#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
CCDC144NL-AS1	440416	genome.wustl.edu	37	17	20841832	20841833	+	RNA	INS	-	-	CGATGA	rs11282828|rs375875297	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:20841832_20841833insCGATGA	ENST00000580278.1	+	0	819_820				RP11-344E13.3_ENST00000577968.1_RNA|RP11-344E13.3_ENST00000423473.2_RNA|RP11-344E13.3_ENST00000439794.2_RNA|RP11-381P6.1_ENST00000582583.1_RNA|RP11-344E13.3_ENST00000437829.1_RNA|RP11-344E13.3_ENST00000583481.1_RNA|RP11-344E13.3_ENST00000580056.1_RNA|RP11-344E13.3_ENST00000433763.2_RNA																							TAGTTCAGAAGCGACCGGGAGC	0.515														2914	0.581869	0.7564	0.5346	5008	,	,		20140	0.6091		0.5249	False		,,,				2504	0.41																0								ENSG00000233098																																			RP11-344E13.3			0				Clone_based_vega_gene																													17.37:g.20841832_20841833insCGATGA		Somatic	NA	NA	NA		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000580278.1	37	NULL		17																																																																																			-	-		0.515	RP11-344E13.3-016	KNOWN	basic	antisense	LOC440416	antisense	OTTHUMT00000444301.1	-				20841833	+1	no_errors	ENST00000577968	ensembl	human	known	74_37	rna	INS	0.003:0.002	CGATGA
GCH1	2643	genome.wustl.edu	37	14	55309792	55309792	+	3'UTR	SNP	T	T	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr14:55309792T>A	ENST00000491895.2	-	0	1884				GCH1_ENST00000543643.2_Intron|GCH1_ENST00000395514.1_Intron|GCH1_ENST00000536224.2_Intron|GCH1_ENST00000254299.4_5'UTR	NM_000161.2	NP_000152.1	P30793	GCH1_HUMAN	GTP cyclohydrolase 1						7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|dopamine biosynthetic process (GO:0042416)|GTP catabolic process (GO:0006184)|metabolic process (GO:0008152)|negative regulation of blood pressure (GO:0045776)|neuromuscular process controlling posture (GO:0050884)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric-oxide synthase activity (GO:0051000)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|pteridine-containing compound biosynthetic process (GO:0042559)|regulation of blood pressure (GO:0008217)|regulation of lung blood pressure (GO:0014916)|regulation of nitric-oxide synthase activity (GO:0050999)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to pain (GO:0048265)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|tetrahydrofolate biosynthetic process (GO:0046654)|vasodilation (GO:0042311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|coenzyme binding (GO:0050662)|GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(2)|lung(7)|skin(2)	11						ATGGGCACTCTCAAATGTTTC	0.388																																					Pancreas(198;1245 2204 4807 21567 38372)												0								ENSG00000131979						64.0	59.0	61.0					14																	55309792		1849	4095	5944	GCH1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U19523	CCDS9720.1, CCDS41954.1, CCDS45110.1	14q22.1-q22.2	2014-04-01	2008-08-01		ENSG00000131979	ENSG00000131979	3.5.4.16		4193	protein-coding gene	gene with protein product	"""dopa-responsive dystonia"""	600225	"""dystonia 14"""	GCH, DYT5, DYT14		7874165, 8695054	Standard	XM_005267530		Approved	GTPCH1, DYT5a	uc001xbi.1	P30793	OTTHUMG00000029754	ENST00000491895.2:c.*943A>T	14.37:g.55309792T>A		Somatic	0	30	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64	Q6FHY7|Q9Y4I8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000491895.2	37	NULL	CCDS9720.1	14																																																																																			-	-		0.388	GCH1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	GCH1	protein_coding	OTTHUMT00000276895.3	T		-		55309792	-1	no_errors	ENST00000254299	ensembl	human	known	74_37	rna	SNP	0.000	A
RP11-782C8.1	0	genome.wustl.edu	37	1	143230119	143230120	+	lincRNA	INS	-	-	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:143230119_143230120insA	ENST00000438000.1	+	0	147				RP11-782C8.5_ENST00000427309.1_lincRNA																							CCAGTTCATTTTTTTTCAGCTC	0.317																																																	0								ENSG00000225278																																			RP11-782C8.5			0				Clone_based_vega_gene																													1.37:g.143230119_143230120insA		Somatic	0	22	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	20	9.09		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000438000.1	37	NULL		1																																																																																			-	-		0.317	RP11-782C8.1-002	KNOWN	basic	lincRNA	LOC101930284	lincRNA	OTTHUMT00000037560.1	-				143230120	-1	no_errors	ENST00000427309	ensembl	human	known	74_37	rna	INS	0.000:0.001	A
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
RIOK1	83732	genome.wustl.edu	37	6	7403055	7403055	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr6:7403055G>A	ENST00000379834.2	+	8	1199	c.692G>A	c.(691-693)cGt>cAt	p.R231H		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	231	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					TCAAGATTTCGTCATGGCTAT	0.318																																																	0								ENSG00000124784						70.0	72.0	71.0					6																	7403055		2203	4300	6503	RIOK1	SO:0001583	missense	0			-	HGNC	BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.692G>A	6.37:g.7403055G>A	ENSP00000369162:p.Arg231His	Somatic	0	65	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	25	45.65	B2RB28|Q8NDC8|Q96NV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RIO-like_kinase,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio1	p.R231H	ENST00000379834.2	37	c.692	CCDS4500.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.537226	0.96460	.	.	ENSG00000124784	ENST00000379834	T	0.07327	3.2	6.17	6.17	0.99709	RIO kinase (1);Protein kinase-like domain (1);RIO-like kinase (1);	0.000000	0.85682	D	0.000000	T	0.28167	0.0695	M	0.85710	2.77	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.01198	-1.1421	10	0.56958	D	0.05	-14.4981	19.8676	0.96824	0.0:0.0:1.0:0.0	.	231	Q9BRS2	RIOK1_HUMAN	H	231	ENSP00000369162:R231H	ENSP00000369162:R231H	R	+	2	0	RIOK1	7348054	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.332000	0.96446	2.941000	0.99782	0.655000	0.94253	CGT	-	pfam_RIO-like_kinase,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio1		0.318	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK1	protein_coding	OTTHUMT00000039780.2	G	NM_031480	-		7403055	+1	no_errors	ENST00000379834	ensembl	human	known	74_37	missense	SNP	1.000	A
DST	667	genome.wustl.edu	37	6	56504764	56504764	+	Missense_Mutation	SNP	T	T	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr6:56504764T>A	ENST00000361203.3	-	15	1956	c.1949A>T	c.(1948-1950)gAa>gTa	p.E650V	DST_ENST00000370788.2_Missense_Mutation_p.E650V|DST_ENST00000370765.6_Missense_Mutation_p.E324V|DST_ENST00000370754.5_Missense_Mutation_p.E828V|DST_ENST00000244364.6_Missense_Mutation_p.E324V|DST_ENST00000370769.4_Missense_Mutation_p.E650V|DST_ENST00000446842.2_Missense_Mutation_p.E324V|DST_ENST00000312431.6_Missense_Mutation_p.E650V|DST_ENST00000518935.1_Missense_Mutation_p.E324V|DST_ENST00000421834.2_Missense_Mutation_p.E650V			Q03001	DYST_HUMAN	dystonin	650					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGATTCAAATTCTTCAATAGC	0.328																																																	0								ENSG00000151914						55.0	60.0	58.0					6																	56504764		2202	4299	6501	DST	SO:0001583	missense	0			-	HGNC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.1949A>T	6.37:g.56504764T>A	ENSP00000354508:p.Glu650Val	Somatic	0	21	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	15	48.28	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.E828V	ENST00000361203.3	37	c.2483		6	.	.	.	.	.	.	.	.	.	.	T	23.2	4.386649	0.82902	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203;ENST00000520645;ENST00000370765;ENST00000518935	D;D;D;D;D;D;D;D;D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26;-3.26;-3.26;-3.26;-3.26;-3.26;-3.26;-3.26;-3.26	5.45	5.45	0.79879	.	0.000000	0.50627	D	0.000101	D	0.95809	0.8636	M	0.76170	2.325	0.34762	D	0.732858	D;D;D;D;D;D;D;D;D;D	0.76494	0.995;0.993;0.995;0.993;0.999;0.992;0.997;0.998;0.993;0.98	D;P;D;P;D;D;D;D;P;D	0.91635	0.983;0.849;0.983;0.849;0.969;0.915;0.992;0.999;0.849;0.934	D	0.95781	0.8817	9	0.52906	T	0.07	.	15.6785	0.77349	0.0:0.0:0.0:1.0	.	679;650;650;828;766;324;324;324;650;324	B4DGY0;Q5TBT1;E7ERU2;E9PEB9;Q03001-13;Q6P0N6;Q03001-3;Q03001-9;Q03001;Q03001-8	.;.;.;.;.;.;.;.;DYST_HUMAN;.	V	324;828;650;650;324;650;650;650;324;690;324;324	ENSP00000244364:E324V;ENSP00000359790:E828V;ENSP00000359805:E650V;ENSP00000400883:E650V;ENSP00000393645:E324V;ENSP00000307959:E650V;ENSP00000359824:E650V;ENSP00000354508:E650V;ENSP00000404924:E324V;ENSP00000431030:E690V;ENSP00000359801:E324V;ENSP00000431003:E324V	ENSP00000244364:E324V	E	-	2	0	DST	56612723	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.868000	0.87116	2.288000	0.76882	0.533000	0.62120	GAA	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.328	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	T	NM_001723	-		56504764	-1	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	SNP	1.000	A
HSPA2	3306	genome.wustl.edu	37	14	65008936	65008936	+	Missense_Mutation	SNP	A	A	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr14:65008936A>T	ENST00000394709.1	+	2	1445	c.1369A>T	c.(1369-1371)Aac>Tac	p.N457Y	RP11-973N13.4_ENST00000554918.1_RNA|HSPA2_ENST00000247207.6_Missense_Mutation_p.N457Y			P54652	HSP72_HUMAN	heat shock 70kDa protein 2	457					male meiosis (GO:0007140)|male meiosis I (GO:0007141)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G2/M transition of mitotic cell cycle (GO:0031662)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)|spermatid development (GO:0007286)|synaptonemal complex disassembly (GO:0070194)	blood microparticle (GO:0072562)|CatSper complex (GO:0036128)|cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycolipid binding (GO:0051861)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CAAGGACAATAACCTGCTGGG	0.592																																					Pancreas(136;1211 1835 24894 31984 38227)												0								ENSG00000126803						72.0	68.0	70.0					14																	65008936		2203	4300	6503	HSPA2	SO:0001583	missense	0			-	HGNC	L26336, BC001752	CCDS9766.1	14q23	2012-10-02	2002-08-29		ENSG00000126803	ENSG00000126803		"""Heat shock proteins / HSP70"""	5235	protein-coding gene	gene with protein product		140560	"""heat shock 70kD protein 2"""				Standard	NM_021979		Approved		uc001xhk.4	P54652	OTTHUMG00000141311	ENST00000394709.1:c.1369A>T	14.37:g.65008936A>T	ENSP00000378199:p.Asn457Tyr	Somatic	0	21	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	29	38.30	Q15508|Q53XM3|Q9UE78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.N457Y	ENST00000394709.1	37	c.1369	CCDS9766.1	14	.	.	.	.	.	.	.	.	.	.	A	17.69	3.450669	0.63290	.	.	ENSG00000126803	ENST00000394709;ENST00000247207;ENST00000545222	T;T	0.01051	5.4;5.4	4.9	4.9	0.64082	.	0.000000	0.64402	U	0.000014	T	0.11707	0.0285	H	0.96720	3.87	0.48452	D	0.999651	D	0.76494	0.999	D	0.67725	0.953	T	0.03673	-1.1014	10	0.87932	D	0	-1.071	14.5952	0.68400	1.0:0.0:0.0:0.0	.	457	P54652	HSP72_HUMAN	Y	457;457;231	ENSP00000378199:N457Y;ENSP00000247207:N457Y	ENSP00000247207:N457Y	N	+	1	0	HSPA2	64078689	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.280000	0.95786	1.851000	0.53745	0.456000	0.33151	AAC	-	pfam_Hsp_70_fam		0.592	HSPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA2	protein_coding	OTTHUMT00000280651.1	A		-		65008936	+1	no_errors	ENST00000247207	ensembl	human	known	74_37	missense	SNP	1.000	T
TNFSF12	8742	genome.wustl.edu	37	17	7460466	7460466	+	Silent	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:7460466G>A	ENST00000293825.6	+	7	812	c.549G>A	c.(547-549)gtG>gtA	p.V183V	TNFSF13_ENST00000396545.4_5'Flank|TNFSF13_ENST00000338784.4_5'Flank|TNFSF13_ENST00000349228.4_5'Flank|TNFSF12_ENST00000557233.1_Intron|TNFSF12-TNFSF13_ENST00000293826.4_Intron|TNFSF13_ENST00000483039.1_5'Flank|TNFSF12_ENST00000462811.1_3'UTR|TNFSF13_ENST00000380535.4_5'Flank|TNFSF13_ENST00000396542.1_5'Flank	NM_003809.2	NP_003800.1	O43508	TNF12_HUMAN	tumor necrosis factor (ligand) superfamily, member 12	183					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|endothelial cell migration (GO:0043542)|immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|prostate(2)	11		Prostate(122;0.157)				ACTTGCTGGTGGATGGTGTGC	0.652																																																	0								ENSG00000239697						119.0	87.0	98.0					17																	7460466		2203	4300	6503	TNFSF12	SO:0001819	synonymous_variant	0			-	HGNC	AF030099	CCDS11109.1	17p13.1	2008-02-01			ENSG00000239697	ENSG00000239697		"""Tumor necrosis factor (ligand) superfamily"""	11927	protein-coding gene	gene with protein product		602695				9405449, 9560343	Standard	NM_003809		Approved	TWEAK, DR3LG, APO3L		O43508	OTTHUMG00000108148	ENST00000293825.6:c.549G>A	17.37:g.7460466G>A		Somatic	0	57	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	39	36.07	Q8IZK7|Q8WUZ7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom	p.V183	ENST00000293825.6	37	c.549	CCDS11109.1	17																																																																																			-	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom		0.652	TNFSF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF12	protein_coding	OTTHUMT00000226951.2	G	NM_003809	-		7460466	+1	no_errors	ENST00000293825	ensembl	human	known	74_37	silent	SNP	0.961	A
