74_37	missense	SNP	0.031	A
MED22	6837	genome.wustl.edu	37	9	136212030	136212030	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr9:136212030G>T	ENST00000491289.1	-	3	782	c.201C>A	c.(199-201)aaC>aaA	p.N67K	MED22_ENST00000476080.1_Missense_Mutation_p.N67K|MED22_ENST00000371999.1_Intron|MED22_ENST00000344469.5_Missense_Mutation_p.N67K|MED22_ENST00000471524.1_5'UTR|MED22_ENST00000343730.5_Missense_Mutation_p.N67K			Q15528	MED22_HUMAN	mediator complex subunit 22	67						cytoplasm (GO:0005737)|mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|large_intestine(1)|ovary(1)|urinary_tract(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.14e-06)|Epithelial(140;8.2e-06)|all cancers(34;6.94e-05)		CACTCACGATGTTGGCGGCTC	0.607																																																	0								ENSG00000148297						118.0	81.0	94.0					9																	136212030		2203	4300	6503	MED22	SO:0001583	missense	0			-	HGNC		CCDS6963.1, CCDS6964.1	9q34.1	2008-02-05	2007-07-30	2007-07-30	ENSG00000148297	ENSG00000148297			11477	protein-coding gene	gene with protein product		185641	"""surfeit 5"""	SURF5		8499913, 15175163	Standard	NM_133640		Approved	Med24	uc004cdc.3	Q15528	OTTHUMG00000020869	ENST00000491289.1:c.201C>A	9.37:g.136212030G>T	ENSP00000420393:p.Asn67Lys	Somatic	0	61	0.00		0.5992772487206903	67	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B3KW83|B3KWX4|O76072|Q5T8U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med22	p.N67K	ENST00000491289.1	37	c.201	CCDS6963.1	9	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856269	0.32791	.	.	ENSG00000148297	ENST00000491289;ENST00000486395;ENST00000343730;ENST00000344469;ENST00000476080;ENST00000446777;ENST00000494177;ENST00000457204	.	.	.	4.69	3.56	0.40772	.	0.000000	0.85682	D	0.000000	T	0.62159	0.2405	M	0.80982	2.52	0.80722	D	1	B;B	0.31485	0.325;0.03	B;B	0.34873	0.191;0.118	T	0.64045	-0.6499	9	0.39692	T	0.17	-19.9106	9.1715	0.37083	0.1962:0.0:0.8038:0.0	.	67;67	Q15528-2;Q15528	.;MED22_HUMAN	K	67	.	ENSP00000342343:N67K	N	-	3	2	MED22	135201851	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	3.362000	0.52314	2.152000	0.67230	0.462000	0.41574	AAC	-	pfam_Mediator_Med22		0.607	MED22-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MED22	protein_coding	OTTHUMT00000054898.2	G	NM_133640	-		136212030	-1	no_errors	ENST00000343730	ensembl	human	known	74_37	missense	SNP	1.000	T
FANCI	55215	genome.wustl.edu	37	15	89804832	89804832	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr15:89804832G>T	ENST00000310775.7	+	5	391	c.305G>T	c.(304-306)gGa>gTa	p.G102V	FANCI_ENST00000300027.8_Missense_Mutation_p.G102V|FANCI_ENST00000451393.2_5'UTR|FANCI_ENST00000567996.1_Missense_Mutation_p.G102V	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	102					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					CATTTTCCAGGACCATTATTG	0.358								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0								ENSG00000140525						179.0	179.0	179.0					15																	89804832		2200	4299	6499	FANCI	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	-	HGNC	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.305G>T	15.37:g.89804832G>T	ENSP00000310842:p.Gly102Val	Somatic	0	53	0.00		0.5992772487206903	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G102V	ENST00000310775.7	37	c.305	CCDS45346.1	15	.	.	.	.	.	.	.	.	.	.	G	15.01	2.704859	0.48412	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.44881	0.91;0.91;0.91	5.27	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.62950	0.2470	M	0.68317	2.08	0.80722	D	1	P;D	0.89917	0.524;1.0	P;D	0.80764	0.502;0.994	T	0.67925	-0.5544	10	0.66056	D	0.02	-18.6158	16.181	0.81898	0.0:0.1332:0.8668:0.0	.	102;102	Q9NVI1;Q9NVI1-1	FANCI_HUMAN;.	V	102	ENSP00000300027:G102V;ENSP00000310842:G102V;ENSP00000413249:G102V	ENSP00000300027:G102V	G	+	2	0	FANCI	87605836	1.000000	0.71417	0.933000	0.37362	0.863000	0.49368	4.710000	0.61873	1.459000	0.47892	-0.150000	0.13652	GGA	-	NULL		0.358	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	protein_coding	OTTHUMT00000421140.1	G	NM_018193	-		89804832	+1	no_errors	ENST00000310775	ensembl	human	known	74_37	missense	SNP	0.997	T
