#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
IL2RA	3559	genome.wustl.edu	37	10	6060047	6060047	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr10:6060047G>T	ENST00000379959.3	-	7	936	c.763C>A	c.(763-765)Ctc>Atc	p.L255I	SNORA14_ENST00000516113.1_RNA|IL2RA_ENST00000256876.6_Missense_Mutation_p.L246I|IL2RA_ENST00000379954.1_Missense_Mutation_p.L183I	NM_000417.2	NP_000408.1	P01589	IL2RA_HUMAN	interleukin 2 receptor, alpha	255					activation-induced cell death of T cells (GO:0006924)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of defense response to virus (GO:0050687)|negative regulation of immune response (GO:0050777)|negative regulation of inflammatory response (GO:0050728)|negative regulation of T cell proliferation (GO:0042130)|Notch signaling pathway (GO:0007219)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of T cell differentiation (GO:0045582)|regulation of T cell homeostatic proliferation (GO:0046013)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|interleukin-2 receptor activity (GO:0004911)			endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	CCACTCAGGAGGAGGACGCTG	0.612																																																	0								ENSG00000134460						58.0	50.0	53.0					10																	6060047		2203	4300	6503	IL2RA	SO:0001583	missense	0			-	HGNC	X01057	CCDS7076.1	10p15-p14	2014-09-17			ENSG00000134460	ENSG00000134460		"""Interleukins and interleukin receptors"", ""CD molecules"""	6008	protein-coding gene	gene with protein product		147730	"""insulin-dependent diabetes mellitus 10"""	IL2R, IDDM10		3925551, 17676041	Standard	NM_000417		Approved	CD25	uc001iiz.2	P01589	OTTHUMG00000017616	ENST00000379959.3:c.763C>A	10.37:g.6060047G>T	ENSP00000369293:p.Leu255Ile	Somatic	0	36	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q5W007	Missense_Mutation	SNP	20	0.00	0	41	0.00	0	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.L255I	ENST00000379959.3	37	c.763	CCDS7076.1	10	.	.	.	.	.	.	.	.	.	.	G	11.70	1.715716	0.30413	.	.	ENSG00000134460	ENST00000379959;ENST00000397240;ENST00000379954;ENST00000256876	T;T;T	0.56444	1.12;0.46;1.25	3.25	2.34	0.29019	.	0.141489	0.31167	N	0.008137	T	0.65186	0.2667	M	0.70275	2.135	0.20307	N	0.999911	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.987	T	0.52917	-0.8511	10	0.66056	D	0.02	-13.0263	6.4794	0.22055	0.1354:0.0:0.8646:0.0	.	183;255	Q5W005;P01589	.;IL2RA_HUMAN	I	255;145;183;246	ENSP00000369293:L255I;ENSP00000369287:L183I;ENSP00000256876:L246I	ENSP00000256876:L246I	L	-	1	0	IL2RA	6100053	0.843000	0.29541	0.334000	0.25495	0.093000	0.18481	0.857000	0.27831	0.921000	0.36994	-0.258000	0.10820	CTC	-	NULL		0.612	IL2RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL2RA	protein_coding	OTTHUMT00000046627.1	G	NM_000417	-		6060047	-1	no_errors	ENST00000379959	ensembl	human	known	74_37	missense	SNP	0.485	T
MED12L	116931	genome.wustl.edu	37	3	151101578	151101578	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr3:151101578G>A	ENST00000474524.1	+	32	4625	c.4587G>A	c.(4585-4587)atG>atA	p.M1529I	MED12L_ENST00000273432.4_Missense_Mutation_p.M1389I|P2RY12_ENST00000302632.3_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1529						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TAGGAGGAATGTTTGACACGG	0.408																																																	0								ENSG00000144893						80.0	75.0	77.0					3																	151101578		2203	4300	6503	MED12L	SO:0001583	missense	0			-	HGNC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4587G>A	3.37:g.151101578G>A	ENSP00000417235:p.Met1529Ile	Somatic	0	59	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	32	38.46	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	39	0.00	0	18	63.27	31	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.M1529I	ENST00000474524.1	37	c.4587	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807832	0.90623	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.63417	0.12;-0.04	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.75125	0.3807	M	0.69823	2.125	0.80722	D	1	P;B;B	0.49862	0.929;0.112;0.275	P;B;B	0.53549	0.729;0.076;0.075	T	0.76790	-0.2829	10	0.87932	D	0	-31.7279	19.8936	0.96942	0.0:0.0:1.0:0.0	.	1389;1528;1529	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	I	1529;1389	ENSP00000417235:M1529I;ENSP00000273432:M1389I	ENSP00000273432:M1389I	M	+	3	0	MED12L	152584268	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.520000	0.98027	2.793000	0.96121	0.655000	0.94253	ATG	-	NULL		0.408	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	protein_coding	OTTHUMT00000357707.2	G	NM_053002	-		151101578	+1	no_errors	ENST00000474524	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM204A	63877	genome.wustl.edu	37	10	120081869	120081869	+	Intron	SNP	C	C	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr10:120081869C>T	ENST00000369183.4	-	7	803				FAM204A_ENST00000369172.4_Intron|FAM204A_ENST00000469758.1_5'UTR	NM_022063.2	NP_071346.1	Q9H8W3	F204A_HUMAN	family with sequence similarity 204, member A											kidney(1)|large_intestine(5)|lung(4)|ovary(1)	11						agagacagcacgagtctctgg	0.408																																																	0								ENSG00000165669																																			FAM204A	SO:0001627	intron_variant	0			-	HGNC	AK023250	CCDS7605.1	10q26.12	2011-06-01	2011-06-01	2011-06-01	ENSG00000165669	ENSG00000165669			25794	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 84"""	C10orf84		12477932	Standard	NM_022063		Approved	FLJ13188, bA319I23.1	uc010qss.1	Q9H8W3	OTTHUMG00000019131	ENST00000369183.4:c.543+3796G>A	10.37:g.120081869C>T		Somatic	0	22	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	2	86.67	D3DRC6|Q5T373|Q9H5V5	Missense_Mutation	SNP	26	0.00	0	0	100.00	39	NULL	p.V200M	ENST00000369183.4	37	c.598	CCDS7605.1	10																																																																																			-	NULL		0.408	FAM204A-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM204A	protein_coding	OTTHUMT00000050596.2	C	NM_022063	-		120081869	-1	no_errors	ENST00000470476	ensembl	human	known	74_37	missense	SNP	0.000	T
AR	367	genome.wustl.edu	37	X	66765155	66765155	+	Missense_Mutation	SNP	T	T	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chrX:66765155T>A	ENST00000374690.3	+	1	691	c.167T>A	c.(166-168)cTg>cAg	p.L56Q	AR_ENST00000504326.1_Missense_Mutation_p.L56Q|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.L56Q	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	56	Modulating.|Poly-Leu.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	AGTTTGCTGCTGCTgcagcag	0.662									Androgen Insensitivity Syndrome																																								0								ENSG00000169083						10.0	13.0	12.0					X																	66765155		2155	4231	6386	AR	SO:0001583	missense	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	-	HGNC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.167T>A	X.37:g.66765155T>A	ENSP00000363822:p.Leu56Gln	Somatic	0	15	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	17	22.73	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	9	18.18	2	20	4.76	1	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.L56Q	ENST00000374690.3	37	c.167	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	N	8.315	0.823004	0.16678	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.59224	0.28;0.28;0.28	.	.	.	.	0.160911	0.29861	N	0.011003	T	0.42854	0.1221	N	0.02539	-0.55	0.09310	N	0.999999	B;B;D	0.76494	0.001;0.002;0.999	B;B;D	0.87578	0.0;0.0;0.998	T	0.42172	-0.9467	8	0.22109	T	0.4	.	.	.	.	.	56;56;54	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	Q	56	ENSP00000363822:L56Q;ENSP00000421155:L56Q;ENSP00000379359:L56Q	ENSP00000363822:L56Q	L	+	2	0	AR	66681880	1.000000	0.71417	0.901000	0.35422	0.483000	0.33249	0.417000	0.21214	0.000000	0.14550	0.000000	0.15137	CTG	-	pfam_Andrgn_rcpt		0.662	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	protein_coding	OTTHUMT00000057007.1	T	NM_000044	-		66765155	+1	no_errors	ENST00000374690	ensembl	human	known	74_37	missense	SNP	0.942	A
OPTC	26254	genome.wustl.edu	37	1	203468847	203468847	+	Silent	SNP	A	A	G			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr1:203468847A>G	ENST00000367222.2	+	5	716	c.600A>G	c.(598-600)ctA>ctG	p.L200L		NM_014359.3	NP_055174.1	Q9UBM4	OPT_HUMAN	opticin	200					negative regulation of angiogenesis (GO:0016525)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			breast(1)|cervix(1)|kidney(5)|large_intestine(3)|lung(8)|pancreas(1)|stomach(1)	20			BRCA - Breast invasive adenocarcinoma(75;0.109)			TCCGCCTGCTACATGCCCTCC	0.537																																																	0								ENSG00000188770						229.0	224.0	226.0					1																	203468847		2203	4300	6503	OPTC	SO:0001819	synonymous_variant	0			-	HGNC	AF161702	CCDS1439.1	1q31	2008-02-05			ENSG00000188770	ENSG00000188770			8158	protein-coding gene	gene with protein product	"""oculoglycan"""	605127				10636917	Standard	NM_014359		Approved		uc001gzu.1	Q9UBM4	OTTHUMG00000036100	ENST00000367222.2:c.600A>G	1.37:g.203468847A>G		Somatic	0	79	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	41	51.19	Q5T2G4	Silent	SNP	27	0.00	0	14	50.00	14	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L200	ENST00000367222.2	37	c.600	CCDS1439.1	1																																																																																			-	smart_Leu-rich_rpt_typical-subtyp		0.537	OPTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPTC	protein_coding	OTTHUMT00000087964.1	A	NM_014359	-		203468847	+1	no_errors	ENST00000367222	ensembl	human	known	74_37	silent	SNP	0.997	G
