#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
FER	2241	genome.wustl.edu	37	5	108281858	108281858	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr5:108281858G>T	ENST00000281092.4	+	11	1648	c.1264G>T	c.(1264-1266)Gaa>Taa	p.E422*	FER_ENST00000438717.2_Nonsense_Mutation_p.E247*|FER_ENST00000536402.1_Missense_Mutation_p.L317F	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	422					actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		ATCCAAATTTGAATCTATTCG	0.373																																					Colon(146;1051 1799 9836 27344 47401)												0								ENSG00000151422						125.0	131.0	129.0					5																	108281858		2202	4300	6502	FER	SO:0001587	stop_gained	0			-	HGNC	J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.1264G>T	5.37:g.108281858G>T	ENSP00000281092:p.Glu422*	Somatic	0	54	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	B2RCR4|B4DSQ2|H2FLB8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_FCH_dom,superfamily_Kinase-like_dom,smart_FCH_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,pfscan_FCH_dom,pfscan_SH2,pfscan_Prot_kinase_dom	p.E422*	ENST00000281092.4	37	c.1264	CCDS4098.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.644068|8.644068	0.98897|0.98897	.|.	.|.	ENSG00000151422|ENSG00000151422	ENST00000281092;ENST00000438717|ENST00000536402	.|T	.|0.26957	.|1.7	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	0.042749|.	0.85682|.	D|.	0.000000|.	.|T	.|0.51415	.|0.1673	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.51474	.|-0.8701	.|5	0.40728|0.62326	T|D	0.16|0.03	-20.9934|-20.9934	19.6346|19.6346	0.95724|0.95724	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|F	422;247|317	.|ENSP00000442627:L317F	ENSP00000281092:E422X|ENSP00000442627:L317F	E|L	+|+	1|3	0|2	FER|FER	108309757|108309757	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.980000|0.980000	0.70556|0.70556	8.726000|8.726000	0.91474|0.91474	2.720000|2.720000	0.93068|0.93068	0.491000|0.491000	0.48974|0.48974	GAA|TTG	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr		0.373	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER	protein_coding	OTTHUMT00000250664.1	G	NM_005246	-		108281858	+1	no_errors	ENST00000281092	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RP11-423O2.5	0	genome.wustl.edu	37	1	142803281	142803281	+	lincRNA	SNP	C	C	A	rs76943323	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr1:142803281C>A	ENST00000423385.1	-	0	1684																											ACCAAaacaacaacaacaaca	0.358																																																	0								ENSG00000234978																																			RP11-423O2.5			0			-	Clone_based_vega_gene																													1.37:g.142803281C>A		Somatic	1	128	0.78		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	111	8.26		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			-	-		0.358	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	lincRNA	OTTHUMT00000193203.1	C		rs76943323		142803281	-1	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	SNP	0.003	A
EPN2	22905	genome.wustl.edu	37	17	19189049	19189049	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr17:19189049C>T	ENST00000314728.5	+	4	1196	c.712C>T	c.(712-714)Cgc>Tgc	p.R238C	EPN2_ENST00000395626.1_Missense_Mutation_p.R238C|EPN2_ENST00000395620.2_Intron|EPN2_ENST00000347697.2_Intron|EPN2_ENST00000395618.3_Intron|EPN2_ENST00000575595.1_Intron|EPN2_ENST00000571254.1_Intron	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	238					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					gctggcctcccgcccaaatgg	0.677																																																	0								ENSG00000072134						14.0	15.0	14.0					17																	19189049		2197	4284	6481	EPN2	SO:0001583	missense	0			-	HGNC	AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.712C>T	17.37:g.19189049C>T	ENSP00000320543:p.Arg238Cys	Somatic	0	42	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	62	24.39	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Epsin_dom_N,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.R238C	ENST00000314728.5	37	c.712	CCDS11203.1	17	.	.	.	.	.	.	.	.	.	.	C	13.53	2.266022	0.40095	.	.	ENSG00000072134	ENST00000314728;ENST00000395626	T;T	0.33654	2.41;1.4	5.22	3.17	0.36434	.	0.940458	0.08999	N	0.863343	T	0.20007	0.0481	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.07790	-1.0754	10	0.48119	T	0.1	-2.5782	7.5628	0.27862	0.0:0.7969:0.0:0.2031	.	238;238	E9PBC1;O95208	.;EPN2_HUMAN	C	238	ENSP00000320543:R238C;ENSP00000378988:R238C	ENSP00000320543:R238C	R	+	1	0	EPN2	19129642	0.976000	0.34144	1.000000	0.80357	0.996000	0.88848	0.123000	0.15708	1.398000	0.46701	0.655000	0.94253	CGC	-	NULL		0.677	EPN2-001	KNOWN	basic|CCDS	protein_coding	EPN2	protein_coding	OTTHUMT00000132283.3	C	NM_014964	-		19189049	+1	no_errors	ENST00000314728	ensembl	human	known	74_37	missense	SNP	0.999	T
DRD1	1812	genome.wustl.edu	37	5	174869993	174869993	+	Missense_Mutation	SNP	G	G	A	rs5327	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr5:174869993G>A	ENST00000393752.2	-	2	1102	c.110C>T	c.(109-111)aCg>aTg	p.T37M		NM_000794.3	NP_000785.1	P21728	DRD1_HUMAN	dopamine receptor D1	37			T -> P (in dbSNP:rs5327).|T -> R (in dbSNP:rs5328).		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult walking behavior (GO:0007628)|astrocyte development (GO:0014002)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|cellular response to catecholamine stimulus (GO:0071870)|cerebral cortex GABAergic interneuron migration (GO:0021853)|conditioned taste aversion (GO:0001661)|dentate gyrus development (GO:0021542)|dopamine metabolic process (GO:0042417)|dopamine transport (GO:0015872)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose import (GO:0046323)|grooming behavior (GO:0007625)|habituation (GO:0046959)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|maternal behavior (GO:0042711)|mating behavior (GO:0007617)|memory (GO:0007613)|neuronal action potential (GO:0019228)|operant conditioning (GO:0035106)|peristalsis (GO:0030432)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell migration (GO:0030335)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|prepulse inhibition (GO:0060134)|protein import into nucleus (GO:0006606)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|sensitization (GO:0046960)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|transmission of nerve impulse (GO:0019226)|vasodilation (GO:0042311)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(89;0.00895)|Renal(175;0.000159)|Lung NSC(126;0.00625)|all_lung(126;0.0104)	Medulloblastoma(196;0.0208)|all_neural(177;0.0277)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)		Acepromazine(DB01614)|Acetophenazine(DB01063)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Dopamine(DB00988)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Methylergometrine(DB00353)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Phenylpropanolamine(DB00397)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CCCCAGGAGCGTGGACAGGAT	0.572																																																	0			GRCh37	CM086309	DRD1	M	rs5328	ENSG00000184845						102.0	94.0	97.0					5																	174869993		2203	4300	6503	DRD1	SO:0001583	missense	0			-	HGNC	X55760	CCDS4393.1	5q34-q35	2012-08-08			ENSG00000184845	ENSG00000184845		"""GPCR / Class A : Dopamine receptors"""	3020	protein-coding gene	gene with protein product		126449					Standard	NM_000794		Approved		uc003mcz.3	P21728	OTTHUMG00000130557	ENST00000393752.2:c.110C>T	5.37:g.174869993G>A	ENSP00000377353:p.Thr37Met	Somatic	0	36	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	0	100.00	B2RA44|Q4QRJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Dopamine_D1_rcpt,prints_GPCR_Rhodpsn,prints_Dopamine_rcpt,prints_ADR_fam	p.T37M	ENST00000393752.2	37	c.110	CCDS4393.1	5	.	.	.	.	.	.	.	.	.	.	G	22.6	4.309924	0.81247	.	.	ENSG00000184845	ENST00000393752;ENST00000329144	T	0.40756	1.02	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.69895	0.3162	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74414	-0.3673	10	0.72032	D	0.01	.	18.5126	0.90923	0.0:0.0:1.0:0.0	.	37	P21728	DRD1_HUMAN	M	37	ENSP00000377353:T37M	ENSP00000327652:T37M	T	-	2	0	DRD1	174802599	1.000000	0.71417	0.969000	0.41365	0.994000	0.84299	9.675000	0.98638	2.679000	0.91253	0.650000	0.86243	ACG	-	pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_GPCR_Rhodpsn		0.572	DRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD1	protein_coding	OTTHUMT00000252982.2	G	NM_000794	-		174869993	-1	no_errors	ENST00000393752	ensembl	human	known	74_37	missense	SNP	1.000	A
TENM1	10178	genome.wustl.edu	37	X	124097514	124097514	+	Missense_Mutation	SNP	C	C	G			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:124097514C>G	ENST00000371130.3	-	1	152	c.89G>C	c.(88-90)aGt>aCt	p.S30T	TENM1_ENST00000422452.2_Missense_Mutation_p.S30T	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	30	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCCATCTTCACTCTCATCAGA	0.448																																																	0								ENSG00000009694						308.0	273.0	285.0					X																	124097514		2203	4300	6503	TENM1	SO:0001583	missense	0			-	HGNC	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.89G>C	X.37:g.124097514C>G	ENSP00000360171:p.Ser30Thr	Somatic	0	56	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	36	45.45	B2RTR5|Q5JZ17	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.S30T	ENST00000371130.3	37	c.89	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	20.4	3.975983	0.74360	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.40225	1.04;1.04	5.78	5.78	0.91487	Teneurin intracellular, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.61527	0.2354	L	0.50333	1.59	0.54753	D	0.999983	D;D;P	0.57257	0.979;0.979;0.625	D;D;B	0.74023	0.982;0.982;0.402	T	0.62895	-0.6757	10	0.87932	D	0	.	18.9267	0.92548	0.0:1.0:0.0:0.0	.	30;30;30	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	T	30	ENSP00000360171:S30T;ENSP00000403954:S30T	ENSP00000360171:S30T	S	-	2	0	ODZ1	123925195	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.221000	0.78016	2.417000	0.82017	0.600000	0.82982	AGT	-	pfam_Ten_N		0.448	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	protein_coding	OTTHUMT00000058985.1	C	NM_014253	-		124097514	-1	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	SNP	1.000	G
