#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
NGRN	51335	genome.wustl.edu	37	15	90814896	90814896	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr15:90814896C>T	ENST00000379095.3	+	3	760	c.752C>T	c.(751-753)gCg>gTg	p.A251V	NGRN_ENST00000331497.3_3'UTR|RP11-697E2.6_ENST00000561573.1_3'UTR	NM_001033088.1	NP_001028260.2	Q9NPE2	NGRN_HUMAN	neugrin, neurite outgrowth associated	251					neuron differentiation (GO:0030182)	extracellular region (GO:0005576)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			GGCAGTGGTGCGTTGCCAAGT	0.547																																																	0								ENSG00000182768						45.0	41.0	43.0					15																	90814896		2199	4298	6497	NGRN	SO:0001583	missense	0			-	HGNC	AB029315	CCDS32329.1	15q26.1	2008-02-05			ENSG00000182768	ENSG00000182768			18077	protein-coding gene	gene with protein product						11118320	Standard	NR_028052		Approved	DSC92	uc002bpf.1	Q9NPE2	OTTHUMG00000149807	ENST00000379095.3:c.752C>T	15.37:g.90814896C>T	ENSP00000368389:p.Ala251Val	Somatic	0	158	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	117	69	62.90	B2R6M8|Q4V9L7|Q9HBL4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neugrin-related	p.A251V	ENST00000379095.3	37	c.752	CCDS32329.1	15	.	.	.	.	.	.	.	.	.	.	C	7.564	0.665362	0.14710	.	.	ENSG00000182768	ENST00000379095	T	0.29917	1.55	4.73	-0.802	0.10889	.	1.300320	0.05636	U	0.582555	T	0.10637	0.0260	N	0.02539	-0.55	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.19128	-1.0315	10	0.29301	T	0.29	.	0.8411	0.01150	0.1808:0.2816:0.2593:0.2783	.	251	Q9NPE2	NGRN_HUMAN	V	251	ENSP00000368389:A251V	ENSP00000368389:A251V	A	+	2	0	NGRN	88615900	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.889000	0.04144	-0.220000	0.09988	-1.310000	0.01310	GCG	-	pfam_Neugrin-related		0.547	NGRN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NGRN	protein_coding	OTTHUMT00000313418.1	C		-		90814896	+1	no_errors	ENST00000379095	ensembl	human	known	74_37	missense	SNP	0.000	T
SCNN1G	6340	genome.wustl.edu	37	16	23197641	23197641	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr16:23197641G>A	ENST00000300061.2	+	2	192	c.49G>A	c.(49-51)Gtg>Atg	p.V17M		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	17					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	GAATCTGCCCGTGACGGGCCC	0.617																																																	0								ENSG00000166828						53.0	56.0	55.0					16																	23197641		2197	4300	6497	SCNN1G	SO:0001583	missense	0			-	HGNC	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.49G>A	16.37:g.23197641G>A	ENSP00000300061:p.Val17Met	Somatic	0	72	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	5	89.58	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.V17M	ENST00000300061.2	37	c.49	CCDS10608.1	16	.	.	.	.	.	.	.	.	.	.	G	9.968	1.224700	0.22457	.	.	ENSG00000166828	ENST00000300061	T	0.71817	-0.6	5.25	5.25	0.73442	.	0.483686	0.20177	N	0.097602	T	0.49372	0.1553	N	0.08118	0	0.26844	N	0.968302	D	0.59357	0.985	B	0.35655	0.207	T	0.53201	-0.8472	10	0.48119	T	0.1	-32.9152	17.4127	0.87491	0.0:0.0:1.0:0.0	.	17	P51170	SCNNG_HUMAN	M	17	ENSP00000300061:V17M	ENSP00000300061:V17M	V	+	1	0	SCNN1G	23105142	0.993000	0.37304	0.067000	0.19924	0.057000	0.15508	2.224000	0.42945	2.435000	0.82474	0.561000	0.74099	GTG	-	NULL		0.617	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1G	protein_coding	OTTHUMT00000254496.1	G	NM_001039	-		23197641	+1	no_errors	ENST00000300061	ensembl	human	known	74_37	missense	SNP	0.446	A
ZNF761	388561	genome.wustl.edu	37	19	53960833	53960859	+	RNA	DEL	AATGAGTAGAGCAAACCATCAAGCATT	AATGAGTAGAGCAAACCATCAAGCATT	-	rs142938236|rs563984436|rs370104297	byFrequency	TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	AATGAGTAGAGCAAACCATCAAGCATT	AATGAGTAGAGCAAACCATCAAGCATT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr19:53960833_53960859delAATGAGTAGAGCAAACCATCAAGCATT	ENST00000454407.1	+	0	3525_3551							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		GTCCATATGCAATGAGTAGAGCAAACCATCAAGCATTAATTGACATT	0.357														341	0.0680911	0.0477	0.0591	5008	,	,		29050	0.1607		0.0358	False		,,,				2504	0.0399																0								ENSG00000160336																																			ZNF761			0				HGNC	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		19.37:g.53960833_53960859delAATGAGTAGAGCAAACCATCAAGCATT		Somatic	NA	NA	NA		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6ZNB9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000454407.1	37	NULL		19																																																																																			-	-		0.357	ZNF761-203	KNOWN	basic	processed_transcript	ZNF761	processed_transcript		AATGAGTAGAGCAAACCATCAAGCATT	NM_001008401			53960859	+1	no_errors	ENST00000334095	ensembl	human	known	74_37	rna	DEL	0.001:0.002:0.010:0.032:0.032:0.002:0.001:0.001:0.002:0.003:0.003:0.004:0.004:0.001:0.002:0.002:0.006:0.007:0.011:0.002:0.000:0.006:0.003:0.000:0.000:0.000:0.001	-