SORT1	6272	genome.wustl.edu	37	1	109896993	109896993	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:109896993G>T	ENST00000256637.6	-	5	762	c.704C>A	c.(703-705)aCt>aAt	p.T235N	SORT1_ENST00000482236.1_5'Flank|SORT1_ENST00000538502.1_Missense_Mutation_p.T99N	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	235					endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		ACTTACTTCAGTGCTGAGAGC	0.373																																																	0								ENSG00000134243						108.0	106.0	107.0					1																	109896993		2203	4300	6503	SORT1	SO:0001583	missense	0			-	HGNC	BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.704C>A	1.37:g.109896993G>T	ENSP00000256637:p.Thr235Asn	Somatic	0	39	0.00		0.5992772487206903	69	1.43	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BNR_rpt,smart_VPS10	p.T235N	ENST00000256637.6	37	c.704	CCDS798.1	1	.	.	.	.	.	.	.	.	.	.	G	13.75	2.330576	0.41297	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.29142	1.58;1.58	5.41	5.41	0.78517	VPS10 (1);	0.327214	0.33515	N	0.004838	T	0.06645	0.0170	N	0.12746	0.255	0.29476	N	0.856727	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.19679	-1.0298	10	0.17832	T	0.49	-15.0356	11.4592	0.50199	0.0838:0.0:0.9162:0.0	.	99;235	B4DWI3;Q99523	.;SORT_HUMAN	N	235;99	ENSP00000256637:T235N;ENSP00000438597:T99N	ENSP00000256637:T235N	T	-	2	0	SORT1	109698516	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.131000	0.42074	2.515000	0.84797	0.655000	0.94253	ACT	-	smart_VPS10		0.373	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORT1	protein_coding	OTTHUMT00000033179.1	G	NM_002959	-		109896993	-1	no_errors	ENST00000256637	ensembl	human	known	74_37	missense	SNP	1.000	T
PHACTR1	221692	genome.wustl.edu	37	6	13182854	13182854	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr6:13182854delC	ENST00000379350.1	+	6	729	c.600delC	c.(598-600)gtcfs	p.V200fs	PHACTR1_ENST00000379345.2_Frame_Shift_Del_p.V55fs|PHACTR1_ENST00000332995.7_Frame_Shift_Del_p.V200fs|PHACTR1_ENST00000457702.2_Frame_Shift_Del_p.V55fs			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	200					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			TGGAGCCAGTCCCAATGCCCA	0.567																																																	0								ENSG00000112137						83.0	87.0	86.0					6																	13182854		1978	4171	6149	PHACTR1	SO:0001589	frameshift_variant	0				HGNC	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.600delC	6.37:g.13182854delC	ENSP00000368655:p.Val200fs	Somatic	0	33	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	34	30.61	A8K1V2|Q3MJ93|Q5JSJ2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.P201fs	ENST00000379350.1	37	c.600		6																																																																																			-	NULL		0.567	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHACTR1	protein_coding	OTTHUMT00000039876.1	C	XM_166420			13182854	+1	no_errors	ENST00000379350	ensembl	human	known	74_37	frame_shift_del	DEL	0.996	-