MICU2	221154	genome.wustl.edu	37	13	22067469	22067469	+	Silent	SNP	T	T	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr13:22067469T>C	ENST00000382374.4	-	12	1289	c.1224A>G	c.(1222-1224)caA>caG	p.Q408Q	MICU2_ENST00000479790.1_5'UTR	NM_152726.2	NP_689939.1	Q8IYU8	MICU2_HUMAN	mitochondrial calcium uptake 2	408					mitochondrial calcium ion transport (GO:0006851)|negative regulation of mitochondrial calcium ion concentration (GO:0051562)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	calcium channel complex (GO:0034704)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TCCAGTATTCTTGTATACTCT	0.323																																																	0								ENSG00000165487						161.0	153.0	156.0					13																	22067469		2202	4297	6499	MICU2	SO:0001819	synonymous_variant	0			-	HGNC	AK091907	CCDS9297.1	13q12.11	2013-03-13	2013-03-13	2013-03-13	ENSG00000165487	ENSG00000165487		"""EF-hand domain containing"""	31830	protein-coding gene	gene with protein product		610632	"""EF hand domain family A1"", ""EF-hand domain family, member A1"""	EFHA1		23409044	Standard	NM_152726		Approved		uc001uof.3	Q8IYU8	OTTHUMG00000067414	ENST00000382374.4:c.1224A>G	13.37:g.22067469T>C		Somatic	1	116	0.85		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	68	48.48	Q8N0T6|Q8NAX8	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.Q408	ENST00000382374.4	37	c.1224	CCDS9297.1	13																																																																																			-	NULL		0.323	MICU2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICU2	protein_coding	OTTHUMT00000144355.1	T	NM_152726	-		22067469	-1	no_errors	ENST00000382374	ensembl	human	known	74_37	silent	SNP	0.998	C
BIRC8	112401	genome.wustl.edu	37	19	53793609	53793609	+	Missense_Mutation	SNP	G	G	A	rs375698355		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr19:53793609G>A	ENST00000426466.1	-	1	1266	c.19C>T	c.(19-21)Cgg>Tgg	p.R7W		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	7					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		GTAATGAGCCGGGCTTCATAA	0.418																																																	0								ENSG00000163098	G	TRP/ARG	0,4406		0,0,2203	50.0	54.0	53.0		19	-0.9	0.1	19		53	1,8599	1.2+/-3.3	0,1,4299	no	missense	BIRC8	NM_033341.4	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	7/237	53793609	1,13005	2203	4300	6503	BIRC8	SO:0001583	missense	0			-	HGNC	AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.19C>T	19.37:g.53793609G>A	ENSP00000412957:p.Arg7Trp	Somatic	0	39	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	24	31.43	Q6IPY1|Q96RW5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BIR,smart_BIR,smart_Znf_RING,pfscan_BIR,pfscan_Znf_RING	p.R7W	ENST00000426466.1	37	c.19	CCDS12863.1	19	.	.	.	.	.	.	.	.	.	.	G	11.29	1.594703	0.28445	0.0	1.16E-4	ENSG00000163098	ENST00000426466	D	0.96300	-3.97	0.502	-0.919	0.10478	Baculoviral inhibition of apoptosis protein repeat (5);	.	.	.	.	D	0.98024	0.9349	H	0.98802	4.335	0.53005	D	0.999967	D	0.65815	0.995	P	0.56514	0.8	D	0.95337	0.8435	9	0.72032	D	0.01	-18.8463	4.9287	0.13907	0.2609:0.0:0.7391:0.0	.	7	Q96P09	BIRC8_HUMAN	W	7	ENSP00000412957:R7W	ENSP00000412957:R7W	R	-	1	2	BIRC8	58485421	0.695000	0.27747	0.052000	0.19188	0.007000	0.05969	0.999000	0.29757	-0.213000	0.10094	-0.700000	0.03674	CGG	-	pfam_BIR,smart_BIR,pfscan_BIR		0.418	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC8	protein_coding	OTTHUMT00000464357.1	G	NM_033341	-		53793609	-1	no_errors	ENST00000426466	ensembl	human	known	74_37	missense	SNP	0.904	A
FANCG	2189	genome.wustl.edu	37	9	35078228	35078228	+	Silent	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr9:35078228G>A	ENST00000378643.3	-	4	911	c.420C>T	c.(418-420)caC>caT	p.H140H	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	140					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CAACCAGGCGGTGCAGGGCAG	0.627			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	0								ENSG00000221829						69.0	69.0	69.0					9																	35078228		2203	4300	6503	FANCG	SO:0001819	synonymous_variant	0			-	HGNC	AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.420C>T	9.37:g.35078228G>A		Somatic	0	28	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73		Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Sig_transdc_His_kin_Hpt_dom,smart_TPR_repeat	p.H140	ENST00000378643.3	37	c.420	CCDS6574.1	9																																																																																			-	superfamily_Sig_transdc_His_kin_Hpt_dom		0.627	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCG	protein_coding	OTTHUMT00000052269.1	G	NM_004629	-		35078228	-1	no_errors	ENST00000378643	ensembl	human	known	74_37	silent	SNP	0.952	A
LINC01410	103352539	genome.wustl.edu	37	9	66466650	66466650	+	lincRNA	SNP	G	G	C	rs1133399	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr9:66466650G>C	ENST00000424345.1	+	0	1283																											gctaataaaggactccttaat	0.478																																																	0								ENSG00000238113																																			RP11-262H14.1			0			-	Clone_based_vega_gene																													9.37:g.66466650G>C		Somatic	0	14	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	6	40.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000424345.1	37	NULL		9																																																																																			-	-		0.478	RP11-262H14.1-001	KNOWN	basic	lincRNA	LOC100996870	lincRNA	OTTHUMT00000128851.1	G		rs1133399		66466650	+1	no_errors	ENST00000424345	ensembl	human	known	74_37	rna	SNP	0.105	C
TUBB8P12	260334	genome.wustl.edu	37	18	50029	50029	+	5'UTR	SNP	A	A	G	rs78085163		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr18:50029A>G	ENST00000573909.1	-	0	211				RP11-683L23.1_ENST00000308911.6_5'Flank|RP11-683L23.1_ENST00000594555.1_5'Flank																							aacaggacttaattatacgtt	0.403																																																	0								ENSG00000173213																																			RP11-683L23.1	SO:0001623	5_prime_UTR_variant	0			-	Clone_based_vega_gene																												ENST00000573909.1:c.-322T>C	18.37:g.50029A>G		Somatic	0	12	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	3	72.73		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000573909.1	37	NULL		18																																																																																			-	-		0.403	RP11-683L23.1-002	PUTATIVE	not_best_in_genome_evidence|basic	protein_coding	ENSG00000173213	protein_coding	OTTHUMT00000439819.1	A		rs78085163		50029	-1	no_errors	ENST00000575325	ensembl	human	known	74_37	rna	SNP	0.047	G
NCK2	8440	genome.wustl.edu	37	2	106471560	106471560	+	Missense_Mutation	SNP	C	C	G			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:106471560C>G	ENST00000233154.4	+	3	483	c.41C>G	c.(40-42)aCc>aGc	p.T14S	AC009505.2_ENST00000598281.1_RNA|NCK2_ENST00000393349.2_Missense_Mutation_p.T14S|AC009505.2_ENST00000596418.1_RNA|AC009505.2_ENST00000427050.2_RNA|NCK2_ENST00000451463.2_Missense_Mutation_p.T14S|NCK2_ENST00000522586.1_Missense_Mutation_p.T14S	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	14	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						TGGGACTACACCGCCCAGCAG	0.542																																																	0								ENSG00000071051						92.0	89.0	90.0					2																	106471560		2203	4300	6503	NCK2	SO:0001583	missense	0			-	HGNC	AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.41C>G	2.37:g.106471560C>G	ENSP00000233154:p.Thr14Ser	Somatic	0	42	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	19	57.78	D3DVK1|Q9BWN9|Q9UIC3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,pfam_SH2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pirsf_Cytoplasmic_NCK,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.T14S	ENST00000233154.4	37	c.41	CCDS33266.1	2	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049851	0.55218	.	.	ENSG00000071051	ENST00000233154;ENST00000451463;ENST00000393348;ENST00000522586;ENST00000425756;ENST00000393349	T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.77;0.76	5.7	5.7	0.88788	Src homology-3 domain (5);	0.048137	0.85682	D	0.000000	T	0.42426	0.1202	L	0.41356	1.27	0.80722	D	1	B;B	0.21452	0.014;0.056	B;B	0.29077	0.038;0.098	T	0.32824	-0.9892	10	0.07175	T	0.84	.	19.8253	0.96616	0.0:1.0:0.0:0.0	.	14;14	E7ERP6;O43639	.;NCK2_HUMAN	S	14	ENSP00000233154:T14S;ENSP00000410428:T14S;ENSP00000377017:T14S;ENSP00000431109:T14S;ENSP00000408040:T14S;ENSP00000377018:T14S	ENSP00000233154:T14S	T	+	2	0	NCK2	105837992	0.996000	0.38824	0.960000	0.40013	0.992000	0.81027	3.463000	0.53050	2.676000	0.91093	0.650000	0.86243	ACC	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pirsf_Cytoplasmic_NCK,pfscan_SH3_domain,prints_SH3_domain		0.542	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCK2	protein_coding	OTTHUMT00000329634.1	C	NM_003581	-		106471560	+1	no_errors	ENST00000233154	ensembl	human	known	74_37	missense	SNP	0.997	G
PRTN3	5657	genome.wustl.edu	37	19	843968	843968	+	Silent	SNP	G	G	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr19:843968G>T	ENST00000234347.5	+	3	349	c.303G>T	c.(301-303)tcG>tcT	p.S101S	PRTN3_ENST00000544537.2_Silent_p.S60S	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	101	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCACTTCTCGGTGGCTCAGG	0.662																																																	0								ENSG00000196415						37.0	38.0	37.0					19																	843968		2201	4298	6499	PRTN3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.303G>T	19.37:g.843968G>T		Somatic	0	70	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.S101	ENST00000234347.5	37	c.303	CCDS32860.1	19																																																																																			-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.662	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTN3	protein_coding	OTTHUMT00000457888.2	G	NM_002777	-		843968	+1	no_errors	ENST00000234347	ensembl	human	known	74_37	silent	SNP	0.000	T
KIAA2012	100652824	genome.wustl.edu	37	2	202970560	202970560	+	Silent	SNP	G	G	A	rs530562614		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:202970560G>A	ENST00000541917.1	+	9	1774	c.1401G>A	c.(1399-1401)gcG>gcA	p.A467A	AC079354.1_ENST00000295844.3_Silent_p.A523A|AC079354.1_ENST00000409515.3_3'UTR																							TGAAGCATGCGTCCTTAGAAA	0.562													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21925	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000182329																																			AC079354.1	SO:0001819	synonymous_variant	0			-	Clone_based_vega_gene																												ENST00000541917.1:c.1401G>A	2.37:g.202970560G>A		Somatic	0	48	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	26	54.39		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A467	ENST00000541917.1	37	c.1401		2																																																																																			-	NULL		0.562	AC079354.1-201	KNOWN	basic|appris_principal	protein_coding	LOC100652824	protein_coding		G		-		202970560	+1	no_errors	ENST00000541917	ensembl	human	known	74_37	silent	SNP	0.000	A