CBX8	57332	genome.wustl.edu	37	17	77769090	77769090	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr17:77769090G>A	ENST00000269385.4	-	5	631	c.514C>T	c.(514-516)Cgg>Tgg	p.R172W	CBX8_ENST00000485449.1_5'Flank	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	172					histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			tcacgttcccgctccctctct	0.682																																																	0								ENSG00000141570						61.0	41.0	47.0					17																	77769090		2203	4300	6503	CBX8	SO:0001583	missense	0			-	HGNC	AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.514C>T	17.37:g.77769090G>A	ENSP00000269385:p.Arg172Trp	Somatic	0	179	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	226	19.79	Q96H39|Q9NR07	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.R172W	ENST00000269385.4	37	c.514	CCDS11765.1	17	.	.	.	.	.	.	.	.	.	.	G	14.16	2.452756	0.43531	.	.	ENSG00000141570	ENST00000269385;ENST00000427800;ENST00000413392	T;T;T	0.57752	0.64;0.38;0.64	2.92	-4.23	0.03789	.	1.786060	0.03020	N	0.150615	T	0.61578	0.2358	L	0.36672	1.1	0.09310	N	1	D	0.89917	1.0	D	0.64321	0.924	T	0.63005	-0.6733	10	0.66056	D	0.02	-8.0783	13.7199	0.62720	0.0:0.0:0.1745:0.8255	.	172	Q9HC52	CBX8_HUMAN	W	172;147;162	ENSP00000269385:R172W;ENSP00000408753:R147W;ENSP00000405058:R162W	ENSP00000269385:R172W	R	-	1	2	CBX8	75383685	0.000000	0.05858	0.023000	0.16930	0.935000	0.57460	-1.134000	0.03228	-0.863000	0.04084	-0.521000	0.04368	CGG	-	NULL		0.682	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX8	protein_coding	OTTHUMT00000318011.1	G	NM_020649	-		77769090	-1	no_errors	ENST00000269385	ensembl	human	known	74_37	missense	SNP	0.036	A
SEMA6C	10500	genome.wustl.edu	37	1	151104667	151104667	+	3'UTR	SNP	G	G	A	rs587698691		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr1:151104667G>A	ENST00000341697.3	-	0	4777				RP11-68I18.10_ENST00000563624.1_RNA|SEMA6C_ENST00000479820.1_5'UTR			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C						axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			AGCCCCGAGGGGCGAGTTAAG	0.682													G|||	1	0.000199681	0.0	0.0	5008	,	,		13096	0.0		0.001	False		,,,				2504	0.0																0								ENSG00000143434																																			SEMA6C	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.*293C>T	1.37:g.151104667G>A		Somatic	0	11	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000341697.3	37	NULL	CCDS984.1	1																																																																																			-	-		0.682	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	SEMA6C	protein_coding	OTTHUMT00000034074.1	G	NM_030913	-		151104667	-1	no_errors	ENST00000479820	ensembl	human	known	74_37	rna	SNP	0.936	A
SMARCA2	6595	genome.wustl.edu	37	9	2161707	2161707	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:2161707G>T	ENST00000382203.1	+	28	4212	c.4003G>T	c.(4003-4005)Gag>Tag	p.E1335*	SMARCA2_ENST00000302401.3_Nonsense_Mutation_p.E41*|SMARCA2_ENST00000382194.1_Nonsense_Mutation_p.E1335*|SMARCA2_ENST00000349721.2_Nonsense_Mutation_p.E1335*|SMARCA2_ENST00000382185.1_5'UTR|SMARCA2_ENST00000382186.1_5'UTR|RNU2-25P_ENST00000411041.1_RNA|SMARCA2_ENST00000324954.5_5'UTR|SMARCA2_ENST00000357248.2_Nonsense_Mutation_p.E1335*			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	1335					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CGGCAATTTGGAGGAAATGGA	0.368																																																	0								ENSG00000080503						71.0	70.0	70.0					9																	2161707		2203	4300	6503	SMARCA2	SO:0001587	stop_gained	0			-	HGNC	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.4003G>T	9.37:g.2161707G>T	ENSP00000371638:p.Glu1335*	Somatic	1	178	0.56		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	69	188	26.85	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,superfamily_RNaseH-like_dom,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain,prints_Bromodomain	p.E1335*	ENST00000382203.1	37	c.4003	CCDS34977.1	9	.	.	.	.	.	.	.	.	.	.	G	47	13.506735	0.99746	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194;ENST00000302401;ENST00000423555;ENST00000417599	.	.	.	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-20.4405	18.59	0.91206	0.0:0.0:1.0:0.0	.	.	.	.	X	1335;1335;1335;1335;41;39;39	.	ENSP00000305411:E41X	E	+	1	0	SMARCA2	2151707	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.573000	0.98181	2.386000	0.81285	0.585000	0.79938	GAG	-	superfamily_RNaseH-like_dom		0.368	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	SMARCA2	protein_coding	OTTHUMT00000051505.1	G	NM_003070	-		2161707	+1	no_errors	ENST00000349721	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TCOF1	6949	genome.wustl.edu	37	5	149747446	149747446	+	Missense_Mutation	SNP	C	C	T	rs200375016		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr5:149747446C>T	ENST00000504761.2	+	4	344	c.344C>T	c.(343-345)gCg>gTg	p.A115V	TCOF1_ENST00000445265.2_Missense_Mutation_p.A115V|TCOF1_ENST00000394269.3_Missense_Mutation_p.A115V|TCOF1_ENST00000451292.1_Missense_Mutation_p.A115V|TCOF1_ENST00000323668.7_Missense_Mutation_p.A115V|TCOF1_ENST00000439160.2_Missense_Mutation_p.A115V|TCOF1_ENST00000513346.1_Missense_Mutation_p.A115V|TCOF1_ENST00000377797.3_Missense_Mutation_p.A115V			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	115					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTCCTGGGGGCGGACTTGCCA	0.488													C|||	1	0.000199681	0.0	0.0014	5008	,	,		21486	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000070814						84.0	84.0	84.0					5																	149747446		2203	4300	6503	TCOF1	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.344C>T	5.37:g.149747446C>T	ENSP00000421655:p.Ala115Val	Somatic	0	88	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	35	42.62	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TCS_treacle,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_Treacle-like_TCS	p.A115V	ENST00000504761.2	37	c.344	CCDS54936.1	5	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	11.61	1.689577	0.29962	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000394269;ENST00000427724;ENST00000504761;ENST00000513346;ENST00000515516	T;T;T;T;T;D;T;T;T;D	0.85088	-1.09;-1.11;-1.08;-1.08;-1.09;-1.92;-1.09;-1.1;-1.1;-1.94	4.46	-3.38	0.04883	.	