#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NFKBIZ	64332	genome.wustl.edu	37	3	101576029	101576030	+	Splice_Site	INS	-	-	ACTTTTAGAAAGCTTTAATAACC	rs3217713|rs371844266	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr3:101576029_101576030insACTTTTAGAAAGCTTTAATAACC	ENST00000326172.5	+	10	2050		c.e10+2		NFKBIZ_ENST00000326151.5_Splice_Site|NFKBIZ_ENST00000394054.2_Splice_Site	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta						inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						AATGCAAAGGTACACCAGAGTT	0.465														4063	0.811302	0.9546	0.8012	5008	,	,		21934	0.6528		0.7704	False		,,,				2504	0.8303																0								ENSG00000144802																																			NFKBIZ	SO:0001630	splice_region_variant	0				HGNC	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1935+2->ACTTTTAGAAAGCTTTAATAACC	3.37:g.101576029_101576030insACTTTTAGAAAGCTTTAATAACC		Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e10+2	ENST00000326172.5	37	c.1935+2_1935+1	CCDS2946.1	3																																																																																			-	-		0.465	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	protein_coding	OTTHUMT00000353793.1	-	NM_031419		Intron	101576030	+1	no_errors	ENST00000326172	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.000	ACTTTTAGAAAGCTTTAATAACC
EYA3	2140	genome.wustl.edu	37	1	28303802	28303802	+	Intron	SNP	A	A	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr1:28303802A>G	ENST00000373871.3	-	17	1882				EYA3_ENST00000373864.1_Intron|EYA3_ENST00000436342.2_Intron|EYA3_ENST00000540618.1_Intron|EYA3_ENST00000545175.1_Intron|EYA3_ENST00000373863.3_Silent_p.N534N	NM_001282561.1|NM_001282562.1	NP_001269490.1|NP_001269491.1	Q99504	EYA3_HUMAN	EYA transcriptional coactivator and phosphatase 3						anatomical structure morphogenesis (GO:0009653)|double-strand break repair (GO:0006302)|histone dephosphorylation (GO:0016576)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of DNA repair (GO:0045739)|regulation of transcription, DNA-templated (GO:0006355)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		CTCATAGTTTATTATAGTTGC	0.363																																																	0								ENSG00000158161																																			EYA3	SO:0001627	intron_variant	0			-	HGNC	U81602	CCDS316.1, CCDS60050.1, CCDS60051.1, CCDS60052.1	1p36	2014-06-19	2014-06-19		ENSG00000158161	ENSG00000158161		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3521	protein-coding gene	gene with protein product		601655	"""eyes absent (Drosophila) homolog 3"", ""eyes absent homolog 3 (Drosophila)"""			9020840	Standard	NM_001990		Approved	DKFZp686C132	uc001bpi.2	Q99504	OTTHUMG00000003916	ENST00000373871.3:c.1641+1082T>C	1.37:g.28303802A>G		Somatic	0	69	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	A8K190|B4DIR7|B4DNZ7|O95463|Q8IVX7|Q99813	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_HAD-like_dom,tigrfam_EYA	p.N534	ENST00000373871.3	37	c.1602	CCDS316.1	1																																																																																			-	NULL		0.363	EYA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EYA3	protein_coding	OTTHUMT00000011184.1	A	NM_001990	-		28303802	-1	no_errors	ENST00000373863	ensembl	human	known	74_37	silent	SNP	0.002	G
SH3PXD2B	285590	genome.wustl.edu	37	5	171866695	171866704	+	Intron	DEL	CGCACACACA	CGCACACACA	-	rs62387194|rs79198163|rs367799974	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	CGCACACACA	CGCACACACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr5:171866695_171866704delCGCACACACA	ENST00000311601.5	-	1	246				AC011407.1_ENST00000401308.1_RNA|SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B						adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CGcacgcgcgcgcacacacacacacacaca	0.524																																																	0								ENSG00000216127																																			AC011407.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.75+14577TGTGTGTGCG>-	5.37:g.171866695_171866704delCGCACACACA		Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B6F0V2|Q9P2Q1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000311601.5	37	NULL	CCDS34291.1	5																																																																																			-	-		0.524	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216127	protein_coding	OTTHUMT00000372449.1	CGCACACACA	NM_017963			171866704	-1	no_errors	ENST00000401308	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.001:0.000	-
AMICA1	120425	genome.wustl.edu	37	11	118074177	118074215	+	In_Frame_Del	DEL	GGTTTTCTTGAACACCAGGTTCCCTAGGTGGATACTGCA	GGTTTTCTTGAACACCAGGTTCCCTAGGTGGATACTGCA	-			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	GGTTTTCTTGAACACCAGGTTCCCTAGGTGGATACTGCA	GGTTTTCTTGAACACCAGGTTCCCTAGGTGGATACTGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr11:118074177_118074215delGGTTTTCTTGAACACCAGGTTCCCTAGGTGGATACTGCA	ENST00000356289.5	-	6	873_911	c.700_738delTGCAGTATCCACCTAGGGAACCTGGTGTTCAAGAAAACC	c.(700-738)tgcagtatccacctagggaacctggtgttcaagaaaaccdel	p.CSIHLGNLVFKKT234del	AMICA1_ENST00000292067.7_In_Frame_Del_p.CSIHLGNLVFKKT224del|AMICA1_ENST00000533261.1_In_Frame_Del_p.CSIHLGNLVFKKT223del|AMICA1_ENST00000526620.1_In_Frame_Del_p.CSIHLGNLVFKKT195del	NM_001098526.1	NP_001091996.1	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen 1	234	Ig-like V-type 2.				blood coagulation (GO:0007596)|gamma-delta T cell activation (GO:0046629)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte migration (GO:0050900)|monocyte extravasation (GO:0035696)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|stomach(2)	20	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GCAGCACAATGGTTTTCTTGAACACCAGGTTCCCTAGGTGGATACTGCAGGTGTAGTTT	0.536																																																	0								ENSG00000160593																																			AMICA1	SO:0001651	inframe_deletion	0				HGNC	AY138965, AY358362	CCDS8391.1, CCDS41723.1, CCDS66240.1	11q23.3	2013-01-11				ENSG00000160593		"""Immunoglobulin superfamily / V-set domain containing"""	19084	protein-coding gene	gene with protein product		609770				12975309	Standard	NM_001098526		Approved	Gm638, AMICA	uc001psk.2	Q86YT9		ENST00000356289.5:c.700_738delTGCAGTATCCACCTAGGGAACCTGGTGTTCAAGAAAACC	11.37:g.118074177_118074215delGGTTTTCTTGAACACCAGGTTCCCTAGGTGGATACTGCA	ENSP00000348635:p.Cys234_Thr246del	Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0YIV1|B0YIV2|Q496M1|Q5DTC6|Q7Z499|Q8N9I7|Q8NF70	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.CSIHLGNLVFKKT234in_frame_del	ENST00000356289.5	37	c.738_700	CCDS41723.1	11																																																																																			-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom		0.536	AMICA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMICA1	protein_coding	OTTHUMT00000392105.2	GGTTTTCTTGAACACCAGGTTCCCTAGGTGGATACTGCA	NM_153206			118074215	-1	no_errors	ENST00000356289	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.148:0.213:0.220:0.822:0.850:0.832:0.031:0.020:0.002:0.004:0.002:0.001:0.001:0.005:0.020:0.027:0.031:0.031:0.002:0.006:0.043:0.668:0.911:0.949:0.949:0.940:0.912:0.827:0.679:0.696:0.675:0.234:0.055:0.059:0.084:0.850:1.000:1.000	-
SUV39H1	6839	genome.wustl.edu	37	X	48559061	48559061	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chrX:48559061C>T	ENST00000376687.3	+	3	935	c.745C>T	c.(745-747)Cgc>Tgc	p.R249C	AF196970.3_ENST00000416061.1_RNA|SUV39H1_ENST00000453214.2_Silent_p.S96S|SUV39H1_ENST00000337852.6_Missense_Mutation_p.R260C	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)	249	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						CTGCATCTTCCGCACGGATGA	0.602																																																	0								ENSG00000101945						60.0	46.0	51.0					X																	48559061		2203	4300	6503	SUV39H1	SO:0001583	missense	0			-	HGNC	AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.745C>T	X.37:g.48559061C>T	ENSP00000365877:p.Arg249Cys	Somatic	0	121	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	23	66.18	B2R6E8|B4DST0|Q53G60|Q6FHK6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,smart_Post-SET_dom,pirsf_Histone_H3-K9_MeTrfase,pfscan_SET_dom,pfscan_Pre-SET_dom,pfscan_Post-SET_dom,pfscan_Chromo_domain/shadow	p.R260C	ENST00000376687.3	37	c.778	CCDS14304.1	X	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709427	0.68730	.	.	ENSG00000101945	ENST00000337852;ENST00000376687;ENST00000422496	D;D	0.90732	-2.72;-2.72	5.06	5.06	0.68205	SET domain (2);	0.059905	0.64402	D	0.000009	D	0.95310	0.8478	M	0.88031	2.925	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.989;0.993	D	0.95585	0.8650	10	0.87932	D	0	.	10.1478	0.42774	0.1991:0.8009:0.0:0.0	.	260;249	B4DST0;O43463	.;SUV91_HUMAN	C	260;249;107	ENSP00000337976:R260C;ENSP00000365877:R249C	ENSP00000337976:R260C	R	+	1	0	SUV39H1	48444005	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.255000	0.32909	2.082000	0.62665	0.591000	0.81541	CGC	-	smart_SET_dom,pirsf_Histone_H3-K9_MeTrfase,pfscan_SET_dom		0.602	SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV39H1	protein_coding	OTTHUMT00000058909.1	C	NM_003173	-		48559061	+1	no_errors	ENST00000337852	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH12	1010	genome.wustl.edu	37	5	22212547	22212547	+	Intron	SNP	T	T	C			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr5:22212547T>C	ENST00000382254.1	-	4	901				CDH12_ENST00000522262.1_Intron|CDH12_ENST00000504376.2_Intron	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GTTTAGTCAGTTAGAACTTTC	0.413										HNSCC(59;0.17)																																							0								ENSG00000154162																																			CDH12	SO:0001627	intron_variant	0			-	HGNC	L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.185+59A>G	5.37:g.22212547T>C		Somatic	0	13	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	14	33.33	B2RBT1|B7Z2U6|Q86UD2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382254.1	37	NULL	CCDS3890.1	5																																																																																			-	-		0.413	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	protein_coding	OTTHUMT00000207139.1	T	NM_004061	-		22212547	-1	no_errors	ENST00000518209	ensembl	human	known	74_37	rna	SNP	0.882	C
GPR98	84059	genome.wustl.edu	37	5	90136405	90136405	+	Missense_Mutation	SNP	G	G	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr5:90136405G>T	ENST00000405460.2	+	78	16718	c.16622G>T	c.(16621-16623)aGt>aTt	p.S5541I	GPR98_ENST00000425867.2_Missense_Mutation_p.S1202I	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5541					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GAGTTGAGGAGTGCTGAAACA	0.373																																																	0								ENSG00000164199						61.0	60.0	60.0					5																	90136405		1895	4114	6009	GPR98	SO:0001583	missense	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.16622G>T	5.37:g.90136405G>T	ENSP00000384582:p.Ser5541Ile	Somatic	0	77	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	25	45.65	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.S5541I	ENST00000405460.2	37	c.16622	CCDS47246.1	5	.	.	.	.	.	.	.	.	.	.	G	9.049	0.991715	0.18966	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.29142	1.65;1.58	6.16	4.2	0.49525	.	0.414116	0.33438	N	0.004904	T	0.18045	0.0433	L	0.27053	0.805	0.24195	N	0.99554	B;B;B	0.11235	0.003;0.001;0.004	B;B;B	0.09377	0.002;0.001;0.004	T	0.13415	-1.0510	9	.	.	.	.	6.4665	0.21985	0.0736:0.108:0.5988:0.2195	.	1202;5541;1202	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	I	5541;5541;1202	ENSP00000384582:S5541I;ENSP00000392618:S1202I	.	S	+	2	0	GPR98	90172161	0.983000	0.35010	1.000000	0.80357	0.680000	0.39746	2.091000	0.41691	1.600000	0.50102	0.650000	0.86243	AGT	-	NULL		0.373	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	G	NM_032119	-		90136405	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	SNP	0.432	T
DPYSL5	56896	genome.wustl.edu	37	2	27121590	27121590	+	Missense_Mutation	SNP	A	A	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr2:27121590A>T	ENST00000288699.6	+	2	381	c.223A>T	c.(223-225)Aat>Tat	p.N75Y	DPYSL5_ENST00000401478.1_Missense_Mutation_p.N75Y	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	75					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACCTTCATGAATGCCACGTG	0.537																																																	0								ENSG00000157851						93.0	86.0	89.0					2																	27121590		2203	4300	6503	DPYSL5	SO:0001583	missense	0			-	HGNC	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.223A>T	2.37:g.27121590A>T	ENSP00000288699:p.Asn75Tyr	Somatic	0	60	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	36	14.29	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.N75Y	ENST00000288699.6	37	c.223	CCDS1730.1	2	.	.	.	.	.	.	.	.	.	.	A	21.5	4.165345	0.78339	.	.	ENSG00000157851	ENST00000450961;ENST00000288699;ENST00000401478;ENST00000431402;ENST00000434719	T;D;D;T;T	0.90197	-1.09;-2.63;-2.63;-1.1;-1.1	4.99	4.99	0.66335	Amidohydrolase 1 (1);	0.000000	0.85682	D	0.000000	D	0.93543	0.7939	M	0.69358	2.11	0.51233	D	0.999918	D	0.58620	0.983	P	0.60789	0.879	D	0.94225	0.7471	10	0.87932	D	0	-28.7159	13.9664	0.64211	1.0:0.0:0.0:0.0	.	75	Q9BPU6	DPYL5_HUMAN	Y	75	ENSP00000407174:N75Y;ENSP00000288699:N75Y;ENSP00000385549:N75Y;ENSP00000399581:N75Y;ENSP00000413075:N75Y	ENSP00000288699:N75Y	N	+	1	0	DPYSL5	26975094	1.000000	0.71417	0.994000	0.49952	0.934000	0.57294	4.975000	0.63777	2.002000	0.58637	0.533000	0.62120	AAT	-	pfam_Amidohydro_1,tigrfam_Hydantoinase/dihydroPyrase		0.537	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL5	protein_coding	OTTHUMT00000214187.2	A	NM_020134	-		27121590	+1	no_errors	ENST00000288699	ensembl	human	known	74_37	missense	SNP	1.000	T
RP11-344E13.3	0	genome.wustl.edu	37	17	20805851	20805851	+	RNA	SNP	A	A	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:20805851A>T	ENST00000577537.1	+	0	1035				RP11-344E13.3_ENST00000439794.2_RNA|RP11-344E13.3_ENST00000577860.1_RNA|RP11-344E13.3_ENST00000417232.2_RNA|RP11-344E13.3_ENST00000583962.1_RNA																							TTCCTGACAAAGTCCCAGGTC	0.522																																																	0								ENSG00000233098																																			RP11-344E13.3			0			-	Clone_based_vega_gene																													17.37:g.20805851A>T		Somatic	0	139	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	31	53.73		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000577537.1	37	NULL		17																																																																																			-	-		0.522	RP11-344E13.3-001	KNOWN	basic	antisense	LOC440416	antisense	OTTHUMT00000444041.1	A		-		20805851	+1	no_errors	ENST00000577537	ensembl	human	known	74_37	rna	SNP	1.000	T
FRYL	285527	genome.wustl.edu	37	4	48588694	48588694	+	Silent	SNP	A	A	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr4:48588694A>T	ENST00000503238.1	-	16	1691	c.1692T>A	c.(1690-1692)atT>atA	p.I564I	FRYL_ENST00000537810.1_Silent_p.I564I|FRYL_ENST00000358350.4_Silent_p.I564I|FRYL_ENST00000506685.1_Silent_p.I270I|FRYL_ENST00000507711.1_Silent_p.I564I|FRYL_ENST00000264319.7_5'UTR			O94915	FRYL_HUMAN	FRY-like	564					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TCAACCTTGGAATCGCAGCAA	0.353																																																	0								ENSG00000075539						138.0	130.0	132.0					4																	48588694		1841	4092	5933	FRYL	SO:0001819	synonymous_variant	0			-	HGNC	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1692T>A	4.37:g.48588694A>T		Somatic	0	41	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	O95640|Q8WTZ5|Q9NT40	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.I564	ENST00000503238.1	37	c.1692	CCDS43227.1	4																																																																																			-	superfamily_ARM-type_fold		0.353	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	protein_coding	OTTHUMT00000369265.2	A		-		48588694	-1	no_errors	ENST00000358350	ensembl	human	known	74_37	silent	SNP	1.000	T
OR10AG1	282770	genome.wustl.edu	37	11	55735654	55735654	+	Missense_Mutation	SNP	G	G	A	rs548057957	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr11:55735654G>A	ENST00000312345.2	-	1	336	c.286C>T	c.(286-288)Ctt>Ttt	p.L96F		NM_001005491.1	NP_001005491.1	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG, member 1	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(24)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	40	Esophageal squamous(21;0.0137)					CCAAGCATAAGAAAAAAACAC	0.413																																																	0								ENSG00000174970						82.0	84.0	83.0					11																	55735654		2201	4296	6497	OR10AG1	SO:0001583	missense	0			-	HGNC	AB065594	CCDS31514.1	11q11	2012-08-09			ENSG00000174970	ENSG00000174970		"""GPCR / Class A : Olfactory receptors"""	19607	protein-coding gene	gene with protein product							Standard	NM_001005491		Approved		uc010rit.2	Q8NH19	OTTHUMG00000166824	ENST00000312345.2:c.286C>T	11.37:g.55735654G>A	ENSP00000311477:p.Leu96Phe	Somatic	0	39	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	9	79.07	B2RNH4|Q6IEU3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L96F	ENST00000312345.2	37	c.286	CCDS31514.1	11	.	.	.	.	.	.	.	.	.	.	G	4.910	0.169062	0.09339	.	.	ENSG00000174970	ENST00000312345	T	0.00840	5.63	5.47	-0.0419	0.13865	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46442	D	0.000293	T	0.01029	0.0034	L	0.53780	1.695	0.09310	N	1	B	0.23937	0.094	B	0.24394	0.053	T	0.45644	-0.9247	10	0.39692	T	0.17	.	4.5906	0.12304	0.3258:0.2855:0.3886:0.0	.	96	Q8NH19	O10AG_HUMAN	F	96	ENSP00000311477:L96F	ENSP00000311477:L96F	L	-	1	0	OR10AG1	55492230	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	-0.894000	0.04123	0.034000	0.15491	0.477000	0.44152	CTT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.413	OR10AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10AG1	protein_coding	OTTHUMT00000391531.1	G	NM_001005491	-		55735654	-1	no_errors	ENST00000312345	ensembl	human	known	74_37	missense	SNP	0.000	A
SYT14	255928	genome.wustl.edu	37	1	210267894	210267896	+	In_Frame_Del	DEL	GAA	GAA	-	rs144713062|rs200839898|rs2307890	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr1:210267894_210267896delGAA	ENST00000472886.1	+	5	684_686	c.670_672delGAA	c.(670-672)gaadel	p.E225del	SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000422431.1_In_Frame_Del_p.E270del|SYT14_ENST00000399639.2_In_Frame_Del_p.E225del|SYT14_ENST00000367019.1_In_Frame_Del_p.E225del|SYT14_ENST00000534859.1_In_Frame_Del_p.E225del|SYT14_ENST00000537238.1_In_Frame_Del_p.E187del|SYT14_ENST00000367015.1_In_Frame_Del_p.E187del			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	225					cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		TAAAGGATATGAAGAAGATGTTC	0.384														399	0.0796725	0.0098	0.0677	5008	,	,		16957	0.0655		0.1421	False		,,,				2504	0.1329																0								ENSG00000143469		,,,	107,4159		4,99,2030					,,,	2.2	1.0		dbSNP_134	76	1145,7109		84,977,3066	no	coding,coding,coding,coding	SYT14	NM_153262.2,NM_001146264.1,NM_001146262.1,NM_001146261.1	,,,	88,1076,5096	A1A1,A1R,RR		13.8721,2.5082,10.0	,,,	,,,		1252,11268				SYT14	SO:0001651	inframe_deletion	0				HGNC	AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.670_672delGAA	1.37:g.210267897_210267899delGAA	ENSP00000418901:p.Glu225del	Somatic	0	9	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.E270in_frame_del	ENST00000472886.1	37	c.805_807	CCDS31014.1	1																																																																																			-	NULL		0.384	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT14	protein_coding	OTTHUMT00000089124.1	GAA	NM_153262			210267896	+1	no_errors	ENST00000422431	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