RNF149	284996	genome.wustl.edu	37	2	101893740	101893740	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr2:101893740G>T	ENST00000295317.3	-	7	1270	c.1163C>A	c.(1162-1164)gCc>gAc	p.A388D		NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	388					cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						ACTCCTGCCGGCTTCTGCAAG	0.478																																					Colon(25;331 612 6521 7355 31028)												0								ENSG00000163162						44.0	44.0	44.0					2																	101893740		2203	4300	6503	RNF149	SO:0001583	missense	0			-	HGNC	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.1163C>A	2.37:g.101893740G>T	ENSP00000295317:p.Ala388Asp	Somatic	0	73	0.00		0.5992772487206903	76	6.17	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	43	17.31	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.A388D	ENST00000295317.3	37	c.1163	CCDS2051.1	2	.	.	.	.	.	.	.	.	.	.	G	0.128	-1.116724	0.01799	.	.	ENSG00000163162	ENST00000295317	T	0.08370	3.1	4.89	0.781	0.18561	.	1.233990	0.06245	N	0.691050	T	0.05044	0.0135	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.45527	-0.9255	10	0.12103	T	0.63	.	4.8651	0.13604	0.2854:0.1587:0.5559:0.0	.	388	Q8NC42	RN149_HUMAN	D	388	ENSP00000295317:A388D	ENSP00000295317:A388D	A	-	2	0	RNF149	101260172	0.000000	0.05858	0.002000	0.10522	0.132000	0.20833	0.228000	0.17814	0.216000	0.20781	0.563000	0.77884	GCC	-	NULL		0.478	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF149	protein_coding	OTTHUMT00000253180.2	G	NM_173647	-		101893740	-1	no_errors	ENST00000295317	ensembl	human	known	74_37	missense	SNP	0.002	T
RBM15	64783	genome.wustl.edu	37	1	110883188	110883188	+	Missense_Mutation	SNP	G	G	C	rs556732179		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:110883188G>C	ENST00000369784.3	+	1	2061	c.1161G>C	c.(1159-1161)gaG>gaC	p.E387D	RP5-1074L1.1_ENST00000449169.1_RNA|RBM15_ENST00000487146.2_Missense_Mutation_p.E387D|RBM15_ENST00000602849.1_Missense_Mutation_p.E387D	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	387	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		CTGTAACGGAGAGTGATTTAA	0.488			T	MKL1	acute megakaryocytic leukemia																																			Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0								ENSG00000162775						51.0	51.0	51.0					1																	110883188		2203	4300	6503	RBM15	SO:0001583	missense	0			-	HGNC	AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.1161G>C	1.37:g.110883188G>C	ENSP00000358799:p.Glu387Asp	Somatic	0	47	0.00		0.5992772487206903	3	57.14	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	29	35.56	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPOC_C,pfam_RRM_dom,superfamily_SPOC_like_C_dom,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.E387D	ENST00000369784.3	37	c.1161	CCDS822.1	1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423466	0.25639	.	.	ENSG00000162775	ENST00000369784	T	0.21191	2.02	4.69	2.82	0.32997	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.44483	D	0.000443	T	0.09905	0.0243	L	0.39514	1.22	0.51482	D	0.999924	B;P	0.45348	0.066;0.856	B;P	0.44597	0.056;0.454	T	0.05386	-1.0888	10	0.39692	T	0.17	-14.3952	10.498	0.44789	0.1576:0.0:0.8424:0.0	.	387;387	Q96T37-3;Q96T37	.;RBM15_HUMAN	D	387	ENSP00000358799:E387D	ENSP00000358799:E387D	E	+	3	2	RBM15	110684711	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	4.082000	0.57635	0.598000	0.29829	0.655000	0.94253	GAG	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.488	RBM15-001	KNOWN	basic|CCDS	protein_coding	RBM15	protein_coding	OTTHUMT00000031114.2	G	NM_022768	-		110883188	+1	no_errors	ENST00000369784	ensembl	human	known	74_37	missense	SNP	0.989	C
FABP6	2172	genome.wustl.edu	37	5	159640774	159640774	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr5:159640774G>T	ENST00000393980.4	+	3	229	c.83G>T	c.