#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LOC101927209	101927209	genome.wustl.edu	37	1	142621471	142621471	+	lincRNA	SNP	G	G	C	rs4847830		TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr1:142621471G>C	ENST00000610091.1	-	0	6364				RP11-417J8.3_ENST00000426408.1_lincRNA																							CAGTGGAAACGGTCATCTTCC	0.468																																																	0								ENSG00000230880																																			RP11-417J8.3			0			-	Clone_based_vega_gene																													1.37:g.142621471G>C		Somatic	0	17	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53		RNA	SNP	98	27.41	37	128	27.12	48	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			-	-		0.468	RP11-417J8.6-001	KNOWN	basic	lincRNA	LOC101927209	lincRNA	OTTHUMT00000037265.2	G		rs4847830		142621471	+1	no_errors	ENST00000412092	ensembl	human	known	74_37	rna	SNP	0.021	C
RP11-255H23.4	0	genome.wustl.edu	37	19	24014700	24014700	+	lincRNA	SNP	T	T	A			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr19:24014700T>A	ENST00000599944.1	-	0	150				RP11-255H23.2_ENST00000471224.1_RNA																							ATGTCAAAAATGTGTCAAATC	0.264																																																	0								ENSG00000233836																																			RP11-255H23.2			0			-	Clone_based_vega_gene																													19.37:g.24014700T>A		Somatic	0	24	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	7	56.25		RNA	SNP	47	0.00	0	39	37.10	23	-	NULL	ENST00000599944.1	37	NULL		19																																																																																			-	-		0.264	RP11-255H23.4-001	KNOWN	basic	lincRNA	ENSG00000233836	lincRNA	OTTHUMT00000466442.1	T		-		24014700	+1	no_errors	ENST00000471224	ensembl	human	known	74_37	rna	SNP	0.812	A
GOLGA2P5	55592	genome.wustl.edu	37	12	100555585	100555586	+	RNA	INS	-	-	GGTACC	rs80066811	byFrequency	TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr12:100555585_100555586insGGTACC	ENST00000397112.4	-	0	660_661					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						ccttcatttctaggttgggtcc	0.53														1258	0.251198	0.6241	0.1282	5008	,	,		19146	0.0605		0.1193	False		,,,				2504	0.1667																0								ENSG00000238105																																			GOLGA2B			0				Clone_based_vega_gene																													12.37:g.100555585_100555586insGGTACC		Somatic	NA	NA	NA		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q9NSV2	RNA	INS	15	44.44	12	9	59.09	13	-	NULL	ENST00000397112.4	37	NULL		12																																																																																			-	-		0.530	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	pseudogene	OTTHUMT00000396439.2	-				100555586	-1	no_errors	ENST00000397112	ensembl	human	known	74_37	rna	INS	0.044:0.066	GGTACC
HRNR	388697	genome.wustl.edu	37	1	152191612	152191612	+	Silent	SNP	A	A	G			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr1:152191612A>G	ENST00000368801.2	-	3	2568	c.2493T>C	c.(2491-2493)caT>caC	p.H831H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	831					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGGCAGAACCATGCTGACTAT	0.537																																																	0								ENSG00000197915						120.0	120.0	120.0					1																	152191612		2203	4300	6503	HRNR	SO:0001819	synonymous_variant	0			-	HGNC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2493T>C	1.37:g.152191612A>G		Somatic	0	85	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	57	31.33	Q5DT20|Q5U1F4	Silent	SNP	38	0.00	0	27	37.21	16	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.H831	ENST00000368801.2	37	c.2493	CCDS30859.1	1																																																																																			-	NULL		0.537	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	protein_coding	OTTHUMT00000034016.1	A	XM_373868	-		152191612	-1	no_errors	ENST00000368801	ensembl	human	known	74_37	silent	SNP	0.002	G
RUSC2	9853	genome.wustl.edu	37	9	35560483	35560483	+	Silent	SNP	C	C	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr9:35560483C>T	ENST00000455600.1	+	10	4415	c.3846C>T	c.(3844-3846)atC>atT	p.I1282I	FAM166B_ENST00000492890.1_5'Flank	NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1282						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)	p.I1282I(1)		NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			AGGTCTACATCGATGGCTCCA	0.657																																																	1	Substitution - coding silent(1)	large_intestine(1)						ENSG00000198853						50.0	59.0	56.0					9																	35560483		2203	4299	6502	RUSC2	SO:0001819	synonymous_variant	0			-	HGNC	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.3846C>T	9.37:g.35560483C>T		Somatic	0	44	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	29	43.14	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Silent	SNP	22	0.00	0	29	25.64	10	pfam_Run,pfam_SH3_2,superfamily_SH3_domain,smart_Run,smart_SH3_domain,pfscan_Run,pfscan_SH3_domain	p.I1282	ENST00000455600.1	37	c.3846	CCDS35008.1	9																																																																																			-	NULL		0.657	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RUSC2	protein_coding	OTTHUMT00000052309.1	C	XM_048462	-		35560483	+1	no_errors	ENST00000361226	ensembl	human	known	74_37	silent	SNP	0.938	T
NXF4	55999	genome.wustl.edu	37	X	101821949	101821949	+	RNA	SNP	C	C	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chrX:101821949C>T	ENST00000360035.2	+	0	1702					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						TGCATCCAAACGGTGAGCACC	0.498																																																	0								ENSG00000196970																																			NXF4			0			-	HGNC	AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101821949C>T		Somatic	0	80	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	49	45.56		RNA	SNP	20	0.00	0	21	44.74	17	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			-	-		0.498	NXF4-001	KNOWN	basic	processed_transcript	NXF4	pseudogene	OTTHUMT00000095720.1	C		-		101821949	+1	no_errors	ENST00000360035	ensembl	human	known	74_37	rna	SNP	0.061	T
ERICH6B	220081	genome.wustl.edu	37	13	46170720	46170737	+	In_Frame_Del	DEL	CCAGATACTCTTCCTCCT	CCAGATACTCTTCCTCCT	-	rs373081063|rs117004691|rs28548352|rs142875900|rs28460344|rs45625342|rs375947127	byFrequency	TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	CCAGATACTCTTCCTCCT	CCAGATACTCTTCCTCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr13:46170720_46170737delCCAGATACTCTTCCTCCT	ENST00000298738.2	-	3	568_585	c.404_421delAGGAGGAAGAGTATCTGG	c.(403-423)gaggaggaagagtatctgggg>ggg	p.EEEEYL135del		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		135	Glu-rich.									breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						CCTTCCTTCCCCAGATActcttcctcctccagatgctc	0.486														1379	0.275359	0.1362	0.4308	5008	,	,		23489	0.1607		0.493	False		,,,				2504	0.2474																0								ENSG00000165837			414,2088		68,278,905						-4.5	0.0		dbSNP_134	119	2412,2596		704,1004,796	no	coding	FAM194B	NM_182542.2		772,1282,1701	A1A1,A1R,RR		48.1629,16.5468,37.6298				2826,4684				FAM194B	SO:0001651	inframe_deletion	0				HGNC																												ENST00000298738.2:c.404_421delAGGAGGAAGAGTATCTGG	13.37:g.46170720_46170737delCCAGATACTCTTCCTCCT	ENSP00000298738:p.Glu135_Leu140del	Somatic	NA	NA	NA		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q96MB5	In_Frame_Del	DEL	28	0.00	0	26	0.00	0	NULL	p.EEEEYL135in_frame_del	ENST00000298738.2	37	c.421_404	CCDS45045.1	13																																																																																			-	NULL		0.486	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194B	protein_coding	OTTHUMT00000044781.3	CCAGATACTCTTCCTCCT				46170737	-1	no_errors	ENST00000298738	ensembl	human	known	74_37	in_frame_del	DEL	0.119:0.974:0.981:0.958:0.691:0.046:0.004:0.002:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
KDM5C	8242	genome.wustl.edu	37	X	53239969	53239969	+	Missense_Mutation	SNP	T	T	C			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chrX:53239969T>C	ENST00000375401.3	-	11	2004	c.1472A>G	c.(1471-1473)aAt>aGt	p.N491S	KDM5C_ENST00000404049.3_Missense_Mutation_p.N490S|KDM5C_ENST00000465402.1_5'Flank|KDM5C_ENST00000452825.3_Missense_Mutation_p.N424S|KDM5C-IT1_ENST00000412242.1_RNA|KDM5C_ENST00000375383.3_Missense_Mutation_p.N450S|KDM5C_ENST00000375379.3_Missense_Mutation_p.N491S	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	491	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						GATATCTGCATTGATGTGGCA	0.488			"""N, F, S"""		clear cell renal carcinoma																																			Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0								ENSG00000126012						173.0	118.0	137.0					X																	53239969		2203	4300	6503	KDM5C	SO:0001583	missense	0			-	HGNC	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.1472A>G	X.37:g.53239969T>C	ENSP00000364550:p.Asn491Ser	Somatic	0	45	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	18	45.45	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	30	0.00	0	39	32.76	19	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.N491S	ENST00000375401.3	37	c.1472	CCDS14351.1	X	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701105	0.68501	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D;D	0.86164	-2.08;-1.78;-1.78;-1.78;-1.92	5.42	5.42	0.78866	Transcription factor jumonji/aspartyl beta-hydroxylase (2);	0.000000	0.85682	D	0.000000	D	0.86990	0.6066	L	0.49640	1.575	0.53005	D	0.999967	P;P;P	0.45283	0.712;0.855;0.855	B;P;P	0.48334	0.395;0.574;0.574	D	0.87553	0.2466	10	0.59425	D	0.04	-19.0654	12.2755	0.54733	0.0:0.0:0.0:1.0	.	424;490;491	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	S	424;491;490;491;450	ENSP00000445176:N424S;ENSP00000364550:N491S;ENSP00000385394:N490S;ENSP00000364528:N491S;ENSP00000364532:N450S	ENSP00000364528:N491S	N	-	2	0	KDM5C	53256694	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.133000	0.64764	1.803000	0.52742	0.486000	0.48141	AAT	-	smart_JmjC_dom,pfscan_JmjC_dom		0.488	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	protein_coding	OTTHUMT00000056737.2	T	NM_004187	-		53239969	-1	no_errors	ENST00000375401	ensembl	human	known	74_37	missense	SNP	1.000	C