OR4C5	79346	genome.wustl.edu	37	11	48387367	48387367	+	Silent	SNP	T	T	C			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr11:48387367T>C	ENST00000319813.3	-	1	650	c.651A>G	c.(649-651)ggA>ggG	p.G217G				Q8NGB2	OR4C5_HUMAN	olfactory receptor, family 4, subfamily C, member 5	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CAACAAAGAGTCCAAAGACGT	0.478																																																	0								ENSG00000176540																																			OR4C5	SO:0001819	synonymous_variant	0			-	HGNC			11p11.2	2013-03-27	2004-03-04	2004-03-05	ENSG00000176540	ENSG00000176540		"""GPCR / Class A : Olfactory receptors"""	14702	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 5 pseudogene"""	OR4C5P			Standard	NG_002247		Approved	OR4C5Q		Q8NGB2	OTTHUMG00000169462	ENST00000319813.3:c.651A>G	11.37:g.48387367T>C		Somatic	0	43	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	22	38.89	Q6IFB2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G217	ENST00000319813.3	37	c.651		11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.478	OR4C5-001	KNOWN	basic|appris_principal	protein_coding	OR4C5	protein_coding	OTTHUMT00000404174.1	T	NG_002247	-		48387367	-1	no_errors	ENST00000319813	ensembl	human	known	74_37	silent	SNP	0.069	C
MCF2L	23263	genome.wustl.edu	37	13	113563587	113563587	+	Intron	SNP	C	C	G	rs552060162		TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr13:113563587C>G	ENST00000375608.3	+	2	227				MCF2L_ENST00000397036.1_Missense_Mutation_p.Q64E|MCF2L_ENST00000442652.2_Intron			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				ATCTCGTCCACAGTGAGCTGG	0.587																																																	0								ENSG00000126217						193.0	181.0	185.0					13																	113563587		876	1991	2867	MCF2L	SO:0001627	intron_variant	0			-	HGNC	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.169+6902C>G	13.37:g.113563587C>G		Somatic	0	45	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	12	63.64	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q64E	ENST00000375608.3	37	c.190		13	.	.	.	.	.	.	.	.	.	.	C	1.116	-0.656644	0.03480	.	.	ENSG00000126217	ENST00000397036	.	.	.	0.991	-0.68	0.11346	.	.	.	.	.	T	0.35098	0.0920	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.37934	-0.9684	5	0.87932	D	0	.	3.4335	0.07437	0.0:0.5422:0.0:0.4578	.	.	.	.	E	64	.	ENSP00000380230:Q64E	Q	+	1	0	MCF2L	112611588	0.001000	0.12720	0.000000	0.03702	0.014000	0.08584	0.056000	0.14256	-0.284000	0.09102	0.313000	0.20887	CAG	-	NULL		0.587	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	protein_coding	OTTHUMT00000045849.4	C		-		113563587	+1	no_errors	ENST00000397036	ensembl	human	putative	74_37	missense	SNP	0.000	G
CHRNA4	1137	genome.wustl.edu	37	20	61982158	61982158	+	Missense_Mutation	SNP	T	T	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr20:61982158T>A	ENST00000370263.4	-	5	826	c.605A>T	c.(604-606)gAc>gTc	p.D202V	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	202					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	CTCCCAGAAGTCCAGCTGGTC	0.582																																																	0								ENSG00000101204						132.0	107.0	116.0					20																	61982158		2203	4299	6502	CHRNA4	SO:0001583	missense	0			-	HGNC		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.605A>T	20.37:g.61982158T>A	ENSP00000359285:p.Asp202Val	Somatic	0	80	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	29	48.21	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.D202V	ENST00000370263.4	37	c.605	CCDS13517.1	20	.	.	.	.	.	.	.	.	.	.	T	21.9	4.221313	0.79464	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.79454	-1.27	4.87	3.75	0.43078	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.85669	0.5750	M	0.80422	2.495	0.80722	D	1	D;D	0.58620	0.983;0.967	P;P	0.61940	0.867;0.896	D	0.85613	0.1259	10	0.66056	D	0.02	.	10.6451	0.45615	0.0:0.0774:0.0:0.9226	.	131;202	Q4VAQ5;P43681	.;ACHA4_HUMAN	V	108;202;131	ENSP00000359285:D202V	ENSP00000359280:D108V	D	-	2	0	CHRNA4	61452602	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.397000	0.52572	0.672000	0.31204	0.459000	0.35465	GAC	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.582	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA4	protein_coding	OTTHUMT00000080508.3	T		-		61982158	-1	no_errors	ENST00000370263	ensembl	human	known	74_37	missense	SNP	1.000	A
SSC5D	284297	genome.wustl.edu	37	19	56028663	56028663	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr19:56028663C>T	ENST00000389623.6	+	14	3043	c.3020C>T	c.(3019-3021)cCg>cTg	p.P1007L		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1007	Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CCCCCAACCCCGTCCCCAGGT	0.716																																																	0								ENSG00000179954						4.0	7.0	6.0					19																	56028663		669	1567	2236	SSC5D	SO:0001583	missense	0			-	HGNC		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3020C>T	19.37:g.56028663C>T	ENSP00000374274:p.Pro1007Leu	Somatic	0	21	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	23	34.29	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.P1007L	ENST00000389623.6	37	c.3020	CCDS46196.1	19	.	.	.	.	.	.	.	.	.	.	-	14.44	2.537315	0.45176	.	.	ENSG00000179954	ENST00000389623	T	0.01265	5.08	2.92	0.618	0.17624	.	.	.	.	.	T	0.01558	0.0050	L	0.44542	1.39	0.09310	N	1	B	0.15473	0.013	B	0.04013	0.001	T	0.45056	-0.9287	9	0.87932	D	0	.	4.0734	0.09892	0.0:0.6117:0.2449:0.1435	.	1007	A1L4H1	SRCRL_HUMAN	L	1007	ENSP00000374274:P1007L	ENSP00000374274:P1007L	P	+	2	0	SSC5D	60720475	0.000000	0.05858	0.001000	0.08648	0.413000	0.31143	-0.068000	0.11561	0.248000	0.21435	0.466000	0.42574	CCG	-	NULL		0.716	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSC5D	protein_coding	OTTHUMT00000453345.2	C	XM_001718392	-		56028663	+1	no_errors	ENST00000389623	ensembl	human	known	74_37	missense	SNP	0.001	T
FRYL	285527	genome.wustl.edu	37	4	48588693	48588693	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr4:48588693G>A	ENST00000503238.1	-	16	1692	c.1693C>T	c.(1693-1695)Cca>Tca	p.P565S	FRYL_ENST00000537810.1_Missense_Mutation_p.P565S|FRYL_ENST00000358350.4_Missense_Mutation_p.P565S|FRYL_ENST00000506685.1_Missense_Mutation_p.P271S|FRYL_ENST00000507711.1_Missense_Mutation_p.P565S|FRYL_ENST00000264319.7_5'UTR			O94915	FRYL_HUMAN	FRY-like	565					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						ATCAACCTTGGAATCGCAGCA	0.348																																																	0								ENSG00000075539						138.0	130.0	132.0					4																	48588693		1841	4092	5933	FRYL	SO:0001583	missense	0			-	HGNC	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.1693C>T	4.37:g.48588693G>A	ENSP00000426064:p.Pro565Ser	Somatic	0	41	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	20	28.57	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.P565S	ENST00000503238.1	37	c.1693	CCDS43227.1	4	.	.	.	.	.	.	.	.	.	.	G	25.7	4.667773	0.88348	.	.	ENSG00000075539	ENST00000503238;ENST00000358350;ENST00000537810;ENST00000507711;ENST00000506685	T;T;T;T;T	0.61392	3.55;3.55;3.55;3.55;0.11	5.74	5.74	0.90152	Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.79787	0.4506	M	0.83223	2.63	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.992;1.0	T	0.81769	-0.0781	10	0.87932	D	0	.	19.9197	0.97082	0.0:0.0:1.0:0.0	.	565;565	F2Z2S2;O94915	.;FRYL_HUMAN	S	565;565;565;565;271	ENSP00000426064:P565S;ENSP00000351113:P565S;ENSP00000441114:P565S;ENSP00000421584:P565S;ENSP00000425592:P271S	ENSP00000351113:P565S	P	-	1	0	FRYL	48283450	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	9.384000	0.97219	2.702000	0.92279	0.655000	0.94253	CCA	-	superfamily_ARM-type_fold		0.348	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	protein_coding	OTTHUMT00000369265.2	G		-		48588693	-1	no_errors	ENST00000358350	ensembl	human	known	74_37	missense	SNP	1.000	A
LYRM5	144363	genome.wustl.edu	37	12	25357129	25357129	+	Missense_Mutation	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr12:25357129C>G	ENST00000381356.4	+	3	315	c.156C>G	c.(154-156)atC>atG	p.I52M	LYRM5_ENST00000556885.1_Missense_Mutation_p.I50M|LYRM5_ENST00000553788.1_Intron|LYRM5_ENST00000556402.1_3'UTR|LYRM5_ENST00000556927.1_Missense_Mutation_p.I50M|LYRM5_ENST00000556351.1_Missense_Mutation_p.I50M|LYRM5_ENST00000555711.1_3'UTR|LYRM5_ENST00000557540.2_Missense_Mutation_p.I50M	NM_001001660.2	NP_001001660.2	Q6IPR1	LYRM5_HUMAN	LYR motif containing 5	52						mitochondrion (GO:0005739)				large_intestine(3)	3	all_cancers(2;4.75e-35)|all_epithelial(2;1.91e-37)|all_lung(3;1.07e-23)|Lung NSC(3;5.49e-23)|Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.0016)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;2.21e-21)|Epithelial(3;8.04e-19)|all cancers(3;2.26e-16)|STAD - Stomach adenocarcinoma(2;0.00138)			CAGAGAAGATCAAAGAACTTA	0.348																																																	0								ENSG00000205707						46.0	44.0	45.0					12																	25357129		1826	4074	5900	LYRM5	SO:0001583	missense	0			-	HGNC	AK057730	CCDS53764.1	12p12.1	2006-09-19				ENSG00000205707		"""LYR motif containing"""	27052	protein-coding gene	gene with protein product							Standard	NM_001001660		Approved		uc001rgn.3	Q6IPR1		ENST00000381356.4:c.156C>G	12.37:g.25357129C>G	ENSP00000370761:p.Ile52Met	Somatic	0	34	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	32	41.82	J3KPI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Complex1_LYR	p.I52M	ENST00000381356.4	37	c.156	CCDS53764.1	12	.	.	.	.	.	.	.	.	.	.	C	17.72	3.457955	0.63401	.	.	ENSG00000205707	ENST00000557540;ENST00000381356;ENST00000556885;ENST00000556351;ENST00000556927	T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15	6.03	5.14	0.70334	.	0.000000	0.85682	D	0.000000	D	0.86171	0.5869	.	.	.	0.58432	D	0.999999	D	0.71674	0.998	D	0.76071	0.987	D	0.86539	0.1827	9	0.56958	D	0.05	.	9.2003	0.37254	0.1484:0.7732:0.0:0.0783	.	50	Q6IPR1	LYRM5_HUMAN	M	50;52;50;50;50	ENSP00000450584:I50M;ENSP00000370761:I52M;ENSP00000451494:I50M;ENSP00000452146:I50M;ENSP00000450443:I50M	ENSP00000370761:I52M	I	+	3	3	LYRM5	25248396	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.325000	0.43840	1.531000	0.49152	-0.182000	0.12963	ATC	-	pfam_Complex1_LYR		0.348	LYRM5-201	KNOWN	basic|CCDS	protein_coding	LYRM5	protein_coding		C	NM_001001660	-		25357129	+1	no_errors	ENST00000381356	ensembl	human	known	74_37	missense	SNP	1.000	G
MBD6	114785	genome.wustl.edu	37	12	57922286	57922286	+	Missense_Mutation	SNP	A	A	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr12:57922286A>T	ENST00000355673.3	+	10	3119	c.2763A>T	c.(2761-2763)gaA>gaT	p.E921D	MBD6_ENST00000431731.2_Missense_Mutation_p.E921D	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	921						chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						AGCTGGCTGAAGGGGGTGCTG	0.597																																																	0								ENSG00000166987						47.0	58.0	54.0					12																	57922286		2200	4299	6499	MBD6	SO:0001583	missense	0			-	HGNC	AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.2763A>T	12.37:g.57922286A>T	ENSP00000347896:p.Glu921Asp	Somatic	0	53	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	40	23.08	Q8N3M0|Q8NA81|Q96Q00	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.E921D	ENST00000355673.3	37	c.2763	CCDS8944.1	12	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	a|a|a	15.77|15.77|15.77	2.932690|2.932690|2.932690	0.52866|0.52866|0.52866	.|.|.	.|.|.	ENSG00000166987|ENSG00000166987|ENSG00000166987	ENST00000355673;ENST00000431731|ENST00000300263|ENST00000552163	.|.|.	.|.|.	.|.|.	5.04|5.04|5.04	5.04|5.04|5.04	0.67666|0.67666|0.67666	.|.|.	0.114259|.|.	0.38058|.|.	N|.|.	0.001827|.|.	T|T|T	0.30978|0.30978|0.30978	0.0782|0.0782|0.0782	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.35026|0.35026|0.35026	D|D|D	0.758278|0.758278|0.758278	D;D|.|.	0.56035|.|.	0.974;0.974|.|.	D;D|.|.	0.67725|.|.	0.953;0.953|.|.	T|T|T	0.42378|0.42378|0.42378	-0.9455|-0.9455|-0.9455	9|6|5	0.66056|0.87932|.	D|D|.	0.02|0|.	-4.3224|-4.3224|-4.3224	11.3887|11.3887|11.3887	0.49800|0.49800|0.49800	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	921;921|.|.	Q6P0P0;Q96DN6|.|.	.;MBD6_HUMAN|.|.	D|M|W	921|384|156	.|.|.	ENSP00000347896:E921D|ENSP00000300263:K384M|.	E|K|R	+|+|+	3|2|1	2|0|2	MBD6|MBD6|MBD6	56208553|56208553|56208553	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	2.568000|2.568000|2.568000	0.45965|0.45965|0.45965	2.267000|2.267000|2.267000	0.75376|0.75376|0.75376	0.524000|0.524000|0.524000	0.50904|0.50904|0.50904	GAA|AAG|AGG	-	NULL		0.597	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	protein_coding	OTTHUMT00000407250.1	A		-		57922286	+1	no_errors	ENST00000355673	ensembl	human	known	74_37	missense	SNP	1.000	T
PRKG1	5592	genome.wustl.edu	37	10	53841418	53841418	+	Intron	SNP	G	G	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr10:53841418G>T	ENST00000401604.2	+	7	1084				PRKG1_ENST00000373975.2_Splice_Site|PRKG1_ENST00000373985.1_Intron|PRKG1_ENST00000373980.4_Intron			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I						actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		acattctgaggtaaggagtaa	0.403																																																	0								ENSG00000185532																																			PRKG1	SO:0001627	intron_variant	0			-	HGNC		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.890+19027G>T	10.37:g.53841418G>T		Somatic	0	37	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	11	47.62	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e1+1	ENST00000401604.2	37	c.44+1	CCDS44399.1	10																																																																																			-	-		0.403	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	protein_coding		G		-		53841418	+1	no_errors	ENST00000373975	ensembl	human	putative	74_37	splice_site	SNP	0.026	T
XYLB	9942	genome.wustl.edu	37	3	38411731	38411732	+	Intron	INS	-	-	CACACACACACA	rs196387|rs71085317|rs150130857	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr3:38411731_38411732insCACACACACACA	ENST00000207870.3	+	9	855				XYLB_ENST00000542835.1_Intron	NM_005108.3	NP_005099.2	O75191	XYLB_HUMAN	xylulokinase homolog (H. influenzae)						carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|D-xylose metabolic process (GO:0042732)|generation of precursor metabolites and energy (GO:0006091)|xylulose catabolic process (GO:0005998)|xylulose metabolic process (GO:0005997)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|xylulokinase activity (GO:0004856)			endometrium(3)|kidney(3)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|prostate(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.00372)|Kidney(284;0.00405)		GCACTGTAGCGcacacacacac	0.5														1186	0.236821	0.1006	0.3112	5008	,	,		17817	0.2143		0.3022	False		,,,				2504	0.3241																0								ENSG00000093217																																			XYLB	SO:0001627	intron_variant	0				HGNC	AB015046	CCDS2678.1	3p22-p21.3	2006-12-18	2001-12-04		ENSG00000093217	ENSG00000093217			12839	protein-coding gene	gene with protein product		604049	"""xylulokinase (H. influenzae) homolog"""			9763671	Standard	NM_005108		Approved	FLJ10343, FLJ12539	uc003cic.2	O75191	OTTHUMG00000131294	ENST00000207870.3:c.765+66->CACACACACACA	3.37:g.38411731_38411732insCACACACACACA		Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RAW4|B4DDT2|B9EH64	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000207870.3	37	NULL	CCDS2678.1	3																																																																																			-	-		0.500	XYLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLB	protein_coding	OTTHUMT00000254062.2	-	NM_005108			38411732	+1	no_errors	ENST00000487569	ensembl	human	putative	74_37	rna	INS	0.000:0.000	CACACACACACA
PSKH2	85481	genome.wustl.edu	37	8	87076845	87076845	+	Silent	SNP	A	A	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr8:87076845A>T	ENST00000276616.2	-	2	275	c.201T>A	c.(199-201)gcT>gcA	p.A67A	PSKH2_ENST00000517981.1_5'UTR	NM_033126.1	NP_149117.1	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	67	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|kidney(11)|large_intestine(2)|lung(26)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(1)	47			STAD - Stomach adenocarcinoma(118;0.129)			TCCCAATAAGAGCTTTGATGT	0.398																																																	0								ENSG00000147613						74.0	67.0	69.0					8																	87076845		2203	4300	6503	PSKH2	SO:0001819	synonymous_variant	0			-	HGNC	AY037806	CCDS6240.1	8q21.13	2004-06-03				ENSG00000147613			18997	protein-coding gene	gene with protein product							Standard	NM_033126		Approved		uc011lfy.2	Q96QS6		ENST00000276616.2:c.201T>A	8.37:g.87076845A>T		Somatic	0	22	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	A0AV22	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A67	ENST00000276616.2	37	c.201	CCDS6240.1	8																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.398	PSKH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSKH2	protein_coding	OTTHUMT00000374628.1	A	NM_033126	-		87076845	-1	no_errors	ENST00000276616	ensembl	human	known	74_37	silent	SNP	1.000	T
VWA7	80737	genome.wustl.edu	37	6	31740760	31740761	+	Frame_Shift_Ins	INS	-	-	GGACAGGCTCCATG	rs201394026	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr6:31740760_31740761insGGACAGGCTCCATG	ENST00000375688.4	-	7	1257_1258	c.1057_1058insCATGGAGCCTGTCC	c.(1057-1059)cacfs	p.H353fs	VWA7_ENST00000467576.1_De_novo_Start_OutOfFrame|VWA7_ENST00000447450.1_Frame_Shift_Ins_p.H353fs|VWA7_ENST00000375686.3_Frame_Shift_Ins_p.H353fs			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	353	VWFA.					extracellular region (GO:0005576)											CAGGACATAGTGGACAGGCTCC	0.584														67	0.0133786	0.003	0.0187	5008	,	,		19255	0.004		0.0288	False		,,,				2504	0.0174																0								ENSG00000204396			120,3338		5,110,1614						2.0	0.0		dbSNP_134	43	361,6395		24,313,3041	no	frameshift	C6orf27	NM_025258.2		29,423,4655	A1A1,A1R,RR		5.3434,3.4702,4.7092				481,9733				VWA7	SO:0001589	frameshift_variant	0				HGNC		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1044_1057dupCATGGAGCCTGTCC	6.37:g.31740760_31740761insGGACAGGCTCCATG	ENSP00000364840:p.His353fs	Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.H353fs	ENST00000375688.4	37	c.1058_1057	CCDS4721.2	6																																																																																			-	NULL		0.584	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VWA7	protein_coding	OTTHUMT00000076233.2	-	NM_025258			31740761	-1	no_errors	ENST00000375686	ensembl	human	known	74_37	frame_shift_ins	INS	0.037:0.010	GGACAGGCTCCATG