C14orf39	317761	genome.wustl.edu	37	14	60945096	60945096	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr14:60945096G>A	ENST00000321731.3	-	5	404	c.245C>T	c.(244-246)aCa>aTa	p.T82I		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	82					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		AACATCACATGTTGGCTTCCA	0.259																																																	0								ENSG00000179008						61.0	60.0	60.0					14																	60945096		2202	4295	6497	C14orf39	SO:0001583	missense	0			-	HGNC	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.245C>T	14.37:g.60945096G>A	ENSP00000324920:p.Thr82Ile	Somatic	0	67	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	48	36.00	Q08AQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T82I	ENST00000321731.3	37	c.245	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	G	14.94	2.686184	0.47991	.	.	ENSG00000179008	ENST00000321731;ENST00000555476;ENST00000556799	T;T	0.58210	0.83;0.35	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000001	T	0.72391	0.3454	M	0.69823	2.125	0.40882	D	0.984002	D	0.89917	1.0	D	0.87578	0.998	T	0.74153	-0.3757	10	0.59425	D	0.04	-8.3516	17.3748	0.87389	0.0:0.0:1.0:0.0	.	82	Q8N1H7	S6OS1_HUMAN	I	82;53;82	ENSP00000324920:T82I;ENSP00000451665:T53I	ENSP00000324920:T82I	T	-	2	0	C14orf39	60014849	1.000000	0.71417	1.000000	0.80357	0.049000	0.14656	6.011000	0.70760	2.771000	0.95319	0.650000	0.86243	ACA	-	NULL		0.259	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	protein_coding	OTTHUMT00000276948.1	G	NM_174978	-		60945096	-1	no_errors	ENST00000321731	ensembl	human	known	74_37	missense	SNP	1.000	A
IQCA1	79781	genome.wustl.edu	37	2	237402482	237402482	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:237402482C>T	ENST00000409907.3	-	3	659	c.385G>A	c.(385-387)Gaa>Aaa	p.E129K	IQCA1_ENST00000309507.5_Missense_Mutation_p.E125K|IQCA1_ENST00000431676.2_Missense_Mutation_p.E129K	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	129							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						TTTATTACTTCCAACTTCTCC	0.328																																																	0								ENSG00000132321						94.0	85.0	88.0					2																	237402482		1795	4078	5873	IQCA1	SO:0001583	missense	0			-	HGNC	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.385G>A	2.37:g.237402482C>T	ENSP00000387347:p.Glu129Lys	Somatic	0	63	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.E129K	ENST00000409907.3	37	c.385	CCDS46549.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.568|9.568	1.120206|1.120206	0.20877|0.20877	.|.	.|.	ENSG00000132321|ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437|ENST00000418802	D;D;D|.	0.94046|.	-3.19;-3.18;-3.34|.	5.05|5.05	4.11|4.11	0.48088|0.48088	.|.	0.099733|.	0.43919|.	D|.	0.000512|.	T|T	0.35682|0.35682	0.0940|0.0940	N|N	0.20881|0.20881	0.62|0.62	0.34896|0.34896	D|D	0.746043|0.746043	B;B;B|.	0.06786|.	0.001;0.001;0.001|.	B;B;B|.	0.08055|.	0.003;0.003;0.003|.	T|T	0.41197|0.41197	-0.9522|-0.9522	10|5	0.09338|.	T|.	0.73|.	.|.	7.5305|7.5305	0.27681|0.27681	0.0:0.7418:0.1694:0.0888|0.0:0.7418:0.1694:0.0888	.|.	129;136;129|.	E7EWQ0;E9PH78;Q86XH1|.	.;.;IQCA1_HUMAN|.	K|E	129;136;125;129;125|147	ENSP00000387347:E129K;ENSP00000311951:E125K;ENSP00000407213:E129K|.	ENSP00000254653:E129K|.	E|G	-|-	1|2	0|0	IQCA1|IQCA1	237067221|237067221	0.993000|0.993000	0.37304|0.37304	0.665000|0.665000	0.29768|0.29768	0.984000|0.984000	0.73092|0.73092	1.247000|1.247000	0.32815|0.32815	2.357000|2.357000	0.79964|0.79964	0.563000|0.563000	0.77884|0.77884	GAA|GGA	-	NULL		0.328	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	protein_coding	OTTHUMT00000329266.1	C	NM_024726	-		237402482	-1	no_errors	ENST00000409907	ensembl	human	known	74_37	missense	SNP	0.959	T
CLCA2	9635	genome.wustl.edu	37	1	86913457	86913457	+	Silent	SNP	A	A	G			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr1:86913457A>G	ENST00000370565.4	+	11	2142	c.1980A>G	c.(1978-1980)ggA>ggG	p.G660G		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	660					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TTGATGATGGAGCAGGTAACA	0.413																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)												0								ENSG00000137975						59.0	56.0	57.0					1																	86913457		2203	4300	6503	CLCA2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1980A>G	1.37:g.86913457A>G		Somatic	0	67	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	38	32.14	A8K2T3|Q9Y6N2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cl_channel_Ca,pfam_DUF1973,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	p.G660	ENST00000370565.4	37	c.1980	CCDS708.1	1																																																																																			-	pfam_DUF1973,tigrfam_CaCC_prot		0.413	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA2	protein_coding	OTTHUMT00000028284.1	A	NM_006536	-		86913457	+1	no_errors	ENST00000370565	ensembl	human	known	74_37	silent	SNP	0.998	G
KIF4A	24137	genome.wustl.edu	37	X	69550144	69550144	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:69550144G>A	ENST00000374403.3	+	9	1115	c.1033G>A	c.(1033-1035)Gat>Aat	p.D345N	KIF4A_ENST00000374388.3_Missense_Mutation_p.D345N	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	345					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						TGTTAATATTGATCCCCAGAC	0.378																																																	0								ENSG00000090889						107.0	102.0	103.0					X																	69550144		2203	4298	6501	KIF4A	SO:0001583	missense	0			-	HGNC	AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1033G>A	X.37:g.69550144G>A	ENSP00000363524:p.Asp345Asn	Somatic	0	51	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	30	47.37	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.D345N	ENST00000374403.3	37	c.1033	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	30	5.054928	0.93793	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.73363	-0.74;-0.74	5.16	5.16	0.70880	Kinesin, motor domain (1);	0.100034	0.43919	D	0.000507	D	0.84552	0.5497	M	0.80508	2.5	0.80722	D	1	P;P	0.49696	0.927;0.797	P;P	0.56434	0.798;0.584	D	0.87140	0.2202	10	0.87932	D	0	.	16.9009	0.86113	0.0:0.0:1.0:0.0	.	345;345	O95239;O95239-2	KIF4A_HUMAN;.	N	345	ENSP00000363509:D345N;ENSP00000363524:D345N	ENSP00000363509:D345N	D	+	1	0	KIF4A	69466869	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.379000	0.97198	2.285000	0.76669	0.436000	0.28706	GAT	-	superfamily_P-loop_NTPase		0.378	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	protein_coding	OTTHUMT00000057068.1	G	NM_012310	-		69550144	+1	no_errors	ENST00000374403	ensembl	human	known	74_37	missense	SNP	1.000	A
AC026320.1	0	genome.wustl.edu	37	3	191693744	191693749	+	RNA	DEL	GTGTGT	GTGTGT	-	rs199865256|rs371584059		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	GTGTGT	GTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr3:191693744_191693749delGTGTGT	ENST00000401201.1	+	0	2_7																											ctctctctcCgtgtgtgtgtgtgtgt	0.49																																																	0								ENSG00000216020																																			AC026320.1			0				Clone_based_ensembl_gene																													3.37:g.191693750_191693755delGTGTGT		Somatic	NA	NA	NA		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401201.1	37	NULL		3																																																																																			-	-		0.490	AC026320.1-201	NOVEL	basic	miRNA	ENSG00000216020	miRNA		GTGTGT				191693749	+1	no_errors	ENST00000401201	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000	-
SPATA20	64847	genome.wustl.edu	37	17	48625308	48625319	+	Intron	DEL	GGGGAGGGGCCT	GGGGAGGGGCCT	-	rs547335746|rs200637741|rs111627733	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	GGGGAGGGGCCT	GGGGAGGGGCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr17:48625308_48625319delGGGGAGGGGCCT	ENST00000356488.4	+	2	160				SPATA20_ENST00000393244.3_Intron|SPATA20_ENST00000006658.6_Intron	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20						cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			GGAAGGGCCGGGGGAGGGGCCTGGGGAGGGGT	0.656														197	0.0393371	0.0045	0.0418	5008	,	,		16517	0.0198		0.0984	False		,,,				2504	0.044																0								ENSG00000006282																																			SPATA20	SO:0001627	intron_variant	0				HGNC		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.78-325GGGGAGGGGCCT>-	17.37:g.48625308_48625319delGGGGAGGGGCCT		Somatic	NA	NA	NA		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e3-1	ENST00000356488.4	37	c.204+9_20	CCDS58563.1	17																																																																																			-	-		0.656	SPATA20-004	KNOWN	basic|CCDS	protein_coding	SPATA20	protein_coding	OTTHUMT00000367651.1	GGGGAGGGGCCT	NM_022827			48625319	+1	no_errors	ENST00000505085	ensembl	human	known	74_37	splice_site_del	DEL	0.017:0.930:0.996:1.000:0.998:0.997:0.997:0.993:0.978:0.966:0.032:0.000	-
CDC123	8872	genome.wustl.edu	37	10	12288380	12288380	+	Intron	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr10:12288380G>A	ENST00000281141.4	+	11	1126				CDC123_ENST00000378900.2_Intron|RP11-186N15.3_ENST00000598961.1_RNA|RP11-186N15.3_ENST00000421657.1_RNA|CDC123_ENST00000455773.3_Intron	NM_006023.2	NP_006014.2	O75794	CD123_HUMAN	cell division cycle 123						cell cycle arrest (GO:0007050)|cell division (GO:0051301)|positive regulation of cell proliferation (GO:0008284)|regulation of mitotic cell cycle (GO:0007346)	cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12						GGACCCTTGGGAAGCGCAGAG	0.463																																																	0								ENSG00000228302																																			RP11-186N15.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	BC001600	CCDS7090.1	10p13	2013-01-17	2013-01-17	2006-11-06	ENSG00000151465	ENSG00000151465			16827	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 7"", ""cell division cycle 123 homolog (S. cerevisiae)"""	C10orf7		15319434	Standard	NM_006023		Approved	D123	uc001ill.3	O75794	OTTHUMG00000017680	ENST00000281141.4:c.846+104G>A	10.37:g.12288380G>A		Somatic	0	9	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	4	63.64	A8JZZ7|Q14107|Q5T0L4|Q5T0L5|Q5T0L7|Q5T0L8|Q5T0L9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000281141.4	37	NULL	CCDS7090.1	10																																																																																			-	-		0.463	CDC123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228302	protein_coding	OTTHUMT00000046801.1	G	NM_006023	-		12288380	-1	no_errors	ENST00000421657	ensembl	human	known	74_37	rna	SNP	0.000	A
ZNRF2P2	100271874	genome.wustl.edu	37	7	29720400	29720400	+	RNA	SNP	C	C	G			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr7:29720400C>G	ENST00000426767.1	-	0	366				MIR550A3_ENST00000390735.2_RNA	NR_024278.1				zinc and ring finger 2 pseudogene 2																		CTTACAACAACAGGACTCTTA	0.483																																																	0								ENSG00000212024																																			MIR550A3			0			-	HGNC			7p14.3	2011-08-22			ENSG00000239968	ENSG00000225264			42793	pseudogene	pseudogene							Standard	NR_027347		Approved				OTTHUMG00000152750		7.37:g.29720400C>G		Somatic	0	66	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	25	65.75		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000426767.1	37	NULL		7																																																																																			-	-		0.483	ZNRF2P2-003	KNOWN	basic	processed_transcript	MIR550A3	pseudogene	OTTHUMT00000327679.1	C	NR_027347	-		29720400	-1	no_errors	ENST00000390735	ensembl	human	known	74_37	rna	SNP	0.225	G