SCNN1A	6337	genome.wustl.edu	37	12	6464555	6464555	+	Silent	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr12:6464555C>T	ENST00000228916.2	-	6	1124	c.1026G>A	c.(1024-1026)ctG>ctA	p.L342L	SCNN1A_ENST00000540037.1_Silent_p.L42L|SCNN1A_ENST00000396966.2_Silent_p.L342L|SCNN1A_ENST00000358945.3_Silent_p.L342L|SCNN1A_ENST00000538979.1_5'UTR|SCNN1A_ENST00000543768.1_Silent_p.L365L|SCNN1A_ENST00000360168.3_Silent_p.L401L	NM_001038.5	NP_001029.1	P37088	SCNNA_HUMAN	sodium channel, non-voltage-gated 1 alpha subunit	342					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|ciliary membrane (GO:0060170)|cortical actin cytoskeleton (GO:0030864)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(2)|lung(6)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Amiloride(DB00594)|Triamterene(DB00384)	CTGTGGACAGCAGGGGAATGA	0.572																																																	0								ENSG00000111319						51.0	44.0	46.0					12																	6464555		2203	4300	6503	SCNN1A	SO:0001819	synonymous_variant	0			-	HGNC	Z92978	CCDS8543.1, CCDS53738.1, CCDS53739.1	12p13	2012-02-28	2012-02-28		ENSG00000111319	ENSG00000111319		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10599	protein-coding gene	gene with protein product		600228	"""sodium channel, nonvoltage-gated 1 alpha"", ""sodium channel, non-voltage-gated 1 alpha"""	SCNN1		7896277	Standard	NM_001038		Approved	ENaCalpha	uc001qnw.3	P37088	OTTHUMG00000168268	ENST00000228916.2:c.1026G>A	12.37:g.6464555C>T		Somatic	0	14	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	3	75.00	A5X2U9|B4E2Q5|C5HTZ0|O43271|Q6GSQ6|Q9UM64	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.L342	ENST00000228916.2	37	c.1026	CCDS8543.1	12																																																																																			-	pfam_Na+channel_ASC,tigrfam_EnaC		0.572	SCNN1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCNN1A	protein_coding	OTTHUMT00000399055.1	C		-		6464555	-1	no_errors	ENST00000358945	ensembl	human	known	74_37	silent	SNP	0.998	T
KLRC3	3823	genome.wustl.edu	37	12	10588530	10588530	+	Missense_Mutation	SNP	C	C	G	rs75545535		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr12:10588530C>G	ENST00000539033.1	-	1	70	c.56G>C	c.(55-57)cGg>cCg	p.R19P	KLRC2_ENST00000381902.2_Missense_Mutation_p.R19P|KLRC2_ENST00000381901.1_Missense_Mutation_p.R19P|KLRC2_ENST00000536833.2_Intron																							CCTTTGCTGCCGCTTTGGGTC	0.433																																																	0								ENSG00000255641						256.0	255.0	255.0					12																	10588530		2203	4300	6503	NKG2-E	SO:0001583	missense	0			-	Uniprot_gn																												ENST00000539033.1:c.56G>C	12.37:g.10588530C>G	ENSP00000437563:p.Arg19Pro	Somatic	0	55	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	49	12.50		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.R19P	ENST00000539033.1	37	c.56		12	557	0.25503663003663	67	0.13617886178861788	117	0.32320441988950277	145	0.2534965034965035	228	0.3007915567282322	C	11.56	1.674672	0.29693	.	.	ENSG00000255641;ENSG00000205809;ENSG00000205809	ENST00000539033;ENST00000381902;ENST00000381901	T;T;T	0.05996	3.36;3.36;3.36	2.57	-0.0579	0.13799	.	0.475912	0.19666	N	0.108869	T	0.00012	0.0000	L	0.61387	1.9	0.09310	N	1	P;P;D	0.76494	0.932;0.921;0.999	P;P;D	0.70935	0.796;0.88;0.971	T	0.48364	-0.9042	10	0.72032	D	0.01	.	4.9087	0.13811	0.0:0.5158:0.0:0.4842	.	5;19;19	Q3KQS7;P26717;F5H6K3	.;NKG2C_HUMAN;.	P	19	ENSP00000437563:R19P;ENSP00000371327:R19P;ENSP00000371326:R19P	ENSP00000371326:R19P	R	-	2	0	KLRC2;RP11-277P12.6	10479797	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.155000	0.10115	-0.169000	0.10834	0.184000	0.17185	CGG	-	NULL		0.433	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	ENSG00000255641	protein_coding	OTTHUMT00000400274.1	C		rs75545535		10588530	-1	no_errors	ENST00000539033	ensembl	human	known	74_37	missense	SNP	0.000	G
KDM6B	23135	genome.wustl.edu	37	17	7750178	7750183	+	In_Frame_Del	DEL	ACCACC	ACCACC	-			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	ACCACC	ACCACC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:7750178_7750183delACCACC	ENST00000448097.2	+	9	1084_1089	c.753_758delACCACC	c.(751-759)ttaccacca>tta	p.PP262del	KDM6B_ENST00000254846.5_In_Frame_Del_p.PP262del			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	262	Pro-rich.				cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						caccaccattaccaccaccaccacca	0.607																																																	0								ENSG00000132510																																			KDM6B	SO:0001651	inframe_deletion	0				HGNC	AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.753_758delACCACC	17.37:g.7750184_7750189delACCACC	ENSP00000412513:p.Pro262_Pro263del	Somatic	NA	NA	NA		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9IZ40|Q96G33	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.PP255in_frame_del	ENST00000448097.2	37	c.753_758		17																																																																																			-	NULL		0.607	KDM6B-002	KNOWN	basic	protein_coding	KDM6B	protein_coding	OTTHUMT00000440248.1	ACCACC	XM_043272			7750183	+1	no_errors	ENST00000254846	ensembl	human	known	74_37	in_frame_del	DEL	0.528:0.804:0.807:0.775:0.765:0.746	-
CDC73	79577	genome.wustl.edu	37	1	193181546	193181546	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:193181546C>T	ENST00000367435.3	+	13	1277	c.1093C>T	c.(1093-1095)Cct>Tct	p.P365S		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	365	Interaction with POLR2A and PAF1.				cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						TATCATAATTCCTGCAGCTAC	0.303																																																	0								ENSG00000134371						139.0	154.0	149.0					1																	193181546		2203	4299	6502	CDC73	SO:0001583	missense	0			-	HGNC	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.1093C>T	1.37:g.193181546C>T	ENSP00000356405:p.Pro365Ser	Somatic	0	93	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	64	29.67	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_access_fac_Cdc73	p.P365S	ENST00000367435.3	37	c.1093	CCDS1382.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.143327|5.143327	0.94560|0.94560	.|.	.|.	ENSG00000134371|ENSG00000134371	ENST00000367435|ENST00000445394	T|.	0.69926|.	-0.44|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77579|0.77579	0.4151|0.4151	M|M	0.69248|0.69248	2.105|2.105	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.71656|.	0.974|.	T|T	0.77284|0.77284	-0.2645|-0.2645	10|6	0.31617|0.72032	T|D	0.26|0.01	-14.049|-14.049	20.6593|20.6593	0.99626|0.99626	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	365|.	Q6P1J9|.	CDC73_HUMAN|.	S|F	365|306	ENSP00000356405:P365S|.	ENSP00000356405:P365S|ENSP00000398808:S306F	P|S	+|+	1|2	0|0	CDC73|CDC73	191448169|191448169	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.911000|6.911000	0.75746|0.75746	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	CCT|TCC	-	pfam_RNA_pol_access_fac_Cdc73		0.303	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC73	protein_coding	OTTHUMT00000086696.2	C	NM_024529	-		193181546	+1	no_errors	ENST00000367435	ensembl	human	known	74_37	missense	SNP	1.000	T
MTAP	4507	genome.wustl.edu	37	9	21861903	21861903	+	Intron	DEL	T	T	-	rs11356405|rs67222036	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr9:21861903delT	ENST00000460874.2	+	8	1089				MTAP_ENST00000580900.1_Intron|MTAP_ENST00000380172.4_Intron|RP11-70L8.4_ENST00000581788.1_RNA|RP11-145E5.5_ENST00000404796.2_Intron					methylthioadenosine phosphorylase									p.0(1)|p.0?(1)		central_nervous_system(1)|endometrium(2)|kidney(3)|lung(3)|pancreas(1)	10		all_cancers(5;0)|Hepatocellular(5;0.00162)|Colorectal(97;0.173)		GBM - Glioblastoma multiforme(3;0)|Lung(24;2.24e-57)|LUSC - Lung squamous cell carcinoma(38;1.97e-36)|STAD - Stomach adenocarcinoma(4;3.26e-05)|OV - Ovarian serous cystadenocarcinoma(39;0.00931)|COAD - Colon adenocarcinoma(8;0.15)		TCAAAATCTGTTTTTTTTTTT	0.328																																																	2	Whole gene deletion(2)	lung(2)						ENSG00000265194						66.0	57.0	60.0					9																	21861903		692	1591	2283	RP11-70L8.4	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB062485	CCDS6509.1	9p21	2013-05-29			ENSG00000099810	ENSG00000099810	2.4.2.28		7413	protein-coding gene	gene with protein product	"""S-methyl-5'-thioadenosine phosphorylase"""	156540				11126361	Standard	NM_002451		Approved	MSAP, c86fus	uc003zph.3	Q13126	OTTHUMG00000019690	ENST00000460874.2:c.865-72T>-	9.37:g.21861903delT		Somatic	0	10	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000460874.2	37	NULL		9																																																																																			-	-		0.328	MTAP-003	PUTATIVE	basic|exp_conf	protein_coding	ENSG00000265194	protein_coding	OTTHUMT00000051929.2	T	NM_002451			21861903	-1	no_errors	ENST00000581788	ensembl	human	known	74_37	rna	DEL	0.000	-
TWIST1	7291	genome.wustl.edu	37	7	19156406	19156406	+	Missense_Mutation	SNP	T	T	C			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr7:19156406T>C	ENST00000242261.5	-	1	889	c.539A>G	c.(538-540)cAc>cGc	p.H180R	AC003986.6_ENST00000419944.1_RNA	NM_000474.3	NP_000465.1	Q15672	TWST1_HUMAN	twist family bHLH transcription factor 1	180	Sufficient for transactivation activity. {ECO:0000250}.				aortic valve morphogenesis (GO:0003180)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in heart valve development (GO:2000793)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cranial suture morphogenesis (GO:0060363)|embryonic camera-type eye formation (GO:0060900)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cushion morphogenesis (GO:0003203)|eyelid development in camera-type eye (GO:0061029)|in utero embryonic development (GO:0001701)|mitral valve morphogenesis (GO:0003183)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of oxidative phosphorylation uncoupler activity (GO:2000276)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell motility (GO:2000147)|positive regulation of endocardial cushion to mesenchymal transition involved in heart valve formation (GO:2000802)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of bone mineralization (GO:0030500)|rhythmic process (GO:0048511)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription factor binding (GO:0008134)			lung(2)|upper_aerodigestive_tract(1)	3						GAGCCGCTCGTGAGCCACATA	0.652																																																	0								ENSG00000122691						63.0	54.0	57.0					7																	19156406		2203	4300	6503	TWIST1	SO:0001583	missense	0			-	HGNC	U80998	CCDS5367.1	7p21	2014-02-07	2013-10-17	2003-03-28	ENSG00000122691	ENSG00000122691		"""Basic helix-loop-helix proteins"""	12428	protein-coding gene	gene with protein product	"""Saethre-Chotzen syndrome"""	601622	"""blepharophimosis, epicanthus inversus and ptosis 3"", ""acrocephalosyndactyly 3"", ""twist homolog 1 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 1"", ""craniosynostosis"""	ACS3, BPES3, TWIST, CRS		8995765, 11474656, 17343269	Standard	XR_428085		Approved	SCS, H-twist, BPES2, bHLHa38, CRS1	uc003sum.3	Q15672	OTTHUMG00000090821	ENST00000242261.5:c.539A>G	7.37:g.19156406T>C	ENSP00000242261:p.His180Arg	Somatic	0	32	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	10	71.79	A4D128|Q92487|Q99804	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.H180R	ENST00000242261.5	37	c.539	CCDS5367.1	7	.	.	.	.	.	.	.	.	.	.	t	11.65	1.700663	0.30142	.	.	ENSG00000122691	ENST00000242261	D	0.98329	-4.87	4.73	3.54	0.40534	Helix-loop-helix DNA-binding (1);	0.000000	0.50627	D	0.000102	D	0.97288	0.9113	M	0.81802	2.56	0.58432	D	0.999994	B	0.23891	0.093	B	0.30716	0.119	D	0.95093	0.8223	10	0.44086	T	0.13	-15.0211	10.3066	0.43685	0.1481:0.0:0.0:0.8519	.	180	Q15672	TWST1_HUMAN	R	180	ENSP00000242261:H180R	ENSP00000242261:H180R	H	-	2	0	TWIST1	19122931	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.905000	0.87416	0.638000	0.30545	0.369000	0.22263	CAC	-	superfamily_bHLH_dom		0.652	TWIST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWIST1	protein_coding	OTTHUMT00000207625.1	T	NM_000474	-		19156406	-1	no_errors	ENST00000242261	ensembl	human	known	74_37	missense	SNP	1.000	C
C6orf183	389422	genome.wustl.edu	37	6	109578931	109578931	+	RNA	SNP	C	C	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr6:109578931C>A	ENST00000453496.2	+	0	994							Q5T699	CF183_HUMAN	chromosome 6 open reading frame 183																		CTGTGGCTCACCCCAGCCACG	0.567																																																	0								ENSG00000243587																																			C6orf183			0			-	HGNC			6q21	2013-11-06	2012-02-07	2012-02-07	ENSG00000243587	ENSG00000243587			21562	other	unknown							Standard			Approved	bA487F23.3		Q5T699	OTTHUMG00000015337		6.37:g.109578931C>A		Somatic	0	25	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	16	44.83		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000453496.2	37	NULL		6																																																																																			-	-		0.567	C6orf183-002	KNOWN	basic	processed_transcript	C6orf183	polymorphic_pseudogene	OTTHUMT00000257660.2	C		-		109578931	+1	no_errors	ENST00000453496	ensembl	human	known	74_37	rna	SNP	0.021	A
NSUN4	387338	genome.wustl.edu	37	1	46808674	46808674	+	Intron	SNP	A	A	C			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:46808674A>C	ENST00000474844.1	+	2	743				NSUN4_ENST00000537428.1_Intron|NSUN4_ENST00000536062.1_Intron|NSUN4_ENST00000498008.1_3'UTR	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4						rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					TAGAGCTCTCAAAAGTGTTAT	0.517																																																	0								ENSG00000117481																																			NSUN4	SO:0001627	intron_variant	0			-	HGNC	AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.94-1799A>C	1.37:g.46808674A>C		Somatic	0	58	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	40	18.37	A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000474844.1	37	NULL	CCDS534.1	1																																																																																			-	-		0.517	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN4	protein_coding	OTTHUMT00000021427.1	A	NM_199044	-		46808674	+1	no_errors	ENST00000498008	ensembl	human	known	74_37	rna	SNP	0.248	C