F5	2153	genome.wustl.edu	37	1	169509969	169509969	+	Missense_Mutation	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr1:169509969C>G	ENST00000367797.3	-	13	4560	c.4359G>C	c.(4357-4359)caG>caC	p.Q1453H	F5_ENST00000367796.3_Missense_Mutation_p.Q1458H	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1453	35 X 9 AA approximate tandem repeats of [TNP]-L-S-P-D-L-S-Q-T.|B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GAGGTGATATCTGGCTGAGAT	0.473																																																	0								ENSG00000198734						79.0	83.0	82.0					1																	169509969		2203	4300	6503	F5	SO:0001583	missense	0			-	HGNC	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.4359G>C	1.37:g.169509969C>G	ENSP00000356771:p.Gln1453His	Somatic	0	44	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	44	34.33	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.Q1453H	ENST00000367797.3	37	c.4359	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	c	7.786	0.710624	0.15239	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98164	-4.76;-4.76	5.64	-0.408	0.12381	.	2.122730	0.02254	N	0.066879	D	0.91952	0.7451	L	0.49350	1.555	0.21579	N	0.999636	B	0.10296	0.003	B	0.08055	0.003	T	0.82926	-0.0215	9	0.44086	T	0.13	0.1104	1.678	0.02826	0.1427:0.3592:0.2959:0.2022	.	1453	P12259	FA5_HUMAN	H	1453;1458	ENSP00000356771:Q1453H;ENSP00000356770:Q1458H	ENSP00000356770:Q1458H	Q	-	3	2	F5	167776593	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	0.161000	0.16481	-0.400000	0.07656	0.591000	0.81541	CAG	-	NULL		0.473	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	protein_coding	OTTHUMT00000083712.1	C	NM_000130	-		169509969	-1	no_errors	ENST00000367797	ensembl	human	known	74_37	missense	SNP	0.017	G
GOLGA8DP	100132979	genome.wustl.edu	37	15	22709060	22709060	+	RNA	SNP	C	C	G	rs374457347	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr15:22709060C>G	ENST00000314246.8	-	0	1336				RN7SL545P_ENST00000495815.2_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											TCCTGCTGCTCCTGAAGCCTC	0.627													C|||	523	0.104433	0.0439	0.1398	5008	,	,		14446	0.0179		0.2316	False		,,,				2504	0.1196																0								ENSG00000185182																																			GOLGA8DP			0			-	HGNC			15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22709060C>G		Somatic	0	16	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	14	41.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000314246.8	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	4.061	0.009136	0.07912	.	.	ENSG00000185182	ENST00000341390;ENST00000314246;ENST00000317692	.	.	.	0.678	0.678	0.17969	.	.	.	.	.	T	0.17916	0.0430	.	.	.	0.09310	N	0.999992	P	0.38504	0.634	B	0.31101	0.124	T	0.21143	-1.0254	6	0.21014	T	0.42	.	7.6154	0.28154	0.0:1.0:0.0:0.0	.	147	F8WBT8	.	Q	147;147;365	.	ENSP00000327024:E147Q	E	-	1	0	AC116165.1	20260424	1.000000	0.71417	0.002000	0.10522	0.225000	0.24961	1.603000	0.36794	0.770000	0.33336	0.000000	0.15137	GAG	-	-		0.627	GOLGA8DP-002	KNOWN	basic	processed_transcript	GOLGA8DP	pseudogene	OTTHUMT00000415613.1	C	NR_027407	-		22709060	-1	no_errors	ENST00000314246	ensembl	human	known	74_37	rna	SNP	0.005	G
GOT1L1	137362	genome.wustl.edu	37	8	37792593	37792593	+	Missense_Mutation	SNP	T	T	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr8:37792593T>G	ENST00000307599.4	-	8	1169	c.1070A>C	c.(1069-1071)aAc>aCc	p.N357T	GOT1L1_ENST00000518826.1_Missense_Mutation_p.N98T	NM_152413.2	NP_689626.2	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	357					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)	cytoplasm (GO:0005737)	pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(3)|lung(8)|ovary(1)|prostate(1)	14	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			ACCCTTACAGTTGAGTCCAAG	0.537																																																	0								ENSG00000169154						61.0	65.0	64.0					8																	37792593		1887	4094	5981	GOT1L1	SO:0001583	missense	0			-	HGNC	BC029504	CCDS47839.1	8p12	2005-09-22			ENSG00000169154	ENSG00000169154			28487	protein-coding gene	gene with protein product						12477932	Standard	NM_152413		Approved	MGC33309	uc011lbj.1	Q8NHS2	OTTHUMG00000164027	ENST00000307599.4:c.1070A>C	8.37:g.37792593T>G	ENSP00000303077:p.Asn357Thr	Somatic	0	75	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	17	52.78	A8MWL4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase,prints_Asp_trans	p.N357T	ENST00000307599.4	37	c.1070	CCDS47839.1	8	.	.	.	.	.	.	.	.	.	.	T	10.74	1.434558	0.25813	.	.	ENSG00000169154	ENST00000307599;ENST00000518826	T;T	0.21361	2.01;2.01	5.16	-3.26	0.05064	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.332930	0.25307	N	0.031604	T	0.07369	0.0186	N	0.13272	0.32	0.19775	N	0.999952	B	0.14438	0.01	B	0.17433	0.018	T	0.25293	-1.0136	10	0.16896	T	0.51	-0.1641	2.1566	0.03814	0.126:0.3413:0.2906:0.2421	.	357	Q8NHS2	AATC2_HUMAN	T	357;98	ENSP00000303077:N357T;ENSP00000429558:N98T	ENSP00000303077:N357T	N	-	2	0	GOT1L1	37911751	0.032000	0.19561	0.380000	0.26093	0.925000	0.55904	-0.456000	0.06754	-0.413000	0.07507	0.533000	0.62120	AAC	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase,prints_Asp_trans		0.537	GOT1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOT1L1	protein_coding	OTTHUMT00000376823.1	T	NM_152413	-		37792593	-1	no_errors	ENST00000307599	ensembl	human	known	74_37	missense	SNP	0.021	G
MACF1	23499	genome.wustl.edu	37	1	39929473	39929473	+	Intron	SNP	C	C	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr1:39929473C>A	ENST00000372915.3	+	93	21537				MACF1_ENST00000564288.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000567887.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GATGTGGTCACTCTCTGACCT	0.448																																																	0								ENSG00000127603																																			MACF1	SO:0001627	intron_variant	0			-	HGNC	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.21450+115C>A	1.37:g.39929473C>A		Somatic	0	40	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	13	64.86	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372915.3	37	NULL		1																																																																																			-	-		0.448	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	protein_coding	OTTHUMT00000392096.1	C	NM_033044	-		39929473	+1	no_errors	ENST00000497964	ensembl	human	known	74_37	rna	SNP	0.000	A
ZNF286A	57335	genome.wustl.edu	37	17	15603799	15603799	+	Intron	SNP	A	A	G	rs144866168		TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:15603799A>G	ENST00000464847.2	+	1	590				ZNF286A_ENST00000395894.2_Intron|ZNF286A_ENST00000395893.2_Intron|ZNF286A_ENST00000472486.1_Intron|ZNF286A_ENST00000593105.1_Intron|ZNF286A_ENST00000421016.1_Intron|ZNF286A_ENST00000580259.1_Intron|ZNF286A_ENST00000585194.1_Intron|ZNF286A_ENST00000581529.1_Intron|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000583566.1_Intron|ZNF286A_ENST00000413242.2_Intron			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		TGTCTTGGGGATGGATGGGCT	0.547																																																	0								ENSG00000187607																																			ZNF286A	SO:0001627	intron_variant	0			-	Uniprot_gn	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.37+119A>G	17.37:g.15603799A>G		Somatic	0	31	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	B4DKF9|Q96JF3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000464847.2	37	NULL	CCDS11172.1	17																																																																																			-	-		0.547	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF286A	protein_coding	OTTHUMT00000130696.4	A	NM_020652	rs144866168		15603799	+1	no_errors	ENST00000583347	ensembl	human	known	74_37	rna	SNP	0.001	G
HECW1	23072	genome.wustl.edu	37	7	43153832	43153832	+	5'UTR	SNP	C	C	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr7:43153832C>A	ENST00000395891.2	+	0	416				HECW1_ENST00000453890.1_Intron	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CATCTTCTCTCTTTTCCTGGG	0.468																																																	0								ENSG00000002746																																			HECW1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.-190C>A	7.37:g.43153832C>A		Somatic	0	35	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	7	73.08	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000395891.2	37	NULL	CCDS5469.2	7																																																																																			-	-		0.468	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	protein_coding	OTTHUMT00000250893.2	C	NM_015052	-		43153832	+1	no_errors	ENST00000492310	ensembl	human	known	74_37	rna	SNP	0.166	A
POMZP3	22932	genome.wustl.edu	37	7	76256104	76256105	+	5'UTR	INS	-	-	GGAGGGCGGTGT	rs199981312|rs370134150		TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr7:76256104_76256105insGGAGGGCGGTGT	ENST00000310842.4	-	0	453_454				UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA|UPK3B_ENST00000419923.2_Intron|POMZP3_ENST00000275569.4_5'UTR	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion											kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				TGGGTCGGCGGGGAGGGCGGTG	0.743																																																	0								ENSG00000205485																																			AC004980.7	SO:0001623	5_prime_UTR_variant	0				Clone_based_vega_gene	U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.-232->ACACCGCCCTCC	7.37:g.76256104_76256105insGGAGGGCGGTGT		Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	F6STJ3|Q12903|Q9BWB4	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000310842.4	37	NULL	CCDS43606.1	7																																																																																			-	-		0.743	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100133091	protein_coding	OTTHUMT00000341775.1	-	NM_012230			76256105	+1	no_errors	ENST00000418663	ensembl	human	known	74_37	rna	INS	0.012:0.012	GGAGGGCGGTGT
MYL5	4636	genome.wustl.edu	37	4	675704	675704	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr4:675704delC	ENST00000400159.2	+	7	548	c.443delC	c.(442-444)gccfs	p.A148fs	MYL5_ENST00000506838.1_Frame_Shift_Del_p.A107fs|MFSD7_ENST00000404286.2_3'UTR|MFSD7_ENST00000347950.5_3'UTR|MYL5_ENST00000511290.1_Frame_Shift_Del_p.A107fs|MYL5_ENST00000505477.1_Frame_Shift_Del_p.A107fs|MFSD7_ENST00000515118.1_3'UTR|MFSD7_ENST00000503156.1_3'UTR|MFSD7_ENST00000322224.4_3'UTR	NM_002477.1	NP_002468.1	Q02045	MYL5_HUMAN	myosin, light chain 5, regulatory	148	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of muscle contraction (GO:0006937)	muscle myosin complex (GO:0005859)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			endometrium(1)|kidney(1)|lung(1)	3						TTCCAGTTCGCCTCCATCGAT	0.647																																																	0								ENSG00000215375						28.0	29.0	29.0					4																	675704		2195	4299	6494	MYL5	SO:0001589	frameshift_variant	0				HGNC		CCDS43197.1	4p16	2013-01-10	2006-09-29		ENSG00000215375	ENSG00000215375		"""Myosins / Light chain"", ""EF-hand domain containing"""	7586	protein-coding gene	gene with protein product		160782	"""myosin, light polypeptide 5, regulatory"""			1284596	Standard	NM_002477		Approved		uc003gav.3	Q02045	OTTHUMG00000159971	ENST00000400159.2:c.443delC	4.37:g.675704delC	ENSP00000383023:p.Ala148fs	Somatic	0	34	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	Q8IXL8	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.S149fs	ENST00000400159.2	37	c.443	CCDS43197.1	4																																																																																			-	NULL		0.647	MYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL5	protein_coding	OTTHUMT00000358570.2	C	NM_002477			675704	+1	no_errors	ENST00000400159	ensembl	human	known	74_37	frame_shift_del	DEL	0.366	-
MTRNR2L1	100462977	genome.wustl.edu	37	17	22024507	22024507	+	IGR	SNP	T	T	C			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:22024507T>C	ENST00000540040.1	+	0	1555				RP11-846F4.12_ENST00000483901.2_RNA|MTND1P15_ENST00000579693.1_RNA	NM_001190452.1	NP_001177381.1			MT-RNR2-like 1																		CTAGCTATCATCCTATTATCG	0.428																																																	0								ENSG00000243655																																			RP11-846F4.12	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	CR612552	CCDS54097.1	17p11.2	2014-02-18			ENSG00000256618	ENSG00000256618			37155	protein-coding gene	gene with protein product	"""humanin-like 1"""					19477263	Standard	NM_001190452		Approved		uc002gzb.2	P0CJ68	OTTHUMG00000179068		17.37:g.22024507T>C		Somatic	0	68	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000540040.1	37	NULL	CCDS54097.1	17																																																																																			-	-		0.428	MTRNR2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000243655	protein_coding	OTTHUMT00000444600.2	T	NM_001190452	-		22024507	-1	no_errors	ENST00000483901	ensembl	human	known	74_37	rna	SNP	0.662	C
NLRP14	338323	genome.wustl.edu	37	11	7059832	7059832	+	Silent	SNP	A	A	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr11:7059832A>G	ENST00000299481.4	+	2	361	c.15A>G	c.(13-15)tcA>tcG	p.S5S		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	5	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		CAGATTCATCATCATCTTCTT	0.373																																																	0								ENSG00000158077						85.0	93.0	90.0					11																	7059832		2201	4296	6497	NLRP14	SO:0001819	synonymous_variant	0			-	HGNC	BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.15A>G	11.37:g.7059832A>G		Somatic	0	56	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	12	63.64	Q7RTR6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.S5	ENST00000299481.4	37	c.15	CCDS7776.1	11																																																																																			-	pfscan_DAPIN		0.373	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	protein_coding	OTTHUMT00000384551.1	A	NM_176822	-		7059832	+1	no_errors	ENST00000299481	ensembl	human	known	74_37	silent	SNP	0.010	G
TUB	7275	genome.wustl.edu	37	11	8122074	8122074	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr11:8122074G>A	ENST00000299506.2	+	10	1290	c.1141G>A	c.(1141-1143)Ggg>Agg	p.G381R	TUB_ENST00000305253.4_Missense_Mutation_p.G436R|TUB_ENST00000534099.1_Missense_Mutation_p.G387R	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	381					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		AGGCTTCAAGGGGCCTCGGAA	0.557																																																	0								ENSG00000166402						147.0	126.0	133.0					11																	8122074		2201	4296	6497	TUB	SO:0001583	missense	0			-	HGNC	U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.1141G>A	11.37:g.8122074G>A	ENSP00000299506:p.Gly381Arg	Somatic	0	45	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	5	81.48	D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_N,prints_Tubby_C	p.G436R	ENST00000299506.2	37	c.1306	CCDS7787.1	11	.	.	.	.	.	.	.	.	.	.	G	31	5.089033	0.94100	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.93953	-3.32;-3.32;-3.32	4.59	4.59	0.56863	Tubby, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.97275	0.9109	M	0.90759	3.145	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98137	1.0434	10	0.66056	D	0.02	-1.0263	17.7363	0.88394	0.0:0.0:1.0:0.0	.	387;381;436	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	R	387;436;381	ENSP00000434400:G387R;ENSP00000305426:G436R;ENSP00000299506:G381R	ENSP00000299506:G381R	G	+	1	0	TUB	8078650	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.277000	0.76020	0.563000	0.77884	GGG	-	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C		0.557	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TUB	protein_coding	OTTHUMT00000385823.1	G	NM_003320	-		8122074	+1	no_errors	ENST00000305253	ensembl	human	known	74_37	missense	SNP	1.000	A
MAGEB6	158809	genome.wustl.edu	37	X	26211982	26211982	+	Missense_Mutation	SNP	A	A	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chrX:26211982A>G	ENST00000379034.1	+	2	168	c.19A>G	c.(19-21)Agt>Ggt	p.S7G		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	7										breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						GGGTCACAAGAGTAAGCTCCG	0.587																																																	0								ENSG00000176746						76.0	64.0	68.0					X																	26211982		2202	4300	6502	MAGEB6	SO:0001583	missense	0			-	HGNC	AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.19A>G	X.37:g.26211982A>G	ENSP00000368320:p.Ser7Gly	Somatic	0	57	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	11	71.79	Q6GS19|Q9H219	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.S7G	ENST00000379034.1	37	c.19	CCDS14217.1	X	.	.	.	.	.	.	.	.	.	.	A	13.65	2.300504	0.40694	.	.	ENSG00000176746	ENST00000379034	T	0.12147	2.71	2.77	1.53	0.23141	Melanoma associated antigen, MAGE, N-terminal (1);	0.779511	0.11663	N	0.541633	T	0.17577	0.0422	M	0.79475	2.455	0.09310	N	1	B	0.26902	0.163	B	0.28991	0.097	T	0.27434	-1.0074	10	0.72032	D	0.01	.	5.1605	0.15058	0.6959:0.3041:0.0:0.0	.	7	Q8N7X4	MAGB6_HUMAN	G	7	ENSP00000368320:S7G	ENSP00000368320:S7G	S	+	1	0	MAGEB6	26121903	0.274000	0.24191	0.006000	0.13384	0.718000	0.41266	0.763000	0.26517	0.313000	0.23062	0.481000	0.45027	AGT	-	pfam_Melanoma_ass_antigen_N		0.587	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	protein_coding	OTTHUMT00000056123.1	A	NM_173523	-		26211982	+1	no_errors	ENST00000379034	ensembl	human	known	74_37	missense	SNP	0.006	G
CDK12	51755	genome.wustl.edu	37	17	37672033	37672033	+	Missense_Mutation	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:37672033C>G	ENST00000447079.4	+	9	2851	c.2818C>G	c.(2818-2820)Ctg>Gtg	p.L940V	CDK12_ENST00000430627.2_Missense_Mutation_p.L940V	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	940	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						TCAAGCCAATCTGGAACTGGC	0.408			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																														Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0								ENSG00000167258						115.0	108.0	110.0					17																	37672033		2203	4300	6503	CDK12	SO:0001583	missense	0			-	HGNC	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.2818C>G	17.37:g.37672033C>G	ENSP00000398880:p.Leu940Val	Somatic	0	46	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	24	27.27	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L940V	ENST00000447079.4	37	c.2818	CCDS11337.1	17	.	.	.	.	.	.	.	.	.	.	C	13.92	2.379522	0.42207	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.42513	0.97;0.97	6.03	1.88	0.25563	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.35378	N	0.003260	T	0.34106	0.0886	N	0.19112	0.55	0.33718	D	0.616679	D;D;D	0.57571	0.98;0.98;0.976	P;P;P	0.52554	0.573;0.702;0.576	T	0.42085	-0.9472	10	0.27082	T	0.32	-5.1735	9.6962	0.40158	0.0:0.7232:0.0:0.2768	.	939;940;940	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	V	940	ENSP00000407720:L940V;ENSP00000398880:L940V	ENSP00000407720:L940V	L	+	1	2	CDK12	34925559	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	3.309000	0.51903	0.141000	0.18875	0.655000	0.94253	CTG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.408	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK12	protein_coding	OTTHUMT00000256941.4	C	NM_016507	-		37672033	+1	no_errors	ENST00000447079	ensembl	human	known	74_37	missense	SNP	1.000	G