KLHL11	55175	genome.wustl.edu	37	17	40011164	40011164	+	Missense_Mutation	SNP	C	C	G			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr17:40011164C>G	ENST00000319121.3	-	2	1015	c.955G>C	c.(955-957)Gtc>Ctc	p.V319L		NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	319										NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				ACCAACTTGACACAAACTTCA	0.463																																																	0								ENSG00000178502						84.0	81.0	82.0					17																	40011164		2203	4300	6503	KLHL11	SO:0001583	missense	0			-	HGNC		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.955G>C	17.37:g.40011164C>G	ENSP00000314608:p.Val319Leu	Somatic	0	29	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58		Missense_Mutation	SNP	28	0.00	0	39	40.00	26	pfam_BACK,pfam_BTB_POZ,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.V319L	ENST00000319121.3	37	c.955	CCDS11411.1	17	.	.	.	.	.	.	.	.	.	.	C	11.18	1.562479	0.27915	.	.	ENSG00000178502	ENST00000319121;ENST00000540254	T	0.70045	-0.45	5.72	5.72	0.89469	.	0.134395	0.51477	D	0.000087	T	0.44993	0.1320	N	0.03608	-0.345	0.42605	D	0.993292	B	0.02656	0.0	B	0.01281	0.0	T	0.40905	-0.9538	10	0.42905	T	0.14	-13.5677	14.7139	0.69254	0.0:0.7354:0.2646:0.0	.	319	Q9NVR0	KLH11_HUMAN	L	319;182	ENSP00000314608:V319L	ENSP00000314608:V319L	V	-	1	0	KLHL11	37264690	1.000000	0.71417	0.997000	0.53966	0.932000	0.56968	5.252000	0.65445	2.687000	0.91594	0.591000	0.81541	GTC	-	NULL		0.463	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL11	protein_coding	OTTHUMT00000257464.2	C	NM_018143	-		40011164	-1	no_errors	ENST00000319121	ensembl	human	known	74_37	missense	SNP	0.997	G
SNORA11	677799	genome.wustl.edu	37	14	70270922	70270922	+	RNA	DEL	T	T	-	rs566317626		TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr14:70270922delT	ENST00000408133.1	-	0	126									small nucleolar RNA, H/ACA box 11																		ATGGATTCTCTTTTTTTTTTT	0.353																																																	0								ENSG00000221060																																			SNORA11			0				RFAM	AM055729		Xp11.21	2013-09-05			ENSG00000221716	ENSG00000221716		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32599	non-coding RNA	RNA, small nucleolar	"""small nucleolar RNA, H/ACA box 11A"""	300662				16361266, 16381836	Standard	NR_002953		Approved	U107, SNORA11A	uc021ptl.1				14.37:g.70270922delT		Somatic	0	12	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	15	28.57		RNA	DEL	29	0.00	0	61	0.00	0	-	NULL	ENST00000408133.1	37	NULL		14																																																																																			-	-		0.353	SNORA11.1-201	NOVEL	basic	snoRNA	ENSG00000221060	snoRNA		T	NR_002953			70270922	-1	no_errors	ENST00000408133	ensembl	human	novel	74_37	rna	DEL	0.003	-
NRXN1	9378	genome.wustl.edu	37	2	50147836	50147853	+	3'UTR	DEL	GTGTGTGTGTGTGTGTGT	GTGTGTGTGTGTGTGTGT	-	rs200264093|rs201814381|rs199597709|rs199689866|rs368179294|rs201801805|rs200666696|rs200969250|rs66612444		TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	GTGTGTGTGTGTGTGTGT	GTGTGTGTGTGTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr2:50147836_50147853delGTGTGTGTGTGTGTGTGT	ENST00000406316.2	-	0	7139_7156				NRXN1_ENST00000404971.1_3'UTR|NRXN1_ENST00000401710.1_3'UTR|NRXN1_ENST00000342183.5_3'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTGTGGATTCgtgtgtgtgtgtgtgtgtgtgtgtgtgt	0.385																																																	0								ENSG00000179915																																			NRXN1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.*1246ACACACACACACACACAC>-	2.37:g.50147836_50147853delGTGTGTGTGTGTGTGTGT		Somatic	NA	NA	NA		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	17	26.09	6	18	28.00	7	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.385	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	protein_coding	OTTHUMT00000325291.2	GTGTGTGTGTGTGTGTGT				50147853	-1	no_errors	ENST00000484192	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.005:0.106:0.113:0.127:0.107:0.109:0.093:0.096:0.025:0.055:0.070:0.324:0.354:0.283:0.295:0.258	-
CFAP36	112942	genome.wustl.edu	37	2	55761026	55761026	+	Silent	SNP	T	T	C			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr2:55761026T>C	ENST00000349456.4	+	5	563	c.415T>C	c.(415-417)Tta>Cta	p.L139L	CCDC104_ENST00000403007.3_Silent_p.L139L|CCDC104_ENST00000406691.3_Silent_p.L139L|CCDC104_ENST00000490934.1_3'UTR|CCDC104_ENST00000407816.3_Silent_p.L139L|CCDC104_ENST00000339012.3_Silent_p.L164L			Q96G28	CFA36_HUMAN		139										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			ACCTGACTGCTTAACCGATGG	0.363																																																	0								ENSG00000163001						132.0	127.0	129.0					2																	55761026		2203	4300	6503	CCDC104	SO:0001819	synonymous_variant	0			-	HGNC																												ENST00000349456.4:c.415T>C	2.37:g.55761026T>C		Somatic	0	68	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q53SF0|Q53ST9|Q6UY34	Silent	SNP	34	2.86	1	27	0.00	0	pfam_ARF-like_2-bdp_dom	p.L164	ENST00000349456.4	37	c.490	CCDS1854.2	2																																																																																			-	NULL		0.363	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC104	protein_coding	OTTHUMT00000319610.2	T		-		55761026	+1	no_errors	ENST00000339012	ensembl	human	known	74_37	silent	SNP	1.000	C
SMARCB1	6598	genome.wustl.edu	37	22	24176678	24176700	+	3'UTR	DEL	CAACAGGTCATGTTCAATTTCTT	CAACAGGTCATGTTCAATTTCTT	-	rs5030614	byFrequency	TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	CAACAGGTCATGTTCAATTTCTT	CAACAGGTCATGTTCAATTTCTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr22:24176678_24176700delCAACAGGTCATGTTCAATTTCTT	ENST00000263121.7	+	0	1665_1687				SMARCB1_ENST00000407422.3_3'UTR|DERL3_ENST00000404056.1_3'UTR|SMARCB1_ENST00000344921.6_3'UTR|DERL3_ENST00000464023.1_5'UTR|DERL3_ENST00000406855.3_3'UTR	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1						ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)			bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				AAATAAAAGGCAACAGGTCATGTTCAATTTCTTCAACAGGTCA	0.435			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid								649	0.129593	0.1838	0.1282	5008	,	,		17370	0.0506		0.1471	False		,,,				2504	0.1207						yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	0								ENSG00000099958																																			DERL3	SO:0001624	3_prime_UTR_variant	0				HGNC	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.*333CAACAGGTCATGTTCAATTTCTT>-	22.37:g.24176678_24176700delCAACAGGTCATGTTCAATTTCTT		Somatic	NA	NA	NA		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	RNA	DEL	34	0.00	0	47	0.00	0	-	NULL	ENST00000263121.7	37	NULL	CCDS13817.1	22																																																																																			-	-		0.435	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DERL3	protein_coding	OTTHUMT00000319872.1	CAACAGGTCATGTTCAATTTCTT	NM_003073			24176700	-1	no_errors	ENST00000464023	ensembl	human	known	74_37	rna	DEL	0.881:0.744:0.541:0.169:0.191:0.247:0.273:0.214:0.004:0.003:0.003:0.004:0.017:0.025:0.031:0.034:0.036:0.045:0.051:0.010:0.016:0.016:0.010	-
POTEM	641455	genome.wustl.edu	37	14	20010484	20010484	+	Intron	SNP	A	A	G	rs201730464		TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr14:20010484A>G	ENST00000551509.1	-	5	969				RNU6-1268P_ENST00000391214.1_RNA|RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						CTACTAATTTAAAGTCCTTTG	0.353																																																	0								ENSG00000258276																																			RP11-244H18.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.918-244T>C	14.37:g.20010484A>G		Somatic	0	19	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81		RNA	SNP	32	20.00	8	55	21.43	15	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			-	-		0.353	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LOC100508046	protein_coding	OTTHUMT00000409490.3	A	NM_001145442	rs201730464		20010484	+1	no_errors	ENST00000547584	ensembl	human	known	74_37	rna	SNP	0.325	G
PHYHIP	9796	genome.wustl.edu	37	8	22079106	22079106	+	Silent	SNP	G	G	A	rs112627300		TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr8:22079106G>A	ENST00000321613.3	-	6	1209	c.753C>T	c.(751-753)cgC>cgT	p.R251R	PHYHIP_ENST00000454243.2_Silent_p.R251R	NM_001099335.1	NP_001092805.1	Q92561	PHYIP_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein	251										endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	10				Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0629)		GCAGGCGGTCGCGGCAGAAGC	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		16427	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000168490	G	,	1,4211		0,1,2105	29.0	41.0	37.0		753,753	-11.0	0.4	8	dbSNP_132	37	1,8407		0,1,4203	no	coding-synonymous,coding-synonymous	PHYHIP	NM_001099335.1,NM_014759.3	,	0,2,6308	AA,AG,GG		0.0119,0.0237,0.0158	,	251/331,251/331	22079106	2,12618	2106	4204	6310	PHYHIP	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	D87463	CCDS43723.1	8p21.2	2010-02-17	2006-01-09		ENSG00000168490	ENSG00000168490			16865	protein-coding gene	gene with protein product		608511	"""phytanoyl-CoA hydroxylase interacting protein"", ""DYRK1A interacting protein 3"""	DYRK1AP3		9039502, 10686344	Standard	NM_014759		Approved	KIAA0273, PAHX-AP	uc003xbj.4	Q92561	OTTHUMG00000163776	ENST00000321613.3:c.753C>T	8.37:g.22079106G>A		Somatic	0	36	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	D3DSR1|Q8N4I9	Silent	SNP	32	0.00	0	21	31.25	10	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.R251	ENST00000321613.3	37	c.753	CCDS43723.1	8																																																																																			-	NULL		0.632	PHYHIP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PHYHIP	protein_coding	OTTHUMT00000375388.1	G	NM_014759	rs112627300		22079106	-1	no_errors	ENST00000454243	ensembl	human	known	74_37	silent	SNP	0.060	A
ABCC3	8714	genome.wustl.edu	37	17	48757261	48757261	+	Splice_Site	SNP	G	G	A			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr17:48757261G>A	ENST00000285238.8	+	26	3887		c.e26+1			NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3						bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	AGAGACAGAGGTGGGTACTGG	0.527																																																	0								ENSG00000108846						90.0	76.0	81.0					17																	48757261		2203	4300	6503	ABCC3	SO:0001630	splice_region_variant	0			-	HGNC	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.3807+1G>A	17.37:g.48757261G>A		Somatic	0	31	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	20	44.44	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Splice_Site	SNP	38	0.00	0	30	41.18	21	-	e26+1	ENST00000285238.8	37	c.3807+1	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865223	0.71949	.	.	ENSG00000108846	ENST00000285238	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1785	0.89769	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABCC3	46112260	1.000000	0.71417	0.998000	0.56505	0.711000	0.40976	9.764000	0.98949	2.263000	0.75096	0.655000	0.94253	.	-	-		0.527	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	protein_coding	OTTHUMT00000368083.2	G	NM_020038	-	Intron	48757261	+1	no_errors	ENST00000285238	ensembl	human	known	74_37	splice_site	SNP	1.000	A