1.378430	0.05072	N	0.481824	T	0.74726	0.3754	L	0.44542	1.39	0.09310	N	1	P;B;P;B;B;B	0.35272	0.493;0.038;0.493;0.36;0.038;0.038	B;B;B;B;B;B	0.26094	0.066;0.008;0.066;0.03;0.008;0.008	T	0.61222	-0.7106	10	0.40728	T	0.16	0.7303	5.6899	0.17823	0.1425:0.2985:0.0:0.5589	.	115;115;115;115;115;115	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8;Q13428-5	.;.;.;TCOF_HUMAN;.;.	V	115;115;115;115;115;115;115;115;115;103	ENSP00000400939:A115V;ENSP00000367028:A115V;ENSP00000409944:A115V;ENSP00000325223:A115V;ENSP00000406888:A115V;ENSP00000377811:A115V;ENSP00000390717:A115V;ENSP00000421655:A115V;ENSP00000427484:A115V;ENSP00000426471:A103V	ENSP00000325223:A115V	A	+	2	0	TCOF1	149727639	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.158000	0.03153	-0.745000	0.04772	-0.251000	0.11542	GCG	-	NULL		0.488	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCOF1	protein_coding	OTTHUMT00000380552.1	C	NM_001008656	rs200375016		149747446	+1	no_errors	ENST00000451292	ensembl	human	known	74_37	missense	SNP	0.000	T
CDON	50937	genome.wustl.edu	37	11	125828487	125828488	+	3'UTR	INS	-	-	G	rs145359005|rs35654681|rs61917812|rs66953503		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr11:125828487_125828488insG	ENST00000392693.3	-	0	6340_6341				RP11-680F20.6_ENST00000531193.1_RNA|CDON_ENST00000531738.1_3'UTR|RP11-680F20.12_ENST00000582823.1_RNA|RP11-680F20.6_ENST00000524962.2_RNA	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated						anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		tgtgtgtgtgtttatatatata	0.262																																																	0								ENSG00000264299																																			RP11-680F20.12	SO:0001624	3_prime_UTR_variant	0				Clone_based_vega_gene	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.*2350->C	11.37:g.125828487_125828488insG		Somatic	0	42	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	O14631	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000392693.3	37	NULL	CCDS58192.1	11																																																																																			-	-		0.262	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000264299	protein_coding	OTTHUMT00000386749.2	-	NM_016952			125828488	+1	no_errors	ENST00000582823	ensembl	human	known	74_37	rna	INS	0.002:0.001	G
ATRX	546	genome.wustl.edu	37	X	76778881	76778883	+	Splice_Site	DEL	TGT	TGT	-			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chrX:76778881_76778883delTGT	ENST00000373344.5	-	31	6914		c.e31-2		ATRX_ENST00000480283.1_Splice_Site|ATRX_ENST00000395603.3_Splice_Site	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TATGGTATCCTGTTTAGAGGGGT	0.369			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	0								ENSG00000085224																																			ATRX	SO:0001630	splice_region_variant	0				HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.6700-2ACA>-	X.37:g.76778881_76778883delTGT		Somatic	0	247	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	182	16.89	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Splice_Site	DEL	NA	NA	NA	NA	NA	NA	-	e31-2	ENST00000373344.5	37	c.6700-4_6700-2	CCDS14434.1	X																																																																																			-	-		0.369	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	TGT	NM_000489		Intron	76778883	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	splice_site_del	DEL	1.000:0.936:0.928	-
FGD2	221472	genome.wustl.edu	37	6	36990132	36990132	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr6:36990132C>T	ENST00000274963.8	+	13	1615	c.1444C>T	c.(1444-1446)Cgg>Tgg	p.R482W		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	482					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						CCACCACTGCCGGGCCTGCGG	0.667																																																	0								ENSG00000146192						42.0	39.0	40.0					6																	36990132		2203	4299	6502	FGD2	SO:0001583	missense	0			-	HGNC	AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.1444C>T	6.37:g.36990132C>T	ENSP00000274963:p.Arg482Trp	Somatic	1	199	0.50		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	73	238	23.40	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Znf_FYVE,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.R482W	ENST00000274963.8	37	c.1444	CCDS4829.1	6	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682729	0.68157	.	.	ENSG00000146192	ENST00000274963;ENST00000394459	D	0.81579	-1.51	4.59	2.67	0.31697	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.33959	N	0.004384	D	0.90926	0.7148	H	0.97103	3.94	0.39881	D	0.973648	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93118	0.6522	10	0.87932	D	0	-15.4771	12.7324	0.57204	0.2986:0.7014:0.0:0.0	.	482;59	Q7Z6J4;Q7Z6J4-2	FGD2_HUMAN;.	W	482;110	ENSP00000274963:R482W	ENSP00000274963:R482W	R	+	1	2	FGD2	37098110	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	1.627000	0.37050	0.887000	0.36136	0.313000	0.20887	CGG	-	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel		0.667	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD2	protein_coding	OTTHUMT00000040398.2	C	NM_173558	-		36990132	+1	no_errors	ENST00000274963	ensembl	human	known	74_37	missense	SNP	1.000	T