ADAMTS12	81792	genome.wustl.edu	37	5	33614360	33614360	+	Frame_Shift_Del	DEL	C	C	-			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr5:33614360delC	ENST00000504830.1	-	16	2845	c.2510delG	c.(2509-2511)agtfs	p.S837fs	ADAMTS12_ENST00000352040.3_Frame_Shift_Del_p.S752fs|ADAMTS12_ENST00000504582.1_5'UTR	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	837	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GCAGGTCACACTGCACTCTGT	0.498										HNSCC(64;0.19)																																							0								ENSG00000151388						165.0	116.0	132.0					5																	33614360		2203	4300	6503	ADAMTS12	SO:0001589	frameshift_variant	0				HGNC	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.2510delG	5.37:g.33614360delC	ENSP00000422554:p.Ser837fs	Somatic	0	62	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A2RRN9|A5D6V6|Q6UWL3	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.S837fs	ENST00000504830.1	37	c.2510	CCDS34140.1	5																																																																																			-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.498	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	C	NM_030955			33614360	-1	no_errors	ENST00000504830	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
MST1L	11223	genome.wustl.edu	37	1	17084845	17084846	+	RNA	INS	-	-	GCTAGGA			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr1:17084845_17084846insGCTAGGA	ENST00000455405.2	-	0	228							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										TGCTAGACCTGCCATCTTCTGG	0.579																																																	0								ENSG00000186715																																			MST1L			0				HGNC	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084845_17084846insGCTAGGA		Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7WPB1|Q13209	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000455405.2	37	NULL		1																																																																																			-	-		0.579	MST1L-002	KNOWN	basic	processed_transcript	MST1L	pseudogene	OTTHUMT00000400328.1	-	NM_001271733			17084846	-1	no_errors	ENST00000544155	ensembl	human	known	74_37	rna	INS	0.198:0.194	GCTAGGA
FIGLA	344018	genome.wustl.edu	37	2	71012615	71012634	+	Frame_Shift_Del	DEL	CACCACTGCCACCATCTGCC	CACCACTGCCACCATCTGCC	-	rs530282949|rs199858072|rs371010099|rs373484578		TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	CACCACTGCCACCATCTGCC	CACCACTGCCACCATCTGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr2:71012615_71012634delCACCACTGCCACCATCTGCC	ENST00000332372.6	-	3	526_545	c.522_541delGGCAGATGGTGGCAGTGGTG	c.(520-543)tgggcagatggtggcagtggtgagfs	p.WADGGSGE174fs		NM_001004311.3	NP_001004311.2	Q6QHK4	FIGLA_HUMAN	folliculogenesis specific basic helix-loop-helix	174					multicellular organismal development (GO:0007275)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			endometrium(2)|lung(3)	5						TGTGCTGGCTCACCACTGCCACCATCTGCCCAAGGCCCTT	0.473																																																	0								ENSG00000183733																																			FIGLA	SO:0001589	frameshift_variant	0				HGNC	BC039536	CCDS46320.1	2p13.3	2013-05-21			ENSG00000183733	ENSG00000183733		"""Basic helix-loop-helix proteins"""	24669	protein-coding gene	gene with protein product	"""factor in the germline alpha"""	608697				12468641	Standard	NM_001004311		Approved	bHLHc8	uc002she.1	Q6QHK4	OTTHUMG00000153440	ENST00000332372.6:c.522_541delGGCAGATGGTGGCAGTGGTG	2.37:g.71012615_71012634delCACCACTGCCACCATCTGCC	ENSP00000333097:p.Trp174fs	Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.W174fs	ENST00000332372.6	37	c.541_522	CCDS46320.1	2																																																																																			-	NULL		0.473	FIGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGLA	protein_coding	OTTHUMT00000331214.1	CACCACTGCCACCATCTGCC	NM_001004311			71012634	-1	no_errors	ENST00000332372	ensembl	human	known	74_37	frame_shift_del	DEL	0.953:0.953:0.995:0.997:0.997:0.998:0.999:1.000:1.000:0.998:0.961:0.960:0.964:0.956:0.996:0.999:1.000:1.000:1.000:1.000	-
BAIAP2L2	80115	genome.wustl.edu	37	22	38482353	38482394	+	In_Frame_Del	DEL	TGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	TGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	-	rs371997714|rs66500630|rs113792005|rs376182024|rs541462698|rs369923129|rs553799224	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	TGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	TGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr22:38482353_38482394delTGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	ENST00000381669.3	-	12	1466_1507	c.1322_1363delTAGCACCCTCGGAGTACTGGGATGGCCAGTCCCGCTCCCGCA	c.(1321-1365)atagcaccctcggagtactgggatggccagtcccgctcccgcacc>acc	p.IAPSEYWDGQSRSR441del	SLC16A8_ENST00000469516.1_5'Flank	NM_025045.4	NP_079321.3	Q6UXY1	BI2L2_HUMAN	BAI1-associated protein 2-like 2	441					filopodium assembly (GO:0046847)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|signal transduction (GO:0007165)	cell-cell contact zone (GO:0044291)|cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	phospholipid binding (GO:0005543)			large_intestine(2)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	8	Melanoma(58;0.045)					CGGCTTGGGGTGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTATGGAGTTGCC	0.674														708	0.141374	0.0272	0.2291	5008	,	,		20774	0.0565		0.1918	False		,,,				2504	0.2689																0								ENSG00000128298			138,3818		23,92,1863						2.2	0.8		dbSNP_130	20	1131,6525		291,549,2988	no	coding	BAIAP2L2	NM_025045.4		314,641,4851	A1A1,A1R,RR		14.7727,3.4884,10.9283				1269,10343				BAIAP2L2	SO:0001651	inframe_deletion	0				HGNC	BC015619	CCDS43018.1	22q13.1	2005-02-09			ENSG00000128298	ENSG00000128298			26203	protein-coding gene	gene with protein product							Standard	NM_025045		Approved	FLJ22582	uc003auw.3	Q6UXY1	OTTHUMG00000151197	ENST00000381669.3:c.1322_1363delTAGCACCCTCGGAGTACTGGGATGGCCAGTCCCGCTCCCGCA	22.37:g.38482353_38482394delTGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	ENSP00000371085:p.Ile441_Arg454del	Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B0QYE2|Q96BG7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.IAPSEYWDGQSRSR441in_frame_del	ENST00000381669.3	37	c.1363_1322	CCDS43018.1	22																																																																																			-	NULL		0.674	BAIAP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAIAP2L2	protein_coding	OTTHUMT00000321727.1	TGCGGGAGCGGGACTGGCCATCCCAGTACTCCGAGGGTGCTA	NM_025045			38482394	-1	no_errors	ENST00000381669	ensembl	human	known	74_37	in_frame_del	DEL	0.064:0.046:0.050:0.045:0.042:0.063:0.110:0.324:0.560:0.923:0.985:0.985:0.960:0.977:0.992:0.998:0.997:0.996:0.986:0.984:0.997:1.000:1.000:1.000:1.000:1.000:0.975:0.735:0.470:0.666:0.654:0.000:0.001:0.000:0.001:0.041:0.000:0.000:0.001:0.000:0.000:0.001	-
TEX15	56154	genome.wustl.edu	37	8	30701918	30701918	+	Missense_Mutation	SNP	C	C	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr8:30701918C>A	ENST00000256246.2	-	1	4690	c.4616G>T	c.(4615-4617)aGa>aTa	p.R1539I		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1539					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		CTTCTTCTCTCTTTTGTTAAG	0.363																																																	0								ENSG00000133863						183.0	187.0	185.0					8																	30701918		2203	4300	6503	TEX15	SO:0001583	missense	0			-	HGNC	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.4616G>T	8.37:g.30701918C>A	ENSP00000256246:p.Arg1539Ile	Somatic	0	84	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	22	61.40		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R1539I	ENST00000256246.2	37	c.4616	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987980	0.53934	.	.	ENSG00000133863	ENST00000256246	T	0.14391	2.51	5.77	-0.82	0.10826	.	0.204155	0.34507	N	0.003905	T	0.15262	0.0368	M	0.61703	1.905	0.09310	N	0.999995	P	0.37276	0.589	B	0.42422	0.387	T	0.11324	-1.0592	10	0.87932	D	0	.	5.9599	0.19293	0.0:0.4339:0.2553:0.3108	.	1539	Q9BXT5	TEX15_HUMAN	I	1539	ENSP00000256246:R1539I	ENSP00000256246:R1539I	R	-	2	0	TEX15	30821460	0.009000	0.17119	0.000000	0.03702	0.006000	0.05464	0.177000	0.16801	-0.087000	0.12528	-0.733000	0.03571	AGA	-	NULL		0.363	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	protein_coding	OTTHUMT00000376193.1	C		-		30701918	-1	no_errors	ENST00000256246	ensembl	human	known	74_37	missense	SNP	0.000	A
RPP14	11102	genome.wustl.edu	37	3	58303399	58303399	+	3'UTR	SNP	G	G	C	rs538545058	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr3:58303399G>C	ENST00000445193.3	+	0	962				RPP14_ENST00000477305.1_3'UTR|RPP14_ENST00000466547.1_3'UTR|RPP14_ENST00000528153.1_Missense_Mutation_p.C20S|RPP14_ENST00000295959.5_3'UTR	NM_001098783.2	NP_001092253.1	O95059	RPP14_HUMAN	ribonuclease P/MRP 14kDa subunit						tRNA processing (GO:0008033)	nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)|RNA binding (GO:0003723)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.000187)|KIRC - Kidney renal clear cell carcinoma(10;0.0102)|Kidney(10;0.0118)|OV - Ovarian serous cystadenocarcinoma(275;0.191)		AGGACAGTCTGTCTGAACCTG	0.512													G|||	4	0.000798722	0.0015	0.0014	5008	,	,		18367	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000255154																																			RPP14	SO:0001624	3_prime_UTR_variant	0			-	Uniprot_gn	AF001175	CCDS2888.1	3p21.2	2012-05-21	2007-06-26		ENSG00000163684	ENSG00000163684			30327	protein-coding gene	gene with protein product		606112	"""ribonuclease P 14kDa subunit"""			10024167, 11929972	Standard	NM_001098783		Approved	P14	uc031sah.1	O95059	OTTHUMG00000159152	ENST00000445193.3:c.*176G>C	3.37:g.58303399G>C		Somatic	0	50	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q53X97	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MaoC_dom	p.C20S	ENST00000445193.3	37	c.59	CCDS2888.1	3	.	.	.	.	.	.	.	.	.	.	G	13.60	2.286587	0.40494	.	.	ENSG00000255154	ENST00000544156;ENST00000528153	.	.	.	5.6	2.62	0.31277	.	.	.	.	.	T	0.23492	0.0568	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19778	-1.0295	7	0.20519	T	0.43	.	5.0728	0.14615	0.0832:0.1445:0.6236:0.1487	.	20	P86397	HTD2_HUMAN	S	20	.	ENSP00000437142:C20S	C	+	2	0	RP11-80H18.3	58278439	0.000000	0.05858	0.019000	0.16419	0.833000	0.47200	0.288000	0.18939	0.811000	0.34303	0.655000	0.94253	TGT	-	NULL		0.512	RPP14-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000255154	protein_coding	OTTHUMT00000353527.2	G	NM_007042	-		58303399	+1	no_errors	ENST00000528153	ensembl	human	novel	74_37	missense	SNP	0.000	C
HAUS3	79441	genome.wustl.edu	37	4	2237996	2237996	+	Missense_Mutation	SNP	T	T	C			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr4:2237996T>C	ENST00000243706.4	-	4	1766	c.1537A>G	c.(1537-1539)Act>Gct	p.T513A	POLN_ENST00000511885.2_Intron|POLN_ENST00000515357.1_Intron|HAUS3_ENST00000443786.2_Missense_Mutation_p.T513A|HAUS3_ENST00000506763.1_Intron	NM_024511.5	NP_078787.2	Q68CZ6	HAUS3_HUMAN	HAUS augmin-like complex, subunit 3	513					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				breast(3)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						TGATACAAAGTATCACAAAGC	0.343																																																	0								ENSG00000214367						91.0	87.0	89.0					4																	2237996		2203	4300	6503	HAUS3	SO:0001583	missense	0			-	HGNC	AF040964	CCDS33941.1	4p16.3	2013-10-11	2009-04-20	2009-04-20	ENSG00000214367	ENSG00000214367		"""HAUS augmin-like complex subunits"""	28719	protein-coding gene	gene with protein product		613430	"""chromosome 4 open reading frame 15"""	C4orf15		19427217, 19812674	Standard	NM_024511		Approved	MGC4701, IT1, dgt3	uc003ges.1	Q68CZ6		ENST00000243706.4:c.1537A>G	4.37:g.2237996T>C	ENSP00000243706:p.Thr513Ala	Somatic	0	36	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	B4DF64|O43606|Q8TAZ5|Q9BTJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T513A	ENST00000243706.4	37	c.1537	CCDS33941.1	4	.	.	.	.	.	.	.	.	.	.	T	2.082	-0.410466	0.04799	.	.	ENSG00000214367	ENST00000243706;ENST00000443786	T;T	0.39997	1.05;1.05	5.71	0.459	0.16678	.	0.412525	0.23334	N	0.049312	T	0.10594	0.0259	N	0.01668	-0.77	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.24225	-1.0166	10	0.07175	T	0.84	-27.2946	2.2516	0.04044	0.1252:0.4429:0.1223:0.3095	.	513	Q68CZ6	HAUS3_HUMAN	A	513	ENSP00000243706:T513A;ENSP00000392903:T513A	ENSP00000243706:T513A	T	-	1	0	HAUS3	2207794	0.505000	0.26131	0.980000	0.43619	0.910000	0.53928	0.022000	0.13511	0.367000	0.24454	-0.137000	0.14449	ACT	-	NULL		0.343	HAUS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS3	protein_coding	OTTHUMT00000357446.1	T	NM_024511	-		2237996	-1	no_errors	ENST00000243706	ensembl	human	known	74_37	missense	SNP	0.698	C
RP11-439I14.2	0	genome.wustl.edu	37	16	64770704	64770705	+	lincRNA	INS	-	-	CCAGTGATGGTCACCT	rs200421189|rs71143515|rs377231404|rs145408521|rs140029302	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr16:64770704_64770705insCCAGTGATGGTCACCT	ENST00000564293.1	+	0	453_454																											TGTCACCACTGCCACCTTGTTC	0.371														3288	0.65655	0.8434	0.5144	5008	,	,		21531	0.6052		0.5537	False		,,,				2504	0.6636																0								ENSG00000259859																																			RP11-439I14.2			0				Clone_based_vega_gene																													16.37:g.64770704_64770705insCCAGTGATGGTCACCT		Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564293.1	37	NULL		16																																																																																			-	-		0.371	RP11-439I14.2-001	KNOWN	basic	lincRNA	ENSG00000259859	lincRNA	OTTHUMT00000422725.1	-				64770705	+1	no_errors	ENST00000564293	ensembl	human	known	74_37	rna	INS	0.009:0.006	CCAGTGATGGTCACCT
TTN	7273	genome.wustl.edu	37	2	179560896	179560896	+	Missense_Mutation	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr2:179560896C>G	ENST00000591111.1	-	112	30176	c.29952G>C	c.(29950-29952)gaG>gaC	p.E9984D	TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.E10301D|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E9057D|TTN_ENST00000359218.5_Intron			Q8WZ42	TITIN_HUMAN	titin	0	Glu-rich.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTGCTTTTTCTCATACACAG	0.378																																																	0								ENSG00000155657						96.0	78.0	83.0					2																	179560896		1816	4048	5864	TTN	SO:0001583	missense	0			-	HGNC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29952G>C	2.37:g.179560896C>G	ENSP00000465570:p.Glu9984Asp	Somatic	0	122	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	52	30.26	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E9057D	ENST00000591111.1	37	c.27171		2	.	.	.	.	.	.	.	.	.	.	C	12.23	1.876204	0.33162	.	.	ENSG00000155657	ENST00000342992;ENST00000414766	T	0.67345	-0.26	5.5	3.67	0.42095	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.63498	0.2516	M	0.66939	2.045	0.80722	D	1	B;B	0.27791	0.162;0.189	B;B	0.31495	0.055;0.131	T	0.65569	-0.6136	9	0.87932	D	0	.	8.1011	0.30857	0.0:0.8074:0.0:0.1926	.	9984;9984	Q8WZ42;Q8WZ42-5	TITIN_HUMAN;.	D	9057;179	ENSP00000343764:E9057D	ENSP00000343764:E9057D	E	-	3	2	TTN	179269141	0.999000	0.42202	0.997000	0.53966	0.382000	0.30200	1.019000	0.30014	1.298000	0.44778	0.650000	0.86243	GAG	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	protein_coding	OTTHUMT00000460310.1	C	NM_133378	-		179560896	-1	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	SNP	0.998	G
MTOR	2475	genome.wustl.edu	37	1	11174523	11174523	+	Intron	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr1:11174523C>G	ENST00000361445.4	-	53	7241				MTOR_ENST00000376838.1_Intron	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)						cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	AGAAATGGGACAGAGCCACTC	0.537																																																	0								ENSG00000198793						90.0	73.0	79.0					1																	11174523		2203	4300	6503	MTOR	SO:0001627	intron_variant	0			-	HGNC	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7165-13G>C	1.37:g.11174523C>G		Somatic	0	44	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361445.4	37	NULL	CCDS127.1	1																																																																																			-	-		0.537	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	protein_coding	OTTHUMT00000005558.1	C	NM_004958	-		11174523	-1	no_errors	ENST00000473471	ensembl	human	known	74_37	rna	SNP	0.085	G
AATF	26574	genome.wustl.edu	37	17	35413995	35413995	+	3'UTR	SNP	C	C	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:35413995C>A	ENST00000225402.5	+	0	1965				AATF_ENST00000590321.1_3'UTR	NM_012138.3	NP_036270.1	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor						apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|embryonic cleavage (GO:0040016)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|negative regulation of apoptotic process (GO:0043066)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of superoxide anion generation (GO:0032929)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mitotic cell cycle (GO:0007346)|ribosome biogenesis (GO:0042254)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	leucine zipper domain binding (GO:0043522)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)	18		Breast(25;0.00607)				CAGTGGGCGCCTTGGCTGGTG	0.592																																					NSCLC(49;901 1159 19183 41572 46244)												0								ENSG00000108270						64.0	56.0	59.0					17																	35413995		2203	4300	6503	AATF	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF083208	CCDS32632.1	17q12	2014-05-06			ENSG00000108270	ENSG00000275700			19235	protein-coding gene	gene with protein product		608463				11027528, 10783144	Standard	NM_012138		Approved	DED, CHE-1, CHE1, BFR2	uc002hni.3	Q9NY61	OTTHUMG00000188458	ENST00000225402.5:c.*31C>A	17.37:g.35413995C>A		Somatic	0	40	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09	A6NCJ6|B3KQ26|Q9P0A4|Q9UNX5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000225402.5	37	NULL	CCDS32632.1	17																																																																																			-	-		0.592	AATF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AATF	protein_coding	OTTHUMT00000451543.1	C	NM_012138	-		35413995	+1	no_errors	ENST00000587618	ensembl	human	putative	74_37	rna	SNP	0.000	A
TSPAN14	81619	genome.wustl.edu	37	10	82279269	82279269	+	3'UTR	SNP	G	G	T	rs201200757		TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr10:82279269G>T	ENST00000429989.3	+	0	2573				TSPAN14_ENST00000372164.3_3'UTR|TSPAN14_ENST00000265450.5_3'UTR	NM_030927.2	NP_112189.2	Q8NG11	TSN14_HUMAN	tetraspanin 14						establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7			Colorectal(32;0.229)			TGTTGATGATGATTTTTTTTT	0.403																																																	0								ENSG00000108219																																			TSPAN14	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF311903	CCDS7369.1, CCDS44448.1	10q23.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000108219	ENSG00000108219		"""Tetraspanins"""	23303	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 14"""	TM4SF14		11230166	Standard	NM_030927		Approved	DC-TM4F2, MGC11352	uc001kcj.4	Q8NG11	OTTHUMG00000018615	ENST00000429989.3:c.*1537G>T	10.37:g.82279269G>T		Somatic	1	129	0.76		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	71	8.97	A6NHE1|B4DHY6|D3DWD7|D3DWD8|Q567U7|Q9BU34|Q9H0U1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000429989.3	37	NULL	CCDS7369.1	10																																																																																			-	-		0.403	TSPAN14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN14	protein_coding	OTTHUMT00000049081.2	G	NM_030927	rs201200757		82279269	+1	no_errors	ENST00000265450	ensembl	human	known	74_37	rna	SNP	0.040	T
