#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PRAMEF5	343068	genome.wustl.edu	37	1	13366043	13366043	+	Missense_Mutation	SNP	T	T	C			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr1:13366043T>C	ENST00000376168.1	+	3	587	c.487T>C	c.(487-489)Tac>Cac	p.Y163H		NM_001013407.1	NP_001013425.1	Q5TYX0	PRAM5_HUMAN	PRAME family member 5	163					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					central_nervous_system(1)|kidney(3)	4	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCTGGATGAATACCTCACCTG	0.473																																																	0								ENSG00000204502						1.0	1.0	1.0					1																	13366043		14	23	37	PRAMEF5	SO:0001583	missense	0			-	HGNC		CCDS72708.1	1p36.21	2014-07-15			ENSG00000204502			"""-"""	27995	protein-coding gene	gene with protein product			"""PRAME family member 23"""	PRAMEF23			Standard	NM_001013407		Approved	PRAMEF5L	uc001auu.1	Q5TYX0	OTTHUMG00000009505	ENST00000376168.1:c.487T>C	1.37:g.13366043T>C	ENSP00000365338:p.Tyr163His	Somatic	0	19	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	A2BDD6|A4FU31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Y163H	ENST00000376168.1	37	c.487	CCDS30596.1	1	.	.	.	.	.	.	.	.	.	.	.	6.256	0.415292	0.11870	.	.	ENSG00000204502	ENST00000376168	T	0.04917	3.53	1.13	1.13	0.20643	.	0.307559	0.30940	N	0.008569	T	0.03095	0.0091	N	0.12471	0.22	0.80722	P	0.0	.	.	.	.	.	.	T	0.34976	-0.9807	7	0.19147	T	0.46	.	4.4783	0.11755	0.0:0.0:0.0:1.0	.	.	.	.	H	163	ENSP00000365338:Y163H	ENSP00000365338:Y163H	Y	+	1	0	PRAMEF5	13238630	0.002000	0.14202	0.002000	0.10522	0.164000	0.22412	1.152000	0.31663	0.768000	0.33290	0.136000	0.15936	TAC	-	NULL		0.473	PRAMEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF5	protein_coding	OTTHUMT00000026271.1	T	NM_001013407	-		13366043	+1	no_errors	ENST00000376168	ensembl	human	known	74_37	missense	SNP	0.002	C
KCNG4	93107	genome.wustl.edu	37	16	84256307	84256307	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr16:84256307G>T	ENST00000308251.4	-	3	1144	c.1076C>A	c.(1075-1077)aCg>aAg	p.T359K		NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	359					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						GAGCCCCAGCGTCTGCAGCCC	0.662																																																	0								ENSG00000168418						17.0	17.0	17.0					16																	84256307		2198	4296	6494	KCNG4	SO:0001583	missense	0			-	HGNC	AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.1076C>A	16.37:g.84256307G>T	ENSP00000312129:p.Thr359Lys	Somatic	0	24	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	Q96H24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.T359K	ENST00000308251.4	37	c.1076	CCDS10945.1	16	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491469	0.84962	.	.	ENSG00000168418	ENST00000308251	T	0.63096	-0.02	5.61	4.65	0.58169	Ion transport (1);	0.048222	0.85682	D	0.000000	T	0.76821	0.4041	M	0.67700	2.07	0.80722	D	1	D	0.69078	0.997	D	0.69824	0.966	T	0.79671	-0.1706	10	0.66056	D	0.02	.	15.7048	0.77569	0.0:0.1369:0.863:0.0	.	359	Q8TDN1	KCNG4_HUMAN	K	359	ENSP00000312129:T359K	ENSP00000312129:T359K	T	-	2	0	KCNG4	82813808	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.750000	0.68712	1.346000	0.45694	0.655000	0.94253	ACG	-	pfam_Ion_trans_dom,prints_K_chnl		0.662	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG4	protein_coding	OTTHUMT00000269079.2	G	NM_172347	-		84256307	-1	no_errors	ENST00000308251	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF511	118472	genome.wustl.edu	37	10	135126406	135126406	+	3'UTR	SNP	G	G	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr10:135126406G>T	ENST00000359035.3	+	0	1744				ZNF511_ENST00000368554.4_Intron|ZNF511_ENST00000361518.5_3'UTR|ZNF511_ENST00000463816.2_3'UTR			Q8NB15	ZN511_HUMAN	zinc finger protein 511						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	8		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		all cancers(32;7.56e-06)|OV - Ovarian serous cystadenocarcinoma(35;8.15e-06)|Epithelial(32;9.99e-06)		AGTCACCACTGCTGGGCGTGG	0.577																																																	0								ENSG00000198546						57.0	61.0	60.0					10																	135126406		2203	4300	6503	ZNF511	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK091711	CCDS7677.1	10q26.3	2010-04-12			ENSG00000198546	ENSG00000198546		"""Zinc fingers, C2H2-type"""	28445	protein-coding gene	gene with protein product						12477932	Standard	NM_145806		Approved	MGC30006	uc001lmj.1	Q8NB15	OTTHUMG00000019317	ENST00000359035.3:c.*952G>T	10.37:g.135126406G>T		Somatic	0	31	0.00		0.5319925576939081	123	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	A8K8L5|Q8WUP1|Q96BV2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359035.3	37	NULL		10																																																																																			-	-		0.577	ZNF511-002	KNOWN	basic	protein_coding	ZNF511	protein_coding	OTTHUMT00000051143.1	G	NM_145806	-		135126406	+1	no_errors	ENST00000463816	ensembl	human	known	74_37	rna	SNP	0.000	T
CCDC144NL-AS1	440416	genome.wustl.edu	37	17	20806093	20806093	+	RNA	DEL	G	G	-	rs201435947		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr17:20806093delG	ENST00000577537.1	+	0	1277				RP11-344E13.3_ENST00000583962.1_RNA|RP11-344E13.3_ENST00000417232.2_RNA|RP11-344E13.3_ENST00000577860.1_RNA|RP11-344E13.3_ENST00000439794.2_RNA																							CGACTCCCAAGGAACCACTAA	0.463																																																	0								ENSG00000233098																																			RP11-344E13.3			0				Clone_based_vega_gene																													17.37:g.20806093delG		Somatic	0	11	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	9	40.00		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000577537.1	37	NULL		17																																																																																			-	-		0.463	RP11-344E13.3-001	KNOWN	basic	antisense	LOC440416	antisense	OTTHUMT00000444041.1	G				20806093	+1	no_errors	ENST00000577537	ensembl	human	known	74_37	rna	DEL	0.111	-
COIL	8161	genome.wustl.edu	37	17	55028339	55028339	+	Silent	SNP	T	T	C			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr17:55028339T>C	ENST00000240316.4	-	2	298	c.264A>G	c.(262-264)agA>agG	p.R88R		NM_004645.2	NP_004636.1	P38432	COIL_HUMAN	coilin	88						Cajal body (GO:0015030)|cytoplasm (GO:0005737)|female germ cell nucleus (GO:0001674)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	disulfide oxidoreductase activity (GO:0015036)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			NS(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	15	Breast(9;6.15e-08)					CAGCAACTCCTCTCTCTTCTA	0.368																																																	0								ENSG00000121058						35.0	37.0	37.0					17																	55028339		2185	4276	6461	COIL	SO:0001819	synonymous_variant	0			-	HGNC	U06632	CCDS11592.1	17q22	2012-10-02			ENSG00000121058	ENSG00000121058			2184	protein-coding gene	gene with protein product		600272				7971277	Standard	NM_004645		Approved	CLN80, p80-coilin	uc002iuu.3	P38432	OTTHUMG00000178126	ENST00000240316.4:c.264A>G	17.37:g.55028339T>C		Somatic	0	29	0.00		0.5319925576939081	21	38.24	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	17	51.43	B2R931	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R88	ENST00000240316.4	37	c.264	CCDS11592.1	17																																																																																			-	NULL		0.368	COIL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COIL	protein_coding	OTTHUMT00000440618.1	T		-		55028339	-1	no_errors	ENST00000240316	ensembl	human	known	74_37	silent	SNP	0.004	C
ACTN4	81	genome.wustl.edu	37	19	39195638	39195638	+	Silent	SNP	C	C	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr19:39195638C>T	ENST00000252699.2	+	4	538	c.462C>T	c.(460-462)gcC>gcT	p.A154A	ACTN4_ENST00000390009.3_Intron|ACTN4_ENST00000424234.2_Intron	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	154	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTAGGTTCGCCATCCAGGACA	0.577																																					Colon(168;199 1940 10254 46213 46384)												0								ENSG00000130402						153.0	115.0	128.0					19																	39195638		2203	4300	6503	ACTN4	SO:0001819	synonymous_variant	0			-	HGNC	D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.462C>T	19.37:g.39195638C>T		Somatic	0	80	0.00		0.5319925576939081	253	31.99	119	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	35	48.53	A4K467|D6PXK4|O76048	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.A154	ENST00000252699.2	37	c.462	CCDS12518.1	19																																																																																			-	superfamily_CH-domain,pfscan_CH-domain		0.577	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	protein_coding	OTTHUMT00000268091.1	C		-		39195638	+1	no_errors	ENST00000252699	ensembl	human	known	74_37	silent	SNP	1.000	T
UBA7	7318	genome.wustl.edu	37	3	49845842	49845842	+	Missense_Mutation	SNP	G	G	T	rs2234386		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr3:49845842G>T	ENST00000333486.3	-	19	2565	c.2407C>A	c.(2407-2409)Ctg>Atg	p.L803M	MIR5193_ENST00000584510.1_RNA	NM_003335.2	NP_003326.2	P41226	UBA7_HUMAN	ubiquitin-like modifier activating enzyme 7	803					cellular protein modification process (GO:0006464)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|ISG15-protein conjugation (GO:0032020)|modification-dependent protein catabolic process (GO:0019941)|negative regulation of type I interferon production (GO:0032480)|protein ubiquitination (GO:0016567)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ISG15 activating enzyme activity (GO:0019782)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(15)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;3.58e-06)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		AGAGGCTTCAGGGGAGGGCCC	0.567																																																	0								ENSG00000182179						128.0	136.0	133.0					3																	49845842		2203	4300	6503	UBA7	SO:0001583	missense	0			-	HGNC	BC006378	CCDS2805.1	3p21	2007-11-30	2007-11-30	2007-11-30	ENSG00000182179	ENSG00000182179		"""Ubiquitin-like modifier activating enzymes"""	12471	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog B (yeast)"", ""UBA7, ubiquitin-activating enzyme E1"""	191325	"""ubiquitin-activating enzyme E1-like"""	UBE1L		8327486	Standard	NM_003335		Approved	D8, UBE2, UBA1B	uc003cxr.3	P41226	OTTHUMG00000158267	ENST00000333486.3:c.2407C>A	3.37:g.49845842G>T	ENSP00000333266:p.Leu803Met	Somatic	0	41	0.00		0.5319925576939081	65	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	Q9BRB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ThiF_NAD_FAD-bd,pfam_UBact_repeat,pfam_Ub-activating_enz_e1_C,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.L803M	ENST00000333486.3	37	c.2407	CCDS2805.1	3	.	.	.	.	.	.	.	.	.	.	G	13.98	2.399765	0.42512	.	.	ENSG00000182179	ENST00000333486	T	0.44881	0.91	5.22	1.18	0.20946	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.059685	0.64402	D	0.000005	T	0.28234	0.0697	L	0.35723	1.085	0.09310	N	1	P	0.51057	0.941	P	0.45232	0.474	T	0.08806	-1.0704	10	0.28530	T	0.3	-13.8994	3.3046	0.06996	0.2918:0.0:0.5245:0.1837	.	803	P41226	UBA7_HUMAN	M	803	ENSP00000333266:L803M	ENSP00000333266:L803M	L	-	1	2	UBA7	49820846	0.035000	0.19736	0.025000	0.17156	0.381000	0.30169	0.435000	0.21510	0.709000	0.31976	-0.254000	0.11334	CTG	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1		0.567	UBA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA7	protein_coding	OTTHUMT00000350503.1	G	NM_003335	-		49845842	-1	no_errors	ENST00000333486	ensembl	human	known	74_37	missense	SNP	0.031	T
NUP210P1	255330	genome.wustl.edu	37	3	126382250	126382250	+	RNA	SNP	C	C	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr3:126382250C>T	ENST00000357061.3	+	0	217					NR_034158.1				nucleoporin 210kDa pseudogene 1																		CACTGGTGAGCGCTTCCAGGC	0.572																																																	0								ENSG00000198284																																			NUP210P1			0			-	HGNC	BC042038		3q21.2	2011-08-16	2011-08-16	2011-08-16	ENSG00000198284	ENSG00000198284			27399	pseudogene	pseudogene			"""chromosome 3 open reading frame 46"""	C3orf46			Standard	NR_034158		Approved		uc003eje.1		OTTHUMG00000159577		3.37:g.126382250C>T		Somatic	0	38	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	19	58.70		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000357061.3	37	NULL		3																																																																																			-	-		0.572	NUP210P1-002	KNOWN	basic	processed_transcript	NUP210P1	pseudogene	OTTHUMT00000356320.1	C	NR_034158	-		126382250	+1	no_errors	ENST00000357061	ensembl	human	known	74_37	rna	SNP	0.424	T
BNC2	54796	genome.wustl.edu	37	9	16552635	16552635	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr9:16552635T>A	ENST00000380672.4	-	5	619	c.562A>T	c.(562-564)Atc>Ttc	p.I188F	BNC2_ENST00000380666.2_Missense_Mutation_p.I188F|BNC2_ENST00000545497.1_Missense_Mutation_p.I93F|BNC2_ENST00000380667.2_Missense_Mutation_p.I121F	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		TCCAGCAGGATCTTTAGCCGC	0.557																																																	0								ENSG00000173068						125.0	94.0	105.0					9																	16552635		2203	4300	6503	BNC2	SO:0001583	missense	0			-	HGNC	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.562A>T	9.37:g.16552635T>A	ENSP00000370047:p.Ile188Phe	Somatic	0	45	0.00		0.5319925576939081	3	75.00	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	36	37.93		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I188F	ENST00000380672.4	37	c.562	CCDS6482.2	9	.	.	.	.	.	.	.	.	.	.	T	32	5.141932	0.94560	.	.	ENSG00000173068	ENST00000380672;ENST00000418777;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000545497;ENST00000544198;ENST00000380666;ENST00000540340	T;T;T;T;T	0.03717	3.83;3.83;3.83;3.83;3.83	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.20007	0.0481	M	0.77103	2.36	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.995;0.987;0.999;1.0;0.995;0.999	D;D;D;D;D;D;D	0.91635	0.998;0.969;0.974;0.994;0.999;0.969;0.986	T	0.00085	-1.2098	10	0.87932	D	0	-21.817	16.6512	0.85203	0.0:0.0:0.0:1.0	.	93;121;225;188;14;146;188	F5H586;B1APH0;Q06HC4;Q6ZN30-2;B4E3J2;Q5H9S4;Q6ZN30	.;.;.;.;.;.;BNC2_HUMAN	F	188;145;225;216;121;93;14;188;188	ENSP00000370047:I188F;ENSP00000408370:I145F;ENSP00000370042:I121F;ENSP00000444640:I93F;ENSP00000370041:I188F	ENSP00000370041:I188F	I	-	1	0	BNC2	16542635	1.000000	0.71417	1.000000	0.80357	0.773000	0.43773	8.040000	0.89188	2.333000	0.79357	0.482000	0.46254	ATC	-	NULL		0.557	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	protein_coding	OTTHUMT00000216901.5	T	NM_017637	-		16552635	-1	no_errors	ENST00000380672	ensembl	human	known	74_37	missense	SNP	1.000	A