TMEM63B	55362	genome.wustl.edu	37	6	44122120	44122120	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr6:44122120G>A	ENST00000259746.9	+	23	2428	c.2245G>A	c.(2245-2247)Gat>Aat	p.D749N	TMEM63B_ENST00000323267.6_Missense_Mutation_p.D749N			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	749					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CACGGAGACAGATACTGTGGA	0.617																																																	0								ENSG00000137216						103.0	106.0	105.0					6																	44122120		2203	4300	6503	TMEM63B	SO:0001583	missense	0			-	HGNC	BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.2245G>A	6.37:g.44122120G>A	ENSP00000259746:p.Asp749Asn	Somatic	0	41	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	92	17.12	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF221	p.D749N	ENST00000259746.9	37	c.2245	CCDS34461.1	6	.	.	.	.	.	.	.	.	.	.	G	15.01	2.707198	0.48412	.	.	ENSG00000137216	ENST00000259746;ENST00000323267	T;T	0.46451	0.87;0.87	4.99	4.99	0.66335	.	0.528287	0.16558	N	0.209156	T	0.22399	0.0540	L	0.42245	1.32	0.28662	N	0.906079	P	0.44195	0.828	B	0.36959	0.237	T	0.14062	-1.0486	10	0.72032	D	0.01	.	15.4833	0.75545	0.0:0.0:1.0:0.0	.	749	Q5T3F8	TM63B_HUMAN	N	749	ENSP00000259746:D749N;ENSP00000327154:D749N	ENSP00000259746:D749N	D	+	1	0	TMEM63B	44230098	1.000000	0.71417	0.981000	0.43875	0.977000	0.68977	5.375000	0.66173	2.345000	0.79718	0.555000	0.69702	GAT	-	NULL		0.617	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	protein_coding	OTTHUMT00000040712.2	G	XM_166410	-		44122120	+1	no_errors	ENST00000259746	ensembl	human	known	74_37	missense	SNP	0.908	A
NUP85	79902	genome.wustl.edu	37	17	73228049	73228049	+	Nonsense_Mutation	SNP	T	T	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr17:73228049T>A	ENST00000245544.4	+	14	1442	c.1371T>A	c.(1369-1371)tgT>tgA	p.C457*	NUP85_ENST00000579298.1_Nonsense_Mutation_p.C412*|NUP85_ENST00000541827.1_Nonsense_Mutation_p.C411*|NUP85_ENST00000579324.1_Nonsense_Mutation_p.C345*|NUP85_ENST00000447371.2_Nonsense_Mutation_p.C289*|NUP85_ENST00000540768.1_Nonsense_Mutation_p.C60*	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa	457					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			TGCGGATCTGTGAGCAGCGGC	0.592																																																	0								ENSG00000125450						45.0	43.0	44.0					17																	73228049		2203	4300	6503	NUP85	SO:0001587	stop_gained	0			-	HGNC	AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.1371T>A	17.37:g.73228049T>A	ENSP00000245544:p.Cys457*	Somatic	0	41	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	66	25	72.53	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nucleoporin_Nup85	p.C457*	ENST00000245544.4	37	c.1371	CCDS32730.1	17	.	.	.	.	.	.	.	.	.	.	T	18.24	3.579403	0.65878	.	.	ENSG00000125450	ENST00000245544;ENST00000541827;ENST00000447371;ENST00000540768	.	.	.	5.23	-2.93	0.05598	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.5484	11.5756	0.50860	0.0:0.4588:0.0:0.5411	.	.	.	.	X	457;411;289;60	.	ENSP00000245544:C457X	C	+	3	2	NUP85	70739644	0.998000	0.40836	0.910000	0.35882	0.994000	0.84299	0.382000	0.20635	-0.509000	0.06532	0.459000	0.35465	TGT	-	pfam_Nucleoporin_Nup85		0.592	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP85	protein_coding	OTTHUMT00000446619.1	T	NM_024844	-		73228049	+1	no_errors	ENST00000245544	ensembl	human	known	74_37	nonsense	SNP	0.996	A
OR2J1	442185	genome.wustl.edu	37	6	29068810	29068810	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr6:29068810G>T	ENST00000377171.3	+	1	425	c.91G>T	c.(91-93)Gtt>Ttt	p.V31F				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						TCTCTTTGTGGTTATCTTGAT	0.373																																																	0								ENSG00000204702																																			OR2J1	SO:0001583	missense	0			-	HGNC			6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.91G>T	6.37:g.29068810G>T	ENSP00000366376:p.Val31Phe	Somatic	0	245	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	367	14.85	A2AAS1|B0V1T2|Q9GZK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.V31F	ENST00000377171.3	37	c.91		6	.	.	.	.	.	.	.	.	.	.	G	2.530	-0.308768	0.05458	.	.	ENSG00000204702	ENST00000377171	T	0.03065	4.06	2.21	0.193	0.15139	.	.	.	.	.	T	0.00967	0.0032	.	.	.	0.28490	N	0.914543	.	.	.	.	.	.	T	0.48758	-0.9007	6	0.35671	T	0.21	.	1.2614	0.02002	0.1303:0.3224:0.234:0.3132	.	.	.	.	F	31	ENSP00000366376:V31F	ENSP00000366376:V31F	V	+	1	0	OR2J1	29176789	0.000000	0.05858	0.674000	0.29902	0.516000	0.34256	-6.408000	0.00067	0.225000	0.20959	-0.499000	0.04595	GTT	-	prints_GPCR_Rhodpsn		0.373	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	protein_coding	OTTHUMT00000076612.2	G	NG_004683	-		29068810	+1	no_errors	ENST00000377171	ensembl	human	known	74_37	missense	SNP	0.827	T