HTR4	3360	genome.wustl.edu	37	5	147863869	147863869	+	Intron	SNP	C	C	G			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr5:147863869C>G	ENST00000377888.3	-	7	1215				HTR4_ENST00000314512.6_Intron|HTR4_ENST00000517929.1_Intron|HTR4_ENST00000360693.3_Missense_Mutation_p.G384R|HTR4_ENST00000521530.1_Intron|HTR4_ENST00000521735.1_Intron|HTR4_ENST00000520514.1_Intron|HTR4_ENST00000354217.2_Intron|HTR4_ENST00000362016.2_Intron	NM_000870.5	NP_000861.1	Q13639	5HT4R_HUMAN	5-hydroxytryptamine (serotonin) receptor 4, G protein-coupled						G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|regulation of appetite (GO:0032098)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Cinitapride(DB08810)|Cisapride(DB00604)|Ergoloid mesylate(DB01049)|Metoclopramide(DB01233)|Ondansetron(DB00904)	CTCAATGTGCCTGAGAATGGA	0.403																																					GBM(120;370 1604 14007 17804 41573)												0								ENSG00000164270						89.0	89.0	89.0					5																	147863869		2203	4300	6503	HTR4	SO:0001627	intron_variant	0			-	HGNC	Y08756	CCDS4291.1, CCDS34270.1, CCDS34271.1, CCDS34272.1, CCDS34273.1, CCDS34273.2, CCDS75353.1	5q31-q33	2012-08-08	2012-02-03		ENSG00000164270	ENSG00000164270		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5299	protein-coding gene	gene with protein product		602164	"""5-hydroxytryptamine (serotonin) receptor 4"""			9371406, 9276448	Standard	NM_199453		Approved	5-HT4	uc021yfj.1	Q13639	OTTHUMG00000129931	ENST00000377888.3:c.1077-1013G>C	5.37:g.147863869C>G		Somatic	0	22	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	C4WYH4|Q546Q1|Q684M0|Q712M9|Q96KH9|Q96KI0|Q9H199|Q9NY73|Q9UBM6|Q9UBT4|Q9UE22|Q9UE23|Q9UQR6	Missense_Mutation	SNP	34	0.00	0	54	1.82	1	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT4_rcpt,prints_GPCR_Rhodpsn	p.G384R	ENST00000377888.3	37	c.1150	CCDS4291.1	5	.	.	.	.	.	.	.	.	.	.	C	2.428	-0.331583	0.05314	.	.	ENSG00000164270	ENST00000360693	T	0.72394	-0.65	4.06	3.17	0.36434	.	158.041000	0.00166	N	0.000000	T	0.54303	0.1850	.	.	.	0.19775	N	0.999958	B	0.02656	0.0	B	0.01281	0.0	T	0.43376	-0.9395	9	0.15499	T	0.54	.	7.0277	0.24950	0.0:0.8753:0.0:0.1247	.	384	Q712M9	.	R	384	ENSP00000353915:G384R	ENSP00000353915:G384R	G	-	1	0	HTR4	147844062	0.084000	0.21492	0.010000	0.14722	0.024000	0.10985	0.549000	0.23329	1.282000	0.44496	0.650000	0.86243	GGC	-	NULL		0.403	HTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR4	protein_coding	OTTHUMT00000252187.2	C	NM_000870	-		147863869	-1	no_errors	ENST00000360693	ensembl	human	known	74_37	missense	SNP	0.011	G
CASP5	838	genome.wustl.edu	37	11	104878041	104878041	+	Frame_Shift_Del	DEL	T	T	-	rs144697764		TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr11:104878041delT	ENST00000260315.3	-	3	201	c.202delA	c.(202-204)acafs	p.T68fs	CASP5_ENST00000526056.1_Frame_Shift_Del_p.T81fs|CASP5_ENST00000531367.1_Intron|CASP5_ENST00000393139.2_Frame_Shift_Del_p.T35fs|CASP5_ENST00000418434.1_Intron|CASP5_ENST00000444749.2_Frame_Shift_Del_p.T10fs|CASP5_ENST00000393141.2_Frame_Shift_Del_p.T81fs			P51878	CASP5_HUMAN	caspase 5, apoptosis-related cysteine peptidase	68	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|execution phase of apoptosis (GO:0097194)|proteolysis (GO:0006508)|regulation of apoptotic process (GO:0042981)|regulation of inflammatory response (GO:0050727)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|NLRP1 inflammasome complex (GO:0072558)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)	p.T52fs*26(1)		NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|ovary(3)|skin(1)|urinary_tract(1)	35		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		ATCTTAACTGTTTTTTTTTTG	0.358																																																	1	Deletion - Frameshift(1)	ovary(1)						ENSG00000137757		,,,	386,251,42,3585		1,0,1,383,0,0,251,0,41,1455	104.0	101.0	102.0		,,,	-2.3	0.0	11	dbSNP_132	106	651,407,1,7195		0,0,0,651,0,0,407,0,1,3068	no	codingComplex,codingComplex,intron,codingComplex	CASP5	NM_004347.3,NM_001136112.1,NM_001136110.1,NM_001136109.1	,,,	1,0,1,1034,0,0,658,0,42,4523	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		12.8301,15.924,13.884	,,,	,,,	104878041	1037,658,43,10780	2202	4299	6501	CASP5	SO:0001589	frameshift_variant	0				HGNC		CCDS8328.2, CCDS44718.1, CCDS44719.1, CCDS44720.1	11q22.2-q22.3	2006-02-17	2005-08-17		ENSG00000137757	ENSG00000137757		"""Caspases"""	1506	protein-coding gene	gene with protein product		602665	"""caspase 5, apoptosis-related cysteine protease"""			7797592, 9250871	Standard	NM_004347		Approved	ICE(rel)III	uc010ruz.1	P51878	OTTHUMG00000048073	ENST00000260315.3:c.202delA	11.37:g.104878041delT	ENSP00000260315:p.Thr68fs	Somatic	0	30	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B4DKP5|Q0QVY7|Q0QVY8|Q0QVZ0|Q0QVZ1|Q0QVZ2|Q14DD6|Q1HBJ3|Q6DJV7	Frame_Shift_Del	DEL	32	0.00	0	28	0.00	0	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.T81fs	ENST00000260315.3	37	c.241	CCDS8328.2	11																																																																																			-	pfam_CARD,superfamily_DEATH-like_dom,smart_CARD,pirsf_Caspase_IL-1_beta,pfscan_CARD		0.358	CASP5-001	KNOWN	basic|CCDS	protein_coding	CASP5	protein_coding	OTTHUMT00000109397.2	T	NM_004347			104878041	-1	no_errors	ENST00000393141	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
FRMD1	79981	genome.wustl.edu	37	6	168461515	168461515	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr6:168461515C>T	ENST00000283309.6	-	9	1332	c.1268G>A	c.(1267-1269)gGg>gAg	p.G423E	FRMD1_ENST00000440994.2_Missense_Mutation_p.G355E|FRMD1_ENST00000537786.1_Missense_Mutation_p.G194E|FRMD1_ENST00000432403.1_5'UTR	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	423						cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		CTCATGGAGCCCGTGGACCTC	0.657																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												0								ENSG00000153303						46.0	42.0	44.0					6																	168461515		2203	4300	6503	FRMD1	SO:0001583	missense	0			-	HGNC		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.1268G>A	6.37:g.168461515C>T	ENSP00000283309:p.Gly423Glu	Somatic	0	83	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	63	41.12	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	36	0.00	0	27	44.90	22	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.G423E	ENST00000283309.6	37	c.1268	CCDS5306.1	6	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.581746	0.00879	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000537786	T;T;T	0.48836	0.8;0.8;0.8	2.48	-4.97	0.03029	.	2.404160	0.02924	U	0.138326	T	0.08582	0.0213	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.20052	0.026;0.041;0.035;0.011	B;B;B;B	0.19666	0.012;0.021;0.026;0.021	T	0.05989	-1.0852	10	0.02654	T	1	.	1.1834	0.01849	0.2188:0.3373:0.2613:0.1825	.	358;423;355;318	B7Z8G9;Q8N878;Q8N878-2;Q5SZU5	.;FRMD1_HUMAN;.;.	E	423;355;194	ENSP00000283309:G423E;ENSP00000414115:G355E;ENSP00000440078:G194E	ENSP00000283309:G423E	G	-	2	0	FRMD1	168204364	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.231000	0.09069	-0.986000	0.03498	0.313000	0.20887	GGG	-	NULL		0.657	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	protein_coding	OTTHUMT00000362513.2	C	NM_024919	-		168461515	-1	no_errors	ENST00000283309	ensembl	human	known	74_37	missense	SNP	0.000	T
NUFIP1	26747	genome.wustl.edu	37	13	45556291	45556292	+	Splice_Site	INS	-	-	A	rs545776140		TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr13:45556291_45556292insA	ENST00000379161.4	-	2	459		c.e2-2		RP11-321C24.1_ENST00000437748.2_lincRNA	NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1						box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		AATTTTTAACTAAAAAAAAAAA	0.248																																																	0								ENSG00000083635																																			NUFIP1	SO:0001630	splice_region_variant	0				HGNC	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.413-2->T	13.37:g.45556302_45556302dupA		Somatic	0	30	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	Q8WVM5|Q96SG1	Splice_Site	INS	35	2.78	1	40	0.00	0	-	e2-2	ENST00000379161.4	37	c.413-3_413-2	CCDS9393.1	13																																																																																			-	-		0.248	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP1	protein_coding	OTTHUMT00000044755.2	-	NM_012345		Intron	45556292	-1	no_errors	ENST00000379161	ensembl	human	known	74_37	splice_site_ins	INS	0.631:0.474	A
CDH9	1007	genome.wustl.edu	37	5	26890055	26890055	+	Missense_Mutation	SNP	G	G	C			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr5:26890055G>C	ENST00000231021.4	-	9	1574	c.1402C>G	c.(1402-1404)Caa>Gaa	p.Q468E		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	468	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGGCTACTTTGTTTTGGGTTA	0.383																																					Melanoma(8;187 585 15745 40864 52829)												0								ENSG00000113100						149.0	153.0	151.0					5																	26890055		2203	4300	6503	CDH9	SO:0001583	missense	0			-	HGNC	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1402C>G	5.37:g.26890055G>C	ENSP00000231021:p.Gln468Glu	Somatic	0	63	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	96	9.43	Q3B7I5	Missense_Mutation	SNP	30	0.00	0	105	11.02	13	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q468E	ENST00000231021.4	37	c.1402	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	G	16.68	3.191119	0.58017	.	.	ENSG00000113100	ENST00000231021	T	0.52983	0.64	5.46	5.46	0.80206	Cadherin (4);Cadherin-like (1);	0.125905	0.53938	D	0.000046	T	0.49236	0.1545	M	0.69358	2.11	0.47037	D	0.999298	B;B	0.12013	0.001;0.005	B;B	0.17979	0.013;0.02	T	0.41538	-0.9503	9	.	.	.	.	17.8599	0.88778	0.0:0.0:1.0:0.0	.	61;468	B4DFP0;Q9ULB4	.;CADH9_HUMAN	E	468	ENSP00000231021:Q468E	.	Q	-	1	0	CDH9	26925812	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.169000	0.71913	2.566000	0.86566	0.551000	0.68910	CAA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.383	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	protein_coding	OTTHUMT00000207352.1	G	NM_016279	-		26890055	-1	no_errors	ENST00000231021	ensembl	human	known	74_37	missense	SNP	1.000	C
ZNF207	7756	genome.wustl.edu	37	17	30700338	30700338	+	IGR	DEL	A	A	-	rs191933623	byFrequency	TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr17:30700338delA	ENST00000321233.6	+	0	2283				ZNF207_ENST00000577908.1_Intron|ZNF207_ENST00000394670.4_3'UTR|ZNF207_ENST00000584416.1_3'UTR	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207						attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			TGGGatttttaaaaaaaaaaa	0.333																																																	0								ENSG00000010244																																			ZNF207	SO:0001628	intergenic_variant	0				HGNC	AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810		17.37:g.30700338delA		Somatic	0	12	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	RNA	DEL	40	0.00	0	53	0.00	0	-	NULL	ENST00000321233.6	37	NULL	CCDS11271.1	17																																																																																			-	-		0.333	ZNF207-003	KNOWN	basic|CCDS	protein_coding	ZNF207	protein_coding	OTTHUMT00000256251.2	A				30700338	+1	no_errors	ENST00000584416	ensembl	human	putative	74_37	rna	DEL	0.001	-