FAM57A	79850	genome.wustl.edu	37	17	636266	636267	+	Intron	INS	-	-	GGGCC	rs141977343|rs3830920	byFrequency	TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr17:636266_636267insGGGCC	ENST00000308278.8	+	2	358				FAM57A_ENST00000301324.8_Intron|FAM57A_ENST00000572018.1_Intron	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		GTCAGGCCGAAGGGCCGGGCCG	0.762														2438	0.486821	0.3351	0.5173	5008	,	,		10677	0.6022		0.4692	False		,,,				2504	0.5695																0								ENSG00000167695																																			FAM57A	SO:0001627	intron_variant	0				HGNC	AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.123-71->GGGCC	17.37:g.636272_636276dupGGGCC		Somatic	NA	NA	NA		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Frame_Shift_Ins	INS	7	36.36	4	2	87.50	14	NULL	p.P131fs	ENST00000308278.8	37	c.379_380	CCDS10996.1	17																																																																																			-	NULL		0.762	FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM57A	protein_coding	OTTHUMT00000437155.2	-	NM_024792			636267	+1	no_errors	ENST00000574327	ensembl	human	known	74_37	frame_shift_ins	INS	0.000:0.000	GGGCC
ARID1B	57492	genome.wustl.edu	37	6	157521934	157521934	+	Silent	SNP	G	G	A	rs139512931		TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr6:157521934G>A	ENST00000350026.5	+	17	4168	c.4167G>A	c.(4165-4167)gaG>gaA	p.E1389E	ARID1B_ENST00000275248.4_Silent_p.E1384E|ARID1B_ENST00000367148.1_Silent_p.E1442E|ARID1B_ENST00000346085.5_Silent_p.E1402E	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1389					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		AGCAGCAGGAGATGTACAACC	0.617																																																	0								ENSG00000049618	G	,	0,4406		0,0,2203	60.0	64.0	63.0		4167,4206	-0.5	1.0	6	dbSNP_134	63	2,8590	2.2+/-6.3	0,2,4294	no	coding-synonymous,coding-synonymous	ARID1B	NM_017519.2,NM_020732.3	,	0,2,6497	AA,AG,GG		0.0233,0.0,0.0154	,	1389/2237,1402/2250	157521934	2,12996	2203	4296	6499	ARID1B	SO:0001819	synonymous_variant	0			-	HGNC	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4167G>A	6.37:g.157521934G>A		Somatic	0	41	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	35	0.00	0	36	7.69	3	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.E1442	ENST00000350026.5	37	c.4326	CCDS5251.2	6																																																																																			-	NULL		0.617	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	protein_coding	OTTHUMT00000372723.1	G	NM_020732	rs139512931		157521934	+1	no_errors	ENST00000367148	ensembl	human	known	74_37	silent	SNP	0.987	A
PMS1	5378	genome.wustl.edu	37	2	190728845	190728845	+	Missense_Mutation	SNP	A	A	G			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr2:190728845A>G	ENST00000441310.2	+	10	2466	c.2233A>G	c.(2233-2235)Atg>Gtg	p.M745V	PMS1_ENST00000447232.2_Intron|PMS1_ENST00000409823.3_Missense_Mutation_p.M706V|PMS1_ENST00000418224.3_Missense_Mutation_p.M569V|PMS1_ENST00000432292.3_Missense_Mutation_p.M569V	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	745					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			AACAGAGGTAATGTTATTAAA	0.373			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																															yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0								ENSG00000064933						112.0	122.0	118.0					2																	190728845		2203	4300	6503	PMS1	SO:0001583	missense	0			-	HGNC		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.2233A>G	2.37:g.190728845A>G	ENSP00000406490:p.Met745Val	Somatic	0	42	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	27	0.00	0	51	0.00	0	pfam_DNA_mismatch_repair_C,pfam_HMG_box_dom,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom,tigrfam_DNA_mismatch_repair_N	p.M745V	ENST00000441310.2	37	c.2233	CCDS2302.1	2	.	.	.	.	.	.	.	.	.	.	A	12.28	1.892043	0.33442	.	.	ENSG00000064933	ENST00000441310;ENST00000418224;ENST00000409823;ENST00000432292;ENST00000424307;ENST00000452382	T;T;T;T;D;T	0.87571	1.88;1.88;1.88;1.88;-2.27;1.88	5.45	5.45	0.79879	.	0.191150	0.64402	D	0.000003	D	0.83468	0.5261	L	0.56769	1.78	0.37555	D	0.918852	B;B;B	0.15141	0.012;0.012;0.012	B;B;B	0.16289	0.015;0.014;0.015	T	0.80741	-0.1247	10	0.36615	T	0.2	-12.7833	10.1139	0.42579	0.9261:0.0:0.0739:0.0	.	745;706;745	Q4VAL4;Q5FBZ3;P54277	.;.;PMS1_HUMAN	V	745;569;706;569;684;133	ENSP00000406490:M745V;ENSP00000404492:M569V;ENSP00000387125:M706V;ENSP00000398378:M569V;ENSP00000389938:M684V;ENSP00000396232:M133V	ENSP00000387125:M706V	M	+	1	0	PMS1	190437090	1.000000	0.71417	0.992000	0.48379	0.984000	0.73092	6.823000	0.75282	2.301000	0.77427	0.524000	0.50904	ATG	-	NULL		0.373	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	protein_coding	OTTHUMT00000255918.2	A		-		190728845	+1	no_errors	ENST00000441310	ensembl	human	known	74_37	missense	SNP	0.994	G
CDC42BPA	8476	genome.wustl.edu	37	1	227257397	227257397	+	5'UTR	SNP	G	G	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr1:227257397G>T	ENST00000488131.1	-	0	629				CDC42BPA_ENST00000366766.2_Intron|CDC42BPA_ENST00000366767.3_Intron|CDC42BPA_ENST00000366764.2_Intron|CDC42BPA_ENST00000535525.1_Intron|CDC42BPA_ENST00000366769.3_Intron|CDC42BPA_ENST00000366765.3_Intron|CDC42BPA_ENST00000334218.5_Intron					CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				GCAATAAAATGGTTTTATTAT	0.308																																																	0								ENSG00000143776																																			CDC42BPA	SO:0001623	5_prime_UTR_variant	0			-	HGNC	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000488131.1:c.-1230C>A	1.37:g.227257397G>T		Somatic	0	31	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29		RNA	SNP	42	0.00	0	72	0.00	0	-	NULL	ENST00000488131.1	37	NULL		1																																																																																			-	-		0.308	CDC42BPA-008	KNOWN	basic	processed_transcript	CDC42BPA	protein_coding	OTTHUMT00000091703.1	G	NM_014826	-		227257397	-1	no_errors	ENST00000488131	ensembl	human	known	74_37	rna	SNP	0.000	T
AP1G2	8906	genome.wustl.edu	37	14	24037134	24037134	+	5'UTR	SNP	G	G	C			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr14:24037134G>C	ENST00000308724.5	-	0	145				AP1G2_ENST00000556277.1_5'Flank|RP11-66N24.3_ENST00000555968.1_RNA|AP1G2_ENST00000397120.3_5'Flank	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CGGAGAGACAGCATGATAGGC	0.612																																																	0								ENSG00000258727																																			RP11-66N24.3	SO:0001623	5_prime_UTR_variant	0			-	Clone_based_vega_gene	AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.-611C>G	14.37:g.24037134G>C		Somatic	0	39	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	20	37.50	D3DS51|O75504	RNA	SNP	21	0.00	0	24	45.45	20	-	NULL	ENST00000308724.5	37	NULL	CCDS9602.1	14																																																																																			-	-		0.612	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258727	protein_coding	OTTHUMT00000071812.4	G	NM_003917	-		24037134	+1	no_errors	ENST00000555968	ensembl	human	known	74_37	rna	SNP	0.001	C
ASTE1	28990	genome.wustl.edu	37	3	130733047	130733047	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr3:130733047delT	ENST00000264992.3	-	6	2335	c.1894delA	c.(1894-1896)aggfs	p.R632fs	ASTE1_ENST00000514044.1_Frame_Shift_Del_p.R657fs|ATP2C1_ENST00000359644.3_Intron|ATP2C1_ENST00000507488.2_Intron|ATP2C1_ENST00000422190.2_Intron|ATP2C1_ENST00000533801.2_Intron|ATP2C1_ENST00000513801.1_Intron|ATP2C1_ENST00000393221.4_Intron|ATP2C1_ENST00000504381.1_Intron|ATP2C1_ENST00000328560.8_Intron	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	632					DNA repair (GO:0006281)		nuclease activity (GO:0004518)	p.R632fs*33(2)		endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						TTCTTCTGCCTTTTTTTTTTT	0.403																																																	2	Deletion - Frameshift(2)	ovary(2)						ENSG00000034533						57.0	55.0	56.0					3																	130733047		2203	4300	6503	ASTE1	SO:0001589	frameshift_variant	0				HGNC	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1894delA	3.37:g.130733047delT	ENSP00000264992:p.Arg632fs	Somatic	0	36	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Frame_Shift_Del	DEL	32	0.00	0	48	5.88	3	pfam_XPG_DNA_repair_N	p.R632fs	ENST00000264992.3	37	c.1894	CCDS3068.1	3																																																																																			-	NULL		0.403	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTE1	protein_coding	OTTHUMT00000356659.1	T	NM_014065			130733047	-1	no_errors	ENST00000264992	ensembl	human	known	74_37	frame_shift_del	DEL	0.014	-
TRIML1	339976	genome.wustl.edu	37	4	189064937	189064937	+	Intron	SNP	C	C	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr4:189064937C>T	ENST00000332517.3	+	4	875				TRIML1_ENST00000507581.1_3'UTR|RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1						multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		AAATGAATTTCGTCTGTGTTA	0.468																																					Melanoma(31;213 1036 16579 23968 32372)												0								ENSG00000184108						176.0	150.0	158.0					4																	189064937		692	1591	2283	TRIML1	SO:0001627	intron_variant	0			-	HGNC	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.736-55C>T	4.37:g.189064937C>T		Somatic	0	43	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	21	43.24	Q96BE5	RNA	SNP	19	0.00	0	20	52.27	23	-	NULL	ENST00000332517.3	37	NULL	CCDS3851.1	4																																																																																			-	-		0.468	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIML1	protein_coding	OTTHUMT00000359813.1	C	NM_178556	-		189064937	+1	no_errors	ENST00000507581	ensembl	human	known	74_37	rna	SNP	0.000	T