PAPPA	5069	genome.wustl.edu	37	9	118949745	118949745	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:118949745G>T	ENST00000328252.3	+	2	1097	c.728G>T	c.(727-729)aGt>aTt	p.S243I	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	243					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						TTAGGGGGCAGTGCCCTGAAT	0.562																																																	0								ENSG00000182752						83.0	81.0	82.0					9																	118949745		2203	4300	6503	PAPPA	SO:0001583	missense	0			-	HGNC		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.728G>T	9.37:g.118949745G>T	ENSP00000330658:p.Ser243Ile	Somatic	0	76	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	23	60.34	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.S243I	ENST00000328252.3	37	c.728	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569040	0.65765	.	.	ENSG00000182752	ENST00000328252	T	0.75589	-0.95	6.07	4.04	0.47022	Concanavalin A-like lectin/glucanase (1);LamG-like jellyroll fold (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.038408	0.85682	D	0.000000	T	0.64681	0.2620	N	0.19112	0.55	0.80722	D	1	P	0.48016	0.904	P	0.51266	0.664	T	0.66646	-0.5871	10	0.72032	D	0.01	-19.9069	4.4663	0.11691	0.4147:0.0:0.5853:0.0	.	243	Q13219	PAPP1_HUMAN	I	243	ENSP00000330658:S243I	ENSP00000330658:S243I	S	+	2	0	PAPPA	117989566	1.000000	0.71417	0.914000	0.36105	0.948000	0.59901	5.463000	0.66712	1.584000	0.49913	-0.137000	0.14449	AGT	-	superfamily_ConA-like_lec_gl_sf,smart_LamG-like		0.562	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	protein_coding	OTTHUMT00000055546.1	G	NM_002581	-		118949745	+1	no_errors	ENST00000328252	ensembl	human	known	74_37	missense	SNP	1.000	T
COL4A2	1284	genome.wustl.edu	37	13	111080930	111080930	+	Splice_Site	SNP	C	C	T	rs534031166		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr13:111080930C>T	ENST00000360467.5	+	7	783	c.477C>T	c.(475-477)ccC>ccT	p.P159P		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	159					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CCGGGCCTCCCGTGAGTATCC	0.682													C|||	1	0.000199681	0.0	0.0014	5008	,	,		14873	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000134871						22.0	28.0	26.0					13																	111080930		1879	4093	5972	COL4A2	SO:0001630	splice_region_variant	0			-	HGNC	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.477+1C>T	13.37:g.111080930C>T		Somatic	0	144	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	128	31.18	Q14052|Q548C3|Q5VZA9|Q66K23	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.P159	ENST00000360467.5	37	c.477	CCDS41907.1	13																																																																																			-	pfam_Collagen		0.682	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A2	protein_coding	OTTHUMT00000045761.2	C	NM_001846	-	Silent	111080930	+1	no_errors	ENST00000360467	ensembl	human	known	74_37	silent	SNP	0.034	T
ZNF221	7638	genome.wustl.edu	37	19	44470547	44470547	+	Missense_Mutation	SNP	A	A	G			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr19:44470547A>G	ENST00000251269.5	+	6	1221	c.893A>G	c.(892-894)cAa>cGa	p.Q298R	ZNF221_ENST00000592350.1_Missense_Mutation_p.Q298R|ZNF221_ENST00000587682.1_Missense_Mutation_p.Q298R	NM_013359.2	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	298					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(11)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	30		Prostate(69;0.0352)				TCACAGCTTCAAGAACATCAG	0.393																																																	0								ENSG00000159905						132.0	134.0	133.0					19																	44470547		2203	4300	6503	ZNF221	SO:0001583	missense	0			-	HGNC	AF187987	CCDS12633.1	19q13.31	2013-01-08				ENSG00000159905		"""Zinc fingers, C2H2-type"", ""-"""	13014	protein-coding gene	gene with protein product							Standard	NM_013359		Approved		uc002oxx.2	Q9UK13		ENST00000251269.5:c.893A>G	19.37:g.44470547A>G	ENSP00000251269:p.Gln298Arg	Somatic	0	182	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	145	131	52.54	B2RAI6|Q2M2H2|Q9P1U8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q298R	ENST00000251269.5	37	c.893	CCDS12633.1	19	.	.	.	.	.	.	.	.	.	.	a	10.09	1.253879	0.22965	.	.	ENSG00000159905	ENST00000251269	T	0.11930	2.73	2.44	-0.073	0.13737	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05456	0.0144	N	0.05574	-0.02	0.09310	N	1	B	0.17038	0.02	B	0.20384	0.029	T	0.39143	-0.9628	9	0.42905	T	0.14	.	0.1411	0.00083	0.3484:0.1894:0.1514:0.3107	.	298	Q9UK13	ZN221_HUMAN	R	298	ENSP00000251269:Q298R	ENSP00000251269:Q298R	Q	+	2	0	ZNF221	49162387	0.000000	0.05858	0.012000	0.15200	0.900000	0.52787	-2.019000	0.01442	0.191000	0.20236	0.379000	0.24179	CAA	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF221-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF221	protein_coding	OTTHUMT00000460068.1	A		-		44470547	+1	no_errors	ENST00000251269	ensembl	human	known	74_37	missense	SNP	0.000	G