ZNF770	54989	genome.wustl.edu	37	15	35271833	35271833	+	3'UTR	SNP	C	C	A			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr15:35271833C>A	ENST00000356321.4	-	0	4147				AC114546.1_ENST00000391457.2_Missense_Mutation_p.S20R	NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770						regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		GTAAAAGAAGCAAGCAGATCA	0.403																																																	0								ENSG00000212768																																			AC114546.1	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_ensembl_gene	BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.*1727G>T	15.37:g.35271833C>A		Somatic	0	45	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	24	42.86	Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	42	0.00	0	36	40.00	24	NULL	p.S20R	ENST00000356321.4	37	c.60	CCDS10042.1	15	.	.	.	.	.	.	.	.	.	.	c	5.152	0.213690	0.09810	.	.	ENSG00000212768	ENST00000391457	.	.	.	3.15	-0.214	0.13161	.	.	.	.	.	T	0.29783	0.0744	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.35325	-0.9793	5	0.87932	D	0	.	2.1017	0.03682	0.2512:0.4005:0.0:0.3483	.	.	.	.	R	20	.	ENSP00000375288:S20R	S	+	3	2	AC114546.1	33059125	0.000000	0.05858	0.002000	0.10522	0.027000	0.11550	-0.909000	0.04058	-0.034000	0.13713	0.467000	0.42956	AGC	-	NULL		0.403	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000212768	protein_coding	OTTHUMT00000251896.2	C	NM_014106	-		35271833	+1	no_errors	ENST00000391457	ensembl	human	known	74_37	missense	SNP	0.003	A
ZBBX	79740	genome.wustl.edu	37	3	167031769	167031769	+	Silent	SNP	A	A	G			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr3:167031769A>G	ENST00000392766.2	-	16	1750	c.1410T>C	c.(1408-1410)aaT>aaC	p.N470N	ZBBX_ENST00000392764.1_Silent_p.N441N|ZBBX_ENST00000392767.2_Silent_p.N470N|ZBBX_ENST00000307529.5_Silent_p.N470N|ZBBX_ENST00000455345.2_Silent_p.N470N	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	470						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TACCTTTTGAATTATCTTTAT	0.299																																																	0								ENSG00000169064						101.0	100.0	100.0					3																	167031769		1798	4069	5867	ZBBX	SO:0001819	synonymous_variant	0			-	HGNC	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.1410T>C	3.37:g.167031769A>G		Somatic	0	25	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	17	48.48	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Silent	SNP	28	0.00	0	40	42.03	29	pfam_Znf_B-box	p.N470	ENST00000392766.2	37	c.1410	CCDS3199.2	3																																																																																			-	NULL		0.299	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	protein_coding	OTTHUMT00000257657.3	A	NM_024687	-		167031769	-1	no_errors	ENST00000307529	ensembl	human	known	74_37	silent	SNP	0.001	G
ELFN2	114794	genome.wustl.edu	37	22	37771876	37771877	+	5'UTR	INS	-	-	CCT	rs553606382|rs142158248|rs370069619	byFrequency	TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr22:37771876_37771877insCCT	ENST00000402918.2	-	0	483_484				RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'UTR|RP1-63G5.5_ENST00000430883.1_RNA	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2						negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					GACTtcctctccctcctcctcc	0.634														1306	0.260783	0.2088	0.2161	5008	,	,		16480	0.3343		0.2763	False		,,,				2504	0.271																0								ENSG00000166897																																			ELFN2	SO:0001623	5_prime_UTR_variant	0				HGNC	BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.-303->AGG	22.37:g.37771883_37771885dupCCT		Somatic	0	31	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	39	13.33	Q96PY3	RNA	INS	20	4.76	1	14	6.67	1	-	NULL	ENST00000402918.2	37	NULL	CCDS33642.1	22																																																																																			-	-		0.634	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELFN2	protein_coding	OTTHUMT00000318900.2	-	NM_052906			37771877	-1	no_errors	ENST00000414347	ensembl	human	known	74_37	rna	INS	0.001:0.043	CCT
PLEKHA2	59339	genome.wustl.edu	37	8	38801336	38801336	+	Frame_Shift_Del	DEL	A	A	-			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr8:38801336delA	ENST00000521746.1	+	4	462	c.228delA	c.(226-228)ccafs	p.P76fs	PLEKHA2_ENST00000420274.1_Frame_Shift_Del_p.P76fs|PLEKHA2_ENST00000388745.4_3'UTR			Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2	76	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of cell-matrix adhesion (GO:0001954)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	13		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			AACAGAAACCAAAAACTCCAT	0.363																																																	0								ENSG00000169499						47.0	47.0	47.0					8																	38801336		1851	4097	5948	PLEKHA2	SO:0001589	frameshift_variant	0				HGNC	AF286164	CCDS75732.1	8p11.21	2013-01-10	2002-01-14			ENSG00000169499		"""Pleckstrin homology (PH) domain containing"""	14336	protein-coding gene	gene with protein product	"""tandem PH Domain containing protein-2"""	607773	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 2"""			11001876	Standard	NM_021623		Approved	TAPP2	uc003xmi.4	Q9HB19		ENST00000521746.1:c.228delA	8.37:g.38801336delA	ENSP00000430938:p.Pro76fs	Somatic	0	39	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	11	15.38		Frame_Shift_Del	DEL	36	0.00	0	31	0.00	0	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.T78fs	ENST00000521746.1	37	c.228		8																																																																																			-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.363	PLEKHA2-002	PUTATIVE	basic	protein_coding	PLEKHA2	protein_coding	OTTHUMT00000377068.1	A	NM_021623			38801336	+1	no_errors	ENST00000420274	ensembl	human	known	74_37	frame_shift_del	DEL	0.693	-
AC026700.1	0	genome.wustl.edu	37	5	84823943	84823944	+	RNA	DEL	CA	CA	-	rs537929167|rs368649367	byFrequency	TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr5:84823943_84823944delCA	ENST00000401134.1	-	0	8_9																											catgcacatgcacacacacaca	0.337																																																	0								ENSG00000215953																																			AC026700.1			0				Clone_based_ensembl_gene																													5.37:g.84823953_84823954delCA		Somatic	0	39	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	40	14.89		RNA	DEL	32	8.57	3	49	2.00	1	-	NULL	ENST00000401134.1	37	NULL		5																																																																																			-	-		0.337	AC026700.1-201	NOVEL	basic	miRNA	ENSG00000215953	miRNA		CA				84823944	-1	no_errors	ENST00000401134	ensembl	human	novel	74_37	rna	DEL	0.030:0.032	-
TP53	7157	genome.wustl.edu	37	17	7579415	7579415	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr17:7579415C>T	ENST00000269305.4	-	4	461	c.272G>A	c.(271-273)tGg>tAg	p.W91*	TP53_ENST00000420246.2_Nonsense_Mutation_p.W91*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Nonsense_Mutation_p.W91*|TP53_ENST00000445888.2_Nonsense_Mutation_p.W91*|TP53_ENST00000413465.2_Nonsense_Mutation_p.W91*|TP53_ENST00000359597.4_Nonsense_Mutation_p.W91*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	91	Interaction with WWOX.		W -> C (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.W91*(7)|p.G59fs*23(3)|p.V73fs*9(1)|p.D48fs*55(1)|p.A88fs*52(1)|p.W91fs*13(1)|p.P87fs*54(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGACAGGGGCCAGGAGGGGGC	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	25	Deletion - Frameshift(10)|Whole gene deletion(8)|Substitution - Nonsense(7)	lung(7)|upper_aerodigestive_tract(4)|bone(4)|central_nervous_system(3)|breast(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|prostate(1)|liver(1)						ENSG00000141510						44.0	50.0	48.0					17																	7579415		2202	4299	6501	TP53	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.272G>A	17.37:g.7579415C>T	ENSP00000269305:p.Trp91*	Somatic	0	54	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	5	77.27	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	32	0.00	0	7	75.00	21	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.W91*	ENST00000269305.4	37	c.272	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911071	0.72983	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	4.08	4.08	0.47627	.	0.425160	0.22616	N	0.057766	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-8.1711	14.5887	0.68347	0.0:1.0:0.0:0.0	.	.	.	.	X	91	.	ENSP00000269305:W91X	W	-	2	0	TP53	7520140	0.997000	0.39634	0.998000	0.56505	0.633000	0.38033	-0.143000	0.10296	2.561000	0.86390	0.561000	0.74099	TGG	-	NULL		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7579415	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ANKRD44	91526	genome.wustl.edu	37	2	197857417	197857417	+	Intron	SNP	A	A	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr2:197857417A>T	ENST00000282272.8	-	26	2899					NM_001195144.1	NP_001182073.1	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44											NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GGGACACAGCAGGGTACATGC	0.453																																																	0								ENSG00000065413																																			ANKRD44	SO:0001627	intron_variant	0			-	HGNC	AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000282272.8:c.2899+889T>A	2.37:g.197857417A>T		Somatic	0	54	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	28	42.86	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	RNA	SNP	27	0.00	0	39	35.00	21	-	NULL	ENST00000282272.8	37	NULL		2																																																																																			-	-		0.453	ANKRD44-201	KNOWN	basic	protein_coding	ANKRD44	protein_coding		A	NM_153697	-		197857417	-1	no_errors	ENST00000486006	ensembl	human	known	74_37	rna	SNP	0.984	T