ADAM6	8755	genome.wustl.edu	37	14	106437040	106437040	+	lincRNA	SNP	G	G	A	rs71405043|rs571004730	byFrequency	TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr14:106437040G>A	ENST00000452053.1	-	0	620					NR_002224.2				ADAM metallopeptidase domain 6, pseudogene																		CCGTTGTCATGGTTTCGTTAT	0.453													.|||	8	0.00159744	0.0045	0.0	5008	,	,		9657	0.001		0.0	False		,,,				2504	0.001																0								ENSG00000233988																																			ADAM6			0			-	HGNC	AI024595		14q32.33	2013-09-05	2012-08-22		ENSG00000233988	ENSG00000271968		"""ADAM metallopeptidase domain containing"""	213	pseudogene	pseudogene			"""chromosome 14 open reading frame 96"", ""a disintegrin and metalloproteinase domain 6"", ""ADAM metallopeptidase domain 6"""	C14orf96			Standard	NR_002224		Approved	tMDCIV	uc001ysu.1		OTTHUMG00000152319		14.37:g.106437040G>A		Somatic	0	95	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	41	50.60		RNA	SNP	30	0.00	0	36	42.86	27	-	NULL	ENST00000452053.1	37	NULL		14																																																																																			-	-		0.453	ADAM6-001	KNOWN	basic	lincRNA	ADAM6	lincRNA	OTTHUMT00000325881.1	G	NR_002224	-		106437040	-1	no_errors	ENST00000452053	ensembl	human	known	74_37	rna	SNP	0.002	A
C6orf132	647024	genome.wustl.edu	37	6	42072710	42072715	+	In_Frame_Del	DEL	CTCCTC	CTCCTC	-	rs150599390	byFrequency	TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	CTCCTC	CTCCTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr6:42072710_42072715delCTCCTC	ENST00000341865.4	-	4	2934_2939	c.2935_2940delGAGGAG	c.(2935-2940)gaggagdel	p.EE979del		NM_001164446.1	NP_001157918.1	Q5T0Z8	CF132_HUMAN	chromosome 6 open reading frame 132	979								p.E979_E980delEE(2)		breast(1)	1						CGAAGTTGAACTCCTCCTCCTCCTCC	0.655														215	0.0429313	0.0038	0.0793	5008	,	,		12586	0.001		0.1392	False		,,,				2504	0.0143																2	Deletion - In frame(2)	breast(2)						ENSG00000188112			38,19,2223		3,0,32,4,11,1090						3.3	1.0		dbSNP_134	56	399,18,4063		56,0,287,2,14,1881	no	codingComplex	C6orf132	NM_001164446.1		59,0,319,6,25,2971	A1A1,A1A2,A1R,A2A2,A2R,RR		9.308,2.5,7.0118				437,37,6286				C6orf132	SO:0001651	inframe_deletion	0				HGNC		CCDS47428.1	6p21.1	2012-02-06			ENSG00000188112	ENSG00000188112			21288	protein-coding gene	gene with protein product							Standard	NM_001164446		Approved	bA7K24.2	uc003orw.2	Q5T0Z8	OTTHUMG00000014695	ENST00000341865.4:c.2935_2940delGAGGAG	6.37:g.42072716_42072721delCTCCTC	ENSP00000341368:p.Glu979_Glu980del	Somatic	NA	NA	NA		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NI05	In_Frame_Del	DEL	25	24.24	8	24	35.14	13	NULL	p.EE979in_frame_del	ENST00000341865.4	37	c.2940_2935	CCDS47428.1	6																																																																																			-	NULL		0.655	C6orf132-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C6orf132	protein_coding	OTTHUMT00000040548.2	CTCCTC	NM_001164446			42072715	-1	no_errors	ENST00000341865	ensembl	human	putative	74_37	in_frame_del	DEL	0.995:0.998:0.998:0.989:0.987:0.736	-
SCN1A	6323	genome.wustl.edu	37	2	166897761	166897761	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr2:166897761C>T	ENST00000303395.4	-	13	2394	c.2395G>A	c.(2395-2397)Gtg>Atg	p.V799M	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.V771M|SCN1A_ENST00000375405.3_Missense_Mutation_p.V788M|SCN1A_ENST00000423058.2_Missense_Mutation_p.V799M|AC010127.3_ENST00000595268.1_RNA|AC010127.3_ENST00000599041.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	799					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACTGTAAGCACATTATTGAAA	0.368																																																	0								ENSG00000144285						80.0	72.0	75.0					2																	166897761		2203	4300	6503	SCN1A	SO:0001583	missense	0			-	HGNC	AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2395G>A	2.37:g.166897761C>T	ENSP00000303540:p.Val799Met	Somatic	0	36	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	33	0.00	0	54	11.48	7	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.V799M	ENST00000303395.4	37	c.2395	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	12.80	2.046820	0.36085	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.97731	-4.51;-4.51;-4.51;-4.51	5.39	5.39	0.77823	.	0.000000	0.64402	D	0.000020	D	0.95223	0.8451	L	0.39020	1.185	0.43191	D	0.995022	B;B;B	0.20671	0.047;0.028;0.039	B;B;B	0.19148	0.013;0.006;0.024	D	0.92700	0.6174	10	0.16420	T	0.52	.	19.52	0.95182	0.0:1.0:0.0:0.0	.	788;771;799	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	M	799;799;788;771	ENSP00000407030:V799M;ENSP00000303540:V799M;ENSP00000364554:V788M;ENSP00000386312:V771M	ENSP00000303540:V799M	V	-	1	0	SCN1A	166606007	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	3.866000	0.56040	2.671000	0.90904	0.591000	0.81541	GTG	-	NULL		0.368	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	protein_coding	OTTHUMT00000102661.1	C	NM_006920	-		166897761	-1	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	SNP	1.000	T
TMPRSS11F	389208	genome.wustl.edu	37	4	68928384	68928384	+	Intron	SNP	T	T	C			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr4:68928384T>C	ENST00000356291.2	-	8	1075				UBA6-AS1_ENST00000499180.2_RNA|RP11-35D5.1_ENST00000600441.1_RNA|UBA6-AS1_ENST00000511571.1_RNA|UBA6-AS1_ENST00000500538.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F							extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						GCCTATCATCTTTCTTCTCAT	0.403																																																	0								ENSG00000248049						134.0	131.0	132.0					4																	68928384		2203	4300	6503	UBA6-AS1	SO:0001627	intron_variant	0			-	HGNC	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.1015+2018A>G	4.37:g.68928384T>C		Somatic	0	78	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	56	34.12	A8MXX2	RNA	SNP	37	0.00	0	29	44.23	23	-	NULL	ENST00000356291.2	37	NULL	CCDS3520.1	4																																																																																			-	-		0.403	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6-AS1	protein_coding	OTTHUMT00000251439.1	T	NM_207407	-		68928384	+1	no_errors	ENST00000500538	ensembl	human	known	74_37	rna	SNP	1.000	C
EPC1	80314	genome.wustl.edu	37	10	32582648	32582648	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr10:32582648C>T	ENST00000263062.8	-	3	600	c.331G>A	c.(331-333)Gaa>Aaa	p.E111K	EPC1_ENST00000375110.2_Missense_Mutation_p.E61K|EPC1_ENST00000319778.6_Missense_Mutation_p.E111K	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	111					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				TCAGGCTGTTCAGCATCCAAA	0.368																																																	0								ENSG00000120616						52.0	47.0	49.0					10																	32582648		2203	4300	6503	EPC1	SO:0001583	missense	0			-	HGNC	AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.331G>A	10.37:g.32582648C>T	ENSP00000263062:p.Glu111Lys	Somatic	0	47	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	24	0.00	0	57	0.00	0	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.E111K	ENST00000263062.8	37	c.331	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.505035	0.96371	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	T;T;T	0.42513	0.97;0.97;0.97	5.67	5.67	0.87782	Enhancer of polycomb-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65312	0.2679	M	0.67397	2.05	0.80722	D	1	D;D;D;D	0.89917	0.994;0.999;1.0;0.999	D;D;D;D	0.91635	0.964;0.969;0.999;0.991	T	0.63404	-0.6645	10	0.48119	T	0.1	-14.885	19.7564	0.96294	0.0:1.0:0.0:0.0	.	111;61;111;111	B8XCX7;Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;.;EPC1_HUMAN	K	61;111;111	ENSP00000364251:E61K;ENSP00000318559:E111K;ENSP00000263062:E111K	ENSP00000263062:E111K	E	-	1	0	EPC1	32622654	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.677000	0.91161	0.467000	0.42956	GAA	-	pfam_Enhancer_polycomb-like_N		0.368	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	protein_coding	OTTHUMT00000047484.1	C		-		32582648	-1	no_errors	ENST00000263062	ensembl	human	known	74_37	missense	SNP	1.000	T
MMP3	4314	genome.wustl.edu	37	11	102709402	102709402	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr11:102709402G>T	ENST00000299855.5	-	8	1365	c.1109C>A	c.(1108-1110)gCt>gAt	p.A370D	WTAPP1_ENST00000525739.2_RNA	NM_002422.3	NP_002413.1	P08254	MMP3_HUMAN	matrix metallopeptidase 3 (stromelysin 1, progelatinase)	370					cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|positive regulation of oxidative stress-induced cell death (GO:1903209)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|endopeptidase activity (GO:0004175)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.0142)	Marimastat(DB00786)	TGGGTATCCAGCTCGTACCTC	0.383																																																	0								ENSG00000149968						94.0	87.0	89.0					11																	102709402		2203	4299	6502	MMP3	SO:0001583	missense	0			-	HGNC	X05232	CCDS8323.1	11q22.3	2012-10-02	2005-08-08		ENSG00000149968	ENSG00000149968	3.4.24.17		7173	protein-coding gene	gene with protein product		185250	"""matrix metalloproteinase 3 (stromelysin 1, progelatinase)"""	STMY1, STMY			Standard	NM_002422		Approved		uc001phj.1	P08254	OTTHUMG00000048254	ENST00000299855.5:c.1109C>A	11.37:g.102709402G>T	ENSP00000299855:p.Ala370Asp	Somatic	0	56	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B2R8B8|Q3B7S0|Q6GRF8	Missense_Mutation	SNP	24	0.00	0	54	0.00	0	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.A370D	ENST00000299855.5	37	c.1109	CCDS8323.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.54|11.54	1.667809|1.667809	0.29604|0.29604	.|.	.|.	ENSG00000149968|ENSG00000149968	ENST00000299855|ENST00000434103	T|.	0.02236|.	4.38|.	5.07|5.07	4.15|4.15	0.48705|0.48705	Hemopexin/matrixin (2);|.	0.264406|.	0.19963|.	U|.	0.102178|.	T|T	0.46034|0.46034	0.1372|0.1372	L|L	0.52905|0.52905	1.665|1.665	0.09310|0.09310	N|N	1|1	B|.	0.19445|.	0.036|.	B|.	0.36335|.	0.222|.	T|T	0.32214|0.32214	-0.9915|-0.9915	10|5	0.42905|.	T|.	0.14|.	.|.	11.0742|11.0742	0.48021|0.48021	0.0:0.1393:0.7159:0.1448|0.0:0.1393:0.7159:0.1448	.|.	370|.	P08254|.	MMP3_HUMAN|.	D|M	370|14	ENSP00000299855:A370D|.	ENSP00000299855:A370D|.	A|L	-|-	2|1	0|2	MMP3|MMP3	102214612|102214612	0.001000|0.001000	0.12720|0.12720	0.518000|0.518000	0.27811|0.27811	0.236000|0.236000	0.25371|0.25371	1.029000|1.029000	0.30140|0.30140	1.488000|1.488000	0.48433|0.48433	0.591000|0.591000	0.81541|0.81541	GCT|CTG	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat		0.383	MMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP3	protein_coding	OTTHUMT00000109758.2	G	NM_002422	-		102709402	-1	no_errors	ENST00000299855	ensembl	human	known	74_37	missense	SNP	0.026	T