TCIRG1	10312	genome.wustl.edu	37	11	67808747	67808748	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr11:67808747_67808748delCA	ENST00000265686.3	+	2	117_118	c.9_10delCA	c.(7-12)tccatgfs	p.M4fs	TCIRG1_ENST00000532635.1_5'Flank	NM_006019.3	NP_006010.2	Q13488	VPP3_HUMAN	T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 subunit A3	4					ATP hydrolysis coupled proton transport (GO:0015991)|cellular defense response (GO:0006968)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of cell proliferation (GO:0008284)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)|transporter activity (GO:0005215)			breast(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(3)|prostate(1)	16						CCATGGGCTCCATGTTCCGGAG	0.644																																																	0								ENSG00000110719																																			TCIRG1	SO:0001589	frameshift_variant	0				HGNC	AF025374	CCDS8177.1, CCDS53670.1	11q13.2	2014-09-17	2006-01-20		ENSG00000110719	ENSG00000110719		"""ATPases / V-type"""	11647	protein-coding gene	gene with protein product	"""T-cell immune response cDNA 7"""	604592	"""T-cell, immune regulator 1"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein a isoform 3"", ""T-cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3"""			8579597, 9806637	Standard	NM_006019		Approved	TIRC7, OC-116, OC116, ATP6N1C, Atp6i, a3, ATP6V0A3	uc001one.3	Q13488	OTTHUMG00000167358	ENST00000265686.3:c.9_10delCA	11.37:g.67808747_67808748delCA	ENSP00000265686:p.Met4fs	Somatic	0	34	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	38	20.83	O75877|Q8WVC5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_V-ATPase_116kDa_su	p.M4fs	ENST00000265686.3	37	c.9_10	CCDS8177.1	11																																																																																			-	NULL		0.644	TCIRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCIRG1	protein_coding	OTTHUMT00000394305.1	CA	NM_006019			67808748	+1	no_errors	ENST00000265686	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
AMFR	267	genome.wustl.edu	37	16	56439139	56439139	+	Silent	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr16:56439139C>T	ENST00000290649.5	-	5	894	c.684G>A	c.(682-684)gtG>gtA	p.V228V		NM_001144.5	NP_001135.3	Q9UKV5	AMFR_HUMAN	autocrine motility factor receptor, E3 ubiquitin protein ligase	228					aging (GO:0007568)|cellular component movement (GO:0006928)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|learning or memory (GO:0007611)|protein oligomerization (GO:0051259)|protein polyubiquitination (GO:0000209)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)	dendrite (GO:0030425)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	ligase activity (GO:0016874)|receptor activity (GO:0004872)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17						GAGCAGTCCTCACTGTCACAA	0.348																																					Pancreas(2;144 323 39528)												0								ENSG00000159461						66.0	62.0	63.0					16																	56439139		2198	4300	6498	AMFR	SO:0001819	synonymous_variant	0			-	HGNC	L35233	CCDS10758.1	16q21	2013-01-09	2012-02-23		ENSG00000159461	ENSG00000159461		"""RING-type (C3HC4) zinc fingers"""	463	protein-coding gene	gene with protein product		603243	"""autocrine motility factor receptor"""			1649192	Standard	NM_001144		Approved	RNF45, gp78	uc002eiy.4	Q9UKV5	OTTHUMG00000133239	ENST00000290649.5:c.684G>A	16.37:g.56439139C>T		Somatic	0	40	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	46	17.86	P26442|Q8IZ70	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CUE,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_CUE,pfscan_CUE,pfscan_Znf_RING	p.V228	ENST00000290649.5	37	c.684	CCDS10758.1	16																																																																																			-	NULL		0.348	AMFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMFR	protein_coding	OTTHUMT00000256978.2	C		-		56439139	-1	no_errors	ENST00000290649	ensembl	human	known	74_37	silent	SNP	1.000	T
SSPO	23145	genome.wustl.edu	37	7	149500107	149500107	+	RNA	SNP	G	G	A	rs535183718	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr7:149500107G>A	ENST00000378016.2	+	0	7733							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CATCAGAGTCGCCAGAGAAGC	0.687													G|||	4	0.000798722	0.0	0.0014	5008	,	,		15290	0.002		0.001	False		,,,				2504	0.0																0								ENSG00000197558						10.0	13.0	12.0					7																	149500107		2162	4261	6423	SSPO			0			-	HGNC	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149500107G>A		Somatic	0	19	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	7	50.00	Q76B61	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			-	-		0.687	SSPO-202	KNOWN	basic	processed_transcript	SSPO	processed_transcript		G		-		149500107	+1	no_errors	ENST00000378016	ensembl	human	known	74_37	rna	SNP	1.000	A
CBFA2T3	863	genome.wustl.edu	37	16	89017335	89017335	+	Intron	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr16:89017335G>A	ENST00000268679.4	-	1	548				CBFA2T3_ENST00000360302.2_Intron|CBFA2T3_ENST00000436887.2_Intron|CBFA2T3_ENST00000448839.1_Intron|RP11-830F9.6_ENST00000378347.2_Missense_Mutation_p.R270Q	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3						cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CCTGTCTTCCGGATCTGTTCA	0.637			T	RUNX1	AML																																			Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0								ENSG00000205018																																			RP11-830F9.6	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.151+25729C>T	16.37:g.89017335G>A		Somatic	0	136	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	68	39	63.55	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R270Q	ENST00000268679.4	37	c.809	CCDS10972.1	16	.	.	.	.	.	.	.	.	.	.	-	2.480	-0.319960	0.05386	.	.	ENSG00000205018	ENST00000378347	.	.	.	.	.	.	.	.	.	.	.	T	0.19565	0.0470	.	.	.	0.25995	N	0.982196	.	.	.	.	.	.	T	0.24977	-1.0145	4	0.21540	T	0.41	.	2.6646	0.05037	0.4962:0.0:0.5037:0.0	.	.	.	.	Q	270	.	ENSP00000367598:R270Q	R	+	2	0	AC092384.1	87544836	0.332000	0.24722	0.091000	0.20842	0.092000	0.18411	0.035000	0.13797	0.064000	0.16427	0.064000	0.15345	CGG	-	NULL		0.637	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000205018	protein_coding	OTTHUMT00000269545.2	G	NM_005187	-		89017335	+1	no_errors	ENST00000378347	ensembl	human	putative	74_37	missense	SNP	0.501	A
FAP	2191	genome.wustl.edu	37	2	163070519	163070519	+	Missense_Mutation	SNP	T	T	C			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr2:163070519T>C	ENST00000188790.4	-	11	1138	c.931A>G	c.(931-933)Aga>Gga	p.R311G	FAP_ENST00000443424.1_Missense_Mutation_p.R286G	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						TTCTGGACTCTTTTTAGCCAC	0.403																																																	0								ENSG00000078098						132.0	129.0	130.0					2																	163070519		2203	4300	6503	FAP	SO:0001583	missense	0			-	HGNC	U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.931A>G	2.37:g.163070519T>C	ENSP00000188790:p.Arg311Gly	Somatic	0	26	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	19	42.42		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.R311G	ENST00000188790.4	37	c.931	CCDS33311.1	2	.	.	.	.	.	.	.	.	.	.	T	21.8	4.201603	0.79015	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	D;D	0.84146	-1.81;-1.81	5.53	4.32	0.51571	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94066	0.8098	M	0.94142	3.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.95464	0.8545	10	0.87932	D	0	-16.178	13.857	0.63534	0.0:0.0:0.1356:0.8644	.	286;311;311	B4DLR2;B2RD89;Q12884	.;.;SEPR_HUMAN	G	311;286	ENSP00000188790:R311G;ENSP00000411391:R286G	ENSP00000188790:R311G	R	-	1	2	FAP	162778765	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.026000	0.49689	2.107000	0.64212	0.533000	0.62120	AGA	-	pfam_Peptidase_S9B		0.403	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAP	protein_coding	OTTHUMT00000332852.2	T		-		163070519	-1	no_errors	ENST00000188790	ensembl	human	known	74_37	missense	SNP	1.000	C
CDC73	79577	genome.wustl.edu	37	1	193181594	193181594	+	Silent	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:193181594C>T	ENST00000367435.3	+	13	1325	c.1141C>T	c.(1141-1143)Cta>Tta	p.L381L		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	381	Interaction with POLR2A and PAF1.				cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						AAAAGACCTTCTACAGGACCT	0.338																																																	0								ENSG00000134371						121.0	135.0	131.0					1																	193181594		2203	4299	6502	CDC73	SO:0001819	synonymous_variant	0			-	HGNC	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.1141C>T	1.37:g.193181594C>T		Somatic	0	74	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	55	22.54	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_access_fac_Cdc73	p.L381	ENST00000367435.3	37	c.1141	CCDS1382.1	1																																																																																			-	pfam_RNA_pol_access_fac_Cdc73		0.338	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC73	protein_coding	OTTHUMT00000086696.2	C	NM_024529	-		193181594	+1	no_errors	ENST00000367435	ensembl	human	known	74_37	silent	SNP	1.000	T
CHST13	166012	genome.wustl.edu	37	3	126255190	126255190	+	Silent	SNP	G	G	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr3:126255190G>T	ENST00000319340.2	+	2	224	c.174G>T	c.(172-174)ctG>ctT	p.L58L		NM_152889.2	NP_690849.1	Q8NET6	CHSTD_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 13	58					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			central_nervous_system(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(114;0.151)		TCTATGACCTGGATCAGGTAG	0.597																																																	0								ENSG00000180767						108.0	106.0	107.0					3																	126255190		2203	4300	6503	CHST13	SO:0001819	synonymous_variant	0			-	HGNC	AY120869	CCDS3039.1	3q21.3	2008-02-05			ENSG00000180767	ENSG00000180767	2.8.2.5	"""Sulfotransferases, membrane-bound"""	21755	protein-coding gene	gene with protein product		610124				12080076	Standard	NM_152889		Approved	C4ST3	uc003eja.3	Q8NET6	OTTHUMG00000162721	ENST00000319340.2:c.174G>T	3.37:g.126255190G>T		Somatic	0	36	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	Q3SYA3|Q3SYA5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase	p.L58	ENST00000319340.2	37	c.174	CCDS3039.1	3																																																																																			-	NULL		0.597	CHST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST13	protein_coding	OTTHUMT00000370201.2	G	NM_152889	-		126255190	+1	no_errors	ENST00000319340	ensembl	human	known	74_37	silent	SNP	0.930	T
SDK2	54549	genome.wustl.edu	37	17	71434184	71434184	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:71434184C>T	ENST00000392650.3	-	7	835	c.835G>A	c.(835-837)Gcc>Acc	p.A279T	SDK2_ENST00000388726.3_Missense_Mutation_p.A279T	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	279	Ig-like C2-type 3.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TAGTAGCCGGCGTCACTGCCG	0.632																																																	0								ENSG00000069188						28.0	38.0	35.0					17																	71434184		692	1591	2283	SDK2	SO:0001583	missense	0			-	HGNC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.835G>A	17.37:g.71434184C>T	ENSP00000376421:p.Ala279Thr	Somatic	0	62	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	48	39.24	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A279T	ENST00000392650.3	37	c.835	CCDS45769.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.127|0.127	-1.118380|-1.118380	0.01785|0.01785	.|.	.|.	ENSG00000069188|ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893|ENST00000416616	T;T|.	0.14766|.	2.48;2.48|.	5.05|5.05	0.127|0.127	0.14727|0.14727	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.404891|.	0.22383|.	U|.	0.060794|.	T|T	0.23532|0.23532	0.0569|0.0569	N|N	0.05608|0.05608	-0.01|-0.01	0.37546|0.37546	D|D	0.918512|0.918512	B|.	0.12630|.	0.006|.	B|.	0.09377|.	0.004|.	T|T	0.09465|0.09465	-1.0673|-1.0673	10|5	0.11182|.	T|.	0.66|.	.|.	5.2619|5.2619	0.15578|0.15578	0.1463:0.5054:0.0:0.3483|0.1463:0.5054:0.0:0.3483	.|.	279|.	Q58EX2|.	SDK2_HUMAN|.	T|H	279|183	ENSP00000376421:A279T;ENSP00000373378:A279T|.	ENSP00000324967:A279T|.	A|R	-|-	1|2	0|0	SDK2|SDK2	68945779|68945779	0.472000|0.472000	0.25870|0.25870	0.974000|0.974000	0.42286|0.42286	0.038000|0.038000	0.13279|0.13279	0.037000|0.037000	0.13840|0.13840	0.166000|0.166000	0.19597|0.19597	0.462000|0.462000	0.41574|0.41574	GCC|CGC	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.632	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	C	NM_019064	-		71434184	-1	no_errors	ENST00000392650	ensembl	human	known	74_37	missense	SNP	0.879	T
SACM1L	22908	genome.wustl.edu	37	3	45730556	45730556	+	5'Flank	SNP	A	A	G			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr3:45730556A>G	ENST00000389061.5	+	0	0				SACM1L_ENST00000418611.1_5'Flank|SACM1L_ENST00000464524.1_3'UTR|SACM1L_ENST00000541314.1_5'Flank|LIMD1-AS1_ENST00000429798.1_RNA|LIMD1-AS1_ENST00000427644.1_RNA	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		ccattgcgccactggcccCGA	0.532																																																	0								ENSG00000230530						67.0	58.0	61.0					3																	45730556		692	1591	2283	LIMD1-AS1	SO:0001631	upstream_gene_variant	0			-	HGNC	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653		3.37:g.45730556A>G	Exception_encountered	Somatic	0	31	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	10	52.17	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000389061.5	37	NULL	CCDS33745.1	3																																																																																			-	-		0.532	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIMD1-AS1	protein_coding	OTTHUMT00000345065.2	A	NM_014016	-		45730556	-1	no_errors	ENST00000429798	ensembl	human	known	74_37	rna	SNP	1.000	G