RCC1	1104	genome.wustl.edu	37	1	28858479	28858479	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr1:28858479G>T	ENST00000373833.6	+	6	523	c.238G>T	c.(238-240)Gtg>Ttg	p.V80L	RCC1_ENST00000373832.1_Missense_Mutation_p.V80L|RCC1_ENST00000429051.1_3'UTR|RCC1_ENST00000398958.2_Missense_Mutation_p.V80L|RCC1_ENST00000373831.3_Missense_Mutation_p.V111L			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	80					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		CATGCACACCGTGTGTCTAAG	0.607																																																	0								ENSG00000180198						58.0	59.0	59.0					1																	28858479		2203	4300	6503	RCC1	SO:0001583	missense	0			-	HGNC	X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.238G>T	1.37:g.28858479G>T	ENSP00000362939:p.Val80Leu	Somatic	0	63	0.00		0.5319925576939081	65	47.15	58	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	38	39.68	Q16269|Q6NT97	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.V111L	ENST00000373833.6	37	c.331	CCDS323.1	1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.278594	0.59758	.	.	ENSG00000180198	ENST00000398958;ENST00000427469;ENST00000434290;ENST00000373833;ENST00000419074;ENST00000373832;ENST00000373831;ENST00000411533;ENST00000430407	D;D;D;D;D;D;D;D;D	0.84298	-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83;-1.83	5.86	5.86	0.93980	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	T	0.81389	0.4812	N	0.11255	0.115	0.80722	D	1	B;D;D	0.58268	0.024;0.969;0.982	B;P;P	0.54499	0.044;0.754;0.754	T	0.81061	-0.1103	10	0.30078	T	0.28	-15.316	16.9762	0.86313	0.0:0.0:1.0:0.0	.	111;97;80	P18754-2;E9PAT9;P18754	.;.;RCC1_HUMAN	L	80;80;88;80;80;80;111;97;80	ENSP00000381931:V80L;ENSP00000402740:V80L;ENSP00000405258:V88L;ENSP00000362939:V80L;ENSP00000402260:V80L;ENSP00000362938:V80L;ENSP00000362937:V111L;ENSP00000413644:V97L;ENSP00000394650:V80L	ENSP00000362937:V111L	V	+	1	0	RCC1	28731066	1.000000	0.71417	0.981000	0.43875	0.999000	0.98932	9.324000	0.96373	2.784000	0.95788	0.650000	0.86243	GTG	-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens,prints_Reg_chr_condens		0.607	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RCC1	protein_coding	OTTHUMT00000010323.3	G	NM_001269	-		28858479	+1	no_errors	ENST00000373831	ensembl	human	known	74_37	missense	SNP	1.000	T
HELZ2	85441	genome.wustl.edu	37	20	62202768	62202768	+	Intron	SNP	G	G	A	rs71335511|rs33978623	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr20:62202768G>A	ENST00000467148.1	-	2	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										CTCCTGCCCCGCTCCAAGCTC	0.687																																																	0								ENSG00000130589																																			HELZ2	SO:0001627	intron_variant	0			-	HGNC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.279-547C>T	20.37:g.62202768G>A		Somatic	0	41	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	23	23.33	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			-	-		0.687	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	G	NM_001037335	rs33978623		62202768	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	SNP	0.993	A
SLFN12L	100506736	genome.wustl.edu	37	17	33806526	33806526	+	Nonsense_Mutation	SNP	G	G	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr17:33806526G>A	ENST00000260908.7	-	2	820	c.703C>T	c.(703-705)Cga>Tga	p.R235*	RP11-686D22.9_ENST00000587076.1_RNA|SLFN12L_ENST00000449046.1_Nonsense_Mutation_p.R266*|SLFN12L_ENST00000361112.4_Nonsense_Mutation_p.R264*	NM_001195790.1	NP_001182719.1	Q6IEE8	SN12L_HUMAN	schlafen family member 12-like	235						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)			breast(1)|endometrium(4)|kidney(5)|large_intestine(2)|lung(3)|ovary(1)	16						TCTGTAATTCGTTGTAACAAC	0.313																																																	0								ENSG00000205045						112.0	90.0	97.0					17																	33806526		692	1590	2282	SLFN12L	SO:0001587	stop_gained	0			-	HGNC	AK172761	CCDS56026.1	17q12	2011-05-24				ENSG00000205045			33920	protein-coding gene	gene with protein product		614956				9846487	Standard	NM_001195790		Approved		uc021tuy.1	Q6IEE8		ENST00000260908.7:c.703C>T	17.37:g.33806526G>A	ENSP00000437635:p.Arg235*	Somatic	0	62	0.00		0.5319925576939081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	44	48.84	F5H6G3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA-4	p.R266*	ENST00000260908.7	37	c.796	CCDS56026.1	17	.	.	.	.	.	.	.	.	.	.	G	41	8.939927	0.99010	.	.	ENSG00000205045	ENST00000260908;ENST00000361112;ENST00000449046	.	.	.	2.62	-1.25	0.09405	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	2.2986	0.04156	0.3031:0.0:0.4575:0.2393	.	.	.	.	X	235;264;266	.	ENSP00000437635:R235X	R	-	1	2	SLFN12L	30830639	0.000000	0.05858	0.000000	0.03702	0.166000	0.22503	-1.111000	0.03303	0.015000	0.14971	0.411000	0.27672	CGA	-	pfam_ATPase_AAA-4		0.313	SLFN12L-004	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	SLFN12L	protein_coding	OTTHUMT00000395748.2	G	XM_496206	-		33806526	-1	no_errors	ENST00000449046	ensembl	human	known	74_37	nonsense	SNP	0.000	A
LRRFIP2	9209	genome.wustl.edu	37	3	37096646	37096646	+	Silent	SNP	A	A	G	rs201693185		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr3:37096646A>G	ENST00000336686.4	-	26	1961	c.1881T>C	c.(1879-1881)aaT>aaC	p.N627N	LRRFIP2_ENST00000440230.1_Silent_p.N330N|LRRFIP2_ENST00000421276.2_Silent_p.N330N|LRRFIP2_ENST00000354379.4_Silent_p.N306N|LRRFIP2_ENST00000421307.1_Silent_p.N627N|LRRFIP2_ENST00000396428.2_Silent_p.N409N|MLH1_ENST00000536378.1_Intron			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	627					Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TAATTTGTCTATTGGCATCTC	0.388																																																	1	Whole gene deletion(1)	ovary(1)						ENSG00000093167						221.0	221.0	221.0					3																	37096646		2201	4299	6500	LRRFIP2	SO:0001819	synonymous_variant	0			-	HGNC	AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.1881T>C	3.37:g.37096646A>G		Somatic	0	30	0.00		0.5319925576939081	44	56.44	57	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	28	40.43	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rep_flightless-int_pr,superfamily_bHLH_dom,superfamily_Prefoldin	p.N627	ENST00000336686.4	37	c.1881	CCDS2664.1	3																																																																																			-	pfam_Leu-rich_rep_flightless-int_pr,superfamily_Prefoldin		0.388	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	protein_coding	OTTHUMT00000253335.3	A	NM_006309	rs201693185		37096646	-1	no_errors	ENST00000336686	ensembl	human	known	74_37	silent	SNP	0.995	G
NRXN1	9378	genome.wustl.edu	37	2	50148734	50148734	+	3'UTR	SNP	G	G	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr2:50148734G>T	ENST00000406316.2	-	0	6258				NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR|NRXN1_ENST00000401710.1_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TTTTGTGTTGGTTTTTGTGTT	0.413																																																	0								ENSG00000179915																																			NRXN1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*348C>A	2.37:g.50148734G>T		Somatic	0	93	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	59	41.58	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.413	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	G		-		50148734	-1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	SNP	0.985	T
LINC00200	399706	genome.wustl.edu	37	10	1205736	1205736	+	lincRNA	SNP	A	A	G	rs60415666		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr10:1205736A>G	ENST00000425630.1	+	0	29					NR_015376.2				long intergenic non-protein coding RNA 200																		ATGAGGGATGACGCAGGCACA	0.667																																																	0								ENSG00000229205						15.0	18.0	17.0					10																	1205736		687	1591	2278	LINC00200			0			-	HGNC	AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1205736A>G		Somatic	0	26	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000425630.1	37	NULL		10																																																																																			-	-		0.667	LINC00200-001	KNOWN	basic	lincRNA	LINC00200	lincRNA	OTTHUMT00000046417.2	A	NR_015376	rs60415666		1205736	+1	no_errors	ENST00000425630	ensembl	human	known	74_37	rna	SNP	0.155	G
LOXL2	4017	genome.wustl.edu	37	8	23225664	23225664	+	Silent	SNP	G	G	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr8:23225664G>A	ENST00000389131.3	-	2	570	c.201C>T	c.(199-201)caC>caT	p.H67H	RP11-177H13.2_ENST00000519692.1_RNA	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	67	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GGCCCTCGCTGTGCTTCCTCT	0.652																																																	0								ENSG00000134013						73.0	62.0	65.0					8																	23225664		2203	4300	6503	LOXL2	SO:0001819	synonymous_variant	0			-	HGNC	U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.201C>T	8.37:g.23225664G>A		Somatic	0	62	0.00		0.5319925576939081	253	43.15	192	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	39	48.00	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.H67	ENST00000389131.3	37	c.201	CCDS34864.1	8																																																																																			-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.652	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL2	protein_coding	OTTHUMT00000375603.1	G		-		23225664	-1	no_errors	ENST00000389131	ensembl	human	known	74_37	silent	SNP	1.000	A
KCNJ2	3759	genome.wustl.edu	37	17	68172115	68172115	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr17:68172115G>A	ENST00000243457.3	+	2	1318	c.935G>A	c.(934-936)cGt>cAt	p.R312H	KCNJ2_ENST00000535240.1_Missense_Mutation_p.R312H	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	312					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					ACACAGTGCCGTAGCTCTTAT	0.468																																																	0								ENSG00000123700						61.0	63.0	62.0					17																	68172115		2203	4300	6503	KCNJ2	SO:0001583	missense	0			-	HGNC	AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.935G>A	17.37:g.68172115G>A	ENSP00000243457:p.Arg312His	Somatic	0	56	0.00		0.5319925576939081	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	29	44.23	O15110|P48049	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.1	p.R312H	ENST00000243457.3	37	c.935	CCDS11688.1	17	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252522	0.80135	.	.	ENSG00000123700	ENST00000535240;ENST00000243457	D;D	0.94897	-3.55;-3.55	5.77	5.77	0.91146	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.98513	0.9504	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98959	1.0797	9	.	.	.	.	20.3626	0.98863	0.0:0.0:1.0:0.0	.	312	P63252	IRK2_HUMAN	H	312	ENSP00000441848:R312H;ENSP00000243457:R312H	.	R	+	2	0	KCNJ2	65683710	1.000000	0.71417	0.984000	0.44739	0.880000	0.50808	9.813000	0.99286	2.885000	0.99019	0.655000	0.94253	CGT	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir		0.468	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNJ2	protein_coding	OTTHUMT00000450889.1	G	NM_000891	-		68172115	+1	no_errors	ENST00000243457	ensembl	human	known	74_37	missense	SNP	1.000	A
TMEM45A	55076	genome.wustl.edu	37	3	100295909	100295910	+	3'UTR	INS	-	-	TTGTCT	rs199733796|rs5851214	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr3:100295909_100295910insTTGTCT	ENST00000323523.4	+	0	1188_1189				TMEM45A_ENST00000403410.1_3'UTR	NM_018004.1	NP_060474.1	Q9NWC5	TM45A_HUMAN	transmembrane protein 45A							integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)	11						TCTTTTTTACATTGTTCTTGGT	0.347														1253	0.2502	0.3843	0.2493	5008	,	,		18917	0.3185		0.1213	False		,,,				2504	0.1319																0								ENSG00000181458			1436,2816		258,920,948						2.1	0.0		dbSNP_114	38	989,7257		60,869,3194	no	utr-3	TMEM45A	NM_018004.1		318,1789,4142	A1A1,A1R,RR		11.9937,33.7723,19.4031				2425,10073				TMEM45A	SO:0001624	3_prime_UTR_variant	0				HGNC	AK000996	CCDS2937.1	3q12.2	2005-02-04			ENSG00000181458	ENSG00000181458			25480	protein-coding gene	gene with protein product						12477932	Standard	XM_005247568		Approved	FLJ10134, DERP7	uc003dtz.1	Q9NWC5	OTTHUMG00000150327	ENST00000323523.4:c.*48->TTGTCT	3.37:g.100295909_100295910insTTGTCT		Somatic	NA	NA	NA		0.5319925576939081	26	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53YW5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000323523.4	37	NULL	CCDS2937.1	3																																																																																			-	-		0.347	TMEM45A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM45A	protein_coding	OTTHUMT00000317571.1	-	NM_018004			100295910	+1	no_errors	ENST00000488904	ensembl	human	known	74_37	rna	INS	0.000:0.031	TTGTCT
LRBA	987	genome.wustl.edu	37	4	151186065	151186069	+	3'UTR	DEL	AACAA	AACAA	-	rs113745272|rs9307874|rs75691255	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	AACAA	AACAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr4:151186065_151186069delAACAA	ENST00000357115.3	-	0	9640_9644				LRBA_ENST00000510413.1_3'UTR|LRBA_ENST00000535741.1_3'UTR|LRBA_ENST00000503716.1_5'UTR	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing							cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					GGGGTGCCCCAACAAAACAACAGTG	0.459														2931	0.585264	0.3865	0.6974	5008	,	,		16738	0.4762		0.6501	False		,,,				2504	0.82																0								ENSG00000198589																																			LRBA	SO:0001624	3_prime_UTR_variant	0				HGNC	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.*809TTGTT>-	4.37:g.151186070_151186074delAACAA		Somatic	NA	NA	NA		0.5319925576939081	64	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000357115.3	37	NULL	CCDS3773.1	4																																																																																			-	-		0.459	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	protein_coding	OTTHUMT00000364939.1	AACAA				151186069	-1	no_errors	ENST00000503716	ensembl	human	known	74_37	rna	DEL	0.005:0.005:0.005:0.005:0.004	-
DIAPH1	1729	genome.wustl.edu	37	5	140896395	140896395	+	3'UTR	SNP	C	C	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr5:140896395C>T	ENST00000398557.4	-	0	3982				DIAPH1_ENST00000518047.1_3'UTR|DIAPH1_ENST00000389054.3_3'UTR|DIAPH1_ENST00000253811.6_3'UTR|DIAPH1_ENST00000398562.2_3'UTR|DIAPH1_ENST00000520569.1_3'UTR|DIAPH1_ENST00000398566.3_3'UTR|DIAPH1_ENST00000389057.5_3'UTR	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1						actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCTGAGGAGCTGCCGCGGTC	0.597																																																	0								ENSG00000131504						68.0	70.0	70.0					5																	140896395		2088	4198	6286	DIAPH1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.*23G>A	5.37:g.140896395C>T		Somatic	0	39	0.00		0.5319925576939081	87	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000398557.4	37	NULL	CCDS43374.1	5																																																																																			-	-		0.597	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	protein_coding		C	NM_005219	-		140896395	-1	no_errors	ENST00000468119	ensembl	human	putative	74_37	rna	SNP	0.071	T