SETD5	55209	genome.wustl.edu	37	3	9476152	9476152	+	Silent	SNP	C	C	T	rs376494447		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr3:9476152C>T	ENST00000406341.1	+	4	502	c.312C>T	c.(310-312)ctC>ctT	p.L104L	SETD5_ENST00000407969.1_Silent_p.L123L|SETD5_ENST00000302463.6_5'UTR|SETD5_ENST00000402466.1_5'UTR|SETD5_ENST00000402198.1_Silent_p.L104L			Q9C0A6	SETD5_HUMAN	SET domain containing 5	104										NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		GCTTCCTTCTCAACTGTGACA	0.473																																																	0								ENSG00000168137	C		0,3904		0,0,1952	95.0	98.0	97.0		312	4.9	1.0	3		97	2,8302		0,2,4150	no	coding-synonymous	SETD5	NM_001080517.1		0,2,6102	TT,TC,CC		0.0241,0.0,0.0164		104/1443	9476152	2,12206	1952	4152	6104	SETD5	SO:0001819	synonymous_variant	0			-	HGNC	BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.312C>T	3.37:g.9476152C>T		Somatic	0	60	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	44	55.56	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.L104	ENST00000406341.1	37	c.312	CCDS46741.1	3																																																																																			-	NULL		0.473	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	SETD5	protein_coding	OTTHUMT00000318425.1	C	XM_371614	-		9476152	+1	no_errors	ENST00000402198	ensembl	human	known	74_37	silent	SNP	1.000	T
LATS2	26524	genome.wustl.edu	37	13	21563188	21563188	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr13:21563188G>A	ENST00000382592.4	-	4	1136	c.731C>T	c.(730-732)gCa>gTa	p.A244V	LATS2_ENST00000542899.1_Missense_Mutation_p.A244V|LATS2_ENST00000472754.1_5'UTR	NM_014572.2	NP_055387.2			large tumor suppressor kinase 2											breast(4)|central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(2)	45		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CGGGAAGTGTGCCCCTGCTGC	0.711																																																	0								ENSG00000150457						7.0	9.0	8.0					13																	21563188		2173	4241	6414	LATS2	SO:0001583	missense	0			-	HGNC	AB028019	CCDS9294.1	13q11-q12	2013-04-25	2013-04-25		ENSG00000150457	ENSG00000150457			6515	protein-coding gene	gene with protein product		604861	"""LATS (large tumor suppressor, Drosophila) homolog 2"", ""LATS, large tumor suppressor, homolog 2 (Drosophila)"""			10673337	Standard	NM_014572		Approved		uc001unr.4	Q9NRM7	OTTHUMG00000016531	ENST00000382592.4:c.731C>T	13.37:g.21563188G>A	ENSP00000372035:p.Ala244Val	Somatic	0	18	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	31	31.91		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.A244V	ENST00000382592.4	37	c.731	CCDS9294.1	13	.	.	.	.	.	.	.	.	.	.	G	10.50	1.367249	0.24771	.	.	ENSG00000150457	ENST00000382592;ENST00000542899	T;T	0.58506	0.33;0.33	4.88	3.82	0.43975	.	2.277970	0.01491	N	0.017079	T	0.38427	0.1040	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.27673	-1.0067	10	0.25751	T	0.34	.	4.9341	0.13932	0.808:0.0:0.192:0.0	.	244	Q9NRM7	LATS2_HUMAN	V	244	ENSP00000372035:A244V;ENSP00000441817:A244V	ENSP00000372035:A244V	A	-	2	0	LATS2	20461188	0.002000	0.14202	0.001000	0.08648	0.660000	0.38997	1.507000	0.35758	0.852000	0.35287	0.306000	0.20318	GCA	-	NULL		0.711	LATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS2	protein_coding	OTTHUMT00000044102.1	G		-		21563188	-1	no_errors	ENST00000382592	ensembl	human	known	74_37	missense	SNP	0.008	A
MUC12	10071	genome.wustl.edu	37	7	100636722	100636722	+	Missense_Mutation	SNP	G	G	C	rs201822262	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr7:100636722G>C	ENST00000379442.3	+	5	3307	c.3307G>C	c.(3307-3309)Gtt>Ctt	p.V1103L	MUC12_ENST00000536621.1_Missense_Mutation_p.V960L			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1103	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CTCAGGCATCGTTGAAGCATC	0.552													c|||	724	0.144569	0.2511	0.1167	5008	,	,		21543	0.0188		0.1402	False		,,,				2504	0.1544																0								ENSG00000205277						11.0	19.0	17.0					7																	100636722		326	943	1269	MUC12	SO:0001583	missense	0			-	HGNC	AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.3307G>C	7.37:g.100636722G>C	ENSP00000368755:p.Val1103Leu	Somatic	0	33	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	28	15.15	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom	p.V960L	ENST00000379442.3	37	c.2878		7	.	.	.	.	.	.	.	.	.	.	g	0.039	-1.293060	0.01375	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11930	2.73;2.73	0.49	-0.979	0.10276	.	.	.	.	.	T	0.04815	0.0130	N	0.08118	0	0.80722	P	0.0	.	.	.	.	.	.	T	0.40194	-0.9576	6	0.19147	T	0.46	.	2.7178	0.05192	0.4852:0.2627:0.2521:0.0	.	.	.	.	L	1103;960	ENSP00000368755:V1103L;ENSP00000441929:V960L	ENSP00000368755:V1103L	V	+	1	0	MUC12	100423442	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.863000	0.01651	-1.795000	0.01255	-1.271000	0.01417	GTT	-	NULL		0.552	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	protein_coding	OTTHUMT00000347234.1	G	XM_379904	rs201822262		100636722	+1	no_errors	ENST00000536621	ensembl	human	known	74_37	missense	SNP	0.000	C
PRKACG	5568	genome.wustl.edu	37	9	71628296	71628296	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr9:71628296G>T	ENST00000377276.2	-	1	743	c.713C>A	c.(712-714)cCc>cAc	p.P238H		NM_002732.3	NP_002723.2	P22612	KAPCG_HUMAN	protein kinase, cAMP-dependent, catalytic, gamma	238	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|male gonad development (GO:0008584)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)|triglyceride catabolic process (GO:0019433)|water transport (GO:0006833)	cytosol (GO:0005829)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GGCGTAGAAGGGTGGGAAGCC	0.597																																					Esophageal Squamous(110;2236 2623 32146)												0								ENSG00000165059						71.0	69.0	69.0					9																	71628296		2203	4300	6503	PRKACG	SO:0001583	missense	0			-	HGNC	M34182	CCDS6625.1	9q13	2012-10-02			ENSG00000165059	ENSG00000165059	2.7.11.1		9382	protein-coding gene	gene with protein product		176893				2342480, 9598317	Standard	NM_002732		Approved	PKACg	uc004agy.3	P22612	OTTHUMG00000019974	ENST00000377276.2:c.713C>A	9.37:g.71628296G>T	ENSP00000366488:p.Pro238His	Somatic	0	37	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	O60850|Q5VZ02|Q86YI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P238H	ENST00000377276.2	37	c.713	CCDS6625.1	9	.	.	.	.	.	.	.	.	.	.	G	14.99	2.700631	0.48307	.	.	ENSG00000165059	ENST00000377276	T	0.15718	2.4	1.16	1.16	0.20824	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.31041	U	0.008368	T	0.50769	0.1635	H	0.97540	4.025	0.34132	D	0.665329	D	0.89917	1.0	D	0.97110	1.0	T	0.65849	-0.6068	10	0.87932	D	0	.	7.7676	0.28988	0.0:0.0:1.0:0.0	.	238	P22612	KAPCG_HUMAN	H	238	ENSP00000366488:P238H	ENSP00000366488:P238H	P	-	2	0	PRKACG	70818116	1.000000	0.71417	0.002000	0.10522	0.002000	0.02628	5.129000	0.64739	0.556000	0.29098	0.563000	0.77884	CCC	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.597	PRKACG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKACG	protein_coding	OTTHUMT00000052559.1	G		-		71628296	-1	no_errors	ENST00000377276	ensembl	human	known	74_37	missense	SNP	0.994	T
C18orf32	497661	genome.wustl.edu	37	18	47013943	47013943	+	5'Flank	SNP	A	A	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr18:47013943A>C	ENST00000318240.3	-	0	0				RP11-110H1.4_ENST00000580150.1_RNA|C18orf32_ENST00000582392.1_5'Flank|RPL17_ENST00000581091.1_5'Flank|C18orf32_ENST00000579820.1_5'Flank|SNORD58C_ENST00000365223.1_RNA|RPL17-C18orf32_ENST00000332968.6_Intron|RPL17-C18orf32_ENST00000584895.1_Intron|MIR1539_ENST00000410758.1_RNA|MIR1539_ENST00000581232.1_RNA	NM_001035005.3	NP_001030177.1	Q8TCD1	CR032_HUMAN	chromosome 18 open reading frame 32						positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)		signal transducer activity (GO:0004871)			large_intestine(2)|lung(1)	3						TGGATAAGCTATTAGTTTTGC	0.468																																																	0								ENSG00000265496																																			MIR1539	SO:0001631	upstream_gene_variant	0			-	HGNC	AK027111	CCDS32831.1	18q21.1	2012-10-24			ENSG00000177576	ENSG00000177576			31690	protein-coding gene	gene with protein product							Standard	NM_001035005		Approved	FLJ23458	uc002ldl.3	Q8TCD1	OTTHUMG00000179688		18.37:g.47013943A>C	Exception_encountered	Somatic	0	26	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	14	33.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000318240.3	37	NULL	CCDS32831.1	18																																																																																			-	-		0.468	C18orf32-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MIR1539	protein_coding	OTTHUMT00000447656.1	A	NM_001035005	-		47013943	+1	no_errors	ENST00000581232	ensembl	human	known	74_37	rna	SNP	0.000	C
RGAG1	57529	genome.wustl.edu	37	X	109695944	109695944	+	Missense_Mutation	SNP	A	A	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:109695944A>T	ENST00000465301.2	+	3	2345	c.2099A>T	c.(2098-2100)cAa>cTa	p.Q700L	RGAG1_ENST00000540313.1_Missense_Mutation_p.Q700L	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	700										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ATGAGAGCTCAAGACCCAGGA	0.507																																																	0								ENSG00000243978						122.0	101.0	108.0					X																	109695944		2203	4300	6503	RGAG1	SO:0001583	missense	0			-	HGNC	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2099A>T	X.37:g.109695944A>T	ENSP00000419786:p.Gln700Leu	Somatic	0	54	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	29	45.28	Q9P2M8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q700L	ENST00000465301.2	37	c.2099	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	A	1.081	-0.667046	0.03428	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.44083	0.93;0.93	3.96	2.09	0.27110	.	0.852571	0.09821	N	0.751458	T	0.26738	0.0654	L	0.29908	0.895	0.09310	N	1	B	0.14805	0.011	B	0.09377	0.004	T	0.24548	-1.0157	9	.	.	.	-0.6656	4.1289	0.10139	0.4424:0.4398:0.0:0.1178	.	700	Q8NET4	RGAG1_HUMAN	L	700	ENSP00000419786:Q700L;ENSP00000441452:Q700L	.	Q	+	2	0	RGAG1	109582600	0.229000	0.23729	0.001000	0.08648	0.004000	0.04260	1.712000	0.37940	0.402000	0.25451	-0.269000	0.10298	CAA	-	NULL		0.507	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	protein_coding	OTTHUMT00000057906.2	A	NM_020769	-		109695944	+1	no_errors	ENST00000465301	ensembl	human	known	74_37	missense	SNP	0.003	T
TCEB3B	51224	genome.wustl.edu	37	18	44559800	44559800	+	Silent	SNP	C	C	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr18:44559800C>T	ENST00000332567.4	-	1	2188	c.1836G>A	c.(1834-1836)ccG>ccA	p.P612P	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	612	Activation domain. {ECO:0000250}.				regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						CTGGGGCGTCCGGAAGCCGCA	0.498																																																	0								ENSG00000206181						73.0	79.0	77.0					18																	44559800		2203	4300	6503	TCEB3B	SO:0001819	synonymous_variant	0			-	HGNC	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1836G>A	18.37:g.44559800C>T		Somatic	0	66	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	40	37.50	Q9P2V9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.P612	ENST00000332567.4	37	c.1836	CCDS11932.1	18																																																																																			-	pfam_RNA_pol_II_trans_fac_SIII_A		0.498	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	protein_coding	OTTHUMT00000255900.1	C	NM_016427	-		44559800	-1	no_errors	ENST00000332567	ensembl	human	known	74_37	silent	SNP	0.993	T