ADCY5	111	genome.wustl.edu	37	3	123010114	123010114	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr3:123010114C>T	ENST00000462833.1	-	18	4385	c.3173G>A	c.(3172-3174)cGc>cAc	p.R1058H	ADCY5_ENST00000309879.5_Missense_Mutation_p.R708H|ADCY5_ENST00000491190.1_Missense_Mutation_p.R716H	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1058					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		CTCATCATTGCGCCGCTCGCG	0.597																																																	0								ENSG00000173175						93.0	77.0	82.0					3																	123010114		2203	4300	6503	ADCY5	SO:0001583	missense	0			-	HGNC	U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3173G>A	3.37:g.123010114C>T	ENSP00000419361:p.Arg1058His	Somatic	0	82	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	46	41.77	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R1058H	ENST00000462833.1	37	c.3173	CCDS3022.1	3	.	.	.	.	.	.	.	.	.	.	C	27.8	4.865470	0.91511	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879	T;D;D	0.82081	-1.17;-1.53;-1.57	4.53	4.53	0.55603	Adenylyl cyclase class-3/4/guanylyl cyclase (2);	0.000000	0.85682	D	0.000000	D	0.89118	0.6624	M	0.71206	2.165	0.80722	D	1	P;D	0.89917	0.654;1.0	B;P	0.62382	0.071;0.901	D	0.88419	0.3027	10	0.36615	T	0.2	.	17.4829	0.87679	0.0:1.0:0.0:0.0	.	1058;716	O95622;B3KWA8	ADCY5_HUMAN;.	H	1058;716;708	ENSP00000419361:R1058H;ENSP00000418537:R716H;ENSP00000308685:R708H	ENSP00000308685:R708H	R	-	2	0	ADCY5	124492804	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.646000	0.83445	2.362000	0.80069	0.563000	0.77884	CGC	-	smart_A/G_cyclase		0.597	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	protein_coding	OTTHUMT00000355889.4	C	XM_171048	-		123010114	-1	no_errors	ENST00000462833	ensembl	human	known	74_37	missense	SNP	1.000	T
IRF5	3663	genome.wustl.edu	37	7	128587352	128587381	+	In_Frame_Del	DEL	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	-	rs199508964|rs113806178|rs60344245|rs566635242|rs202130620|rs375983447|rs534043449|rs79724471	byFrequency	TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr7:128587352_128587381delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ENST00000402030.2	+	6	574_603	c.502_531delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	c.(502-531)actctgcagccgcccactctgcggccgcctdel	p.TLQPPTLRPP168del	IRF5_ENST00000477535.1_Intron|IRF5_ENST00000473745.1_In_Frame_Del_p.TLQPPTLRPP168del|IRF5_ENST00000249375.4_In_Frame_Del_p.TLQPPTLRPP168del|IRF5_ENST00000357234.5_In_Frame_Del_p.TLQPPTLRPP184del	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	168					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						GTGGCCGCCCACTCTGCAGCCGCCCACTCTGCGGCCGCCTACTCTGCAGC	0.652														2428	0.484824	0.534	0.366	5008	,	,		17245	0.4425		0.5338	False		,,,				2504	0.4959																1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000128604		,,,,	1942,1932		603,736,598					,,,,	0.1	0.9		dbSNP_129	14	3856,4082		1083,1690,1196	no	coding,intron,coding,coding,coding	IRF5	NM_032643.3,NM_001242452.1,NM_001098630.1,NM_001098629.1,NM_001098627.2	,,,,	1686,2426,1794	A1A1,A1R,RR		48.5765,49.8709,49.0857	,,,,	,,,,		5798,6014				IRF5	SO:0001651	inframe_deletion	0				HGNC		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.502_531delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	7.37:g.128587352_128587381delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ENSP00000385352:p.Thr168_Pro177del	Somatic	NA	NA	NA		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.PPTLRPPTLQ187in_frame_del	ENST00000402030.2	37	c.550_579	CCDS5808.1	7																																																																																			-	NULL		0.652	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF5	protein_coding	OTTHUMT00000350934.1	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	NM_001098627			128587381	+1	no_errors	ENST00000357234	ensembl	human	known	74_37	in_frame_del	DEL	0.766:0.707:0.638:0.562:0.538:0.511:0.480:0.444:0.402:0.360:0.317:0.273:0.262:0.251:0.239:0.226:0.213:0.199:0.185:0.170:0.155:0.138:0.122:0.120:0.118:0.116:0.113:0.110:0.107:0.104	-
MRPL15	29088	genome.wustl.edu	37	8	55047874	55047874	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr8:55047874C>T	ENST00000260102.4	+	1	105	c.31C>T	c.(31-33)Cgg>Tgg	p.R11W		NM_014175.3	NP_054894.1	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15	11					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|skin(3)	10		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			CGGTGGGGCCCGGGCCCTGGA	0.672																																																	0								ENSG00000137547						10.0	12.0	11.0					8																	55047874		2045	3951	5996	MRPL15	SO:0001583	missense	0			-	HGNC	AB051619	CCDS6158.1	8q11.2-q13	2012-09-13			ENSG00000137547	ENSG00000137547		"""Mitochondrial ribosomal proteins / large subunits"""	14054	protein-coding gene	gene with protein product		611828				11543634	Standard	NM_014175		Approved	RPML7, MRP-L7, HSPC145, L15mt, MRP-L15	uc003xsa.2	Q9P015	OTTHUMG00000164315	ENST00000260102.4:c.31C>T	8.37:g.55047874C>T	ENSP00000260102:p.Arg11Trp	Somatic	0	441	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	169	197	46.17	Q96Q54|Q9H0Y1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ribosomal_L18e/L15P,superfamily_Ribosomal_L18e/L15P	p.R11W	ENST00000260102.4	37	c.31	CCDS6158.1	8	.	.	.	.	.	.	.	.	.	.	C	19.88	3.908869	0.72868	.	.	ENSG00000137547	ENST00000260102;ENST00000519831	.	.	.	5.45	-10.9	0.00192	.	0.623384	0.17195	N	0.183345	T	0.23171	0.0560	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29912	-0.9996	9	0.66056	D	0.02	0.3999	7.8277	0.29324	0.1213:0.4603:0.2964:0.1219	.	11	Q9P015	RM15_HUMAN	W	11	.	ENSP00000260102:R11W	R	+	1	2	MRPL15	55210427	0.000000	0.05858	0.000000	0.03702	0.625000	0.37756	-4.090000	0.00297	-4.590000	0.00041	-0.271000	0.10264	CGG	-	NULL		0.672	MRPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL15	protein_coding	OTTHUMT00000378254.1	C	NM_014175	-		55047874	+1	no_errors	ENST00000260102	ensembl	human	known	74_37	missense	SNP	0.000	T