(82-84)tGg>tTg	p.W28L	FABP6_ENST00000393982.1_Missense_Mutation_p.W28L	NM_001130958.1	NP_001124430.1	P51161	FABP6_HUMAN	fatty acid binding protein 6, ileal	0					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			breast(1)|kidney(1)|large_intestine(1)|lung(2)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCGTGCACATGGGTGAGCCGG	0.483																																					Colon(29;562 677 12756 16385 20992)												0								ENSG00000170231						151.0	160.0	157.0					5																	159640774		2059	4226	6285	FABP6	SO:0001583	missense	0			-	HGNC	U19869	CCDS4349.1, CCDS43393.1	5q23-q35	2013-03-01	2008-08-01		ENSG00000170231	ENSG00000170231		"""Fatty acid binding protein family"""	3561	protein-coding gene	gene with protein product	"""illeal lipid-binding protein"", ""ileal bile acid binding protein"", ""gastrotropin"""	600422				7894165, 7619861	Standard	NM_001130958		Approved	I-15P, ILLBP, I-BAP, ILBP3, I-BABP, ILBP, I-BALB	uc003lxx.1	P51161	OTTHUMG00000130329	ENST00000393980.4:c.83G>T	5.37:g.159640774G>T	ENSP00000377549:p.Trp28Leu	Somatic	0	49	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q07DR7|Q8TBI3|Q9UGI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Calycin-like,prints_Fatty_acid-bd	p.W28L	ENST00000393980.4	37	c.83	CCDS43393.1	5	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901207	0.33535	.	.	ENSG00000170231	ENST00000393980;ENST00000393982	T;T	0.13307	2.6;2.6	2.08	2.08	0.27032	.	0.063246	0.08080	U	1.000000	T	0.32102	0.0818	.	.	.	0.09310	N	1	D	0.69078	0.997	D	0.80764	0.994	T	0.10823	-1.0613	9	0.87932	D	0	.	7.7054	0.28646	0.0:0.0:1.0:0.0	.	28	P51161-2	.	L	28	ENSP00000377549:W28L;ENSP00000377551:W28L	ENSP00000377549:W28L	W	+	2	0	FABP6	159573352	0.006000	0.16342	0.030000	0.17652	0.022000	0.10575	1.956000	0.40382	1.469000	0.48083	0.549000	0.68633	TGG	-	NULL		0.483	FABP6-001	KNOWN	basic|CCDS	protein_coding	FABP6	protein_coding	OTTHUMT00000252678.4	G	NM_001040442	-		159640774	+1	no_errors	ENST00000393980	ensembl	human	known	74_37	missense	SNP	0.034	T
PRKACA	5566	genome.wustl.edu	37	19	14202661	14202661	+	3'UTR	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr19:14202661G>T	ENST00000308677.4	-	0	2515				SAMD1_ENST00000541938.1_5'Flank|SAMD1_ENST00000533683.2_5'Flank|PRKACA_ENST00000350356.3_5'UTR	NM_002730.3	NP_002721.1	P17612	KAPCA_HUMAN	protein kinase, cAMP-dependent, catalytic, alpha						activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|carbohydrate metabolic process (GO:0005975)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to glucagon stimulus (GO:0071377)|cellular response to glucose stimulus (GO:0071333)|cellular response to parathyroid hormone stimulus (GO:0071374)|cytosolic calcium ion homeostasis (GO:0051480)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm formation (GO:0001707)|mitotic cell cycle (GO:0000278)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of protein export from nucleus (GO:0046827)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of insulin secretion (GO:0050796)|regulation of osteoblast differentiation (GO:0045667)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein binding (GO:0043393)|regulation of protein processing (GO:0070613)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of synaptic transmission (GO:0050804)|regulation of tight junction assembly (GO:2000810)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|calcium channel complex (GO:0034704)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|motile cilium (GO:0031514)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|protein kinase A regulatory subunit binding (GO:0034237)|protein kinase binding (GO:0019901)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16						GGGATGGGGAGAAGTTATGAG	0.577																																																	0								ENSG00000072062																																			PRKACA	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS12304.1, CCDS12305.1	19p13.1	2012-10-02				ENSG00000072062	2.7.11.1		9380	protein-coding gene	gene with protein product		601639				8884279	Standard	NM_002730		Approved	PKACa	uc002myc.3	P17612		ENST00000308677.4:c.*1263C>A	19.37:g.14202661G>T		Somatic	0	73	0.00		0.5992772487206903	109	39.56	72	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	48	40.74	Q32P54|Q9H2Y0|Q9NRB4|Q9NRH9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000308677.4	37	NULL	CCDS12304.1	19																																																																																			-	-		0.577	PRKACA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACA	protein_coding	OTTHUMT00000459004.1	G	NM_002730	-		14202661	-1	no_errors	ENST00000350356	ensembl	human	known	74_37	rna	SNP	0.979	T