FAM26D	221301	genome.wustl.edu	37	6	116875489	116875489	+	Missense_Mutation	SNP	C	C	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr6:116875489C>A	ENST00000368596.3	+	1	577	c.533C>A	c.(532-534)gCt>gAt	p.A178D	FAM26D_ENST00000416171.2_Missense_Mutation_p.A34D|FAM26D_ENST00000405399.1_Missense_Mutation_p.A35D|FAM26D_ENST00000368597.2_Intron			Q5JW98	FA26D_HUMAN	family with sequence similarity 26, member D	178					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				endometrium(1)|lung(5)	6		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0458)|OV - Ovarian serous cystadenocarcinoma(136;0.0694)|Epithelial(106;0.222)		GATGAAATAGCTCTTCTGCAC	0.408																																																	0								ENSG00000164451																																			FAM26D	SO:0001583	missense	0			-	HGNC	AK056801	CCDS5109.1, CCDS59032.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000164451	ENSG00000164451			21094	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 78"""	C6orf78			Standard	NM_153036		Approved	FLJ32239	uc010ked.4	Q5JW98	OTTHUMG00000015443	ENST00000368596.3:c.533C>A	6.37:g.116875489C>A	ENSP00000357585:p.Ala178Asp	Somatic	0	30	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	14	53.33	B0QZ25|B0QZ27|B4DTQ0|Q96MK0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A178D	ENST00000368596.3	37	c.533		6	.	.	.	.	.	.	.	.	.	.	C	11.90	1.777594	0.31502	.	.	ENSG00000164451	ENST00000416171;ENST00000405399;ENST00000368596	T;T;T	0.18960	2.18;2.18;2.18	6.11	2.18	0.27775	.	0.503984	0.20018	N	0.100967	T	0.02807	0.0084	.	.	.	0.27120	N	0.962158	P;P	0.45474	0.859;0.773	B;B	0.37304	0.246;0.246	T	0.33574	-0.9863	9	0.16420	T	0.52	-19.597	4.2659	0.10763	0.0:0.4497:0.1598:0.3905	.	34;178	B4DTQ0;Q5JW98	.;FA26D_HUMAN	D	34;35;178	ENSP00000416976:A34D;ENSP00000385836:A35D;ENSP00000357585:A178D	ENSP00000357585:A178D	A	+	2	0	FAM26D	116982182	0.985000	0.35326	0.427000	0.26684	0.906000	0.53458	0.804000	0.27098	0.389000	0.25086	-0.345000	0.07892	GCT	-	NULL		0.408	FAM26D-002	KNOWN	basic|appris_principal	protein_coding	FAM26D	protein_coding	OTTHUMT00000041958.1	C	NM_153036	-		116875489	+1	no_errors	ENST00000368596	ensembl	human	known	74_37	missense	SNP	0.771	A
DEAF1	10522	genome.wustl.edu	37	11	680002	680003	+	Intron	INS	-	-	ACCAGGATG	rs71278583|rs398038332|rs67467914	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr11:680002_680003insACCAGGATG	ENST00000382409.3	-	8	1482				RP11-754B17.1_ENST00000527799.1_RNA|DEAF1_ENST00000525904.1_5'UTR|DEAF1_ENST00000338675.6_Intron	NM_021008.2	NP_066288.2	O75398	DEAF1_HUMAN	DEAF1 transcription factor						anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)		CACAGGAGAAAACCAGGATGGC	0.52														2632	0.525559	0.2927	0.5303	5008	,	,		20992	0.7173		0.5686	False		,,,				2504	0.5951																0								ENSG00000177030																																			DEAF1	SO:0001627	intron_variant	0				HGNC	AF049460	CCDS31327.1	11p15.5	2013-01-10	2013-01-10		ENSG00000177030	ENSG00000177030		"""Zinc fingers, MYND-type"""	14677	protein-coding gene	gene with protein product		602635	"""deformed epidermal autoregulatory factor 1 (Drosophila)"""			9773984	Standard	XR_428838		Approved	NUDR, SPN, ZMYND5	uc001lqq.1	O75398	OTTHUMG00000165363	ENST00000382409.3:c.998-186->CATCCTGGT	11.37:g.680003_680011dupACCAGGATG		Somatic	NA	NA	NA		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382409.3	37	NULL	CCDS31327.1	11																																																																																			-	-		0.520	DEAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEAF1	protein_coding	OTTHUMT00000383614.3	-	NM_021008			680003	-1	no_errors	ENST00000525904	ensembl	human	known	74_37	rna	INS	0.000:0.000	ACCAGGATG
TENM1	10178	genome.wustl.edu	37	X	124097497	124097497	+	Missense_Mutation	SNP	G	G	C	rs370597690		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:124097497G>C	ENST00000371130.3	-	1	169	c.106C>G	c.(106-108)Cca>Gca	p.P36A	TENM1_ENST00000422452.2_Missense_Mutation_p.P36A	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	36	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GACTGTCTTGGTTTTCTTCCA	0.438																																																	0								ENSG00000009694						316.0	283.0	294.0					X																	124097497		2203	4300	6503	TENM1	SO:0001583	missense	0			-	HGNC	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.106C>G	X.37:g.124097497G>C	ENSP00000360171:p.Pro36Ala	Somatic	0	53	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	35	45.45	B2RTR5|Q5JZ17	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.P36A	ENST00000371130.3	37	c.106	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342883	0.41498	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	T;T	0.30981	1.51;1.51	5.78	5.78	0.91487	Teneurin intracellular, N-terminal (2);	0.154026	0.44285	D	0.000480	T	0.26955	0.0660	L	0.34521	1.04	0.35125	D	0.767452	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.001	T	0.22208	-1.0223	10	0.62326	D	0.03	.	15.1558	0.72739	0.0:0.1375:0.8625:0.0	.	36;36;36	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	A	36	ENSP00000360171:P36A;ENSP00000403954:P36A	ENSP00000360171:P36A	P	-	1	0	ODZ1	123925178	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.028000	0.64115	2.417000	0.82017	0.600000	0.82982	CCA	-	pfam_Ten_N		0.438	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	protein_coding	OTTHUMT00000058985.1	G	NM_014253	-		124097497	-1	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	SNP	1.000	C
ZNF726	730087	genome.wustl.edu	37	19	24102852	24102852	+	Missense_Mutation	SNP	T	T	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr19:24102852T>C	ENST00000334589.5	+	3	312	c.194T>C	c.(193-195)aTg>aCg	p.M65T	ZNF726_ENST00000525354.2_Missense_Mutation_p.M65T|ZNF726_ENST00000322487.7_Missense_Mutation_p.M65T|ZNF726_ENST00000531821.2_Missense_Mutation_p.M65T|ZNF726_ENST00000575986.1_Missense_Mutation_p.M65T|ZNF726_ENST00000594466.1_Missense_Mutation_p.M65T|CTB-92J24.3_ENST00000596326.1_RNA			A6NNF4	ZN726_HUMAN	zinc finger protein 726	65	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										CCCTGGAATATGAAGCGAGAT	0.423																																																	0								ENSG00000213967																																			ZNF726	SO:0001583	missense	0			-	HGNC	DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000334589.5:c.194T>C	19.37:g.24102852T>C	ENSP00000334762:p.Met65Thr	Somatic	0	86	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	58	33.33	M0R0X8|Q86Y87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.M65T	ENST00000334589.5	37	c.194		19	.	.	.	.	.	.	.	.	.	.	t	2.781	-0.253460	0.05829	.	.	ENSG00000213967	ENST00000525354;ENST00000334589;ENST00000531821;ENST00000322487	T;T;T;T	0.06142	5.71;5.64;5.67;3.34	1.14	-2.28	0.06826	.	.	.	.	.	T	0.04815	0.0130	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40194	-0.9576	6	0.42905	T	0.14	.	1.3689	0.02207	0.3385:0.2819:0.0:0.3795	.	.	.	.	T	65	ENSP00000433319:M65T;ENSP00000334762:M65T;ENSP00000432583:M65T;ENSP00000317125:M65T	ENSP00000317125:M65T	M	+	2	0	ZNF726	23894692	0.012000	0.17670	0.000000	0.03702	0.006000	0.05464	-0.140000	0.10342	-0.504000	0.06577	0.352000	0.21897	ATG	-	pfscan_Krueppel-associated_box		0.423	ZNF726-003	PUTATIVE	basic|exp_conf	protein_coding	ZNF726	protein_coding	OTTHUMT00000395815.2	T	XM_001715134	-		24102852	+1	no_errors	ENST00000322487	ensembl	human	known	74_37	missense	SNP	0.000	C
ADAMTS7	11173	genome.wustl.edu	37	15	79051801	79051801	+	Missense_Mutation	SNP	C	C	A	rs201472223		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr15:79051801C>A	ENST00000388820.4	-	24	5233	c.5023G>T	c.(5023-5025)Gcc>Tcc	p.A1675S		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1675					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGGGAGGGGGCGCCGTGGCTG	0.721																																																	0								ENSG00000136378						7.0	9.0	9.0					15																	79051801		2082	4133	6215	ADAMTS7	SO:0001583	missense	0			-	HGNC	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.5023G>T	15.37:g.79051801C>A	ENSP00000373472:p.Ala1675Ser	Somatic	0	24	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	19	29.63	Q14F51|Q6P7J9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.A1675S	ENST00000388820.4	37	c.5023	CCDS32303.1	15	.	.	.	.	.	.	.	.	.	.	c	1.406	-0.576936	0.03854	.	.	ENSG00000136378	ENST00000388820	T	0.59502	0.26	2.92	0.947	0.19555	.	2.418420	0.02155	U	0.058341	T	0.39627	0.1085	N	0.19112	0.55	0.09310	N	1	B	0.25007	0.116	B	0.23150	0.044	T	0.16600	-1.0397	10	0.09590	T	0.72	.	6.0212	0.19630	0.0:0.7622:0.0:0.2378	.	1675	Q9UKP4	ATS7_HUMAN	S	1675	ENSP00000373472:A1675S	ENSP00000373472:A1675S	A	-	1	0	ADAMTS7	76838856	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.624000	0.24462	0.111000	0.17947	-2.153000	0.00332	GCC	-	NULL		0.721	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	protein_coding	OTTHUMT00000421331.1	C	NM_014272	rs201472223		79051801	-1	no_errors	ENST00000388820	ensembl	human	known	74_37	missense	SNP	0.001	A
MT-CO1	4512	genome.wustl.edu	37	M	7218	7218	+	Missense_Mutation	SNP	C	C	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrM:7218C>A	ENST00000361624.2	+	1	1315	c.1315C>A	c.(1315-1317)Cgt>Agt	p.R439S	MT-CO3_ENST00000362079.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	439					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GAATGCCCCGACGTTACTCGG	0.413																																																	0								ENSG00000198804																																			MT-CO1	SO:0001583	missense	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1315C>A	M.37:g.7218C>A	ENSP00000354499:p.Arg439Ser	Somatic	0	36	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	9	18.18	Q34770	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.R439S	ENST00000361624.2	37	c.1315		MT																																																																																			-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1		0.413	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	protein_coding		C	YP_003024028	-		7218	+1	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	SNP	NULL	A