TSSC2	650368	genome.wustl.edu	37	11	3423884	3423884	+	RNA	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr11:3423884C>T	ENST00000529482.1	+	0	728									tumor suppressing subtransferable candidate 2 pseudogene																		CTTCATGGAGCGGGATGCTGG	0.642																																																	0								ENSG00000223756																																			TSSC2			0			-	HGNC			11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3423884C>T		Somatic	0	204	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	69	79	46.62		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000529482.1	37	NULL		11																																																																																			-	-		0.642	TSSC2-003	KNOWN	basic	processed_transcript	TSSC2	pseudogene	OTTHUMT00000392020.1	C		-		3423884	+1	no_errors	ENST00000529482	ensembl	human	known	74_37	rna	SNP	0.441	T
RTN1	6252	genome.wustl.edu	37	14	60193761	60193761	+	Silent	SNP	C	C	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr14:60193761C>A	ENST00000267484.5	-	3	1976	c.1641G>T	c.(1639-1641)acG>acT	p.T547T		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	547					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		GCAACATGGGCGTCTCAGGCT	0.687																																																	0								ENSG00000139970						23.0	27.0	25.0					14																	60193761		2203	4300	6503	RTN1	SO:0001819	synonymous_variant	0			-	HGNC	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.1641G>T	14.37:g.60193761C>A		Somatic	0	131	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	96	29.93	Q16800|Q16801|Q5BKZ4|Q9BQ59	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Reticulon,pfscan_Reticulon	p.T547	ENST00000267484.5	37	c.1641	CCDS9740.1	14																																																																																			-	NULL		0.687	RTN1-001	KNOWN	basic|CCDS	protein_coding	RTN1	protein_coding	OTTHUMT00000072278.2	C		-		60193761	-1	no_errors	ENST00000267484	ensembl	human	known	74_37	silent	SNP	0.000	A
FBN1	2200	genome.wustl.edu	37	15	48752489	48752489	+	Missense_Mutation	SNP	A	A	C			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr15:48752489A>C	ENST00000316623.5	-	43	5705	c.5250T>G	c.(5248-5250)agT>agG	p.S1750R		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1750			S -> R (in ACMICD). {ECO:0000269|PubMed:21683322}.		extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CTGGCCTTTGACTTCCACAGA	0.418																																																	0								ENSG00000166147						86.0	77.0	80.0					15																	48752489		2198	4296	6494	FBN1	SO:0001583	missense	0			-	HGNC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.5250T>G	15.37:g.48752489A>C	ENSP00000325527:p.Ser1750Arg	Somatic	0	36	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.S1750R	ENST00000316623.5	37	c.5250	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	A	16.77	3.215358	0.58452	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.92348	-3.02	6.16	-1.83	0.07833	Matrix fibril-associated (2);	0.000000	0.85682	D	0.000000	D	0.91583	0.7341	L	0.38692	1.165	0.80722	D	1	D	0.59357	0.985	D	0.68483	0.958	D	0.88072	0.2801	10	0.39692	T	0.17	.	11.915	0.52761	0.5734:0.0:0.4266:0.0	.	1750	P35555	FBN1_HUMAN	R	1750;318;640	ENSP00000325527:S1750R	ENSP00000325527:S1750R	S	-	3	2	FBN1	46539781	1.000000	0.71417	0.997000	0.53966	0.962000	0.63368	1.535000	0.36061	-0.079000	0.12707	-0.417000	0.06048	AGT	-	superfamily_TB_dom,pirsf_FBN		0.418	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	protein_coding	OTTHUMT00000417355.1	A		-		48752489	-1	no_errors	ENST00000316623	ensembl	human	known	74_37	missense	SNP	0.992	C
TMPRSS11B	132724	genome.wustl.edu	37	4	69107497	69107497	+	Missense_Mutation	SNP	A	A	C			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr4:69107497A>C	ENST00000332644.5	-	2	195	c.34T>G	c.(34-36)Tgg>Ggg	p.W12G		NM_182502.3	NP_872308.2	Q86T26	TM11B_HUMAN	transmembrane protease, serine 11B	12						extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)	27						CATAGTGGCCAAGATCTTTGG	0.408																																																	0								ENSG00000185873						76.0	75.0	76.0					4																	69107497		2203	4300	6503	TMPRSS11B	SO:0001583	missense	0			-	HGNC	BX537945	CCDS3521.1	4q13.2	2010-04-13			ENSG00000185873	ENSG00000185873		"""Serine peptidases / Transmembrane"""	25398	protein-coding gene	gene with protein product							Standard	NM_182502		Approved		uc003hdw.4	Q86T26	OTTHUMG00000129301	ENST00000332644.5:c.34T>G	4.37:g.69107497A>C	ENSP00000330475:p.Trp12Gly	Somatic	0	113	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	131	10.27	A8K4D9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_SEA_dom,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pirsf_Pept_S1A_HAT/DESC1,pfscan_SEA_dom,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.W12G	ENST00000332644.5	37	c.34	CCDS3521.1	4	.	.	.	.	.	.	.	.	.	.	A	6.267	0.417398	0.11870	.	.	ENSG00000185873	ENST00000332644	D	0.88509	-2.39	5.19	1.35	0.21983	.	1.398320	0.04930	N	0.456744	D	0.86581	0.5967	M	0.61703	1.905	0.09310	N	1	B	0.19935	0.04	B	0.16722	0.016	T	0.68443	-0.5407	10	0.33141	T	0.24	.	7.16	0.25659	0.722:0.0:0.278:0.0	.	12	Q86T26	TM11B_HUMAN	G	12	ENSP00000330475:W12G	ENSP00000330475:W12G	W	-	1	0	TMPRSS11B	68790092	0.045000	0.20229	0.061000	0.19648	0.076000	0.17211	0.539000	0.23175	0.311000	0.23014	0.482000	0.46254	TGG	-	pirsf_Pept_S1A_HAT/DESC1		0.408	TMPRSS11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11B	protein_coding	OTTHUMT00000251431.2	A	NM_182502	-		69107497	-1	no_errors	ENST00000332644	ensembl	human	known	74_37	missense	SNP	0.012	C
