#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SMARCA2	6595	genome.wustl.edu	37	9	2039773	2039773	+	Silent	SNP	G	G	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr9:2039773G>A	ENST00000382203.1	+	4	872	c.663G>A	c.(661-663)caG>caA	p.Q221Q	RP11-264I13.2_ENST00000426860.1_RNA|SMARCA2_ENST00000349721.2_Silent_p.Q221Q|SMARCA2_ENST00000357248.2_Silent_p.Q221Q|SMARCA2_ENST00000382194.1_Silent_p.Q221Q|SMARCA2_ENST00000491574.1_3'UTR			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	221	Poly-Gln.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		aacagcagcagcaacagcagc	0.627																																																	0								ENSG00000080503						12.0	14.0	14.0					9																	2039773		2198	4286	6484	SMARCA2	SO:0001819	synonymous_variant	0			-	HGNC	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.663G>A	9.37:g.2039773G>A		Somatic	0	32	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	37	17.78	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.Q221	ENST00000382203.1	37	c.663	CCDS34977.1	9																																																																																			-	NULL		0.627	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	protein_coding	OTTHUMT00000051505.1	G	NM_003070	-		2039773	+1	no_errors	ENST00000349721	ensembl	human	known	74_37	silent	SNP	0.982	A
PCDH9	5101	genome.wustl.edu	37	13	66878902	66878902	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr13:66878902G>T	ENST00000377865.2	-	4	3733	c.3599C>A	c.(3598-3600)tCc>tAc	p.S1200Y	PCDH9_ENST00000456367.1_Missense_Mutation_p.S1166Y|PCDH9-AS1_ENST00000430861.1_RNA|PCDH9_ENST00000328454.5_Missense_Mutation_p.S1166Y|PCDH9_ENST00000544246.1_Missense_Mutation_p.S1200Y			Q9HC56	PCDH9_HUMAN	protocadherin 9	1200					forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GCCTTCATTGGAGCCATACTG	0.488																																																	0								ENSG00000184226						175.0	138.0	150.0					13																	66878902		2203	4300	6503	PCDH9	SO:0001583	missense	0			-	HGNC	AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.3599C>A	13.37:g.66878902G>T	ENSP00000367096:p.Ser1200Tyr	Somatic	0	85	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S1200Y	ENST00000377865.2	37	c.3599	CCDS9444.1	13	.	.	.	.	.	.	.	.	.	.	G	15.13	2.742453	0.49151	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454	T;T;T;T	0.58940	0.32;0.32;0.3;0.3	6.05	6.05	0.98169	.	0.306802	0.23920	N	0.043257	T	0.55673	0.1935	N	0.22421	0.69	0.38268	D	0.942071	P;P;P	0.41041	0.617;0.736;0.617	B;P;B	0.48227	0.261;0.571;0.367	T	0.62067	-0.6932	10	0.87932	D	0	.	16.0133	0.80420	0.0:0.1336:0.8664:0.0	.	1158;1166;1200	B7ZM79;Q9HC56-2;Q9HC56	.;.;PCDH9_HUMAN	Y	1200;1200;1166;1166	ENSP00000442186:S1200Y;ENSP00000367096:S1200Y;ENSP00000401699:S1166Y;ENSP00000332060:S1166Y	ENSP00000332060:S1166Y	S	-	2	0	PCDH9	65776903	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.396000	0.59684	2.878000	0.98634	0.650000	0.86243	TCC	-	NULL		0.488	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH9	protein_coding	OTTHUMT00000276387.1	G	NM_203487	-		66878902	-1	no_errors	ENST00000377865	ensembl	human	known	74_37	missense	SNP	1.000	T
SKIV2L2	23517	genome.wustl.edu	37	5	54624535	54624535	+	Silent	SNP	G	G	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr5:54624535G>A	ENST00000230640.5	+	5	665	c.411G>A	c.(409-411)ccG>ccA	p.P137P	SKIV2L2_ENST00000545714.1_Silent_p.P36P	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	137					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				AGGAATACCCGTTCATTCTTG	0.378																																					Melanoma(2;92 134 23744 29976 33782)												0								ENSG00000039123						147.0	140.0	143.0					5																	54624535		2203	4300	6503	SKIV2L2	SO:0001819	synonymous_variant	0			-	HGNC	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.411G>A	5.37:g.54624535G>A		Somatic	0	79	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	52	48.00	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R69H	ENST00000230640.5	37	c.206	CCDS3967.1	5																																																																																			-	NULL		0.378	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L2	protein_coding	OTTHUMT00000214108.1	G		-		54624535	+1	no_errors	ENST00000506750	ensembl	human	known	74_37	missense	SNP	0.902	A
TMEM109	79073	genome.wustl.edu	37	11	60690262	60690262	+	3'UTR	SNP	A	A	C			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr11:60690262A>C	ENST00000227525.3	+	0	1760				TMEM132A_ENST00000005286.4_5'Flank|TMEM109_ENST00000540280.1_3'UTR|TMEM109_ENST00000536171.1_3'UTR|RP11-881M11.4_ENST00000543907.1_RNA|TMEM132A_ENST00000453848.2_5'Flank	NM_024092.2	NP_076997.1	Q9BVC6	TM109_HUMAN	transmembrane protein 109						cellular response to gamma radiation (GO:0071480)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell death (GO:0060548)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8						TGTCTCTTTCAAGTGCCTTAA	0.562																																																	0								ENSG00000110108																																			TMEM109	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS7996.1	11q12.2	2005-12-22				ENSG00000110108			28771	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_024092		Approved	MGC5508	uc001nqg.3	Q9BVC6		ENST00000227525.3:c.*625A>C	11.37:g.60690262A>C		Somatic	0	33	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	28	44.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000227525.3	37	NULL	CCDS7996.1	11																																																																																			-	-		0.562	TMEM109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM109	protein_coding	OTTHUMT00000396343.1	A	NM_024092	-		60690262	+1	no_errors	ENST00000540280	ensembl	human	putative	74_37	rna	SNP	1.000	C
ADGB	79747	genome.wustl.edu	37	6	147103231	147103231	+	Missense_Mutation	SNP	C	C	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr6:147103231C>A	ENST00000397944.3	+	30	4014	c.3938C>A	c.(3937-3939)tCt>tAt	p.S1313Y	ADGB_ENST00000367493.3_Missense_Mutation_p.S628Y|ADGB_ENST00000523560.1_3'UTR|ADGB_ENST00000367488.1_Missense_Mutation_p.S36Y	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1313					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						GGACAAAAATCTTCAGTAACT	0.388																																																	0								ENSG00000118492						81.0	72.0	75.0					6																	147103231		692	1591	2283	ADGB	SO:0001583	missense	0			-	HGNC	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.3938C>A	6.37:g.147103231C>A	ENSP00000381036:p.Ser1313Tyr	Somatic	0	27	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	19	47.22	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.S1313Y	ENST00000397944.3	37	c.3938		6	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986828	0.74589	.	.	ENSG00000118492	ENST00000397944;ENST00000367493;ENST00000367490;ENST00000326916;ENST00000470716;ENST00000367488	T;T	0.52057	1.2;0.68	4.75	4.75	0.60458	.	.	.	.	.	T	0.53012	0.1770	L	0.41492	1.28	0.37400	D	0.912814	D;D	0.89917	0.993;1.0	P;D	0.80764	0.77;0.994	T	0.59674	-0.7410	9	0.87932	D	0	.	16.8776	0.86056	0.0:1.0:0.0:0.0	.	1313;258	Q8N7X0;Q8N7X0-2	CAN7L_HUMAN;.	Y	1313;628;271;36;36;36	ENSP00000381036:S1313Y;ENSP00000356460:S271Y	ENSP00000323839:S36Y	S	+	2	0	C6orf103	147144924	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	4.343000	0.59348	2.346000	0.79739	0.591000	0.81541	TCT	-	NULL		0.388	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	protein_coding	OTTHUMT00000376350.2	C	NM_024694	-		147103231	+1	no_errors	ENST00000397944	ensembl	human	known	74_37	missense	SNP	1.000	A
OBSCN	84033	genome.wustl.edu	37	1	228494695	228494696	+	Frame_Shift_Ins	INS	-	-	GAGCGTG	rs4653939	byFrequency	TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr1:228494695_228494696insGAGCGTG	ENST00000422127.1	+	45	12064_12065	c.12020_12021insGAGCGTG	c.(12019-12024)gcgagcfs	p.-4010fs	OBSCN_ENST00000570156.2_Frame_Shift_Ins_p.-4967fs|OBSCN_ENST00000366707.4_Frame_Shift_Ins_p.-1644fs|OBSCN_ENST00000284548.11_Frame_Shift_Ins_p.-4010fs|OBSCN_ENST00000366709.4_Frame_Shift_Ins_p.-1129fs	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGGGCGGGTGCGAGCGTGGAGT	0.653																																																	0								ENSG00000154358																																			OBSCN	SO:0001589	frameshift_variant	0				HGNC	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12021_12027dupGAGCGTG	1.37:g.228494696_228494702dupGAGCGTG	ENSP00000409493:p.Glu4010fs	Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.E4011fs	ENST00000422127.1	37	c.12020_12021	CCDS58065.1	1																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.653	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	protein_coding		-	NM_052843			228494696	+1	no_errors	ENST00000422127	ensembl	human	known	74_37	frame_shift_ins	INS	0.001:0.000	GAGCGTG
PLEKHM1	9842	genome.wustl.edu	37	17	43530773	43530773	+	Silent	SNP	C	C	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr17:43530773C>T	ENST00000430334.3	-	7	2578	c.2445G>A	c.(2443-2445)ctG>ctA	p.L815L	PLEKHM1_ENST00000421073.2_Silent_p.L726L|AC091132.1_ENST00000433601.1_RNA	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	815					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GGATAGCCACCAGGTACTGCA	0.622																																																	0								ENSG00000225190						45.0	44.0	44.0					17																	43530773		2203	4300	6503	PLEKHM1	SO:0001819	synonymous_variant	0			-	HGNC	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.2445G>A	17.37:g.43530773C>T		Somatic	0	60	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	42	50.00	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Run,superfamily_Znf_FYVE_PHD,smart_Run,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Pleckstrin_homology,pfscan_Run,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.L815	ENST00000430334.3	37	c.2445	CCDS32671.1	17																																																																																			-	NULL		0.622	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM1	protein_coding	OTTHUMT00000444659.1	C	NM_014798	-		43530773	-1	no_errors	ENST00000430334	ensembl	human	known	74_37	silent	SNP	1.000	T
PLXNA2	5362	genome.wustl.edu	37	1	208390466	208390466	+	Missense_Mutation	SNP	T	T	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr1:208390466T>A	ENST00000367033.3	-	2	1559	c.802A>T	c.(802-804)Atc>Ttc	p.I268F		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	268	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GCGGAGTTGATGGCCACACCC	0.572																																																	0								ENSG00000076356						114.0	113.0	114.0					1																	208390466		2203	4300	6503	PLXNA2	SO:0001583	missense	0			-	HGNC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.802A>T	1.37:g.208390466T>A	ENSP00000356000:p.Ile268Phe	Somatic	0	33	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	37	24.49	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.I268F	ENST00000367033.3	37	c.802	CCDS31013.1	1	.	.	.	.	.	.	.	.	.	.	T	8.111	0.778733	0.16120	.	.	ENSG00000076356	ENST00000367033	T	0.10860	2.83	5.84	2.21	0.28008	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	1.057010	0.07354	N	0.882856	T	0.06962	0.0177	N	0.08118	0	0.35911	D	0.831129	B;B	0.32939	0.391;0.288	B;B	0.40134	0.32;0.216	T	0.41805	-0.9488	10	0.18276	T	0.48	.	5.5435	0.17051	0.0:0.1475:0.146:0.7065	.	322;268	O75051-2;O75051	.;PLXA2_HUMAN	F	268	ENSP00000356000:I268F	ENSP00000356000:I268F	I	-	1	0	PLXNA2	206457089	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.819000	0.39022	0.441000	0.26529	0.533000	0.62120	ATC	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.572	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	protein_coding	OTTHUMT00000088932.6	T	NM_025179	-		208390466	-1	no_errors	ENST00000367033	ensembl	human	known	74_37	missense	SNP	1.000	A
LOC644794	644794	genome.wustl.edu	37	7	66369212	66369213	+	lincRNA	INS	-	-	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr7:66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC	ENST00000610177.1	+	0	1369_1370																											TGCCTCGTGGCGGCCTTCCCCG	0.738																																																	0								ENSG00000273142																																			RP11-458F8.4			0				Clone_based_vega_gene																													7.37:g.66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC		Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610177.1	37	NULL		7																																																																																			-	-		0.738	RP11-458F8.4-001	KNOWN	basic	lincRNA	LOC644794	lincRNA	OTTHUMT00000472525.1	-				66369213	+1	no_errors	ENST00000610177	ensembl	human	known	74_37	rna	INS	0.293:0.454	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC
GPR133	283383	genome.wustl.edu	37	12	131498757	131498757	+	Missense_Mutation	SNP	A	A	G			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr12:131498757A>G	ENST00000261654.5	+	13	1904	c.1345A>G	c.(1345-1347)Atg>Gtg	p.M449V	GPR133_ENST00000376682.4_Missense_Mutation_p.M135V|GPR133_ENST00000535015.1_Missense_Mutation_p.M481V	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	449					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		CGCGGAGGCCATGCATCACCA	0.592																																																	0								ENSG00000111452						114.0	95.0	102.0					12																	131498757		2203	4300	6503	GPR133	SO:0001583	missense	0			-	HGNC	AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.1345A>G	12.37:g.131498757A>G	ENSP00000261654:p.Met449Val	Somatic	0	41	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	44	27.87	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.M449V	ENST00000261654.5	37	c.1345	CCDS9272.1	12	.	.	.	.	.	.	.	.	.	.	a	0.013	-1.619727	0.00828	.	.	ENSG00000111452	ENST00000261654;ENST00000535015;ENST00000545900;ENST00000376682	T;T;T	0.38240	1.21;1.21;1.15	4.43	2.57	0.30868	.	0.550721	0.18534	N	0.138404	T	0.10723	0.0262	N	0.01352	-0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32375	-0.9909	10	0.11794	T	0.64	.	6.4026	0.21646	0.2378:0.0:0.7622:0.0	.	481;449	B7ZLF7;Q6QNK2	.;GP133_HUMAN	V	449;481;145;135	ENSP00000261654:M449V;ENSP00000444425:M481V;ENSP00000365872:M135V	ENSP00000261654:M449V	M	+	1	0	GPR133	130064710	0.005000	0.15991	0.001000	0.08648	0.003000	0.03518	1.445000	0.35079	0.412000	0.25729	-0.253000	0.11424	ATG	-	NULL		0.592	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR133	protein_coding	OTTHUMT00000399356.1	A	NM_198827	-		131498757	+1	no_errors	ENST00000261654	ensembl	human	known	74_37	missense	SNP	0.007	G
REEP5	7905	genome.wustl.edu	37	5	112222764	112222764	+	Silent	SNP	G	G	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr5:112222764G>T	ENST00000379638.4	-	4	816	c.468C>A	c.(466-468)gtC>gtA	p.V156V	CTC-487M23.8_ENST00000506997.1_Intron|REEP5_ENST00000474542.2_5'UTR|CTC-487M23.8_ENST00000512790.1_Intron|REEP5_ENST00000545426.1_3'UTR|REEP5_ENST00000513339.1_Intron|REEP5_ENST00000504247.1_3'UTR	NM_005669.4	NP_005660.4	Q00765	REEP5_HUMAN	receptor accessory protein 5	156						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		TAAGGTCCTTGACCACACTGT	0.522																																																	0								ENSG00000129625						212.0	179.0	190.0					5																	112222764		2202	4300	6502	REEP5	SO:0001819	synonymous_variant	0			-	HGNC	BC000232	CCDS4109.2	5q22-q23	2008-02-05	2006-02-07	2006-02-07	ENSG00000129625	ENSG00000129625		"""Receptor accessory proteins"""	30077	protein-coding gene	gene with protein product	"""deleted in polyposis 1"", ""polyposis locus protein 1"", ""polyposis coli region hypothetical protein DP1"""	125265	"""chromosome 5 open reading frame 18"""	C5orf18		16271481, 15550249	Standard	NM_005669		Approved	DP1, TB2, D5S346	uc003kqe.1	Q00765	OTTHUMG00000128807	ENST00000379638.4:c.468C>A	5.37:g.112222764G>T		Somatic	0	81	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	71	47.79	B7Z681|D3DT04|Q04198|Q5QGT0|Q9BWH9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TB2_DP1_HVA22	p.V156	ENST00000379638.4	37	c.468	CCDS4109.2	5																																																																																			-	NULL		0.522	REEP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REEP5	protein_coding	OTTHUMT00000250739.2	G	NM_005669	-		112222764	-1	no_errors	ENST00000379638	ensembl	human	known	74_37	silent	SNP	1.000	T
HNRNPA1L2	144983	genome.wustl.edu	37	13	53217551	53217553	+	In_Frame_Del	DEL	CAG	CAG	-	rs549497633	byFrequency	TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr13:53217551_53217553delCAG	ENST00000357495.2	+	1	984_986	c.924_926delCAG	c.(922-927)tccagc>tcc	p.308_309SS>S	HNRNPA1L2_ENST00000398039.1_In_Frame_Del_p.308_309SS>S|HNRNPA1L2_ENST00000342657.3_In_Frame_Del_p.308_309SS>S			Q32P51	RA1L2_HUMAN	heterogeneous nuclear ribonucleoprotein A1-like 2	308	Gly-rich.				alternative mRNA splicing, via spliceosome (GO:0000380)|mRNA transport (GO:0051028)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			cervix(1)|large_intestine(1)|lung(5)	7						ATGGCGTTTCCAGCAGCAGCAGT	0.498																																																	0								ENSG00000139675																																			HNRNPA1L2	SO:0001651	inframe_deletion	0				HGNC		CCDS31980.1	13q14.3	2013-02-12			ENSG00000139675	ENSG00000139675		"""RNA binding motif (RRM) containing"""	27067	protein-coding gene	gene with protein product						12477932	Standard	NM_001011724		Approved	LOC144983	uc001vgy.1	Q32P51	OTTHUMG00000016972	ENST00000357495.2:c.924_926delCAG	13.37:g.53217560_53217562delCAG	ENSP00000350090:p.Ser313del	Somatic	0	19	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	Q5TBS2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_HnRNPA1,smart_RRM_dom,pfscan_RRM_dom	p.S312in_frame_del	ENST00000357495.2	37	c.924_926	CCDS31980.1	13																																																																																			-	NULL		0.498	HNRNPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPA1L2	protein_coding	OTTHUMT00000045098.1	CAG	NM_001011724			53217553	+1	no_errors	ENST00000342657	ensembl	human	known	74_37	in_frame_del	DEL	0.015:0.792:0.834	-
LRIG2	9860	genome.wustl.edu	37	1	113616182	113616182	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr1:113616182C>T	ENST00000361127.5	+	1	352	c.154C>T	c.(154-156)Cct>Tct	p.P52S	RP11-31F15.2_ENST00000421157.1_lincRNA	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	52	LRRNT.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		CTGCCGCATTCCTCTCCTGGA	0.657											OREG0013684	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000198799						75.0	87.0	83.0					1																	113616182		2203	4299	6502	LRIG2	SO:0001583	missense	0			-	HGNC	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.154C>T	1.37:g.113616182C>T	ENSP00000355396:p.Pro52Ser	Somatic	0	38	0.00	1451	0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	29	46.30	Q9NSN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P52S	ENST00000361127.5	37	c.154	CCDS30808.1	1	.	.	.	.	.	.	.	.	.	.	C	4.749	0.139214	0.09083	.	.	ENSG00000198799	ENST00000361127	T	0.60171	0.21	4.93	4.0	0.46444	.	0.408218	0.24769	N	0.035751	T	0.23806	0.0576	L	0.36672	1.1	0.19775	N	0.99995	B	0.16802	0.019	B	0.20384	0.029	T	0.13953	-1.0490	10	0.14252	T	0.57	.	11.0858	0.48086	0.0:0.8132:0.1868:0.0	.	52	O94898	LRIG2_HUMAN	S	52	ENSP00000355396:P52S	ENSP00000355396:P52S	P	+	1	0	LRIG2	113417705	0.001000	0.12720	0.326000	0.25389	0.609000	0.37215	0.070000	0.14573	1.276000	0.44395	0.563000	0.77884	CCT	-	NULL		0.657	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	protein_coding	OTTHUMT00000033549.2	C	NM_014813	-		113616182	+1	no_errors	ENST00000361127	ensembl	human	known	74_37	missense	SNP	0.251	T
SRF	6722	genome.wustl.edu	37	6	43143452	43143453	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr6:43143452_43143453delGA	ENST00000265354.4	+	3	1147_1148	c.789_790delGA	c.(787-792)ctgaagfs	p.K264fs	SRF_ENST00000457278.2_Frame_Shift_Del_p.K60fs	NM_003131.2	NP_003122.1	P11831	SRF_HUMAN	serum response factor (c-fos serum response element-binding transcription factor)	264					angiogenesis involved in wound healing (GO:0060055)|associative learning (GO:0008306)|cardiac myofibril assembly (GO:0055003)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular senescence (GO:0090398)|contractile actin filament bundle assembly (GO:0030038)|developmental growth (GO:0048589)|dorsal aorta morphogenesis (GO:0035912)|epithelial cell-cell adhesion (GO:0090136)|epithelial structure maintenance (GO:0010669)|erythrocyte development (GO:0048821)|eyelid development in camera-type eye (GO:0061029)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|hematopoietic stem cell differentiation (GO:0060218)|hippocampus development (GO:0021766)|long term synaptic depression (GO:0060292)|long-term memory (GO:0007616)|megakaryocyte development (GO:0035855)|mesoderm formation (GO:0001707)|morphogenesis of an epithelial sheet (GO:0002011)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet formation (GO:0030220)|positive regulation of cell differentiation (GO:0045597)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription by glucose (GO:0046016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive thymic T cell selection (GO:0045059)|primitive streak formation (GO:0090009)|regulation of cell adhesion (GO:0030155)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of water loss via skin (GO:0033561)|response to cytokine (GO:0034097)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|sarcomere organization (GO:0045214)|skin morphogenesis (GO:0043589)|stress fiber assembly (GO:0043149)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|tight junction assembly (GO:0070830)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	12			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.011)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			AGGACACACTGAAGCCGGCGTT	0.545																																																	0								ENSG00000112658																																			SRF	SO:0001589	frameshift_variant	0				HGNC	J03161	CCDS4889.1	6p	2008-02-05			ENSG00000112658	ENSG00000112658			11291	protein-coding gene	gene with protein product		600589				3203386	Standard	NM_003131		Approved	MCM1	uc003oui.3	P11831	OTTHUMG00000014722	ENST00000265354.4:c.789_790delGA	6.37:g.43143452_43143453delGA	ENSP00000265354:p.Lys264fs	Somatic	0	37	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	20	45.95	Q5T648	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TF_MADSbox,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.K264fs	ENST00000265354.4	37	c.789_790	CCDS4889.1	6																																																																																			-	NULL		0.545	SRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRF	protein_coding	OTTHUMT00000040581.1	GA	NM_003131			43143453	+1	no_errors	ENST00000265354	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
PODN	127435	genome.wustl.edu	37	1	53538729	53538729	+	3'UTR	SNP	G	G	C			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr1:53538729G>C	ENST00000471210.1	+	0	845				PODN_ENST00000371500.3_Intron|PODN_ENST00000395871.2_Intron|PODN_ENST00000312553.5_Intron|RP11-334A14.5_ENST00000447867.1_RNA			Q7Z5L7	PODN_HUMAN	podocan						negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						agtgaaaAAAGCTGTCTAACT	0.498																																																	0								ENSG00000174348																																			PODN	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AY313607	CCDS573.1, CCDS55601.1, CCDS55602.1	1p32.3	2008-02-05			ENSG00000174348	ENSG00000174348		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	23174	protein-coding gene	gene with protein product	"""podocan proteoglycan"""	608661					Standard	NM_153703		Approved	PCAN, PODOCAN, MGC24995, SLRR5A	uc010onr.2	Q7Z5L7	OTTHUMG00000008934	ENST00000471210.1:c.*842G>C	1.37:g.53538729G>C		Somatic	0	15	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00	B4DKN5|B4E373|Q5VVZ2|Q5VVZ3|Q6PIR3|Q6UXL8|Q8N641	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000471210.1	37	NULL		1																																																																																			-	-		0.498	PODN-002	KNOWN	basic	processed_transcript	PODN	protein_coding	OTTHUMT00000024736.1	G	NM_153703	-		53538729	+1	no_errors	ENST00000471210	ensembl	human	known	74_37	rna	SNP	0.240	C
TARBP1	6894	genome.wustl.edu	37	1	234528283	234528283	+	Missense_Mutation	SNP	G	G	T	rs376860218		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr1:234528283G>T	ENST00000040877.1	-	29	4575	c.4576C>A	c.(4576-4578)Cta>Ata	p.L1526I	TARBP1_ENST00000483404.1_5'UTR	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1526					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TAATCAATTAGCTGAGGTGGT	0.343																																																	0								ENSG00000059588						134.0	133.0	133.0					1																	234528283		2203	4300	6503	TARBP1	SO:0001583	missense	0			-	HGNC		CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4576C>A	1.37:g.234528283G>T	ENSP00000040877:p.Leu1526Ile	Somatic	0	43	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	38	30.91	Q9H581	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.L1526I	ENST00000040877.1	37	c.4576	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547512	0.45383	.	.	ENSG00000059588	ENST00000040877	T	0.51817	0.69	5.72	2.51	0.30379	tRNA/rRNA methyltransferase, SpoU (1);	0.077706	0.53938	D	0.000049	T	0.56455	0.1986	L	0.46947	1.48	0.80722	D	1	D	0.65815	0.995	D	0.85130	0.997	T	0.49986	-0.8880	10	0.34782	T	0.22	-17.0393	9.3668	0.38230	0.2564:0.0:0.7436:0.0	.	1526	Q13395	TARB1_HUMAN	I	1526	ENSP00000040877:L1526I	ENSP00000040877:L1526I	L	-	1	2	TARBP1	232594906	1.000000	0.71417	0.748000	0.31131	0.192000	0.23643	2.980000	0.49321	0.593000	0.29745	0.585000	0.79938	CTA	-	pfam_SpoU_MeTrfase		0.343	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	protein_coding	OTTHUMT00000092616.1	G	NM_005646	-		234528283	-1	no_errors	ENST00000040877	ensembl	human	novel	74_37	missense	SNP	1.000	T