COL4A2	1284	genome.wustl.edu	37	13	111164409	111164409	+	Silent	SNP	C	C	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr13:111164409C>T	ENST00000360467.5	+	48	5316	c.5010C>T	c.(5008-5010)aaC>aaT	p.N1670N		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	1670	Collagen IV NC1. {ECO:0000255|PROSITE- ProRule:PRU00736}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			ACTACGCCAACAAGTACAGCT	0.622																																																	0								ENSG00000134871						70.0	79.0	76.0					13																	111164409		2140	4252	6392	COL4A2	SO:0001819	synonymous_variant	0			-	HGNC	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.5010C>T	13.37:g.111164409C>T		Somatic	0	114	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	101	8.18	Q14052|Q548C3|Q5VZA9|Q66K23	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.N1670	ENST00000360467.5	37	c.5010	CCDS41907.1	13																																																																																			-	pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC		0.622	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	protein_coding	OTTHUMT00000045761.2	C	NM_001846	-		111164409	+1	no_errors	ENST00000360467	ensembl	human	known	74_37	silent	SNP	1.000	T
PODXL	5420	genome.wustl.edu	37	7	131190689	131190689	+	Silent	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr7:131190689G>A	ENST00000378555.3	-	8	1664	c.1417C>T	c.(1417-1419)Ctg>Ttg	p.L473L	PODXL_ENST00000537928.1_Silent_p.L441L|PODXL_ENST00000541194.1_Silent_p.L475L|PODXL_ENST00000322985.9_Silent_p.L441L			O00592	PODXL_HUMAN	podocalyxin-like	473					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					ACGAGGAGCAGGAATGATGCC	0.632																																																	0								ENSG00000128567						40.0	34.0	36.0					7																	131190689		2203	4299	6502	PODXL	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.1417C>T	7.37:g.131190689G>A		Somatic	0	74	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	51	10.53	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CD34/Podocalyxin,pirsf_Podocalyxin-like_p1	p.L475	ENST00000378555.3	37	c.1423	CCDS34755.1	7																																																																																			-	pfam_CD34/Podocalyxin,pirsf_Podocalyxin-like_p1		0.632	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PODXL	protein_coding	OTTHUMT00000337627.2	G	NM_001018111	-		131190689	-1	no_errors	ENST00000541194	ensembl	human	known	74_37	silent	SNP	1.000	A
NRXN1	9378	genome.wustl.edu	37	2	50923314	50923321	+	Intron	DEL	GTGTGTGT	GTGTGTGT	-	rs202071380|rs201534178|rs200473527		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	GTGTGTGT	GTGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:50923314_50923321delGTGTGTGT	ENST00000406316.2	-	6	2309				NRXN1_ENST00000404971.1_Intron|NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000405472.3_Intron|AC009234.2_ENST00000401372.1_RNA|NRXN1_ENST00000401669.2_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			Gtacatatacgtgtgtgtgtgtgtgtgt	0.438																																																	0								ENSG00000216191																																			AC009234.2	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.833-72561ACACACAC>-	2.37:g.50923322_50923329delGTGTGTGT		Somatic	NA	NA	NA		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000406316.2	37	NULL	CCDS54360.1	2																																																																																			-	-		0.438	NRXN1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000216191	protein_coding	OTTHUMT00000325291.2	GTGTGTGT				50923321	-1	no_errors	ENST00000401372	ensembl	human	novel	74_37	rna	DEL	0.006:0.004:0.003:0.002:0.002:0.000:0.000:0.000	-
SOBP	55084	genome.wustl.edu	37	6	107956488	107956488	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr6:107956488C>T	ENST00000317357.5	+	6	3099	c.2440C>T	c.(2440-2442)Cat>Tat	p.H814Y	SOBP_ENST00000494935.1_3'UTR	NM_018013.3	NP_060483.3			sine oculis binding protein homolog (Drosophila)											endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	26		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		GGACGAGGACCATGCCTATGC	0.647																																																	0								ENSG00000112320						66.0	81.0	76.0					6																	107956488		2122	4238	6360	SOBP	SO:0001583	missense	0			-	HGNC	AK001021	CCDS43488.1	6q21	2007-03-15			ENSG00000112320	ENSG00000112320			29256	protein-coding gene	gene with protein product		613667					Standard	NM_018013		Approved	FLJ10159	uc003prx.3	A7XYQ1	OTTHUMG00000015312	ENST00000317357.5:c.2440C>T	6.37:g.107956488C>T	ENSP00000318900:p.His814Tyr	Somatic	0	39	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H814Y	ENST00000317357.5	37	c.2440	CCDS43488.1	6	.	.	.	.	.	.	.	.	.	.	C	24.1	4.493821	0.84962	.	.	ENSG00000112320	ENST00000317357;ENST00000230065	T	0.32515	1.45	4.7	4.7	0.59300	.	1.149520	0.06788	U	0.786566	T	0.39226	0.1070	L	0.29908	0.895	0.58432	D	0.999997	D	0.67145	0.996	D	0.75484	0.986	T	0.31613	-0.9937	10	0.72032	D	0.01	-2.4118	17.6084	0.88045	0.0:1.0:0.0:0.0	.	814	A7XYQ1	SOBP_HUMAN	Y	814;209	ENSP00000318900:H814Y	ENSP00000230065:H209Y	H	+	1	0	SOBP	108063181	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.361000	0.79497	2.130000	0.65690	0.462000	0.41574	CAT	-	NULL		0.647	SOBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOBP	protein_coding	OTTHUMT00000041693.2	C	NM_018013	-		107956488	+1	no_errors	ENST00000317357	ensembl	human	known	74_37	missense	SNP	1.000	T
SGIP1	84251	genome.wustl.edu	37	1	67142719	67142719	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr1:67142719G>T	ENST00000371037.4	+	13	756	c.679G>T	c.(679-681)Ggc>Tgc	p.G227C	SGIP1_ENST00000468286.1_3'UTR|SGIP1_ENST00000237247.6_Missense_Mutation_p.G231C|AL139147.1_ENST00000502413.2_5'Flank|SGIP1_ENST00000371035.3_Missense_Mutation_p.G184C|SGIP1_ENST00000371036.3_Missense_Mutation_p.G194C|SGIP1_ENST00000371039.1_Missense_Mutation_p.G195C	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	227	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						ATGGGGTTCAGGCCAACCAAT	0.388																																																	0								ENSG00000118473						120.0	120.0	120.0					1																	67142719		2203	4300	6503	SGIP1	SO:0001583	missense	0			-	HGNC	AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.679G>T	1.37:g.67142719G>T	ENSP00000360076:p.Gly227Cys	Somatic	0	28	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Muniscin_C-term_mu_dom,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	p.G231C	ENST00000371037.4	37	c.691	CCDS30744.1	1	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377353	0.61735	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000424320;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037	T;T;T;T;T;T	0.03358	3.96;3.96;3.96;3.96;3.96;3.96	5.35	4.44	0.53790	.	0.354548	0.33515	N	0.004825	T	0.01287	0.0042	N	0.14661	0.345	0.38778	D	0.954704	P	0.40000	0.698	B	0.40329	0.326	T	0.60816	-0.7188	10	0.54805	T	0.06	-7.3616	10.1944	0.43045	0.072:0.0:0.792:0.136	.	227	Q9BQI5	SGIP1_HUMAN	C	231;195;219;184;230;230;194;227	ENSP00000237247:G231C;ENSP00000360078:G195C;ENSP00000410439:G219C;ENSP00000360074:G184C;ENSP00000360075:G194C;ENSP00000360076:G227C	ENSP00000237247:G231C	G	+	1	0	SGIP1	66915307	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	3.135000	0.50546	1.256000	0.44068	0.655000	0.94253	GGC	-	NULL		0.388	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	protein_coding	OTTHUMT00000025395.4	G	NM_032291	-		67142719	+1	no_errors	ENST00000237247	ensembl	human	known	74_37	missense	SNP	1.000	T
MT-ND5	4540	genome.wustl.edu	37	M	12213	12213	+	5'Flank	SNP	G	G	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrM:12213G>T	ENST00000361567.2	+	0	0				MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TTACCGAGAAAGCTCACAAGA	0.403																																																	0								ENSG00000210184																																			MT-TS2	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915			M.37:g.12213G>T	Exception_encountered	Somatic	0	19	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	6	25.00	Q34773|Q8WCY3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361567.2	37	NULL		MT																																																																																			-	-		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-TS2	protein_coding		G	YP_003024036	-		12213	+1	no_errors	ENST00000387449	ensembl	human	known	74_37	rna	SNP	NULL	T
PSMB11	122706	genome.wustl.edu	37	14	23512330	23512330	+	Missense_Mutation	SNP	C	C	T	rs533259463		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr14:23512330C>T	ENST00000408907.2	+	1	955	c.896C>T	c.(895-897)aCg>aTg	p.T299M		NM_001099780.1	NP_001093250.1	A5LHX3	PSB11_HUMAN	proteasome (prosome, macropain) subunit, beta type, 11	299					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|kidney(2)|lung(4)	7	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		GGGACTGAGACGGTGTGAGAA	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19280	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000222028						18.0	20.0	20.0					14																	23512330		2079	4195	6274	PSMB11	SO:0001583	missense	0			-	HGNC		CCDS41923.1	14q11.2	2008-01-31				ENSG00000222028			31963	protein-coding gene	gene with protein product		611137				17540904	Standard	NM_001099780		Approved	beta5t	uc010ake.1	A5LHX3		ENST00000408907.2:c.896C>T	14.37:g.23512330C>T	ENSP00000386212:p.Thr299Met	Somatic	0	45	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	40	16.67		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.T299M	ENST00000408907.2	37	c.896	CCDS41923.1	14	.	.	.	.	.	.	.	.	.	.	C	12.21	1.869741	0.33069	.	.	ENSG00000222028	ENST00000408907	T	0.29655	1.56	3.6	-7.21	0.01490	.	.	.	.	.	T	0.13713	0.0332	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.33803	-0.9854	9	0.52906	T	0.07	.	10.4345	0.44428	0.0:0.1427:0.6451:0.2122	.	299	A5LHX3	PSB11_HUMAN	M	299	ENSP00000386212:T299M	ENSP00000386212:T299M	T	+	2	0	PSMB11	22582170	0.000000	0.05858	0.004000	0.12327	0.460000	0.32559	-2.566000	0.00917	-1.587000	0.01630	-0.367000	0.07326	ACG	-	NULL		0.647	PSMB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB11	protein_coding	OTTHUMT00000408294.1	C	NM_001099780	-		23512330	+1	no_errors	ENST00000408907	ensembl	human	known	74_37	missense	SNP	0.001	T