FKBP10	60681	genome.wustl.edu	37	17	39976138	39976138	+	Intron	SNP	G	G	T	rs377206833		TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr17:39976138G>T	ENST00000321562.4	+	6	1167				FKBP10_ENST00000544340.1_Missense_Mutation_p.R82L	NM_021939.3	NP_068758.3	Q96AY3	FKB10_HUMAN	FK506 binding protein 10, 65 kDa						chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			cervix(1)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	14		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		CGCCCCTTCCGCAGTGGAGAA	0.582																																																	0								ENSG00000141756																																			FKBP10	SO:0001627	intron_variant	0			-	HGNC	AB045981	CCDS11409.1	17q21.2	2014-09-17	2002-08-29		ENSG00000141756	ENSG00000141756		"""EF-hand domain containing"""	18169	protein-coding gene	gene with protein product		607063	"""FK506 binding protein 10 (65 kDa)"""			11071917, 18786928	Standard	NM_021939		Approved	hFKBP65, FLJ22041, FKBP6, FLJ20683, FLJ23833	uc002hxv.2	Q96AY3	OTTHUMG00000133497	ENST00000321562.4:c.1063+211G>T	17.37:g.39976138G>T		Somatic	0	34	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	10	58.33	Q7Z3R4|Q9H3N3|Q9H6J3|Q9H6N5|Q9UF89	Missense_Mutation	SNP	33	0.00	0	28	34.88	15	pfam_PPIase_FKBP_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_PPIase_FKBP_dom	p.R82L	ENST00000321562.4	37	c.245	CCDS11409.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.551|8.551	0.875444|0.875444	0.17395|0.17395	.|.	.|.	ENSG00000141756|ENSG00000141756	ENST00000455106|ENST00000544340	.|T	.|0.41400	.|1.0	4.1|4.1	-2.31|-2.31	0.06765|0.06765	.|.	.|.	.|.	.|.	.|.	T|T	0.21718|0.21718	0.0523|0.0523	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B	.|0.12013	.|0.005	.|B	.|0.17979	.|0.02	T|T	0.24083|0.24083	-1.0170|-1.0170	4|8	.|0.21540	.|T	.|0.41	.|.	4.6782|4.6782	0.12722|0.12722	0.2782:0.3634:0.3584:0.0|0.2782:0.3634:0.3584:0.0	.|.	.|82	.|Q9H6J3	.|.	S|L	113|82	.|ENSP00000442009:R82L	.|ENSP00000442009:R82L	A|R	+|+	1|2	0|0	FKBP10|FKBP10	37229664|37229664	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.002000|0.002000	0.02628|0.02628	-1.329000|-1.329000	0.02677|0.02677	-0.351000|-0.351000	0.08249|0.08249	-1.240000|-1.240000	0.01540|0.01540	GCA|CGC	-	pfam_PPIase_FKBP_dom,pfscan_PPIase_FKBP_dom		0.582	FKBP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP10	protein_coding	OTTHUMT00000257410.2	G	NM_021939	-		39976138	+1	no_errors	ENST00000544340	ensembl	human	known	74_37	missense	SNP	0.000	T
ARHGAP27	201176	genome.wustl.edu	37	17	43474297	43474297	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr17:43474297C>T	ENST00000428638.1	-	11	1935	c.1936G>A	c.(1936-1938)Gcg>Acg	p.A646T	CTB-39G8.3_ENST00000592389.1_RNA|ARHGAP27_ENST00000582826.1_5'Flank|ARHGAP27_ENST00000532038.1_Missense_Mutation_p.A424T|ARHGAP27_ENST00000376922.2_Missense_Mutation_p.A305T|ARHGAP27_ENST00000455881.1_Missense_Mutation_p.A305T|ARHGAP27_ENST00000442348.1_Missense_Mutation_p.A619T|ARHGAP27_ENST00000532891.2_Missense_Mutation_p.A624T|ARHGAP27_ENST00000528384.1_Missense_Mutation_p.A278T			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	646					positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					TTCGGTCGCGCGTCCTCCTCT	0.672																																																	0								ENSG00000159314						72.0	64.0	67.0					17																	43474297		2203	4300	6503	ARHGAP27	SO:0001583	missense	0			-	HGNC	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.1936G>A	17.37:g.43474297C>T	ENSP00000403323:p.Ala646Thr	Somatic	0	60	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	36	30.19	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Missense_Mutation	SNP	26	0.00	0	21	44.74	17	pfam_RhoGAP_dom,pfam_WW_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.A646T	ENST00000428638.1	37	c.1936		17	.	.	.	.	.	.	.	.	.	.	C	8.481	0.859759	0.17178	.	.	ENSG00000159314	ENST00000532038;ENST00000376922;ENST00000528384;ENST00000532891;ENST00000428638;ENST00000442348;ENST00000455881	T;T;T;T;T;T;T	0.08282	3.11;3.11;3.12;3.17;3.17;3.17;3.11	4.38	-8.04	0.01110	.	2.667510	0.01416	N	0.014199	T	0.04318	0.0119	L	0.38175	1.15	0.09310	N	1	B;B	0.32382	0.001;0.368	B;B	0.22753	0.001;0.041	T	0.35871	-0.9771	10	0.13853	T	0.58	.	1.6964	0.02863	0.1974:0.3294:0.0976:0.3756	.	619;646	F8WBX1;Q6ZUM4	.;RHG27_HUMAN	T	424;305;278;624;646;619;305	ENSP00000432762:A424T;ENSP00000366121:A305T;ENSP00000431591:A278T;ENSP00000433942:A624T;ENSP00000403323:A646T;ENSP00000409330:A619T;ENSP00000408235:A305T	ENSP00000366121:A305T	A	-	1	0	ARHGAP27	40830080	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-0.907000	0.04067	-1.679000	0.01452	-0.379000	0.06801	GCG	-	NULL		0.672	ARHGAP27-202	KNOWN	basic	protein_coding	ARHGAP27	protein_coding		C	NM_199282	-		43474297	-1	no_errors	ENST00000428638	ensembl	human	known	74_37	missense	SNP	0.000	T
DMD	1756	genome.wustl.edu	37	X	32481570	32481570	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chrX:32481570G>T	ENST00000357033.4	-	25	3624	c.3418C>A	c.(3418-3420)Cac>Aac	p.H1140N	DMD_ENST00000378677.2_Missense_Mutation_p.H1136N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1140					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGGCACATGTGATCCCACTGA	0.428																																																	0								ENSG00000198947						258.0	162.0	194.0					X																	32481570		2202	4300	6502	DMD	SO:0001583	missense	0			-	HGNC	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3418C>A	X.37:g.32481570G>T	ENSP00000354923:p.His1140Asn	Somatic	0	83	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	33	50.75	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	26	0.00	0	29	30.95	13	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.H1140N	ENST00000357033.4	37	c.3418	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	6.739	0.505197	0.12822	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.48201	0.82;0.82	5.43	-3.95	0.04118	.	0.410909	0.16739	U	0.201519	T	0.26376	0.0644	L	0.36672	1.1	0.09310	N	1	B;B;B	0.14012	0.0;0.009;0.0	B;B;B	0.15484	0.0;0.013;0.0	T	0.16041	-1.0416	10	0.21014	T	0.42	.	2.8698	0.05613	0.4026:0.1033:0.3862:0.1079	.	1132;1140;1136	P11532-4;P11532;E9PDN5	.;DMD_HUMAN;.	N	1132;1136;1140;1140;1017	ENSP00000367948:H1136N;ENSP00000354923:H1140N	ENSP00000354923:H1140N	H	-	1	0	DMD	32391491	0.001000	0.12720	0.000000	0.03702	0.565000	0.35776	-0.099000	0.11007	-1.738000	0.01348	0.436000	0.28706	CAC	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.428	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	protein_coding	OTTHUMT00000056182.2	G	NM_004006	-		32481570	-1	no_errors	ENST00000357033	ensembl	human	known	74_37	missense	SNP	0.016	T
ARL13A	392509	genome.wustl.edu	37	X	100229170	100229170	+	Silent	SNP	G	G	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chrX:100229170G>T	ENST00000450049.2	+	3	227	c.114G>T	c.(112-114)gtG>gtT	p.V38V		NM_001162491.1	NP_001155963.1	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13A	38					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(1)|ovary(1)	2						CTGTTCTTGTGGAGGCATTCC	0.418																																																	0								ENSG00000174225						84.0	68.0	73.0					X																	100229170		1849	4068	5917	ARL13A	SO:0001819	synonymous_variant	0			-	HGNC		CCDS55463.1	Xq22.1	2014-05-09	2005-11-18	2005-11-18	ENSG00000174225	ENSG00000174225		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31709	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 13"""	ARL13			Standard	NM_001162491		Approved		uc011mrf.2	Q5H913	OTTHUMG00000022013	ENST00000450049.2:c.114G>T	X.37:g.100229170G>T		Somatic	0	61	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	32	48.39	B2RTT6|B4DX50	Silent	SNP	29	0.00	0	32	39.62	21	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR	p.V38	ENST00000450049.2	37	c.114	CCDS55463.1	X																																																																																			-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR		0.418	ARL13A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ARL13A	protein_coding	OTTHUMT00000057504.2	G	XM_373358	-		100229170	+1	no_errors	ENST00000450457	ensembl	human	known	74_37	silent	SNP	0.000	T
INPP4A	3631	genome.wustl.edu	37	2	99169399	99169399	+	Silent	SNP	C	C	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr2:99169399C>T	ENST00000523221.1	+	13	1329	c.1329C>T	c.(1327-1329)ggC>ggT	p.G443G	INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000545415.1_Silent_p.G443G|INPP4A_ENST00000409540.3_Silent_p.G443G|INPP4A_ENST00000409851.3_Silent_p.G438G|INPP4A_ENST00000409016.4_Silent_p.G443G|INPP4A_ENST00000074304.5_Silent_p.G443G			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	443					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						CTGCCACTGGCCTTGAGAGGA	0.577																																																	0								ENSG00000040933						39.0	40.0	40.0					2																	99169399		2011	4172	6183	INPP4A	SO:0001819	synonymous_variant	0			-	HGNC	U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1329C>T	2.37:g.99169399C>T		Somatic	0	27	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	33	28.26	O15326|Q13187|Q53TD8|Q8TC02	Silent	SNP	25	0.00	0	32	39.62	21	superfamily_C2_dom	p.G443	ENST00000523221.1	37	c.1329	CCDS46369.1	2																																																																																			-	NULL		0.577	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	protein_coding	OTTHUMT00000376095.1	C	NM_001566	-		99169399	+1	no_errors	ENST00000074304	ensembl	human	known	74_37	silent	SNP	0.990	T
TYK2	7297	genome.wustl.edu	37	19	10463145	10463145	+	Silent	SNP	G	G	A			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr19:10463145G>A	ENST00000525621.1	-	23	3764	c.3283C>T	c.(3283-3285)Ctg>Ttg	p.L1095L	TYK2_ENST00000529422.1_Intron|TYK2_ENST00000264818.6_Silent_p.L1095L|TYK2_ENST00000524462.1_Silent_p.L910L	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	1095	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CAGTGCGTCAGCAGCTCATAC	0.607																																																	0								ENSG00000105397						79.0	81.0	80.0					19																	10463145		2203	4300	6503	TYK2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.3283C>T	19.37:g.10463145G>A		Somatic	0	63	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	41	41.43	Q6QB10|Q96CH0	Silent	SNP	22	0.00	0	25	37.50	15	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.L1095	ENST00000525621.1	37	c.3283	CCDS12236.1	19																																																																																			-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.607	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	protein_coding	OTTHUMT00000389443.1	G		-		10463145	-1	no_errors	ENST00000264818	ensembl	human	known	74_37	silent	SNP	1.000	A
KIAA1429	25962	genome.wustl.edu	37	8	95507155	95507155	+	Frame_Shift_Del	DEL	T	T	-			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr8:95507155delT	ENST00000297591.5	-	20	4649	c.4574delA	c.(4573-4575)gatfs	p.D1526fs	KIAA1429_ENST00000437199.1_3'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1526					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CAACTGATCATCCATGACATC	0.323																																																	0								ENSG00000164944						130.0	137.0	134.0					8																	95507155		2203	4300	6503	KIAA1429	SO:0001589	frameshift_variant	0				HGNC	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.4574delA	8.37:g.95507155delT	ENSP00000297591:p.Asp1526fs	Somatic	0	32	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Frame_Shift_Del	DEL	33	0.00	0	46	0.00	0	superfamily_ARM-type_fold	p.D1525fs	ENST00000297591.5	37	c.4574	CCDS34923.1	8																																																																																			-	NULL		0.323	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	protein_coding	OTTHUMT00000378720.2	T	NM_015496			95507155	-1	no_errors	ENST00000297591	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