STARD9	57519	genome.wustl.edu	37	15	42956067	42956067	+	Silent	SNP	A	A	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr15:42956067A>G	ENST00000290607.7	+	13	1185	c.1128A>G	c.(1126-1128)agA>agG	p.R376R		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	376	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						GCACACTGAGATATGCATCCA	0.458																																																	0								ENSG00000159433						138.0	107.0	116.0					15																	42956067		692	1590	2282	STARD9	SO:0001819	synonymous_variant	0			-	HGNC	AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.1128A>G	15.37:g.42956067A>G		Somatic	0	32	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_START_lipid-bd_dom,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R376	ENST00000290607.7	37	c.1128	CCDS53935.1	15																																																																																			-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom		0.458	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	protein_coding	OTTHUMT00000431094.1	A		-		42956067	+1	no_errors	ENST00000290607	ensembl	human	known	74_37	silent	SNP	1.000	G
GRINA	2907	genome.wustl.edu	37	8	145065511	145065511	+	Silent	SNP	C	C	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr8:145065511C>A	ENST00000313269.5	+	2	398	c.120C>A	c.(118-120)gcC>gcA	p.A40A	GRINA_ENST00000395068.4_Silent_p.A40A	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	40	Pro-rich.					integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACCCTGGGGCCCCTTACCCAC	0.682																																																	0								ENSG00000178719						17.0	21.0	20.0					8																	145065511		2187	4288	6475	GRINA	SO:0001819	synonymous_variant	0			-	HGNC	NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.120C>A	8.37:g.145065511C>A		Somatic	0	17	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	4	73.33	B3KXM7|O43836|Q8IVW7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Bax_inhibitor_1-related	p.A40	ENST00000313269.5	37	c.120	CCDS34961.1	8																																																																																			-	NULL		0.682	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GRINA	protein_coding	OTTHUMT00000384048.1	C	NM_001009184	-		145065511	+1	no_errors	ENST00000313269	ensembl	human	known	74_37	silent	SNP	0.238	A
PRELP	5549	genome.wustl.edu	37	1	203455877	203455877	+	Missense_Mutation	SNP	C	C	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr1:203455877C>A	ENST00000343110.2	+	3	1144	c.1017C>A	c.(1015-1017)ttC>ttA	p.F339L		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	339					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			TAGTGGCGTTCCATGACTTCT	0.557																																																	0								ENSG00000188783						118.0	104.0	109.0					1																	203455877		2203	4300	6503	PRELP	SO:0001583	missense	0			-	HGNC	BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.1017C>A	1.37:g.203455877C>A	ENSP00000343924:p.Phe339Leu	Somatic	0	87	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	49	34.67	Q6FG38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.F339L	ENST00000343110.2	37	c.1017	CCDS1438.1	1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.355599	0.24598	.	.	ENSG00000188783	ENST00000343110	T	0.39787	1.06	5.45	4.55	0.56014	.	0.234157	0.36409	N	0.002613	T	0.18509	0.0444	N	0.03608	-0.345	0.41182	D	0.986244	B	0.06786	0.001	B	0.06405	0.002	T	0.07597	-1.0764	10	0.10902	T	0.67	-1.0179	11.123	0.48302	0.0:0.9142:0.0:0.0858	.	339	P51888	PRELP_HUMAN	L	339	ENSP00000343924:F339L	ENSP00000343924:F339L	F	+	3	2	PRELP	201722500	1.000000	0.71417	0.977000	0.42913	0.784000	0.44337	2.264000	0.43302	1.302000	0.44855	0.555000	0.69702	TTC	-	NULL		0.557	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRELP	protein_coding	OTTHUMT00000087474.1	C	NM_002725	-		203455877	+1	no_errors	ENST00000343110	ensembl	human	known	74_37	missense	SNP	1.000	A
FBXW10	10517	genome.wustl.edu	37	17	18653145	18653145	+	Missense_Mutation	SNP	C	C	G	rs200535885	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:18653145C>G	ENST00000395665.4	+	3	1002	c.781C>G	c.(781-783)Ctg>Gtg	p.L261V	FBXW10_ENST00000395667.1_Missense_Mutation_p.L261V|FBXW10_ENST00000301938.4_Missense_Mutation_p.L261V|FBXW10_ENST00000308799.4_Missense_Mutation_p.L261V			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	261										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						ATTGGTTGACCTGGATGACAT	0.473																																																	0								ENSG00000171931						129.0	103.0	112.0					17																	18653145		2203	4297	6500	FBXW10	SO:0001583	missense	0			-	HGNC	BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.781C>G	17.37:g.18653145C>G	ENSP00000379025:p.Leu261Val	Somatic	0	80	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L261V	ENST00000395665.4	37	c.781	CCDS11199.3	17	.	.	.	.	.	.	.	.	.	.	C	9.289	1.050026	0.19827	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.32515	1.45;1.45;1.45;1.45	2.48	-1.27	0.09347	.	0.000000	0.28908	U	0.013760	T	0.23649	0.0572	M	0.65975	2.015	0.09310	N	1	B;B;B;B	0.19583	0.037;0.037;0.022;0.016	B;B;B;B	0.19148	0.024;0.024;0.011;0.024	T	0.15780	-1.0425	10	0.31617	T	0.26	.	3.914	0.09214	0.0:0.3418:0.3911:0.2671	.	261;261;261;261	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	V	261	ENSP00000379026:L261V;ENSP00000310382:L261V;ENSP00000306937:L261V;ENSP00000379025:L261V	ENSP00000306937:L261V	L	+	1	2	FBXW10	18593870	0.154000	0.22792	0.008000	0.14137	0.738000	0.42128	0.251000	0.18257	-0.391000	0.07763	-0.507000	0.04495	CTG	-	NULL		0.473	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	FBXW10	protein_coding	OTTHUMT00000313531.2	C	NM_031456	rs200535885		18653145	+1	no_errors	ENST00000308799	ensembl	human	known	74_37	missense	SNP	0.004	G
C4BPA	722	genome.wustl.edu	37	1	207300183	207300183	+	Missense_Mutation	SNP	G	G	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr1:207300183G>T	ENST00000367070.3	+	7	1026	c.832G>T	c.(832-834)Gta>Tta	p.V278L		NM_000715.3	NP_000706.1	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	278	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|negative regulation of complement activation, classical pathway (GO:0045959)|positive regulation of protein catabolic process (GO:0045732)|regulation of complement activation (GO:0030449)|regulation of opsonization (GO:1903027)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(1)|urinary_tract(2)	28						AGGCAGCAGTGTAATTCATTG	0.403																																																	0								ENSG00000123838						185.0	161.0	169.0					1																	207300183		2203	4300	6503	C4BPA	SO:0001583	missense	0			-	HGNC	M31452	CCDS1477.1	1q32	2010-09-24	2001-11-28		ENSG00000123838	ENSG00000123838			1325	protein-coding gene	gene with protein product		120830	"""complement component 4-binding protein, alpha"""	C4BP			Standard	XM_005273251		Approved		uc001hfo.3	P04003	OTTHUMG00000036173	ENST00000367070.3:c.832G>T	1.37:g.207300183G>T	ENSP00000356037:p.Val278Leu	Somatic	0	38	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	20	37.50	Q5VVQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.V278L	ENST00000367070.3	37	c.832	CCDS1477.1	1	.	.	.	.	.	.	.	.	.	.	G	1.315	-0.600982	0.03744	.	.	ENSG00000123838	ENST00000367070	T	0.66460	-0.21	5.75	-11.5	0.00074	Complement control module (2);Sushi/SCR/CCP (3);	1.766220	0.02858	N	0.129976	T	0.44435	0.1293	N	0.16368	0.405	0.09310	N	1	B	0.11235	0.004	B	0.18871	0.023	T	0.19516	-1.0303	10	0.18276	T	0.48	.	11.5064	0.50468	0.3279:0.0:0.5393:0.1328	.	278	P04003	C4BPA_HUMAN	L	278	ENSP00000356037:V278L	ENSP00000356037:V278L	V	+	1	0	C4BPA	205366806	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-3.804000	0.00362	-2.563000	0.00472	-0.485000	0.04761	GTA	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.403	C4BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4BPA	protein_coding	OTTHUMT00000088089.3	G		-		207300183	+1	no_errors	ENST00000367070	ensembl	human	known	74_37	missense	SNP	0.000	T
CRYBG3	131544	genome.wustl.edu	37	3	97596769	97596769	+	Missense_Mutation	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr3:97596769C>G	ENST00000182096.4	+	1	951	c.887C>G	c.(886-888)tCc>tGc	p.S296C		NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2244							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						CTGCAGACTTCCCAAAGTCAT	0.423																																																	0								ENSG00000080200						81.0	76.0	78.0					3																	97596769		1814	4091	5905	CRYBG3	SO:0001583	missense	0			-	HGNC			3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.887C>G	3.37:g.97596769C>G	ENSP00000182096:p.Ser296Cys	Somatic	0	52	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.S296C	ENST00000182096.4	37	c.887		3	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815322	0.50527	.	.	ENSG00000080200	ENST00000182096	T	0.75477	-0.94	5.7	4.79	0.61399	.	1.058720	0.07304	N	0.874627	T	0.73690	0.3619	L	0.27053	0.805	0.80722	D	1	D	0.63880	0.993	P	0.49999	0.628	T	0.69978	-0.4998	10	0.66056	D	0.02	.	15.1374	0.72579	0.0:0.8601:0.1399:0.0	.	296	Q68DQ2	CRBG3_HUMAN	C	296	ENSP00000182096:S296C	ENSP00000182096:S296C	S	+	2	0	CRYBG3	99079459	0.946000	0.32159	0.962000	0.40283	0.527000	0.34593	1.598000	0.36740	2.705000	0.92388	0.505000	0.49811	TCC	-	NULL		0.423	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	protein_coding	OTTHUMT00000353751.1	C	NM_153605	-		97596769	+1	no_errors	ENST00000182096	ensembl	human	known	74_37	missense	SNP	0.943	G
CEACAM16	388551	genome.wustl.edu	37	19	45208935	45208935	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr19:45208935C>T	ENST00000405314.2	+	4	834	c.737C>T	c.(736-738)aCg>aTg	p.T246M	CEACAM16_ENST00000587331.1_Missense_Mutation_p.T246M|CTB-171A8.1_ENST00000590796.1_RNA			Q2WEN9	CEA16_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 16	246	Ig-like C2-type 2.				sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)|stereocilium bundle tip (GO:0032426)				endometrium(3)|large_intestine(2)|lung(3)|ovary(1)	9	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				GACTTCAACACGTCCCTCACC	0.602																																																	0								ENSG00000213892						71.0	78.0	76.0					19																	45208935		2108	4233	6341	CEACAM16	SO:0001583	missense	0			-	HGNC		CCDS54278.1	19q13.31	2014-01-27			ENSG00000213892	ENSG00000213892		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31948	protein-coding gene	gene with protein product		614591				21368133	Standard	NM_001039213		Approved	DFNA4B	uc010xxd.2	Q2WEN9	OTTHUMG00000151519	ENST00000405314.2:c.737C>T	19.37:g.45208935C>T	ENSP00000385576:p.Thr246Met	Somatic	0	93	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	10	58.33	A7LI12	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T246M	ENST00000405314.2	37	c.737	CCDS54278.1	19	.	.	.	.	.	.	.	.	.	.	c	10.60	1.396252	0.25205	.	.	ENSG00000213892	ENST00000396750;ENST00000405314	T	0.44083	0.93	5.24	0.319	0.15873	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.520885	0.14290	N	0.328954	T	0.24928	0.0605	L	0.41492	1.28	0.09310	N	1	P	0.34934	0.476	B	0.19946	0.027	T	0.07966	-1.0745	10	0.44086	T	0.13	-1.2085	5.8236	0.18540	0.0:0.5321:0.2973:0.1705	.	305	Q2WEN9	CEA16_HUMAN	M	311;246	ENSP00000385576:T246M	ENSP00000379974:T311M	T	+	2	0	CEACAM16	49900775	0.001000	0.12720	0.117000	0.21633	0.965000	0.64279	0.302000	0.19192	-0.067000	0.12976	-0.215000	0.12644	ACG	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.602	CEACAM16-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	CEACAM16	protein_coding		C	XM_371177	-		45208935	+1	no_errors	ENST00000405314	ensembl	human	known	74_37	missense	SNP	0.026	T
SPECC1	92521	genome.wustl.edu	37	17	20150563	20150563	+	Missense_Mutation	SNP	G	G	C	rs371735963		TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:20150563G>C	ENST00000261503.5	+	9	2580	c.2529G>C	c.(2527-2529)aaG>aaC	p.K843N	SPECC1_ENST00000395530.2_Missense_Mutation_p.K762N|SPECC1_ENST00000395527.4_Missense_Mutation_p.K843N|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000536879.1_Missense_Mutation_p.K183N	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	843					cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		CTGTCCATAAGACCCCCAGAA	0.453																																																	0								ENSG00000128487						50.0	52.0	52.0					17																	20150563		2203	4300	6503	SPECC1	SO:0001583	missense	0			-	HGNC	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.2529G>C	17.37:g.20150563G>C	ENSP00000261503:p.Lys843Asn	Somatic	0	36	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	24	14.29	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.K843N	ENST00000261503.5	37	c.2529	CCDS32590.1	17	.	.	.	.	.	.	.	.	.	.	G	10.53	1.375274	0.24857	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000536879;ENST00000395527	T;T	0.52526	0.66;0.66	4.28	2.28	0.28536	.	0.107613	0.64402	D	0.000008	T	0.50582	0.1624	L	0.57536	1.79	0.31509	N	0.663808	P;D;P	0.56968	0.67;0.978;0.791	B;P;B	0.56514	0.299;0.8;0.392	T	0.53500	-0.8430	10	0.23891	T	0.37	-37.5504	6.5702	0.22535	0.2202:0.0:0.7798:0.0	.	843;762;843	A8MV89;Q5M775-4;Q5M775	.;.;CYTSB_HUMAN	N	843;843;183;762	ENSP00000261503:K843N;ENSP00000438294:K183N	ENSP00000261503:K843N	K	+	3	2	SPECC1	20091155	0.981000	0.34729	0.895000	0.35142	0.992000	0.81027	1.900000	0.39828	0.563000	0.29222	0.586000	0.80456	AAG	-	NULL		0.453	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1	protein_coding	OTTHUMT00000441206.1	G	NM_152904	-		20150563	+1	no_errors	ENST00000261503	ensembl	human	known	74_37	missense	SNP	0.976	C
AURKB	9212	genome.wustl.edu	37	17	8110218	8110218	+	Intron	SNP	G	G	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:8110218G>T	ENST00000585124.1	-	6	492				AURKB_ENST00000535053.1_Intron|AURKB_ENST00000534871.1_Intron|AURKB_ENST00000316199.6_Intron|AURKB_ENST00000578549.1_Silent_p.V97V	NM_004217.3	NP_004208.2	Q96GD4	AURKB_HUMAN	aurora kinase B						abscission (GO:0009838)|aging (GO:0007568)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|cleavage furrow formation (GO:0036089)|cytokinesis checkpoint (GO:0031565)|histone H3-S28 phosphorylation (GO:0043988)|histone modification (GO:0016570)|mitotic cell cycle (GO:0000278)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytokinesis (GO:0032467)|protein autophosphorylation (GO:0046777)|protein localization to kinetochore (GO:0034501)|protein phosphorylation (GO:0006468)|regulation of chromosome segregation (GO:0051983)|spindle checkpoint (GO:0031577)|spindle midzone assembly involved in mitosis (GO:0051256)|spindle stabilization (GO:0043146)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|central_nervous_system(1)|lung(2)	4						TGGGGGAAGAGACAGAGGAGG	0.562																																					NSCLC(134;1161 2470 43664 51568)												0								ENSG00000178999						32.0	33.0	33.0					17																	8110218		2203	4300	6503	AURKB	SO:0001627	intron_variant	0			-	HGNC	AF004022	CCDS11134.1, CCDS58514.1, CCDS67162.1	17p13.1	2013-01-17	2003-07-21	2003-07-23	ENSG00000178999	ENSG00000178999		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11390	protein-coding gene	gene with protein product	"""aurora-B"", ""aurora-1"", ""protein phosphatase 1, regulatory subunit 48"""	604970	"""serine/threonine kinase 12"""	STK12		9858806	Standard	NM_001256834		Approved	Aik2, IPL1, AurB, AIM-1, ARK2, STK5, PPP1R48	uc002gkm.4	Q96GD4	OTTHUMG00000108189	ENST00000585124.1:c.399-12C>A	17.37:g.8110218G>T		Somatic	0	40	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B4DNM4|C7G533|C7G534|C7G535|D3DTR4|J9JID1|O14630|O60446|O95083|Q96DV5|Q9UQ46	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V97	ENST00000585124.1	37	c.291	CCDS11134.1	17																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.562	AURKB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AURKB	protein_coding	OTTHUMT00000226995.2	G	NM_004217	-		8110218	-1	no_errors	ENST00000578549	ensembl	human	novel	74_37	silent	SNP	0.001	T
TBC1D3P1-DHX40P1	653645	genome.wustl.edu	37	17	58094588	58094588	+	lincRNA	SNP	T	T	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:58094588T>G	ENST00000407042.3	-	0	221									TBC1D3P1-DHX40P1 readthrough transcribed pseudogene																		TCCAAAAGACTTAGGCCCCTT	0.577																																																	0								ENSG00000267104																																			TBC1D3P1-DHX40P1			0			-	HGNC			17q23.1	2014-09-10	2012-12-07		ENSG00000267104	ENSG00000267104			42362	other	readthrough			"""TBC1D3P1-DHX40P1 readthrough (non-protein coding)"""				Standard	NR_002924		Approved		uc002iyf.2		OTTHUMG00000179977		17.37:g.58094588T>G		Somatic	0	333	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	83	286	22.43		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000407042.3	37	NULL		17	.	.	.	.	.	.	.	.	.	.	T	0.049	-1.255970	0.01457	.	.	ENSG00000238283	ENST00000407042	.	.	.	0.0465	-0.093	0.13652	.	40.982500	0.00698	N	0.000765	T	0.21387	0.0515	.	.	.	.	.	.	.	.	.	.	.	.	T	0.07328	-1.0778	4	0.54805	T	0.06	.	.	.	.	.	.	.	.	T	37	.	ENSP00000383952:K37T	K	-	2	0	AC005702.1	55449370	0.004000	0.15560	0.001000	0.08648	0.001000	0.01503	-2.393000	0.01055	-1.658000	0.01490	-1.732000	0.00693	AAG	-	-		0.577	TBC1D3P1-DHX40P1-201	KNOWN	basic	lincRNA	TBC1D3P1-DHX40P1	lincRNA		T	NR_002924	-		58094588	-1	no_errors	ENST00000407042	ensembl	human	known	74_37	rna	SNP	0.001	G
CNGB3	54714	genome.wustl.edu	37	8	87616328	87616328	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr8:87616328C>T	ENST00000320005.5	-	15	1821	c.1774G>A	c.(1774-1776)Gaa>Aaa	p.E592K		NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	592					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						TACCTGATTTCTCCAAACACC	0.378																																																	0								ENSG00000170289						79.0	77.0	78.0					8																	87616328		2203	4300	6503	CNGB3	SO:0001583	missense	0			-	HGNC	AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.1774G>A	8.37:g.87616328C>T	ENSP00000316605:p.Glu592Lys	Somatic	0	45	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	15	50.00	C9JA51|Q9NRE9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.E592K	ENST00000320005.5	37	c.1774	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.724161	0.96847	.	.	ENSG00000170289	ENST00000320005	D	0.98264	-4.83	5.97	5.97	0.96955	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.99417	0.9794	H	0.97186	3.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98501	1.0614	10	0.87932	D	0	.	20.428	0.99075	0.0:1.0:0.0:0.0	.	592	Q9NQW8	CNGB3_HUMAN	K	592	ENSP00000316605:E592K	ENSP00000316605:E592K	E	-	1	0	CNGB3	87685444	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.625000	0.83145	2.837000	0.97791	0.655000	0.94253	GAA	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom		0.378	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	protein_coding	OTTHUMT00000375107.1	C	NM_019098	-		87616328	-1	no_errors	ENST00000320005	ensembl	human	known	74_37	missense	SNP	1.000	T