CRB1	23418	genome.wustl.edu	37	1	197390617	197390617	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr1:197390617delG	ENST00000367400.3	+	6	1794	c.1659delG	c.(1657-1659)aagfs	p.K553fs	CRB1_ENST00000544212.1_Frame_Shift_Del_p.K34fs|CRB1_ENST00000367399.2_Frame_Shift_Del_p.K441fs|CRB1_ENST00000367397.1_5'UTR|CRB1_ENST00000538660.1_Frame_Shift_Del_p.K553fs|CRB1_ENST00000543483.1_Frame_Shift_Del_p.K252fs|CRB1_ENST00000535699.1_Frame_Shift_Del_p.K484fs	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	553	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ATCAGTCAAAGGTGCTTCTGT	0.458																																																	0								ENSG00000134376						126.0	127.0	127.0					1																	197390617		2203	4300	6503	CRB1	SO:0001589	frameshift_variant	0				HGNC		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1659delG	1.37:g.197390617delG	ENSP00000356370:p.Lys553fs	Somatic	0	60	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	33	54.79	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Frame_Shift_Del	DEL	34	0.00	0	37	30.19	16	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.V554fs	ENST00000367400.3	37	c.1659	CCDS1390.1	1																																																																																			-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.458	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	protein_coding	OTTHUMT00000086565.2	G	NM_201253			197390617	+1	no_errors	ENST00000367400	ensembl	human	known	74_37	frame_shift_del	DEL	0.002	-
RIMS1	22999	genome.wustl.edu	37	6	72960727	72960727	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr6:72960727C>T	ENST00000521978.1	+	14	2476	c.2476C>T	c.(2476-2478)Cga>Tga	p.R826*	RIMS1_ENST00000518273.1_Nonsense_Mutation_p.R826*|RIMS1_ENST00000517827.1_Nonsense_Mutation_p.R285*|RIMS1_ENST00000425662.2_Nonsense_Mutation_p.R219*|RIMS1_ENST00000522291.1_Nonsense_Mutation_p.R826*|RIMS1_ENST00000491071.2_Nonsense_Mutation_p.R826*|RIMS1_ENST00000401910.3_Nonsense_Mutation_p.R300*|RIMS1_ENST00000520567.1_Nonsense_Mutation_p.R826*|RIMS1_ENST00000538414.1_5'Flank|RIMS1_ENST00000523963.1_Nonsense_Mutation_p.R300*|RIMS1_ENST00000348717.5_Nonsense_Mutation_p.R826*|RIMS1_ENST00000264839.7_Nonsense_Mutation_p.R826*|RIMS1_ENST00000517960.1_Nonsense_Mutation_p.R826*	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	826	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				TTTTAGAGAACGAATGTTAGA	0.323																																																	0								ENSG00000079841						84.0	80.0	81.0					6																	72960727		1819	4070	5889	RIMS1	SO:0001587	stop_gained	0			-	HGNC	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2476C>T	6.37:g.72960727C>T	ENSP00000428417:p.Arg826*	Somatic	0	35	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	16	48.39	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Nonsense_Mutation	SNP	34	0.00	0	25	48.98	24	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.R826*	ENST00000521978.1	37	c.2476	CCDS47449.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	44|44	10.796964|10.796964	0.99469|0.99469	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827;ENST00000370420|ENST00000517433	.|.	.|.	.|.	5.69|5.69	3.87|3.87	0.44632|0.44632	.|.	0.119184|.	0.37437|.	N|.	0.002093|.	.|T	.|0.59742	.|0.2216	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.60078	.|-0.7333	.|4	0.02654|.	T|.	1|.	-6.9827|-6.9827	14.8021|14.8021	0.69924|0.69924	0.2771:0.7228:0.0:0.0|0.2771:0.7228:0.0:0.0	.|.	.|.	.|.	.|.	X|M	826;826;826;826;826;826;826;826;826;826;826;826;300;300;219;219;285;51|399	.|.	ENSP00000264839:R826X|.	R|T	+|+	1|2	2|0	RIMS1|RIMS1	73017448|73017448	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	6.027000|6.027000	0.70881|0.70881	0.706000|0.706000	0.31912|0.31912	-0.291000|-0.291000	0.09656|0.09656	CGA|ACG	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.323	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	protein_coding	OTTHUMT00000374968.1	C		-		72960727	+1	no_errors	ENST00000521978	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TMEM244	253582	genome.wustl.edu	37	6	130166922	130166922	+	Missense_Mutation	SNP	C	C	T	rs143949103		TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr6:130166922C>T	ENST00000368143.1	-	2	191	c.109G>A	c.(109-111)Gtg>Atg	p.V37M	TMEM244_ENST00000438392.1_Missense_Mutation_p.V37M	NM_001010876.1	NP_001010876.1	Q5VVB8	TM244_HUMAN	transmembrane protein 244	37						integral component of membrane (GO:0016021)		p.V37M(1)									TCAAACATCACGCAGCCCATG	0.358													C|||	1	0.000199681	0.0	0.0	5008	,	,		18431	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)						ENSG00000203756	C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	111.0	103.0	106.0		109	-2.4	0.0	6	dbSNP_134	106	0,8600		0,0,4300	yes	missense	C6orf191	NM_001010876.1	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	37/129	130166922	1,13005	2203	4300	6503	TMEM244	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS34536.1	6q22.33	2012-02-21	2012-02-21	2012-02-21	ENSG00000203756	ENSG00000203756			21571	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 191"""	C6orf191			Standard	NM_001010876		Approved	bA174C7.4	uc003qbs.3	Q5VVB8	OTTHUMG00000015553	ENST00000368143.1:c.109G>A	6.37:g.130166922C>T	ENSP00000357125:p.Val37Met	Somatic	0	41	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	27	44.90		Missense_Mutation	SNP	29	0.00	0	20	63.64	35	pfam_Integral_membrane_SYS1-rel	p.V37M	ENST00000368143.1	37	c.109	CCDS34536.1	6	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	3.211	-0.161646	0.06502	2.27E-4	0.0	ENSG00000203756	ENST00000368143;ENST00000438392	T;T	0.38401	1.14;1.14	4.41	-2.44	0.06502	.	0.691250	0.12851	N	0.433943	T	0.03434	0.0099	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41592	-0.9500	10	0.30854	T	0.27	-33.3459	5.9151	0.19050	0.0:0.2501:0.3143:0.4356	.	37	Q5VVB8	CF191_HUMAN	M	37	ENSP00000357125:V37M;ENSP00000403755:V37M	ENSP00000357125:V37M	V	-	1	0	C6orf191	130208615	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.521000	0.06245	-0.489000	0.06716	-2.688000	0.00140	GTG	-	pfam_Integral_membrane_SYS1-rel		0.358	TMEM244-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM244	protein_coding	OTTHUMT00000042194.1	C	NM_001010876	rs143949103		130166922	-1	no_errors	ENST00000368143	ensembl	human	known	74_37	missense	SNP	0.000	T
POLR3C	10623	genome.wustl.edu	37	1	145598254	145598254	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr1:145598254C>T	ENST00000334163.3	-	9	1159	c.999G>A	c.(997-999)atG>atA	p.M333I	POLR3C_ENST00000471254.1_5'Flank|POLR3C_ENST00000369294.1_Missense_Mutation_p.M333I	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	333					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			TGATGACATACATTCCTCCAC	0.393																																																	0								ENSG00000186141						86.0	81.0	82.0					1																	145598254		2203	4300	6503	POLR3C	SO:0001583	missense	0			-	HGNC	AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.999G>A	1.37:g.145598254C>T	ENSP00000334564:p.Met333Ile	Somatic	0	46	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	26	33.33	O15317|Q9Y3R6	Missense_Mutation	SNP	33	0.00	0	19	52.50	21	pfam_RNA_pol_III_Rpc82_C,pfam_RNA_pol_III_RPC82-rel_HTH	p.M333I	ENST00000334163.3	37	c.999	CCDS921.1	1	.	.	.	.	.	.	.	.	.	.	C	16.90	3.251053	0.59212	.	.	ENSG00000186141	ENST00000334163;ENST00000369294	T;T	0.40756	1.02;1.02	6.11	6.11	0.99139	RNA polymerase III Rpc82, C -terminal (1);	0.106440	0.85682	D	0.000000	T	0.25195	0.0612	L	0.45581	1.43	0.58432	D	0.999999	B;B;B	0.26602	0.154;0.101;0.057	B;B;B	0.23574	0.047;0.028;0.039	T	0.02352	-1.1172	10	0.31617	T	0.26	-19.6738	16.2343	0.82363	0.0:1.0:0.0:0.0	.	333;333;333	E9PHH9;Q9BUI4;Q53F76	.;RPC3_HUMAN;.	I	333	ENSP00000334564:M333I;ENSP00000358300:M333I	ENSP00000334564:M333I	M	-	3	0	POLR3C	144309611	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.627000	0.61276	2.906000	0.99361	0.655000	0.94253	ATG	-	pfam_RNA_pol_III_Rpc82_C		0.393	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3C	protein_coding	OTTHUMT00000038542.1	C	NM_006468	-		145598254	-1	no_errors	ENST00000334163	ensembl	human	known	74_37	missense	SNP	1.000	T
LOC399715	399715	genome.wustl.edu	37	10	6369914	6369914	+	lincRNA	DEL	G	G	-			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr10:6369914delG	ENST00000399868.2	+	0	239					NR_040079.1																						GAAGAAGAGAGGGCTTTGTTG	0.502																																																	0								ENSG00000215244																																			RP11-563J2.2			0				Clone_based_vega_gene																													10.37:g.6369914delG		Somatic	0	75	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	56	39.13		RNA	DEL	30	0.00	0	30	40.00	20	-	NULL	ENST00000399868.2	37	NULL		10																																																																																			-	-		0.502	RP11-563J2.2-001	KNOWN	basic	lincRNA	LOC399715	lincRNA	OTTHUMT00000472270.1	G				6369914	+1	no_errors	ENST00000399868	ensembl	human	known	74_37	rna	DEL	0.000	-