GABRB1	2560	genome.wustl.edu	37	4	47427786	47427786	+	Silent	SNP	C	C	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr4:47427786C>A	ENST00000295454.3	+	9	1468	c.1176C>A	c.(1174-1176)gcC>gcA	p.A392A	GABRB1_ENST00000538619.1_Silent_p.A322A	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	392					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ACCCCAAGGCCACCATGTACT	0.642																																																	0								ENSG00000163288						56.0	61.0	59.0					4																	47427786		2203	4300	6503	GABRB1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.1176C>A	4.37:g.47427786C>A		Somatic	0	33	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	27	48.08	B2R6U7|D6REL3|Q16166|Q8TBK3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.A392	ENST00000295454.3	37	c.1176	CCDS3474.1	4																																																																																			-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.642	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB1	protein_coding	OTTHUMT00000216896.1	C		-		47427786	+1	no_errors	ENST00000295454	ensembl	human	known	74_37	silent	SNP	0.996	A
SRF	6722	genome.wustl.edu	37	6	43143443	43143450	+	Splice_Site	DEL	GGACACAC	GGACACAC	-			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	GGACACAC	GGACACAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr6:43143443_43143450delGGACACAC	ENST00000265354.4	+	3	1138_1145	c.780_787delGGACACAC	c.(778-789)aaggacacactg>aatg	p.KDTL260fs	SRF_ENST00000457278.2_Splice_Site_p.KDTL56fs	NM_003131.2	NP_003122.1	P11831	SRF_HUMAN	serum response factor (c-fos serum response element-binding transcription factor)	260					angiogenesis involved in wound healing (GO:0060055)|associative learning (GO:0008306)|cardiac myofibril assembly (GO:0055003)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-matrix adhesion (GO:0007160)|cellular response to glucose stimulus (GO:0071333)|cellular senescence (GO:0090398)|contractile actin filament bundle assembly (GO:0030038)|developmental growth (GO:0048589)|dorsal aorta morphogenesis (GO:0035912)|epithelial cell-cell adhesion (GO:0090136)|epithelial structure maintenance (GO:0010669)|erythrocyte development (GO:0048821)|eyelid development in camera-type eye (GO:0061029)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|hematopoietic stem cell differentiation (GO:0060218)|hippocampus development (GO:0021766)|long term synaptic depression (GO:0060292)|long-term memory (GO:0007616)|megakaryocyte development (GO:0035855)|mesoderm formation (GO:0001707)|morphogenesis of an epithelial sheet (GO:0002011)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|neuron development (GO:0048666)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|platelet formation (GO:0030220)|positive regulation of cell differentiation (GO:0045597)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription by glucose (GO:0046016)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive thymic T cell selection (GO:0045059)|primitive streak formation (GO:0090009)|regulation of cell adhesion (GO:0030155)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of water loss via skin (GO:0033561)|response to cytokine (GO:0034097)|response to hormone (GO:0009725)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|sarcomere organization (GO:0045214)|skin morphogenesis (GO:0043589)|stress fiber assembly (GO:0043149)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|tight junction assembly (GO:0070830)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	12			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.011)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			TCTGGGTATAGGACACACTGAAGCCGGC	0.548																																																	0								ENSG00000112658																																			SRF	SO:0001630	splice_region_variant	0				HGNC	J03161	CCDS4889.1	6p	2008-02-05			ENSG00000112658	ENSG00000112658			11291	protein-coding gene	gene with protein product		600589				3203386	Standard	NM_003131		Approved	MCM1	uc003oui.3	P11831	OTTHUMG00000014722	ENST00000265354.4:c.781-1GGACACAC>-	6.37:g.43143443_43143450delGGACACAC		Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T648	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TF_MADSbox,superfamily_TF_MADSbox,smart_TF_MADSbox,pfscan_TF_MADSbox,prints_TF_MADSbox	p.K261fs	ENST00000265354.4	37	c.782_787	CCDS4889.1	6																																																																																			-	NULL		0.548	SRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRF	protein_coding	OTTHUMT00000040581.1	GGACACAC	NM_003131		Frame_Shift_Del	43143450	+1	no_errors	ENST00000265354	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:0.809:0.785:0.793:0.701:0.997	-
TLN2	83660	genome.wustl.edu	37	15	63029075	63029075	+	Splice_Site	DEL	A	A	-			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr15:63029075delA	ENST00000561311.1	+	28	3588		c.e28-1		TLN2_ENST00000559908.1_Splice_Site|TLN2_ENST00000306829.6_Splice_Site			Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						TTTTTCCCCCAGGGGTGGCTG	0.577																																																	0								ENSG00000171914						29.0	32.0	31.0					15																	63029075		2202	4300	6502	TLN2	SO:0001630	splice_region_variant	0				HGNC	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.3359-1A>-	15.37:g.63029075delA		Somatic	0	22	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	23	37.84	A6NLB8	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e26-2	ENST00000561311.1	37	c.3359-2	CCDS32261.1	15																																																																																			-	-		0.577	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	protein_coding	OTTHUMT00000257878.2	A			Intron	63029075	+1	no_errors	ENST00000306829	ensembl	human	known	74_37	splice_site_del	DEL	0.998	-
PTGFRN	5738	genome.wustl.edu	37	1	117509804	117509804	+	Silent	SNP	G	G	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr1:117509804G>A	ENST00000393203.2	+	6	2058	c.1911G>A	c.(1909-1911)gaG>gaA	p.E637E	PTGFRN_ENST00000496699.1_3'UTR	NM_020440.2	NP_065173.2	Q9P2B2	FPRP_HUMAN	prostaglandin F2 receptor inhibitor	637	Ig-like C2-type 5.				lipid particle organization (GO:0034389)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)	46	Lung SC(450;0.225)	all_cancers(81;0.00104)|all_lung(203;8.97e-05)|all_epithelial(167;0.000139)|Lung NSC(69;0.000446)		Lung(183;0.0704)|LUSC - Lung squamous cell carcinoma(189;0.227)|Colorectal(144;0.248)		AGGAGGATGAGTTCCGCTATC	0.537																																																	0								ENSG00000134247						149.0	145.0	146.0					1																	117509804		2203	4300	6503	PTGFRN	SO:0001819	synonymous_variant	0			-	HGNC	AB014734	CCDS890.1	1p13.1	2013-01-29	2013-01-25		ENSG00000134247	ENSG00000134247		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9601	protein-coding gene	gene with protein product		601204	"""prostaglandin F2 receptor negative regulator"""			8655148	Standard	NM_020440		Approved	FPRP, EWI-F, CD9P-1, FLJ11001, KIAA1436, SMAP-6, CD315	uc001egv.1	Q9P2B2	OTTHUMG00000012028	ENST00000393203.2:c.1911G>A	1.37:g.117509804G>A		Somatic	0	13	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	6	53.85	Q5VVU9|Q8N2K6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.E637	ENST00000393203.2	37	c.1911	CCDS890.1	1																																																																																			-	smart_Ig_sub		0.537	PTGFRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGFRN	protein_coding	OTTHUMT00000033271.1	G	NM_020440	-		117509804	+1	no_errors	ENST00000393203	ensembl	human	known	74_37	silent	SNP	0.984	A
CTNNA2	1496	genome.wustl.edu	37	2	79914691	79914691	+	Intron	SNP	G	G	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr2:79914691G>T	ENST00000402739.4	+	1	107				CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000466387.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000409266.1_Splice_Site_p.C35F|CTNNA2_ENST00000541047.1_Intron	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2						axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						GCCTTGCAGTGCATTTTTTTT	0.348																																																	0								ENSG00000066032																																			CTNNA2	SO:0001627	intron_variant	0			-	HGNC		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.102+35907G>T	2.37:g.79914691G>T		Somatic	0	34	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Vinculin/catenin	p.C35F	ENST00000402739.4	37	c.104		2	.	.	.	.	.	.	.	.	.	.	G	3.047	-0.196143	0.06259	.	.	ENSG00000066032	ENST00000409266	.	.	.	3.68	-1.76	0.08006	.	.	.	.	.	T	0.34687	0.0906	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40289	-0.9571	5	0.87932	D	0	.	3.4895	0.07632	0.4854:0.0:0.3287:0.186	.	.	.	.	F	35	.	ENSP00000387232:C35F	C	+	2	0	CTNNA2	79768199	0.000000	0.05858	0.000000	0.03702	0.193000	0.23685	-0.399000	0.07250	-0.370000	0.08016	0.563000	0.77884	TGC	-	NULL		0.348	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	protein_coding	OTTHUMT00000328511.4	G	NM_004389	-		79914691	+1	no_errors	ENST00000409266	ensembl	human	putative	74_37	missense	SNP	0.000	T
PCLO	27445	genome.wustl.edu	37	7	82584755	82584755	+	Silent	SNP	C	C	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr7:82584755C>T	ENST00000333891.9	-	5	5851	c.5514G>A	c.(5512-5514)ccG>ccA	p.P1838P	PCLO_ENST00000423517.2_Silent_p.P1838P	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ACTCTTCTGTCGGAGATGCAT	0.428																																																	0								ENSG00000186472						227.0	209.0	215.0					7																	82584755		1869	4105	5974	PCLO	SO:0001819	synonymous_variant	0			-	HGNC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5514G>A	7.37:g.82584755C>T		Somatic	0	67	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	5	88.10		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.P1838	ENST00000333891.9	37	c.5514	CCDS47630.1	7																																																																																			-	NULL		0.428	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	protein_coding	OTTHUMT00000337368.5	C	NM_014510	-		82584755	-1	no_errors	ENST00000333891	ensembl	human	known	74_37	silent	SNP	0.608	T
FAIM2	23017	genome.wustl.edu	37	12	50295102	50295102	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr12:50295102C>T	ENST00000320634.3	-	2	116	c.22G>A	c.(22-24)Gtg>Atg	p.V8M	FAIM2_ENST00000550890.1_De_novo_Start_InFrame	NM_012306.3	NP_036438.2	Q9BWQ8	LFG2_HUMAN	Fas apoptotic inhibitory molecule 2	8					apoptotic process (GO:0006915)|cerebellar granular layer development (GO:0021681)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum development (GO:0021549)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of neuron apoptotic process (GO:0043524)|regulation of neuron apoptotic process (GO:0043523)|response to ischemia (GO:0002931)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|postsynaptic membrane (GO:0045211)				endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|skin(2)	14						TTGTTAGCCACGGAGAGCTAT	0.577																																																	0								ENSG00000135472						36.0	36.0	36.0					12																	50295102		2203	4300	6503	FAIM2	SO:0001583	missense	0			-	HGNC	AB023167	CCDS8791.1	12q13	2010-03-18				ENSG00000135472			17067	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 2"""	604306				10231032, 10535980	Standard	NM_012306		Approved	KIAA0950, LFG, NMP35, LIFEGUARD, TMBIM2, LFG2	uc001rvj.2	Q9BWQ8	OTTHUMG00000169808	ENST00000320634.3:c.22G>A	12.37:g.50295102C>T	ENSP00000321951:p.Val8Met	Somatic	0	45	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A8K1W6|B3KR08|Q9UJY9|Q9Y2F7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Bax_inhibitor_1-related	p.V8M	ENST00000320634.3	37	c.22	CCDS8791.1	12	.	.	.	.	.	.	.	.	.	.	C	18.79	3.699006	0.68501	.	.	ENSG00000135472	ENST00000320634;ENST00000550635	T	0.36340	1.26	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000009	T	0.44993	0.1320	L	0.44542	1.39	0.45284	D	0.998283	D	0.67145	0.996	P	0.54401	0.751	T	0.32134	-0.9918	10	0.54805	T	0.06	-14.0643	15.01	0.71542	0.0:1.0:0.0:0.0	.	8	Q9BWQ8	FAIM2_HUMAN	M	8	ENSP00000321951:V8M	ENSP00000321951:V8M	V	-	1	0	FAIM2	48581369	0.996000	0.38824	1.000000	0.80357	0.829000	0.46940	3.606000	0.54095	2.627000	0.88993	0.561000	0.74099	GTG	-	NULL		0.577	FAIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAIM2	protein_coding	OTTHUMT00000405984.1	C	NM_012306	-		50295102	-1	no_errors	ENST00000320634	ensembl	human	known	74_37	missense	SNP	0.999	T