SPTBN1	6711	genome.wustl.edu	37	2	54839385	54839385	+	Missense_Mutation	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr2:54839385C>G	ENST00000356805.4	+	4	669	c.388C>G	c.(388-390)Ctt>Gtt	p.L130V	SPTBN1_ENST00000333896.5_Missense_Mutation_p.L117V	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	130	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GAGAGTCCATCTTGAGAACAT	0.547																																																	0								ENSG00000115306						143.0	126.0	132.0					2																	54839385		2203	4300	6503	SPTBN1	SO:0001583	missense	0			-	HGNC		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.388C>G	2.37:g.54839385C>G	ENSP00000349259:p.Leu130Val	Somatic	0	93	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	54	43.16	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.L130V	ENST00000356805.4	37	c.388	CCDS33198.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.147054	0.94603	.	.	ENSG00000115306	ENST00000356805;ENST00000389980;ENST00000333896	T;T;D	0.97186	0.07;0.07;-4.28	5.6	5.6	0.85130	Actinin-type, actin-binding, conserved site (1);Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97794	0.9276	L	0.48986	1.54	0.80722	D	1	D;D	0.58620	0.957;0.983	P;D	0.65573	0.819;0.936	D	0.98452	1.0592	10	0.87932	D	0	.	19.9698	0.97280	0.0:1.0:0.0:0.0	.	117;130	Q01082-3;Q01082	.;SPTB2_HUMAN	V	130;130;117	ENSP00000349259:L130V;ENSP00000374630:L130V;ENSP00000334156:L117V	ENSP00000334156:L117V	L	+	1	0	SPTBN1	54692889	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.878000	0.63093	2.786000	0.95864	0.561000	0.74099	CTT	-	pirsf_Spectrin_bsu,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain		0.547	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN1	protein_coding	OTTHUMT00000258115.3	C		-		54839385	+1	no_errors	ENST00000356805	ensembl	human	known	74_37	missense	SNP	1.000	G
KRT14	3861	genome.wustl.edu	37	17	39742691	39742691	+	Missense_Mutation	SNP	C	C	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:39742691C>A	ENST00000167586.6	-	1	482	c.396G>T	c.(394-396)aaG>aaT	p.K132N		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	132	Coil 1A.|Rod.				aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				GAGCACGCACCTTGTCCAGGT	0.587																																																	0								ENSG00000186847						135.0	142.0	139.0					17																	39742691		2203	4296	6499	KRT14	SO:0001583	missense	0			-	HGNC	BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.396G>T	17.37:g.39742691C>A	ENSP00000167586:p.Lys132Asn	Somatic	0	199	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	49	57.02	Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.K132N	ENST00000167586.6	37	c.396	CCDS11400.1	17	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630373	0.67015	.	.	ENSG00000186847	ENST00000167586	D	0.93953	-3.32	5.11	4.13	0.48395	Filament (1);	0.000000	0.56097	D	0.000026	D	0.97247	0.9100	H	0.95328	3.655	0.53005	D	0.999969	D	0.71674	0.998	D	0.76071	0.987	D	0.97047	0.9761	10	0.62326	D	0.03	.	9.8221	0.40889	0.1404:0.7867:0.0:0.0729	.	132	P02533	K1C14_HUMAN	N	132	ENSP00000167586:K132N	ENSP00000167586:K132N	K	-	3	2	KRT14	36996217	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.724000	0.47285	1.277000	0.44412	0.549000	0.68633	AAG	-	pfam_IF		0.587	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT14	protein_coding	OTTHUMT00000257289.1	C	NM_000526	-		39742691	-1	no_errors	ENST00000167586	ensembl	human	known	74_37	missense	SNP	1.000	A
GALNT3	2591	genome.wustl.edu	37	2	166605335	166605335	+	Missense_Mutation	SNP	G	G	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr2:166605335G>T	ENST00000392701.3	-	11	2633	c.1858C>A	c.(1858-1860)Cca>Aca	p.P620T	GALNT3_ENST00000409882.1_Missense_Mutation_p.P358T	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	620	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						GGATCTGATGGGTTGCATGAC	0.333																																																	0								ENSG00000115339						91.0	87.0	88.0					2																	166605335		2203	4299	6502	GALNT3	SO:0001583	missense	0			-	HGNC		CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1858C>A	2.37:g.166605335G>T	ENSP00000376465:p.Pro620Thr	Somatic	0	64	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	37	27.45	Q53TG9|Q7Z476	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.P620T	ENST00000392701.3	37	c.1858	CCDS2226.1	2	.	.	.	.	.	.	.	.	.	.	G	9.442	1.088431	0.20390	.	.	ENSG00000115339	ENST00000392701;ENST00000409882	T;T	0.76968	-1.06;-1.06	5.86	4.04	0.47022	Ricin B-related lectin (1);Ricin B lectin (3);	0.108090	0.64402	N	0.000005	T	0.68833	0.3044	L	0.45422	1.42	0.51233	D	0.999918	B	0.06786	0.001	B	0.15052	0.012	T	0.60367	-0.7277	10	0.18710	T	0.47	.	12.991	0.58618	0.0:0.1237:0.7474:0.1289	.	620	Q14435	GALT3_HUMAN	T	620;358	ENSP00000376465:P620T;ENSP00000386955:P358T	ENSP00000376465:P620T	P	-	1	0	GALNT3	166313581	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	2.994000	0.49433	0.796000	0.33947	0.563000	0.77884	CCA	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin		0.333	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT3	protein_coding	OTTHUMT00000255205.2	G	NM_004482	-		166605335	-1	no_errors	ENST00000392701	ensembl	human	known	74_37	missense	SNP	1.000	T
TTC6	319089	genome.wustl.edu	37	14	38165968	38165968	+	Missense_Mutation	SNP	G	G	A	rs551122113		TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr14:38165968G>A	ENST00000553443.1	+	4	1304	c.1304G>A	c.(1303-1305)cGa>cAa	p.R435Q				Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	0										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		GAAATTAAGCGAATGCGGAAA	0.294													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14227	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000139865																																			TTC6	SO:0001583	missense	0			-	HGNC	BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000553443.1:c.1304G>A	14.37:g.38165968G>A	ENSP00000451131:p.Arg435Gln	Somatic	0	37	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	6	70.00	Q3SY88|Q96CE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R435Q	ENST00000553443.1	37	c.1304		14	.	.	.	.	.	.	.	.	.	.	G	11.71	1.721135	0.30503	.	.	ENSG00000139865	ENST00000553443	T	0.71222	-0.55	4.66	-1.26	0.09376	.	.	.	.	.	T	0.58935	0.2157	.	.	.	.	.	.	.	.	.	.	.	.	T	0.57271	-0.7840	4	.	.	.	.	6.0862	0.19968	0.2627:0.3188:0.4185:0.0	.	.	.	.	Q	435	ENSP00000451131:R435Q	.	R	+	2	0	TTC6	37235719	0.000000	0.05858	0.120000	0.21714	0.011000	0.07611	-0.305000	0.08188	-0.261000	0.09405	-1.094000	0.02160	CGA	-	NULL		0.294	TTC6-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TTC6	protein_coding	OTTHUMT00000348620.4	G	XM_002343299	-		38165968	+1	no_errors	ENST00000553443	ensembl	human	novel	74_37	missense	SNP	0.022	A
MIR520F	574464	genome.wustl.edu	37	19	54185491	54185491	+	RNA	SNP	C	C	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr19:54185491C>T	ENST00000384824.1	+	0	79				MIR519E_ENST00000385075.1_RNA|MIR515-2_ENST00000384883.1_RNA	NR_030186.1				microRNA 520f																		AGAGGGTTACCGTTTGGGAAA	0.458																																																	0								ENSG00000207555						64.0	58.0	60.0					19																	54185491		1568	3582	5150	MIR520F			0			-	HGNC			19q13.42	2011-09-12		2008-12-18	ENSG00000207555	ENSG00000207555		"""ncRNAs / Micro RNAs"""	32096	non-coding RNA	RNA, micro				MIRN520F			Standard	NR_030186		Approved	hsa-mir-520f	uc021uzp.1				19.37:g.54185491C>T		Somatic	0	63	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000384824.1	37	NULL		19																																																																																			-	-		0.458	MIR520F-201	KNOWN	basic	miRNA	MIR520F	miRNA		C	NR_030186	-		54185491	+1	no_errors	ENST00000384824	ensembl	human	known	74_37	rna	SNP	0.101	T
PRRC2B	84726	genome.wustl.edu	37	9	134351084	134351084	+	Missense_Mutation	SNP	G	G	C	rs200684547		TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr9:134351084G>C	ENST00000357304.4	+	15	3623	c.3568G>C	c.(3568-3570)Ggt>Cgt	p.G1190R	PRRC2B_ENST00000458550.1_Intron|PRRC2B_ENST00000372249.1_5'UTR|PRRC2B_ENST00000405995.1_Intron	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1190							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GGACCACAGCGGTCTAGATGC	0.612																																																	0								ENSG00000130723						21.0	23.0	22.0					9																	134351084		1949	4157	6106	PRRC2B	SO:0001583	missense	0			-	HGNC	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.3568G>C	9.37:g.134351084G>C	ENSP00000349856:p.Gly1190Arg	Somatic	0	47	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	8.89	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAT2_N	p.G1190R	ENST00000357304.4	37	c.3568	CCDS48044.1	9	.	.	.	.	.	.	.	.	.	.	G	7.262	0.605296	0.14002	.	.	ENSG00000130723	ENST00000357304;ENST00000418650	T	0.27256	1.68	5.54	1.01	0.19927	.	.	.	.	.	T	0.22666	0.0547	L	0.36672	1.1	0.09310	N	0.99999	P;B	0.47545	0.897;0.389	P;B	0.47162	0.54;0.121	T	0.11227	-1.0596	8	.	.	.	.	6.8133	0.23817	0.5832:0.0:0.4168:0.0	.	486;1190	Q5H9R5;Q5JSZ5	.;PRC2B_HUMAN	R	1190;486	ENSP00000349856:G1190R	.	G	+	1	0	PRRC2B	133340905	0.080000	0.21391	0.000000	0.03702	0.481000	0.33189	0.796000	0.26986	0.285000	0.22329	0.462000	0.41574	GGT	-	NULL		0.612	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	protein_coding		G		-		134351084	+1	no_errors	ENST00000357304	ensembl	human	known	74_37	missense	SNP	0.000	C
ROBO4	54538	genome.wustl.edu	37	11	124766916	124766916	+	Silent	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr11:124766916G>A	ENST00000306534.3	-	2	797	c.312C>T	c.(310-312)gcC>gcT	p.A104A	ROBO4_ENST00000533054.1_5'UTR|ROBO4_ENST00000526899.1_5'UTR	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	104	Ig-like C2-type 1.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CTGTGGACAGGGCCTGGCCAT	0.672																																																	0								ENSG00000154133						43.0	44.0	44.0					11																	124766916		2201	4299	6500	ROBO4	SO:0001819	synonymous_variant	0			-	HGNC	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.312C>T	11.37:g.124766916G>A		Somatic	0	76	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	42	43.24	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A104	ENST00000306534.3	37	c.312	CCDS8455.1	11																																																																																			-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.672	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO4	protein_coding	OTTHUMT00000387111.1	G	NM_019055	-		124766916	-1	no_errors	ENST00000306534	ensembl	human	known	74_37	silent	SNP	0.376	A
SLCO1B1	10599	genome.wustl.edu	37	12	21370181	21370181	+	Silent	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr12:21370181C>G	ENST00000256958.2	+	12	1722	c.1626C>G	c.(1624-1626)gtC>gtG	p.V542V		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	542					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	CAATACAAGTCTTGAATTTAT	0.353																																																	0								ENSG00000134538						129.0	132.0	131.0					12																	21370181		2203	4300	6503	SLCO1B1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1626C>G	12.37:g.21370181C>G		Somatic	0	47	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	32	34.69	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.V542	ENST00000256958.2	37	c.1626	CCDS8685.1	12																																																																																			-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter		0.353	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1B1	protein_coding	OTTHUMT00000402070.1	C	NM_006446	-		21370181	+1	no_errors	ENST00000256958	ensembl	human	known	74_37	silent	SNP	0.001	G
ZNF526	116115	genome.wustl.edu	37	19	42730215	42730215	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr19:42730215G>A	ENST00000301215.3	+	3	1885	c.1660G>A	c.(1660-1662)Gtc>Atc	p.V554I		NM_133444.1	NP_597701.1	Q8TF50	ZN526_HUMAN	zinc finger protein 526	554					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|cervix(1)|endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(3)	22		Prostate(69;0.0704)				CTTGCGGCCAGTCGCCTTTGC	0.652																																																	0								ENSG00000167625						43.0	42.0	42.0					19																	42730215		2203	4300	6503	ZNF526	SO:0001583	missense	0			-	HGNC	AB075831	CCDS12598.1	19q13.31	2013-01-08				ENSG00000167625		"""Zinc fingers, C2H2-type"""	29415	protein-coding gene	gene with protein product		614387				11853319	Standard	NM_133444		Approved	KIAA1951, MGC4267	uc002osz.1	Q8TF50		ENST00000301215.3:c.1660G>A	19.37:g.42730215G>A	ENSP00000301215:p.Val554Ile	Somatic	0	66	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	21	19.23	B3KV29|Q69YI2|Q96E24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V554I	ENST00000301215.3	37	c.1660	CCDS12598.1	19	.	.	.	.	.	.	.	.	.	.	G	10.50	1.368962	0.24771	.	.	ENSG00000167625	ENST00000437878;ENST00000301215	T	0.08984	3.03	4.76	1.28	0.21552	.	0.334622	0.22438	N	0.060047	T	0.03220	0.0094	N	0.08118	0	0.09310	N	1	P	0.35328	0.495	B	0.25987	0.065	T	0.43940	-0.9360	10	0.35671	T	0.21	-22.2782	7.6853	0.28536	0.0766:0.0:0.5099:0.4135	.	554	Q8TF50	ZN526_HUMAN	I	410;554	ENSP00000301215:V554I	ENSP00000301215:V554I	V	+	1	0	ZNF526	47422055	0.989000	0.36119	0.005000	0.12908	0.683000	0.39861	2.962000	0.49176	0.283000	0.22279	0.561000	0.74099	GTC	-	NULL		0.652	ZNF526-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF526	protein_coding	OTTHUMT00000463681.2	G	XM_057401	-		42730215	+1	no_errors	ENST00000301215	ensembl	human	known	74_37	missense	SNP	0.002	A
NRF1	4899	genome.wustl.edu	37	7	129367102	129367102	+	Silent	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr7:129367102C>G	ENST00000393232.1	+	10	1362	c.1245C>G	c.(1243-1245)gtC>gtG	p.V415V	NRF1_ENST00000393231.3_Silent_p.V415V|NRF1_ENST00000393230.2_Silent_p.V415V|NRF1_ENST00000223190.4_Silent_p.V415V|NRF1_ENST00000539636.1_Silent_p.V254V|NRF1_ENST00000353868.4_Silent_p.V349V|NRF1_ENST00000311967.2_Silent_p.V415V	NM_005011.3	NP_005002.3	Q16656	NRF1_HUMAN	nuclear respiratory factor 1	415	Required for transcriptional activation.				cellular lipid metabolic process (GO:0044255)|generation of precursor metabolites and energy (GO:0006091)|mitochondrion organization (GO:0007005)|organ regeneration (GO:0031100)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to folic acid (GO:0051593)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(2)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	24						CCCATGCTGTCGCCACCCTGG	0.577																																																	0								ENSG00000106459						48.0	45.0	46.0					7																	129367102		2203	4300	6503	NRF1	SO:0001819	synonymous_variant	0			-	HGNC	L22454	CCDS5813.2	7q32	2008-07-18			ENSG00000106459	ENSG00000106459			7996	protein-coding gene	gene with protein product	"""alpha palindromic-binding protein"""	600879				2584221	Standard	NM_005011		Approved	EWG, ALPHA-PAL	uc003voz.3	Q16656	OTTHUMG00000143736	ENST00000393232.1:c.1245C>G	7.37:g.129367102C>G		Somatic	0	76	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	46	17.86	A8K4C6|B4DDV6|Q15305|Q96AN2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Nrf1_NLS/DNA-bd_dimer,pfam_Nrf1_activation-bd	p.V415	ENST00000393232.1	37	c.1245	CCDS5813.2	7																																																																																			-	NULL		0.577	NRF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	NRF1	protein_coding	OTTHUMT00000289813.1	C	NM_001040110	-		129367102	+1	no_errors	ENST00000393231	ensembl	human	known	74_37	silent	SNP	1.000	G
GLRA1	2741	genome.wustl.edu	37	5	151239459	151239459	+	Silent	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr5:151239459G>A	ENST00000455880.2	-	4	649	c.363C>T	c.(361-363)atC>atT	p.I121I	GLRA1_ENST00000274576.4_Silent_p.I121I|GLRA1_ENST00000471351.2_5'UTR|GLRA1_ENST00000545569.1_Silent_p.I38I			P23415	GLRA1_HUMAN	glycine receptor, alpha 1	121					acrosome reaction (GO:0007340)|action potential (GO:0001508)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|muscle contraction (GO:0006936)|negative regulation of transmission of nerve impulse (GO:0051970)|neuromuscular process controlling posture (GO:0050884)|neuropeptide signaling pathway (GO:0007218)|positive regulation of acrosome reaction (GO:2000344)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|external side of plasma membrane (GO:0009897)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|taurine binding (GO:0030977)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	23		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Ginkgo biloba(DB01381)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Lindane(DB00431)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CAGGTTTCCAGATGGAGTCCA	0.537																																																	0								ENSG00000145888						167.0	159.0	161.0					5																	151239459		2203	4300	6503	GLRA1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4320.1, CCDS54942.1	5q33.1	2012-02-07	2008-01-24		ENSG00000145888	ENSG00000145888		"""Ligand-gated ion channels / Glycine receptors"""	4326	protein-coding gene	gene with protein product	"""startle disease/hyperekplexia"", ""stiff person syndrome"""	138491	"""glycine receptor, alpha 1 (startle disease/hyperekplexia)"""	STHE		1355335, 8298642	Standard	NM_000171		Approved		uc003lut.3	P23415	OTTHUMG00000130121	ENST00000455880.2:c.363C>T	5.37:g.151239459G>A		Somatic	0	104	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	47	41.25	B2R6T3|Q14C77|Q6DJV9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Glycine_rcpt_A1,prints_Neur_channel,tigrfam_Neur_channel	p.I121	ENST00000455880.2	37	c.363	CCDS54942.1	5																																																																																			-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel		0.537	GLRA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA1	protein_coding	OTTHUMT00000373959.1	G		-		151239459	-1	no_errors	ENST00000455880	ensembl	human	known	74_37	silent	SNP	1.000	A
PLXNA2	5362	genome.wustl.edu	37	1	208390563	208390563	+	Silent	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr1:208390563C>G	ENST00000367033.3	-	2	1462	c.705G>C	c.(703-705)ctG>ctC	p.L235L		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	235	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		AGTGGGAGACCAGGGCCAGGG	0.552																																																	0								ENSG00000076356						179.0	187.0	185.0					1																	208390563		2203	4300	6503	PLXNA2	SO:0001819	synonymous_variant	0			-	HGNC	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.705G>C	1.37:g.208390563C>G		Somatic	0	60	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	46	29.23	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.L235	ENST00000367033.3	37	c.705	CCDS31013.1	1																																																																																			-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom		0.552	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA2	protein_coding	OTTHUMT00000088932.6	C	NM_025179	-		208390563	-1	no_errors	ENST00000367033	ensembl	human	known	74_37	silent	SNP	0.993	G