DNAH10	196385	genome.wustl.edu	37	12	124298365	124298365	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr12:124298365C>A	ENST00000409039.3	+	20	3357	c.3332C>A	c.(3331-3333)aCa>aAa	p.T1111K		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1111	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GTCCTTGCAACAATTGCAGAA	0.408																																																	0								ENSG00000197653						76.0	75.0	75.0					12																	124298365		2102	4263	6365	DNAH10	SO:0001583	missense	0			-	HGNC	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3332C>A	12.37:g.124298365C>A	ENSP00000386770:p.Thr1111Lys	Somatic	0	93	0.00		0.5992772487206903	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	54	25.00	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.T1111K	ENST00000409039.3	37	c.3332	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887538	0.91814	.	.	ENSG00000197653	ENST00000409039	T	0.22945	1.93	5.72	5.72	0.89469	.	.	.	.	.	T	0.48259	0.1490	M	0.80183	2.485	0.54753	D	0.999987	P	0.45011	0.848	P	0.52823	0.71	T	0.31613	-0.9937	9	0.29301	T	0.29	.	19.8751	0.96867	0.0:1.0:0.0:0.0	.	1111	Q8IVF4	DYH10_HUMAN	K	1111	ENSP00000386770:T1111K	ENSP00000386770:T1111K	T	+	2	0	DNAH10	122864318	1.000000	0.71417	0.113000	0.21522	0.987000	0.75469	5.720000	0.68470	2.695000	0.91970	0.655000	0.94253	ACA	-	NULL		0.408	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	protein_coding	OTTHUMT00000335420.3	C		-		124298365	+1	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	SNP	0.945	A
PIGC	5279	genome.wustl.edu	37	1	172411238	172411238	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr1:172411238G>T	ENST00000367728.1	-	1	1988	c.525C>A	c.(523-525)agC>agA	p.S175R	C1orf105_ENST00000367727.4_Intron|PIGC_ENST00000344529.4_Missense_Mutation_p.S175R|PIGC_ENST00000258324.1_Missense_Mutation_p.S175R|PIGC_ENST00000484368.1_Intron			Q92535	PIGC_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class C	175					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			breast(1)|endometrium(1)|kidney(1)|lung(1)	4						AGGATAGTGTGCTGGATACAA	0.478																																																	0								ENSG00000135845						102.0	82.0	88.0					1																	172411238		2203	4300	6503	PIGC	SO:0001583	missense	0			-	HGNC	BC006539	CCDS1302.1	1q23-q25	2013-02-26	2006-06-28		ENSG00000135845	ENSG00000135845	2.4.1.198	"""Phosphatidylinositol glycan anchor biosynthesis"""	8960	protein-coding gene	gene with protein product	"""phosphatidylinositol N-acetylglucosaminyltransferase"""	601730	"""phosphatidylinositol glycan, class C"""			8806613, 9325057	Standard	NM_153747		Approved		uc001gio.3	Q92535	OTTHUMG00000034751	ENST00000367728.1:c.525C>A	1.37:g.172411238G>T	ENSP00000356702:p.Ser175Arg	Somatic	0	33	0.00		0.5992772487206903	161	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	O14491	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plno_GlcNAc_GPI2,pirsf_Plno_GlcNAc_GPI2	p.S175R	ENST00000367728.1	37	c.525	CCDS1302.1	1	.	.	.	.	.	.	.	.	.	.	G	13.49	2.252883	0.39797	.	.	ENSG00000135845	ENST00000344529;ENST00000367728;ENST00000258324	T;T;T	0.41065	1.01;1.01;1.01	5.34	4.42	0.53409	.	0.046402	0.85682	D	0.000000	T	0.29945	0.0749	L	0.46157	1.445	0.80722	D	1	P	0.47484	0.896	P	0.49887	0.625	T	0.02533	-1.1145	10	0.30078	T	0.28	-6.2388	9.5423	0.39260	0.1623:0.0:0.8377:0.0	.	175	Q92535	PIGC_HUMAN	R	175	ENSP00000356701:S175R;ENSP00000356702:S175R;ENSP00000258324:S175R	ENSP00000258324:S175R	S	-	3	2	PIGC	170677861	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	0.833000	0.27504	2.505000	0.84491	0.650000	0.86243	AGC	-	pfam_Plno_GlcNAc_GPI2,pirsf_Plno_GlcNAc_GPI2		0.478	PIGC-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIGC	protein_coding	OTTHUMT00000084068.1	G	NM_153747	-		172411238	-1	no_errors	ENST00000258324	ensembl	human	known	74_37	missense	SNP	1.000	T