FAM184A	79632	genome.wustl.edu	37	6	119345393	119345393	+	Nonsense_Mutation	SNP	C	C	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr6:119345393C>A	ENST00000338891.7	-	2	1188	c.745G>T	c.(745-747)Gaa>Taa	p.E249*	FAM184A_ENST00000522284.1_Nonsense_Mutation_p.E129*|FAM184A_ENST00000368475.4_Nonsense_Mutation_p.E129*|FAM184A_ENST00000352896.5_Nonsense_Mutation_p.E129*|RP11-351A11.1_ENST00000518570.1_RNA|FAM184A_ENST00000521531.1_Nonsense_Mutation_p.E249*	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	249						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						AACTTGCCTTCATAATCCTCA	0.423																																																	0								ENSG00000111879						93.0	84.0	87.0					6																	119345393		1885	4104	5989	FAM184A	SO:0001587	stop_gained	0			-	HGNC	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.745G>T	6.37:g.119345393C>A	ENSP00000342604:p.Glu249*	Somatic	0	79	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	61	15.28	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Nonsense_Mutation	SNP	36	0.00	0	47	9.62	5	superfamily_Prefoldin	p.E249*	ENST00000338891.7	37	c.745	CCDS43499.1	6	.	.	.	.	.	.	.	.	.	.	C	23.1	4.379518	0.82682	.	.	ENSG00000111879	ENST00000338891;ENST00000352896;ENST00000368475;ENST00000521531;ENST00000522284	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-16.2622	18.8673	0.92298	0.0:1.0:0.0:0.0	.	.	.	.	X	249;129;129;249;129	.	ENSP00000342604:E249X	E	-	1	0	FAM184A	119387092	1.000000	0.71417	1.000000	0.80357	0.046000	0.14306	7.398000	0.79919	2.534000	0.85438	0.655000	0.94253	GAA	-	NULL		0.423	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM184A	protein_coding	OTTHUMT00000042009.3	C	NM_024581	-		119345393	-1	no_errors	ENST00000338891	ensembl	human	known	74_37	nonsense	SNP	1.000	A
GPR144	347088	genome.wustl.edu	37	9	127232787	127232787	+	Missense_Mutation	SNP	C	C	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr9:127232787C>A	ENST00000334810.1	+	17	2573	c.2573C>A	c.(2572-2574)cCc>cAc	p.P858H				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	858					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						ACGGTGAAGCCCGTGCTGGTC	0.711																																																	0								ENSG00000180264						23.0	30.0	28.0					9																	127232787		692	1591	2283	GPR144	SO:0001583	missense	0			-	HGNC	AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.2573C>A	9.37:g.127232787C>A	ENSP00000335156:p.Pro858His	Somatic	0	130	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	77	25.96	Q86SL4|Q8NH12	Missense_Mutation	SNP	24	0.00	0	36	16.28	7	pfam_GPCR_2_secretin-like,pfam_Pentaxin,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_C-type_lectin_fold,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_Pentaxin,prints_GPCR_2_secretin-like	p.P858H	ENST00000334810.1	37	c.2573	CCDS48016.1	9	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382167	0.61845	.	.	ENSG00000180264	ENST00000334810;ENST00000446588	T	0.37752	1.18	4.63	4.63	0.57726	GPCR, family 2-like (1);	.	.	.	.	T	0.57902	0.2085	M	0.64997	1.995	0.50039	D	0.999847	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.62530	-0.6835	9	0.72032	D	0.01	.	16.0758	0.80967	0.0:1.0:0.0:0.0	.	43;858	A1E4E8;Q7Z7M1	.;GP144_HUMAN	H	858;43	ENSP00000335156:P858H	ENSP00000335156:P858H	P	+	2	0	GPR144	126272608	0.999000	0.42202	0.960000	0.40013	0.442000	0.32017	4.239000	0.58694	2.113000	0.64589	0.561000	0.74099	CCC	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.711	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR144	protein_coding	OTTHUMT00000054026.2	C	NM_182611	-		127232787	+1	no_errors	ENST00000334810	ensembl	human	known	74_37	missense	SNP	1.000	A
TUBA8	51807	genome.wustl.edu	37	22	18609580	18609580	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr22:18609580G>A	ENST00000330423.3	+	4	908	c.835G>A	c.(835-837)Gag>Aag	p.E279K	TUBA8_ENST00000316027.6_Missense_Mutation_p.E213K	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	279					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						CATCTCTGCCGAGAAAGCCTA	0.592																																																	0								ENSG00000183785						108.0	88.0	95.0					22																	18609580		2203	4300	6503	TUBA8	SO:0001583	missense	0			-	HGNC	AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.835G>A	22.37:g.18609580G>A	ENSP00000333326:p.Glu279Lys	Somatic	0	78	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	35	52.05	B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Missense_Mutation	SNP	31	0.00	0	21	44.74	17	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.E279K	ENST00000330423.3	37	c.835	CCDS13751.1	22	.	.	.	.	.	.	.	.	.	.	.	16.62	3.174762	0.57692	.	.	ENSG00000183785	ENST00000316027;ENST00000330423;ENST00000416740	D;D;D	0.84516	-1.86;-1.86;-1.86	5.67	5.67	0.87782	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.097027	0.64402	D	0.000001	D	0.89276	0.6669	M	0.80508	2.5	0.80722	D	1	P;P;P	0.45634	0.78;0.863;0.56	B;P;B	0.46659	0.423;0.523;0.149	D	0.90480	0.4459	10	0.87932	D	0	.	19.1191	0.93355	0.0:0.0:1.0:0.0	.	213;303;279	B3KPW9;C9J2C0;Q9NY65	.;.;TBA8_HUMAN	K	213;279;303	ENSP00000318575:E213K;ENSP00000333326:E279K;ENSP00000412646:E303K	ENSP00000318575:E213K	E	+	1	0	TUBA8	16989580	1.000000	0.71417	0.988000	0.46212	0.999000	0.98932	9.869000	0.99810	2.837000	0.97791	0.655000	0.94253	GAG	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Beta_tubulin		0.592	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA8	protein_coding	OTTHUMT00000316232.3	G	NM_018943	-		18609580	+1	no_errors	ENST00000330423	ensembl	human	known	74_37	missense	SNP	1.000	A
DEFB129	140881	genome.wustl.edu	37	20	210205	210205	+	Missense_Mutation	SNP	C	C	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr20:210205C>A	ENST00000246105.4	+	2	376	c.345C>A	c.(343-345)aaC>aaA	p.N115K		NM_080831.3	NP_543021.1	Q9H1M3	DB129_HUMAN	defensin, beta 129	115					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|stomach(1)	9		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			CTAATACCAACTTTGTCATCA	0.408																																																	0								ENSG00000125903						107.0	104.0	105.0					20																	210205		2203	4300	6503	DEFB129	SO:0001583	missense	0			-	HGNC	AY358186	CCDS12992.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125903	ENSG00000125903		"""Defensins, beta"""	16218	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 87"""	C20orf87		11854508	Standard	NM_080831		Approved	bA530N10.3, DEFB-29	uc002wda.3	Q9H1M3	OTTHUMG00000031618	ENST00000246105.4:c.345C>A	20.37:g.210205C>A	ENSP00000246105:p.Asn115Lys	Somatic	0	25	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q8NES7	Missense_Mutation	SNP	28	0.00	0	61	0.00	0	NULL	p.N115K	ENST00000246105.4	37	c.345	CCDS12992.1	20	.	.	.	.	.	.	.	.	.	.	C	7.784	0.710200	0.15239	.	.	ENSG00000125903	ENST00000246105	T	0.40225	1.04	3.96	0.935	0.19483	.	0.568390	0.16061	N	0.231482	T	0.26810	0.0656	L	0.34521	1.04	0.09310	N	1	B	0.32203	0.36	B	0.32211	0.142	T	0.19582	-1.0301	10	0.72032	D	0.01	-10.1418	3.4826	0.07607	0.1991:0.5864:0.0:0.2145	.	115	Q9H1M3	DB129_HUMAN	K	115	ENSP00000246105:N115K	ENSP00000246105:N115K	N	+	3	2	DEFB129	158205	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.756000	0.26419	0.242000	0.21303	-0.251000	0.11542	AAC	-	NULL		0.408	DEFB129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB129	protein_coding	OTTHUMT00000077430.2	C	NM_080831	-		210205	+1	no_errors	ENST00000246105	ensembl	human	known	74_37	missense	SNP	0.001	A
LINC00910	100130581	genome.wustl.edu	37	17	41466121	41466131	+	lincRNA	DEL	CGGCGCATGGA	CGGCGCATGGA	-	rs371010095|rs201706976|rs138448506|rs66825422|rs79782698		TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	CGGCGCATGGA	CGGCGCATGGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr17:41466121_41466131delCGGCGCATGGA	ENST00000606190.1	-	0	0									long intergenic non-protein coding RNA 910																		CAGAGGGAGGCGGCGCATGGACGGCGAGGGC	0.668																																																	0								ENSG00000188825																																			LINC00910			0				HGNC	BC035366		17q21.31	2013-05-21			ENSG00000188825	ENSG00000188825		"""Long non-coding RNAs"""	44361	non-coding RNA	RNA, long non-coding							Standard	NR_027412		Approved				OTTHUMG00000180880		17.37:g.41466121_41466131delCGGCGCATGGA		Somatic	NA	NA	NA		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	30	9.09	3	62	21.52	17	-	NULL	ENST00000606190.1	37	NULL		17																																																																																			-	-		0.668	LINC00910-201	KNOWN	basic	snRNA	LINC00910	lincRNA		CGGCGCATGGA	NR_027412			41466131	-1	no_errors	ENST00000586231	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