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037863	10037863	+	RNA	DEL	C	C	-	rs373540942		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chrY:10037863delC	ENST00000515896.1	+	0	100									RNA, 5.8S ribosomal pseudogene 6																		ATCGACACTTCGAACGCACTT	0.552																																																	0								ENSG00000251705																																			RNA5-8SP6			0				HGNC			Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037863delC		Somatic	0	42	0.00		0.5319925576939081	301	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	56	9.68		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			-	-		0.552	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	rRNA		C				10037863	+1	no_errors	ENST00000515896	ensembl	human	known	74_37	rna	DEL	1.000	-
CXCL5	6374	genome.wustl.edu	37	4	74864215	74864217	+	In_Frame_Del	DEL	CAG	CAG	-	rs139966143	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr4:74864215_74864217delCAG	ENST00000296027.4	-	1	279_281	c.82_84delCTG	c.(82-84)ctgdel	p.L28del		NM_002994.3	NP_002985.1	P42830	CXCL5_HUMAN	chemokine (C-X-C motif) ligand 5	28					cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|immune response (GO:0006955)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(1)	9	Breast(15;0.00136)		all cancers(17;0.00273)|Lung(101;0.196)			CTGGCTGCGTCAGCAGCAGCAGC	0.7																																																	0								ENSG00000163735			159,4049		24,111,1969						-0.9	0.4			15	307,7843		42,223,3810	no	coding	CXCL5	NM_002994.3		66,334,5779	A1A1,A1R,RR		3.7669,3.7785,3.7708				466,11892				CXCL5	SO:0001651	inframe_deletion	0				HGNC	X78686	CCDS34006.1	4q13.3	2013-02-25	2002-08-22	2002-08-23		ENSG00000163735		"""Endogenous ligands"""	10642	protein-coding gene	gene with protein product		600324	"""small inducible cytokine subfamily B (Cys-X-Cys), member 5 (epithelial-derived neutrophil-activating peptide 78)"""	SCYB5		7929219	Standard	NM_002994		Approved	ENA-78	uc003hhk.4	P42830		ENST00000296027.4:c.82_84delCTG	4.37:g.74864224_74864226delCAG	ENSP00000296027:p.Leu28del	Somatic	0	34	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39	Q96QE1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXC	p.L28in_frame_del	ENST00000296027.4	37	c.84_82	CCDS34006.1	4																																																																																			-	superfamily_Chemokine_IL8-like_dom		0.700	CXCL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCL5	protein_coding	OTTHUMT00000362749.1	CAG	NM_002994			74864217	-1	no_errors	ENST00000296027	ensembl	human	known	74_37	in_frame_del	DEL	0.072:0.215:0.363	-
AKNAD1	254268	genome.wustl.edu	37	1	109400924	109400924	+	5'Flank	DEL	T	T	-			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr1:109400924delT	ENST00000370001.3	-	0	0				AKNAD1_ENST00000369995.3_5'Flank|AKNAD1_ENST00000357393.4_Intron|SPATA42_ENST00000369989.2_RNA|SPATA42_ENST00000417241.1_RNA	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1							cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						AACTTTTGTCTTTTTTTTTTT	0.363																																																	0								ENSG00000203897																																			SPATA42	SO:0001631	upstream_gene_variant	0				HGNC	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231		1.37:g.109400924delT	Exception_encountered	Somatic	0	13	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	9	35.71	B9EK62|Q5T1N0|Q8N990|Q8NCN9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370001.3	37	NULL	CCDS791.2	1																																																																																			-	-		0.363	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA42	protein_coding	OTTHUMT00000030923.2	T	NM_152763			109400924	+1	no_errors	ENST00000417241	ensembl	human	known	74_37	rna	DEL	0.000	-
FBN2	2201	genome.wustl.edu	37	5	127713448	127713448	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr5:127713448C>T	ENST00000508053.1	-	19	2820	c.1846G>A	c.(1846-1848)Gtt>Att	p.V616I	FBN2_ENST00000508989.1_Missense_Mutation_p.V583I|FBN2_ENST00000511489.1_5'UTR|FBN2_ENST00000262464.4_Missense_Mutation_p.V616I			P35556	FBN2_HUMAN	fibrillin 2	616	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TCCATACCAACACAGTTTTTT	0.388																																																	0								ENSG00000138829						142.0	146.0	144.0					5																	127713448		2203	4300	6503	FBN2	SO:0001583	missense	0			-	HGNC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1846G>A	5.37:g.127713448C>T	ENSP00000424571:p.Val616Ile	Somatic	0	70	0.00		0.5319925576939081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	47	37.33	B4DU01|Q59ES6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.V616I	ENST00000508053.1	37	c.1846	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849620	0.32699	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.87256	-2.23;-2.23;-2.23	4.21	4.21	0.49690	EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000018	D	0.89065	0.6609	L	0.37466	1.105	0.31154	N	0.705108	B;P	0.50156	0.091;0.932	B;P	0.61592	0.079;0.891	D	0.86131	0.1575	10	0.30854	T	0.27	.	17.8845	0.88850	0.0:1.0:0.0:0.0	.	583;616	D6RJI3;P35556	.;FBN2_HUMAN	I	616;616;583	ENSP00000262464:V616I;ENSP00000424571:V616I;ENSP00000425596:V583I	ENSP00000262464:V616I	V	-	1	0	FBN2	127741347	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.322000	0.33689	2.648000	0.89879	0.655000	0.94253	GTT	-	pirsf_FBN,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom		0.388	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	protein_coding	OTTHUMT00000371618.2	C	NM_001999	-		127713448	-1	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	SNP	1.000	T
GPR110	266977	genome.wustl.edu	37	6	46991854	46991854	+	Missense_Mutation	SNP	G	G	A	rs200254260		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr6:46991854G>A	ENST00000371253.2	-	5	592	c.377C>T	c.(376-378)aCg>aTg	p.T126M	GPR110_ENST00000371243.2_Missense_Mutation_p.T126M|GPR110_ENST00000449332.2_5'UTR	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	126					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						TGCTCCAGCCGTGTGAAGGTA	0.507													G|||	1	0.000199681	0.0	0.0	5008	,	,		19636	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000153292						133.0	107.0	116.0					6																	46991854		2203	4300	6503	GPR110	SO:0001583	missense	0			GMAF=0.0005	HGNC	AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.377C>T	6.37:g.46991854G>A	ENSP00000360299:p.Thr126Met	Somatic	0	57	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	37	42.19	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_SEA_dom,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_Ig-hepta_rcpt	p.T126M	ENST00000371253.2	37	c.377	CCDS34471.1	6	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	3.862	-0.029771	0.07589	.	.	ENSG00000153292	ENST00000371252;ENST00000371253;ENST00000371243	T	0.34667	1.35	5.51	-4.45	0.03546	.	0.774716	0.11793	N	0.528966	T	0.07954	0.0199	L	0.53249	1.67	0.23519	N	0.997509	B;B	0.33694	0.421;0.166	B;B	0.21360	0.034;0.007	T	0.13980	-1.0489	10	0.44086	T	0.13	0.2375	0.85	0.01170	0.4025:0.1169:0.2197:0.2609	.	126;126	Q5T601-2;Q5T601	.;GP110_HUMAN	M	126	ENSP00000360299:T126M	ENSP00000360289:T126M	T	-	2	0	GPR110	47099813	0.000000	0.05858	0.001000	0.08648	0.051000	0.14879	-0.674000	0.05233	-0.469000	0.06911	-0.140000	0.14226	ACG	-	NULL		0.507	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR110	protein_coding	OTTHUMT00000040810.2	G	NM_153840	rs200254260		46991854	-1	no_errors	ENST00000371253	ensembl	human	known	74_37	missense	SNP	0.001	A
LINC00987	100499405	genome.wustl.edu	37	12	9394744	9394745	+	lincRNA	INS	-	-	T	rs77464119|rs71045242|rs386375561|rs71453687		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr12:9394744_9394745insT	ENST00000427111.3	+	0	1568_1569					NR_036466.1				long intergenic non-protein coding RNA 987																		ATAAGCAAATCTTTTTTTTTTT	0.421																																																	0								ENSG00000237248																																			LINC00987			0				HGNC	AK126248		12p13.31	2013-07-04			ENSG00000237248	ENSG00000237248		"""Long non-coding RNAs"""	48911	non-coding RNA	RNA, long non-coding							Standard	NR_036466		Approved				OTTHUMG00000168332		12.37:g.9394755_9394755dupT		Somatic	0	17	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000427111.3	37	NULL		12																																																																																			-	-		0.421	LINC00987-001	KNOWN	basic	lincRNA	LINC00987	lincRNA	OTTHUMT00000399347.1	-				9394745	+1	no_errors	ENST00000427111	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
SEZ6L2	26470	genome.wustl.edu	37	16	29888759	29888759	+	Missense_Mutation	SNP	G	G	A	rs200681349		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr16:29888759G>A	ENST00000308713.5	-	11	2269	c.1742C>T	c.(1741-1743)aCg>aTg	p.T581M	SEZ6L2_ENST00000350527.3_Missense_Mutation_p.T511M|SEZ6L2_ENST00000537485.1_Missense_Mutation_p.T537M|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.T467M	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	581	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GTCGAACAGCGTCAGCATGTC	0.692																																																	0								ENSG00000174938						22.0	24.0	24.0					16																	29888759		2196	4299	6495	SEZ6L2	SO:0001583	missense	0			-	HGNC	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1742C>T	16.37:g.29888759G>A	ENSP00000312550:p.Thr581Met	Somatic	0	34	0.00		0.5319925576939081	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.T581M	ENST00000308713.5	37	c.1742	CCDS10659.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.207821	0.95033	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.57	5.57	0.84162	CUB (5);	0.000000	0.53938	D	0.000049	T	0.47893	0.1470	M	0.84082	2.675	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999;0.999	T	0.49881	-0.8892	10	0.62326	D	0.03	.	18.3115	0.90201	0.0:0.0:1.0:0.0	.	537;581;467;511;581;511	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	M	511;581;467;537	ENSP00000310206:T511M;ENSP00000312550:T581M;ENSP00000319215:T467M;ENSP00000439412:T537M	ENSP00000312550:T581M	T	-	2	0	SEZ6L2	29796260	1.000000	0.71417	0.986000	0.45419	0.836000	0.47400	7.304000	0.78882	2.618000	0.88619	0.655000	0.94253	ACG	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.692	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	protein_coding	OTTHUMT00000255154.2	G	NM_012410	-		29888759	-1	no_errors	ENST00000308713	ensembl	human	known	74_37	missense	SNP	1.000	A
TAF1	6872	genome.wustl.edu	37	X	70587351	70587351	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chrX:70587351A>T	ENST00000373790.4	+	2	234	c.183A>T	c.(181-183)gaA>gaT	p.E61D	TAF1_ENST00000276072.3_Missense_Mutation_p.E61D|TAF1_ENST00000449580.1_Missense_Mutation_p.E61D|TAF1_ENST00000423759.1_Missense_Mutation_p.E61D	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	61	Protein kinase 1.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				TTTTTCAGGAATGTAAGAAGC	0.517																																																	0								ENSG00000147133						89.0	71.0	77.0					X																	70587351		2203	4300	6503	TAF1	SO:0001583	missense	0			-	HGNC		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.183A>T	X.37:g.70587351A>T	ENSP00000362895:p.Glu61Asp	Somatic	0	60	0.00		0.5319925576939081	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	44	27.87	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.E61D	ENST00000373790.4	37	c.183	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	19.36	3.812109	0.70797	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.13196	2.61;2.68;2.7;2.64	4.51	-0.246	0.13022	TAFII-230 TBP-binding (2);	0.000000	0.85682	D	0.000000	T	0.13841	0.0335	L	0.33485	1.01	0.49213	D	0.999763	B;P	0.40970	0.085;0.734	B;P	0.47915	0.054;0.561	T	0.03384	-1.1042	10	0.59425	D	0.04	.	9.0001	0.36077	0.7387:0.0:0.2613:0.0	.	61;61	P21675;P21675-2	TAF1_HUMAN;.	D	61	ENSP00000362895:E61D;ENSP00000389000:E61D;ENSP00000406549:E61D;ENSP00000276072:E61D	ENSP00000276072:E61D	E	+	3	2	TAF1	70504076	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	1.476000	0.35420	-0.077000	0.12752	-0.283000	0.09986	GAA	-	pirsf_TAF1_animal,pfam_TAF_II_230-bd,superfamily_TAF_II_230-bd		0.517	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	protein_coding	OTTHUMT00000058995.2	A	NM_004606	-		70587351	+1	no_errors	ENST00000449580	ensembl	human	known	74_37	missense	SNP	0.997	T
MAZ	4150	genome.wustl.edu	37	16	29821605	29821605	+	3'UTR	SNP	C	C	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr16:29821605C>T	ENST00000322945.6	+	0	1652				AC009133.15_ENST00000566537.1_RNA|AC009133.14_ENST00000563806.1_RNA|MAZ_ENST00000568544.1_3'UTR|AC009133.20_ENST00000569039.1_RNA|AC009133.14_ENST00000569981.1_RNA|MAZ_ENST00000563402.1_Silent_p.Y152Y|MAZ_ENST00000219782.6_3'UTR|PRRT2_ENST00000300797.6_5'Flank|MAZ_ENST00000545521.1_3'UTR|MAZ_ENST00000566906.2_Silent_p.Y150Y|PRRT2_ENST00000567659.1_5'Flank|PRRT2_ENST00000358758.7_5'Flank|MAZ_ENST00000568282.1_3'UTR|MAZ_ENST00000562337.1_3'UTR	NM_002383.2	NP_002374.2	P56270	MAZ_HUMAN	MYC-associated zinc finger protein (purine-binding transcription factor)						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|termination of RNA polymerase II transcription (GO:0006369)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	10						TCCCTTGGTACAAGCTCCTCT	0.552																																					Colon(72;875 1167 15364 30899 37091)												0								ENSG00000103495																																			MAZ	SO:0001624	3_prime_UTR_variant	0			-	HGNC	M93339	CCDS42143.1, CCDS42144.1, CCDS61902.1, CCDS61903.1	16p11.2	2013-01-08			ENSG00000103495	ENSG00000103495		"""Zinc fingers, C2H2-type"""	6914	protein-coding gene	gene with protein product		600999				1567856, 1502157	Standard	NM_001276275		Approved	ZF87, Pur-1, Zif87, ZNF801	uc002dtx.4	P56270	OTTHUMG00000132119	ENST00000322945.6:c.*53C>T	16.37:g.29821605C>T		Somatic	0	63	0.00		0.5319925576939081	959	0.10	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	A8QJL9|C6G496|G5E927|H3BQD6|Q15703|Q8NFN7|Q99443	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Y152	ENST00000322945.6	37	c.456	CCDS42143.1	16																																																																																			-	NULL		0.552	MAZ-001	KNOWN	basic|CCDS	protein_coding	MAZ	protein_coding	OTTHUMT00000435536.1	C	NM_002383	-		29821605	+1	no_errors	ENST00000563402	ensembl	human	novel	74_37	silent	SNP	0.311	T