EIF2S2	8894	genome.wustl.edu	37	20	32684518	32684518	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr20:32684518C>T	ENST00000374980.2	-	6	849	c.628G>A	c.(628-630)Gtc>Atc	p.V210I		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	210					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						CCTACTCGGACGACTTGTGGA	0.398																																																	0								ENSG00000125977						109.0	108.0	109.0					20																	32684518		2203	4297	6500	EIF2S2	SO:0001583	missense	0			-	HGNC	M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.628G>A	20.37:g.32684518C>T	ENSP00000364119:p.Val210Ile	Somatic	0	81	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	38	38.71	Q9BVU0|Q9UJE4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transl_init_fac_IF2/IF5,superfamily_Transl_init_fac_IF2/IF5_N,superfamily_Transl_init_fac_IF2/IF5_Zn-bd,smart_Transl_init_fac_IF2/IF5	p.V210I	ENST00000374980.2	37	c.628	CCDS13231.1	20	.	.	.	.	.	.	.	.	.	.	C	34	5.375453	0.95923	.	.	ENSG00000125977	ENST00000374980	T	0.42131	0.98	5.77	5.77	0.91146	Translation initiation factor IF2/IF5, N-terminal (2);Translation initiation factor IF2/IF5 (2);	0.000000	0.85682	D	0.000000	T	0.61160	0.2325	L	0.49513	1.565	0.80722	D	1	B;D;D	0.59357	0.004;0.985;0.985	B;D;D	0.68621	0.005;0.959;0.959	T	0.56798	-0.7919	10	0.51188	T	0.08	-31.1684	20.3627	0.98863	0.0:1.0:0.0:0.0	.	210;210;210	B5BU01;Q6IBR8;P20042	.;.;IF2B_HUMAN	I	210	ENSP00000364119:V210I	ENSP00000364119:V210I	V	-	1	0	EIF2S2	32148179	1.000000	0.71417	0.982000	0.44146	0.997000	0.91878	7.552000	0.82192	2.885000	0.99019	0.655000	0.94253	GTC	-	pfam_Transl_init_fac_IF2/IF5,superfamily_Transl_init_fac_IF2/IF5_N,smart_Transl_init_fac_IF2/IF5		0.398	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S2	protein_coding	OTTHUMT00000078765.2	C	NM_003908	-		32684518	-1	no_errors	ENST00000374980	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC27A5	10998	genome.wustl.edu	37	19	59022824	59022824	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr19:59022824C>T	ENST00000263093.2	-	1	608	c.499G>A	c.(499-501)Gcg>Acg	p.A167T	SLC27A5_ENST00000601355.1_Intron	NM_012254.2	NP_036386.1	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid transporter), member 5	167					bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|ketone body biosynthetic process (GO:0046951)|plasma membrane long-chain fatty acid transport (GO:0015911)|small molecule metabolic process (GO:0044281)|triglyceride mobilization (GO:0006642)|very long-chain fatty acid metabolic process (GO:0000038)	basal plasma membrane (GO:0009925)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|protein complex (GO:0043234)	ATP binding (GO:0005524)|cholate-CoA ligase activity (GO:0047747)|fatty acid transporter activity (GO:0015245)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		CACAGGCTCGCAGGGTCACCC	0.701																																																	0								ENSG00000083807						11.0	10.0	11.0					19																	59022824		2177	4271	6448	SLC27A5	SO:0001583	missense	0			-	HGNC	AF064255	CCDS12983.1	19q13.43	2013-07-15			ENSG00000083807	ENSG00000083807		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10999	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 3"""	603314				10479480, 10749848	Standard	NM_012254		Approved	FATP5, VLACSR, VLCS-H2, VLCSH2, FACVL3, FLJ22987, ACSVL6, ACSB	uc002qtc.2	Q9Y2P5	OTTHUMG00000183543	ENST00000263093.2:c.499G>A	19.37:g.59022824C>T	ENSP00000263093:p.Ala167Thr	Somatic	0	58	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	41	14.58	B3KVP6|B4DPQ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AMP-dep_Synth/Lig	p.A167T	ENST00000263093.2	37	c.499	CCDS12983.1	19	.	.	.	.	.	.	.	.	.	.	c	9.132	1.011674	0.19277	.	.	ENSG00000083807	ENST00000263093	T	0.55760	0.5	3.78	-7.45	0.01374	AMP-dependent synthetase/ligase (1);	2.083320	0.02152	N	0.058079	T	0.36963	0.0986	L	0.35414	1.06	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24404	-1.0161	10	0.11794	T	0.64	0.9122	11.132	0.48351	0.0:0.2986:0.0:0.7014	.	167	Q9Y2P5	S27A5_HUMAN	T	167	ENSP00000263093:A167T	ENSP00000263093:A167T	A	-	1	0	SLC27A5	63714636	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.357000	0.02607	-1.482000	0.01860	-0.391000	0.06502	GCG	-	pfam_AMP-dep_Synth/Lig		0.701	SLC27A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A5	protein_coding	OTTHUMT00000467060.1	C	NM_012254	-		59022824	-1	no_errors	ENST00000263093	ensembl	human	known	74_37	missense	SNP	0.000	T
ANKRD19P	138649	genome.wustl.edu	37	9	95646683	95646683	+	RNA	SNP	T	T	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr9:95646683T>G	ENST00000446878.1	+	0	217				ANKRD19P_ENST00000473204.1_RNA																							GACAAAGCCCTGTCCTCCATG	0.542																																																	0								ENSG00000226668																																			RP11-526D8.7			0			-	Clone_based_vega_gene																													9.37:g.95646683T>G		Somatic	0	144	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	75	24.24		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000446878.1	37	NULL		9																																																																																			-	-		0.542	RP11-526D8.7-006	PUTATIVE	basic	processed_transcript	ENSG00000226668	pseudogene	OTTHUMT00000316907.1	T		-		95646683	+1	no_errors	ENST00000446878	ensembl	human	putative	74_37	rna	SNP	0.008	G
HDHD3	81932	genome.wustl.edu	37	9	116136322	116136322	+	Missense_Mutation	SNP	A	A	C			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr9:116136322A>C	ENST00000238379.5	-	2	1210	c.313T>G	c.(313-315)Ttc>Gtc	p.F105V	HDHD3_ENST00000374180.3_Missense_Mutation_p.F105V|HDHD3_ENST00000485934.1_5'UTR	NM_031219.2	NP_112496.1	Q9BSH5	HDHD3_HUMAN	haloacid dehalogenase-like hydrolase domain containing 3	105						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			large_intestine(2)|liver(1)	3						GGGTGGCTGAAGTCTTTATAA	0.607																																																	0								ENSG00000119431						77.0	86.0	83.0					9																	116136322		2203	4300	6503	HDHD3	SO:0001583	missense	0			-	HGNC	AK097067	CCDS6793.1	9q33.1	2006-04-12	2004-08-09	2004-08-12	ENSG00000119431	ENSG00000119431			28171	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 158"""	C9orf158		12477932	Standard	NM_031219		Approved	MGC12904	uc004bhi.1	Q9BSH5	OTTHUMG00000020524	ENST00000238379.5:c.313T>G	9.37:g.116136322A>C	ENSP00000238379:p.Phe105Val	Somatic	0	28	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	14	33.33	B2RD47	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HAD-like_dom,superfamily_HAD-like_dom,prints_HAD-SF_hydro_IA,tigrfam_HAD-SF_hydro_IA_REG-2-like,tigrfam_HAD-SF_hydro_IA	p.F105V	ENST00000238379.5	37	c.313	CCDS6793.1	9	.	.	.	.	.	.	.	.	.	.	A	23.2	4.393169	0.83011	.	.	ENSG00000119431	ENST00000238379;ENST00000374180	T;T	0.06142	3.34;3.34	5.76	5.76	0.90799	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);	0.207015	0.51477	D	0.000086	T	0.27313	0.0670	M	0.91972	3.26	0.80722	D	1	D	0.56521	0.976	P	0.55508	0.777	T	0.16837	-1.0389	10	0.72032	D	0.01	-5.48	15.2448	0.73499	1.0:0.0:0.0:0.0	.	105	Q9BSH5	HDHD3_HUMAN	V	105	ENSP00000238379:F105V;ENSP00000363295:F105V	ENSP00000238379:F105V	F	-	1	0	HDHD3	115176143	1.000000	0.71417	0.998000	0.56505	0.714000	0.41099	8.286000	0.89916	2.197000	0.70478	0.533000	0.62120	TTC	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IA_REG-2-like		0.607	HDHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDHD3	protein_coding	OTTHUMT00000053731.1	A	NM_031219	-		116136322	-1	no_errors	ENST00000238379	ensembl	human	known	74_37	missense	SNP	1.000	C
COPS2	9318	genome.wustl.edu	37	15	49431771	49431771	+	Missense_Mutation	SNP	T	T	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr15:49431771T>G	ENST00000388901.5	-	4	399	c.326A>C	c.(325-327)gAa>gCa	p.E109A	COPS2_ENST00000542928.1_Missense_Mutation_p.E45A|Y_RNA_ENST00000363250.1_RNA|COPS2_ENST00000299259.6_Missense_Mutation_p.E109A	NM_001143887.1|NM_004236.3	NP_001137359.1|NP_004227.1	P61201	CSN2_HUMAN	COP9 signalosome subunit 2	109					cell proliferation (GO:0008283)|cullin deneddylation (GO:0010388)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)	signal transducer activity (GO:0004871)|transcription corepressor activity (GO:0003714)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(1)|skin(2)	18		all_lung(180;0.0428)		all cancers(107;1.34e-07)|GBM - Glioblastoma multiforme(94;3.02e-05)		AATGGATTTTTCAGAATAATT	0.313																																					NSCLC(36;322 1063 10349 30082 48062)|Esophageal Squamous(122;685 1633 15569 21293 52803)												0								ENSG00000166200						63.0	68.0	66.0					15																	49431771		2196	4289	6485	COPS2	SO:0001583	missense	0			-	HGNC	AF212227	CCDS32235.1, CCDS45257.1	15q21.2	2013-03-14	2013-03-14						30747	protein-coding gene	gene with protein product		604508	"""COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis)"""			7776974, 9535219	Standard	NM_004236		Approved	TRIP15, ALIEN, CSN2	uc001zxh.3	P61201		ENST00000388901.5:c.326A>C	15.37:g.49431771T>G	ENSP00000373553:p.Glu109Ala	Somatic	0	53	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	22	15.38	O88950|Q15647|Q6FGP4|Q9BY54|Q9R249|Q9UNI2|Q9UNQ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.E109A	ENST00000388901.5	37	c.326	CCDS32235.1	15	.	.	.	.	.	.	.	.	.	.	T	28.1	4.889006	0.91814	.	.	ENSG00000166200	ENST00000299259;ENST00000388901;ENST00000542928	.	.	.	5.48	5.48	0.80851	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.84955	0.5587	H	0.94847	3.59	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.70016	0.967;0.967;0.967	D	0.85814	0.1381	9	0.16896	T	0.51	-14.8722	15.5924	0.76543	0.0:0.0:0.0:1.0	.	45;110;109	B4DIH5;Q59EL2;P61201	.;.;CSN2_HUMAN	A	109;109;45	.	ENSP00000299259:E109A	E	-	2	0	COPS2	47219063	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.084000	0.62774	0.533000	0.62120	GAA	-	NULL		0.313	COPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS2	protein_coding	OTTHUMT00000417840.1	T	NM_004236	-		49431771	-1	no_errors	ENST00000299259	ensembl	human	known	74_37	missense	SNP	1.000	G
FRMPD1	22844	genome.wustl.edu	37	9	37731073	37731090	+	In_Frame_Del	DEL	CGTGGCCTTTGAATACCT	CGTGGCCTTTGAATACCT	-	rs550566906		TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	CGTGGCCTTTGAATACCT	CGTGGCCTTTGAATACCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr9:37731073_37731090delCGTGGCCTTTGAATACCT	ENST00000539465.1	+	9	1424_1441	c.831_848delCGTGGCCTTTGAATACCT	c.(829-849)cccgtggcctttgaatacctc>ccc	p.VAFEYL278del	FRMPD1_ENST00000541302.1_In_Frame_Del_p.VAFEYL147del|FRMPD1_ENST00000377765.3_In_Frame_Del_p.VAFEYL278del|FRMPD1_ENST00000536622.1_In_Frame_Del_p.VAFEYL100del|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	278	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AAGAAGACCCCGTGGCCTTTGAATACCTCTATCTGCAG	0.509																																																	0								ENSG00000070601																																			FRMPD1	SO:0001651	inframe_deletion	0				HGNC	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.831_848delCGTGGCCTTTGAATACCT	9.37:g.37731073_37731090delCGTGGCCTTTGAATACCT	ENSP00000444411:p.Val278_Leu283del	Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_PDZ,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.VAFEYL278in_frame_del	ENST00000539465.1	37	c.831_848	CCDS6612.1	9																																																																																			-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain		0.509	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FRMPD1	protein_coding	OTTHUMT00000402969.1	CGTGGCCTTTGAATACCT	NM_014907			37731090	+1	no_errors	ENST00000377765	ensembl	human	known	74_37	in_frame_del	DEL	0.017:0.990:0.998:0.994:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.985:1.000:1.000:0.998:1.000:1.000	-
PLXNB1	5364	genome.wustl.edu	37	3	48461323	48461323	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr3:48461323G>A	ENST00000358536.4	-	11	2641	c.2372C>T	c.(2371-2373)cCg>cTg	p.P791L	PLXNB1_ENST00000456774.1_Intron|PLXNB1_ENST00000296440.6_Missense_Mutation_p.P791L|PLXNB1_ENST00000358459.4_Intron|PLXNB1_ENST00000448774.2_Intron	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	791	Pro-rich.				axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CGGTGACAGCGGGGAGGCCAA	0.667																																																	0								ENSG00000164050						15.0	19.0	17.0					3																	48461323		2202	4298	6500	PLXNB1	SO:0001583	missense	0			-	HGNC	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.2372C>T	3.37:g.48461323G>A	ENSP00000351338:p.Pro791Leu	Somatic	0	29	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.P791L	ENST00000358536.4	37	c.2372	CCDS2765.1	3	.	.	.	.	.	.	.	.	.	.	G	5.258	0.233016	0.09969	.	.	ENSG00000164050	ENST00000296440;ENST00000358536	T;T	0.03065	4.06;4.06	4.55	-6.07	0.02158	.	1.257560	0.05603	N	0.576682	T	0.01695	0.0054	N	0.08118	0	0.09310	N	1	B	0.14805	0.011	B	0.06405	0.002	T	0.49341	-0.8950	10	0.12430	T	0.62	.	6.0747	0.19909	0.2833:0.0:0.3547:0.362	.	791	O43157	PLXB1_HUMAN	L	791	ENSP00000296440:P791L;ENSP00000351338:P791L	ENSP00000296440:P791L	P	-	2	0	PLXNB1	48436327	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.115000	0.10741	-0.620000	0.05641	0.455000	0.32223	CCG	-	NULL		0.667	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	protein_coding	OTTHUMT00000344454.1	G	NM_002673	-		48461323	-1	no_errors	ENST00000296440	ensembl	human	known	74_37	missense	SNP	0.000	A
ACY1	95	genome.wustl.edu	37	3	52019141	52019141	+	Intron	SNP	T	T	C			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr3:52019141T>C	ENST00000404366.2	+	3	240				ACY1_ENST00000494103.1_Intron|ACY1_ENST00000476351.1_Intron|ACY1_ENST00000476854.1_Intron|ACY1_ENST00000458031.2_Intron|ACY1_ENST00000468068.1_3'UTR|ABHD14A-ACY1_ENST00000463937.1_Intron|ABHD14B_ENST00000483233.1_5'Flank	NM_000666.2|NM_001198895.1	NP_000657.1|NP_001185824.1	Q03154	ACY1_HUMAN	aminoacylase 1						cellular amino acid metabolic process (GO:0006520)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aminoacylase activity (GO:0004046)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Acetylcysteine(DB06151)|L-Aspartic Acid(DB00128)	CATTTCTGGGTATGCTCCACT	0.557																																																	0								ENSG00000243989																																			ACY1	SO:0001627	intron_variant	0			-	HGNC	L07548	CCDS2844.1, CCDS56261.1, CCDS56262.1, CCDS56263.1	3p21.2	2006-02-02			ENSG00000243989	ENSG00000243989	3.5.1.14		177	protein-coding gene	gene with protein product		104620				1707030, 6948533	Standard	NM_000666		Approved		uc003dcq.3	Q03154	OTTHUMG00000157815	ENST00000404366.2:c.95-82T>C	3.37:g.52019141T>C		Somatic	0	45	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32	C9J6I6|C9J9D8|C9JWD4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000404366.2	37	NULL	CCDS2844.1	3																																																																																			-	-		0.557	ACY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACY1	protein_coding	OTTHUMT00000349657.1	T	NM_000666	-		52019141	+1	no_errors	ENST00000468068	ensembl	human	known	74_37	rna	SNP	0.001	C
CCDC144A	9720	genome.wustl.edu	37	17	16706252	16706252	+	3'UTR	SNP	G	G	A	rs200099225	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:16706252G>A	ENST00000443444.2	+	0	7397				USP32P1_ENST00000393005.2_RNA|RP11-219A15.2_ENST00000582895.1_lincRNA|RP11-219A15.1_ENST00000448331.3_3'UTR|RP11-219A15.4_ENST00000602730.1_RNA			A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A																		CGGCATGGGCGAGGATTTTTC	0.353													-|||	891	0.177915	0.0257	0.2161	5008	,	,		20868	0.2877		0.2187	False		,,,				2504	0.2014																0								ENSG00000188933																																			USP32P1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000443444.2:c.*2973G>A	17.37:g.16706252G>A		Somatic	0	57	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	O60311|Q6ZU57	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443444.2	37	NULL	CCDS45621.1	17																																																																																			-	-		0.353	CCDC144A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP32P1	protein_coding		G		rs200099225		16706252	+1	no_errors	ENST00000341745	ensembl	human	known	74_37	rna	SNP	0.005	A
HTR3C	170572	genome.wustl.edu	37	3	183776224	183776224	+	Missense_Mutation	SNP	T	T	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr3:183776224T>G	ENST00000318351.1	+	6	603	c.569T>G	c.(568-570)aTg>aGg	p.M190R		NM_130770.2	NP_570126.2	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine (serotonin) receptor 3C, ionotropic	190					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(2)	32	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	GTGGACAGCATGCTGCTGGGC	0.577																																																	0								ENSG00000178084						77.0	65.0	69.0					3																	183776224		2203	4300	6503	HTR3C	SO:0001583	missense	0			-	HGNC	AF459285	CCDS3250.1	3q27	2012-05-22	2012-02-03		ENSG00000178084	ENSG00000178084		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24003	protein-coding gene	gene with protein product		610121	"""5-hydroxytryptamine (serotonin) receptor 3, family member C"""			12801637, 15157181	Standard	NM_130770		Approved		uc003fmk.3	Q8WXA8	OTTHUMG00000156862	ENST00000318351.1:c.569T>G	3.37:g.183776224T>G	ENSP00000322617:p.Met190Arg	Somatic	0	43	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	25	37.50	A2RRR5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Neur_channel	p.M190R	ENST00000318351.1	37	c.569	CCDS3250.1	3	.	.	.	.	.	.	.	.	.	.	.	8.383	0.837977	0.16891	.	.	ENSG00000178084	ENST00000318351	T	0.79352	-1.26	5.26	2.87	0.33458	Neurotransmitter-gated ion-channel ligand-binding (3);	0.427798	0.27388	N	0.019584	T	0.64316	0.2587	L	0.35487	1.065	0.09310	N	1	B	0.17038	0.02	B	0.19391	0.025	T	0.57458	-0.7808	10	0.87932	D	0	-20.0346	5.2989	0.15768	0.0:0.0899:0.1788:0.7312	.	190	Q8WXA8	5HT3C_HUMAN	R	190	ENSP00000322617:M190R	ENSP00000322617:M190R	M	+	2	0	HTR3C	185258918	0.023000	0.18921	0.016000	0.15963	0.397000	0.30659	1.004000	0.29822	0.455000	0.26910	0.533000	0.62120	ATG	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd		0.577	HTR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3C	protein_coding	OTTHUMT00000346296.1	T	NM_130770	-		183776224	+1	no_errors	ENST00000318351	ensembl	human	known	74_37	missense	SNP	0.037	G
RPS23	6228	genome.wustl.edu	37	5	81571946	81571946	+	Missense_Mutation	SNP	C	C	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr5:81571946C>G	ENST00000296674.8	-	4	667	c.414G>C	c.(412-414)aaG>aaC	p.K138N	RPS23_ENST00000510210.1_Intron|RPS23_ENST00000512493.1_Intron|RPS23_ENST00000507980.1_3'UTR|RPS23_ENST00000503605.1_5'Flank|ATG10_ENST00000514253.2_Intron|RPS23_ENST00000510019.1_Missense_Mutation_p.K80N	NM_001025.4	NP_001016.1	P62266	RS23_HUMAN	ribosomal protein S23	138					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			prostate(1)	1		Lung NSC(167;0.0025)|all_lung(232;0.00278)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;1.94e-42)|Epithelial(54;8.38e-37)|all cancers(79;1.42e-31)		TTGGTCTTTCCTTCTTGCCTT	0.383																																																	0								ENSG00000186468						85.0	81.0	82.0					5																	81571946		1836	4082	5918	RPS23	SO:0001583	missense	0			-	HGNC	AB007158	CCDS47241.1	5q14.2	2013-05-09			ENSG00000186468	ENSG00000186468		"""S ribosomal proteins"""	10410	protein-coding gene	gene with protein product		603683				9582194	Standard	NM_001025		Approved	S23	uc003khu.3	P62266	OTTHUMG00000162557	ENST00000296674.8:c.414G>C	5.37:g.81571946C>G	ENSP00000296674:p.Lys138Asn	Somatic	0	31	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64	P39028|Q6IB08	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_S12/S23,superfamily_NA-bd_OB-fold,pirsf_Ribosomal_S12/S23,tigrfam_Ribosomal_S23_euk/arc	p.K138N	ENST00000296674.8	37	c.414	CCDS47241.1	5	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729931	0.48833	.	.	ENSG00000186468	ENST00000296674;ENST00000510019	.	.	.	5.26	1.38	0.22167	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	0.096296	0.64402	D	0.000001	T	0.77772	0.4180	H	0.95850	3.73	0.80722	D	1	B	0.29886	0.26	B	0.38056	0.264	T	0.77905	-0.2413	9	0.87932	D	0	.	10.6791	0.45804	0.0:0.6601:0.0:0.3399	.	138	P62266	RS23_HUMAN	N	138;80	.	ENSP00000296674:K138N	K	-	3	2	RPS23	81607702	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	2.596000	0.46205	0.220000	0.20860	-0.291000	0.09656	AAG	-	pfam_Ribosomal_S12/S23,superfamily_NA-bd_OB-fold,pirsf_Ribosomal_S12/S23,tigrfam_Ribosomal_S23_euk/arc		0.383	RPS23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS23	protein_coding	OTTHUMT00000369546.2	C	NM_001025	-		81571946	-1	no_errors	ENST00000296674	ensembl	human	known	74_37	missense	SNP	1.000	G