SLC22A14	9389	genome.wustl.edu	37	3	38350537	38350537	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr3:38350537G>A	ENST00000273173.4	+	4	959	c.868G>A	c.(868-870)Gcc>Acc	p.A290T	SLC22A14_ENST00000448498.1_Missense_Mutation_p.A290T	NM_004803.3	NP_004794.2	Q9Y267	S22AE_HUMAN	solute carrier family 22, member 14	290					organic cation transport (GO:0015695)	integral component of plasma membrane (GO:0005887)	organic cation transmembrane transporter activity (GO:0015101)			central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0554)|Kidney(284;0.0696)		GACAGGGATCGCCTACAGTCT	0.572																																																	0								ENSG00000144671						167.0	153.0	157.0					3																	38350537		2203	4300	6503	SLC22A14	SO:0001583	missense	0			-	HGNC	AB011082	CCDS2677.1	3p21.3	2013-05-22	2008-01-11	2003-10-15	ENSG00000144671	ENSG00000144671		"""Solute carriers"""	8495	protein-coding gene	gene with protein product		604048	"""organic cationic transporter-like 4"", ""solute carrier family 22 (organic cation transporter), member 14"""	ORCTL4		10072596	Standard	NM_004803		Approved	OCTL2	uc003cib.2	Q9Y267	OTTHUMG00000131082	ENST00000273173.4:c.868G>A	3.37:g.38350537G>A	ENSP00000273173:p.Ala290Thr	Somatic	0	129	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	103	35.22	A0AVS9|A1L4H6|B2RCX3|Q6DJT3	Missense_Mutation	SNP	29	0.00	0	21	58.82	30	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A290T	ENST00000273173.4	37	c.868	CCDS2677.1	3	.	.	.	.	.	.	.	.	.	.	G	13.57	2.276695	0.40294	.	.	ENSG00000144671	ENST00000448498;ENST00000423219;ENST00000273173	T;T	0.61392	0.11;0.11	5.02	2.19	0.27852	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.313592	0.33253	N	0.005107	T	0.71492	0.3346	M	0.88377	2.95	0.09310	N	0.999999	D	0.67145	0.996	P	0.61477	0.889	T	0.63033	-0.6727	10	0.87932	D	0	.	4.8404	0.13487	0.159:0.0:0.4076:0.4333	.	290	Q9Y267	S22AE_HUMAN	T	290	ENSP00000396283:A290T;ENSP00000273173:A290T	ENSP00000273173:A290T	A	+	1	0	SLC22A14	38325541	0.004000	0.15560	0.002000	0.10522	0.033000	0.12548	0.251000	0.18257	0.226000	0.20979	0.655000	0.94253	GCC	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.572	SLC22A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A14	protein_coding	OTTHUMT00000253742.3	G	NM_004803	-		38350537	+1	no_errors	ENST00000273173	ensembl	human	known	74_37	missense	SNP	0.031	A
TENM3	55714	genome.wustl.edu	37	4	183267832	183267832	+	Silent	SNP	A	A	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr4:183267832A>T	ENST00000511685.1	+	3	384	c.261A>T	c.(259-261)ggA>ggT	p.G87G	TENM3_ENST00000406950.2_Silent_p.G87G			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	87	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGCAGTTAGGAGTTTGTGAAC	0.408																																																	0								ENSG00000218336						53.0	51.0	52.0					4																	183267832		1851	4091	5942	TENM3	SO:0001819	synonymous_variant	0			-	HGNC	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.261A>T	4.37:g.183267832A>T		Somatic	0	79	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	84	8.70	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	36	0.00	0	47	17.54	10	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.G87	ENST00000511685.1	37	c.261	CCDS47165.1	4																																																																																			-	pfam_Ten_N		0.408	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	protein_coding	OTTHUMT00000361734.1	A		-		183267832	+1	no_errors	ENST00000406950	ensembl	human	known	74_37	silent	SNP	0.995	T
GDF3	9573	genome.wustl.edu	37	12	7843092	7843092	+	Silent	SNP	G	G	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr12:7843092G>A	ENST00000329913.3	-	2	524	c.477C>T	c.(475-477)acC>acT	p.T159T		NM_020634.1	NP_065685.1	Q9NR23	GDF3_HUMAN	growth differentiation factor 3	159					endoderm development (GO:0007492)|eye development (GO:0001654)|formation of anatomical boundary (GO:0048859)|growth (GO:0040007)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of epidermal cell differentiation (GO:0045605)|notochord development (GO:0030903)|primitive streak formation (GO:0090009)|regulation of cell fate commitment (GO:0010453)|response to dietary excess (GO:0002021)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						GCTTAGGGGTGGTCTGGCCCC	0.537																																																	0								ENSG00000184344						60.0	63.0	62.0					12																	7843092		2203	4300	6503	GDF3	SO:0001819	synonymous_variant	0			-	HGNC	AF263538	CCDS8581.1	12p13.1	2014-01-30			ENSG00000184344	ENSG00000184344		"""Endogenous ligands"""	4218	protein-coding gene	gene with protein product		606522				9467948	Standard	NM_020634		Approved		uc001qte.3	Q9NR23	OTTHUMG00000168433	ENST00000329913.3:c.477C>T	12.37:g.7843092G>A		Somatic	0	43	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	23	58.93	Q8NEJ4	Silent	SNP	36	0.00	0	14	58.82	20	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.T159	ENST00000329913.3	37	c.477	CCDS8581.1	12																																																																																			-	pfam_TGF-b_N		0.537	GDF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF3	protein_coding	OTTHUMT00000399717.1	G		-		7843092	-1	no_errors	ENST00000329913	ensembl	human	known	74_37	silent	SNP	0.000	A
IQGAP2	10788	genome.wustl.edu	37	5	75884734	75884734	+	Silent	SNP	G	G	A	rs1131232	byFrequency	TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr5:75884734G>A	ENST00000274364.6	+	6	759	c.462G>A	c.(460-462)ttG>ttA	p.L154L	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	154	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		CTTTCAGTTTGTATCTGTTCA	0.279													A|||	3486	0.696086	0.7572	0.6671	5008	,	,		16795	0.751		0.492	False		,,,				2504	0.7873																0								ENSG00000145703	A		3096,1310	441.0+/-346.2	1102,892,209	68.0	75.0	72.0		462	-3.2	1.0	5	dbSNP_119	72	4100,4500	592.2+/-393.0	958,2184,1158	no	coding-synonymous	IQGAP2	NM_006633.2		2060,3076,1367	AA,AG,GG		47.6744,29.7322,44.6717		154/1576	75884734	7196,5810	2203	4300	6503	IQGAP2	SO:0001819	synonymous_variant	0			-	HGNC	U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.462G>A	5.37:g.75884734G>A		Somatic	0	29	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64	A8K4V1|B7Z8A4|J3KR91	Silent	SNP	30	0.00	0	60	0.00	0	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_dom,pfscan_RasGAP	p.L154	ENST00000274364.6	37	c.462	CCDS34188.1	5																																																																																			-	pfam_CH-domain,superfamily_CH-domain,pfscan_CH-domain		0.279	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	protein_coding	OTTHUMT00000368877.1	G	NM_006633	rs1131232		75884734	+1	no_errors	ENST00000274364	ensembl	human	known	74_37	silent	SNP	0.991	A
SMG5	23381	genome.wustl.edu	37	1	156237384	156237423	+	Frame_Shift_Del	DEL	TGGGTGAGGAGGGCAGGTAGAAGAGGCAGAGGTTGAAGTC	TGGGTGAGGAGGGCAGGTAGAAGAGGCAGAGGTTGAAGTC	-	rs7530192|rs201878597|rs372597884	byFrequency	TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	TGGGTGAGGAGGGCAGGTAGAAGAGGCAGAGGTTGAAGTC	TGGGTGAGGAGGGCAGGTAGAAGAGGCAGAGGTTGAAGTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr1:156237384_156237423delTGGGTGAGGAGGGCAGGTAGAAGAGGCAGAGGTTGAAGTC	ENST00000361813.5	-	10	1099_1138	c.955_994delGACTTCAACCTCTGCCTCTTCTACCTGCCCTCCTCACCCA	c.(955-996)gacttcaacctctgcctcttctacctgccctcctcacccaacfs	p.DFNLCLFYLPSSPN319fs	SMG5_ENST00000489907.2_5'Flank|SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	319					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					AGGCTGAGGTTGGGTGAGGAGGGCAGGTAGAAGAGGCAGAGGTTGAAGTCCTCCAGGACT	0.562																																																	0								ENSG00000198952																																			SMG5	SO:0001589	frameshift_variant	0				HGNC	AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.955_994delGACTTCAACCTCTGCCTCTTCTACCTGCCCTCCTCACCCA	1.37:g.156237384_156237423delTGGGTGAGGAGGGCAGGTAGAAGAGGCAGAGGTTGAAGTC	ENSP00000355261:p.Asp319fs	Somatic	NA	NA	NA		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Frame_Shift_Del	DEL	30	0.00	0	28	9.68	3	pfam_EST1,smart_PIN_dom	p.D319fs	ENST00000361813.5	37	c.994_955	CCDS1137.1	1																																																																																			-	NULL		0.562	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	protein_coding	OTTHUMT00000046308.1	TGGGTGAGGAGGGCAGGTAGAAGAGGCAGAGGTTGAAGTC	NM_015327			156237423	-1	no_errors	ENST00000361813	ensembl	human	known	74_37	frame_shift_del	DEL	0.982:1.000:1.000:0.998:0.963:0.996:0.995:0.914:0.996:0.996:0.994:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
EZR	7430	genome.wustl.edu	37	6	159206479	159206479	+	Missense_Mutation	SNP	A	A	G			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr6:159206479A>G	ENST00000367075.3	-	5	497	c.329T>C	c.(328-330)aTc>aCc	p.I110T	EZR_ENST00000392177.4_Missense_Mutation_p.I78T|EZR_ENST00000337147.7_Missense_Mutation_p.I110T|EZR_ENST00000476189.1_5'UTR	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	110	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		ATCGCTAAGGATTCCTTCCTT	0.527			T	ROS1	NSCLC																																			Dom	yes		6	6q25.3	7430	ezrin		E	0								ENSG00000092820						115.0	89.0	98.0					6																	159206479		2203	4300	6503	EZR	SO:0001583	missense	0			-	HGNC	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.329T>C	6.37:g.159206479A>G	ENSP00000356042:p.Ile110Thr	Somatic	0	98	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	55	39.56	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	21	0.00	0	20	50.00	20	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.I110T	ENST00000367075.3	37	c.329	CCDS5258.1	6	.	.	.	.	.	.	.	.	.	.	A	15.81	2.944019	0.53079	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.85484	-1.99;-1.99;-1.99	4.34	4.34	0.51931	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.94915	0.8356	H	0.98883	4.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96627	0.9464	10	0.87932	D	0	.	13.6987	0.62595	1.0:0.0:0.0:0.0	.	78;110	E7EQR4;P15311	.;EZRI_HUMAN	T	110;110;78	ENSP00000338934:I110T;ENSP00000356042:I110T;ENSP00000376016:I78T	ENSP00000338934:I110T	I	-	2	0	EZR	159126467	1.000000	0.71417	0.071000	0.20095	0.264000	0.26372	9.028000	0.93712	1.825000	0.53177	0.528000	0.53228	ATC	-	pirsf_ERM,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,pfscan_FERM_domain		0.527	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EZR	protein_coding	OTTHUMT00000042878.1	A	NM_003379	-		159206479	-1	no_errors	ENST00000337147	ensembl	human	known	74_37	missense	SNP	0.998	G