COL20A1	57642	genome.wustl.edu	37	20	61952385	61952385	+	Silent	SNP	C	C	T	rs115782548	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr20:61952385C>T	ENST00000358894.6	+	26	3274	c.3174C>T	c.(3172-3174)ccC>ccT	p.P1058P	COL20A1_ENST00000422202.1_Silent_p.P1065P|COL20A1_ENST00000326996.6_Silent_p.P1058P|COL20A1_ENST00000435874.1_Silent_p.P1065P	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	1058					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					AGACCTGCCCCGCCTTCGTGT	0.612																																																	0								ENSG00000101203						24.0	29.0	27.0					20																	61952385		1886	4092	5978	COL20A1	SO:0001819	synonymous_variant	0			-	HGNC	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.3174C>T	20.37:g.61952385C>T		Somatic	1	146	0.68		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	82	81	50.31	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.P1058	ENST00000358894.6	37	c.3174	CCDS46628.1	20																																																																																			-	NULL		0.612	COL20A1-006	KNOWN	basic|CCDS	protein_coding	COL20A1	protein_coding	OTTHUMT00000144595.2	C	NM_020882	-		61952385	+1	no_errors	ENST00000326996	ensembl	human	known	74_37	silent	SNP	0.008	T
OR6C76	390326	genome.wustl.edu	37	12	55820959	55820959	+	Frame_Shift_Del	DEL	A	A	-	rs397719965|rs57387180		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr12:55820959delA	ENST00000328314.3	+	1	922	c.922delA	c.(922-924)aaafs	p.K311fs		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	311						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GATTTCCCACAAAAAAAAAAA	0.338																																																	0								ENSG00000185821						19.0	20.0	19.0					12																	55820959		2110	4120	6230	OR6C76	SO:0001589	frameshift_variant	0				HGNC		CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.922delA	12.37:g.55820959delA	ENSP00000328402:p.Lys311fs	Somatic	0	8	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	9	52.63		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K311fs	ENST00000328314.3	37	c.922	CCDS31823.1	12																																																																																			-	NULL		0.338	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C76	protein_coding	OTTHUMT00000406675.1	A	NM_001005183			55820959	+1	no_errors	ENST00000328314	ensembl	human	known	74_37	frame_shift_del	DEL	0.016	-
FAM208B	54906	genome.wustl.edu	37	10	5777269	5777269	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr10:5777269G>T	ENST00000328090.5	+	12	1832	c.1207G>T	c.(1207-1209)Gcg>Tcg	p.A403S	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	403																	TACATAAGGTGCGGAAGTGCT	0.378																																																	0								ENSG00000108021						128.0	124.0	125.0					10																	5777269		1834	4089	5923	FAM208B	SO:0001583	missense	0			-	HGNC	BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.1207G>T	10.37:g.5777269G>T	ENSP00000328426:p.Ala403Ser	Somatic	0	74	0.00		0.5319925576939081	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	76	8.43	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3715,pfam_DUF3699	p.A403S	ENST00000328090.5	37	c.1207	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637241	0.87760	.	.	ENSG00000108021	ENST00000328090	T	0.17054	2.3	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000012	T	0.41581	0.1165	M	0.70275	2.135	0.36960	D	0.893279	D	0.89917	1.0	D	0.87578	0.998	T	0.34625	-0.9821	10	0.41790	T	0.15	.	15.5023	0.75709	0.0:0.0:1.0:0.0	.	403	Q5VWN6	F208B_HUMAN	S	403	ENSP00000328426:A403S	ENSP00000328426:A403S	A	+	1	0	C10orf18	5817275	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.008000	0.63991	2.738000	0.93877	0.655000	0.94253	GCG	-	NULL		0.378	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	protein_coding	OTTHUMT00000046571.2	G	NM_017782	-		5777269	+1	no_errors	ENST00000328090	ensembl	human	known	74_37	missense	SNP	1.000	T
OTOF	9381	genome.wustl.edu	37	2	26693554	26693556	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr2:26693554_26693556delCTT	ENST00000272371.2	-	32	4054_4056	c.3928_3930delAAG	c.(3928-3930)aagdel	p.K1310del	OTOF_ENST00000403946.3_In_Frame_Del_p.K1310del|OTOF_ENST00000338581.6_In_Frame_Del_p.K543del|OTOF_ENST00000402415.3_In_Frame_Del_p.K620del|OTOF_ENST00000339598.3_In_Frame_Del_p.K543del	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1310	Poly-Lys.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCGCAGTGCCcttcttcttcttc	0.576																																					GBM(102;732 1451 20652 24062 31372)												0								ENSG00000115155		,,,	10,9,4247		0,0,10,0,9,2114					,,,	4.9	1.0			146	5,24,8225		0,0,5,0,24,4098	no	codingComplex,codingComplex,codingComplex,codingComplex	OTOF	NM_194323.2,NM_194322.2,NM_194248.2,NM_004802.3	,,,	0,0,15,0,33,6212	A1A1,A1A2,A1R,A2A2,A2R,RR		0.3513,0.4454,0.3834	,,,	,,,		15,33,12472				OTOF	SO:0001651	inframe_deletion	0				HGNC	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3928_3930delAAG	2.37:g.26693563_26693565delCTT	ENSP00000272371:p.Lys1310del	Somatic	0	19	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.K1310in_frame_del	ENST00000272371.2	37	c.3930_3928	CCDS1725.1	2																																																																																			-	NULL		0.576	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	CTT				26693556	-1	no_errors	ENST00000272371	ensembl	human	known	74_37	in_frame_del	DEL	0.998:1.000:1.000	-
HRNR	388697	genome.wustl.edu	37	1	152188847	152188847	+	Missense_Mutation	SNP	A	A	G	rs145667921		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr1:152188847A>G	ENST00000368801.2	-	3	5333	c.5258T>C	c.(5257-5259)gTc>gCc	p.V1753A	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1753					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGACCAAAGACAGAAGAGTG	0.562																																																	0								ENSG00000197915						1.0	1.0	1.0					1																	152188847		388	960	1348	HRNR	SO:0001583	missense	0			-	HGNC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5258T>C	1.37:g.152188847A>G	ENSP00000357791:p.Val1753Ala	Somatic	0	18	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	Q5DT20|Q5U1F4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.V1753A	ENST00000368801.2	37	c.5258	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	13.29	2.191978	0.38707	.	.	ENSG00000197915	ENST00000368801	T	0.01548	4.78	3.15	2.19	0.27852	.	.	.	.	.	T	0.00412	0.0013	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48103	-0.9064	9	0.07482	T	0.82	.	1.9459	0.03356	0.2121:0.4632:0.2061:0.1186	.	1753	Q86YZ3	HORN_HUMAN	A	1753	ENSP00000357791:V1753A	ENSP00000357791:V1753A	V	-	2	0	HRNR	150455471	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.214000	0.09292	0.170000	0.19704	-0.294000	0.09567	GTC	-	NULL		0.562	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	protein_coding	OTTHUMT00000034016.1	A	XM_373868	rs145667921		152188847	-1	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	SNP	0.002	G
YEATS2	55689	genome.wustl.edu	37	3	183495458	183495458	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr3:183495458C>G	ENST00000305135.5	+	19	2901	c.2706C>G	c.(2704-2706)atC>atG	p.I902M		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	902					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TAAAAGTCATCTCTGGACAGA	0.438																																																	0								ENSG00000163872						89.0	86.0	87.0					3																	183495458		2062	4224	6286	YEATS2	SO:0001583	missense	0			-	HGNC	AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.2706C>G	3.37:g.183495458C>G	ENSP00000306983:p.Ile902Met	Somatic	0	73	0.00		0.5319925576939081	37	42.19	27	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	42	46.84	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_YEATS,pfscan_YEATS	p.I902M	ENST00000305135.5	37	c.2706	CCDS43175.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.55|16.55	3.154720|3.154720	0.57259|0.57259	.|.	.|.	ENSG00000163872|ENSG00000163872	ENST00000421660;ENST00000305135|ENST00000432781	T|.	0.23348|.	1.91|.	5.68|5.68	3.88|3.88	0.44766|0.44766	.|.	0.063063|.	0.64402|.	D|.	0.000007|.	T|T	0.29556|0.29556	0.0737|0.0737	N|N	0.24115|0.24115	0.695|0.695	0.29492|0.29492	N|N	0.855548|0.855548	D|.	0.67145|.	0.996|.	P|.	0.59703|.	0.862|.	T|T	0.19582|0.19582	-1.0301|-1.0301	10|5	0.72032|.	D|.	0.01|.	-21.8247|-21.8247	6.6736|6.6736	0.23082|0.23082	0.1812:0.6628:0.0:0.156|0.1812:0.6628:0.0:0.156	.|.	902|.	Q9ULM3|.	YETS2_HUMAN|.	M|V	902|88	ENSP00000306983:I902M|.	ENSP00000306983:I902M|.	I|L	+|+	3|1	3|0	YEATS2|YEATS2	184978152|184978152	0.999000|0.999000	0.42202|0.42202	1.000000|1.000000	0.80357|0.80357	0.937000|0.937000	0.57800|0.57800	0.557000|0.557000	0.23454|0.23454	1.376000|1.376000	0.46267|0.46267	0.655000|0.655000	0.94253|0.94253	ATC|CTC	-	NULL		0.438	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	protein_coding	OTTHUMT00000346507.2	C	NM_018023	-		183495458	+1	no_errors	ENST00000305135	ensembl	human	known	74_37	missense	SNP	1.000	G
ZNF114	163071	genome.wustl.edu	37	19	48789076	48789076	+	Missense_Mutation	SNP	A	A	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr19:48789076A>T	ENST00000595607.1	+	6	689	c.195A>T	c.(193-195)aaA>aaT	p.K65N	ZNF114_ENST00000315849.1_Missense_Mutation_p.K65N|ZNF114_ENST00000600687.1_Missense_Mutation_p.K65N|ZNF114_ENST00000597695.1_Missense_Mutation_p.K31N			Q8NC26	ZN114_HUMAN	zinc finger protein 114	65	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		TTCTTCCTAAAAGAACATTTC	0.443																																																	0								ENSG00000178150						91.0	84.0	86.0					19																	48789076		2203	4300	6503	ZNF114	SO:0001583	missense	0			-	HGNC	BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.195A>T	19.37:g.48789076A>T	ENSP00000469998:p.Lys65Asn	Somatic	0	59	0.00		0.5319925576939081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	36	52.63	A8K6B0|Q08AQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K65N	ENST00000595607.1	37	c.195	CCDS12713.1	19	.	.	.	.	.	.	.	.	.	.	A	9.460	1.092844	0.20471	.	.	ENSG00000178150	ENST00000315849	T	0.05081	3.5	1.98	-0.171	0.13331	Krueppel-associated box (1);	.	.	.	.	T	0.03695	0.0105	N	0.08118	0	0.09310	N	1	D	0.59357	0.985	P	0.47827	0.558	T	0.41395	-0.9511	9	0.17832	T	0.49	.	5.4509	0.16565	0.6977:0.0:0.3023:0.0	.	65	Q8NC26	ZN114_HUMAN	N	65	ENSP00000318898:K65N	ENSP00000318898:K65N	K	+	3	2	ZNF114	53480888	0.000000	0.05858	0.000000	0.03702	0.209000	0.24338	0.638000	0.24674	-0.119000	0.11830	0.338000	0.21704	AAA	-	pfscan_Krueppel-associated_box		0.443	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF114	protein_coding	OTTHUMT00000465601.1	A	NM_153608	-		48789076	+1	no_errors	ENST00000315849	ensembl	human	known	74_37	missense	SNP	0.000	T
TFDP1	7027	genome.wustl.edu	37	13	114292086	114292086	+	Intron	SNP	G	G	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr13:114292086G>T	ENST00000375370.5	+	11	1218				TFDP1_ENST00000544902.1_Silent_p.V291V|TFDP1_ENST00000538138.1_Intron	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1						anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			TGCGTCTTGTGTTGTTTCTGT	0.488										TSP Lung(29;0.18)																																							0								ENSG00000198176						68.0	65.0	66.0					13																	114292086		2203	4300	6503	TFDP1	SO:0001627	intron_variant	0			-	HGNC	BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.1007-47G>T	13.37:g.114292086G>T		Somatic	0	27	0.00		0.5319925576939081	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B4DLQ9|Q5JSB4|Q8IZL5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transc_factor_DP_C,pfam_E2F_TDP,pirsf_Transcrpt_fac_DP	p.V291	ENST00000375370.5	37	c.873	CCDS9538.1	13																																																																																			-	pirsf_Transcrpt_fac_DP		0.488	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFDP1	protein_coding	OTTHUMT00000045918.3	G	NM_007111	-		114292086	+1	no_errors	ENST00000544902	ensembl	human	known	74_37	silent	SNP	0.000	T
BDNF	627	genome.wustl.edu	37	11	27681176	27681177	+	5'UTR	INS	-	-	TGTGTG	rs149254890|rs397725548|rs28722151	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr11:27681176_27681177insTGTGTG	ENST00000525528.1	-	0	28_29				BDNF_ENST00000314915.6_Intron|BDNF_ENST00000439476.2_5'UTR|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000395983.3_Intron|BDNF-AS_ENST00000499008.3_RNA|BDNF-AS_ENST00000501176.2_RNA|BDNF-AS_ENST00000500662.2_RNA|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000584049.1_Intron|BDNF_ENST00000532997.1_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000533246.1_Intron|BDNF-AS_ENST00000530313.1_RNA|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000418212.1_Intron|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000356660.4_Intron|BDNF_ENST00000420794.1_Intron|BDNF_ENST00000530861.1_Intron|BDNF_ENST00000533131.1_Intron|BDNF_ENST00000395986.2_Intron|BDNF_ENST00000395980.2_Intron|BDNF_ENST00000395978.3_Intron|BDNF_ENST00000438929.1_Intron	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						GATGTTCTCTCtgtgtgtgtgt	0.446																																																	0								ENSG00000245573																																			BDNF-AS	SO:0001623	5_prime_UTR_variant	0				HGNC	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.-1066->CACACA	11.37:g.27681177_27681182dupTGTGTG		Somatic	NA	NA	NA		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000525528.1	37	NULL	CCDS7866.1	11																																																																																			-	-		0.446	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF-AS	protein_coding	OTTHUMT00000388135.1	-	NM_170735			27681177	+1	no_errors	ENST00000530313	ensembl	human	known	74_37	rna	INS	0.003:0.002	TGTGTG
PCDHB10	56126	genome.wustl.edu	37	5	140574170	140574175	+	In_Frame_Del	DEL	AGGCCG	AGGCCG	-	rs58244182|rs140613424|rs140393827	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	AGGCCG	AGGCCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr5:140574170_140574175delAGGCCG	ENST00000239446.4	+	1	2229_2234	c.2045_2050delAGGCCG	c.(2044-2052)caggccgag>cag	p.AE683del		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	683					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCAGGCCCAGGCCGAGGCCGACTT	0.704														2124	0.424121	0.4372	0.4971	5008	,	,		11585	0.5347		0.3658	False		,,,				2504	0.3006																0								ENSG00000120324			851,2755		246,359,1198						2.2	0.0		dbSNP_129	38	1442,5672		362,718,2477	no	coding	PCDHB10	NM_018930.3		608,1077,3675	A1A1,A1R,RR		20.2699,23.5996,21.3899				2293,8427				PCDHB10	SO:0001651	inframe_deletion	0				HGNC	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2045_2050delAGGCCG	5.37:g.140574176_140574181delAGGCCG	ENSP00000239446:p.Ala683_Glu684del	Somatic	NA	NA	NA		0.5319925576939081	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96T99	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.EA684in_frame_del	ENST00000239446.4	37	c.2045_2050	CCDS4252.1	5																																																																																			-	NULL		0.704	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB10	protein_coding	OTTHUMT00000251821.1	AGGCCG	NM_018930			140574175	+1	no_errors	ENST00000239446	ensembl	human	known	74_37	in_frame_del	DEL	0.001:0.028:0.066:0.762:0.806:0.823	-