WDR66	144406	genome.wustl.edu	37	12	122359397	122359398	+	In_Frame_Ins	INS	-	-	GAGGAGGAGGAGAAA	rs142042908|rs386767074|rs58098972|rs142971083|rs377641095|rs71082910		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr12:122359397_122359398insGAGGAGGAGGAGAAA	ENST00000288912.4	+	2	1040_1041	c.186_187insGAGGAGGAGGAGAAA	c.(187-189)gag>GAGGAGGAGGAGAAAgag	p.63_63E>EEEEKE	WDR66_ENST00000397454.2_In_Frame_Ins_p.63_63E>EEEEKE	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	63	Glu-rich.						calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		aggaggaaggggaggaggaggg	0.465																																					Esophageal Squamous(85;849 1794 49757 52143)												0								ENSG00000158023																																			WDR66	SO:0001652	inframe_insertion	0				HGNC	AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	Exception_encountered	12.37:g.122359397_122359398insGAGGAGGAGGAGAAA	Exception_encountered	Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.65in_frame_insEKEEE	ENST00000288912.4	37	c.186_187	CCDS41853.1	12																																																																																			-	NULL		0.465	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	protein_coding	OTTHUMT00000401700.1	-	NM_144668			122359398	+1	no_errors	ENST00000288912	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.000	GAGGAGGAGGAGAAA
SLC5A11	115584	genome.wustl.edu	37	16	24918471	24918471	+	Nonsense_Mutation	SNP	G	G	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr16:24918471G>T	ENST00000347898.3	+	12	1862	c.1240G>T	c.(1240-1242)Gag>Tag	p.E414*	SLC5A11_ENST00000424767.2_Nonsense_Mutation_p.E379*|SLC5A11_ENST00000449109.2_Nonsense_Mutation_p.E258*|SLC5A11_ENST00000567758.1_Nonsense_Mutation_p.E379*|SLC5A11_ENST00000539472.1_Nonsense_Mutation_p.E350*|SLC5A11_ENST00000569071.1_Nonsense_Mutation_p.E258*|SLC5A11_ENST00000568579.1_Nonsense_Mutation_p.E344*|SLC5A11_ENST00000545376.1_Nonsense_Mutation_p.E344*|SLC5A11_ENST00000565769.1_Nonsense_Mutation_p.E350*	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		TCGGGCATCTGAGAAGGAGCT	0.597																																																	0								ENSG00000158865						102.0	105.0	104.0					16																	24918471		2197	4300	6497	SLC5A11	SO:0001587	stop_gained	0			-	HGNC	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.1240G>T	16.37:g.24918471G>T	ENSP00000289932:p.Glu414*	Somatic	0	26	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	35	41.67		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.E414*	ENST00000347898.3	37	c.1240	CCDS10625.1	16	.	.	.	.	.	.	.	.	.	.	G	39	7.740880	0.98462	.	.	ENSG00000158865	ENST00000347898;ENST00000449109;ENST00000424767;ENST00000545376;ENST00000539472	.	.	.	5.57	5.57	0.84162	.	0.047074	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	17.0478	0.86509	0.0:0.0:1.0:0.0	.	.	.	.	X	414;258;379;344;350	.	ENSP00000289932:E414X	E	+	1	0	SLC5A11	24825972	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.700000	0.98707	2.633000	0.89246	0.563000	0.77884	GAG	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.597	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A11	protein_coding	OTTHUMT00000214091.3	G	NM_052944	-		24918471	+1	no_errors	ENST00000347898	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RP11-764K9.1	0	genome.wustl.edu	37	9	68400304	68400304	+	lincRNA	SNP	C	C	T	rs75333251	byFrequency	TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr9:68400304C>T	ENST00000417843.2	-	0	1515																											TGGTGGACTGCTTGGGCCGTT	0.552																																																	0								ENSG00000225411																																			RP11-764K9.1			0			-	Clone_based_vega_gene																													9.37:g.68400304C>T		Somatic	0	8	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			-	-		0.552	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	lincRNA	OTTHUMT00000129817.2	C		rs75333251		68400304	-1	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	SNP	0.047	T
MGAT4D	152586	genome.wustl.edu	37	4	141377825	141377825	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr4:141377825delA	ENST00000503109.2	-	9	925	c.926delT	c.(925-927)ttafs	p.L309fs	RP11-542P2.1_ENST00000511113.1_Frame_Shift_Del_p.L309fs|RP11-542P2.1_ENST00000511632.1_5'UTR|RP11-542P2.1_ENST00000515354.1_Frame_Shift_Del_p.L101fs																							GTAGAACATTAAAAAAAACCG	0.333																																																	0								ENSG00000205301																																			RP11-542P2.1	SO:0001589	frameshift_variant	0				Clone_based_vega_gene																												ENST00000503109.2:c.926delT	4.37:g.141377825delA	ENSP00000426225:p.Leu309fs	Somatic	0	26	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	21	43.24		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Glyco_transf_54	p.L309fs	ENST00000503109.2	37	c.926		4																																																																																			-	pfam_Glyco_transf_54		0.333	RP11-542P2.1-008	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LOC152586	protein_coding	OTTHUMT00000369949.1	A				141377825	-1	no_errors	ENST00000511113	ensembl	human	putative	74_37	frame_shift_del	DEL	0.985	-
SNX25	83891	genome.wustl.edu	37	4	186180114	186180114	+	Silent	SNP	G	G	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr4:186180114G>A	ENST00000504273.1	+	3	429	c.135G>A	c.(133-135)caG>caA	p.Q45Q	SNX25_ENST00000264694.8_Silent_p.Q45Q			Q9H3E2	SNX25_HUMAN	sorting nexin 25	45	PXA. {ECO:0000255|PROSITE- ProRule:PRU00147, ECO:0000255|PROSITE- ProRule:PRU00553}.				negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		TTGCCAGACAGCTGCACCACA	0.448																																																	0								ENSG00000109762						136.0	122.0	127.0					4																	186180114		2203	4300	6503	SNX25	SO:0001819	synonymous_variant	0			-	HGNC	AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.135G>A	4.37:g.186180114G>A		Somatic	0	55	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	42	39.13	Q3ZT30|Q8N6K3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_RGS_dom,pfam_Phox,superfamily_Regulat_G_prot_signal_superfam,superfamily_Phox,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal_superfam,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal_superfam	p.Q45	ENST00000504273.1	37	c.135	CCDS34116.1	4																																																																																			-	pfam_Phox_assoc,smart_PX_assoc_Snx13,pfscan_Phox_assoc		0.448	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX25	protein_coding	OTTHUMT00000360756.1	G	NM_031953	-		186180114	+1	no_errors	ENST00000264694	ensembl	human	known	74_37	silent	SNP	1.000	A
LHPP	64077	genome.wustl.edu	37	10	126177109	126177109	+	Missense_Mutation	SNP	G	G	C			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr10:126177109G>C	ENST00000368842.5	+	3	460	c.432G>C	c.(430-432)gaG>gaC	p.E144D	LHPP_ENST00000368839.1_Missense_Mutation_p.E144D|LHPP_ENST00000392757.4_Missense_Mutation_p.E144D	NM_022126.3	NP_071409.3	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic pyrophosphate phosphatase	144					phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|phosphohistidine phosphatase activity (GO:0008969)|protein homodimerization activity (GO:0042803)			large_intestine(2)|lung(2)	4		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		TGCTCATGGAGCTGGAAAAAC	0.463																																					GBM(165;1980 2715 15999 18454)												0								ENSG00000107902						127.0	124.0	125.0					10																	126177109		2203	4300	6503	LHPP	SO:0001583	missense	0			-	HGNC	AB049629	CCDS7640.1, CCDS53587.1	10q26.2	2010-02-17			ENSG00000107902	ENSG00000107902	3.6.1.1		30042	protein-coding gene	gene with protein product						12801912, 16430861	Standard	NM_022126		Approved	HDHD2B	uc001lhs.2	Q9H008	OTTHUMG00000019214	ENST00000368842.5:c.432G>C	10.37:g.126177109G>C	ENSP00000357835:p.Glu144Asp	Somatic	0	43	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	26	50.94	B3KP20|Q2TBE9|Q5VUV9|Q5VUW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_hyp2,tigrfam_HAD-SF_hydro_IIA	p.E144D	ENST00000368842.5	37	c.432	CCDS7640.1	10	.	.	.	.	.	.	.	.	.	.	G	2.988	-0.208753	0.06140	.	.	ENSG00000107902	ENST00000392757;ENST00000368842;ENST00000368839	T;T;T	0.21361	2.01;2.01;2.01	5.16	1.8	0.24995	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);Nitrophenylphosphatase-like  domain (1);	0.446177	0.22966	N	0.053495	T	0.07954	0.0199	N	0.12422	0.21	0.30706	N	0.749814	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.06405	0.001;0.002;0.0	T	0.23084	-1.0198	10	0.12103	T	0.63	-31.0238	2.4591	0.04537	0.2587:0.2052:0.4307:0.1054	.	144;144;144	Q5T1Z0;Q9H008-2;Q9H008	.;.;LHPP_HUMAN	D	144	ENSP00000376512:E144D;ENSP00000357835:E144D;ENSP00000357832:E144D	ENSP00000357832:E144D	E	+	3	2	LHPP	126167099	0.041000	0.20044	1.000000	0.80357	0.923000	0.55619	-0.521000	0.06245	0.618000	0.30179	-0.345000	0.07892	GAG	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_hyp2,tigrfam_HAD-SF_hydro_IIA		0.463	LHPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHPP	protein_coding	OTTHUMT00000050870.1	G	NM_022126	-		126177109	+1	no_errors	ENST00000368842	ensembl	human	known	74_37	missense	SNP	1.000	C
HEXIM1	10614	genome.wustl.edu	37	17	43227864	43227864	+	3'UTR	SNP	G	G	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr17:43227864G>T	ENST00000332499.2	+	0	3181				AC002117.1_ENST00000589950.1_RNA|AC002117.1_ENST00000452741.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1						heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TTCCTTTTTAGAAGTTTTTTT	0.328																																																	0								ENSG00000224505																																			AC002117.1	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.*227G>T	17.37:g.43227864G>T		Somatic	0	39	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	34	34.62	B2R8Y5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000332499.2	37	NULL	CCDS11495.1	17																																																																																			-	-		0.328	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000224505	protein_coding	OTTHUMT00000449821.2	G	NM_006460	-		43227864	-1	no_errors	ENST00000589950	ensembl	human	known	74_37	rna	SNP	0.051	T
VPS45	11311	genome.wustl.edu	37	1	150082514	150082514	+	Intron	DEL	A	A	-			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr1:150082514delA	ENST00000369130.3	+	14	2039				VPS45_ENST00000535106.1_Intron|VPS45_ENST00000369128.5_Intron|VPS45_ENST00000484306.1_3'UTR	NM_001279354.1|NM_007259.3	NP_001266283.1|NP_009190.2	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45 homolog (S. cerevisiae)						blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|vesicle docking involved in exocytosis (GO:0006904)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TTCCTCCACCAAAAAAAAAAG	0.303																																																	0								ENSG00000136631																																			VPS45	SO:0001627	intron_variant	0				HGNC	U35246	CCDS944.1, CCDS60244.1, CCDS72904.1	1q21.2	2008-02-05	2006-12-19	2006-12-19	ENSG00000136631	ENSG00000136631			14579	protein-coding gene	gene with protein product		610035	"""vacuolar protein sorting 45A (yeast homolog)"", ""vacuolar protein sorting 45A (yeast)"""	VPS45B, VPS45A		8996080	Standard	NM_007259		Approved	h-vps45, H1	uc001etp.3	Q9NRW7	OTTHUMG00000012511	ENST00000369130.3:c.1494-97A>-	1.37:g.150082514delA		Somatic	0	16	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	D3DUZ9|F5H8K1|Q15715|Q53FR8|Q5T4P6|Q9Y4Z6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369130.3	37	NULL	CCDS944.1	1																																																																																			-	-		0.303	VPS45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS45	protein_coding	OTTHUMT00000034964.1	A	NM_007259			150082514	+1	no_errors	ENST00000484306	ensembl	human	known	74_37	rna	DEL	0.965	-
ATR	545	genome.wustl.edu	37	3	142184164	142184164	+	Intron	DEL	A	A	-	rs78538255		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr3:142184164delA	ENST00000350721.4	-	41	7019				ATR_ENST00000383101.3_Intron|RP11-383G6.3_ENST00000460977.1_RNA	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TGAGTTATGTAAAAAAAAAAA	0.244								Other conserved DNA damage response genes																																									0								ENSG00000244327																																			RP11-383G6.3	SO:0001627	intron_variant	0				Clone_based_vega_gene	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.6898-82T>-	3.37:g.142184164delA		Somatic	0	18	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	Q59HB2|Q7KYL3|Q93051|Q9BXK4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000350721.4	37	NULL	CCDS3124.1	3																																																																																			-	-		0.244	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000244327	protein_coding	OTTHUMT00000353995.2	A	NM_001184			142184164	-1	no_errors	ENST00000460977	ensembl	human	known	74_37	rna	DEL	0.001	-