CLN8	2055	genome.wustl.edu	37	8	1728483	1728483	+	Missense_Mutation	SNP	G	G	T	rs386834134		TCGA-FX-A76Y-01A-11D-A351-09	TCGA-FX-A76Y-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4b20604a-cda0-4e4e-b0fa-a37129cdef5e	ba44c28e-2e23-4deb-b9d5-ea07f07e8d79	g.chr8:1728483G>T	ENST00000331222.4	+	3	858	c.611G>T	c.(610-612)cGc>cTc	p.R204L	CLN8_ENST00000523237.1_3'UTR	NM_018941.3	NP_061764.2	Q9UBY8	CLN8_HUMAN	ceroid-lipofuscinosis, neuronal 8 (epilepsy, progressive with mental retardation)	204	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.		R -> C (in CLN8). {ECO:0000269|PubMed:15024724}.		adult walking behavior (GO:0007628)|age-dependent response to oxidative stress (GO:0001306)|associative learning (GO:0008306)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|ceramide biosynthetic process (GO:0046513)|ceramide metabolic process (GO:0006672)|cholesterol metabolic process (GO:0008203)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|lipid biosynthetic process (GO:0008610)|lipid transport (GO:0006869)|lysosome organization (GO:0007040)|mitochondrial membrane organization (GO:0007006)|musculoskeletal movement (GO:0050881)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteolysis (GO:0045861)|negative regulation of transferase activity (GO:0051348)|nervous system development (GO:0007399)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|phospholipid metabolic process (GO:0006644)|photoreceptor cell maintenance (GO:0045494)|protein catabolic process (GO:0030163)|regulation of cell size (GO:0008361)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic motor neuron differentiation (GO:0021523)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24		Ovarian(12;0.0563)|Colorectal(14;0.0815)|Hepatocellular(245;0.0831)		BRCA - Breast invasive adenocarcinoma(11;7.67e-05)|READ - Rectum adenocarcinoma(644;0.0913)		TTTCACTGCCGCATGGTTCTA	0.522																																					Pancreas(155;338 1942 6138 10888 50612)												0								ENSG00000182372						223.0	143.0	170.0					8																	1728483		2203	4300	6503	CLN8	SO:0001583	missense	0			-	HGNC	AF123761	CCDS5956.1	8p23.3	2014-09-17			ENSG00000182372	ENSG00000182372			2079	protein-coding gene	gene with protein product		607837	"""chromosome 8 open reading frame 61"""	EPMR, C8orf61		10508524	Standard	NM_018941		Approved	FLJ39417	uc003wpo.4	Q9UBY8	OTTHUMG00000090343	ENST00000331222.4:c.611G>T	8.37:g.1728483G>T	ENSP00000328182:p.Arg204Leu	Somatic	0	46	0.00		0.5992772487206903	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	43	10.42	Q86U71|Q96I95	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	p.R204L	ENST00000331222.4	37	c.611	CCDS5956.1	8	.	.	.	.	.	.	.	.	.	.	G	32	5.167182	0.94768	.	.	ENSG00000182372	ENST00000331222	D	0.99760	-6.66	5.17	4.29	0.51040	TRAM/LAG1/CLN8 homology domain (3);	0.091849	0.44688	N	0.000428	D	0.99670	0.9877	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97208	0.9869	10	0.72032	D	0.01	-4.8069	13.086	0.59140	0.0775:0.0:0.9225:0.0	.	204	Q9UBY8	CLN8_HUMAN	L	204	ENSP00000328182:R204L	ENSP00000328182:R204L	R	+	2	0	CLN8	1715890	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.222000	0.78025	2.400000	0.81607	0.650000	0.86243	CGC	-	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom		0.522	CLN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN8	protein_coding	OTTHUMT00000206715.2	G	NM_018941	-		1728483	+1	no_errors	ENST00000331222	ensembl	human	known	74_37	missense	SNP	1.000	T