FAT2	2196	genome.wustl.edu	37	5	150922247	150922247	+	Missense_Mutation	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr5:150922247G>A	ENST00000261800.5	-	9	8453	c.8441C>T	c.(8440-8442)aCc>aTc	p.T2814I		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2814	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AATGACTGAGGTCCCCACTGG	0.512																																																	0								ENSG00000086570						119.0	109.0	113.0					5																	150922247		2203	4300	6503	FAT2	SO:0001583	missense	0			-	HGNC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.8441C>T	5.37:g.150922247G>A	ENSP00000261800:p.Thr2814Ile	Somatic	0	38	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	17	34.62	O75091|Q9NSR7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.T2814I	ENST00000261800.5	37	c.8441	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714020	0.48622	.	.	ENSG00000086570	ENST00000261800	T	0.58210	0.35	5.79	4.92	0.64577	Cadherin (3);Cadherin-like (1);	0.000000	0.64402	D	0.000004	T	0.79185	0.4403	M	0.93808	3.46	0.49687	D	0.999817	D	0.89917	1.0	D	0.97110	1.0	D	0.84932	0.0860	10	0.72032	D	0.01	.	14.591	0.68365	0.0699:0.0:0.9301:0.0	.	2814	Q9NYQ8	FAT2_HUMAN	I	2814	ENSP00000261800:T2814I	ENSP00000261800:T2814I	T	-	2	0	FAT2	150902440	1.000000	0.71417	0.120000	0.21714	0.948000	0.59901	5.646000	0.67916	1.451000	0.47736	0.462000	0.41574	ACC	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.512	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	G	NM_001447	-		150922247	-1	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	SNP	0.976	A
LINC01317	104355287	genome.wustl.edu	37	2	33951639	33951640	+	lincRNA	INS	-	-	GCTAGG	rs3217586|rs70940218	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr2:33951639_33951640insGCTAGG	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							ACTAAGGCACAGCTAGGGCGGG	0.619														1982	0.395767	0.3185	0.4856	5008	,	,		14411	0.3948		0.4245	False		,,,				2504	0.408																0								ENSG00000239649																																			MYADML			0				HGNC																													2.37:g.33951640_33951645dupGCTAGG		Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			-	-		0.619	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	lincRNA	OTTHUMT00000325406.1	-				33951640	-1	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	INS	0.441:0.327	GCTAGG
CLEC18C	283971	genome.wustl.edu	37	16	70211379	70211379	+	Missense_Mutation	SNP	C	C	T	rs150702800	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr16:70211379C>T	ENST00000569347.2	+	3	706	c.452C>T	c.(451-453)aCg>aTg	p.T151M	CLEC18C_ENST00000536907.2_Missense_Mutation_p.T151M|CLEC18C_ENST00000541793.2_Missense_Mutation_p.T151M|CLEC18C_ENST00000561612.1_Intron|CLEC18C_ENST00000314151.8_Missense_Mutation_p.T151M	NM_173619.2	NP_775890.2	Q8NCF0	CL18C_HUMAN	C-type lectin domain family 18, member C	151	SCP.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|large_intestine(6)|lung(1)	10						ACCCACTACACGCAGGTGAGT	0.582													c|||	20	0.00399361	0.0	0.0072	5008	,	,		17630	0.0		0.0139	False		,,,				2504	0.001																0								ENSG00000157335						12.0	11.0	11.0					16																	70211379		2080	4022	6102	CLEC18C	SO:0001583	missense	0			-	HGNC	AL833339	CCDS32473.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157335		"""C-type lectin domain containing"""	28538	protein-coding gene	gene with protein product						12477932	Standard	XM_005255906		Approved	MGC34761		Q8NCF0		ENST00000569347.2:c.452C>T	16.37:g.70211379C>T	ENSP00000455920:p.Thr151Met	Somatic	0	44	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	Q8IUW8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_CAP_domain,superfamily_CAP_domain,superfamily_C-type_lectin_fold,smart_Allrgn_V5/Tpx1,smart_EG-like_dom,smart_C-type_lectin,prints_Allrgn_V5/Tpx1,pfscan_EG-like_dom,pfscan_C-type_lectin	p.T151M	ENST00000569347.2	37	c.452	CCDS32473.1	16	.	.	.	.	.	.	.	.	.	.	c	15.27	2.783528	0.49891	.	.	ENSG00000157335	ENST00000541793;ENST00000314151;ENST00000433156;ENST00000539438;ENST00000536907	T;T;T	0.16073	2.37;2.37;2.37	4.32	4.32	0.51571	CAP domain (3);	0.000000	0.85682	D	0.000000	T	0.49389	0.1554	H	0.96080	3.765	0.49687	D	0.999819	D	0.71674	0.998	P	0.59643	0.861	T	0.65738	-0.6095	10	0.66056	D	0.02	.	12.6961	0.57005	0.0:1.0:0.0:0.0	.	151	Q8NCF0	CL18C_HUMAN	M	151;151;151;147;151	ENSP00000444875:T151M;ENSP00000326538:T151M;ENSP00000444726:T151M	ENSP00000326538:T151M	T	+	2	0	CLEC18C	68768880	0.998000	0.40836	0.993000	0.49108	0.104000	0.19210	4.129000	0.57957	2.125000	0.65367	0.298000	0.19748	ACG	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1		0.582	CLEC18C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLEC18C	protein_coding	OTTHUMT00000434588.2	C	NM_173619	rs150702800		70211379	+1	no_errors	ENST00000314151	ensembl	human	known	74_37	missense	SNP	0.997	T
KANK3	256949	genome.wustl.edu	37	19	8388400	8388401	+	Frame_Shift_Ins	INS	-	-	GATT			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr19:8388400_8388401insGATT	ENST00000593649.1	-	11	2469_2470	c.2404_2405insAATC	c.(2404-2406)ctcfs	p.L802fs	KANK3_ENST00000330915.3_Intron|NDUFA7_ENST00000598884.1_5'Flank|NDUFA7_ENST00000301457.2_5'Flank			Q6NY19	KANK3_HUMAN	KN motif and ankyrin repeat domains 3	802										breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	9						cagtgaactgagattgtgccgc	0.525																																																	0								ENSG00000186994																																			KANK3	SO:0001589	frameshift_variant	0				HGNC	AK128815	CCDS12199.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000186994		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	24796	protein-coding gene	gene with protein product		614611	"""ankyrin repeat domain 47"""	ANKRD47		17996375, 19554261	Standard	NM_198471		Approved	FLJ46061	uc010dwa.3	Q6NY19		ENST00000593649.1:c.2401_2404dupAATC	19.37:g.8388401_8388404dupGATT	ENSP00000470728:p.Leu802fs	Somatic	0	19	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	4	63.64	Q6NZI1|Q6ZQR3|Q8IUV2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L802fs	ENST00000593649.1	37	c.2405_2404		19																																																																																			-	NULL		0.525	KANK3-002	KNOWN	basic	protein_coding	KANK3	protein_coding	OTTHUMT00000461379.1	-	NM_198471			8388401	-1	no_errors	ENST00000593649	ensembl	human	known	74_37	frame_shift_ins	INS	0.049:0.050	GATT
RP11-566K19.3	0	genome.wustl.edu	37	15	22752707	22752715	+	RNA	DEL	CTCTCCTCC	CTCTCCTCC	-	rs147037053	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	CTCTCCTCC	CTCTCCTCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr15:22752707_22752715delCTCTCCTCC	ENST00000560026.1	-	0	360_368																											AAAGCGTAGGCTCTCCTCCAGGAGGCTCT	0.44														392	0.0782748	0.1135	0.0663	5008	,	,		16614	0.0437		0.0537	False		,,,				2504	0.1002																0								ENSG00000259596																																			RP11-566K19.3			0				Clone_based_vega_gene																													15.37:g.22752707_22752715delCTCTCCTCC		Somatic	NA	NA	NA		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560026.1	37	NULL		15																																																																																			-	-		0.440	RP11-566K19.3-001	KNOWN	non_canonical_polymorphism|basic|readthrough_transcript	processed_transcript	ENSG00000259596	processed_transcript	OTTHUMT00000415617.1	CTCTCCTCC				22752715	-1	no_errors	ENST00000560026	ensembl	human	known	74_37	rna	DEL	0.054:0.077:0.097:0.114:0.128:0.140:0.150:0.157:0.163	-
ALK	238	genome.wustl.edu	37	2	30143133	30143133	+	Silent	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr2:30143133G>A	ENST00000389048.3	-	1	1299	c.393C>T	c.(391-393)tcC>tcT	p.S131S	ALK_ENST00000431873.1_Silent_p.S131S	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	131					activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S131S(1)	ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GCTTGCGCACGGAGCCGCCCT	0.741			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	1	Substitution - coding silent(1)	lung(1)						ENSG00000171094						6.0	9.0	8.0					2																	30143133		2154	4236	6390	ALK	SO:0001819	synonymous_variant	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	-	HGNC	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.393C>T	2.37:g.30143133G>A		Somatic	0	29	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	13	50.00	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S131	ENST00000389048.3	37	c.393	CCDS33172.1	2																																																																																			-	NULL		0.741	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	protein_coding	OTTHUMT00000324994.1	G	NM_004304	-		30143133	-1	no_errors	ENST00000389048	ensembl	human	known	74_37	silent	SNP	0.851	A
SPRY3	10251	genome.wustl.edu	37	X	155004280	155004280	+	Silent	SNP	A	A	G			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chrX:155004280A>G	ENST00000302805.2	+	2	1178	c.747A>G	c.(745-747)caA>caG	p.Q249Q		NM_005840.1	NP_005831.1	O43610	SPY3_HUMAN	sprouty homolog 3 (Drosophila)	249	Cys-rich.|SPR. {ECO:0000255|PROSITE- ProRule:PRU00572}.				multicellular organismal development (GO:0007275)|regulation of signal transduction (GO:0009966)	cytoplasm (GO:0005737)|membrane (GO:0016020)						all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ATCTGTGCCAACAGGGCTATG	0.592													A|||	970	0.19369	0.2489	0.1744	5008	,	,		20237	0.0179		0.2992	False		,,,				2504	0.2055																0								ENSG00000168939	A		1040,3366		132,776,1295	207.0	192.0	197.0		747	2.0	1.0	X	dbSNP_134	197	2390,6202		328,1734,2234	no	coding-synonymous	SPRY3	NM_005840.1		460,2510,3529	GG,GA,AA		27.8166,23.6042,26.3887		249/289	155004280	3430,9568	2203	4296	6499	SPRY3	SO:0001819	synonymous_variant	0			-	HGNC	AF041038	CCDS14769.4	Xq28 and Yq12	2008-02-05	2001-11-28		ENSG00000168939	ENSG00000168939		"""Pseudoautosomal regions / PAR2"""	11271	protein-coding gene	gene with protein product	"""antagonist of FGF signaling"""	300531	"""sprouty (Drosophila) homolog 2"""			9458049	Standard	NM_005840		Approved	HSPRY3	uc004fnq.1	O43610	OTTHUMG00000022675	ENST00000302805.2:c.747A>G	X.37:g.155004280A>G		Somatic	0	119	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	A8K0H8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sprouty	p.Q249	ENST00000302805.2	37	c.747	CCDS14769.4	X																																																																																			-	pfam_Sprouty		0.592	SPRY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRY3	protein_coding	OTTHUMT00000058823.2	A	NM_005840	-		155004280	+1	no_errors	ENST00000302805	ensembl	human	known	74_37	silent	SNP	1.000	G
ANKRD40	91369	genome.wustl.edu	37	17	48773462	48773462	+	Silent	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr17:48773462G>A	ENST00000285243.6	-	5	1272	c.1003C>T	c.(1003-1005)Ctg>Ttg	p.L335L	RP11-294J22.6_ENST00000574246.1_RNA|Y_RNA_ENST00000364470.1_RNA	NM_052855.3	NP_443087.1	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	335										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)|urinary_tract(1)	11			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			ATCAGAACCAGTTCCAGCTCC	0.393																																																	0								ENSG00000154945						112.0	107.0	109.0					17																	48773462		2203	4300	6503	ANKRD40	SO:0001819	synonymous_variant	0			-	HGNC	BC012978	CCDS11572.1	17q21.33	2013-01-10			ENSG00000154945	ENSG00000154945		"""Ankyrin repeat domain containing"""	28233	protein-coding gene	gene with protein product						12477932	Standard	NM_052855		Approved	MGC15396	uc002iso.3	Q6AI12	OTTHUMG00000162255	ENST00000285243.6:c.1003C>T	17.37:g.48773462G>A		Somatic	0	68	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	56	23.29	Q96E32	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L335	ENST00000285243.6	37	c.1003	CCDS11572.1	17																																																																																			-	NULL		0.393	ANKRD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD40	protein_coding	OTTHUMT00000368201.2	G	NM_052855	-		48773462	-1	no_errors	ENST00000285243	ensembl	human	known	74_37	silent	SNP	1.000	A
POT1	25913	genome.wustl.edu	37	7	124503553	124503553	+	Missense_Mutation	SNP	C	C	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr7:124503553C>T	ENST00000357628.3	-	8	995	c.397G>A	c.(397-399)Gta>Ata	p.V133I	POT1_ENST00000393329.1_Missense_Mutation_p.V2I	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	133					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						AAGGCTTCTACCATTTTGTGG	0.428																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)												0								ENSG00000128513						164.0	148.0	154.0					7																	124503553		2203	4299	6502	POT1	SO:0001583	missense	0			-	HGNC	AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.397G>A	7.37:g.124503553C>T	ENSP00000350249:p.Val133Ile	Somatic	0	51	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	32	37.25	O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Telomer_end-bd_POT1/Cdc13,superfamily_NA-bd_OB-fold,smart_Telomer_end-bd_POT1/Cdc13	p.V133I	ENST00000357628.3	37	c.397	CCDS5793.1	7	.	.	.	.	.	.	.	.	.	.	C	24.5	4.538282	0.85917	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000440969;ENST00000393326;ENST00000265391	T;T	0.58940	0.35;0.3	5.44	4.56	0.56223	Nucleic acid-binding, OB-fold-like (1);Telomere end binding protein (2);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.70954	0.3283	M	0.61703	1.905	0.44181	D	0.996996	D	0.71674	0.998	D	0.79784	0.993	T	0.68819	-0.5308	10	0.35671	T	0.21	-6.7615	13.7146	0.62689	0.0:0.9244:0.0:0.0756	.	133	Q9NUX5	POTE1_HUMAN	I	133;2;133;133;133;132	ENSP00000350249:V133I;ENSP00000377002:V2I	ENSP00000265391:V132I	V	-	1	0	POT1	124290789	0.955000	0.32602	1.000000	0.80357	0.960000	0.62799	1.049000	0.30392	2.543000	0.85770	0.650000	0.86243	GTA	-	pfam_Telomer_end-bd_POT1/Cdc13,superfamily_NA-bd_OB-fold,smart_Telomer_end-bd_POT1/Cdc13		0.428	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POT1	protein_coding	OTTHUMT00000347861.1	C		-		124503553	-1	no_errors	ENST00000357628	ensembl	human	known	74_37	missense	SNP	1.000	T
SNHG11	128439	genome.wustl.edu	37	20	37075523	37075523	+	RNA	SNP	G	G	T			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr20:37075523G>T	ENST00000365032.1	+	0	0				SNORA60_ENST00000362396.1_RNA					small nucleolar RNA host gene 11 (non-protein coding)																		CCCGACAAAAGGGGAAACTGA	0.687																																																	0								ENSG00000174365																																			SNHG11			0			-	HGNC	AF497716		20q11.23	2012-10-16	2008-09-05	2008-04-16	ENSG00000174365	ENSG00000174365		"""Long non-coding RNAs"""	25046	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 101"""		"""chromosome 20 open reading frame 198"""	C20orf198		12477932	Standard	NR_003239		Approved	LINC00101	uc002xis.1		OTTHUMG00000032449		20.37:g.37075523G>T		Somatic	0	75	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	45	43.04		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000365032.1	37	NULL		20																																																																																			-	-		0.687	SNHG11-201	KNOWN	basic	snoRNA	SNHG11	processed_transcript		G	NR_003239	-		37075523	+1	no_errors	ENST00000359074	ensembl	human	known	74_37	rna	SNP	0.149	T
ACSF3	197322	genome.wustl.edu	37	16	89181109	89181109	+	Intron	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr16:89181109G>A	ENST00000317447.4	+	6	1503				ACSF3_ENST00000378345.4_Intron|ACSF3_ENST00000406948.3_Intron|CTD-2555A7.3_ENST00000562782.1_RNA	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3						fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		TCGGGTGGATGGGGGAGGTGT	0.607																																																	0								ENSG00000261546																																			CTD-2555A7.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.1126+214G>A	16.37:g.89181109G>A		Somatic	0	10	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	3	78.57	A8K4J8|C9JQL6|Q6INA0|Q8N2F7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000317447.4	37	NULL	CCDS10974.1	16																																																																																			-	-		0.607	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261546	protein_coding	OTTHUMT00000269919.1	G	NM_174917	-		89181109	-1	no_errors	ENST00000562782	ensembl	human	known	74_37	rna	SNP	0.000	A
TRIO	7204	genome.wustl.edu	37	5	14405992	14405992	+	Silent	SNP	G	G	A			TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr5:14405992G>A	ENST00000344204.4	+	32	4776	c.4752G>A	c.(4750-4752)aaG>aaA	p.K1584K	TRIO_ENST00000537187.1_Silent_p.K1584K	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1584	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					ACTGGATAAAGCATATCCGCG	0.542																																																	0								ENSG00000038382						61.0	54.0	57.0					5																	14405992		2203	4300	6503	TRIO	SO:0001819	synonymous_variant	0			-	HGNC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.4752G>A	5.37:g.14405992G>A		Somatic	0	27	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.K1584	ENST00000344204.4	37	c.4752	CCDS3883.1	5																																																																																			-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.542	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	protein_coding	OTTHUMT00000253711.2	G	NM_007118	-		14405992	+1	no_errors	ENST00000344204	ensembl	human	known	74_37	silent	SNP	1.000	A
RMDN2	151393	genome.wustl.edu	37	2	38179415	38179416	+	Intron	DEL	TG	TG	-	rs373421848|rs59393160|rs72332368	byFrequency	TCGA-HS-A5N8-01A-11D-A26G-09	TCGA-HS-A5N8-10A-01D-A26G-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	acb9a894-a6b5-455d-9398-9b571e32f7f9	83917cee-8439-465e-a985-a291e4d88f3e	g.chr2:38179415_38179416delTG	ENST00000406384.1	+	3	646				RMDN2_ENST00000234195.3_Intron|RMDN2_ENST00000402091.3_Frame_Shift_Del_p.C353fs|RMDN2_ENST00000407257.1_Intron|RMDN2_ENST00000417700.2_Intron|RMDN2_ENST00000354545.2_Intron|RMDN2-AS1_ENST00000414365.2_RNA	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											TTTCATAGCCTGTAGAATTCAT	0.376														1639	0.327276	0.2322	0.3804	5008	,	,		19825	0.0764		0.4533	False		,,,				2504	0.547																0								ENSG00000115841																																			RMDN2	SO:0001627	intron_variant	0				HGNC	AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.453-21767TG>-	2.37:g.38179415_38179416delTG		Somatic	0	44	0.00		0.7930090419608695	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.C353fs	ENST00000406384.1	37	c.1057_1058	CCDS54351.1	2																																																																																			-	NULL		0.376	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMDN2	protein_coding	OTTHUMT00000325577.1	TG	NM_144713			38179416	+1	no_errors	ENST00000402091	ensembl	human	putative	74_37	frame_shift_del	DEL	0.025:0.016	-