SF1	7536	genome.wustl.edu	37	11	64544038	64544038	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr11:64544038G>A	ENST00000377390.3	-	2	429	c.92C>T	c.(91-93)aCa>aTa	p.T31I	SF1_ENST00000334944.5_Missense_Mutation_p.T31I|SF1_ENST00000377387.1_Missense_Mutation_p.T156I|SF1_ENST00000422298.2_5'UTR|SF1_ENST00000227503.9_Missense_Mutation_p.T31I|AP001462.6_ENST00000594089.1_lincRNA|SF1_ENST00000377394.3_Missense_Mutation_p.T31I|SF1_ENST00000433274.2_Missense_Mutation_p.T5I	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	31					Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						TGGAATCACTGTCTTCTGTTC	0.428																																																	0								ENSG00000168066						165.0	153.0	157.0					11																	64544038		2201	4297	6498	SF1	SO:0001583	missense	0			-	HGNC	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.92C>T	11.37:g.64544038G>A	ENSP00000366607:p.Thr31Ile	Somatic	0	64	0.00		0.5319925576939081	162	45.30	135	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	31	50.79	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_KH_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_KH_dom_type_1	p.T31I	ENST00000377390.3	37	c.92	CCDS31599.1	11	.	.	.	.	.	.	.	.	.	.	G	16.31	3.086311	0.55861	.	.	ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000377394;ENST00000334944;ENST00000433274;ENST00000432725;ENST00000416674	T;T;T;T;T;T	0.48522	0.84;0.85;0.86;0.87;0.84;0.81	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.55210	0.1906	L	0.42581	1.335	0.80722	D	1	D;B;B;B;B;B	0.54964	0.969;0.291;0.291;0.192;0.291;0.291	P;B;B;B;B;B	0.54629	0.757;0.056;0.056;0.042;0.091;0.13	T	0.54490	-0.8286	10	0.49607	T	0.09	.	16.7043	0.85367	0.0:0.0:1.0:0.0	.	31;31;31;31;31;156	Q14820;Q15637-6;Q15637-4;Q15637;Q15637-2;Q15637-5	.;.;.;SF01_HUMAN;.;.	I	156;31;31;31;31;5;5;31	ENSP00000366604:T156I;ENSP00000366607:T31I;ENSP00000227503:T31I;ENSP00000366611:T31I;ENSP00000334414:T31I;ENSP00000396793:T5I	ENSP00000227503:T31I	T	-	2	0	SF1	64300614	1.000000	0.71417	0.983000	0.44433	0.956000	0.61745	7.619000	0.83057	2.540000	0.85666	0.563000	0.77884	ACA	-	NULL		0.428	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SF1	protein_coding	OTTHUMT00000143242.1	G	NM_004630	-		64544038	-1	no_errors	ENST00000377390	ensembl	human	known	74_37	missense	SNP	0.998	A
HOXD11	3237	genome.wustl.edu	37	2	176973387	176973388	+	Intron	INS	-	-	TGTGTG	rs56323681		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr2:176973387_176973388insTGTGTG	ENST00000249504.5	+	2	851				HOXD11_ENST00000498438.1_Intron|AC009336.1_ENST00000401374.2_RNA	NM_021192.2	NP_067015.2	P31277	HXD11_HUMAN	homeobox D11						anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|developmental growth (GO:0048589)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of cell development (GO:0010720)|positive regulation of chondrocyte differentiation (GO:0032332)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|single fertilization (GO:0007338)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)							OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		GTGCCAGGCTCtgtgtgtgtgt	0.609			T	NUP98	AML																																			Dom	yes		2	2q31-q32	3237	homeo box D11		L	0								ENSG00000216193																																			AC009336.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene		CCDS2265.1	2q31.1	2011-06-20	2005-12-22		ENSG00000128713	ENSG00000128713		"""Homeoboxes / ANTP class : HOXL subclass"""	5134	protein-coding gene	gene with protein product		142986	"""homeo box D11"""	HOX4, HOX4F		1973146, 1358459	Standard	NM_021192		Approved		uc002uki.3	P31277	OTTHUMG00000132510	ENST00000249504.5:c.782-247->TGTGTG	2.37:g.176973388_176973393dupTGTGTG		Somatic	NA	NA	NA		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NIS4|Q9NS02	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000249504.5	37	NULL	CCDS2265.1	2																																																																																			-	-		0.609	HOXD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216193	protein_coding	OTTHUMT00000359250.2	-				176973388	+1	no_errors	ENST00000401374	ensembl	human	novel	74_37	rna	INS	0.011:0.248	TGTGTG
FOXD4L5	653427	genome.wustl.edu	37	9	70177160	70177160	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr9:70177160G>A	ENST00000377420.1	-	1	1655	c.824C>T	c.(823-825)gCc>gTc	p.A275V		NM_001126334.1	NP_001119806.1	Q5VV16	FX4L5_HUMAN	forkhead box D4-like 5	275					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|lung(2)	7						ATAGACGGGGGCCGAGAGCAG	0.697																																																	0								ENSG00000204779						2.0	3.0	3.0					9																	70177160		439	1198	1637	FOXD4L5	SO:0001583	missense	0			-	HGNC		CCDS47977.1	9q13	2008-07-21			ENSG00000204779	ENSG00000204779			18522	protein-coding gene	gene with protein product						12234674	Standard	NM_001126334		Approved	bA15J10.2, OTTHUMG00000013332	uc010moc.3	Q5VV16	OTTHUMG00000013332	ENST00000377420.1:c.824C>T	9.37:g.70177160G>A	ENSP00000366637:p.Ala275Val	Somatic	1	104	0.95		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	112	15.79		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A275V	ENST00000377420.1	37	c.824	CCDS47977.1	9	.	.	.	.	.	.	.	.	.	.	g	14.27	2.486724	0.44249	.	.	ENSG00000204779	ENST00000377420	D	0.94184	-3.37	1.07	1.07	0.20283	.	0.184523	0.25634	U	0.029334	D	0.85809	0.5783	L	0.34521	1.04	0.29104	N	0.881274	B	0.28850	0.225	B	0.15870	0.014	T	0.79529	-0.1766	10	0.56958	D	0.05	.	7.6881	0.28552	0.0:0.0:1.0:0.0	.	275	Q5VV16	FX4L5_HUMAN	V	275	ENSP00000366637:A275V	ENSP00000366637:A275V	A	-	2	0	FOXD4L5	69466980	0.000000	0.05858	0.786000	0.31890	0.259000	0.26198	-1.488000	0.02308	0.534000	0.28695	0.074000	0.15403	GCC	-	NULL		0.697	FOXD4L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L5	protein_coding	OTTHUMT00000037122.1	G	NM_001126334	-		70177160	-1	no_errors	ENST00000377420	ensembl	human	known	74_37	missense	SNP	0.999	A
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037819	10037819	+	RNA	SNP	T	T	G	rs5005396		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chrY:10037819T>G	ENST00000515896.1	+	0	56									RNA, 5.8S ribosomal pseudogene 6																		CAGCTAGCTGTGAGAATTAAT	0.527																																																	0								ENSG00000251705																																			RNA5-8SP6			0			-	HGNC			Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037819T>G		Somatic	0	61	0.00		0.5319925576939081	2	0.13	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	75	8.54		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			-	-		0.527	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	rRNA		T		-		10037819	+1	no_errors	ENST00000515896	ensembl	human	known	74_37	rna	SNP	1.000	G
XYLT1	64131	genome.wustl.edu	37	16	17202853	17202853	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr16:17202853T>A	ENST00000261381.6	-	12	2663	c.2579A>T	c.(2578-2580)aAt>aTt	p.N860I		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	860					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						GAGGGGCCCATTGTGCAGCTT	0.567																																																	0								ENSG00000103489						72.0	75.0	74.0					16																	17202853		2197	4300	6497	XYLT1	SO:0001583	missense	0			-	HGNC	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2579A>T	16.37:g.17202853T>A	ENSP00000261381:p.Asn860Ile	Somatic	0	57	0.00		0.5319925576939081	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q9H1B6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_XylT,pfam_Glyco_trans_14	p.N860I	ENST00000261381.6	37	c.2579	CCDS10569.1	16	.	.	.	.	.	.	.	.	.	.	T	10.11	1.259724	0.23051	.	.	ENSG00000103489	ENST00000261381	T	0.04917	3.53	5.81	-0.235	0.13071	.	0.182098	0.64402	D	0.000011	T	0.06280	0.0162	L	0.59436	1.845	0.44227	D	0.997063	B	0.24132	0.098	B	0.18263	0.021	T	0.21518	-1.0243	10	0.72032	D	0.01	-35.8623	5.2766	0.15653	0.0:0.4235:0.1637:0.4129	.	860	Q86Y38	XYLT1_HUMAN	I	860	ENSP00000261381:N860I	ENSP00000261381:N860I	N	-	2	0	XYLT1	17110354	0.007000	0.16637	0.932000	0.37286	0.105000	0.19272	0.055000	0.14229	0.117000	0.18138	-0.250000	0.11733	AAT	-	NULL		0.567	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	protein_coding	OTTHUMT00000252241.2	T	NM_022166	-		17202853	-1	no_errors	ENST00000261381	ensembl	human	known	74_37	missense	SNP	0.740	A
AMZ2	51321	genome.wustl.edu	37	17	66247426	66247427	+	Intron	INS	-	-	CTGTATAG	rs200969552|rs58359332	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr17:66247426_66247427insCTGTATAG	ENST00000359904.3	+	4	1718				AMZ2_ENST00000577985.1_Intron|AMZ2_ENST00000577866.1_Intron|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577273.1_Intron|AMZ2_ENST00000580753.1_Intron|AMZ2_ENST00000359783.4_Intron|AMZ2_ENST00000392720.2_Intron	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GATATTTAAAATATTTTCAGTT	0.356														1657	0.330871	0.5121	0.3487	5008	,	,		15358	0.2768		0.1918	False		,,,				2504	0.272																0								ENSG00000196704																																			AMZ2	SO:0001627	intron_variant	0				HGNC	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.586+107->CTGTATAG	17.37:g.66247426_66247427insCTGTATAG		Somatic	NA	NA	NA		0.5319925576939081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000359904.3	37	NULL	CCDS11674.1	17																																																																																			-	-		0.356	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	protein_coding	OTTHUMT00000448261.1	-	NM_016627			66247427	+1	no_errors	ENST00000581779	ensembl	human	known	74_37	rna	INS	0.001:0.003	CTGTATAG
OR5AS1	219447	genome.wustl.edu	37	11	55798441	55798441	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr11:55798441C>A	ENST00000313555.1	+	1	547	c.547C>A	c.(547-549)Cct>Act	p.P183T		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					TGATATCCCACCTCTTCTGGC	0.423																																																	0								ENSG00000181785						283.0	280.0	281.0					11																	55798441		2201	4296	6497	OR5AS1	SO:0001583	missense	0			-	HGNC	AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.547C>A	11.37:g.55798441C>A	ENSP00000324111:p.Pro183Thr	Somatic	0	12	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	16	48.39	Q6IFB8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P183T	ENST00000313555.1	37	c.547	CCDS31516.1	11	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972077	0.34754	.	.	ENSG00000181785	ENST00000313555	T	0.00216	8.53	5.46	3.45	0.39498	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34628	U	0.003818	T	0.00552	0.0018	M	0.81942	2.565	0.20764	N	0.999852	D	0.89917	1.0	D	0.91635	0.999	T	0.34950	-0.9808	10	0.72032	D	0.01	.	12.9354	0.58311	0.2943:0.7057:0.0:0.0	.	183	Q8N127	O5AS1_HUMAN	T	183	ENSP00000324111:P183T	ENSP00000324111:P183T	P	+	1	0	OR5AS1	55555017	0.000000	0.05858	0.824000	0.32777	0.215000	0.24574	0.303000	0.19210	1.279000	0.44446	-0.195000	0.12781	CCT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.423	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AS1	protein_coding	OTTHUMT00000391538.1	C	NM_001001921	-		55798441	+1	no_errors	ENST00000313555	ensembl	human	known	74_37	missense	SNP	0.576	A
OR2T35	403244	genome.wustl.edu	37	1	248801945	248801951	+	Frame_Shift_Del	DEL	CAGCACG	CAGCACG	-	rs143010547|rs112397726	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	CAGCACG	CAGCACG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr1:248801945_248801951delCAGCACG	ENST00000317450.3	-	1	608_614	c.609_615delCGTGCTG	c.(607-615)tgcgtgctgfs	p.CVL203fs		NM_001001827.1	NP_001001827.1	Q8NGX2	O2T35_HUMAN	olfactory receptor, family 2, subfamily T, member 35	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	6	all_cancers(71;2.04e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TAAGCAGCATCAGCACGCAGCAGGCAT	0.527																																																	0								ENSG00000177151																																			OR2T35	SO:0001589	frameshift_variant	0				HGNC	BK004475	CCDS31123.1	1q44	2012-08-09			ENSG00000177151	ENSG00000177151		"""GPCR / Class A : Olfactory receptors"""	31257	protein-coding gene	gene with protein product							Standard	NM_001001827		Approved		uc001ies.1	Q8NGX2	OTTHUMG00000040380	ENST00000317450.3:c.609_615delCGTGCTG	1.37:g.248801945_248801951delCAGCACG	ENSP00000324369:p.Cys203fs	Somatic	NA	NA	NA		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6IEY7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C203fs	ENST00000317450.3	37	c.615_609	CCDS31123.1	1																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.527	OR2T35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T35	protein_coding	OTTHUMT00000097130.1	CAGCACG	NM_001001827			248801951	-1	no_errors	ENST00000317450	ensembl	human	known	74_37	frame_shift_del	DEL	0.008:0.060:0.023:0.016:0.015:0.015:0.006	-
POU4F3	5459	genome.wustl.edu	37	5	145719326	145719326	+	Silent	SNP	C	C	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr5:145719326C>T	ENST00000230732.4	+	2	425	c.336C>T	c.(334-336)caC>caT	p.H112H	CTC-359M8.1_ENST00000515598.1_RNA	NM_002700.2	NP_002691.1	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	112					auditory receptor cell differentiation (GO:0042491)|axon extension (GO:0048675)|inner ear morphogenesis (GO:0042472)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)|vestibulocochlear nerve development (GO:0021562)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			ACGCCGTGCACCAGGGCCTCG	0.662																																																	0								ENSG00000091010						116.0	101.0	106.0					5																	145719326		2203	4299	6502	POU4F3	SO:0001819	synonymous_variant	0			-	HGNC	U10060	CCDS4281.1	5q32	2011-06-20	2007-07-13		ENSG00000091010	ENSG00000091010		"""Homeoboxes / POU class"""	9220	protein-coding gene	gene with protein product		602460	"""POU domain class 4, transcription factor 3"""	DFNA15		9506947	Standard	NM_002700		Approved	BRN3C	uc003loa.2	Q15319	OTTHUMG00000129684	ENST00000230732.4:c.336C>T	5.37:g.145719326C>T		Somatic	0	40	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	18	53.85	O60557|Q2M3F8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.H112	ENST00000230732.4	37	c.336	CCDS4281.1	5																																																																																			-	NULL		0.662	POU4F3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F3	protein_coding	OTTHUMT00000251887.2	C	NM_002700	-		145719326	+1	no_errors	ENST00000230732	ensembl	human	known	74_37	silent	SNP	1.000	T