GMPR2	51292	genome.wustl.edu	37	14	24707611	24707611	+	Splice_Site	SNP	G	G	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr14:24707611G>A	ENST00000355299.4	+	9	1318	c.857G>A	c.(856-858)aGa>aAa	p.R286K	GMPR2_ENST00000399440.2_Splice_Site_p.R286K|GMPR2_ENST00000557854.1_Missense_Mutation_p.R304K|GMPR2_ENST00000559836.1_Splice_Site_p.R286K|GMPR2_ENST00000559910.1_Splice_Site_p.R253K|GMPR2_ENST00000559104.1_Splice_Site_p.R271K|GMPR2_ENST00000348719.7_Missense_Mutation_p.R286K|GMPR2_ENST00000420554.2_Splice_Site_p.R304K|GMPR2_ENST00000456667.3_Splice_Site_p.R258K	NM_001002000.1	NP_001002000.1	Q9P2T1	GMPR2_HUMAN	guanosine monophosphate reductase 2	286	GMP binding.				GMP metabolic process (GO:0046037)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|GMP reductase complex (GO:1902560)	GMP reductase activity (GO:0003920)|metal ion binding (GO:0046872)			large_intestine(4)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	12				GBM - Glioblastoma multiforme(265;0.0181)		GCTGAGTACAGGTATGTGTGG	0.517																																																	0								ENSG00000100938						92.0	98.0	96.0					14																	24707611		2039	4203	6242	GMPR2	SO:0001630	splice_region_variant	0			-	HGNC		CCDS41935.1, CCDS45087.1, CCDS61419.1, CCDS73624.1	14q11.2	2006-11-24							4377	protein-coding gene	gene with protein product		610781					Standard	XM_005267742		Approved		uc001wnw.3	Q9P2T1		ENST00000355299.4:c.857+1G>A	14.37:g.24707611G>A		Somatic	0	20	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	11	59.26	D3DS66|Q567T0|Q6IAJ8|Q86T14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IMP_DH_GMPRt,pfam_FMN-dep_DH,tigrfam_GMP_reduct1	p.R286K	ENST00000355299.4	37	c.857	CCDS41935.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.691749	0.96793	.	.	ENSG00000100938	ENST00000355299;ENST00000421944;ENST00000420554;ENST00000399440;ENST00000348719;ENST00000456667	T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;2.02;-1.15	6.17	6.17	0.99709	Aldolase-type TIM barrel (1);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.83608	0.5291	L	0.58969	1.84	0.80722	D	1	B;D;D;D;D;D	0.61080	0.41;0.985;0.958;0.989;0.958;0.958	B;P;P;P;P;P	0.57244	0.198;0.816;0.745;0.737;0.674;0.739	T	0.78076	-0.2345	10	0.20519	T	0.43	.	19.6509	0.95805	0.0:0.0:1.0:0.0	.	123;258;286;304;288;286	Q86SZ5;Q86T14;Q6PKC0;Q9P2T1-2;Q7Z527;Q9P2T1	.;.;.;.;.;GMPR2_HUMAN	K	286;286;304;286;286;258	ENSP00000347449:R286K;ENSP00000392859:R304K;ENSP00000382369:R286K;ENSP00000334409:R286K;ENSP00000405743:R258K	ENSP00000334409:R286K	R	+	2	0	GMPR2	23777451	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	9.675000	0.98638	2.941000	0.99782	0.655000	0.94253	AGA;AGA;AGA;AGA;AGG;AGA	-	tigrfam_GMP_reduct1		0.517	GMPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GMPR2	protein_coding	OTTHUMT00000415821.2	G	NM_016576	-	Missense_Mutation	24707611	+1	no_errors	ENST00000348719	ensembl	human	known	74_37	missense	SNP	1.000	A
TMEM255B	348013	genome.wustl.edu	37	13	114502418	114502418	+	Intron	SNP	T	T	C			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr13:114502418T>C	ENST00000375353.3	+	5	450					NM_182614.2	NP_872420.1	Q8WV15	T255B_HUMAN	transmembrane protein 255B							integral component of membrane (GO:0016021)											GAGATTCATGTGGGTTTTGCT	0.547																																																	0								ENSG00000184497						103.0	84.0	90.0					13																	114502418		2203	4300	6503	TMEM255B	SO:0001627	intron_variant	0			-	HGNC	BC018995	CCDS45071.1	13q34	2012-11-30	2012-11-30	2012-11-30	ENSG00000184497	ENSG00000184497			28297	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member B"""	FAM70B		12477932	Standard	NM_182614		Approved	MGC20579	uc001vuh.3	Q8WV15	OTTHUMG00000017398	ENST00000375353.3:c.423+26T>C	13.37:g.114502418T>C		Somatic	0	32	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	24	42.86		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375353.3	37	NULL	CCDS45071.1	13																																																																																			-	-		0.547	TMEM255B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM255B	protein_coding	OTTHUMT00000045953.4	T	NM_182614	-		114502418	+1	no_errors	ENST00000488362	ensembl	human	known	74_37	rna	SNP	0.000	C
PTHLH	5744	genome.wustl.edu	37	12	28114898	28114898	+	Intron	DEL	T	T	-	rs377014358		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr12:28114898delT	ENST00000545234.1	-	5	1065				RP11-993B23.3_ENST00000538113.1_RNA|PTHLH_ENST00000539239.1_Intron|PTHLH_ENST00000538310.1_Frame_Shift_Del_p.K186fs|PTHLH_ENST00000354417.3_Frame_Shift_Del_p.K186fs|PTHLH_ENST00000395872.1_Intron			P12272	PTHR_HUMAN	parathyroid hormone-like hormone						adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP metabolic process (GO:0046058)|cell-cell signaling (GO:0007267)|endochondral ossification (GO:0001958)|endoderm development (GO:0007492)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|female pregnancy (GO:0007565)|lung alveolus development (GO:0048286)|mammary gland bud elongation (GO:0060649)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|nipple sheath formation (GO:0060659)|osteoblast development (GO:0002076)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|protein processing (GO:0016485)|regulation of gene expression (GO:0010468)|skeletal system development (GO:0001501)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	hormone activity (GO:0005179)|peptide hormone receptor binding (GO:0051428)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)|stomach(1)	10	Lung SC(9;0.184)					GTTGTTTTCCTTTTTTTTTTT	0.333																																																	0								ENSG00000087494						16.0	16.0	16.0					12																	28114898		875	1991	2866	PTHLH	SO:0001627	intron_variant	0				HGNC		CCDS8715.1, CCDS44853.1	12p12.1-p11.2	2014-01-07			ENSG00000087494	ENSG00000087494		"""Endogenous ligands"""	9607	protein-coding gene	gene with protein product	"""osteostatin"", ""parathyroid hormone-like hormone preproprotein"", ""parathyroid hormone-related protein preproprotein"""	168470				2708388	Standard	NM_002820		Approved	PTHRP, HHM, PLP, PTHR	uc001ril.3	P12272	OTTHUMG00000169221	ENST00000545234.1:c.524+1382A>-	12.37:g.28114898delT		Somatic	0	13	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	Q15251|Q6FH74	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PTH/PTH-rel,smart_PTH/PTH-rel	p.K186fs	ENST00000545234.1	37	c.557	CCDS44853.1	12																																																																																			-	NULL		0.333	PTHLH-001	KNOWN	basic|CCDS	protein_coding	PTHLH	protein_coding	OTTHUMT00000402913.1	T	NM_198965			28114898	-1	no_errors	ENST00000354417	ensembl	human	known	74_37	frame_shift_del	DEL	0.135	-
ELAC2	60528	genome.wustl.edu	37	17	12917814	12917814	+	Splice_Site	SNP	C	C	G			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr17:12917814C>G	ENST00000338034.4	-	5	672		c.e5-1		ELAC2_ENST00000609345.1_Splice_Site|ELAC2_ENST00000578071.1_Intron|ELAC2_ENST00000395962.2_Splice_Site|ELAC2_ENST00000426905.3_Splice_Site	NM_018127.6|NM_173717.1	NP_060597.4|NP_776065.1	Q9BQ52	RNZ2_HUMAN	elaC ribonuclease Z 2						mitochondrial tRNA 3'-trailer cleavage, endonucleolytic (GO:0072684)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|skin(1)	23						GGTATTTTTCCTAATGAAAAA	0.333																																																	0								ENSG00000006744						117.0	119.0	119.0					17																	12917814		2203	4300	6503	ELAC2	SO:0001630	splice_region_variant	0			-	HGNC	AF304370	CCDS11164.1, CCDS54093.1	17p11.2	2013-05-24	2013-05-24		ENSG00000006744	ENSG00000006744	3.1.26.11		14198	protein-coding gene	gene with protein product	"""tRNase Z (long form)"""	605367	"""elaC (E. coli) homolog 2"", ""elaC homolog 2 (E. coli)"""			10986046, 16636667, 21559454	Standard	NM_018127		Approved	FLJ10530, HPC2	uc010vvr.2	Q9BQ52	OTTHUMG00000058764	ENST00000338034.4:c.433-1G>C	17.37:g.12917814C>G		Somatic	0	27	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	55	32.93	B4DPL9|Q6IA94|Q9HAS8|Q9HAS9|Q9NVT1	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e5-1	ENST00000338034.4	37	c.433-1	CCDS11164.1	17	.	.	.	.	.	.	.	.	.	.	C	14.93	2.683709	0.47991	.	.	ENSG00000006744	ENST00000426905;ENST00000338034;ENST00000395962	.	.	.	4.89	1.6	0.23607	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.986	0.53147	0.4766:0.5234:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ELAC2	12858539	1.000000	0.71417	0.877000	0.34402	0.980000	0.70556	5.193000	0.65120	0.190000	0.20209	0.655000	0.94253	.	-	-		0.333	ELAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELAC2	protein_coding	OTTHUMT00000129934.5	C		-	Intron	12917814	-1	no_errors	ENST00000338034	ensembl	human	known	74_37	splice_site	SNP	1.000	G
GLIS1	148979	genome.wustl.edu	37	1	53986357	53986357	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr1:53986357G>T	ENST00000312233.2	-	6	1717	c.1151C>A	c.(1150-1152)gCt>gAt	p.A384D		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						GTCGCTGGCAGCCAGCTGTGT	0.697																																																	0								ENSG00000174332						25.0	26.0	26.0					1																	53986357		2201	4299	6500	GLIS1	SO:0001583	missense	0			-	HGNC	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.1151C>A	1.37:g.53986357G>T	ENSP00000309653:p.Ala384Asp	Somatic	0	45	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A384D	ENST00000312233.2	37	c.1151	CCDS582.1	1	.	.	.	.	.	.	.	.	.	.	G	9.548	1.115271	0.20795	.	.	ENSG00000174332	ENST00000312233	T	0.10860	2.83	4.89	2.91	0.33838	.	1.106110	0.06911	N	0.807675	T	0.08088	0.0202	N	0.24115	0.695	0.09310	N	1	B	0.17038	0.02	B	0.20577	0.03	T	0.39292	-0.9621	10	0.11794	T	0.64	.	9.1573	0.37000	0.0841:0.1489:0.767:0.0	.	384	Q8NBF1	GLIS1_HUMAN	D	384	ENSP00000309653:A384D	ENSP00000309653:A384D	A	-	2	0	GLIS1	53758945	0.766000	0.28496	0.347000	0.25668	0.877000	0.50540	2.436000	0.44819	1.144000	0.42321	0.561000	0.74099	GCT	-	NULL		0.697	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS1	protein_coding	OTTHUMT00000022109.1	G	NM_147193	-		53986357	-1	no_errors	ENST00000312233	ensembl	human	known	74_37	missense	SNP	0.019	T
SOS2	6655	genome.wustl.edu	37	14	50585356	50585356	+	Silent	SNP	C	C	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr14:50585356C>T	ENST00000216373.5	-	23	3979	c.3705G>A	c.(3703-3705)caG>caA	p.Q1235Q	VCPKMT_ENST00000395859.2_5'Flank|SOS2_ENST00000543680.1_Silent_p.Q1202Q|VCPKMT_ENST00000395860.2_5'Flank	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	1235					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					GTGGAGGTGGCTGAAGATTAA	0.522																																																	0								ENSG00000100485						131.0	126.0	128.0					14																	50585356		2203	4300	6503	SOS2	SO:0001819	synonymous_variant	0			-	HGNC	L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.3705G>A	14.37:g.50585356C>T		Somatic	0	72	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	63	38.83	B7ZKT6|D3DSB4|Q15503|Q17RN1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.Q1235	ENST00000216373.5	37	c.3705	CCDS9697.1	14																																																																																			-	NULL		0.522	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOS2	protein_coding	OTTHUMT00000276878.2	C		-		50585356	-1	no_errors	ENST00000216373	ensembl	human	known	74_37	silent	SNP	1.000	T
TRPC5	7224	genome.wustl.edu	37	X	111078203	111078203	+	Silent	SNP	T	T	G			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chrX:111078203T>G	ENST00000262839.2	-	7	2760	c.1842A>C	c.(1840-1842)gtA>gtC	p.V614V		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	614					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TCAGCAGCACTACCAGGGAGA	0.428																																																	0								ENSG00000072315						306.0	254.0	272.0					X																	111078203		2203	4300	6503	TRPC5	SO:0001819	synonymous_variant	0			-	HGNC	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1842A>C	X.37:g.111078203T>G		Somatic	0	56	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	49	47.31	B2RP53|O75233|Q5JXY8|Q9Y514	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.V614	ENST00000262839.2	37	c.1842	CCDS14561.1	X																																																																																			-	pfam_Ion_trans_dom,prints_TRPC_channel,tigrfam_TRP_channel		0.428	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	protein_coding	OTTHUMT00000057945.1	T	NM_012471	-		111078203	-1	no_errors	ENST00000262839	ensembl	human	known	74_37	silent	SNP	0.997	G