TP53	7157	genome.wustl.edu	37	17	7577580	7577580	+	Missense_Mutation	SNP	T	T	C	rs587780073		TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr17:7577580T>C	ENST00000269305.4	-	7	890	c.701A>G	c.(700-702)tAc>tGc	p.Y234C	TP53_ENST00000413465.2_Missense_Mutation_p.Y234C|TP53_ENST00000455263.2_Missense_Mutation_p.Y234C|TP53_ENST00000445888.2_Missense_Mutation_p.Y234C|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000359597.4_Missense_Mutation_p.Y234C|TP53_ENST00000420246.2_Missense_Mutation_p.Y234C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	234	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> K (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> N (in sporadic cancers; somatic mutation).|Y -> Q (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|Y -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y234C(94)|p.Y234S(9)|p.Y141C(8)|p.0?(8)|p.?(5)|p.Y234del(3)|p.Y141S(2)|p.I232_Y236delIHYNY(1)|p.Y234fs*2(1)|p.Y234F(1)|p.T230_Y234delTTIHY(1)|p.H233fs*6(1)|p.Y234R(1)|p.V225fs*23(1)|p.D228fs*12(1)|p.Y234fs*5(1)|p.Y234fs*4(1)|p.I232fs*5(1)|p.H233_C242del10(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATGTAGTTGTAGTGGATGGT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	141	Substitution - Missense(115)|Whole gene deletion(8)|Deletion - Frameshift(7)|Deletion - In frame(6)|Unknown(5)	lung(32)|haematopoietic_and_lymphoid_tissue(17)|breast(17)|ovary(15)|central_nervous_system(10)|urinary_tract(9)|upper_aerodigestive_tract(8)|oesophagus(7)|biliary_tract(6)|large_intestine(5)|kidney(4)|bone(4)|cervix(2)|stomach(2)|adrenal_gland(1)|skin(1)|liver(1)	GRCh37	CM035576	TP53	M		ENSG00000141510						119.0	95.0	103.0					17																	7577580		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.701A>G	17.37:g.7577580T>C	ENSP00000269305:p.Tyr234Cys	Somatic	0	70	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	3	94.74	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y234C	ENST00000269305.4	37	c.701	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	16.52	3.146603	0.57044	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99826	-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98;-6.98	4.62	3.49	0.39957	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.211900	0.41823	D	0.000804	D	0.99778	0.9908	M	0.88105	2.93	0.51012	D	0.999909	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.982;0.998;0.997;0.985;0.994;0.999	D	0.98045	1.0384	10	0.87932	D	0	-10.1131	9.0203	0.36195	0.1783:0.0:0.0:0.8216	.	234;234;141;234;234;234	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	C	234;234;234;234;234;234;223;141;102;141	ENSP00000410739:Y234C;ENSP00000352610:Y234C;ENSP00000269305:Y234C;ENSP00000398846:Y234C;ENSP00000391127:Y234C;ENSP00000391478:Y234C;ENSP00000425104:Y102C;ENSP00000423862:Y141C	ENSP00000269305:Y234C	Y	-	2	0	TP53	7518305	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.037000	0.41174	0.835000	0.34877	0.379000	0.24179	TAC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	-		7577580	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	C
FBXO30	84085	genome.wustl.edu	37	6	146126375	146126375	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr6:146126375G>T	ENST00000237281.4	-	2	1333	c.1167C>A	c.(1165-1167)ttC>ttA	p.F389L		NM_032145.4	NP_115521.3	Q8TB52	FBX30_HUMAN	F-box protein 30	389	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		AAAGAAAATTGAATGAAGGAG	0.393																																																	0								ENSG00000118496						157.0	156.0	156.0					6																	146126375		2203	4300	6503	FBXO30	SO:0001583	missense	0			-	HGNC	AF248640	CCDS5208.1	6q24	2008-02-05	2004-06-15		ENSG00000118496	ENSG00000118496		"""F-boxes /  ""other"""""	15600	protein-coding gene	gene with protein product		609101	"""F-box only protein, helicase, 18"""				Standard	XM_005267159		Approved	MGC21674, Fbx30	uc003qla.3	Q8TB52	OTTHUMG00000015749	ENST00000237281.4:c.1167C>A	6.37:g.146126375G>T	ENSP00000237281:p.Phe389Leu	Somatic	0	67	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q9BXZ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_F-box_dom,superfamily_F-box_dom,superfamily_TRAF-like,pfscan_F-box_dom,pfscan_Znf_TRAF	p.F389L	ENST00000237281.4	37	c.1167	CCDS5208.1	6	.	.	.	.	.	.	.	.	.	.	G	1.924	-0.447550	0.04572	.	.	ENSG00000118496	ENST00000237281	T	0.18502	2.21	5.46	3.64	0.41730	.	0.211973	0.50627	N	0.000117	T	0.03739	0.0106	L	0.47716	1.5	0.31949	N	0.609955	B	0.06786	0.001	B	0.04013	0.001	T	0.40515	-0.9559	10	0.02654	T	1	-1.4169	9.2805	0.37725	0.0733:0.2765:0.6502:0.0	.	389	Q8TB52	FBX30_HUMAN	L	389	ENSP00000237281:F389L	ENSP00000237281:F389L	F	-	3	2	FBXO30	146168068	1.000000	0.71417	0.996000	0.52242	0.950000	0.60333	2.178000	0.42519	0.759000	0.33084	-0.165000	0.13383	TTC	-	NULL		0.393	FBXO30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO30	protein_coding	OTTHUMT00000042570.2	G		-		146126375	-1	no_errors	ENST00000237281	ensembl	human	known	74_37	missense	SNP	0.999	T
WDR87	83889	genome.wustl.edu	37	19	38378740	38378740	+	Silent	SNP	T	T	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr19:38378740T>C	ENST00000303868.5	-	6	5678	c.5454A>G	c.(5452-5454)agA>agG	p.R1818R	WDR87_ENST00000447313.2_Silent_p.R1857R	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1818	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TGTTGATCCATCTTTCCCTTT	0.443																																																	0								ENSG00000171804						222.0	155.0	175.0					19																	38378740		692	1591	2283	WDR87	SO:0001819	synonymous_variant	0			-	HGNC	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.5454A>G	19.37:g.38378740T>C		Somatic	0	116	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	13	77.59	Q9BWV9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1857	ENST00000303868.5	37	c.5571	CCDS46063.1	19																																																																																			-	superfamily_ARM-type_fold		0.443	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	protein_coding	OTTHUMT00000314628.2	T	XM_940478	-		38378740	-1	no_errors	ENST00000447313	ensembl	human	known	74_37	silent	SNP	0.000	C
RAD54L2	23132	genome.wustl.edu	37	3	51669630	51669630	+	Missense_Mutation	SNP	A	A	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr3:51669630A>C	ENST00000409535.2	+	9	1289	c.1164A>C	c.(1162-1164)aaA>aaC	p.K388N	RAD54L2_ENST00000296477.3_Missense_Mutation_p.K82N	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	388	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CTCGTGCTAAAGTGATGGCTG	0.463																																																	0								ENSG00000164080						125.0	112.0	116.0					3																	51669630		2203	4300	6503	RAD54L2	SO:0001583	missense	0			-	HGNC	AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.1164A>C	3.37:g.51669630A>C	ENSP00000386520:p.Lys388Asn	Somatic	0	36	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	28	44.00	Q8TB57|Q9BV54	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K388N	ENST00000409535.2	37	c.1164	CCDS33765.2	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.95|15.95	2.983535|2.983535	0.53827|0.53827	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000409535;ENST00000296477|ENST00000432863	D;D|.	0.93659|.	-3.26;-3.26|.	5.43|5.43	3.11|3.11	0.35812|0.35812	DEAD-like helicase (2);SNF2-related (1);|.	0.042343|.	0.85682|.	D|.	0.000000|.	T|T	0.43433|0.43433	0.1247|0.1247	L|L	0.28776|0.28776	0.89|0.89	0.52501|0.52501	D|D	0.999956|0.999956	B|.	0.30021|.	0.265|.	B|.	0.39706|.	0.307|.	T|T	0.20907|0.20907	-1.0261|-1.0261	10|5	0.36615|.	T|.	0.2|.	-2.7906|-2.7906	7.5205|7.5205	0.27624|0.27624	0.8232:0.0:0.1767:0.0|0.8232:0.0:0.1767:0.0	.|.	388|.	Q9Y4B4|.	ARIP4_HUMAN|.	N|R	388;82|217	ENSP00000386520:K388N;ENSP00000296477:K82N|.	ENSP00000296477:K82N|.	K|S	+|+	3|1	2|0	RAD54L2|RAD54L2	51644670|51644670	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.708000|1.708000	0.37899|0.37899	2.069000|2.069000	0.61940|0.61940	0.533000|0.533000	0.62120|0.62120	AAA|AGT	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.463	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	protein_coding	OTTHUMT00000328700.2	A	NM_015106	-		51669630	+1	no_errors	ENST00000409535	ensembl	human	known	74_37	missense	SNP	1.000	C
RABGGTB	5876	genome.wustl.edu	37	1	76259678	76259714	+	Intron	DEL	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	-	rs372421559|rs377221880|rs75986168|rs141490560|rs377745023	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr1:76259678_76259714delCCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	ENST00000319942.3	+	8	776				RABGGTB_ENST00000496055.1_Intron|MSH4_ENST00000263187.3_5'Flank|RABGGTB_ENST00000535300.1_Intron	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit						cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						CATCAGATTACCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCTCAAAATTAGG	0.376														911	0.181909	0.1604	0.2781	5008	,	,		24903	0.0169		0.2843	False		,,,				2504	0.2076																0								ENSG00000137955																																			RABGGTB	SO:0001627	intron_variant	0				HGNC	U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.706-55CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT>-	1.37:g.76259678_76259714delCCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT		Somatic	NA	NA	NA		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q92697	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000319942.3	37	NULL	CCDS669.1	1																																																																																			-	-		0.376	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	protein_coding	OTTHUMT00000026972.1	CCTAAGAGTGAGACTTAACCCACTTTTAAATTGTTCT	NM_004582			76259714	+1	no_errors	ENST00000459697	ensembl	human	known	74_37	rna	DEL	0.002:0.001:0.001:0.000:0.002:0.005:0.008:0.009:0.007:0.005:0.003:0.003:0.001:0.001:0.002:0.001:0.001:0.001:0.000:0.000:0.000:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000	-
LRP2	4036	genome.wustl.edu	37	2	169999283	169999283	+	Missense_Mutation	SNP	T	T	C			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:169999283T>C	ENST00000263816.3	-	71	13294	c.13009A>G	c.(13009-13011)Atc>Gtc	p.I4337V		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4337	EGF-like 16. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGGCTGCAGATCTGTTTGCAA	0.542																																																	0								ENSG00000081479						118.0	113.0	115.0					2																	169999283		2203	4300	6503	LRP2	SO:0001583	missense	0			-	HGNC		CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.13009A>G	2.37:g.169999283T>C	ENSP00000263816:p.Ile4337Val	Somatic	0	66	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	45	35.71	O00711|Q16215	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.I4337V	ENST00000263816.3	37	c.13009	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	T	1.467	-0.560837	0.03939	.	.	ENSG00000081479	ENST00000263816	D	0.89196	-2.48	5.86	2.09	0.27110	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.318407	0.33127	N	0.005252	T	0.58524	0.2128	N	0.00146	-1.995	0.58432	D	0.999997	B	0.02656	0.0	B	0.04013	0.001	T	0.49485	-0.8935	10	0.12430	T	0.62	.	9.3347	0.38043	0.0:0.7346:0.0:0.2654	.	4337	P98164	LRP2_HUMAN	V	4337	ENSP00000263816:I4337V	ENSP00000263816:I4337V	I	-	1	0	LRP2	169707529	0.212000	0.23540	0.156000	0.22583	0.109000	0.19521	0.753000	0.26376	0.175000	0.19841	-0.924000	0.02725	ATC	-	superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom		0.542	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	protein_coding	OTTHUMT00000255231.2	T	NM_004525	-		169999283	-1	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	SNP	0.636	C