GCH1	2643	genome.wustl.edu	37	14	55309793	55309793	+	3'UTR	SNP	C	C	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr14:55309793C>A	ENST00000491895.2	-	0	1883				GCH1_ENST00000543643.2_Intron|GCH1_ENST00000395514.1_Intron|GCH1_ENST00000536224.2_Intron|GCH1_ENST00000254299.4_5'UTR	NM_000161.2	NP_000152.1	P30793	GCH1_HUMAN	GTP cyclohydrolase 1						7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|dopamine biosynthetic process (GO:0042416)|GTP catabolic process (GO:0006184)|metabolic process (GO:0008152)|negative regulation of blood pressure (GO:0045776)|neuromuscular process controlling posture (GO:0050884)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric-oxide synthase activity (GO:0051000)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|pteridine-containing compound biosynthetic process (GO:0042559)|regulation of blood pressure (GO:0008217)|regulation of lung blood pressure (GO:0014916)|regulation of nitric-oxide synthase activity (GO:0050999)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to pain (GO:0048265)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|tetrahydrofolate biosynthetic process (GO:0046654)|vasodilation (GO:0042311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|coenzyme binding (GO:0050662)|GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(2)|lung(7)|skin(2)	11						TGGGCACTCTCAAATGTTTCT	0.383																																					Pancreas(198;1245 2204 4807 21567 38372)												0								ENSG00000131979						62.0	57.0	58.0					14																	55309793		1842	4094	5936	GCH1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	U19523	CCDS9720.1, CCDS41954.1, CCDS45110.1	14q22.1-q22.2	2014-04-01	2008-08-01		ENSG00000131979	ENSG00000131979	3.5.4.16		4193	protein-coding gene	gene with protein product	"""dopa-responsive dystonia"""	600225	"""dystonia 14"""	GCH, DYT5, DYT14		7874165, 8695054	Standard	XM_005267530		Approved	GTPCH1, DYT5a	uc001xbi.1	P30793	OTTHUMG00000029754	ENST00000491895.2:c.*942G>T	14.37:g.55309793C>A		Somatic	0	30	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64	Q6FHY7|Q9Y4I8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000491895.2	37	NULL	CCDS9720.1	14																																																																																			-	-		0.383	GCH1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	GCH1	protein_coding	OTTHUMT00000276895.3	C		-		55309793	-1	no_errors	ENST00000254299	ensembl	human	known	74_37	rna	SNP	0.000	A
TM6SF1	53346	genome.wustl.edu	37	15	83781571	83781571	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr15:83781571G>A	ENST00000322019.9	+	2	389	c.115G>A	c.(115-117)Gct>Act	p.A39T	TM6SF1_ENST00000379390.6_Missense_Mutation_p.A39T|TM6SF1_ENST00000565774.1_Missense_Mutation_p.A39T|RP11-382A20.2_ENST00000565513.1_RNA|TM6SF1_ENST00000379386.4_Missense_Mutation_p.A39T|TM6SF1_ENST00000564988.1_3'UTR			Q9BZW5	TM6S1_HUMAN	transmembrane 6 superfamily member 1	39						integral component of membrane (GO:0016021)				endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						TGTAGGGGTTGCTGCCCTCAT	0.507																																																	0								ENSG00000136404						197.0	164.0	175.0					15																	83781571		2203	4300	6503	TM6SF1	SO:0001583	missense	0			-	HGNC	AF255922	CCDS10323.1, CCDS45338.1	15q24-q26	2003-04-04			ENSG00000136404	ENSG00000136404			11860	protein-coding gene	gene with protein product		606562				11124529	Standard	NM_001144903		Approved		uc002bjp.3	Q9BZW5	OTTHUMG00000147365	ENST00000322019.9:c.115G>A	15.37:g.83781571G>A	ENSP00000317000:p.Ala39Thr	Somatic	0	78	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	93	36.73	A8K7T5|H3BU56|Q4U0U5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transmembrane_6/97	p.A39T	ENST00000322019.9	37	c.115	CCDS10323.1	15	.	.	.	.	.	.	.	.	.	.	G	22.7	4.320224	0.81469	.	.	ENSG00000136404	ENST00000322019;ENST00000379386;ENST00000379384;ENST00000379390;ENST00000258909	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	5.8	5.8	0.92144	.	0.297236	0.37857	N	0.001914	T	0.20740	0.0499	N	0.08118	0	0.42515	D	0.992981	P;P;P	0.41313	0.629;0.745;0.534	B;B;B	0.38803	0.146;0.282;0.107	T	0.08638	-1.0712	10	0.54805	T	0.06	-13.8636	18.8219	0.92100	0.0:0.0:1.0:0.0	.	39;39;39	E9PD04;Q6P4D7;Q9BZW5	.;.;TM6S1_HUMAN	T	39	ENSP00000317000:A39T;ENSP00000368696:A39T;ENSP00000368693:A39T;ENSP00000368700:A39T;ENSP00000258909:A39T	ENSP00000258909:A39T	A	+	1	0	TM6SF1	81572575	1.000000	0.71417	0.986000	0.45419	0.980000	0.70556	5.220000	0.65267	2.739000	0.93911	0.561000	0.74099	GCT	-	NULL		0.507	TM6SF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TM6SF1	protein_coding	OTTHUMT00000304009.1	G	NM_023003	-		83781571	+1	no_errors	ENST00000379386	ensembl	human	known	74_37	missense	SNP	0.997	A
OR10G4	390264	genome.wustl.edu	37	11	123886552	123886552	+	Missense_Mutation	SNP	A	A	G			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr11:123886552A>G	ENST00000320891.4	+	1	271	c.271A>G	c.(271-273)Atc>Gtc	p.I91V		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CGGCAGGGCTATCTCCTTCCA	0.527																																																	0								ENSG00000254737						27.0	26.0	26.0					11																	123886552		2196	4273	6469	OR10G4	SO:0001583	missense	0			-	HGNC	AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.271A>G	11.37:g.123886552A>G	ENSP00000325076:p.Ile91Val	Somatic	0	26	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	33	26.67	Q6IEW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I91V	ENST00000320891.4	37	c.271	CCDS31702.1	11	.	.	.	.	.	.	.	.	.	.	a	4.431	0.079706	0.08533	.	.	ENSG00000254737	ENST00000320891	T	0.00469	7.21	3.48	1.04	0.20106	GPCR, rhodopsin-like superfamily (1);	0.131916	0.34133	N	0.004236	T	0.00496	0.0016	M	0.75777	2.31	0.20074	N	0.999936	B	0.12630	0.006	B	0.17979	0.02	T	0.43814	-0.9368	10	0.66056	D	0.02	.	7.6669	0.28437	0.8129:0.0:0.1871:0.0	.	91	Q8NGN3	O10G4_HUMAN	V	91	ENSP00000325076:I91V	ENSP00000325076:I91V	I	+	1	0	OR10G4	123391762	0.936000	0.31750	0.263000	0.24496	0.184000	0.23303	1.728000	0.38105	0.093000	0.17368	0.473000	0.43528	ATC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.527	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G4	protein_coding	OTTHUMT00000387268.1	A	NM_001004462	-		123886552	+1	no_errors	ENST00000320891	ensembl	human	known	74_37	missense	SNP	0.421	G
GGCX	2677	genome.wustl.edu	37	2	85781577	85781578	+	Intron	INS	-	-	TTGTTGTTG	rs376988482|rs112936952|rs72370006|rs60769490	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr2:85781577_85781578insTTGTTGTTG	ENST00000233838.4	-	7	806				GGCX_ENST00000430215.3_Intron|GGCX_ENST00000473665.1_5'UTR	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase						blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	CTCTAGgttgtttgttgttgtt	0.465														546	0.109026	0.1067	0.1369	5008	,	,		23095	0.0179		0.2366	False		,,,				2504	0.0552																0								ENSG00000115486																																			GGCX	SO:0001627	intron_variant	0				HGNC		CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.726-148->CAACAACAA	2.37:g.85781578_85781586dupTTGTTGTTG		Somatic	NA	NA	NA		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DMC5|E9PEE1|Q14415|Q6GU45	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000233838.4	37	NULL	CCDS1978.1	2																																																																																			-	-		0.465	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCX	protein_coding	OTTHUMT00000252490.3	-	NM_000821			85781578	-1	no_errors	ENST00000473665	ensembl	human	known	74_37	rna	INS	0.009:0.012	TTGTTGTTG
KIAA0556	23247	genome.wustl.edu	37	16	27761600	27761600	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr16:27761600G>A	ENST00000261588.4	+	16	3338	c.3319G>A	c.(3319-3321)Gcc>Acc	p.A1107T		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1107						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						AGGAGAAATCGCCAAGGCCTC	0.473																																																	0								ENSG00000047578						75.0	79.0	78.0					16																	27761600		2197	4300	6497	KIAA0556	SO:0001583	missense	0			-	HGNC	AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3319G>A	16.37:g.27761600G>A	ENSP00000261588:p.Ala1107Thr	Somatic	0	20	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	5	61.54	A7E2C2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Thaumatin	p.A1107T	ENST00000261588.4	37	c.3319	CCDS32415.1	16	.	.	.	.	.	.	.	.	.	.	G	35	5.557224	0.96514	.	.	ENSG00000047578	ENST00000261588	T	0.13657	2.57	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.45597	0.1350	M	0.88105	2.93	0.58432	D	0.999999	D	0.76494	0.999	D	0.68765	0.96	T	0.53683	-0.8404	10	0.72032	D	0.01	-18.5808	18.9572	0.92664	0.0:0.0:1.0:0.0	.	1107	O60303	K0556_HUMAN	T	1107	ENSP00000261588:A1107T	ENSP00000261588:A1107T	A	+	1	0	KIAA0556	27669101	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.647000	0.98478	2.621000	0.88768	0.650000	0.86243	GCC	-	NULL		0.473	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0556	protein_coding	OTTHUMT00000433724.1	G	NM_015202	-		27761600	+1	no_errors	ENST00000261588	ensembl	human	known	74_37	missense	SNP	1.000	A
OFD1	8481	genome.wustl.edu	37	X	13771531	13771531	+	Missense_Mutation	SNP	G	G	C	rs312262864		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chrX:13771531G>C	ENST00000340096.6	+	11	1427	c.1100G>C	c.(1099-1101)cGa>cCa	p.R367P	OFD1_ENST00000490265.1_3'UTR|OFD1_ENST00000380550.3_Missense_Mutation_p.R327P|OFD1_ENST00000380567.1_Missense_Mutation_p.R227P	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	367					axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						AGAACTAATCGACTGATTGAA	0.383																																																	0			GRCh37	CM085614	OFD1	M		ENSG00000046651						107.0	99.0	101.0					X																	13771531		2203	4300	6503	OFD1	SO:0001583	missense	0			-	HGNC	Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.1100G>C	X.37:g.13771531G>C	ENSP00000344314:p.Arg367Pro	Somatic	0	74	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	121	25.77	B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Lipoprotein_6,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.R367P	ENST00000340096.6	37	c.1100	CCDS14157.1	X	.	.	.	.	.	.	.	.	.	.	.	12.44	1.937920	0.34189	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567;ENST00000543598	D;D;D	0.95980	-2.3;-3.87;-1.83	5.79	-2.56	0.06268	.	0.319691	0.40818	N	0.001016	D	0.95468	0.8528	M	0.62723	1.935	0.18873	N	0.999984	P;D;D;P;D	0.60160	0.874;0.987;0.983;0.946;0.987	P;P;P;P;P	0.55824	0.473;0.785;0.706;0.601;0.785	D	0.92061	0.5656	10	0.45353	T	0.12	-5.8403	15.6677	0.77242	0.7833:0.0:0.2167:0.0	.	190;367;327;227;367	F5H2Z4;A8K2T9;O75665-3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	P	327;367;227;190	ENSP00000369923:R327P;ENSP00000344314:R367P;ENSP00000369941:R227P	ENSP00000344314:R367P	R	+	2	0	OFD1	13681452	0.001000	0.12720	0.000000	0.03702	0.329000	0.28539	-0.064000	0.11636	-1.291000	0.02368	-0.909000	0.02823	CGA	-	NULL		0.383	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OFD1	protein_coding	OTTHUMT00000055808.1	G	NM_003611	-		13771531	+1	no_errors	ENST00000340096	ensembl	human	known	74_37	missense	SNP	0.000	C
DOPEY2	9980	genome.wustl.edu	37	21	37617590	37617590	+	Silent	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr21:37617590G>A	ENST00000399151.3	+	19	3397	c.3312G>A	c.(3310-3312)ccG>ccA	p.P1104P		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1104					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						ACGGCGCCCCGGACAGCAGCG	0.647																																																	0								ENSG00000142197						115.0	86.0	96.0					21																	37617590		2203	4300	6503	DOPEY2	SO:0001819	synonymous_variant	0			-	HGNC	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3312G>A	21.37:g.37617590G>A		Somatic	0	12	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	17	29.17	D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dopey_N	p.P1104	ENST00000399151.3	37	c.3312	CCDS13643.1	21																																																																																			-	NULL		0.647	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	protein_coding	OTTHUMT00000194636.1	G	NM_005128	-		37617590	+1	no_errors	ENST00000399151	ensembl	human	known	74_37	silent	SNP	0.000	A
TP53	7157	genome.wustl.edu	37	17	7577545	7577545	+	Missense_Mutation	SNP	T	T	C	rs483352695|rs397516437		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:7577545T>C	ENST00000269305.4	-	7	925	c.736A>G	c.(736-738)Atg>Gtg	p.M246V	TP53_ENST00000445888.2_Missense_Mutation_p.M246V|TP53_ENST00000455263.2_Missense_Mutation_p.M246V|TP53_ENST00000359597.4_Missense_Mutation_p.M246V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.M246V|TP53_ENST00000420246.2_Missense_Mutation_p.M246V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	246	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		M -> I (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M246V(34)|p.0?(8)|p.?(5)|p.M246L(3)|p.G244_M246>V(3)|p.M246fs*1(2)|p.M153V(2)|p.M246_P250delMNRRP(2)|p.G151_M153>V(1)|p.G244fs*17(1)|p.C242fs*98(1)|p.G245fs*17(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*14(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCCGGTTCATGCCGCCCATG	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Missense(39)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	liver(8)|haematopoietic_and_lymphoid_tissue(7)|large_intestine(6)|biliary_tract(6)|lung(6)|ovary(6)|breast(5)|stomach(4)|bone(4)|upper_aerodigestive_tract(3)|urinary_tract(3)|oesophagus(3)|soft_tissue(2)|central_nervous_system(2)|pancreas(2)	GRCh37	CM942294	TP53	M		ENSG00000141510						152.0	113.0	126.0					17																	7577545		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.736A>G	17.37:g.7577545T>C	ENSP00000269305:p.Met246Val	Somatic	0	48	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	10	66.67	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.M246V	ENST00000269305.4	37	c.736	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	20.2	3.945888	0.73672	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99784	-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74	4.62	3.54	0.40534	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99684	0.9881	M	0.87971	2.92	0.53005	D	0.999962	D;P;P;D;P;D	0.76494	0.993;0.889;0.832;0.994;0.931;0.999	D;P;B;D;D;D	0.80764	0.972;0.545;0.403;0.984;0.947;0.994	D	0.98572	1.0646	10	0.87932	D	0	-28.5667	8.419	0.32690	0.0:0.0941:0.0:0.9059	.	246;246;153;246;246;246	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	V	246;246;246;246;246;246;235;153;114;153	ENSP00000410739:M246V;ENSP00000352610:M246V;ENSP00000269305:M246V;ENSP00000398846:M246V;ENSP00000391127:M246V;ENSP00000391478:M246V;ENSP00000425104:M114V;ENSP00000423862:M153V	ENSP00000269305:M246V	M	-	1	0	TP53	7518270	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.824000	0.86668	0.914000	0.36822	0.379000	0.24179	ATG	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	-		7577545	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	C