ARPC2	10109	genome.wustl.edu	37	2	219118832	219118832	+	3'UTR	DEL	A	A	-	rs376913304		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr2:219118832delA	ENST00000295685.10	+	0	1358				ARPC2_ENST00000315717.5_3'UTR|RP11-378A13.1_ENST00000562328.1_RNA	NM_005731.2	NP_005722.1	O15144	ARPC2_HUMAN	actin related protein 2/3 complex, subunit 2, 34kDa						Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	6		Renal(207;0.0474)		Epithelial(149;1.21e-06)|all cancers(144;0.000212)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0103)		CCCAAGAATTAAAAAAAAAAA	0.368																																																	0								ENSG00000163466																																			ARPC2	SO:0001624	3_prime_UTR_variant	0				HGNC	AF006085	CCDS2410.1	2q36.1	2011-07-06	2002-08-29		ENSG00000163466	ENSG00000163466		"""Actin related protein 2/3 complex subunits"""	705	protein-coding gene	gene with protein product		604224	"""actin related protein 2/3 complex, subunit 2 (34 kD)"""			9359840, 9230079	Standard	NM_005731		Approved	p34-Arc, ARC34	uc002vhd.4	O15144	OTTHUMG00000133618	ENST00000295685.10:c.*194A>-	2.37:g.219118832delA		Somatic	0	25	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	Q92801|Q9P1D4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000295685.10	37	NULL	CCDS2410.1	2																																																																																			-	-		0.368	ARPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC2	protein_coding	OTTHUMT00000256777.2	A	NM_005731			219118832	+1	no_errors	ENST00000487321	ensembl	human	putative	74_37	rna	DEL	0.933	-
ADNP2	22850	genome.wustl.edu	37	18	77895236	77895236	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr18:77895236G>A	ENST00000262198.4	+	4	2395	c.1940G>A	c.(1939-1941)gGt>gAt	p.G647D		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	647					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CTGCCGTCAGGTGCAGCTGCA	0.647																																																	0								ENSG00000101544						66.0	62.0	64.0					18																	77895236		2203	4300	6503	ADNP2	SO:0001583	missense	0			-	HGNC	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.1940G>A	18.37:g.77895236G>A	ENSP00000262198:p.Gly647Asp	Somatic	0	31	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	19	48.65	A8K951|O94943|Q9H9P3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.G647D	ENST00000262198.4	37	c.1940	CCDS32853.1	18	.	.	.	.	.	.	.	.	.	.	G	4.045	0.005982	0.07866	.	.	ENSG00000101544	ENST00000262198	.	.	.	4.86	4.86	0.63082	.	0.175502	0.38720	N	0.001596	T	0.22975	0.0555	N	0.25647	0.755	0.09310	N	0.999999	P	0.36683	0.565	B	0.33254	0.16	T	0.14392	-1.0474	8	.	.	.	-15.5636	10.7082	0.45966	0.0862:0.0:0.9138:0.0	.	647	Q6IQ32	ADNP2_HUMAN	D	647	.	.	G	+	2	0	ADNP2	75996227	0.257000	0.24022	0.033000	0.17914	0.006000	0.05464	2.386000	0.44380	2.537000	0.85549	0.650000	0.86243	GGT	-	NULL		0.647	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	protein_coding	OTTHUMT00000418979.1	G	NM_014913	-		77895236	+1	no_errors	ENST00000262198	ensembl	human	known	74_37	missense	SNP	0.121	A
FAXC	84553	genome.wustl.edu	37	6	99728897	99728905	+	3'UTR	DEL	TAAGGCTGC	TAAGGCTGC	-			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	TAAGGCTGC	TAAGGCTGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr6:99728897_99728905delTAAGGCTGC	ENST00000389677.5	-	0	1647_1655				FAXC_ENST00000538471.1_3'UTR|FAXC_ENST00000461803.1_5'UTR	NM_032511.2	NP_115900.1	Q5TGI0	FAXC_HUMAN	failed axon connections homolog (Drosophila)							integral component of membrane (GO:0016021)											AAAAAAGAAATAAGGCTGCTATAGTCCAG	0.431																																																	0								ENSG00000146267																																			FAXC	SO:0001624	3_prime_UTR_variant	0				HGNC	BC011583	CCDS34500.1	6q16.3	2012-02-07	2012-02-07	2012-02-07	ENSG00000146267	ENSG00000146267			20742	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 168"""	C6orf168		12477932	Standard	NM_032511		Approved	MGC2817, dJ273F20	uc003ppj.4	Q5TGI0	OTTHUMG00000015261	ENST00000389677.5:c.*143GCAGCCTTA>-	6.37:g.99728897_99728905delTAAGGCTGC		Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KU39|Q96F61|Q96LU3|Q9BR58|Q9BSS2	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389677.5	37	NULL	CCDS34500.1	6																																																																																			-	-		0.431	FAXC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAXC	protein_coding	OTTHUMT00000041589.4	TAAGGCTGC	NM_032511			99728905	-1	no_errors	ENST00000461803	ensembl	human	known	74_37	rna	DEL	1.000:1.000:1.000:1.000:1.000:1.000:0.997:0.997:0.919	-
RP3-470B24.5	0	genome.wustl.edu	37	6	168377135	168377135	+	lincRNA	SNP	T	T	C	rs372663828		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr6:168377135T>C	ENST00000538528.1	-	0	484																											CTGCAGTGTGTTGGGAGGAGG	0.622																																																	0								ENSG00000235994						5.0	7.0	6.0					6																	168377135		670	1551	2221	RP3-470B24.5			0			-	Clone_based_vega_gene																													6.37:g.168377135T>C		Somatic	0	46	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	59	15.49		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000538528.1	37	NULL		6																																																																																			-	-		0.622	RP3-470B24.5-201	KNOWN	basic	lincRNA	ENSG00000235994	lincRNA		T		-		168377135	-1	no_errors	ENST00000538528	ensembl	human	known	74_37	rna	SNP	0.990	C
GPR19	2842	genome.wustl.edu	37	12	12815224	12815224	+	Silent	SNP	T	T	C			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr12:12815224T>C	ENST00000540510.1	-	2	351	c.159A>G	c.(157-159)caA>caG	p.Q53Q	GPR19_ENST00000332427.2_Silent_p.Q53Q			P46093	GPR4_HUMAN	G protein-coupled receptor 19	0					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		GAAGGTCTGTTTGGTTGCTCA	0.507																																																	0								ENSG00000183150						163.0	150.0	155.0					12																	12815224		2203	4300	6503	GPR19	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.159A>G	12.37:g.12815224T>C		Somatic	0	51	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	82	7	92.13	A8K3T3|B0M0K1|Q6NWM4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.Q53	ENST00000540510.1	37	c.159	CCDS8652.1	12																																																																																			-	NULL		0.507	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR19	protein_coding	OTTHUMT00000400662.1	T	NM_006143	-		12815224	-1	no_errors	ENST00000332427	ensembl	human	known	74_37	silent	SNP	0.000	C
GLYATL2	219970	genome.wustl.edu	37	11	58660193	58660193	+	Intron	SNP	G	G	C			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr11:58660193G>C	ENST00000533636.1	-	1	60				GLYATL1P2_ENST00000529451.1_RNA			Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2							endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	AGTCAGTGAAGGTAGAGCATT	0.433																																																	0								ENSG00000254717																																			GLYATL1P2	SO:0001627	intron_variant	0			-	HGNC	AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000533636.1:c.506+11435C>G	11.37:g.58660193G>C		Somatic	0	31	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	21	43.24	A5LGC7|Q86WC3|Q96AT2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000533636.1	37	NULL		11																																																																																			-	-		0.433	GLYATL2-002	KNOWN	basic	processed_transcript	GLYATL1P2	protein_coding	OTTHUMT00000394601.1	G	NM_145016	-		58660193	+1	no_errors	ENST00000529451	ensembl	human	known	74_37	rna	SNP	0.000	C
APOA4	337	genome.wustl.edu	37	11	116691844	116691844	+	Silent	SNP	G	G	A	rs373920026		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr11:116691844G>A	ENST00000357780.3	-	3	1044	c.930C>T	c.(928-930)taC>taT	p.Y310Y		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	310	13 X 22 AA approximate tandem repeats.				cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		AGTTTTCCCCGTAGGGCTCCA	0.637																																																	0								ENSG00000110244	G		1,4401	2.1+/-5.4	0,1,2200	53.0	57.0	56.0		930	-3.6	0.0	11		56	2,8582	2.2+/-6.3	0,2,4290	no	coding-synonymous	APOA4	NM_000482.3		0,3,6490	AA,AG,GG		0.0233,0.0227,0.0231		310/397	116691844	3,12983	2201	4292	6493	APOA4	SO:0001819	synonymous_variant	0			-	HGNC		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.930C>T	11.37:g.116691844G>A		Somatic	0	28	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	22	40.54	A8MSL6|Q14CW8|Q6Q787	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_ApoA1_A4_E	p.Y310	ENST00000357780.3	37	c.930	CCDS31681.1	11																																																																																			-	pfam_ApoA1_A4_E		0.637	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA4	protein_coding	OTTHUMT00000106279.2	G	NM_000482	-		116691844	-1	no_errors	ENST00000357780	ensembl	human	known	74_37	silent	SNP	0.006	A
DMXL2	23312	genome.wustl.edu	37	15	51751092	51751097	+	Intron	DEL	AGCAGC	AGCAGC	-	rs76476368|rs111734926|rs28362472|rs578027761|rs370429483|rs555701753	byFrequency	TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	AGCAGC	AGCAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr15:51751092_51751097delAGCAGC	ENST00000251076.5	-	34	8211				RP11-707P17.2_ENST00000559173.1_RNA|RP11-707P17.2_ENST00000560727.1_RNA|DMXL2_ENST00000449909.3_Intron|RP11-707P17.1_ENST00000561007.1_RNA|RP11-707P17.2_ENST00000559977.1_RNA|DMXL2_ENST00000543779.2_Intron	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2							cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AAGAAAATGTagcagcagcagcagca	0.369																																																	0								ENSG00000259668																																			RP11-707P17.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7924-100GCTGCT>-	15.37:g.51751098_51751103delAGCAGC		Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RTR3|B7ZMH3|F5GWF1|O94938	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000251076.5	37	NULL	CCDS10141.1	15																																																																																			-	-		0.369	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	ENSG00000259668	protein_coding	OTTHUMT00000254671.2	AGCAGC	NM_015263			51751097	+1	no_errors	ENST00000559173	ensembl	human	known	74_37	rna	DEL	0.994:0.992:0.991:0.990:0.990:0.990	-
FBXO5	26271	genome.wustl.edu	37	6	153292170	153292170	+	3'UTR	DEL	A	A	-	rs57467405|rs560486828	byFrequency	TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr6:153292170delA	ENST00000229758.3	-	0	1530				FBXO5_ENST00000477822.1_5'UTR|FBXO5_ENST00000367241.3_3'UTR	NM_012177.3	NP_036309.1	Q9UKT4	FBX5_HUMAN	F-box protein 5						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibition of mitotic anaphase-promoting complex activity (GO:0060565)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|negative regulation of meiosis (GO:0045835)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|oocyte maturation (GO:0001556)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|spindle assembly involved in female meiosis I (GO:0007057)|vesicle organization (GO:0016050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	15		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		TTCTGGGGGGAAAAAAACCTC	0.249													?|AAAAAAA|AAAAAA|unsure	505	0.100839	0.0129	0.111	5008	,	,		15718	0.0724		0.2425	False		,,,				2504	0.0961				NSCLC(121;372 1757 17721 17977 29669)												0								ENSG00000112029																																			FBXO5	SO:0001624	3_prime_UTR_variant	0				HGNC	AF129535	CCDS5242.1, CCDS47501.1	6q25-q26	2008-02-05	2004-06-15		ENSG00000112029	ENSG00000112029		"""F-boxes /  ""other"""""	13584	protein-coding gene	gene with protein product		606013	"""F-box only protein 5"""			10531035, 10531037	Standard	NM_012177		Approved	FBX5, Fbxo31, EMI1	uc003qpg.3	Q9UKT4	OTTHUMG00000015854	ENST00000229758.3:c.*128T>-	6.37:g.153292170delA		Somatic	0	9	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	7	46.15	B3KNX5|Q5TF47|Q8WV29|Q9UGC8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000229758.3	37	NULL	CCDS5242.1	6																																																																																			-	-		0.249	FBXO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO5	protein_coding	OTTHUMT00000042757.1	A				153292170	-1	no_errors	ENST00000477822	ensembl	human	known	74_37	rna	DEL	0.002	-
ARAP2	116984	genome.wustl.edu	37	4	36230792	36230792	+	Missense_Mutation	SNP	A	A	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr4:36230792A>T	ENST00000303965.4	-	2	806	c.317T>A	c.(316-318)cTt>cAt	p.L106H		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	106					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						AGAATTGGAAAGTTCTATGCA	0.378																																																	0								ENSG00000047365						95.0	92.0	93.0					4																	36230792		2203	4300	6503	ARAP2	SO:0001583	missense	0			-	HGNC	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.317T>A	4.37:g.36230792A>T	ENSP00000302895:p.Leu106His	Somatic	0	44	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	25	43.18	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_SAM_2,pfam_Ras-assoc,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.L106H	ENST00000303965.4	37	c.317	CCDS3441.1	4	.	.	.	.	.	.	.	.	.	.	A	6.143	0.394510	0.11638	.	.	ENSG00000047365	ENST00000303965	T	0.63096	-0.02	5.79	0.418	0.16429	.	1.233890	0.05731	N	0.599553	T	0.45316	0.1336	N	0.24115	0.695	0.09310	N	1	B;B	0.13594	0.008;0.003	B;B	0.14023	0.01;0.003	T	0.36841	-0.9731	10	0.72032	D	0.01	.	2.678	0.05085	0.4089:0.3475:0.1315:0.112	.	36;106	A7E2A5;Q8WZ64	.;ARAP2_HUMAN	H	106	ENSP00000302895:L106H	ENSP00000302895:L106H	L	-	2	0	ARAP2	35907187	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.575000	0.05861	-0.113000	0.11958	-0.323000	0.08544	CTT	-	NULL		0.378	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP2	protein_coding	OTTHUMT00000215074.2	A	NM_015230	-		36230792	-1	no_errors	ENST00000303965	ensembl	human	known	74_37	missense	SNP	0.000	T