KIF9	64147	genome.wustl.edu	37	3	47287688	47287688	+	Splice_Site	SNP	T	T	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr3:47287688T>A	ENST00000265529.3	-	14	1968	c.1288A>T	c.(1288-1290)Agc>Tgc	p.S430C	KIF9_ENST00000352910.4_Splice_Site_p.S337C|KIF9-AS1_ENST00000429315.3_RNA|KIF9_ENST00000487440.1_5'UTR|KIF9_ENST00000444589.2_Splice_Site_p.S430C|KIF9_ENST00000335044.2_Splice_Site_p.S430C|KIF9_ENST00000452770.2_Splice_Site_p.S430C			Q9HAQ2	KIF9_HUMAN	kinesin family member 9	430					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle disassembly (GO:1903008)|regulation of podosome assembly (GO:0071801)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|podosome (GO:0002102)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|protein dimerization activity (GO:0046983)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(15)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)	34		Acute lymphoblastic leukemia(5;0.164)		BRCA - Breast invasive adenocarcinoma(193;0.000284)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GTCTCTCACCTCAGAACCACC	0.537																																					Colon(44;962 1147 15977 24541)												0								ENSG00000088727						68.0	54.0	59.0					3																	47287688		2202	4300	6502	KIF9	SO:0001630	splice_region_variant	0			-	HGNC	AF311212	CCDS2751.1, CCDS2752.1	3p21.31	2008-03-03			ENSG00000088727	ENSG00000088727		"""Kinesins"""	16666	protein-coding gene	gene with protein product		607910				11483511	Standard	NM_022342		Approved	MGC104186	uc003cqx.3	Q9HAQ2	OTTHUMG00000133512	ENST00000265529.3:c.1289+1A>T	3.37:g.47287688T>A		Somatic	0	74	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	31	53.73	Q86Z28|Q9H8A4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S430C	ENST00000265529.3	37	c.1288	CCDS2752.1	3	.	.	.	.	.	.	.	.	.	.	T	14.84	2.654078	0.47362	.	.	ENSG00000088727	ENST00000335044;ENST00000265529;ENST00000444589;ENST00000452770;ENST00000352910	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	5.16	5.16	0.70880	.	0.332353	0.36444	N	0.002597	T	0.54759	0.1878	L	0.44542	1.39	0.28649	N	0.90677	D;P	0.60575	0.988;0.943	P;B	0.57244	0.816;0.428	T	0.54774	-0.8243	10	0.66056	D	0.02	.	12.9933	0.58632	0.0:0.0:0.0:1.0	.	430;430	Q9HAQ2-2;Q9HAQ2	.;KIF9_HUMAN	C	430;430;430;430;337	ENSP00000333942:S430C;ENSP00000265529:S430C;ENSP00000414987:S430C;ENSP00000391100:S430C;ENSP00000292334:S337C	ENSP00000265529:S430C	S	-	1	0	KIF9	47262692	1.000000	0.71417	1.000000	0.80357	0.013000	0.08279	3.691000	0.54720	2.174000	0.68829	0.528000	0.53228	AGC	-	NULL		0.537	KIF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF9	protein_coding	OTTHUMT00000257475.2	T		-	Missense_Mutation	47287688	-1	no_errors	ENST00000265529	ensembl	human	known	74_37	missense	SNP	1.000	A
ANAPC1	64682	genome.wustl.edu	37	2	112536331	112536331	+	Missense_Mutation	SNP	T	T	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr2:112536331T>A	ENST00000341068.3	-	45	6078	c.5306A>T	c.(5305-5307)gAt>gTt	p.D1769V		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1769					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						AGAAAAGAGATCCAGAATTTC	0.383																																																	0								ENSG00000153107						57.0	53.0	55.0					2																	112536331		2200	4294	6494	ANAPC1	SO:0001583	missense	0			-	HGNC	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.5306A>T	2.37:g.112536331T>A	ENSP00000339109:p.Asp1769Val	Somatic	0	159	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	78	43.48	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D1769V	ENST00000341068.3	37	c.5306	CCDS2093.1	2	.	.	.	.	.	.	.	.	.	.	T	7.986	0.752153	0.15778	.	.	ENSG00000153107	ENST00000341068	.	.	.	4.05	4.05	0.47172	.	0.109079	0.36167	N	0.002749	T	0.44623	0.1302	L	0.40543	1.245	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.33879	-0.9851	9	0.28530	T	0.3	-8.3828	8.8988	0.35481	0.0:0.0904:0.0:0.9096	.	1769	Q9H1A4	APC1_HUMAN	V	1769	.	ENSP00000339109:D1769V	D	-	2	0	ANAPC1	112252802	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.710000	0.47169	1.585000	0.49928	0.454000	0.30748	GAT	-	NULL		0.383	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	protein_coding	OTTHUMT00000254045.2	T	NM_022662	-		112536331	-1	no_errors	ENST00000341068	ensembl	human	known	74_37	missense	SNP	1.000	A
REPIN1	29803	genome.wustl.edu	37	7	150069396	150069407	+	In_Frame_Del	DEL	CCGCCAGGGGCC	CCGCCAGGGGCC	-	rs3832490	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	CCGCCAGGGGCC	CCGCCAGGGGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr7:150069396_150069407delCCGCCAGGGGCC	ENST00000425389.2	+	1	1144_1155	c.1066_1077delCCGCCAGGGGCC	c.(1066-1077)ccgccaggggccdel	p.PPGA356del	REPIN1_ENST00000540729.1_In_Frame_Del_p.PPGA356del|REPIN1_ENST00000444957.1_In_Frame_Del_p.PPGA356del|REPIN1_ENST00000479668.1_3'UTR|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000489432.2_In_Frame_Del_p.PPGA413del|REPIN1_ENST00000397281.2_In_Frame_Del_p.PPGA356del	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	356	Pro-rich.				DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.P356_A359delPPGA(1)		cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			CCAGGAGCCGCCGCCAGGGGCCCCGCCAGAGC	0.783														714	0.142572	0.3207	0.0533	5008	,	,		8637	0.0724		0.0348	False		,,,				2504	0.1483																1	Deletion - In frame(1)	prostate(1)						ENSG00000214022		,,,	481,1369		176,129,620					,,,	-7.4	0.0		dbSNP_107	1	202,4558		64,74,2242	no	coding,coding,coding,coding	REPIN1	NM_014374.3,NM_013400.3,NM_001099696.2,NM_001099695.1	,,,	240,203,2862	A1A1,A1R,RR		4.2437,26.0,10.3328	,,,	,,,		683,5927				REPIN1	SO:0001651	inframe_deletion	0				HGNC	AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.1066_1077delCCGCCAGGGGCC	7.37:g.150069396_150069407delCCGCCAGGGGCC	ENSP00000388287:p.Pro356_Ala359del	Somatic	NA	NA	NA		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.GAPP415in_frame_del	ENST00000425389.2	37	c.1237_1248	CCDS43677.1	7																																																																																			-	NULL		0.783	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	REPIN1	protein_coding	OTTHUMT00000376940.1	CCGCCAGGGGCC	NM_014374			150069407	+1	no_errors	ENST00000489432	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001	-
SCML2	10389	genome.wustl.edu	37	X	18257646	18257646	+	3'UTR	SNP	T	T	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chrX:18257646T>A	ENST00000251900.4	-	0	3987				SCML2_ENST00000491988.1_5'UTR	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)						anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					CTAAAGTACATTTGGTTTTCT	0.289																																					Esophageal Squamous(100;1252 1965 19021 35517)												0								ENSG00000102098																																			SCML2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.*1725A>T	X.37:g.18257646T>A		Somatic	0	106	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	66	44.07	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000251900.4	37	NULL	CCDS14185.1	X																																																																																			-	-		0.289	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCML2	protein_coding	OTTHUMT00000055941.1	T	NM_006089	-		18257646	-1	no_errors	ENST00000491988	ensembl	human	known	74_37	rna	SNP	1.000	A
CPNE6	9362	genome.wustl.edu	37	14	24545608	24545608	+	Silent	SNP	C	C	T			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr14:24545608C>T	ENST00000397016.2	+	13	1409	c.1098C>T	c.(1096-1098)atC>atT	p.I366I	CPNE6_ENST00000537691.1_Silent_p.I421I|CPNE6_ENST00000216775.2_Silent_p.I366I	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	366	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		GGGCTCGAATCCCCCCCAACT	0.602																																																	0								ENSG00000100884						117.0	125.0	122.0					14																	24545608		2203	4300	6503	CPNE6	SO:0001819	synonymous_variant	0			-	HGNC	AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.1098C>T	14.37:g.24545608C>T		Somatic	0	37	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.I421	ENST00000397016.2	37	c.1263	CCDS9607.1	14																																																																																			-	pfam_Copine,smart_VWF_A,pfscan_VWF_A		0.602	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE6	protein_coding	OTTHUMT00000071869.5	C		-		24545608	+1	no_errors	ENST00000537691	ensembl	human	known	74_37	silent	SNP	0.986	T
COL6A6	131873	genome.wustl.edu	37	3	130293060	130293060	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr3:130293060G>A	ENST00000358511.6	+	7	3269	c.3238G>A	c.(3238-3240)Ggt>Agt	p.G1080S	COL6A6_ENST00000453409.2_Missense_Mutation_p.G1080S	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	1080	Nonhelical region.|VWFA 6. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.G1080S(1)		NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CACACACATCGGTGCTGCACT	0.473																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000206384						98.0	98.0	98.0					3																	130293060		1998	4172	6170	COL6A6	SO:0001583	missense	0			-	HGNC	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.3238G>A	3.37:g.130293060G>A	ENSP00000351310:p.Gly1080Ser	Somatic	0	16	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	8	50.00	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G1080S	ENST00000358511.6	37	c.3238	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481386	0.63849	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.85629	-2.01;-2.01	5.0	5.0	0.66597	von Willebrand factor, type A (3);	0.000000	0.56097	D	0.000021	D	0.94079	0.8102	M	0.91510	3.215	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.95184	0.8302	10	0.72032	D	0.01	.	18.2589	0.90028	0.0:0.0:1.0:0.0	.	1080	A6NMZ7	CO6A6_HUMAN	S	1080	ENSP00000351310:G1080S;ENSP00000399236:G1080S	ENSP00000351310:G1080S	G	+	1	0	COL6A6	131775750	1.000000	0.71417	0.687000	0.30102	0.021000	0.10359	9.383000	0.97214	2.480000	0.83734	0.561000	0.74099	GGT	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.473	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	protein_coding	OTTHUMT00000356705.5	G	NM_001102608	-		130293060	+1	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	SNP	1.000	A
BCR	613	genome.wustl.edu	37	22	23652503	23652503	+	Intron	SNP	T	T	C	rs201201470	byFrequency	TCGA-IE-A4EH-01A-11D-A24N-09	TCGA-IE-A4EH-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bfcee5bd-7c24-4f45-a3a6-2aefd4849b0e	cd00cebf-c6ff-4950-9836-85300c25b19b	g.chr22:23652503T>C	ENST00000305877.8	+	18	3823				BCR_ENST00000359540.3_Intron|BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.?(1)	BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	CCCTTCTCCCTACTGTAGATC	0.532			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""								C|||	1567	0.312899	0.2784	0.2305	5008	,	,		15891	0.621		0.2227	False		,,,				2504	0.1933							Dom	yes		22	22q11.21	613	breakpoint cluster region		L	1	Unknown(1)	stomach(1)						ENSG00000186716						47.0	46.0	46.0					22																	23652503		1653	3598	5251	BCR	SO:0001627	intron_variant	0			-	HGNC		CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3073-8T>C	22.37:g.23652503T>C		Somatic	0	64	0.00		0.7041195523825613	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44	P78501|Q12842|Q4LE80|Q6NZI3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			-	-		0.532	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	protein_coding	OTTHUMT00000075819.1	T	NM_004327	rs201201470		23652503	+1	no_errors	ENST00000419722	ensembl	human	known	74_37	rna	SNP	0.000	C