RP11-757O6.1	0	genome.wustl.edu	37	18	14252079	14252080	+	lincRNA	INS	-	-	C	rs60709779|rs374136544		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr18:14252079_14252080insC	ENST00000580200.1	+	0	506_507																											GAGTGGCTCTGTTGAAGGACCG	0.54																																																	0								ENSG00000264222																																			RP11-757O6.1			0				Clone_based_vega_gene																													18.37:g.14252079_14252080insC		Somatic	0	31	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000580200.1	37	NULL		18																																																																																			-	-		0.540	RP11-757O6.1-001	KNOWN	basic	lincRNA	ENSG00000264222	lincRNA	OTTHUMT00000442841.1	-				14252080	+1	no_errors	ENST00000580200	ensembl	human	known	74_37	rna	INS	0.205:0.200	C
AMOT	154796	genome.wustl.edu	37	X	112022618	112022644	+	In_Frame_Del	DEL	CTGGAGCAGCAGCAGCAGCAACAGCAA	CTGGAGCAGCAGCAGCAGCAACAGCAA	-	rs200107563|rs201619225		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	CTGGAGCAGCAGCAGCAGCAACAGCAA	CTGGAGCAGCAGCAGCAGCAACAGCAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chrX:112022618_112022644delCTGGAGCAGCAGCAGCAGCAACAGCAA	ENST00000524145.1	-	11	2812_2838	c.2738_2764delTTGCTGTTGCTGCTGCTGCTGCTCCAG	c.(2737-2766)gttgctgttgctgctgctgctgctccagct>gct	p.VAVAAAAAP913del	MIR4329_ENST00000582643.1_RNA|AMOT_ENST00000371962.1_In_Frame_Del_p.VAVAAAAAP681del|AMOT_ENST00000304758.1_In_Frame_Del_p.VAVAAAAAP504del|AMOT_ENST00000371959.3_In_Frame_Del_p.VAVAAAAAP913del			Q4VCS5	AMOT_HUMAN	angiomotin	913					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						gcagcagcagctggagcagcagcagcagcaacagcaactggagcagc	0.626																																																	0								ENSG00000126016		,	64,3426		9,34,12,1484,424					,	3.4	0.0			16	161,5798		24,58,55,2140,1460	no	coding,coding	AMOT	NM_133265.2,NM_001113490.1	,	33,92,67,3624,1884	A1A1,A1R,A1,RR,R		2.7018,1.8338,2.3812	,	,		225,9224				AMOT	SO:0001651	inframe_deletion	0				HGNC	AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.2738_2764delTTGCTGTTGCTGCTGCTGCTGCTCCAG	X.37:g.112022618_112022644delCTGGAGCAGCAGCAGCAGCAACAGCAA	ENSP00000429013:p.Val913_Pro921del	Somatic	NA	NA	NA		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q504X5|Q9HD27|Q9UPT1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.VAVAAAAAP913in_frame_del	ENST00000524145.1	37	c.2764_2738	CCDS48154.1	X																																																																																			-	NULL		0.626	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	protein_coding	OTTHUMT00000378570.1	CTGGAGCAGCAGCAGCAGCAACAGCAA	NM_133265			112022644	-1	no_errors	ENST00000371959	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.002:0.001:0.005:0.079:0.099:0.118:0.121:0.120:0.097:0.094:0.002:0.051:0.890:0.970:0.967:0.966:0.809:0.003:0.000:0.000:0.001:0.207:0.194:0.198:0.522	-
ARHGEF4	50649	genome.wustl.edu	37	2	131673046	131673046	+	5'Flank	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr2:131673046G>A	ENST00000326016.5	+	0	0				ARHGEF4_ENST00000525839.1_5'Flank|ARHGEF4_ENST00000392953.3_5'Flank|ARHGEF4_ENST00000409359.1_Silent_p.K179K|ARHGEF4_ENST00000428230.2_5'Flank	NM_015320.2	NP_056135.2	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor (GEF) 4						apoptotic signaling pathway (GO:0097190)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein domain specific binding (GO:0019904)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(4)	29		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		ACACATCAAAGTATGTGCTCA	0.547																																																	0								ENSG00000136002																																			ARHGEF4	SO:0001631	upstream_gene_variant	0			-	HGNC	AL137289	CCDS2165.1, CCDS42754.1	2q22	2013-01-10			ENSG00000136002	ENSG00000136002		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	684	protein-coding gene	gene with protein product	"""APC-stimulated guanine nucleotide exchange factor"""	605216				10873612	Standard	NM_015320		Approved	STM6, KIAA1112, ASEF	uc002tsa.1	Q9NR80	OTTHUMG00000131657		2.37:g.131673046G>A	Exception_encountered	Somatic	0	29	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	24	20.00	Q9HDC6|Q9UPP0	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K179	ENST00000326016.5	37	c.537	CCDS2165.1	2																																																																																			-	NULL		0.547	ARHGEF4-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ARHGEF4	protein_coding	OTTHUMT00000254554.4	G		-		131673046	+1	no_errors	ENST00000409359	ensembl	human	putative	74_37	silent	SNP	0.000	A
CWC22	57703	genome.wustl.edu	37	2	180810224	180810224	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr2:180810224C>T	ENST00000410053.3	-	20	2658	c.2359G>A	c.(2359-2361)Gac>Aac	p.D787N	CWC22_ENST00000295749.6_Missense_Mutation_p.D787N	NM_020943.2	NP_065994.1	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein	787					mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(8)|stomach(1)	30						ACATCTTTGTCTGATGTGTAC	0.378																																																	0								ENSG00000163510						226.0	212.0	216.0					2																	180810224		1861	4109	5970	CWC22	SO:0001583	missense	0			-	HGNC		CCDS46465.1	2q31.3	2014-07-03	2014-07-03		ENSG00000163510	ENSG00000163510			29322	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein b"""	615186	"""CWC22 spliceosome-associated protein homolog (S. cerevisiae)"""			9136012, 23236153	Standard	NM_020943		Approved	KIAA1604, EIF4GL, fSAPb, NCM	uc010frh.1	Q9HCG8	OTTHUMG00000154244	ENST00000410053.3:c.2359G>A	2.37:g.180810224C>T	ENSP00000387006:p.Asp787Asn	Somatic	0	88	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	57	37.36	Q05DC2|Q4G135|Q52LF0|Q6PEX2|Q7Z6I0|Q9H5L3|Q9H6Q6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MIF4G-like_typ-3,pfam_Initiation_fac_eIF4g_MI,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3,smart_Initiation_fac_eIF4g_MI	p.D787N	ENST00000410053.3	37	c.2359	CCDS46465.1	2	.	.	.	.	.	.	.	.	.	.	C	13.34	2.208230	0.39003	.	.	ENSG00000163510	ENST00000410053;ENST00000295749	T;T	0.21361	2.01;2.01	4.59	4.59	0.56863	.	0.430894	0.22313	N	0.061715	T	0.37598	0.1009	L	0.50333	1.59	0.41738	D	0.98959	D	0.69078	0.997	D	0.73380	0.98	T	0.06570	-1.0819	10	0.48119	T	0.1	-16.3733	11.5128	0.50502	0.0:0.803:0.1969:0.0	.	787	Q9HCG8	CWC22_HUMAN	N	787	ENSP00000387006:D787N;ENSP00000295749:D787N	ENSP00000295749:D787N	D	-	1	0	CWC22	180518469	0.997000	0.39634	0.753000	0.31225	0.016000	0.09150	3.602000	0.54066	2.262000	0.75019	0.655000	0.94253	GAC	-	NULL		0.378	CWC22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CWC22	protein_coding	OTTHUMT00000334537.1	C	NM_020943	-		180810224	-1	no_errors	ENST00000295749	ensembl	human	known	74_37	missense	SNP	0.941	T
UGT1A3	54659	genome.wustl.edu	37	2	234638180	234638180	+	Silent	SNP	C	C	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr2:234638180C>A	ENST00000482026.1	+	1	427	c.408C>A	c.(406-408)gcC>gcA	p.A136A	UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A6_ENST00000480628.1_Intron|UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000609767.1_Silent_p.A136A			P35503	UD13_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A3	136					cellular glucuronidation (GO:0052695)|flavonoid glucuronidation (GO:0052696)|metabolic process (GO:0008152)|retinoic acid metabolic process (GO:0042573)|xenobiotic glucuronidation (GO:0052697)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|UDP-glycosyltransferase activity (GO:0008194)			breast(2)|endometrium(7)|kidney(18)|large_intestine(6)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	46		Breast(86;0.000765)|all_lung(227;0.00266)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.0456)|Lung SC(224;0.128)		Epithelial(121;2.4e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000476)|Lung(119;0.00243)|LUSC - Lung squamous cell carcinoma(224;0.00599)	Atorvastatin(DB01076)|Candesartan(DB00796)|Cyproheptadine(DB00434)|Eltrombopag(DB06210)|Etodolac(DB00749)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Irbesartan(DB01029)|Lamotrigine(DB00555)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Pitavastatin(DB08860)|Simvastatin(DB00641)|Valproic Acid(DB00313)	ATAATGAGGCCCTGATCAGGC	0.438																																																	0								ENSG00000243135						191.0	197.0	195.0					2																	234638180		2203	4300	6503	UGT1A3	SO:0001819	synonymous_variant	0			-	HGNC	M84127	CCDS2509.1	2q37	2010-03-05	2005-07-20		ENSG00000243135	ENSG00000243135		"""UDP glucuronosyltransferases"""	12535	other	complex locus constituent		606428	"""UDP glycosyltransferase 1 family, polypeptide A3"""			9295054, 1339448, 11434514	Standard	NM_019093		Approved	UGT1C		P35503	OTTHUMG00000059118	ENST00000482026.1:c.408C>A	2.37:g.234638180C>A		Somatic	0	80	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	54	34.15	B8K287	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.A136	ENST00000482026.1	37	c.408	CCDS2509.1	2																																																																																			-	pfam_UDP_glucos_trans		0.438	UGT1A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	UGT1A3	protein_coding	OTTHUMT00000130983.1	C	NM_019093	-		234638180	+1	no_errors	ENST00000482026	ensembl	human	known	74_37	silent	SNP	0.000	A
RINT1	60561	genome.wustl.edu	37	7	105195661	105195661	+	Missense_Mutation	SNP	G	G	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr7:105195661G>T	ENST00000257700.2	+	11	1889	c.1658G>T	c.(1657-1659)tGg>tTg	p.W553L		NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	553	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CTAGCAGATTGGGCTGACAAT	0.323																																																	0								ENSG00000135249						146.0	144.0	145.0					7																	105195661		2203	4300	6503	RINT1	SO:0001583	missense	0			-	HGNC	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.1658G>T	7.37:g.105195661G>T	ENSP00000257700:p.Trp553Leu	Somatic	0	25	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RINT1_TIP1	p.W553L	ENST00000257700.2	37	c.1658	CCDS34726.1	7	.	.	.	.	.	.	.	.	.	.	G	29.7	5.031533	0.93575	.	.	ENSG00000135249	ENST00000257700	T	0.37584	1.19	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.64897	0.2640	M	0.80616	2.505	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62039	-0.6938	10	0.39692	T	0.17	-8.9782	20.2245	0.98337	0.0:0.0:1.0:0.0	.	553	Q6NUQ1	RINT1_HUMAN	L	553	ENSP00000257700:W553L	ENSP00000257700:W553L	W	+	2	0	RINT1	104982897	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.110000	0.94302	2.770000	0.95276	0.650000	0.86243	TGG	-	pfam_RINT1_TIP1		0.323	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RINT1	protein_coding	OTTHUMT00000348686.1	G	NM_021930	-		105195661	+1	no_errors	ENST00000257700	ensembl	human	known	74_37	missense	SNP	1.000	T
KHDRBS1	10657	genome.wustl.edu	37	1	32508537	32508537	+	3'UTR	DEL	A	A	-			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:32508537delA	ENST00000327300.7	+	0	1811				KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GAAGTTGAGTAAAAAAAAAAA	0.254																																					Ovarian(173;401 1982 12359 31110 42403)												0								ENSG00000121774																																			KHDRBS1	SO:0001624	3_prime_UTR_variant	0				HGNC	U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.*312A>-	1.37:g.32508537delA		Somatic	0	24	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000327300.7	37	NULL	CCDS350.1	1																																																																																			-	-		0.254	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	protein_coding	OTTHUMT00000011199.4	A	NM_006559			32508537	+1	no_errors	ENST00000307714	ensembl	human	known	74_37	rna	DEL	0.903	-
GRIA1	2890	genome.wustl.edu	37	5	153190650	153190650	+	Missense_Mutation	SNP	C	C	G	rs376123993		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr5:153190650C>G	ENST00000285900.5	+	16	2929	c.2586C>G	c.(2584-2586)aaC>aaG	p.N862K	GRIA1_ENST00000521843.2_Missense_Mutation_p.N793K|GRIA1_ENST00000340592.5_Missense_Mutation_p.N862K|GRIA1_ENST00000448073.4_Missense_Mutation_p.N872K|GRIA1_ENST00000518783.1_Missense_Mutation_p.N872K|GRIA1_ENST00000518142.1_Missense_Mutation_p.N782K	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	862					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TCCCCCGCAACAGCGGGGCAG	0.592																																																	0								ENSG00000155511						43.0	48.0	47.0					5																	153190650		2203	4300	6503	GRIA1	SO:0001583	missense	0			-	HGNC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2586C>G	5.37:g.153190650C>G	ENSP00000285900:p.Asn862Lys	Somatic	0	54	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	58	30.12	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.N872K	ENST00000285900.5	37	c.2616	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	C	9.421	1.082946	0.20309	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.11821	2.79;2.74;2.79;2.74;2.74;2.79;2.79	5.16	4.3	0.51218	.	0.303410	0.34932	N	0.003580	T	0.06096	0.0158	N	0.08118	0	0.27157	N	0.961265	B;B;B;B;B	0.18166	0.01;0.01;0.026;0.005;0.004	B;B;B;B;B	0.15870	0.006;0.006;0.014;0.008;0.003	T	0.26467	-1.0102	10	0.31617	T	0.26	.	5.2411	0.15471	0.1749:0.6544:0.0:0.1707	.	872;872;782;862;862	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	K	862;862;782;862;795;793;872;872	ENSP00000285900:N862K;ENSP00000427920:N782K;ENSP00000339343:N862K;ENSP00000427864:N795K;ENSP00000442108:N793K;ENSP00000428994:N872K;ENSP00000415569:N872K	ENSP00000285900:N862K	N	+	3	2	GRIA1	153170843	1.000000	0.71417	0.991000	0.47740	0.772000	0.43724	2.590000	0.46154	1.173000	0.42796	-0.137000	0.14449	AAC	-	NULL		0.592	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	protein_coding	OTTHUMT00000252456.3	C		-		153190650	+1	no_errors	ENST00000448073	ensembl	human	known	74_37	missense	SNP	0.995	G