MTNR1A	4543	genome.wustl.edu	37	4	187454917	187454917	+	Missense_Mutation	SNP	C	C	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr4:187454917C>T	ENST00000307161.5	-	2	1180	c.979G>A	c.(979-981)Gtg>Atg	p.V327M	RP11-215A19.2_ENST00000509111.1_Intron	NM_005958.3	NP_005949.1	P48039	MTR1A_HUMAN	melatonin receptor 1A	327					circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|mating behavior (GO:0007617)|positive regulation of cGMP biosynthetic process (GO:0030828)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	hormone binding (GO:0042562)|melatonin receptor activity (GO:0008502)|organic cyclic compound binding (GO:0097159)	p.V327M(1)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	CTATCGGCCACGTCGTTAGAG	0.453																																																	1	Substitution - Missense(1)	central_nervous_system(1)						ENSG00000168412						136.0	133.0	134.0					4																	187454917		2203	4300	6503	MTNR1A	SO:0001583	missense	0			-	HGNC		CCDS3848.1	4q35	2012-08-08				ENSG00000168412		"""GPCR / Class A : Melatonin receptors"""	7463	protein-coding gene	gene with protein product		600665				7558006	Standard	NM_005958		Approved	MEL-1A-R	uc003izd.1	P48039		ENST00000307161.5:c.979G>A	4.37:g.187454917C>T	ENSP00000302811:p.Val327Met	Somatic	0	83	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	48	42.86	A0AVC5|B0M0L2	Missense_Mutation	SNP	32	0.00	0	23	46.51	20	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Melatonin_rcpt,prints_GPCR_Rhodpsn,prints_Mel_1A_rcpt,prints_NPY_rcpt,prints_Mel_rcpt_1C	p.V327M	ENST00000307161.5	37	c.979	CCDS3848.1	4	.	.	.	.	.	.	.	.	.	.	C	3.338	-0.135180	0.06711	.	.	ENSG00000168412	ENST00000307161	T	0.71579	-0.58	4.66	-0.47	0.12131	.	0.671283	0.14970	N	0.287848	T	0.50803	0.1637	L	0.28274	0.84	0.09310	N	1	B	0.24576	0.106	B	0.12156	0.007	T	0.40194	-0.9576	10	0.51188	T	0.08	-0.1175	6.5811	0.22594	0.0:0.581:0.1228:0.2962	.	327	P48039	MTR1A_HUMAN	M	327	ENSP00000302811:V327M	ENSP00000302811:V327M	V	-	1	0	MTNR1A	187691911	0.260000	0.24053	0.000000	0.03702	0.006000	0.05464	2.465000	0.45075	0.154000	0.19237	-0.140000	0.14226	GTG	-	prints_Mel_1A_rcpt,prints_Mel_rcpt_1C		0.453	MTNR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTNR1A	protein_coding	OTTHUMT00000360189.1	C		-		187454917	-1	no_errors	ENST00000307161	ensembl	human	known	74_37	missense	SNP	0.049	T
CCDC59	29080	genome.wustl.edu	37	12	82736380	82736385	+	RNA	DEL	ATATAC	ATATAC	-	rs148601718	byFrequency	TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	ATATAC	ATATAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr12:82736380_82736385delATATAC	ENST00000408194.1	-	0	104_109																											atgtatgtatatatacatatatatgt	0.204														262	0.0523163	0.0552	0.0605	5008	,	,		15716	0.002		0.0805	False		,,,				2504	0.0654																0								ENSG00000221121																																			AC083811.1			0				Clone_based_ensembl_gene																													12.37:g.82736380_82736385delATATAC		Somatic	NA	NA	NA		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	21	0.00	0	10	0.00	0	-	NULL	ENST00000408194.1	37	NULL		12																																																																																			-	-		0.204	AC083811.1-201	NOVEL	basic	miRNA	ENSG00000221121	miRNA		ATATAC				82736385	-1	no_errors	ENST00000408194	ensembl	human	novel	74_37	rna	DEL	0.012:0.010:0.008:0.005:0.002:0.001	-
LPPR5	163404	genome.wustl.edu	37	1	99422183	99422183	+	Nonsense_Mutation	SNP	G	G	A			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr1:99422183G>A	ENST00000263177.4	-	2	573	c.352C>T	c.(352-354)Cga>Tga	p.R118*	LPPR5_ENST00000370188.3_Nonsense_Mutation_p.R118*	NM_001037317.1	NP_001032394.1	Q32ZL2	LPPR5_HUMAN		118						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)	p.R118*(1)									CGGACAGTTCGGCGCACCAGC	0.358																																																	1	Substitution - Nonsense(1)	prostate(1)						ENSG00000117598						63.0	67.0	66.0					1																	99422183		2202	4300	6502	LPPR5	SO:0001587	stop_gained	0			-	Uniprot_gn																												ENST00000263177.4:c.352C>T	1.37:g.99422183G>A	ENSP00000263177:p.Arg118*	Somatic	0	51	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	21	32.26	A8MPX4|B7UCH3|Q32ZD0|Q3ZCU7	Nonsense_Mutation	SNP	42	0.00	0	34	47.69	31	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.R118*	ENST00000263177.4	37	c.352	CCDS30778.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.375200	0.97515	.	.	ENSG00000117598	ENST00000370188;ENST00000263177	.	.	.	4.74	-0.68	0.11346	.	0.066699	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0516	0.64739	0.0:0.0:0.2126:0.7874	.	.	.	.	X	118	.	ENSP00000263177:R118X	R	-	1	2	AL161744.1	99194771	0.994000	0.37717	0.970000	0.41538	0.996000	0.88848	0.449000	0.21744	0.102000	0.17638	0.591000	0.81541	CGA	-	superfamily_P_Acid_Pase_2/haloperoxidase		0.358	LPPR5-002	KNOWN	basic|CCDS	protein_coding	LPPR5	protein_coding	OTTHUMT00000393221.1	G		-		99422183	-1	no_errors	ENST00000263177	ensembl	human	known	74_37	nonsense	SNP	0.780	A
PTPRM	5797	genome.wustl.edu	37	18	8244162	8244162	+	Missense_Mutation	SNP	G	G	A			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr18:8244162G>A	ENST00000332175.8	+	15	3444	c.2407G>A	c.(2407-2409)Gac>Aac	p.D803N	PTPRM_ENST00000580170.1_Missense_Mutation_p.D803N|PTPRM_ENST00000400060.4_Missense_Mutation_p.D803N|PTPRM_ENST00000400053.4_Missense_Mutation_p.D741N|PTPRM_ENST00000444013.1_Missense_Mutation_p.D590N	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	803					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				CACAAACTGCGACGAGGCTTT	0.488																																																	0								ENSG00000173482						158.0	141.0	147.0					18																	8244162		2203	4300	6503	PTPRM	SO:0001583	missense	0			-	HGNC	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2407G>A	18.37:g.8244162G>A	ENSP00000331418:p.Asp803Asn	Somatic	0	47	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	24	50.00	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	29	0.00	0	14	54.55	18	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.D803N	ENST00000332175.8	37	c.2407	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	G	35	5.548658	0.96488	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.50548	1.12;1.08;0.91;0.74	5.71	5.71	0.89125	.	0.050312	0.85682	D	0.000000	T	0.42131	0.1189	L	0.39898	1.24	0.80722	D	1	P;P;P	0.43352	0.782;0.804;0.804	B;B;B	0.38296	0.27;0.163;0.163	T	0.18935	-1.0321	10	0.26408	T	0.33	.	19.8593	0.96777	0.0:0.0:1.0:0.0	.	590;803;803	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	N	803;803;741;590	ENSP00000331418:D803N;ENSP00000382933:D803N;ENSP00000382927:D741N;ENSP00000387608:D590N	ENSP00000331418:D803N	D	+	1	0	PTPRM	8234162	1.000000	0.71417	0.991000	0.47740	0.973000	0.67179	9.869000	0.99810	2.700000	0.92200	0.557000	0.71058	GAC	-	NULL		0.488	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	protein_coding	OTTHUMT00000254456.1	G		-		8244162	+1	no_errors	ENST00000400060	ensembl	human	known	74_37	missense	SNP	1.000	A
DLK2	65989	genome.wustl.edu	37	6	43420846	43420846	+	Missense_Mutation	SNP	G	G	C			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr6:43420846G>C	ENST00000357338.3	-	4	868	c.168C>G	c.(166-168)caC>caG	p.H56Q	DLK2_ENST00000372485.1_Missense_Mutation_p.H56Q|DLK2_ENST00000372488.3_Missense_Mutation_p.H56Q|DLK2_ENST00000414245.1_Missense_Mutation_p.H56Q	NM_206539.1	NP_996262.1	Q6UY11	DLK2_HUMAN	delta-like 2 homolog (Drosophila)	56	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				negative regulation of Notch signaling pathway (GO:0045746)|regulation of fat cell differentiation (GO:0045598)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			AGCGCTCACAGTGCAGCCCCT	0.617																																																	0								ENSG00000171462						39.0	36.0	37.0					6																	43420846		2203	4300	6503	DLK2	SO:0001583	missense	0			-	HGNC	AK055380	CCDS4897.1, CCDS75461.1	6p21.1	2008-02-05	2007-07-05	2007-07-05	ENSG00000171462	ENSG00000171462			21113	protein-coding gene	gene with protein product			"""EGF-like-domain, multiple 9"""	EGFL9			Standard	NM_001286656		Approved	MGC2487	uc003ovb.3	Q6UY11	OTTHUMG00000014735	ENST00000357338.3:c.168C>G	6.37:g.43420846G>C	ENSP00000349893:p.His56Gln	Somatic	0	23	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	4	73.33	B3KNZ7|Q5T3T8|Q9BQ54	Missense_Mutation	SNP	30	0.00	0	7	69.57	16	pfam_EG-like_dom,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.H56Q	ENST00000357338.3	37	c.168	CCDS4897.1	6	.	.	.	.	.	.	.	.	.	.	G	14.36	2.511931	0.44660	.	.	ENSG00000171462	ENST00000372485;ENST00000372488;ENST00000372496;ENST00000357338;ENST00000414245	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	4.72	2.9	0.33743	EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.336037	0.31772	N	0.007090	T	0.07413	0.0187	N	0.01352	-0.895	0.34434	D	0.69886	B	0.22604	0.072	B	0.19946	0.027	T	0.09378	-1.0677	10	0.30078	T	0.28	.	9.1544	0.36983	0.2372:0.0:0.7628:0.0	.	56	Q6UY11	DLK2_HUMAN	Q	56	ENSP00000361563:H56Q;ENSP00000361566:H56Q;ENSP00000349893:H56Q;ENSP00000398906:H56Q	ENSP00000349893:H56Q	H	-	3	2	DLK2	43528824	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.415000	0.34748	1.115000	0.41800	0.484000	0.47621	CAC	-	smart_EG-like_dom,pfscan_EG-like_dom		0.617	DLK2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	DLK2	protein_coding	OTTHUMT00000040618.1	G	NM_023932	-		43420846	-1	no_errors	ENST00000357338	ensembl	human	known	74_37	missense	SNP	1.000	C