TBC1D1	23216	genome.wustl.edu	37	4	38140082	38140082	+	3'UTR	DEL	A	A	-	rs11330073	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr4:38140082delA	ENST00000261439.4	+	0	4988				TBC1D1_ENST00000407365.1_3'UTR	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						TGGGACTTTCAAAAAAAAAAG	0.463													|||unknown(HR)	332	0.0662939	0.1672	0.049	5008	,	,		20385	0.0437		0.0199	False		,,,				2504	0.0133																0								ENSG00000065882																																			TBC1D1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.*1126A>-	4.37:g.38140082delA		Somatic	0	32	0.00		0.5319925576939081	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261439.4	37	NULL	CCDS33972.1	4																																																																																			-	-		0.463	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	protein_coding	OTTHUMT00000317443.2	A	NM_015173			38140082	+1	no_errors	ENST00000407365	ensembl	human	known	74_37	rna	DEL	0.000	-
ARHGEF10L	55160	genome.wustl.edu	37	1	17944985	17944987	+	Intron	DEL	CCT	CCT	-	rs544006964	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	CCT	CCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr1:17944985_17944987delCCT	ENST00000361221.3	+	10	994				ARHGEF10L_ENST00000469726.1_Intron|ARHGEF10L_ENST00000375415.1_Intron|ARHGEF10L_ENST00000434513.1_Intron|ARHGEF10L_ENST00000452522.1_Intron|ARHGEF10L_ENST00000375420.3_Intron|ARHGEF10L_ENST00000167825.4_In_Frame_Del_p.S52del|ARHGEF10L_ENST00000375408.3_In_Frame_Del_p.S52del	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like							cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		ATCCGCTGTCcctcctcctcctc	0.68																																																	0								ENSG00000074964																																			ARHGEF10L	SO:0001627	intron_variant	0				HGNC	AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.836-847CCT>-	1.37:g.17944994_17944996delCCT		Somatic	0	22	0.00		0.5319925576939081	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.S50in_frame_del	ENST00000361221.3	37	c.137_139	CCDS182.1	1																																																																																			-	NULL		0.680	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	ARHGEF10L	protein_coding	OTTHUMT00000007147.1	CCT	NM_018125			17944987	+1	no_errors	ENST00000375408	ensembl	human	known	74_37	in_frame_del	DEL	0.989:0.989:0.996	-
STXBP5L	9515	genome.wustl.edu	37	3	120941941	120941941	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr3:120941941G>T	ENST00000273666.6	+	11	1319	c.1048G>T	c.(1048-1050)Gta>Tta	p.V350L	STXBP5L_ENST00000471454.1_Missense_Mutation_p.V350L|STXBP5L_ENST00000492541.1_Missense_Mutation_p.V350L|STXBP5L_ENST00000472879.1_Missense_Mutation_p.V350L|STXBP5L_ENST00000497029.1_Missense_Mutation_p.V350L	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	350					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		AGCAATTACAGTACTTGAAAT	0.348																																																	0								ENSG00000145087						150.0	143.0	145.0					3																	120941941		1874	4106	5980	STXBP5L	SO:0001583	missense	0			-	HGNC	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1048G>T	3.37:g.120941941G>T	ENSP00000273666:p.Val350Leu	Somatic	0	35	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	24	48.94	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.V350L	ENST00000273666.6	37	c.1048	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	G	21.8	4.199801	0.79015	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.40756	1.71;1.72;1.52;1.02;1.51;1.72	4.5	4.5	0.54988	WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.000000	0.85682	D	0.000000	T	0.62454	0.2429	M	0.62723	1.935	0.80722	D	1	B;D	0.71674	0.014;0.998	B;D	0.80764	0.03;0.994	T	0.66280	-0.5963	10	0.62326	D	0.03	-33.7259	17.3968	0.87448	0.0:0.0:1.0:0.0	.	350;350	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	L	350	ENSP00000273666:V350L;ENSP00000420019:V350L;ENSP00000419627:V350L;ENSP00000420287:V350L;ENSP00000420666:V350L;ENSP00000420167:V350L	ENSP00000273666:V350L	V	+	1	0	STXBP5L	122424631	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.657000	0.98554	2.316000	0.78162	0.462000	0.41574	GTA	-	pfam_LLGL2,superfamily_WD40_repeat_dom		0.348	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	protein_coding	OTTHUMT00000355256.3	G		-		120941941	+1	no_errors	ENST00000273666	ensembl	human	known	74_37	missense	SNP	1.000	T
ACSL4	2182	genome.wustl.edu	37	X	108904872	108904872	+	Missense_Mutation	SNP	G	G	A	rs122458138		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chrX:108904872G>A	ENST00000469796.2	-	14	2104	c.1708C>T	c.(1708-1710)Cgt>Tgt	p.R570C	ACSL4_ENST00000348502.6_Missense_Mutation_p.R529C|ACSL4_ENST00000340800.2_Missense_Mutation_p.R570C			O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4	570			R -> S (in MRX63). {ECO:0000269|PubMed:11889465}.		cellular lipid metabolic process (GO:0044255)|dendritic spine development (GO:0060996)|embryonic process involved in female pregnancy (GO:0060136)|fatty acid transport (GO:0015908)|lipid biosynthetic process (GO:0008610)|lipid metabolic process (GO:0006629)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|negative regulation of prostaglandin secretion (GO:0032307)|positive regulation of cell growth (GO:0030307)|response to interleukin-15 (GO:0070672)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|neuronal cell body (GO:0043025)|peroxisome (GO:0005777)	arachidonate-CoA ligase activity (GO:0047676)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)	22					Icosapent(DB00159)|Rosiglitazone(DB00412)	TCTTTCTTACGATCTGTTAAG	0.343																																					Pancreas(188;358 2127 38547 41466 45492)												0			GRCh37	CM020684	ACSL4	M	rs122458138	ENSG00000068366						134.0	112.0	120.0					X																	108904872		2203	4299	6502	ACSL4	SO:0001583	missense	0			-	HGNC	BC034959	CCDS14548.1, CCDS14549.1	Xq22.3-q23	2008-02-05	2004-02-19	2004-02-20	ENSG00000068366	ENSG00000068366		"""Acyl-CoA synthetase family"""	3571	protein-coding gene	gene with protein product	"""lignoceroyl-CoA synthase"", "" long-chain fatty-acid-Coenzyme A ligase 4"""	300157	"""fatty-acid-Coenzyme A ligase, long-chain 4"", ""mental retardation, X-linked 63"", ""mental retardation, X-linked 68"""	FACL4, MRX63, MRX68		9480748, 12949969	Standard	NM_022977		Approved	ACS4, LACS4	uc004eoi.2	O60488	OTTHUMG00000022190	ENST00000469796.2:c.1708C>T	X.37:g.108904872G>A	ENSP00000419171:p.Arg570Cys	Somatic	0	39	0.00		0.5319925576939081	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	29	46.30	D3DUY2|O60848|O60849|Q5JWV8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.R570C	ENST00000469796.2	37	c.1708	CCDS14548.1	X	.	.	.	.	.	.	.	.	.	.	G	25.3	4.627204	0.87560	.	.	ENSG00000068366	ENST00000348502;ENST00000469796;ENST00000340800	T;T;T	0.60672	0.17;0.17;0.17	4.67	4.67	0.58626	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.88062	0.6336	H	0.99922	4.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94281	0.7520	10	0.87932	D	0	-11.9297	17.1389	0.86748	0.0:0.0:1.0:0.0	.	570	O60488	ACSL4_HUMAN	C	529;570;570	ENSP00000262835:R529C;ENSP00000419171:R570C;ENSP00000339787:R570C	ENSP00000339787:R570C	R	-	1	0	ACSL4	108791528	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.841000	0.86834	2.055000	0.61198	0.506000	0.49869	CGT	-	pfam_AMP-dep_Synth/Lig		0.343	ACSL4-003	KNOWN	basic|CCDS	protein_coding	ACSL4	protein_coding	OTTHUMT00000358155.2	G	NM_004458	-		108904872	-1	no_errors	ENST00000340800	ensembl	human	known	74_37	missense	SNP	1.000	A
ASPM	259266	genome.wustl.edu	37	1	197071130	197071130	+	Missense_Mutation	SNP	C	C	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr1:197071130C>A	ENST00000367409.4	-	18	7507	c.7251G>T	c.(7249-7251)agG>agT	p.R2417S	ASPM_ENST00000294732.7_Intron|ASPM_ENST00000367408.1_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2417	IQ 25. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ATGATCTAAACCTACTCTGAA	0.393																																																	0								ENSG00000066279						112.0	115.0	114.0					1																	197071130		2203	4299	6502	ASPM	SO:0001583	missense	0			-	HGNC	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.7251G>T	1.37:g.197071130C>A	ENSP00000356379:p.Arg2417Ser	Somatic	0	54	0.00		0.5319925576939081	5	37.50	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	25	68.35	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.R2417S	ENST00000367409.4	37	c.7251	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	c	8.424	0.847121	0.17034	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.72167	-0.63	4.13	0.467	0.16721	.	0.722320	0.13128	N	0.411644	T	0.73426	0.3585	L	0.60012	1.86	0.80722	D	1	P;B	0.49358	0.923;0.236	D;B	0.69824	0.966;0.349	T	0.68981	-0.5266	10	0.22109	T	0.4	.	1.3491	0.02169	0.1437:0.3672:0.142:0.347	.	403;2417	E7EQ84;Q8IZT6	.;ASPM_HUMAN	S	2417;403	ENSP00000356379:R2417S	ENSP00000356376:R403S	R	-	3	2	ASPM	195337753	0.000000	0.05858	0.131000	0.22000	0.994000	0.84299	-0.457000	0.06745	0.341000	0.23771	0.558000	0.71614	AGG	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS		0.393	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	protein_coding	OTTHUMT00000088256.1	C	NM_018136	-		197071130	-1	no_errors	ENST00000367409	ensembl	human	known	74_37	missense	SNP	0.022	A
SNTG1	54212	genome.wustl.edu	37	8	51415418	51415418	+	Silent	SNP	C	C	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr8:51415418C>A	ENST00000522124.1	+	9	1105	c.444C>A	c.(442-444)ctC>ctA	p.L148L	SNTG1_ENST00000517473.1_Silent_p.L148L|SNTG1_ENST00000518864.1_Silent_p.L148L|SNTG1_ENST00000276467.5_Silent_p.L148L	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	148					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				TCCTCAAACTCCCATTGAATG	0.318																																																	0								ENSG00000147481						68.0	65.0	66.0					8																	51415418		2203	4300	6503	SNTG1	SO:0001819	synonymous_variant	0			-	HGNC	AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.444C>A	8.37:g.51415418C>A		Somatic	0	40	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q2M3Q0|Q9NY98	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology	p.L148	ENST00000522124.1	37	c.444	CCDS6147.1	8																																																																																			-	NULL		0.318	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	protein_coding	OTTHUMT00000377964.1	C		-		51415418	+1	no_errors	ENST00000518864	ensembl	human	known	74_37	silent	SNP	0.938	A
STAT3	6774	genome.wustl.edu	37	17	40498700	40498700	+	Missense_Mutation	SNP	T	T	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr17:40498700T>A	ENST00000264657.5	-	3	472	c.160A>T	c.(160-162)Act>Tct	p.T54S	STAT3_ENST00000404395.3_Missense_Mutation_p.T54S|STAT3_ENST00000389272.3_5'UTR|STAT3_ENST00000585517.1_Missense_Mutation_p.T54S|STAT3_ENST00000588969.1_Missense_Mutation_p.T54S	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	54					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		AACACCAAAGTGGCATGTGAT	0.448									Hyperimmunoglobulin E Recurrent Infection Syndrome																																								0								ENSG00000168610						203.0	200.0	201.0					17																	40498700		2203	4300	6503	STAT3	SO:0001583	missense	0	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	-	HGNC	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.160A>T	17.37:g.40498700T>A	ENSP00000264657:p.Thr54Ser	Somatic	0	42	0.00		0.5319925576939081	109	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	45	9.62	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.T54S	ENST00000264657.5	37	c.160	CCDS32656.1	17	.	.	.	.	.	.	.	.	.	.	T	27.8	4.867309	0.91511	.	.	ENSG00000168610	ENST00000264657;ENST00000404395	T;T	0.52526	0.66;0.66	5.66	5.66	0.87406	STAT transcription factor, protein interaction (4);	0.000000	0.85682	D	0.000000	T	0.65281	0.2676	L	0.60845	1.875	0.49915	D	0.999833	D;D;D	0.67145	0.996;0.979;0.979	D;D;D	0.74023	0.98;0.982;0.982	T	0.66002	-0.6031	10	0.52906	T	0.07	-11.8545	16.1819	0.81915	0.0:0.0:0.0:1.0	.	54;54;54	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	S	54	ENSP00000264657:T54S;ENSP00000384943:T54S	ENSP00000264657:T54S	T	-	1	0	STAT3	37752226	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.882000	0.87258	2.279000	0.76181	0.533000	0.62120	ACT	-	pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction		0.448	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT3	protein_coding	OTTHUMT00000319353.3	T	NM_139276, NM_003150	-		40498700	-1	no_errors	ENST00000264657	ensembl	human	known	74_37	missense	SNP	1.000	A
FBXL12	54850	genome.wustl.edu	37	19	9931256	9931261	+	5'Flank	DEL	ATACAC	ATACAC	-	rs71188840|rs375527443|rs368108275		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	ATACAC	ATACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr19:9931256_9931261delATACAC	ENST00000247977.4	-	0	0				SNORA70_ENST00000363367.1_RNA|FBXL12_ENST00000592067.1_5'Flank|FBXL12_ENST00000586651.1_5'Flank|FBXL12_ENST00000588922.1_5'Flank|FBXL12_ENST00000589626.1_5'Flank|FBXL12_ENST00000586469.1_5'Flank|AC008752.1_ENST00000401283.1_RNA|FBXL12_ENST00000585379.1_Intron|FBXL12_ENST00000586073.1_5'Flank	NM_017703.1	NP_060173.1	Q9NXK8	FXL12_HUMAN	F-box and leucine-rich repeat protein 12						protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)				endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(2)	10						atatatatatataCACACACACACAC	0.442																																																	0								ENSG00000216102																																			AC008752.1	SO:0001631	upstream_gene_variant	0				Clone_based_ensembl_gene	AK000195	CCDS12218.1	19p13.2	2011-06-09				ENSG00000127452		"""F-boxes / Leucine-rich repeats"""	13611	protein-coding gene	gene with protein product		609079				10531037	Standard	XM_005259964		Approved	FLJ20188, Fbl12	uc002mme.3	Q9NXK8			19.37:g.9931256_9931261delATACAC	Exception_encountered	Somatic	NA	NA	NA		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KSJ8|Q9H5K4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000247977.4	37	NULL	CCDS12218.1	19																																																																																			-	-		0.442	FBXL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216102	protein_coding	OTTHUMT00000450265.1	ATACAC	NM_017703			9931261	+1	no_errors	ENST00000401283	ensembl	human	novel	74_37	rna	DEL	0.001:0.002:0.004:0.003:0.003:0.001	-