MYCBP2	23077	genome.wustl.edu	37	13	77836223	77836223	+	Silent	SNP	G	G	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr13:77836223G>T	ENST00000544440.2	-	11	1515	c.1498C>A	c.(1498-1500)Cga>Aga	p.R500R	MYCBP2_ENST00000407578.2_Silent_p.R538R|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Silent_p.R500R					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GCAAACTCTCGTCCTGCACCA	0.318																																																	0								ENSG00000005810						88.0	86.0	86.0					13																	77836223		2203	4299	6502	MYCBP2	SO:0001819	synonymous_variant	0			-	HGNC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.1498C>A	13.37:g.77836223G>T		Somatic	0	41	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51		Silent	SNP	38	0.00	0	56	0.00	0	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.R538	ENST00000544440.2	37	c.1612		13																																																																																			-	superfamily_RCC1/BLIP-II,superfamily_ARM-type_fold		0.318	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	protein_coding	OTTHUMT00000045326.1	G	NM_015057	-		77836223	-1	no_errors	ENST00000407578	ensembl	human	known	74_37	silent	SNP	1.000	T
PTEN	5728	genome.wustl.edu	37	10	89692895	89692895	+	Missense_Mutation	SNP	G	G	A	rs587781255		TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr10:89692895G>A	ENST00000371953.3	+	5	1736	c.379G>A	c.(379-381)Gga>Aga	p.G127R		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	127	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(5)|p.R55fs*1(5)|p.Y27fs*1(2)|p.G127R(2)|p.A121_F145del(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CTGTAAAGCTGGAAAGGGACG	0.408		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	53	Whole gene deletion(37)|Deletion - Frameshift(8)|Unknown(5)|Substitution - Missense(2)|Deletion - In frame(1)	prostate(16)|central_nervous_system(11)|skin(6)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|endometrium(3)|breast(3)|ovary(3)|soft_tissue(1)|urinary_tract(1)						ENSG00000171862						141.0	130.0	134.0					10																	89692895		2203	4300	6503	PTEN	SO:0001583	missense	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	-	HGNC	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.379G>A	10.37:g.89692895G>A	ENSP00000361021:p.Gly127Arg	Somatic	0	90	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	6	86.36	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	29	0.00	0	3	90.00	27	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.G127R	ENST00000371953.3	37	c.379	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.108288	0.94292	.	.	ENSG00000171862	ENST00000371953	D	0.99957	-8.97	5.22	5.22	0.72569	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.99969	0.9989	H	0.99211	4.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96771	0.9568	9	.	.	.	-11.1665	18.7776	0.91918	0.0:0.0:1.0:0.0	.	127	P60484	PTEN_HUMAN	R	127	ENSP00000361021:G127R	.	G	+	1	0	PTEN	89682875	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.429000	0.97481	2.411000	0.81874	0.655000	0.94253	GGA	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ		0.408	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	protein_coding	OTTHUMT00000049241.1	G	NM_000314	-		89692895	+1	no_errors	ENST00000371953	ensembl	human	known	74_37	missense	SNP	1.000	A
FRMD3	257019	genome.wustl.edu	37	9	85958162	85958162	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr9:85958162C>T	ENST00000304195.3	-	5	621	c.415G>A	c.(415-417)Ggc>Agc	p.G139S	FRMD3_ENST00000376438.1_Missense_Mutation_p.G139S	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	139	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						AGCAGGCGGCCATGAAAAATG	0.473																																																	0								ENSG00000172159						104.0	110.0	108.0					9																	85958162		2035	4194	6229	FRMD3	SO:0001583	missense	0			-	HGNC	AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.415G>A	9.37:g.85958162C>T	ENSP00000303508:p.Gly139Ser	Somatic	0	46	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	28	0.00	0	53	0.00	0	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.G139S	ENST00000304195.3	37	c.415	CCDS43840.1	9	.	.	.	.	.	.	.	.	.	.	C	36	5.734777	0.96865	.	.	ENSG00000172159	ENST00000376438;ENST00000304195;ENST00000376422	T;T	0.80909	-1.43;-1.43	6.17	6.17	0.99709	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	D	0.93527	0.7934	H	0.95470	3.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94182	0.7433	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	139;139	A2A2Y4;A2A2Y4-2	FRMD3_HUMAN;.	S	139;139;35	ENSP00000365621:G139S;ENSP00000303508:G139S	ENSP00000303508:G139S	G	-	1	0	FRMD3	85147982	1.000000	0.71417	0.816000	0.32577	0.958000	0.62258	7.693000	0.84214	2.941000	0.99782	0.655000	0.94253	GGC	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like		0.473	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD3	protein_coding	OTTHUMT00000157355.1	C	NM_174938	-		85958162	-1	no_errors	ENST00000304195	ensembl	human	known	74_37	missense	SNP	1.000	T
DDX5	1655	genome.wustl.edu	37	17	62497435	62497435	+	Intron	SNP	G	G	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr17:62497435G>T	ENST00000225792.5	-	12	1618				DDX5_ENST00000578804.1_Intron|DDX5_ENST00000580026.1_5'UTR|MIR3064_ENST00000581130.1_RNA|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000450599.2_Intron	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5						cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			GCGCTTCCAAGAAGCCAGGAT	0.478			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)			Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0								ENSG00000108654																																			DDX5	SO:0001627	intron_variant	0			-	HGNC	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1217-544C>A	17.37:g.62497435G>T		Somatic	0	39	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	RNA	SNP	28	0.00	0	44	0.00	0	-	NULL	ENST00000225792.5	37	NULL	CCDS11659.1	17																																																																																			-	-		0.478	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	protein_coding	OTTHUMT00000444030.1	G	NM_004396	-		62497435	-1	no_errors	ENST00000580026	ensembl	human	known	74_37	rna	SNP	1.000	T
C8orf48	157773	genome.wustl.edu	37	8	13425285	13425285	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr8:13425285G>A	ENST00000297324.4	+	1	934	c.785G>A	c.(784-786)tGg>tAg	p.W262*	RP11-145O15.3_ENST00000529018.1_RNA	NM_001007090.2	NP_001007091	Q96LL4	CH048_HUMAN	chromosome 8 open reading frame 48	262										NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	5						AGAATAATCTGGAAAAGACTG	0.408																																																	0								ENSG00000164743						53.0	49.0	51.0					8																	13425285		692	1591	2283	C8orf48	SO:0001587	stop_gained	0			-	HGNC	AK058131	CCDS47809.1	8p22	2012-04-13			ENSG00000164743	ENSG00000164743			26345	protein-coding gene	gene with protein product						12477932	Standard	NM_001007090		Approved	FLJ25402	uc003wwp.3	Q96LL4	OTTHUMG00000165482	ENST00000297324.4:c.785G>A	8.37:g.13425285G>A	ENSP00000297324:p.Trp262*	Somatic	0	51	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	Q96LJ9	Nonsense_Mutation	SNP	32	0.00	0	33	0.00	0	NULL	p.W262*	ENST00000297324.4	37	c.785	CCDS47809.1	8	.	.	.	.	.	.	.	.	.	.	G	37	6.077391	0.97262	.	.	ENSG00000164743	ENST00000297324	.	.	.	5.26	5.26	0.73747	.	0.000000	0.40144	U	0.001177	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.7302	0.69374	0.0:0.0:1.0:0.0	.	.	.	.	X	262	.	ENSP00000297324:W262X	W	+	2	0	C8orf48	13469656	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	5.204000	0.65180	2.644000	0.89710	0.655000	0.94253	TGG	-	NULL		0.408	C8orf48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf48	protein_coding	OTTHUMT00000384400.1	G	NM_001007090	-		13425285	+1	no_errors	ENST00000297324	ensembl	human	known	74_37	nonsense	SNP	1.000	A
TESK1	7016	genome.wustl.edu	37	9	35607308	35607309	+	Intron	DEL	TG	TG	-			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr9:35607308_35607309delTG	ENST00000336395.5	+	5	787				MIR4667_ENST00000578933.1_RNA|TESK1_ENST00000498522.1_Intron|CD72_ENST00000490239.1_5'Flank	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1						cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GGGGATACTATGTGTGTGTGTG	0.545																																																	0								ENSG00000107140																																			TESK1	SO:0001627	intron_variant	0				HGNC	D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.538-15TG>-	9.37:g.35607318_35607319delTG		Somatic	0	30	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	Q8IXZ8	RNA	DEL	26	0.00	0	35	2.78	1	-	NULL	ENST00000336395.5	37	NULL	CCDS6580.1	9																																																																																			-	-		0.545	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK1	protein_coding	OTTHUMT00000052314.1	TG	NM_006285			35607309	+1	no_errors	ENST00000463897	ensembl	human	known	74_37	rna	DEL	0.001:0.001	-
GDF2	2658	genome.wustl.edu	37	10	48416492	48416492	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr10:48416492G>A	ENST00000249598.1	-	1	361	c.202C>T	c.(202-204)Cgc>Tgc	p.R68C		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	68			R -> L (in HHT5; impaired protein processing and function). {ECO:0000269|PubMed:23972370}.		activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R68C(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						TTAAGGCTGCGCAGGAAATCC	0.577																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000128802						78.0	73.0	75.0					10																	48416492		2203	4300	6503	GDF2	SO:0001583	missense	0			-	HGNC	AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.202C>T	10.37:g.48416492G>A	ENSP00000249598:p.Arg68Cys	Somatic	0	48	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	64	8.57	Q5VSQ9|Q9Y571	Missense_Mutation	SNP	26	0.00	0	47	7.69	4	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.R68C	ENST00000249598.1	37	c.202	CCDS7219.1	10	.	.	.	.	.	.	.	.	.	.	G	16.99	3.272845	0.59649	.	.	ENSG00000128802	ENST00000249598	T	0.67865	-0.29	5.22	5.22	0.72569	Transforming growth factor-beta, N-terminal (1);	0.048640	0.85682	D	0.000000	T	0.77831	0.4189	M	0.76002	2.32	0.80722	D	1	D	0.89917	1.0	D	0.72625	0.978	T	0.79107	-0.1939	10	0.62326	D	0.03	.	7.3187	0.26515	0.0861:0.0:0.7337:0.1802	.	68	Q9UK05	GDF2_HUMAN	C	68	ENSP00000249598:R68C	ENSP00000249598:R68C	R	-	1	0	GDF2	48036498	1.000000	0.71417	1.000000	0.80357	0.374000	0.29953	3.013000	0.49582	2.595000	0.87683	0.655000	0.94253	CGC	-	pfam_TGF-b_N		0.577	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF2	protein_coding	OTTHUMT00000047891.1	G	NM_016204	-		48416492	-1	no_errors	ENST00000249598	ensembl	human	known	74_37	missense	SNP	1.000	A