MCF2	4168	genome.wustl.edu	37	X	138678809	138678809	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chrX:138678809G>T	ENST00000370576.4	-	19	2385	c.2176C>A	c.(2176-2178)Ctt>Att	p.L726I	MCF2_ENST00000520602.1_Missense_Mutation_p.L786I|MCF2_ENST00000414978.1_Missense_Mutation_p.L786I|MCF2_ENST00000519895.1_Missense_Mutation_p.L802I|MCF2_ENST00000370578.4_Missense_Mutation_p.L871I|MCF2_ENST00000370573.4_Missense_Mutation_p.L726I|AL033403.1_ENST00000401295.2_RNA|MCF2_ENST00000536274.1_Missense_Mutation_p.L687I|MCF2_ENST00000338585.6_Missense_Mutation_p.L742I	NM_001171879.1|NM_005369.4	NP_001165350.1|NP_005360.3	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	726	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					TACAAGAAAAGGTGTCGCTGC	0.408																																																	0								ENSG00000101977						145.0	121.0	129.0					X																	138678809		2203	4300	6503	MCF2	SO:0001583	missense	0			-	HGNC		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000370576.4:c.2176C>A	X.37:g.138678809G>T	ENSP00000359608:p.Leu726Ile	Somatic	0	80	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	28	50.00	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	28	0.00	0	25	51.92	27	pfam_DH-domain,superfamily_DH-domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L871I	ENST00000370576.4	37	c.2611	CCDS14667.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.86|12.86	2.064363|2.064363	0.36470|0.36470	.|.	.|.	ENSG00000101977|ENSG00000101977	ENST00000520602;ENST00000370576;ENST00000536274;ENST00000370578;ENST00000414978;ENST00000446225;ENST00000519895;ENST00000370573;ENST00000338585|ENST00000437564	T;T;T;T;T;T;T;T;T|.	0.12465|.	2.68;2.68;2.68;2.68;2.68;2.68;2.68;2.68;2.68|.	5.88|5.88	0.644|0.644	0.17776|0.17776	Pleckstrin homology-type (1);Pleckstrin homology domain (2);|.	0.169822|.	0.53938|.	N|.	0.000054|.	T|T	0.61426|0.61426	0.2346|0.2346	L|L	0.53671|0.53671	1.685|1.685	0.35869|0.35869	D|D	0.828072|0.828072	B;B;B;B;B;B;B;B|.	0.28971|.	0.012;0.147;0.02;0.012;0.02;0.012;0.229;0.012|.	B;B;B;B;B;B;B;B|.	0.41894|.	0.046;0.203;0.099;0.046;0.099;0.034;0.369;0.046|.	T|T	0.63699|0.63699	-0.6578|-0.6578	10|5	0.18276|.	T|.	0.48|.	.|.	15.251|15.251	0.73545|0.73545	0.0:0.0:0.3938:0.6062|0.0:0.0:0.3938:0.6062	.|.	802;871;687;726;726;871;742;726|.	E9PH77;B7Z3Z2;F5H091;B2R9S6;P10911-2;Q5JYJ7;P10911-4;P10911|.	.;.;.;.;.;.;.;MCF2_HUMAN|.	I|H	786;726;687;871;786;329;802;726;742|229	ENSP00000427745:L786I;ENSP00000359608:L726I;ENSP00000438155:L687I;ENSP00000359610:L871I;ENSP00000397055:L786I;ENSP00000405848:L329I;ENSP00000430276:L802I;ENSP00000359605:L726I;ENSP00000342204:L742I|.	ENSP00000342204:L742I|.	L|P	-|-	1|2	0|0	MCF2|MCF2	138506475|138506475	1.000000|1.000000	0.71417|0.71417	0.007000|0.007000	0.13788|0.13788	0.924000|0.924000	0.55760|0.55760	1.874000|1.874000	0.39568|0.39568	-0.331000|-0.331000	0.08501|0.08501	0.600000|0.600000	0.82982|0.82982	CTT|CCT	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.408	MCF2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MCF2	protein_coding	OTTHUMT00000058560.1	G	NM_005369	-		138678809	-1	no_errors	ENST00000370578	ensembl	human	known	74_37	missense	SNP	0.977	T
ZHX1	11244	genome.wustl.edu	37	8	124266184	124266185	+	Frame_Shift_Ins	INS	-	-	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr8:124266184_124266185insT	ENST00000522655.1	-	3	2542_2543	c.2002_2003insA	c.(2002-2004)acafs	p.T668fs	ZHX1_ENST00000395571.3_Frame_Shift_Ins_p.T668fs|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000522595.1_5'Flank|ZHX1_ENST00000297857.2_Frame_Shift_Ins_p.T668fs			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	668					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			CTGCTCAGGTGTTTTTTTACAT	0.465																																																	0								ENSG00000165156																																			ZHX1	SO:0001589	frameshift_variant	0				HGNC	AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.2003dupA	8.37:g.124266191_124266191dupT	ENSP00000428821:p.Thr668fs	Somatic	0	63	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	33	26.67	Q8IWD8	Frame_Shift_Ins	INS	43	0.00	0	25	37.50	15	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.T668fs	ENST00000522655.1	37	c.2003_2002	CCDS6342.1	8																																																																																			-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.465	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZHX1	protein_coding	OTTHUMT00000381759.1	-				124266185	-1	no_errors	ENST00000297857	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.969	T
MUC4	4585	genome.wustl.edu	37	3	195516077	195516077	+	Missense_Mutation	SNP	A	A	G			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr3:195516077A>G	ENST00000463781.3	-	2	2833	c.2374T>C	c.(2374-2376)Tcc>Ccc	p.S792P	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S792P|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	797					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACCCTGAGGAGGCCGGTTCG	0.612																																																	0								ENSG00000145113						97.0	109.0	105.0					3																	195516077		2181	4272	6453	MUC4	SO:0001583	missense	0			-	HGNC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2374T>C	3.37:g.195516077A>G	ENSP00000417498:p.Ser792Pro	Somatic	0	21	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	9	60.00	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	25	0.00	0	22	47.62	20	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S792P	ENST00000463781.3	37	c.2374	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	7.348	0.622350	0.14193	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.48522	0.81;0.83	2.5	-0.11	0.13580	.	1.737300	0.03453	N	0.210939	T	0.37320	0.0999	L	0.39898	1.24	0.09310	N	1	B;B	0.26081	0.141;0.061	B;B	0.23419	0.046;0.021	T	0.14727	-1.0462	10	0.32370	T	0.25	-0.0193	4.7682	0.13142	0.6949:0.0:0.3051:0.0	.	792;797	E7ESK3;Q99102	.;MUC4_HUMAN	P	792;792;766	ENSP00000417498:S792P;ENSP00000420243:S792P	ENSP00000376209:S766P	S	-	1	0	MUC4	197000472	0.001000	0.12720	0.001000	0.08648	0.229000	0.25112	0.211000	0.17474	-0.009000	0.14296	0.510000	0.49958	TCC	-	NULL		0.612	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	A	NM_018406	-		195516077	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	SNP	0.002	G
TFDP1	7027	genome.wustl.edu	37	13	114277516	114277516	+	Missense_Mutation	SNP	T	T	G			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr13:114277516T>G	ENST00000375370.5	+	4	313	c.101T>G	c.(100-102)gTt>gGt	p.V34G	TFDP1_ENST00000544902.1_5'UTR|TFDP1_ENST00000465174.1_3'UTR|TFDP1_ENST00000538138.1_5'UTR	NM_007111.4	NP_009042.1	Q14186	TFDP1_HUMAN	transcription factor Dp-1	34					anoikis (GO:0043276)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA biosynthetic process (GO:2000278)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(10)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.132)|all_epithelial(44;0.0731)|all_lung(25;0.149)|Breast(118;0.153)	all cancers(43;0.0576)			CTCGTGGCCGTTCACCCCTCC	0.547										TSP Lung(29;0.18)																																							0								ENSG00000198176						104.0	79.0	88.0					13																	114277516		2202	4300	6502	TFDP1	SO:0001583	missense	0			-	HGNC	BC011685	CCDS9538.1	13q34	2008-07-18			ENSG00000198176	ENSG00000198176			11749	protein-coding gene	gene with protein product		189902				8413592, 9027491	Standard	NM_007111		Approved	Dp-1, DRTF1, DP1	uc001vtw.3	Q14186	OTTHUMG00000017388	ENST00000375370.5:c.101T>G	13.37:g.114277516T>G	ENSP00000364519:p.Val34Gly	Somatic	0	46	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	11	69.44	B4DLQ9|Q5JSB4|Q8IZL5	Missense_Mutation	SNP	28	0.00	0	8	75.00	24	pfam_Transc_factor_DP_C,pfam_E2F_TDP,pirsf_Transcrpt_fac_DP	p.V34G	ENST00000375370.5	37	c.101	CCDS9538.1	13	.	.	.	.	.	.	.	.	.	.	T	14.77	2.634184	0.47049	.	.	ENSG00000198176	ENST00000375370;ENST00000408980;ENST00000453989	T;T;T	0.34667	1.79;1.38;1.35	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.55465	0.1922	M	0.66939	2.045	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.85130	0.994;0.997;0.997	T	0.52510	-0.8566	10	0.22109	T	0.4	.	14.0931	0.65004	0.0:0.0:0.0:1.0	.	34;34;34	Q5JSB5;Q5JSB6;Q14186	.;.;TFDP1_HUMAN	G	34	ENSP00000364519:V34G;ENSP00000386145:V34G;ENSP00000401389:V34G	ENSP00000364519:V34G	V	+	2	0	TFDP1	113325517	1.000000	0.71417	0.112000	0.21494	0.149000	0.21700	6.559000	0.73946	1.727000	0.51537	0.402000	0.26972	GTT	-	pirsf_Transcrpt_fac_DP		0.547	TFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFDP1	protein_coding	OTTHUMT00000045918.3	T	NM_007111	-		114277516	+1	no_errors	ENST00000375370	ensembl	human	known	74_37	missense	SNP	1.000	G
DNHD1	144132	genome.wustl.edu	37	11	6566849	6566849	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr11:6566849G>T	ENST00000527990.2	+	19	4680	c.4680G>T	c.(4678-4680)caG>caT	p.Q1560H	DNHD1_ENST00000254579.6_Missense_Mutation_p.Q1560H			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1560					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		AAGGTGGGCAGTCCCTGCCTT	0.587																																																	0								ENSG00000179532						44.0	41.0	42.0					11																	6566849		692	1591	2283	DNHD1	SO:0001583	missense	0			-	HGNC	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.4680G>T	11.37:g.6566849G>T	ENSP00000436180:p.Gln1560His	Somatic	0	20	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	26	0.00	0	29	0.00	0	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_P-loop_NTPase,superfamily_t-SNARE	p.Q1560H	ENST00000527990.2	37	c.4680	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	G	10.47	1.359622	0.24598	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.46819	0.86;0.86	5.76	0.09	0.14461	.	0.761271	0.12815	N	0.436875	T	0.36991	0.0987	L	0.60455	1.87	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.39921	-0.9590	10	0.62326	D	0.03	.	1.9055	0.03276	0.2476:0.2148:0.4156:0.1219	.	1560	Q96M86	DNHD1_HUMAN	H	1560	ENSP00000254579:Q1560H;ENSP00000436180:Q1560H	ENSP00000254579:Q1560H	Q	+	3	2	DNHD1	6523425	0.000000	0.05858	0.002000	0.10522	0.251000	0.25915	-0.209000	0.09358	0.275000	0.22094	0.655000	0.94253	CAG	-	NULL		0.587	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	protein_coding	OTTHUMT00000384673.2	G	NM_144666	-		6566849	+1	no_errors	ENST00000254579	ensembl	human	known	74_37	missense	SNP	0.000	T
C20orf62	140834	genome.wustl.edu	37	20	43080770	43080770	+	Missense_Mutation	SNP	C	C	A			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr20:43080770C>A	ENST00000306731.4	-	3	266	c.218G>T	c.(217-219)aGc>aTc	p.S73I	RP5-1013A22.2_ENST00000415299.1_RNA			Q4KN68	CT062_HUMAN	chromosome 20 open reading frame 62	0										lung(1)	1						agctctgccgctaatattgga	0.473																																																	0								ENSG00000168746																																			C20orf62	SO:0001583	missense	0			-	HGNC		CCDS74729.1	20q13.12	2014-08-13			ENSG00000168746	ENSG00000168746			16195	protein-coding gene	gene with protein product							Standard	NM_001287807		Approved	dJ1013A22.3	uc002xmb.3	Q4KN68	OTTHUMG00000130221	ENST00000306731.4:c.218G>T	20.37:g.43080770C>A	ENSP00000304128:p.Ser73Ile	Somatic	0	46	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	56	11.11	A2A2S9|Q5QPC4	Missense_Mutation	SNP	32	0.00	0	40	11.11	5	NULL	p.S73I	ENST00000306731.4	37	c.218		20	.	.	.	.	.	.	.	.	.	.	C	3.537	-0.094472	0.07053	.	.	ENSG00000168746	ENST00000306731	.	.	.	2.4	0.366	0.16136	.	.	.	.	.	T	0.38904	0.1058	.	.	.	.	.	.	.	.	.	.	.	.	T	0.48990	-0.8985	4	0.87932	D	0	.	3.5891	0.07982	0.0:0.5768:0.2656:0.1575	.	.	.	.	I	73	.	ENSP00000304128:S73I	S	-	2	0	C20orf62	42514184	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-1.327000	0.02682	0.149000	0.19098	0.596000	0.82720	AGC	-	NULL		0.473	C20orf62-001	PUTATIVE	basic|appris_candidate	protein_coding	C20orf62	protein_coding	OTTHUMT00000252540.1	C		-		43080770	-1	no_errors	ENST00000306731	ensembl	human	putative	74_37	missense	SNP	0.000	A