TTN	7273	genome.wustl.edu	37	2	179416435	179416435	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr2:179416435G>C	ENST00000591111.1	-	285	86493	c.86269C>G	c.(86269-86271)Cgt>Ggt	p.R28757G	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R21525G|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R21333G|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R27830G|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R30398G|RP11-65L3.2_ENST00000603415.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R21458G|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28757	Fibronectin type-III 109. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCATATACACGGAATTGGTAA	0.393																																																	0								ENSG00000155657						129.0	124.0	125.0					2																	179416435		1854	4108	5962	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.86269C>G	2.37:g.179416435G>C	ENSP00000465570:p.Arg28757Gly	Somatic	0	62	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	35	47.76	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R27830G	ENST00000591111.1	37	c.83488		2	.	.	.	.	.	.	.	.	.	.	G	14.67	2.605754	0.46527	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.60797	0.16;0.16;0.16;0.16	5.75	5.75	0.90469	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.85600	0.5734	H	0.98833	4.345	0.58432	D	0.999994	D;D;D;D	0.56287	0.975;0.975;0.975;0.975	P;P;P;P	0.60682	0.878;0.878;0.878;0.878	D	0.91056	0.4882	9	0.87932	D	0	.	19.94	0.97155	0.0:0.0:1.0:0.0	.	21333;21458;21525;28757	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	G	27830;21333;21525;21458;21330	ENSP00000343764:R27830G;ENSP00000434586:R21333G;ENSP00000340554:R21525G;ENSP00000352154:R21458G	ENSP00000340554:R21525G	R	-	1	0	TTN	179124681	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.074000	0.76791	2.721000	0.93114	0.650000	0.86243	CGT	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	G	NM_133378	-		179416435	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	1.000	C
MORC2	22880	genome.wustl.edu	37	22	31328907	31328907	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr22:31328907C>T	ENST00000397641.3	-	22	2899	c.2491G>A	c.(2491-2493)Gtg>Atg	p.V831M	MORC2_ENST00000215862.4_Missense_Mutation_p.V769M|MORC2-AS1_ENST00000441558.1_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	831						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						TCTGTGGGCACGTAGTCAAAC	0.622																																																	0								ENSG00000133422						253.0	228.0	236.0					22																	31328907		2203	4300	6503	MORC2	SO:0001583	missense	0			-	HGNC	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2491G>A	22.37:g.31328907C>T	ENSP00000380763:p.Val831Met	Somatic	0	49	0.00		0.5319925576939081	144	42.17	105	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	41	38.81	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_CW,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Carb-bd_dom,pfscan_Znf_CW	p.V831M	ENST00000397641.3	37	c.2491		22	.	.	.	.	.	.	.	.	.	.	C	22.0	4.223703	0.79576	.	.	ENSG00000133422	ENST00000397641;ENST00000215862	T;T	0.14144	2.53;2.53	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.32346	0.0826	L	0.44542	1.39	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00201	-1.1926	10	0.30854	T	0.27	.	20.3854	0.98941	0.0:1.0:0.0:0.0	.	831	Q9Y6X9	MORC2_HUMAN	M	831;769	ENSP00000380763:V831M;ENSP00000215862:V769M	ENSP00000215862:V769M	V	-	1	0	MORC2	29658907	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.825000	0.97269	0.655000	0.94253	GTG	-	NULL		0.622	MORC2-001	KNOWN	basic|appris_principal	protein_coding	MORC2	protein_coding	OTTHUMT00000321710.2	C	NM_014941	-		31328907	-1	no_errors	ENST00000397641	ensembl	human	known	74_37	missense	SNP	1.000	T
ZDHHC11	79844	genome.wustl.edu	37	5	712045	712046	+	Intron	INS	-	-	TCT			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr5:712045_712046insTCT	ENST00000424784.2	-	14	1931				ZDHHC11B_ENST00000522356.1_5'UTR|ZDHHC11B_ENST00000508859.2_3'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GGCCCATCAGCTCTTAAGCAGC	0.569																																																	0								ENSG00000206077																																			ZDHHC11B	SO:0001627	intron_variant	0				HGNC	AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-1046->AGA	5.37:g.712046_712048dupTCT		Somatic	0	19	0.00		0.5319925576939081	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	25	21.88	Q6UWR9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			-	-		0.569	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	protein_coding		-	NM_024786			712046	-1	no_errors	ENST00000522356	ensembl	human	known	74_37	rna	INS	0.959:0.955	TCT
PRADC1	84279	genome.wustl.edu	37	2	73455974	73455974	+	Missense_Mutation	SNP	C	C	G			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr2:73455974C>G	ENST00000258083.2	-	4	462	c.395G>C	c.(394-396)aGt>aCt	p.S132T	PRADC1_ENST00000480093.1_Intron	NM_032319.1	NP_115695.1	Q9BSG0	PADC1_HUMAN	protease-associated domain containing 1	132	PA.					extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|large_intestine(1)|lung(2)	4						GCGCTGGGTACTGTCCTGGAT	0.622																																																	0								ENSG00000135617						43.0	38.0	39.0					2																	73455974		2203	4300	6503	PRADC1	SO:0001583	missense	0			-	HGNC	BC005069	CCDS1924.1	2p13.2	2012-10-31	2011-04-15	2011-04-15	ENSG00000135617	ENSG00000135617			16047	protein-coding gene	gene with protein product	"""protease-associated domain-containing glycoprotein 21 kDa"""		"""chromosome 2 open reading frame 7"""	C2orf7		15498570	Standard	NM_032319		Approved	MGC13004, PAP21, hPAP21	uc002siy.3	Q9BSG0	OTTHUMG00000129773	ENST00000258083.2:c.395G>C	2.37:g.73455974C>G	ENSP00000258083:p.Ser132Thr	Somatic	0	53	0.00		0.5319925576939081	41	49.38	40	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	35	44.44	Q2Z1P2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Protease-assoc_domain	p.S132T	ENST00000258083.2	37	c.395	CCDS1924.1	2	.	.	.	.	.	.	.	.	.	.	C	13.51	2.259574	0.39995	.	.	ENSG00000135617	ENST00000258083	T	0.43294	0.95	4.64	4.64	0.57946	Protease-associated domain, PA (1);	0.110172	0.64402	D	0.000007	T	0.38639	0.1048	L	0.54965	1.715	0.42369	D	0.992443	B	0.23650	0.089	B	0.28553	0.091	T	0.28396	-1.0045	10	0.42905	T	0.14	-12.2771	10.2533	0.43381	0.0:0.9077:0.0:0.0923	.	132	Q9BSG0	PADC1_HUMAN	T	132	ENSP00000258083:S132T	ENSP00000258083:S132T	S	-	2	0	PRADC1	73309482	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.837000	0.62796	2.576000	0.86940	0.655000	0.94253	AGT	-	pfam_Protease-assoc_domain		0.622	PRADC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRADC1	protein_coding	OTTHUMT00000251989.1	C	NM_032319	-		73455974	-1	no_errors	ENST00000258083	ensembl	human	known	74_37	missense	SNP	1.000	G
MYADM	91663	genome.wustl.edu	37	19	54379104	54379104	+	3'UTR	DEL	A	A	-	rs75209913|rs369211393		TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr19:54379104delA	ENST00000391769.2	+	0	2601				MYADM_ENST00000391771.1_3'UTR|MYADM_ENST00000391770.4_3'UTR|MYADM_ENST00000336967.3_3'UTR|AC008440.5_ENST00000413496.2_RNA	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker						establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		actccatctcaaaaaaaaaaa	0.498																																																	0								ENSG00000232220																																			AC008440.5	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.*1352A>-	19.37:g.54379104delA		Somatic	0	30	0.00		0.5319925576939081	304	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000391769.2	37	NULL	CCDS12866.1	19																																																																																			-	-		0.498	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232220	protein_coding	OTTHUMT00000134337.1	A	NM_138373			54379104	-1	no_errors	ENST00000413496	ensembl	human	known	74_37	rna	DEL	0.000	-
CFP	5199	genome.wustl.edu	37	X	47486725	47486725	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chrX:47486725C>T	ENST00000396992.3	-	5	701	c.581G>A	c.(580-582)gGg>gAg	p.G194E	CFP_ENST00000377005.2_Missense_Mutation_p.G194E|CFP_ENST00000480317.1_5'Flank|CFP_ENST00000247153.3_Missense_Mutation_p.G194E	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	194	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						GGCCCAGGCCCCGTGTGCTGT	0.652																																																	0								ENSG00000126759						24.0	27.0	26.0					X																	47486725		2194	4279	6473	CFP	SO:0001583	missense	0			-	HGNC	M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.581G>A	X.37:g.47486725C>T	ENSP00000380189:p.Gly194Glu	Somatic	0	89	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	58	35.56	O15134|O15135|O15136|O75826	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.G194E	ENST00000396992.3	37	c.581	CCDS14282.1	X	.	.	.	.	.	.	.	.	.	.	C	19.02	3.745191	0.69418	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005;ENST00000469388	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	5.63	5.63	0.86233	.	0.183427	0.46442	D	0.000288	D	0.86477	0.5942	H	0.97852	4.09	0.53688	D	0.999978	D;D	0.89917	0.999;1.0	D;D	0.91635	0.987;0.999	D	0.90916	0.4779	10	0.72032	D	0.01	.	13.9691	0.64228	0.0:1.0:0.0:0.0	.	130;194	B3KVK6;P27918	.;PROP_HUMAN	E	194;194;194;59	ENSP00000380189:G194E;ENSP00000247153:G194E;ENSP00000366204:G194E;ENSP00000418258:G59E	ENSP00000247153:G194E	G	-	2	0	CFP	47371669	0.995000	0.38212	0.969000	0.41365	0.598000	0.36846	5.368000	0.66133	2.370000	0.80446	0.596000	0.82720	GGG	-	superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.652	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFP	protein_coding	OTTHUMT00000056435.2	C	NM_002621	-		47486725	-1	no_errors	ENST00000247153	ensembl	human	known	74_37	missense	SNP	1.000	T
DENND2C	163259	genome.wustl.edu	37	1	115127989	115127989	+	3'UTR	DEL	A	A	-			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr1:115127989delA	ENST00000393274.1	-	0	3644				DENND2C_ENST00000481894.1_5'Flank|DENND2C_ENST00000393276.3_3'UTR	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C						positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGCTGCTATAAAAAAAAAAT	0.408																																																	0								ENSG00000175984																																			DENND2C	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.*232T>-	1.37:g.115127989delA		Somatic	0	20	0.00		0.5319925576939081	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38	B1AL26|Q5TCX6|Q6P3R3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000393274.1	37	NULL	CCDS58018.1	1																																																																																			-	-		0.408	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	protein_coding	OTTHUMT00000314822.1	A	NM_198459			115127989	-1	no_errors	ENST00000495031	ensembl	human	known	74_37	rna	DEL	0.000	-
HIVEP2	3097	genome.wustl.edu	37	6	143092151	143092151	+	Missense_Mutation	SNP	T	T	A	rs139717578	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr6:143092151T>A	ENST00000367604.1	-	4	4364	c.3725A>T	c.(3724-3726)tAt>tTt	p.Y1242F	HIVEP2_ENST00000012134.2_Missense_Mutation_p.Y1242F|HIVEP2_ENST00000367603.2_Missense_Mutation_p.Y1242F			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1242					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GGGCTTGCCATAGCTCTTCTG	0.498																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0								ENSG00000010818						135.0	131.0	132.0					6																	143092151		1989	4172	6161	HIVEP2	SO:0001583	missense	0			-	HGNC	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3725A>T	6.37:g.143092151T>A	ENSP00000356576:p.Tyr1242Phe	Somatic	0	48	0.00		0.5319925576939081	33	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Y1242F	ENST00000367604.1	37	c.3725	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	T	16.73	3.203519	0.58234	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02301	4.35;4.35;4.35	5.97	5.97	0.96955	.	0.186013	0.49305	D	0.000155	T	0.03520	0.0101	L	0.41356	1.27	0.45733	D	0.998631	D	0.67145	0.996	P	0.57620	0.824	T	0.54344	-0.8308	10	0.59425	D	0.04	-15.3693	16.4504	0.83984	0.0:0.0:0.0:1.0	.	1242	P31629	ZEP2_HUMAN	F	1242	ENSP00000356576:Y1242F;ENSP00000356575:Y1242F;ENSP00000012134:Y1242F	ENSP00000012134:Y1242F	Y	-	2	0	HIVEP2	143133844	1.000000	0.71417	0.954000	0.39281	0.803000	0.45373	3.937000	0.56575	2.288000	0.76882	0.533000	0.62120	TAT	-	NULL		0.498	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	protein_coding	OTTHUMT00000042495.1	T		-		143092151	-1	no_errors	ENST00000012134	ensembl	human	known	74_37	missense	SNP	0.987	A
MON1B	22879	genome.wustl.edu	37	16	77229444	77229444	+	Missense_Mutation	SNP	G	G	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr16:77229444G>T	ENST00000248248.3	+	5	1658	c.1308G>T	c.(1306-1308)gaG>gaT	p.E436D	MON1B_ENST00000320859.6_Intron|MON1B_ENST00000439557.2_Missense_Mutation_p.E327D|MON1B_ENST00000545553.1_Missense_Mutation_p.E290D	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	436										breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						CTGAGCTAGAGGCCCCCTACA	0.612																																																	0								ENSG00000103111						51.0	40.0	44.0					16																	77229444		2198	4300	6498	MON1B	SO:0001583	missense	0			-	HGNC	BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.1308G>T	16.37:g.77229444G>T	ENSP00000248248:p.Glu436Asp	Somatic	0	54	0.00		0.5319925576939081	45	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B4DDZ0|O94949	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vacuolar_fusion_protein_MON1,prints_Vacuolar_fusion_protein_MON1	p.E436D	ENST00000248248.3	37	c.1308	CCDS10925.1	16	.	.	.	.	.	.	.	.	.	.	G	15.57	2.873796	0.51695	.	.	ENSG00000103111	ENST00000248248;ENST00000439557;ENST00000545553	.	.	.	5.02	2.03	0.26663	.	0.110750	0.64402	D	0.000007	T	0.31638	0.0803	L	0.33339	1.005	0.80722	D	1	B;B;B;B	0.33171	0.029;0.046;0.046;0.4	B;B;B;B	0.30251	0.026;0.103;0.103;0.113	T	0.04115	-1.0976	9	0.21014	T	0.42	.	3.9746	0.09468	0.284:0.1777:0.5383:0.0	.	290;327;316;436	B4DDZ0;E7EW32;Q6ZR87;Q7L1V2	.;.;.;MON1B_HUMAN	D	436;327;290	.	ENSP00000248248:E436D	E	+	3	2	MON1B	75786945	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	2.311000	0.43717	0.790000	0.33803	-0.136000	0.14681	GAG	-	pfam_Vacuolar_fusion_protein_MON1		0.612	MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON1B	protein_coding	OTTHUMT00000269036.2	G	NM_014940	-		77229444	+1	no_errors	ENST00000248248	ensembl	human	known	74_37	missense	SNP	1.000	T