FZD6	8323	genome.wustl.edu	37	8	104342132	104342138	+	Frame_Shift_Del	DEL	GAGAGAG	GAGAGAG	-			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	GAGAGAG	GAGAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr8:104342132_104342138delGAGAGAG	ENST00000358755.4	+	6	2108_2114	c.1791_1797delGAGAGAG	c.(1789-1797)atgagagagfs	p.MRE597fs	FZD6_ENST00000523739.1_Frame_Shift_Del_p.MRE565fs|FZD6_ENST00000522566.1_Frame_Shift_Del_p.MRE597fs|FZD6_ENST00000540287.1_Frame_Shift_Del_p.MRE292fs	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	597					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			AAACATCAATGAGAGAGGTGAAAGCGG	0.498																																																	0								ENSG00000164930																																			FZD6	SO:0001589	frameshift_variant	0				HGNC	AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.1791_1797delGAGAGAG	8.37:g.104342132_104342138delGAGAGAG	ENSP00000351605:p.Met597fs	Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.R598fs	ENST00000358755.4	37	c.1791_1797	CCDS6298.1	8																																																																																			-	NULL		0.498	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD6	protein_coding	OTTHUMT00000380560.1	GAGAGAG	NM_003506			104342138	+1	no_errors	ENST00000358755	ensembl	human	known	74_37	frame_shift_del	DEL	0.997:1.000:0.999:0.997:0.998:0.983:0.019	-
ATRX	546	genome.wustl.edu	37	X	76875878	76875884	+	Frame_Shift_Del	DEL	TTTGAAG	TTTGAAG	-			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	TTTGAAG	TTTGAAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chrX:76875878_76875884delTTTGAAG	ENST00000373344.5	-	20	5465_5471	c.5251_5257delCTTCAAA	c.(5251-5259)cttcaaaatfs	p.LQN1751fs	ATRX_ENST00000395603.3_Frame_Shift_Del_p.LQN1713fs|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1751	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.N1753D(2)|p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATTAGGTTATTTTGAAGTGGTGTTCCT	0.319			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	3	Substitution - Missense(2)|Unknown(1)	lung(2)|bone(1)						ENSG00000085224																																			ATRX	SO:0001589	frameshift_variant	0				HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5251_5257delCTTCAAA	X.37:g.76875878_76875884delTTTGAAG	ENSP00000362441:p.Leu1751fs	Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L1751fs	ENST00000373344.5	37	c.5257_5251	CCDS14434.1	X																																																																																			-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.319	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	TTTGAAG	NM_000489			76875884	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:0.987:1.000:1.000:1.000:1.000:0.999	-
RIMS4	140730	genome.wustl.edu	37	20	43378937	43378937	+	IGR	SNP	T	T	G			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr20:43378937T>G	ENST00000372851.3	-	0	5203				KCNK15_ENST00000372861.3_Missense_Mutation_p.W151G	NM_001205317.1|NM_182970.3	NP_001192246.1|NP_892015.1	Q9H426	RIMS4_HUMAN	regulating synaptic membrane exocytosis 4						exocytosis (GO:0006887)|neurotransmitter transport (GO:0006836)|regulation of membrane potential (GO:0042391)	cell junction (GO:0030054)|presynaptic active zone (GO:0048786)|synaptic membrane (GO:0097060)				central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(5)|urinary_tract(1)	29		Myeloproliferative disorder(115;0.0122)				GGGCCTGCGGTGGACGTGCGT	0.711																																																	0								ENSG00000124249						26.0	24.0	25.0					20																	43378937		2199	4292	6491	KCNK15	SO:0001628	intergenic_variant	0			-	HGNC		CCDS13338.1, CCDS56191.1	20q13.12	2005-02-03	2003-06-18	2003-06-20	ENSG00000101098	ENSG00000101098			16183	protein-coding gene	gene with protein product		611601	"""chromosome 20 open reading frame 190"""	C20orf190		12620390	Standard	NM_182970		Approved	dJ781B1.3	uc010ggu.3	Q9H426	OTTHUMG00000032546		20.37:g.43378937T>G		Somatic	0	40	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	24	38.46	A4FU94|E1P613|Q3MI44|Q5JWT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_TASK5,prints_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl	p.W151G	ENST00000372851.3	37	c.451	CCDS13338.1	20	.	.	.	.	.	.	.	.	.	.	t	9.458	1.092335	0.20471	.	.	ENSG00000124249	ENST00000372861	D	0.97138	-4.26	4.29	2.18	0.27775	.	0.473958	0.18094	U	0.151884	D	0.89438	0.6715	N	0.08118	0	0.24431	N	0.994579	B	0.02656	0.0	B	0.01281	0.0	T	0.80815	-0.1214	10	0.26408	T	0.33	.	5.6655	0.17693	0.3825:0.5111:0.0:0.1063	.	151	Q9H427	KCNKF_HUMAN	G	151	ENSP00000361952:W151G	ENSP00000361952:W151G	W	+	1	0	KCNK15	42812351	0.042000	0.20092	1.000000	0.80357	0.608000	0.37181	0.118000	0.15605	1.014000	0.39417	-0.140000	0.14226	TGG	-	pirsf_2pore_dom_K_chnl_TASK		0.711	RIMS4-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNK15	protein_coding	OTTHUMT00000101027.2	T	NM_182970	-		43378937	+1	no_errors	ENST00000372861	ensembl	human	known	74_37	missense	SNP	0.980	G
ATRX	546	genome.wustl.edu	37	X	76875887	76875887	+	Missense_Mutation	SNP	G	G	C			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chrX:76875887G>C	ENST00000373344.5	-	20	5462	c.5248C>G	c.(5248-5250)Cca>Gca	p.P1750A	ATRX_ENST00000395603.3_Missense_Mutation_p.P1712A|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1750	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTTTGAAGTGGTGTTCCTGTT	0.323			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						87.0	74.0	79.0					X																	76875887		2201	4294	6495	ATRX	SO:0001583	missense	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5248C>G	X.37:g.76875887G>C	ENSP00000362441:p.Pro1750Ala	Somatic	0	70	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	77	18.95	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P1750A	ENST00000373344.5	37	c.5248	CCDS14434.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.188417|4.188417	0.78789|0.78789	.|.	.|.	ENSG00000085224|ENSG00000085224	ENST00000400866|ENST00000373344;ENST00000395603	.|D;D	.|0.99764	.|-6.68;-6.68	4.57|4.57	4.57|4.57	0.56435|0.56435	.|DEAD-like helicase (2);SNF2-related (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99822|0.99822	0.9921|0.9921	M|M	0.92738|0.92738	3.34|3.34	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.997;0.999	D|D	0.96614|0.96614	0.9454|0.9454	5|10	.|0.87932	.|D	.|0	-5.529|-5.529	16.6125|16.6125	0.84892|0.84892	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1712;1750	.|P46100-4;P46100	.|.;ATRX_HUMAN	Q|A	38|1750;1712	.|ENSP00000362441:P1750A;ENSP00000378967:P1712A	.|ENSP00000362441:P1750A	H|P	-|-	3|1	2|0	ATRX|ATRX	76762543|76762543	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.439000|9.439000	0.97543|0.97543	1.833000|1.833000	0.53350|0.53350	0.600000|0.600000	0.82982|0.82982	CAC|CCA	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.323	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	G	NM_000489	-		76875887	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	SNP	1.000	C
CCDC168	643677	genome.wustl.edu	37	13	103382411	103382411	+	Missense_Mutation	SNP	A	A	C			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr13:103382411A>C	ENST00000322527.2	-	1	6748	c.6749T>G	c.(6748-6750)tTg>tGg	p.L2250W		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2250	Ser-rich.																ACTATGACACAACCAGTCAGG	0.388																																																	0								ENSG00000175820						84.0	66.0	72.0					13																	103382411		692	1591	2283	CCDC168	SO:0001583	missense	0			-	HGNC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.6749T>G	13.37:g.103382411A>C	ENSP00000320232:p.Leu2250Trp	Somatic	0	27	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	14	66.67	Q8N800	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L2250W	ENST00000322527.2	37	c.6749		13	.	.	.	.	.	.	.	.	.	.	A	13.46	2.245222	0.39697	.	.	ENSG00000175820	ENST00000322527	T	0.04119	3.7	5.11	1.33	0.21861	.	0.678922	0.11379	N	0.570028	T	0.04952	0.0133	L	0.40543	1.245	0.09310	N	1	P	0.35894	0.526	B	0.37550	0.253	T	0.39418	-0.9615	10	0.48119	T	0.1	0.611	5.3483	0.16022	0.5103:0.3924:0.0972:0.0	.	2250	Q8NDH2	CC168_HUMAN	W	2250	ENSP00000320232:L2250W	ENSP00000320232:L2250W	L	-	2	0	CCDC168	102180412	0.000000	0.05858	0.002000	0.10522	0.701000	0.40568	0.255000	0.18333	0.349000	0.23975	0.460000	0.39030	TTG	-	NULL		0.388	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	protein_coding		A	NM_001146197	-		103382411	-1	no_errors	ENST00000322527	ensembl	human	known	74_37	missense	SNP	0.000	C
DPP4	1803	genome.wustl.edu	37	2	162873349	162873349	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr2:162873349G>T	ENST00000360534.3	-	18	2056	c.1496C>A	c.(1495-1497)gCt>gAt	p.A499D	DPP4_ENST00000491591.1_5'UTR	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	499					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	TTTATCCAAAGCTGAATTGTC	0.363																																																	0								ENSG00000197635						84.0	86.0	85.0					2																	162873349		2203	4300	6503	DPP4	SO:0001583	missense	0			-	HGNC	M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1496C>A	2.37:g.162873349G>T	ENSP00000353731:p.Ala499Asp	Somatic	0	29	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	21	19.23	Q53TN1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.A499D	ENST00000360534.3	37	c.1496	CCDS2216.1	2	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759042	0.31137	.	.	ENSG00000197635	ENST00000360534	D	0.95949	-3.86	5.61	2.32	0.28847	.	0.181585	0.48767	N	0.000177	D	0.87366	0.6159	N	0.10664	0.02	0.40014	D	0.975321	B	0.02656	0.0	B	0.01281	0.0	T	0.79890	-0.1612	10	0.14252	T	0.57	-23.5807	13.6302	0.62191	0.0:0.0:0.326:0.674	.	499	P27487	DPP4_HUMAN	D	499	ENSP00000353731:A499D	ENSP00000353731:A499D	A	-	2	0	DPP4	162581595	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.518000	0.45537	0.816000	0.34421	-0.188000	0.12872	GCT	-	NULL		0.363	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP4	protein_coding	OTTHUMT00000255079.2	G		-		162873349	-1	no_errors	ENST00000360534	ensembl	human	known	74_37	missense	SNP	1.000	T
SSX7	280658	genome.wustl.edu	37	X	52682511	52682511	+	Silent	SNP	G	G	A	rs372765662		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chrX:52682511G>A	ENST00000298181.5	-	2	170	c.12C>T	c.(10-12)gaC>gaT	p.D4D		NM_173358.2	NP_775494.1	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|skin(1)	16	Ovarian(276;0.236)					CAAAGGCGTCGTCTCCGTTCA	0.547													.|||	1	0.000264901	0.0	0.0	3775	,	,		14423	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000187754	G		0,3835		0,0,0,1632,571	299.0	245.0	263.0		12	-1.1	0.0	X		263	1,6727		0,0,1,2428,1871	no	coding-synonymous	SSX7	NM_173358.2		0,0,1,4060,2442	AA,AG,A,GG,G		0.0149,0.0,0.0095		4/189	52682511	1,10562	2203	4300	6503	SSX7	SO:0001819	synonymous_variant	0			-	HGNC	BK000687	CCDS14343.1	Xp11.23	2011-02-10			ENSG00000187754	ENSG00000187754			19653	protein-coding gene	gene with protein product		300542				12216073	Standard	NM_173358		Approved		uc004dqx.1	Q7RTT5	OTTHUMG00000021572	ENST00000298181.5:c.12C>T	X.37:g.52682511G>A		Somatic	0	261	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	144	328	30.44		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.D4	ENST00000298181.5	37	c.12	CCDS14343.1	X																																																																																			-	NULL		0.547	SSX7-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	SSX7	protein_coding	OTTHUMT00000056671.1	G	NM_173358	-		52682511	-1	no_errors	ENST00000298181	ensembl	human	known	74_37	silent	SNP	0.001	A