LCE4A	199834	genome.wustl.edu	37	1	152681680	152681681	+	In_Frame_Ins	INS	-	-	AGCTCTGGGGGCTGCTGT	rs6143428|rs11269814|rs200890315|rs33921874	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:152681680_152681681insAGCTCTGGGGGCTGCTGT	ENST00000368777.1	+	2	385_386	c.129_130insAGCTCTGGGGGCTGCTGT	c.(130-132)agc>AGCTCTGGGGGCTGCTGTagc	p.44_44S>SSGGCCS	LCE4A_ENST00000335535.3_In_Frame_Ins_p.44_44S>SSGGCCS			Q5TA78	LCE4A_HUMAN	late cornified envelope 4A	44	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.116)			GCTGTGGCTCCAGCTCTGGGGG	0.599														4009	0.800519	0.9758	0.853	5008	,	,		18534	0.6855		0.7177	False		,,,				2504	0.7301																0								ENSG00000187170																																			LCE4A	SO:0001652	inframe_insertion	0				HGNC	BI670517	CCDS1022.1	1q22	2008-02-05	2004-10-11	2004-10-15	ENSG00000187170	ENSG00000187170		"""Late cornified envelopes"""	16613	protein-coding gene	gene with protein product		612618	"""small proline rich-like (epidermal differentiation complex) 4A"""	SPRL4A		11698679	Standard	NM_178356		Approved	LEP8	uc001fak.2	Q5TA78	OTTHUMG00000014394	Exception_encountered	1.37:g.152681680_152681681insAGCTCTGGGGGCTGCTGT	Exception_encountered	Somatic	NA	NA	NA		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q14D97	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.47in_frame_insCCSSGG	ENST00000368777.1	37	c.129_130	CCDS1022.1	1																																																																																			-	NULL		0.599	LCE4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE4A	protein_coding	OTTHUMT00000040048.1	-	NM_178356			152681681	+1	no_errors	ENST00000335535	ensembl	human	known	74_37	in_frame_ins	INS	0.030:0.049	AGCTCTGGGGGCTGCTGT
SCN11A	11280	genome.wustl.edu	37	3	38948822	38948843	+	Intron	DEL	TGTGTGTGTGTGTATATATCTA	TGTGTGTGTGTGTATATATCTA	-	rs138466233|rs371006611|rs200809384|rs62242293	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	TGTGTGTGTGTGTATATATCTA	TGTGTGTGTGTGTATATATCTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr3:38948822_38948843delTGTGTGTGTGTGTATATATCTA	ENST00000302328.3	-	10	1672				SCN11A_ENST00000450244.1_Intron|AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000456224.3_Intron|SCN11A_ENST00000444237.2_Intron	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit						cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	tgtgtgtgtgtgtgtgtgtgtgtATATATCTATATATacaca	0.387																																																	0								ENSG00000215941																																			AC116038.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1473+596TAGATATATACACACACACACA>-	3.37:g.38948822_38948843delTGTGTGTGTGTGTATATATCTA		Somatic	NA	NA	NA		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000302328.3	37	NULL	CCDS33737.1	3																																																																																			-	-		0.387	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215941	protein_coding	OTTHUMT00000109746.4	TGTGTGTGTGTGTATATATCTA	NM_014139			38948843	+1	no_errors	ENST00000401122	ensembl	human	novel	74_37	rna	DEL	0.193:0.195:0.137:0.126:0.125:0.119:0.107:0.069:0.062:0.049:0.028:0.020:0.007:0.002:0.001:0.001:0.002:0.002:0.002:0.001:0.001:0.001	-
ZNF815P	401303	genome.wustl.edu	37	7	5887309	5887309	+	RNA	SNP	C	C	G	rs201257714		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr7:5887309C>G	ENST00000421890.1	+	0	1352							A8K554	ZN815_HUMAN	zinc finger protein 815, pseudogene																		ACGAGTGCTCCGACTGCGGGA	0.642																																																	0								ENSG00000235944																																			ZNF815P			0			-	HGNC	AK096288		7p22.1	2012-10-05	2012-04-20	2012-04-20	ENSG00000235944	ENSG00000235944			22029	pseudogene	pseudogene			"""zinc finger protein 815"""	ZNF815			Standard	NR_023382		Approved	FLJ38969	uc003spc.2	A8K554	OTTHUMG00000155501		7.37:g.5887309C>G		Somatic	0	18	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000421890.1	37	NULL		7																																																																																			-	-		0.642	ZNF815P-002	KNOWN	basic	processed_transcript	ZNF815P	pseudogene	OTTHUMT00000340385.1	C		rs201257714		5887309	+1	no_errors	ENST00000422825	ensembl	human	known	74_37	rna	SNP	0.000	G
LRRC37A	9884	genome.wustl.edu	37	17	44409004	44409004	+	Missense_Mutation	SNP	T	T	C	rs62073248	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:44409004T>C	ENST00000320254.5	+	9	4364	c.4361T>C	c.(4360-4362)cTg>cCg	p.L1454P	ARL17B_ENST00000575698.1_Intron|ARL17B_ENST00000570618.1_Intron|LRRC37A_ENST00000496930.1_Missense_Mutation_p.L492P|LRRC37A_ENST00000393465.3_Missense_Mutation_p.L1454P|ARL17B_ENST00000434041.2_Intron|ARL17B_ENST00000575960.1_Intron	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	1454						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		GGCACTGACCTGTCCCCCGAG	0.502																																																	0								ENSG00000176681																																			LRRC37A	SO:0001583	missense	0			-	HGNC	BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.4361T>C	17.37:g.44409004T>C	ENSP00000326324:p.Leu1454Pro	Somatic	0	10	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	Q68DY2|Q8IWC7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L1454P	ENST00000320254.5	37	c.4361	CCDS11504.2	17	.	.	.	.	.	.	.	.	.	.	t	6.227	0.410104	0.11812	.	.	ENSG00000176681	ENST00000496930;ENST00000393466;ENST00000393465;ENST00000320254	T;T;T	0.59638	1.45;0.25;0.26	2.49	1.29	0.21616	.	.	.	.	.	T	0.65238	0.2672	L	0.59436	1.845	0.09310	N	1	D;D;D	0.76494	0.999;0.969;0.995	D;P;D	0.75484	0.931;0.651;0.986	T	0.50890	-0.8774	9	0.45353	T	0.12	.	3.2767	0.06901	0.0:0.503:0.0:0.497	.	492;574;1454	E9PP10;Q5YKG5;A6NMS7	.;.;L37A1_HUMAN	P	492;1454;1454;1454	ENSP00000437021:L492P;ENSP00000377108:L1454P;ENSP00000326324:L1454P	ENSP00000326324:L1454P	L	+	2	0	LRRC37A	41764765	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.093000	0.15086	0.349000	0.23975	0.347000	0.21830	CTG	-	NULL		0.502	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC37A	protein_coding	OTTHUMT00000313519.3	T	NM_014834	rs200790029		44409004	+1	no_errors	ENST00000320254	ensembl	human	known	74_37	missense	SNP	0.000	C
RP11-964E11.2	0	genome.wustl.edu	37	14	37116998	37116998	+	RNA	SNP	G	G	C			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr14:37116998G>C	ENST00000555107.1	-	0	1902																											GGGAAGGCCTGCGGGGTTTCC	0.692																																																	0								ENSG00000258661																																			RP11-964E11.2			0			-	Clone_based_vega_gene																													14.37:g.37116998G>C		Somatic	0	41	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	20	50.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000555107.1	37	NULL		14																																																																																			-	-		0.692	RP11-964E11.2-001	KNOWN	basic	antisense	ENSG00000258661	antisense	OTTHUMT00000410133.1	G		-		37116998	-1	no_errors	ENST00000555107	ensembl	human	known	74_37	rna	SNP	0.000	C
PADI1	29943	genome.wustl.edu	37	1	17570753	17570753	+	3'UTR	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:17570753G>A	ENST00000375471.4	+	0	2099				PADI1_ENST00000413717.2_3'UTR|PADI1_ENST00000536552.1_3'UTR|PADI1_ENST00000537499.1_3'UTR|PADI1_ENST00000460293.1_3'UTR	NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I						protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GCCCCCACCCGCCATCCTCTC	0.602																																					Esophageal Squamous(80;414 1257 4580 27746 50832)												0								ENSG00000142623						36.0	38.0	37.0					1																	17570753		2203	4300	6503	PADI1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.*15G>A	1.37:g.17570753G>A		Somatic	0	34	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A1L4K6|Q70SX6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375471.4	37	NULL	CCDS178.1	1																																																																																			-	-		0.602	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI1	protein_coding	OTTHUMT00000006621.1	G	NM_013358	-		17570753	+1	no_errors	ENST00000460293	ensembl	human	known	74_37	rna	SNP	0.000	A
WDR3	10885	genome.wustl.edu	37	1	118496638	118496638	+	Silent	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:118496638G>A	ENST00000349139.5	+	22	2324	c.2277G>A	c.(2275-2277)agG>agA	p.R759R	SPAG17_ENST00000336338.5_3'UTR	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	759						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		AGGCTGAGAGGATTATGGAGG	0.418																																																	0								ENSG00000065183						146.0	142.0	143.0					1																	118496638		2203	4300	6503	WDR3	SO:0001819	synonymous_variant	0			-	HGNC	AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.2277G>A	1.37:g.118496638G>A		Somatic	0	15	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	9	47.06		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R759	ENST00000349139.5	37	c.2277	CCDS898.1	1																																																																																			-	NULL		0.418	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	protein_coding	OTTHUMT00000033720.2	G	NM_006784	-		118496638	+1	no_errors	ENST00000349139	ensembl	human	known	74_37	silent	SNP	1.000	A
GINS3	64785	genome.wustl.edu	37	16	58426423	58426423	+	5'UTR	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr16:58426423C>T	ENST00000318129.5	+	0	126				GINS3_ENST00000328514.7_5'UTR|GINS3_ENST00000426538.2_5'UTR	NM_022770.3	NP_073607.2	Q9BRX5	PSF3_HUMAN	GINS complex subunit 3 (Psf3 homolog)						DNA replication (GO:0006260)	nucleus (GO:0005634)				NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	7						TGCCCAGTCTCCGCTTCCCCG	0.597																																																	0								ENSG00000181938																																			GINS3	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC005879	CCDS10796.1, CCDS45498.1, CCDS45499.1	16q21	2008-02-05			ENSG00000181938	ENSG00000181938			25851	protein-coding gene	gene with protein product		610610				12477932	Standard	NM_022770		Approved	FLJ13912, PSF3	uc010cdj.3	Q9BRX5	OTTHUMG00000133486	ENST00000318129.5:c.-83C>T	16.37:g.58426423C>T		Somatic	0	26	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	10	41.18	B2RDP3|E9PB21|Q9H870	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000318129.5	37	NULL	CCDS10796.1	16																																																																																			-	-		0.597	GINS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS3	protein_coding	OTTHUMT00000257384.2	C	NM_022770	-		58426423	+1	no_errors	ENST00000564814	ensembl	human	putative	74_37	rna	SNP	0.000	T
NYAP1	222950	genome.wustl.edu	37	7	100084455	100084455	+	Missense_Mutation	SNP	A	A	C			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr7:100084455A>C	ENST00000300179.2	+	3	239	c.80A>C	c.(79-81)gAg>gCg	p.E27A	NYAP1_ENST00000454988.1_5'Flank|AC092849.1_ENST00000583832.1_RNA|NYAP1_ENST00000423930.1_Missense_Mutation_p.E27A	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	27					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												TCCAGTAAGGAGGTGGCCCCC	0.706																																																	0								ENSG00000166924						3.0	3.0	3.0					7																	100084455		1496	3302	4798	NYAP1	SO:0001583	missense	0			-	HGNC	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.80A>C	7.37:g.100084455A>C	ENSP00000300179:p.Glu27Ala	Somatic	0	40	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	20	31.03	Q6U9Y3|Q8N1V0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E27A	ENST00000300179.2	37	c.80	CCDS5696.1	7	.	.	.	.	.	.	.	.	.	.	A	20.6	4.019945	0.75275	.	.	ENSG00000166924	ENST00000300179;ENST00000423930	T;T	0.42131	0.98;0.98	4.84	4.84	0.62591	.	0.000000	0.51477	D	0.000089	T	0.31358	0.0794	N	0.19112	0.55	0.44789	D	0.997799	P	0.45474	0.859	P	0.47573	0.55	T	0.04333	-1.0959	10	0.11794	T	0.64	-24.2481	10.7322	0.46104	1.0:0.0:0.0:0.0	.	27	Q6ZVC0	CG051_HUMAN	A	27	ENSP00000300179:E27A;ENSP00000411861:E27A	ENSP00000300179:E27A	E	+	2	0	C7orf51	99922391	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.763000	0.55257	2.025000	0.59659	0.379000	0.24179	GAG	-	NULL		0.706	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NYAP1	protein_coding	OTTHUMT00000339335.2	A	NM_173564	-		100084455	+1	no_errors	ENST00000423930	ensembl	human	known	74_37	missense	SNP	1.000	C
EVPL	2125	genome.wustl.edu	37	17	74017573	74017573	+	Silent	SNP	C	C	G	rs78569674	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:74017573C>G	ENST00000301607.3	-	9	1240	c.987G>C	c.(985-987)ctG>ctC	p.L329L	EVPL_ENST00000586740.1_Silent_p.L329L	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	329	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.L329L(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCACGTGCTGCAGCTGGGTCT	0.706																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)						ENSG00000167880						29.0	25.0	26.0					17																	74017573		2201	4297	6498	EVPL	SO:0001819	synonymous_variant	0			-	HGNC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.987G>C	17.37:g.74017573C>G		Somatic	0	19	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	7	50.00	A0AUV5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.L329	ENST00000301607.3	37	c.987	CCDS11737.1	17																																																																																			-	smart_Spectrin/alpha-actinin		0.706	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	protein_coding	OTTHUMT00000449483.1	C	NM_001988	rs78569674		74017573	-1	no_errors	ENST00000301607	ensembl	human	known	74_37	silent	SNP	1.000	G