LRRIQ3	127255	genome.wustl.edu	37	1	74649253	74649253	+	Missense_Mutation	SNP	T	T	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr1:74649253T>A	ENST00000395089.1	-	1	115	c.116A>T	c.(115-117)cAt>cTt	p.H39L	LRRIQ3_ENST00000354431.4_Missense_Mutation_p.H39L|LRRIQ3_ENST00000370911.3_Missense_Mutation_p.H39L|LRRIQ3_ENST00000370909.2_Missense_Mutation_p.H39L			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	39										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						agactttaaatgaaggccatt	0.328																																																	0								ENSG00000162620						57.0	59.0	58.0					1																	74649253		2201	4296	6497	LRRIQ3	SO:0001583	missense	0			-	HGNC	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.116A>T	1.37:g.74649253T>A	ENSP00000378524:p.His39Leu	Somatic	0	44	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	13	48.00	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Missense_Mutation	SNP	39	0.00	0	32	54.29	38	pfscan_IQ_motif_EF-hand-BS	p.H39L	ENST00000395089.1	37	c.116	CCDS41350.1	1	.	.	.	.	.	.	.	.	.	.	T	12.66	2.004484	0.35320	.	.	ENSG00000162620	ENST00000395089;ENST00000354431;ENST00000370909;ENST00000388972;ENST00000370911	T;T;T;T	0.31769	1.98;1.98;1.48;1.98	5.06	3.87	0.44632	.	0.261790	0.27311	N	0.019954	T	0.07818	0.0196	N	0.19112	0.55	0.29138	N	0.879195	B	0.12630	0.006	B	0.08055	0.003	T	0.18999	-1.0319	10	0.59425	D	0.04	.	8.9473	0.35767	0.3186:0.0:0.0:0.6814	.	39	A6PVS8	LRIQ3_HUMAN	L	39	ENSP00000378524:H39L;ENSP00000346414:H39L;ENSP00000359946:H39L;ENSP00000359948:H39L	ENSP00000346414:H39L	H	-	2	0	LRRIQ3	74421841	0.997000	0.39634	0.994000	0.49952	0.913000	0.54294	1.259000	0.32956	0.787000	0.33731	0.533000	0.62120	CAT	-	NULL		0.328	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRIQ3	protein_coding	OTTHUMT00000316539.1	T	NM_145258	-		74649253	-1	no_errors	ENST00000354431	ensembl	human	known	74_37	missense	SNP	1.000	A
LOC440040	440040	genome.wustl.edu	37	11	49830158	49830158	+	RNA	SNP	G	G	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr11:49830158G>A	ENST00000527477.1	+	0	1489																											CCCATCACTGGACTGAGGGAC	0.473																																																	0								ENSG00000205035																																			RP11-707M1.1			0			-	Clone_based_vega_gene																													11.37:g.49830158G>A		Somatic	0	169	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	102	36.25		RNA	SNP	23	0.00	0	20	45.95	17	-	NULL	ENST00000527477.1	37	NULL		11																																																																																			-	-		0.473	RP11-707M1.1-003	KNOWN	basic	processed_transcript	LOC440040	pseudogene	OTTHUMT00000391378.2	G		-		49830158	+1	no_errors	ENST00000527477	ensembl	human	known	74_37	rna	SNP	0.189	A
TTC6	319089	genome.wustl.edu	37	14	38091983	38091983	+	Silent	SNP	G	G	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr14:38091983G>A	ENST00000553443.1	+	1	714	c.714G>A	c.(712-714)gaG>gaA	p.E238E				Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	0										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		GGGCCCGCGAGGCGCGGGAAG	0.731																																																	0								ENSG00000139865																																			TTC6	SO:0001819	synonymous_variant	0			-	HGNC	BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000553443.1:c.714G>A	14.37:g.38091983G>A		Somatic	0	12	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	Q3SY88|Q96CE6	Silent	SNP	21	0.00	0	26	33.33	13	NULL	p.E238	ENST00000553443.1	37	c.714		14																																																																																			-	NULL		0.731	TTC6-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TTC6	protein_coding	OTTHUMT00000348620.4	G	XM_002343299	-		38091983	+1	no_errors	ENST00000533625	ensembl	human	known	74_37	silent	SNP	0.000	A
LAMA1	284217	genome.wustl.edu	37	18	6975937	6975937	+	Splice_Site	SNP	G	G	T			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr18:6975937G>T	ENST00000389658.3	-	45	6581	c.6488C>A	c.(6487-6489)gCt>gAt	p.A2163D	RN7SL537P_ENST00000584392.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2163	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ATAACTTACAGCGGTGCTGCT	0.383																																																	0								ENSG00000101680						136.0	136.0	136.0					18																	6975937		2203	4300	6503	LAMA1	SO:0001630	splice_region_variant	0			-	HGNC	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.6489+1C>A	18.37:g.6975937G>T		Somatic	0	33	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79		Missense_Mutation	SNP	33	0.00	0	46	0.00	0	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.A2163D	ENST00000389658.3	37	c.6488	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	1.105	-0.660024	0.03454	.	.	ENSG00000101680	ENST00000389658	T	0.61980	0.06	5.64	2.91	0.33838	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.328929	0.32134	N	0.006537	T	0.38348	0.1037	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.14755	-1.0461	10	0.15499	T	0.54	.	4.7228	0.12926	0.0:0.4925:0.1594:0.3481	.	2163	P25391	LAMA1_HUMAN	D	2163	ENSP00000374309:A2163D	ENSP00000374309:A2163D	A	-	2	0	LAMA1	6965937	0.409000	0.25368	0.001000	0.08648	0.035000	0.12851	0.856000	0.27818	0.423000	0.26033	-0.902000	0.02854	GCT	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.383	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	protein_coding	OTTHUMT00000257369.1	G	NM_005559	-	Missense_Mutation	6975937	-1	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	SNP	0.001	T
SH2B1	25970	genome.wustl.edu	37	16	28875215	28875223	+	Intron	DEL	GCCGCCGCC	GCCGCCGCC	-	rs55893769|rs564097441|rs138146565|rs577756912	byFrequency	TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	GCCGCCGCC	GCCGCCGCC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr16:28875215_28875223delGCCGCCGCC	ENST00000322610.8	+	3	356				SH2B1_ENST00000395532.4_5'Flank|SH2B1_ENST00000563674.1_3'UTR|RP11-22P6.2_ENST00000567731.1_RNA|SH2B1_ENST00000337120.5_5'UTR|SH2B1_ENST00000538342.1_5'UTR|SH2B1_ENST00000359285.5_5'UTR|SH2B1_ENST00000545570.1_Intron			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						GGGAGCGGGAgccgccgccgccgccgccg	0.713																																																	0								ENSG00000178188																																			SH2B1	SO:0001627	intron_variant	0				HGNC	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.-84+140GCCGCCGCC>-	16.37:g.28875224_28875232delGCCGCCGCC		Somatic	NA	NA	NA		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	RNA	DEL	13	38.10	8	26	33.33	13	-	NULL	ENST00000322610.8	37	NULL	CCDS53996.1	16																																																																																			-	-		0.713	SH2B1-001	KNOWN	basic|CCDS	protein_coding	SH2B1	protein_coding	OTTHUMT00000432666.1	GCCGCCGCC	NM_015503			28875223	+1	no_errors	ENST00000563674	ensembl	human	known	74_37	rna	DEL	0.968:0.615:0.267:1.000:1.000:1.000:0.999:0.964:0.945	-
SCN9A	6335	genome.wustl.edu	37	2	167168143	167168143	+	Missense_Mutation	SNP	C	C	A			TCGA-IE-A4EK-01A-11D-A24N-09	TCGA-IE-A4EK-10A-01D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	56681386-d407-4f53-ae4f-6c04437652f7	0989420d-2639-41ee-912d-3526312eeb65	g.chr2:167168143C>A	ENST00000409435.1	-	1	123	c.124G>T	c.(124-126)Gat>Tat	p.D42Y	SCN9A_ENST00000303354.6_Missense_Mutation_p.D42Y|SCN9A_ENST00000409672.1_Missense_Mutation_p.D42Y|SCN9A_ENST00000375387.4_Missense_Mutation_p.D42Y			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	42					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TCTTCATCATCATCTTTCTTT	0.473																																																	0								ENSG00000169432						110.0	116.0	114.0					2																	167168143		2023	4212	6235	SCN9A	SO:0001583	missense	0			-	HGNC	X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.124G>T	2.37:g.167168143C>A	ENSP00000386330:p.Asp42Tyr	Somatic	0	62	0.00		0.6368422372731544	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	35	36.36	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	26	0.00	0	14	61.11	22	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.D42Y	ENST00000409435.1	37	c.124	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	c	12.07	1.828552	0.32329	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435	D;D;D;D	0.96365	-3.97;-3.99;-3.99;-3.99	5.33	4.46	0.54185	.	0.506884	0.19557	N	0.111405	D	0.97720	0.9252	M	0.89414	3.03	0.42028	D	0.991016	P	0.47484	0.896	P	0.54924	0.764	D	0.98137	1.0434	10	0.87932	D	0	.	13.5435	0.61688	0.0:0.9238:0.0:0.0762	.	42	E7EUN6	.	Y	42	ENSP00000386306:D42Y;ENSP00000364536:D42Y;ENSP00000304748:D42Y;ENSP00000386330:D42Y	ENSP00000304748:D42Y	D	-	1	0	SCN9A	166876389	0.295000	0.24389	0.698000	0.30274	0.058000	0.15608	1.569000	0.36428	1.253000	0.44018	-0.218000	0.12543	GAT	-	NULL		0.473	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	protein_coding	OTTHUMT00000333639.1	C	NM_002977	-		167168143	-1	no_errors	ENST00000303354	ensembl	human	known	74_37	missense	SNP	0.843	A