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037843	10037843	+	RNA	SNP	C	C	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chrY:10037843C>T	ENST00000515896.1	+	0	80									RNA, 5.8S ribosomal pseudogene 6																		AATTGCAGGACACATTGATCA	0.512																																																	0								ENSG00000251705																																			RNA5-8SP6			0			-	HGNC			Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037843C>T		Somatic	0	64	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09		RNA	SNP	57	5.00	3	75	6.25	5	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			-	-		0.512	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	rRNA		C		-		10037843	+1	no_errors	ENST00000515896	ensembl	human	known	74_37	rna	SNP	1.000	T
OR5M8	219484	genome.wustl.edu	37	11	56258788	56258788	+	Missense_Mutation	SNP	C	C	T	rs574852072	byFrequency	TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr11:56258788C>T	ENST00000327216.2	-	1	83	c.59G>A	c.(58-60)cGg>cAg	p.R20Q		NM_001005282.1	NP_001005282.1	Q8NGP6	OR5M8_HUMAN	olfactory receptor, family 5, subfamily M, member 8	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(22)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	Esophageal squamous(21;0.00352)					TTGTAATTCCCGGCGACTGGT	0.483													C|||	4	0.000798722	0.0	0.0014	5008	,	,		19178	0.0		0.0	False		,,,				2504	0.0031																0								ENSG00000181371						80.0	85.0	83.0					11																	56258788		2201	4296	6497	OR5M8	SO:0001583	missense	0			-	HGNC	AB065744	CCDS31533.1	11q11	2012-08-09			ENSG00000181371	ENSG00000181371		"""GPCR / Class A : Olfactory receptors"""	14846	protein-coding gene	gene with protein product							Standard	NM_001005282		Approved		uc001nix.1	Q8NGP6	OTTHUMG00000166877	ENST00000327216.2:c.59G>A	11.37:g.56258788C>T	ENSP00000323354:p.Arg20Gln	Somatic	0	18	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	7	56.25	B2RNM5|Q6IEW3|Q96RB8	Missense_Mutation	SNP	36	0.00	0	22	56.00	28	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R20Q	ENST00000327216.2	37	c.59	CCDS31533.1	11	.	.	.	.	.	.	.	.	.	.	C	8.855	0.945463	0.18356	.	.	ENSG00000181371	ENST00000327216	T	0.00433	7.43	4.13	-7.18	0.01505	.	1.292630	0.06259	U	0.693636	T	0.00144	0.0004	N	0.03154	-0.405	0.09310	N	1	B	0.13145	0.007	B	0.04013	0.001	T	0.36915	-0.9728	10	0.39692	T	0.17	0.1659	3.5083	0.07699	0.209:0.2522:0.4222:0.1166	.	20	Q8NGP6	OR5M8_HUMAN	Q	20	ENSP00000323354:R20Q	ENSP00000323354:R20Q	R	-	2	0	OR5M8	56015364	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.691000	0.00198	-1.486000	0.01851	-1.292000	0.01352	CGG	-	NULL		0.483	OR5M8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M8	protein_coding	OTTHUMT00000391641.1	C	NM_001005282	-		56258788	-1	no_errors	ENST00000327216	ensembl	human	known	74_37	missense	SNP	0.000	T
LOC644794	644794	genome.wustl.edu	37	7	66369212	66369213	+	lincRNA	INS	-	-	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr7:66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC	ENST00000610177.1	+	0	1369_1370																											TGCCTCGTGGCGGCCTTCCCCG	0.738																																																	0								ENSG00000273142																																			RP11-458F8.4			0				Clone_based_vega_gene																													7.37:g.66369212_66369213insGGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC		Somatic	NA	NA	NA		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	24	0.00	0	52	0.00	0	-	NULL	ENST00000610177.1	37	NULL		7																																																																																			-	-		0.738	RP11-458F8.4-001	KNOWN	basic	lincRNA	LOC644794	lincRNA	OTTHUMT00000472525.1	-				66369213	+1	no_errors	ENST00000610177	ensembl	human	known	74_37	rna	INS	0.293:0.454	GGCCTTTCCAGGCCCAGCTCTCGCCTCCCGGC
ARHGEF17	9828	genome.wustl.edu	37	11	73021059	73021059	+	Missense_Mutation	SNP	G	G	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr11:73021059G>T	ENST00000263674.3	+	1	1726	c.1376G>T	c.(1375-1377)cGg>cTg	p.R459L	RP11-800A3.7_ENST00000546324.1_RNA	NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	459					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						AGTCGACAGCGGAAGTCCCTG	0.582																																																	0								ENSG00000110237						73.0	78.0	76.0					11																	73021059		2200	4293	6493	ARHGEF17	SO:0001583	missense	0			-	HGNC	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.1376G>T	11.37:g.73021059G>T	ENSP00000263674:p.Arg459Leu	Somatic	0	31	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	9	55.00	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	29	0.00	0	6	77.78	21	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,superfamily_Vinculin/catenin,smart_DH-domain,pfscan_DH-domain	p.R459L	ENST00000263674.3	37	c.1376	CCDS8221.1	11	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595191	0.46318	.	.	ENSG00000110237	ENST00000263674	T	0.63913	-0.07	5.13	5.13	0.70059	.	0.293946	0.28088	N	0.016654	T	0.64000	0.2559	L	0.27053	0.805	0.33909	D	0.639432	D	0.58268	0.982	P	0.54759	0.76	T	0.75456	-0.3311	10	0.87932	D	0	-15.9157	17.1507	0.86777	0.0:0.0:1.0:0.0	.	459	Q96PE2	ARHGH_HUMAN	L	459	ENSP00000263674:R459L	ENSP00000263674:R459L	R	+	2	0	ARHGEF17	72698707	1.000000	0.71417	0.899000	0.35326	0.495000	0.33615	5.328000	0.65887	2.387000	0.81309	0.462000	0.41574	CGG	-	NULL		0.582	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF17	protein_coding	OTTHUMT00000397365.1	G	NM_014786	-		73021059	+1	no_errors	ENST00000263674	ensembl	human	known	74_37	missense	SNP	0.936	T
NBPF1	55672	genome.wustl.edu	37	1	16899669	16899669	+	Silent	SNP	C	C	T	rs373211172		TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr1:16899669C>T	ENST00000430580.2	-	22	3305	c.2418G>A	c.(2416-2418)gaG>gaA	p.E806E	NBPF1_ENST00000287968.8_3'UTR|NBPF1_ENST00000432949.1_Silent_p.E264E|NBPF1_ENST00000420031.2_Silent_p.E24E	NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	806	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.|Poly-Glu.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CTTCCTCTTCCTCATCATCAC	0.383																																																	0								ENSG00000219481						3.0	2.0	2.0					1																	16899669		574	1351	1925	NBPF1	SO:0001819	synonymous_variant	0			-	HGNC	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.2418G>A	1.37:g.16899669C>T		Somatic	0	12	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	Q8N4E8|Q9C0H0	Silent	SNP	9	0.00	0	8	11.11	1	pfam_NBPF_dom	p.E264	ENST00000430580.2	37	c.792		1																																																																																			-	NULL		0.383	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	protein_coding	OTTHUMT00000106436.3	C	NM_017940	-		16899669	-1	no_errors	ENST00000432949	ensembl	human	known	74_37	silent	SNP	0.002	T
LRRC20	55222	genome.wustl.edu	37	10	72083656	72083656	+	Silent	SNP	C	C	A			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr10:72083656C>A	ENST00000355790.4	-	4	840	c.363G>T	c.(361-363)gcG>gcT	p.A121A	LRRC20_ENST00000358141.2_Silent_p.A71A|LRRC20_ENST00000395011.1_Silent_p.A71A|LRRC20_ENST00000373224.1_Silent_p.A121A|LRRC20_ENST00000395010.1_Intron	NM_001278212.1|NM_001278214.1|NM_207119.1	NP_001265141.1|NP_001265143.1|NP_997002.1	Q8TCA0	LRC20_HUMAN	leucine rich repeat containing 20	121										endometrium(2)|large_intestine(4)|lung(2)|urinary_tract(1)	9						TGGTCTCCAGCGCCGGCAGGG	0.657																																																	0								ENSG00000172731						73.0	67.0	69.0					10																	72083656		2203	4300	6503	LRRC20	SO:0001819	synonymous_variant	0			-	HGNC	BC024001	CCDS7300.1, CCDS7301.1, CCDS7302.1, CCDS73145.1	10q22.2	2004-04-15			ENSG00000172731	ENSG00000172731			23421	protein-coding gene	gene with protein product							Standard	NM_207119		Approved	FLJ10751, FLJ10844	uc031pvr.1	Q8TCA0	OTTHUMG00000018407	ENST00000355790.4:c.363G>T	10.37:g.72083656C>A		Somatic	0	31	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	9	59.09	Q5T6D4|Q5T6D6|Q9NVA6|Q9NVG3	Silent	SNP	28	0.00	0	4	82.61	19	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A121	ENST00000355790.4	37	c.363	CCDS7302.1	10																																																																																			-	smart_Leu-rich_rpt_typical-subtyp		0.657	LRRC20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC20	protein_coding	OTTHUMT00000048510.1	C	NM_018239	-		72083656	-1	no_errors	ENST00000355790	ensembl	human	known	74_37	silent	SNP	0.006	A
SAG	6295	genome.wustl.edu	37	2	234255546	234255546	+	Silent	SNP	C	C	T			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr2:234255546C>T	ENST00000409110.1	+	16	1436	c.1206C>T	c.(1204-1206)gaC>gaT	p.D402D		NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	402					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		ACAAGAATGACGTTGATGAGT	0.448																																																	0								ENSG00000130561						93.0	98.0	96.0					2																	234255546		2010	4177	6187	SAG	SO:0001819	synonymous_variant	0			-	HGNC		CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.1206C>T	2.37:g.234255546C>T		Somatic	0	63	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	35	45.31	A0FDN6|Q53SV3|Q99858	Silent	SNP	35	0.00	0	27	47.06	24	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.D402	ENST00000409110.1	37	c.1206	CCDS46545.1	2																																																																																			-	NULL		0.448	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAG	protein_coding	OTTHUMT00000330126.1	C	NM_000541	-		234255546	+1	no_errors	ENST00000409110	ensembl	human	known	74_37	silent	SNP	0.000	T
SLC27A2	11001	genome.wustl.edu	37	15	50515326	50515326	+	Silent	SNP	T	T	C			TCGA-HB-A5W3-01A-11D-A29N-09	TCGA-HB-A5W3-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4d4eff82-ede0-47f1-b49a-ada025952114	546cfd48-e472-4186-a83a-09f5aef53000	g.chr15:50515326T>C	ENST00000267842.5	+	5	1369	c.1137T>C	c.(1135-1137)ggT>ggC	p.G379G	SLC27A2_ENST00000544960.1_Silent_p.G144G|SLC27A2_ENST00000380902.4_Silent_p.G326G|Y_RNA_ENST00000363735.1_RNA	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	379					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		GAAAAGTTGGTGCTGTTGGAA	0.378																																																	0								ENSG00000140284						128.0	118.0	121.0					15																	50515326		2196	4295	6491	SLC27A2	SO:0001819	synonymous_variant	0			-	HGNC	D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.1137T>C	15.37:g.50515326T>C		Somatic	0	43	0.00		0.6625809360319761	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	33	40.00	A8K2J7|Q53FY6|Q6PF09	Silent	SNP	36	0.00	0	34	46.97	31	pfam_AMP-dep_Synth/Lig	p.G379	ENST00000267842.5	37	c.1137	CCDS10133.1	15																																																																																			-	pfam_AMP-dep_Synth/Lig		0.378	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A2	protein_coding	OTTHUMT00000254539.2	T	NM_003645	-		50515326	+1	no_errors	ENST00000267842	ensembl	human	known	74_37	silent	SNP	0.775	C