ARMCX6	54470	genome.wustl.edu	37	X	100871412	100871412	+	Missense_Mutation	SNP	G	G	A	rs138992392		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chrX:100871412G>A	ENST00000361910.4	-	3	543	c.199C>T	c.(199-201)Cgg>Tgg	p.R67W	ARMCX6_ENST00000538627.1_Missense_Mutation_p.R67W|ARMCX6_ENST00000539247.1_Missense_Mutation_p.R67W|ARMCX6_ENST00000497931.1_Intron	NM_019007.3	NP_061880.2	Q7L4S7	ARMX6_HUMAN	armadillo repeat containing, X-linked 6	67						integral component of membrane (GO:0016021)				endometrium(3)|kidney(1)|liver(2)|lung(3)	9						GTCCAGGGCCGAGCCATAGTT	0.592																																																	0								ENSG00000198960		TRP/ARG,TRP/ARG,TRP/ARG	1,3834		0,1,1631,571	76.0	70.0	72.0		199,199,199	2.8	1.0	X	dbSNP_134	72	0,6728		0,0,2428,1872	no	missense,missense,missense	ARMCX6	NM_001009584.1,NM_001184768.1,NM_019007.3	101,101,101	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	benign,benign,benign	67/301,67/301,67/301	100871412	1,10562	2203	4300	6503	ARMCX6	SO:0001583	missense	0			-	HGNC	BC007677	CCDS14488.1	Xq21.33-q22.3	2014-03-21			ENSG00000198960	ENSG00000198960		"""Armadillo repeat containing"""	26094	protein-coding gene	gene with protein product						16221301, 22569362	Standard	NM_001184768		Approved	FLJ20811, GASP10	uc004ehy.3	Q7L4S7	OTTHUMG00000022034	ENST00000361910.4:c.199C>T	X.37:g.100871412G>A	ENSP00000354708:p.Arg67Trp	Somatic	0	82	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	38	56.82	Q9NWJ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ARM-rpt_dom	p.R67W	ENST00000361910.4	37	c.199	CCDS14488.1	X	.	.	.	.	.	.	.	.	.	.	.	5.320	0.244434	0.10077	2.61E-4	0.0	ENSG00000198960	ENST00000361910;ENST00000539247;ENST00000538627	T;T;T	0.48522	0.81;0.81;0.81	3.71	2.83	0.33086	.	0.000000	0.38111	N	0.001802	T	0.46249	0.1383	L	0.36672	1.1	0.29673	N	0.842289	D	0.76494	0.999	P	0.54815	0.761	T	0.44329	-0.9335	10	0.62326	D	0.03	-3.0956	7.6178	0.28169	0.0:0.0:0.7475:0.2525	.	67	Q7L4S7	ARMX6_HUMAN	W	67	ENSP00000354708:R67W;ENSP00000444537:R67W;ENSP00000440648:R67W	ENSP00000354708:R67W	R	-	1	2	ARMCX6	100758068	0.945000	0.32115	0.986000	0.45419	0.047000	0.14425	0.597000	0.24059	0.925000	0.37094	-0.497000	0.04613	CGG	-	NULL		0.592	ARMCX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX6	protein_coding	OTTHUMT00000057562.1	G	NM_019007	rs138992392		100871412	-1	no_errors	ENST00000361910	ensembl	human	known	74_37	missense	SNP	0.979	A
VSTM2B	342865	genome.wustl.edu	37	19	30019367	30019367	+	Missense_Mutation	SNP	A	A	T			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr19:30019367A>T	ENST00000335523.7	+	3	380	c.295A>T	c.(295-297)Agc>Tgc	p.S99C	CTC-525D6.2_ENST00000579268.1_RNA|CTC-525D6.1_ENST00000582581.1_RNA	NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	99	Ig-like V-type.					integral component of membrane (GO:0016021)				breast(2)	2						AACTAAAATCAGCGTAAGTGT	0.617											OREG0025392	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000187135						80.0	80.0	80.0					19																	30019367		692	1591	2283	VSTM2B	SO:0001583	missense	0			-	HGNC		CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.295A>T	19.37:g.30019367A>T	ENSP00000335038:p.Ser99Cys	Somatic	0	40	0.00	814	0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	29	46.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.S99C	ENST00000335523.7	37	c.295	CCDS46034.1	19	.	.	.	.	.	.	.	.	.	.	A	19.49	3.837552	0.71373	.	.	ENSG00000187135	ENST00000335523	T	0.31510	1.49	4.71	4.71	0.59529	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.844752	0.10228	N	0.700099	T	0.58666	0.2138	M	0.78456	2.415	0.53005	D	0.999961	D	0.89917	1.0	D	0.87578	0.998	T	0.55927	-0.8063	10	0.87932	D	0	-11.1103	13.3672	0.60692	1.0:0.0:0.0:0.0	.	99	A6NLU5	VTM2B_HUMAN	C	99	ENSP00000335038:S99C	ENSP00000335038:S99C	S	+	1	0	VSTM2B	34711207	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.079000	0.76829	1.920000	0.55613	0.444000	0.29173	AGC	-	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom		0.617	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSTM2B	protein_coding	OTTHUMT00000458601.1	A	NM_001146339	-		30019367	+1	no_errors	ENST00000335523	ensembl	human	known	74_37	missense	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76875886	76875886	+	Missense_Mutation	SNP	G	G	C			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chrX:76875886G>C	ENST00000373344.5	-	20	5463	c.5249C>G	c.(5248-5250)cCa>cGa	p.P1750R	ATRX_ENST00000395603.3_Missense_Mutation_p.P1712R|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1750	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATTTTGAAGTGGTGTTCCTGT	0.323			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						87.0	74.0	78.0					X																	76875886		2201	4294	6495	ATRX	SO:0001583	missense	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5249C>G	X.37:g.76875886G>C	ENSP00000362441:p.Pro1750Arg	Somatic	0	70	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	77	18.95	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P1750R	ENST00000373344.5	37	c.5249	CCDS14434.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.086146|4.086146	0.76642|0.76642	.|.	.|.	ENSG00000085224|ENSG00000085224	ENST00000400866|ENST00000373344;ENST00000395603	.|D;D	.|0.99766	.|-6.69;-6.69	4.57|4.57	4.57|4.57	0.56435|0.56435	.|DEAD-like helicase (2);SNF2-related (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.99896|0.99896	0.9950|0.9950	H|H	0.99368|0.99368	4.535|4.535	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|0.999;1.0	D|D	0.95864|0.95864	0.8885|0.8885	5|10	.|0.87932	.|D	.|0	-5.529|-5.529	16.6125|16.6125	0.84892|0.84892	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1712;1750	.|P46100-4;P46100	.|.;ATRX_HUMAN	D|R	39|1750;1712	.|ENSP00000362441:P1750R;ENSP00000378967:P1712R	.|ENSP00000362441:P1750R	H|P	-|-	1|2	0|0	ATRX|ATRX	76762542|76762542	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.439000|9.439000	0.97543|0.97543	1.833000|1.833000	0.53350|0.53350	0.600000|0.600000	0.82982|0.82982	CAC|CCA	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.323	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	G	NM_000489	-		76875886	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	SNP	1.000	C
RNFT2	84900	genome.wustl.edu	37	12	117290182	117290183	+	3'UTR	INS	-	-	TTCCCC	rs140709252|rs71099009|rs201262887	byFrequency	TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr12:117290182_117290183insTTCCCC	ENST00000392549.2	+	0	1644_1645				RNFT2_ENST00000319176.7_3'UTR|RNFT2_ENST00000551251.1_3'UTR|RNFT2_ENST00000407967.3_Intron	NM_001109903.1	NP_001103373.1	Q96EX2	RNFT2_HUMAN	ring finger protein, transmembrane 2							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	6	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.034)		AAACCAGGACTTTCCCCTTGGC	0.564														2254	0.45008	0.0386	0.7738	5008	,	,		20897	0.4732		0.7296	False		,,,				2504	0.4652																0								ENSG00000135119																																			RNFT2	SO:0001624	3_prime_UTR_variant	0				HGNC	AK027533	CCDS9180.2, CCDS44987.1	12q24.22	2013-01-09	2008-02-26	2008-02-26	ENSG00000135119	ENSG00000135119		"""RING-type (C3HC4) zinc fingers"""	25905	protein-coding gene	gene with protein product			"""transmembrane protein 118"""	TMEM118		12477932	Standard	NM_032814		Approved	FLJ14627	uc009zwn.3	Q96EX2	OTTHUMG00000150882	ENST00000392549.2:c.*77->TTCCCC	12.37:g.117290183_117290188dupTTCCCC		Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PAM7|Q96SU5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392549.2	37	NULL	CCDS44987.1	12																																																																																			-	-		0.564	RNFT2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RNFT2	protein_coding		-	NM_032814			117290183	+1	no_errors	ENST00000551251	ensembl	human	known	74_37	rna	INS	0.014:0.009	TTCCCC
DLGAP1	9229	genome.wustl.edu	37	18	3879965	3879965	+	Missense_Mutation	SNP	C	C	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr18:3879965C>A	ENST00000315677.3	-	4	699	c.104G>T	c.(103-105)aGc>aTc	p.S35I	DLGAP1_ENST00000581527.1_Missense_Mutation_p.S35I|DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000584874.1_Missense_Mutation_p.S35I|DLGAP1_ENST00000515196.2_Missense_Mutation_p.S35I	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	35					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				CTCCACTGGGCTCAGCAGGTA	0.667																																																	0								ENSG00000170579						56.0	53.0	54.0					18																	3879965		2203	4300	6503	DLGAP1	SO:0001583	missense	0			-	HGNC	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.104G>T	18.37:g.3879965C>A	ENSP00000316377:p.Ser35Ile	Somatic	0	141	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	96	126	43.24	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GKAP	p.S35I	ENST00000315677.3	37	c.104	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	C	18.66	3.671364	0.67814	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.17370	2.29;2.28	5.8	4.93	0.64822	.	0.097027	0.85682	D	0.000000	T	0.28333	0.0700	M	0.63843	1.955	0.41256	D	0.986742	P;P;P	0.50617	0.771;0.937;0.905	B;P;P	0.56398	0.424;0.735;0.797	T	0.02797	-1.1109	10	0.87932	D	0	-27.2092	5.5561	0.17117	0.0:0.7387:0.0:0.2613	.	35;35;35	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	I	35	ENSP00000316377:S35I;ENSP00000445973:S35I	ENSP00000316377:S35I	S	-	2	0	DLGAP1	3869965	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.748000	0.55142	2.744000	0.94065	0.655000	0.94253	AGC	-	NULL		0.667	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	protein_coding	OTTHUMT00000254394.4	C		-		3879965	-1	no_errors	ENST00000315677	ensembl	human	known	74_37	missense	SNP	1.000	A
PADI1	29943	genome.wustl.edu	37	1	17567209	17567209	+	Missense_Mutation	SNP	T	T	A	rs541735647		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr1:17567209T>A	ENST00000375471.4	+	15	1804	c.1712T>A	c.(1711-1713)cTc>cAc	p.L571H	PADI1_ENST00000537499.1_Missense_Mutation_p.L128H|PADI1_ENST00000413717.2_Intron|PADI1_ENST00000536552.1_Missense_Mutation_p.L42H|PADI1_ENST00000460293.1_3'UTR	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	571					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	ATTCCCCAGCTCTTCTTCCTG	0.577																																					Esophageal Squamous(80;414 1257 4580 27746 50832)												0								ENSG00000142623						121.0	116.0	118.0					1																	17567209		2203	4300	6503	PADI1	SO:0001583	missense	0			-	HGNC	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.1712T>A	1.37:g.17567209T>A	ENSP00000364620:p.Leu571His	Somatic	0	56	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	55	29.49	A1L4K6|Q70SX6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.L571H	ENST00000375471.4	37	c.1712	CCDS178.1	1	.	.	.	.	.	.	.	.	.	.	T	14.37	2.515899	0.44763	.	.	ENSG00000142623	ENST00000375471;ENST00000537499;ENST00000536552	T;T;T	0.38887	1.11;1.11;1.11	3.74	3.74	0.42951	Protein-arginine deiminase, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.68924	0.3054	M	0.91717	3.235	0.44694	D	0.997683	D	0.89917	1.0	D	0.97110	1.0	T	0.76027	-0.3109	10	0.87932	D	0	-32.3189	11.427	0.50015	0.0:0.0:0.0:1.0	.	571	Q9ULC6	PADI1_HUMAN	H	571;128;42	ENSP00000364620:L571H;ENSP00000444032:L128H;ENSP00000444833:L42H	ENSP00000364620:L571H	L	+	2	0	PADI1	17439796	1.000000	0.71417	0.990000	0.47175	0.020000	0.10135	7.405000	0.80007	1.582000	0.49881	0.454000	0.30748	CTC	-	pfam_PAD_C,pirsf_Protein-arginine_deiminase_sub		0.577	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI1	protein_coding	OTTHUMT00000006621.1	T	NM_013358	-		17567209	+1	no_errors	ENST00000375471	ensembl	human	known	74_37	missense	SNP	1.000	A
IFNL2	282616	genome.wustl.edu	37	19	39760617	39760617	+	Missense_Mutation	SNP	C	C	A			TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chr19:39760617C>A	ENST00000331982.5	+	6	622	c.567C>A	c.(565-567)gaC>gaA	p.D189E		NM_172138.1	NP_742150.1	Q8IZJ0	IFNL2_HUMAN	interferon, lambda 2	189					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|mucosal immune response (GO:0002385)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											TCACGCGAGACCTGAATTGTG	0.537																																																	0								ENSG00000183709						48.0	47.0	47.0					19																	39760617		2203	4300	6503	IFNL2	SO:0001583	missense	0			-	HGNC	AY129148	CCDS42567.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000183709	ENSG00000183709		"""Interferons"""	18364	protein-coding gene	gene with protein product		607401	"""interleukin 28A"", ""interleukin 28A (interferon, lambda 2)"""	IL28A			Standard	NM_172138		Approved	IL-28A	uc002oku.1	Q8IZJ0		ENST00000331982.5:c.567C>A	19.37:g.39760617C>A	ENSP00000333639:p.Asp189Glu	Somatic	0	64	0.00		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	63	33.68	Q45KQ8|Q6VN55|Q8IWL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D189E	ENST00000331982.5	37	c.567	CCDS42567.1	19	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824931	0.50739	.	.	ENSG00000183709	ENST00000331982	T	0.52295	0.67	3.27	1.03	0.20045	.	0.000000	0.64402	D	0.000003	T	0.62575	0.2439	M	0.83953	2.67	0.20074	N	0.999936	D	0.89917	1.0	D	0.79108	0.992	T	0.50294	-0.8845	10	0.87932	D	0	-9.0758	3.9503	0.09366	0.0:0.6037:0.2539:0.1424	.	189	Q8IZJ0	IL28A_HUMAN	E	189	ENSP00000333639:D189E	ENSP00000333639:D189E	D	+	3	2	IL28A	44452457	0.945000	0.32115	0.797000	0.32132	0.032000	0.12392	0.324000	0.19610	0.686000	0.31488	0.454000	0.30748	GAC	-	NULL		0.537	IFNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNL2	protein_coding	OTTHUMT00000463833.1	C	NM_172138	-		39760617	+1	no_errors	ENST00000331982	ensembl	human	known	74_37	missense	SNP	0.397	A
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-HB-A3L4-01A-11D-A21Q-09	TCGA-HB-A3L4-10A-01D-A21Q-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	23976ad7-4b4a-48ec-b407-36fd75119645	6bdcbf01-b44e-4688-8d32-1892a63a3d28	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.711929838615836	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