NPR2	4882	genome.wustl.edu	37	9	35811486	35811497	+	IGR	DEL	CCAGGACCAGAG	CCAGGACCAGAG	-	rs59748329|rs555852229|rs141090907	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	CCAGGACCAGAG	CCAGGACCAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr9:35811486_35811497delCCAGGACCAGAG	ENST00000342694.2	+	0	3686				AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000340291.2_In_Frame_Del_p.182_186GSGPG>G|TMEM8B_ENST00000377996.1_5'Flank|SPAG8_ENST00000484764.1_In_Frame_Del_p.180_184GSGPG>G|SPAG8_ENST00000479751.1_5'Flank|HINT2_ENST00000474908.1_5'Flank|SPAG8_ENST00000396638.2_In_Frame_Del_p.182_186GSGPG>G	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2						bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.S183C(2)|p.S183_G186delSGPG(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	agagccatgaccaggaccagagccaggaccag	0.637														1567	0.312899	0.4985	0.2334	5008	,	,		13915	0.379		0.2008	False		,,,				2504	0.1656																3	Substitution - Missense(2)|Deletion - In frame(1)	prostate(2)|upper_aerodigestive_tract(1)						ENSG00000137098		,	1872,2386		432,1008,689					,	-8.9	0.0		dbSNP_132	42	1635,6615		166,1303,2656	no	coding,coding	SPAG8	NM_172312.1,NM_001039592.1	,	598,2311,3345	A1A1,A1R,RR		19.8182,43.9643,28.0381	,	,		3507,9001				SPAG8	SO:0001628	intergenic_variant	0				HGNC	AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871		9.37:g.35811486_35811497delCCAGGACCAGAG		Somatic	NA	NA	NA		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	prints_Antifreeze_1	p.SGPG183in_frame_del	ENST00000342694.2	37	c.557_546	CCDS6590.1	9																																																																																			-	NULL		0.637	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG8	protein_coding	OTTHUMT00000052345.1	CCAGGACCAGAG				35811497	-1	no_errors	ENST00000340291	ensembl	human	known	74_37	in_frame_del	DEL	0.595:0.593:0.546:0.350:0.036:0.005:0.002:0.001:0.001:0.001:0.001:0.001	-
TLN1	7094	genome.wustl.edu	37	9	35711350	35711351	+	Frame_Shift_Ins	INS	-	-	C	rs201783008	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr9:35711350_35711351insC	ENST00000314888.9	-	30	4273_4274	c.3920_3921insG	c.(3919-3921)ggcfs	p.G1307fs	TLN1_ENST00000540444.1_Frame_Shift_Ins_p.G1307fs	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1307					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			ACATGGAGATGCCCTTCAAGTT	0.54																																																	0								ENSG00000137076																																			TLN1	SO:0001589	frameshift_variant	0				HGNC	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.3921dupG	9.37:g.35711353_35711353dupC	ENSP00000316029:p.Gly1307fs	Somatic	0	35	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	24	40.00	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.I1308fs	ENST00000314888.9	37	c.3921_3920	CCDS35009.1	9																																																																																			-	pfam_Vinculin-bd_dom,superfamily_Vinculin/catenin		0.540	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	protein_coding	OTTHUMT00000052353.2	-	NM_006289			35711351	-1	no_errors	ENST00000314888	ensembl	human	known	74_37	frame_shift_ins	INS	0.999:1.000	C
ANO7	50636	genome.wustl.edu	37	2	242128165	242128165	+	Frame_Shift_Del	DEL	G	G	-	rs376011925		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr2:242128165delG	ENST00000274979.8	+	1	242	c.139delG	c.(139-141)ggafs	p.G47fs	ANO7_ENST00000402530.3_Frame_Shift_Del_p.G47fs|ANO7_ENST00000402430.3_Frame_Shift_Del_p.G47fs	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	47					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GACCTCTTCCGGAAGCCACTG	0.677																																																	0								ENSG00000146205						41.0	44.0	43.0					2																	242128165		2203	4300	6503	ANO7	SO:0001589	frameshift_variant	0				HGNC	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.139delG	2.37:g.242128165delG	ENSP00000274979:p.Gly47fs	Somatic	0	22	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	16	51.52	Q6IWH6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Anoctamin	p.G47fs	ENST00000274979.8	37	c.139	CCDS33423.1	2																																																																																			-	NULL		0.677	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO7	protein_coding	OTTHUMT00000323509.1	G	NM_001001891			242128165	+1	no_errors	ENST00000274979	ensembl	human	known	74_37	frame_shift_del	DEL	0.078	-
UNC5C	8633	genome.wustl.edu	37	4	96140390	96140390	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr4:96140390C>T	ENST00000453304.1	-	9	1723	c.1375G>A	c.(1375-1377)Gtc>Atc	p.V459I	UNC5C_ENST00000506749.1_Missense_Mutation_p.V478I	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	459					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TTGTCTGAGACGTCATGCAGG	0.507																																																	0								ENSG00000182168						325.0	314.0	318.0					4																	96140390		2203	4300	6503	UNC5C	SO:0001583	missense	0			-	HGNC	AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.1375G>A	4.37:g.96140390C>T	ENSP00000406022:p.Val459Ile	Somatic	0	13	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	7	53.33	Q8IUT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ZU5,pfam_Death_domain,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.V459I	ENST00000453304.1	37	c.1375	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	C	14.73	2.622983	0.46840	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749	T;T;T	0.56941	0.73;0.43;0.45	5.21	5.21	0.72293	.	0.000000	0.85682	D	0.000000	T	0.42154	0.1190	L	0.29908	0.895	0.80722	D	1	B;B;B	0.31599	0.109;0.33;0.147	B;B;B	0.17098	0.017;0.014;0.014	T	0.40794	-0.9544	10	0.56958	D	0.05	.	18.7712	0.91893	0.0:1.0:0.0:0.0	.	459;478;459	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	I	459;418;478;478	ENSP00000406022:V459I;ENSP00000426924:V478I;ENSP00000426153:V478I	ENSP00000328673:V418I	V	-	1	0	UNC5C	96359413	1.000000	0.71417	0.999000	0.59377	0.951000	0.60555	4.743000	0.62110	2.438000	0.82558	0.655000	0.94253	GTC	-	NULL		0.507	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	protein_coding	OTTHUMT00000253607.1	C	NM_003728	-		96140390	-1	no_errors	ENST00000453304	ensembl	human	known	74_37	missense	SNP	1.000	T
LAMP3	27074	genome.wustl.edu	37	3	182871758	182871758	+	Silent	SNP	C	C	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr3:182871758C>A	ENST00000265598.3	-	2	726	c.471G>T	c.(469-471)ggG>ggT	p.G157G	LAMP3_ENST00000466939.1_Silent_p.G133G	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	157	Thr-rich.				cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			GAGTGGTGTTCCCAGTTGTGT	0.537																																																	0								ENSG00000078081						376.0	381.0	379.0					3																	182871758		2203	4300	6503	LAMP3	SO:0001819	synonymous_variant	0			-	HGNC	AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.471G>T	3.37:g.182871758C>A		Somatic	0	129	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	92	39.07	D3DNS4|O94781|Q8NEC8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.G157	ENST00000265598.3	37	c.471	CCDS3242.1	3																																																																																			-	pfam_Lysosome-assoc_membr_glycop		0.537	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMP3	protein_coding	OTTHUMT00000350863.1	C		-		182871758	-1	no_errors	ENST00000265598	ensembl	human	known	74_37	silent	SNP	0.002	A
RLF	6018	genome.wustl.edu	37	1	40661333	40661333	+	Silent	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:40661333G>A	ENST00000372771.4	+	4	531	c.504G>A	c.(502-504)ggG>ggA	p.G168G		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	168					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TGGAATTTGGGAATAATAACC	0.358																																																	0								ENSG00000117000						67.0	67.0	67.0					1																	40661333		2203	4300	6503	RLF	SO:0001819	synonymous_variant	0			-	HGNC		CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.504G>A	1.37:g.40661333G>A		Somatic	0	20	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	14	39.13	Q14CQ1|Q9NU60	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G168	ENST00000372771.4	37	c.504	CCDS448.1	1																																																																																			-	NULL		0.358	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	protein_coding	OTTHUMT00000015767.1	G	NM_012421	-		40661333	+1	no_errors	ENST00000372771	ensembl	human	known	74_37	silent	SNP	0.945	A
DNAH17-AS1	100996295	genome.wustl.edu	37	17	76495054	76495054	+	5'UTR	SNP	C	C	G			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:76495054C>G	ENST00000598378.1	+	0	144				DNAH17_ENST00000389840.5_Intron|RP11-559N14.5_ENST00000591373.1_RNA|DNAH17_ENST00000585328.1_Intron					DNAH17 antisense RNA 1																		GCCAGTCACCCGACGTGACCC	0.582																																																	0								ENSG00000267432						24.0	27.0	26.0					17																	76495054		2078	4230	6308	RP11-559N14.5	SO:0001623	5_prime_UTR_variant	0			-	Clone_based_vega_gene			17q25.3	2014-02-12	2013-05-21		ENSG00000268470	ENSG00000267432		"""Long non-coding RNAs"""	48594	non-coding RNA	RNA, long non-coding							Standard	NR_102401		Approved				OTTHUMG00000177588	ENST00000598378.1:c.-1015C>G	17.37:g.76495054C>G		Somatic	0	29	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	20	42.86		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000598378.1	37	NULL		17																																																																																			-	-		0.582	DNAH17-AS1-201	KNOWN	basic|appris_principal	protein_coding	DNAH17-AS1	protein_coding		C		-		76495054	+1	no_errors	ENST00000591373	ensembl	human	known	74_37	rna	SNP	0.000	G
U2SURP	23350	genome.wustl.edu	37	3	142720221	142720222	+	5'Flank	INS	-	-	GGACAACGA	rs3832221|rs11282240	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr3:142720221_142720222insGGACAACGA	ENST00000473835.2	+	0	0				RP11-91G21.1_ENST00000597953.1_lincRNA|RP11-372E1.6_ENST00000595248.1_RNA|U2SURP_ENST00000397933.2_5'Flank|U2SURP_ENST00000493598.2_5'Flank|RP11-372E1.6_ENST00000497652.1_RNA|RP11-372E1.6_ENST00000595774.1_RNA	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing						RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						CAGCTGGCCCTGATTCTCTGAA	0.515														3604	0.719649	0.8949	0.6988	5008	,	,		19350	0.7212		0.6183	False		,,,				2504	0.6002																0								ENSG00000241570																																			RP11-372E1.6	SO:0001631	upstream_gene_variant	0				Clone_based_vega_gene	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323		3.37:g.142720221_142720222insGGACAACGA	Exception_encountered	Somatic	NA	NA	NA		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000473835.2	37	NULL	CCDS46928.1	3																																																																																			-	-		0.515	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927832	protein_coding	OTTHUMT00000354603.2	-	NM_001080415			142720222	+1	no_errors	ENST00000595248	ensembl	human	known	74_37	rna	INS	0.005:0.015	GGACAACGA
PDZD2	23037	genome.wustl.edu	37	5	32108775	32108778	+	3'UTR	DEL	ACTT	ACTT	-			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	ACTT	ACTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr5:32108775_32108778delACTT	ENST00000438447.1	+	0	9442_9445				PDZD2_ENST00000282493.3_3'UTR|CTD-2152M20.2_ENST00000503441.1_RNA|PDZD2_ENST00000513490.1_3'UTR			O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						AGAGAATAAGACTTACTTAAAAAA	0.314																																																	0								ENSG00000133401																																			PDZD2	SO:0001624	3_prime_UTR_variant	0				HGNC	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.*537ACTT>-	5.37:g.32108779_32108782delACTT		Somatic	0	53	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	31	20.51	Q9BXD4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000438447.1	37	NULL	CCDS34137.1	5																																																																																			-	-		0.314	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	protein_coding	OTTHUMT00000366608.1	ACTT				32108778	+1	no_errors	ENST00000397559	ensembl	human	known	74_37	rna	DEL	0.005:0.005:0.008:0.010	-
ARID1A	8289	genome.wustl.edu	37	1	27088786	27088786	+	Nonsense_Mutation	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:27088786C>T	ENST00000324856.7	+	7	2766	c.2395C>T	c.(2395-2397)Cag>Tag	p.Q799*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q416*|RN7SL501P_ENST00000578818.1_RNA|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q799*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	799					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTATGGTCCCCAGGGGGGTCA	0.552			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0								ENSG00000117713						53.0	57.0	55.0					1																	27088786		2203	4300	6503	ARID1A	SO:0001587	stop_gained	0			-	HGNC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2395C>T	1.37:g.27088786C>T	ENSP00000320485:p.Gln799*	Somatic	0	30	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q799*	ENST00000324856.7	37	c.2395	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.743778	0.98465	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-6.9253	19.428	0.94751	0.0:1.0:0.0:0.0	.	.	.	.	X	799;799;416	.	ENSP00000320485:Q799X	Q	+	1	0	ARID1A	26961373	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.320000	0.79064	2.824000	0.97209	0.655000	0.94253	CAG	-	NULL		0.552	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	protein_coding	OTTHUMT00000011437.2	C	NM_139135	-		27088786	+1	no_errors	ENST00000324856	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TTC24	164118	genome.wustl.edu	37	1	156555412	156555412	+	Intron	SNP	C	C	T			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:156555412C>T	ENST00000368237.3	+	8	1456				TTC24_ENST00000478081.1_3'UTR|TTC24_ENST00000368236.3_Intron|AL365181.1_ENST00000581084.1_RNA			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24											breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCTCACTACTCAATAGCATCT	0.483																																																	0								ENSG00000187862																																			TTC24	SO:0001627	intron_variant	0			-	HGNC		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.1457-93C>T	1.37:g.156555412C>T		Somatic	0	37	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q5T3H7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368237.3	37	NULL	CCDS53379.1	1																																																																																			-	-		0.483	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	protein_coding	OTTHUMT00000158547.1	C	XM_089384	-		156555412	+1	no_errors	ENST00000478081	ensembl	human	known	74_37	rna	SNP	0.000	T