LUC7L3	51747	genome.wustl.edu	37	17	48827881	48827881	+	Missense_Mutation	SNP	T	T	G			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr17:48827881T>G	ENST00000505658.1	+	10	1347	c.1158T>G	c.(1156-1158)gaT>gaG	p.D386E	LUC7L3_ENST00000544170.1_Missense_Mutation_p.D310E|LUC7L3_ENST00000393227.2_Missense_Mutation_p.D386E|LUC7L3_ENST00000240304.1_Missense_Mutation_p.D386E			O95232	LC7L3_HUMAN	LUC7-like 3 (S. cerevisiae)	386	Arg/Ser-rich.				mRNA splice site selection (GO:0006376)|RNA splicing (GO:0008380)	focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U1 snRNP (GO:0005685)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.D386fs*2(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	12						GATCTGATGATAAAAAAAGTA	0.353																																																	1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000108848						126.0	128.0	127.0					17																	48827881		2203	4300	6503	LUC7L3	SO:0001583	missense	0			-	HGNC		CCDS11573.1	17q21.33	2010-02-17			ENSG00000108848	ENSG00000108848			24309	protein-coding gene	gene with protein product	"""cisplatin resistance associated overexpressed protein"", ""CRE-associated protein"""	609434				10631324, 12565863	Standard	NM_016424		Approved	LUC7A, CROP, OA48-18, CREAP-1, FLJ11063, CRA, hLuc7A	uc002iss.3	O95232	OTTHUMG00000162257	ENST00000505658.1:c.1158T>G	17.37:g.48827881T>G	ENSP00000425092:p.Asp386Glu	Somatic	0	41	0.00		0.5319925576939081	323	50.60	339	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	32	36.00	B3KN54|D3DTY1|Q6PHR9|Q9NUY0|Q9P2S7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Luc7-rel	p.D386E	ENST00000505658.1	37	c.1158	CCDS11573.1	17	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	21.2|21.2|21.2	4.108921|4.108921|4.108921	0.77096|0.77096|0.77096	.|.|.	.|.|.	ENSG00000108848|ENSG00000108848|ENSG00000108848	ENST00000505658;ENST00000393227;ENST00000240304;ENST00000544170|ENST00000503728|ENST00000513969	T;T;T;T|.|.	0.62105|.|.	1.61;0.05;1.61;1.61|.|.	5.95|5.95|5.95	4.87|4.87|4.87	0.63330|0.63330|0.63330	.|.|.	0.093051|.|.	0.64402|.|.	D|.|.	0.000001|.|.	T|T|.	0.37758|0.37758|.	0.1015|0.1015|.	N|N|N	0.14661|0.14661|0.14661	0.345|0.345|0.345	0.43632|0.43632|0.43632	D|D|D	0.996022|0.996022|0.996022	B;B;B|.|.	0.20261|.|.	0.001;0.01;0.043|.|.	B;B;B|.|.	0.15870|.|.	0.008;0.014;0.014|.|.	T|T|.	0.16867|0.16867|.	-1.0388|-1.0388|.	10|5|.	0.38643|.|.	T|.|.	0.18|.|.	-18.8694|-18.8694|-18.8694	9.0747|9.0747|9.0747	0.36513|0.36513|0.36513	0.0:0.1406:0.0:0.8594|0.0:0.1406:0.0:0.8594|0.0:0.1406:0.0:0.8594	.|.|.	310;386;386|.|.	B4DJ96;O95232;A8K3C5|.|.	.;LC7L3_HUMAN;.|.|.	E|R|E	386;386;386;310|35|37	ENSP00000425092:D386E;ENSP00000376919:D386E;ENSP00000240304:D386E;ENSP00000444253:D310E|.|.	ENSP00000240304:D386E|.|.	D|I|X	+|+|+	3|2|1	2|0|0	LUC7L3|LUC7L3|LUC7L3	46182880|46182880|46182880	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	1.910000|1.910000|1.910000	0.39927|0.39927|0.39927	1.065000|1.065000|1.065000	0.40693|0.40693|0.40693	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	GAT|ATA|TAA	-	NULL		0.353	LUC7L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LUC7L3	protein_coding	OTTHUMT00000368205.2	T	NM_016424	-		48827881	+1	no_errors	ENST00000240304	ensembl	human	known	74_37	missense	SNP	1.000	G
CYP11B1	1584	genome.wustl.edu	37	8	143961100	143961100	+	Missense_Mutation	SNP	G	G	A			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr8:143961100G>A	ENST00000292427.4	-	1	162	c.130C>T	c.(130-132)Cgt>Tgt	p.R44C	CYP11B1_ENST00000377675.3_Missense_Mutation_p.R44C|CYP11B1_ENST00000517471.1_Missense_Mutation_p.R44C	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	44					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	TTGCCTGGACGCCGGGGCATG	0.647									Familial Hyperaldosteronism type I																																								0								ENSG00000160882						65.0	61.0	63.0					8																	143961100		2203	4300	6503	CYP11B1	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	-	HGNC	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.130C>T	8.37:g.143961100G>A	ENSP00000292427:p.Arg44Cys	Somatic	0	41	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	22	47.62	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B,prints_Cyt_P450	p.R44C	ENST00000292427.4	37	c.130	CCDS6392.1	8	.	.	.	.	.	.	.	.	.	.	G	2.671	-0.277599	0.05679	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.74947	-0.33;-0.32;-0.89	2.96	0.184	0.15086	.	1.068100	0.07430	N	0.895534	T	0.37019	0.0988	N	0.00538	-1.39	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.001;0.003;0.001	T	0.26395	-1.0104	10	0.35671	T	0.21	.	1.7769	0.03023	0.5406:0.0:0.1791:0.2803	.	44;44;44	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	C	44	ENSP00000292427:R44C;ENSP00000428043:R44C;ENSP00000366903:R44C	ENSP00000292427:R44C	R	-	1	0	CYP11B1	143958102	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	0.270000	0.18607	0.327000	0.23409	0.305000	0.20034	CGT	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial		0.647	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B1	protein_coding	OTTHUMT00000379475.2	G		-		143961100	-1	no_errors	ENST00000292427	ensembl	human	known	74_37	missense	SNP	0.099	A
SERPINA11	256394	genome.wustl.edu	37	14	94909099	94909099	+	Silent	SNP	G	G	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr14:94909099G>T	ENST00000334708.3	-	5	1177	c.1113C>A	c.(1111-1113)gcC>gcA	p.A371A	RP11-349I1.2_ENST00000536735.1_RNA	NM_001080451.1	NP_001073920.1	Q86U17	SPA11_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11	371					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(14)|skin(1)|upper_aerodigestive_tract(1)	24				COAD - Colon adenocarcinoma(157;0.211)		AAGCAGCCCCGGCCTCGGTCC	0.582																																																	0								ENSG00000186910						60.0	59.0	59.0					14																	94909099		2203	4300	6503	SERPINA11	SO:0001819	synonymous_variant	0			-	HGNC	BX248259	CCDS32149.1	14q32.13	2014-02-18	2005-08-18		ENSG00000186910	ENSG00000186910		"""Serine (or cysteine) peptidase inhibitors"""	19193	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11"""			15014966, 24172014	Standard	NM_001080451		Approved		uc001ydd.1	Q86U17	OTTHUMG00000171348	ENST00000334708.3:c.1113C>A	14.37:g.94909099G>T		Somatic	0	50	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.42	B2RV07	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.A371	ENST00000334708.3	37	c.1113	CCDS32149.1	14																																																																																			-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.582	SERPINA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA11	protein_coding	OTTHUMT00000413091.1	G	NM_001080451	-		94909099	-1	no_errors	ENST00000334708	ensembl	human	known	74_37	silent	SNP	0.002	T
BTBD11	121551	genome.wustl.edu	37	12	108004005	108004005	+	Missense_Mutation	SNP	C	C	T			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr12:108004005C>T	ENST00000280758.5	+	5	2210	c.1682C>T	c.(1681-1683)gCg>gTg	p.A561V	BTBD11_ENST00000420571.2_Missense_Mutation_p.A561V|BTBD11_ENST00000490090.2_Missense_Mutation_p.A561V|BTBD11_ENST00000357167.4_Missense_Mutation_p.A98V|RP11-128P10.1_ENST00000548473.1_RNA	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	561						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AAGCTGGATGCGGTGGCCATC	0.582											OREG0022090	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000151136						137.0	119.0	125.0					12																	108004005		2203	4300	6503	BTBD11	SO:0001583	missense	0			-	HGNC	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.1682C>T	12.37:g.108004005C>T	ENSP00000280758:p.Ala561Val	Somatic	0	40	0.00	21	0.5319925576939081	7	53.33	8	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	23	55.77	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.A561V	ENST00000280758.5	37	c.1682	CCDS31893.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.343882	0.95807	.	.	ENSG00000151136	ENST00000280758;ENST00000420571;ENST00000490090;ENST00000550706;ENST00000415943;ENST00000357167	T;T;T;T;T;T	0.51071	1.16;1.23;1.2;0.73;0.72;0.96	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.51550	0.1681	N	0.08118	0	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.994;0.986;0.996;0.988	T	0.59669	-0.7411	10	0.42905	T	0.14	.	19.3929	0.94592	0.0:1.0:0.0:0.0	.	561;98;561;561	A6QL63-2;E9PHS4;A6QL63;A6QL63-3	.;.;BTBDB_HUMAN;.	V	561;561;561;192;195;98	ENSP00000280758:A561V;ENSP00000413889:A561V;ENSP00000447319:A561V;ENSP00000447606:A192V;ENSP00000407416:A195V;ENSP00000349690:A98V	ENSP00000280758:A561V	A	+	2	0	BTBD11	106528135	1.000000	0.71417	0.979000	0.43373	0.886000	0.51366	7.773000	0.85462	2.572000	0.86782	0.462000	0.41574	GCG	-	NULL		0.582	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	protein_coding	OTTHUMT00000318003.1	C	NM_152322	-		108004005	+1	no_errors	ENST00000280758	ensembl	human	known	74_37	missense	SNP	1.000	T
MLC1	23209	genome.wustl.edu	37	22	50518372	50518372	+	Missense_Mutation	SNP	A	A	G			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr22:50518372A>G	ENST00000311597.5	-	5	1004	c.398T>C	c.(397-399)cTa>cCa	p.L133P	MLC1_ENST00000535444.1_Missense_Mutation_p.L54P|MLC1_ENST00000538737.1_Intron|MLC1_ENST00000431262.2_Missense_Mutation_p.L103P|MLC1_ENST00000395876.2_Missense_Mutation_p.L133P|MLC1_ENST00000450140.2_Intron	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	133					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		GTTCAGGACTAGTTTGCATCC	0.473																																																	0								ENSG00000100427						193.0	168.0	176.0					22																	50518372		2203	4300	6503	MLC1	SO:0001583	missense	0			-	HGNC	D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.398T>C	22.37:g.50518372A>G	ENSP00000310375:p.Leu133Pro	Somatic	0	69	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	48	43.53	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L133P	ENST00000311597.5	37	c.398	CCDS14083.1	22	.	.	.	.	.	.	.	.	.	.	A	18.26	3.584913	0.65992	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000431262;ENST00000535444;ENST00000442311	D;D;D;D;D	0.96651	-4.04;-4.04;-3.66;-3.88;-4.08	5.12	5.12	0.69794	.	0.000000	0.64402	D	0.000001	D	0.97642	0.9227	M	0.70275	2.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98397	1.0566	10	0.87932	D	0	-15.396	13.9052	0.63831	1.0:0.0:0.0:0.0	.	103;133	B7Z659;Q15049	.;MLC1_HUMAN	P	133;133;103;54;103	ENSP00000379216:L133P;ENSP00000310375:L133P;ENSP00000415877:L103P;ENSP00000438910:L54P;ENSP00000401385:L103P	ENSP00000310375:L133P	L	-	2	0	MLC1	48860499	1.000000	0.71417	0.612000	0.29024	0.459000	0.32528	8.051000	0.89446	1.918000	0.55548	0.459000	0.35465	CTA	-	NULL		0.473	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLC1	protein_coding	OTTHUMT00000316979.2	A	NM_015166	-		50518372	-1	no_errors	ENST00000311597	ensembl	human	known	74_37	missense	SNP	0.997	G
EOMES	8320	genome.wustl.edu	37	3	27763427	27763428	+	In_Frame_Ins	INS	-	-	CGGCGC	rs368178421|rs1874198|rs3062761	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr3:27763427_27763428insCGGCGC	ENST00000295743.4	-	1	561_562	c.358_359insGCGCCG	c.(358-360)gcc>gGCGCCGcc	p.119_120insGA	EOMES_ENST00000461503.1_Intron|EOMES_ENST00000537516.1_Intron|EOMES_ENST00000449599.1_In_Frame_Ins_p.119_120insGA			O95936	EOMES_HUMAN	eomesodermin	119	Ala-rich.		A -> G (in dbSNP:rs12715125).		brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						ggcggcggcggctgcagcggcg	0.767														2685	0.536142	0.3147	0.5274	5008	,	,		7250	0.8363		0.3837	False		,,,				2504	0.6892																0								ENSG00000163508			101,91,844		44,2,11,38,13,410						-0.4	0.1		dbSNP_102	1	316,357,1963		136,0,44,143,71,924	no	codingComplex	EOMES	NM_005442.2		180,2,55,181,84,1334	A1A1,A1A2,A1R,A2A2,A2R,RR		25.5311,18.5328,23.5566				417,448,2807				EOMES	SO:0001652	inframe_insertion	0				HGNC	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.358_359insGCGCCG	3.37:g.27763427_27763428insCGGCGC	ENSP00000295743:p.Ala119_Ala120insGlyAla	Somatic	NA	NA	NA		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.120in_frame_insGA	ENST00000295743.4	37	c.359_358	CCDS2646.1	3																																																																																			-	NULL		0.767	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EOMES	protein_coding	OTTHUMT00000252995.1	-	NM_005442			27763428	-1	no_errors	ENST00000449599	ensembl	human	known	74_37	in_frame_ins	INS	0.116:0.075	CGGCGC
MT-CO2	4513	genome.wustl.edu	37	M	8091	8091	+	Missense_Mutation	SNP	G	G	C			TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chrM:8091G>C	ENST00000361739.1	+	1	506	c.506G>C	c.(505-507)gGc>gCc	p.G169A	MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TA_ENST00000387392.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	169					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CCCCACATTAGGCTTAAAAAC	0.473																																																	0								ENSG00000198712																																			MT-CO2	SO:0001583	missense	0			-	HGNC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.506G>C	M.37:g.8091G>C	ENSP00000354876:p.Gly169Ala	Somatic	0	117	0.00		0.5319925576939081	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	83	3	96.51	Q37526	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.G169A	ENST00000361739.1	37	c.506		MT																																																																																			-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2		0.473	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	protein_coding		G	YP_003024029	-		8091	+1	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	SNP	NULL	C
IRF5	3663	genome.wustl.edu	37	7	128587352	128587381	+	In_Frame_Del	DEL	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	-	rs199508964|rs113806178|rs60344245|rs566635242|rs202130620|rs375983447|rs534043449|rs79724471	byFrequency	TCGA-FX-A8OO-01A-11D-A36J-09	TCGA-FX-A8OO-10A-01D-A36M-09	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	3def8194-e7e6-4872-be76-50bedf6b1339	bdc4ce01-8e6f-4cfb-9850-8e48d99cc23d	g.chr7:128587352_128587381delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ENST00000402030.2	+	6	574_603	c.502_531delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	c.(502-531)actctgcagccgcccactctgcggccgcctdel	p.TLQPPTLRPP168del	IRF5_ENST00000473745.1_In_Frame_Del_p.TLQPPTLRPP168del|IRF5_ENST00000249375.4_In_Frame_Del_p.TLQPPTLRPP168del|IRF5_ENST00000357234.5_In_Frame_Del_p.TLQPPTLRPP184del|IRF5_ENST00000477535.1_Intron	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	168					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						GTGGCCGCCCACTCTGCAGCCGCCCACTCTGCGGCCGCCTACTCTGCAGC	0.652														2428	0.484824	0.534	0.366	5008	,	,		17245	0.4425		0.5338	False		,,,				2504	0.4959																1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000128604		,,,,	1942,1932		603,736,598					,,,,	0.1	0.9		dbSNP_129	14	3856,4082		1083,1690,1196	no	coding,intron,coding,coding,coding	IRF5	NM_032643.3,NM_001242452.1,NM_001098630.1,NM_001098629.1,NM_001098627.2	,,,,	1686,2426,1794	A1A1,A1R,RR		48.5765,49.8709,49.0857	,,,,	,,,,		5798,6014				IRF5	SO:0001651	inframe_deletion	0				HGNC		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.502_531delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	7.37:g.128587352_128587381delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ENSP00000385352:p.Thr168_Pro177del	Somatic	NA	NA	NA		0.5319925576939081	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.PPTLRPPTLQ187in_frame_del	ENST00000402030.2	37	c.550_579	CCDS5808.1	7																																																																																			-	NULL		0.652	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF5	protein_coding	OTTHUMT00000350934.1	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	NM_001098627			128587381	+1	no_errors	ENST00000357234	ensembl	human	known	74_37	in_frame_del	DEL	0.766:0.707:0.638:0.562:0.538:0.511:0.480:0.444:0.402:0.360:0.317:0.273:0.262:0.251:0.239:0.226:0.213:0.199:0.185:0.170:0.155:0.138:0.122:0.120:0.118:0.116:0.113:0.110:0.107:0.104	-