CDC73	79577	genome.wustl.edu	37	1	193181539	193181539	+	Silent	SNP	C	C	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:193181539C>A	ENST00000367435.3	+	13	1270	c.1086C>A	c.(1084-1086)atC>atA	p.I362I		NM_024529.4	NP_078805.3	Q6P1J9	CDC73_HUMAN	cell division cycle 73	362	Interaction with POLR2A and PAF1.|Poly-Ile.				cell cycle (GO:0007049)|cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|mRNA polyadenylation (GO:0006378)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mRNA 3'-end processing (GO:0031442)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein destabilization (GO:0031648)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(14)|ovary(1)|pancreas(1)|parathyroid(51)|skin(1)|upper_aerodigestive_tract(1)	87						CACCCATTATCATAATTCCTG	0.299																																																	0								ENSG00000134371						135.0	150.0	145.0					1																	193181539		2203	4299	6502	CDC73	SO:0001819	synonymous_variant	0			-	HGNC	AF312865	CCDS1382.1	1q25	2014-09-17	2013-01-17	2005-07-20	ENSG00000134371	ENSG00000134371			16783	protein-coding gene	gene with protein product	"""Paf1/RNA polymerase II complex component"""	607393	"""chromosome 1 open reading frame 28"", ""hyperparathyroidism 2 (with jaw tumor)"", ""cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"", ""hyperparathyroidism 1"""	C1orf28, HRPT2, HRPT1		11318611, 15632063, 18755853	Standard	NM_024529		Approved	parafibromin, FIHP	uc001gtb.3	Q6P1J9	OTTHUMG00000035676	ENST00000367435.3:c.1086C>A	1.37:g.193181539C>A		Somatic	0	95	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	64	29.67	A6NLZ8|B2RBR2|Q6PK51|Q96A07|Q9H245|Q9H5L7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_access_fac_Cdc73	p.I362	ENST00000367435.3	37	c.1086	CCDS1382.1	1	.	.	.	.	.	.	.	.	.	.	C	9.431	1.085492	0.20390	.	.	ENSG00000134371	ENST00000445394	.	.	.	6.07	3.21	0.36854	.	.	.	.	.	T	0.70439	0.3224	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70521	-0.4849	5	0.66056	D	0.02	-7.2715	10.9736	0.47452	0.0:0.8059:0.0:0.1941	.	.	.	.	N	304	.	ENSP00000398808:H304N	H	+	1	0	CDC73	191448162	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.459000	0.21908	0.446000	0.26666	0.655000	0.94253	CAT	-	pfam_RNA_pol_access_fac_Cdc73		0.299	CDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC73	protein_coding	OTTHUMT00000086696.2	C	NM_024529	-		193181539	+1	no_errors	ENST00000367435	ensembl	human	known	74_37	silent	SNP	1.000	A
GPATCH1	55094	genome.wustl.edu	37	19	33602767	33602767	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr19:33602767G>A	ENST00000170564.2	+	12	2037	c.1723G>A	c.(1723-1725)Gag>Aag	p.E575K		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	575					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					CGCCAAGGAGGAGGATGACTC	0.557																																					Pancreas(67;88 1713 4567 18227)												0								ENSG00000076650						110.0	92.0	98.0					19																	33602767		2203	4300	6503	GPATCH1	SO:0001583	missense	0			-	HGNC	AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.1723G>A	19.37:g.33602767G>A	ENSP00000170564:p.Glu575Lys	Somatic	0	42	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	20	33.33	Q8IZV6|Q8N3B7|Q9NW94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1604,pfam_G_patch_dom,superfamily_C-type_lectin_fold,pfscan_G_patch_dom	p.E575K	ENST00000170564.2	37	c.1723	CCDS12428.1	19	.	.	.	.	.	.	.	.	.	.	G	19.10	3.762046	0.69763	.	.	ENSG00000076650	ENST00000170564	T	0.32272	1.46	5.51	5.51	0.81932	.	0.257144	0.44902	D	0.000405	T	0.32466	0.0830	M	0.73598	2.24	0.80722	D	1	P	0.36465	0.554	B	0.27500	0.08	T	0.19418	-1.0306	10	0.15952	T	0.53	-25.0513	18.42	0.90587	0.0:0.0:1.0:0.0	.	575	Q9BRR8	GPTC1_HUMAN	K	575	ENSP00000170564:E575K	ENSP00000170564:E575K	E	+	1	0	GPATCH1	38294607	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	6.346000	0.72999	2.597000	0.87782	0.650000	0.86243	GAG	-	NULL		0.557	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH1	protein_coding	OTTHUMT00000450834.1	G	NM_018025	-		33602767	+1	no_errors	ENST00000170564	ensembl	human	known	74_37	missense	SNP	1.000	A
ANKRD20A5P	440482	genome.wustl.edu	37	18	14184386	14184386	+	RNA	SNP	A	A	G	rs375149306		TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr18:14184386A>G	ENST00000581935.1	+	0	1075							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						CCCCGTAATTAGCGTAAAACA	0.318																																																	0								ENSG00000186481																																			ANKRD20A5P			0			-	HGNC	BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14184386A>G		Somatic	0	9	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00	Q4G1B6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			-	-		0.318	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	pseudogene	OTTHUMT00000442833.1	A		-		14184386	+1	no_errors	ENST00000581935	ensembl	human	known	74_37	rna	SNP	0.001	G
EVPL	2125	genome.wustl.edu	37	17	74017594	74017594	+	Silent	SNP	A	A	G	rs193119748	byFrequency	TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:74017594A>G	ENST00000301607.3	-	9	1219	c.966T>C	c.(964-966)tgT>tgC	p.C322C	EVPL_ENST00000586740.1_Silent_p.C322C	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	322	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCTGGCAGATACACAGGTTCA	0.721																																																	0								ENSG00000167880						29.0	26.0	27.0					17																	74017594		2202	4299	6501	EVPL	SO:0001819	synonymous_variant	0			-	HGNC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.966T>C	17.37:g.74017594A>G		Somatic	0	21	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	9	43.75	A0AUV5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.C322	ENST00000301607.3	37	c.966	CCDS11737.1	17																																																																																			-	smart_Spectrin/alpha-actinin		0.721	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	protein_coding	OTTHUMT00000449483.1	A	NM_001988	rs193119748		74017594	-1	no_errors	ENST00000301607	ensembl	human	known	74_37	silent	SNP	1.000	G
SEMA4D	10507	genome.wustl.edu	37	9	91978732	91978732	+	Missense_Mutation	SNP	G	G	C			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr9:91978732G>C	ENST00000420987.1	-	18	2462	c.2016C>G	c.(2014-2016)agC>agG	p.S672R	SEMA4D_ENST00000455551.2_Missense_Mutation_p.S672R|SEMA4D_ENST00000420101.2_Missense_Mutation_p.S57R|SEMA4D_ENST00000343780.4_Missense_Mutation_p.S672R|SEMA4D_ENST00000339861.4_Missense_Mutation_p.S672R|SEMA4D_ENST00000469653.1_5'UTR	NM_001142287.1	NP_001135759.1	Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	0					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)	p.S57S(1)		NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GATACTCAGCGCTTTCCCTGA	0.592																																																	1	Substitution - coding silent(1)	endometrium(1)						ENSG00000187764						107.0	85.0	92.0					9																	91978732		2203	4300	6503	SEMA4D	SO:0001583	missense	0			-	HGNC	U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000420987.1:c.2016C>G	9.37:g.91978732G>C	ENSP00000391733:p.Ser672Arg	Somatic	0	43	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	18	51.35	B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom,pfscan_Ig-like_dom	p.S672R	ENST00000420987.1	37	c.2016	CCDS47991.1	9	.	.	.	.	.	.	.	.	.	.	G	8.894	0.954648	0.18431	.	.	ENSG00000187764	ENST00000339861;ENST00000420987;ENST00000420101;ENST00000455551;ENST00000343780	T;T;T;T	0.15718	2.4;2.4;2.4;2.4	5.05	1.13	0.20643	.	0.165528	0.43260	D	0.000581	T	0.16685	0.0401	.	.	.	0.09310	N	1	P	0.45428	0.858	B	0.44163	0.443	T	0.08493	-1.0719	9	0.72032	D	0.01	.	9.0985	0.36653	0.4385:0.0:0.5615:0.0	.	672	Q92854-2	.	R	672;672;57;672;672	ENSP00000344923:S672R;ENSP00000391733:S672R;ENSP00000411981:S672R;ENSP00000343418:S672R	ENSP00000344923:S672R	S	-	3	2	SEMA4D	91168552	0.000000	0.05858	0.007000	0.13788	0.108000	0.19459	-0.389000	0.07342	0.331000	0.23511	0.462000	0.41574	AGC	-	pfscan_Ig-like_dom		0.592	SEMA4D-203	KNOWN	basic|CCDS	protein_coding	SEMA4D	protein_coding	OTTHUMT00000402418.2	G	NM_006378	-		91978732	-1	no_errors	ENST00000343780	ensembl	human	known	74_37	missense	SNP	0.001	C
DNAH2	146754	genome.wustl.edu	37	17	7678177	7678177	+	Missense_Mutation	SNP	C	C	G			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr17:7678177C>G	ENST00000572933.1	+	29	6062	c.4602C>G	c.(4600-4602)ttC>ttG	p.F1534L	DNAH2_ENST00000389173.2_Missense_Mutation_p.F1534L			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1534	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TCCCCCGCTTCTACTTCTTGT	0.448																																																	0								ENSG00000183914						102.0	98.0	99.0					17																	7678177		2203	4300	6503	DNAH2	SO:0001583	missense	0			-	HGNC	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.4602C>G	17.37:g.7678177C>G	ENSP00000458355:p.Phe1534Leu	Somatic	0	35	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F1534L	ENST00000572933.1	37	c.4602	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	C	19.79	3.893683	0.72639	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.78003	-1.14	5.44	5.44	0.79542	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	D	0.89143	0.6631	M	0.92026	3.265	0.80722	D	1	D	0.60160	0.987	D	0.69142	0.962	D	0.90698	0.4618	10	0.72032	D	0.01	.	11.527	0.50586	0.0:0.9169:0.0:0.0831	.	1534	Q9P225	DYH2_HUMAN	L	1534	ENSP00000373825:F1534L	ENSP00000353818:F1534L	F	+	3	2	DNAH2	7618902	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.203000	0.32284	2.565000	0.86533	0.637000	0.83480	TTC	-	pfam_Dynein_heavy_dom-2		0.448	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	protein_coding	OTTHUMT00000440241.1	C	NM_020877	-		7678177	+1	no_errors	ENST00000389173	ensembl	human	known	74_37	missense	SNP	1.000	G
CNKSR1	10256	genome.wustl.edu	37	1	26511667	26511667	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr1:26511667G>A	ENST00000374253.5	+	14	1358	c.1319G>A	c.(1318-1320)cGc>cAc	p.R440H	CNKSR1_ENST00000531191.1_Missense_Mutation_p.R175H|CNKSR1_ENST00000361530.6_Missense_Mutation_p.R433H	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	440	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		TACTGGTACCGCCAGCCCCAG	0.582																																					NSCLC(180;1396 2109 28270 30756 34275)												0								ENSG00000142675																																			CNKSR1	SO:0001583	missense	0			-	HGNC	AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1319G>A	1.37:g.26511667G>A	ENSP00000363371:p.Arg440His	Somatic	0	24	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	24	22.58	B1AMW9|O95381	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CRIC_domain_Chordata,pfam_Pleckstrin_homology,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.R440H	ENST00000374253.5	37	c.1319		1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.590231	0.46214	.	.	ENSG00000142675	ENST00000361530;ENST00000374253;ENST00000531191	T;T;T	0.75821	-0.97;-0.97;-0.97	5.55	4.64	0.57946	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.377447	0.29459	N	0.012083	T	0.65943	0.2740	L	0.52573	1.65	0.35713	D	0.816531	B;B	0.22211	0.066;0.066	B;B	0.12837	0.008;0.008	T	0.67841	-0.5566	10	0.40728	T	0.16	-8.19	9.0988	0.36656	0.2256:0.0:0.7744:0.0	.	440;433	Q969H4;Q53GM7	CNKR1_HUMAN;.	H	433;440;175	ENSP00000354609:R433H;ENSP00000363371:R440H;ENSP00000431817:R175H	ENSP00000354609:R433H	R	+	2	0	CNKSR1	26384254	0.008000	0.16893	1.000000	0.80357	0.993000	0.82548	1.205000	0.32308	1.339000	0.45563	0.650000	0.86243	CGC	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.582	CNKSR1-007	KNOWN	basic	protein_coding	CNKSR1	protein_coding	OTTHUMT00000089943.2	G	NM_006314	-		26511667	+1	no_errors	ENST00000374253	ensembl	human	known	74_37	missense	SNP	1.000	A
ERBB4	2066	genome.wustl.edu	37	2	212248560	212248560	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N7-01A-21D-A26G-09	TCGA-HS-A5N7-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	0ed66c47-3927-4b0d-8bd9-3fcef06f7538	1770637f-2776-4d75-8831-d45979297d85	g.chr2:212248560G>A	ENST00000342788.4	-	28	4017	c.3707C>T	c.(3706-3708)gCg>gTg	p.A1236V	ERBB4_ENST00000436443.1_Missense_Mutation_p.A1220V|ERBB4_ENST00000402597.1_Missense_Mutation_p.A1226V	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1236					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.A1236E(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	GTTGTCAAACGCTTTCTTGGC	0.483										TSP Lung(8;0.080)																																							1	Substitution - Missense(1)	lung(1)						ENSG00000178568						244.0	224.0	231.0					2																	212248560		2203	4300	6503	ERBB4	SO:0001583	missense	0			-	HGNC	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3707C>T	2.37:g.212248560G>A	ENSP00000342235:p.Ala1236Val	Somatic	0	70	0.00		0.701590058484691	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	77	27.36	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A1236V	ENST00000342788.4	37	c.3707	CCDS2394.1	2	.	.	.	.	.	.	.	.	.	.	G	16.32	3.088790	0.55968	.	.	ENSG00000178568	ENST00000342788;ENST00000436443;ENST00000402597	T;T;T	0.75938	-0.97;-0.97;-0.98	5.11	5.11	0.69529	.	0.062435	0.64402	D	0.000006	T	0.74268	0.3694	N	0.12961	0.28	0.44880	D	0.997891	P;D;P;B	0.61697	0.78;0.99;0.78;0.273	B;P;B;B	0.59115	0.09;0.852;0.09;0.041	T	0.77760	-0.2467	10	0.54805	T	0.06	.	19.09	0.93223	0.0:0.0:1.0:0.0	.	1210;1226;1220;1236	Q15303-4;Q15303-2;Q15303-3;Q15303	.;.;.;ERBB4_HUMAN	V	1236;1220;1226	ENSP00000342235:A1236V;ENSP00000403204:A1220V;ENSP00000385565:A1226V	ENSP00000342235:A1236V	A	-	2	0	ERBB4	211956805	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	5.961000	0.70356	2.812000	0.96745	0.557000	0.71058	GCG	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt		0.483	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	protein_coding	OTTHUMT00000256597.1	G	NM_001042599	-		212248560	-1	no_errors	ENST00000342788	ensembl	human	known	74_37	missense	SNP	0.996	A