GPR112	139378	genome.wustl.edu	37	X	135427331	135427331	+	Missense_Mutation	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chrX:135427331C>T	ENST00000394143.1	+	6	1757	c.1466C>T	c.(1465-1467)aCa>aTa	p.T489I	GPR112_ENST00000412101.1_Missense_Mutation_p.T284I|GPR112_ENST00000287534.4_Missense_Mutation_p.T426I|GPR112_ENST00000370652.1_Missense_Mutation_p.T489I|GPR112_ENST00000394141.1_Missense_Mutation_p.T284I	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	489					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AGAAACCAGACAGCATTTCCA	0.463																																																	0								ENSG00000156920						97.0	83.0	88.0					X																	135427331		2203	4300	6503	GPR112	SO:0001583	missense	0			-	HGNC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1466C>T	X.37:g.135427331C>T	ENSP00000377699:p.Thr489Ile	Somatic	0	96	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	35	50.70	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T489I	ENST00000394143.1	37	c.1466	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	c	8.752	0.921526	0.17982	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.29917	1.59;1.59;1.55;1.69;1.55	3.29	1.99	0.26369	.	.	.	.	.	T	0.16128	0.0388	N	0.24115	0.695	0.09310	N	1	P;P;B	0.38677	0.642;0.642;0.3	B;B;B	0.37780	0.258;0.17;0.027	T	0.14504	-1.0470	9	0.09338	T	0.73	.	5.295	0.15747	0.0:0.7468:0.0:0.2532	.	426;284;489	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	I	489;489;284;426;284	ENSP00000377699:T489I;ENSP00000359686:T489I;ENSP00000416526:T284I;ENSP00000287534:T426I;ENSP00000377697:T284I	ENSP00000287534:T426I	T	+	2	0	GPR112	135254997	0.456000	0.25744	0.007000	0.13788	0.041000	0.13682	0.574000	0.23714	0.270000	0.21984	0.411000	0.27672	ACA	-	NULL		0.463	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	protein_coding	OTTHUMT00000286639.1	C		-		135427331	+1	no_errors	ENST00000370652	ensembl	human	known	74_37	missense	SNP	0.037	T
WDR11	55717	genome.wustl.edu	37	10	122648750	122648751	+	3'UTR	INS	-	-	TTTTGTTTTGTTTTG	rs71019800|rs369445236|rs141904743	byFrequency	TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr10:122648750_122648751insTTTTGTTTTGTTTTG	ENST00000604509.1	+	0	2177_2178				WDR11_ENST00000263461.6_Intron			Q8WWQ0	PHIP_HUMAN	WD repeat domain 11						cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						AAATGAAATCtttttgttttgt	0.411														579	0.115615	0.1006	0.1023	5008	,	,		15252	0.0268		0.175	False		,,,				2504	0.1759																0								ENSG00000120008																																			WDR11	SO:0001624	3_prime_UTR_variant	0				HGNC	AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000604509.1:c.*2175->TTTTGTTTTGTTTTG	10.37:g.122648750_122648751insTTTTGTTTTGTTTTG		Somatic	NA	NA	NA		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000604509.1	37	NULL		10																																																																																			-	-		0.411	WDR11-006	KNOWN	non_canonical_U12|basic	processed_transcript	WDR11	protein_coding	OTTHUMT00000468479.1	-				122648751	+1	no_errors	ENST00000604509	ensembl	human	known	74_37	rna	INS	0.024:0.006	TTTTGTTTTGTTTTG
CHD6	84181	genome.wustl.edu	37	20	40044280	40044280	+	Splice_Site	SNP	T	T	C			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr20:40044280T>C	ENST00000373233.3	-	34	6664		c.e34-2		CHD6_ENST00000480022.1_5'Flank	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GAAGCTCTCCTGTGAACACAC	0.498																																																	0								ENSG00000124177						30.0	31.0	31.0					20																	40044280		2041	4081	6122	CHD6	SO:0001630	splice_region_variant	0			-	HGNC	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.6487-2A>G	20.37:g.40044280T>C		Somatic	0	33	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	62	12.68	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e33-2	ENST00000373233.3	37	c.6487-2	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	T	19.43	3.825550	0.71143	.	.	ENSG00000124177	ENST00000373233	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2285	0.82315	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CHD6	39477694	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.926000	0.70070	2.235000	0.73313	0.460000	0.39030	.	-	-		0.498	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	protein_coding	OTTHUMT00000079270.1	T		-	Intron	40044280	-1	no_errors	ENST00000373233	ensembl	human	known	74_37	splice_site	SNP	1.000	C
C6orf132	647024	genome.wustl.edu	37	6	42075170	42075170	+	Frame_Shift_Del	DEL	C	C	-			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr6:42075170delC	ENST00000341865.4	-	4	479	c.480delG	c.(478-480)gggfs	p.G160fs		NM_001164446.1	NP_001157918.1	Q5T0Z8	CF132_HUMAN	chromosome 6 open reading frame 132	160	Pro-rich.									breast(1)	1						gcagtggCGACCCCCCTGGAG	0.672																																																	0								ENSG00000188112						5.0	6.0	6.0					6																	42075170		672	1554	2226	C6orf132	SO:0001589	frameshift_variant	0				HGNC		CCDS47428.1	6p21.1	2012-02-06			ENSG00000188112	ENSG00000188112			21288	protein-coding gene	gene with protein product							Standard	NM_001164446		Approved	bA7K24.2	uc003orw.2	Q5T0Z8	OTTHUMG00000014695	ENST00000341865.4:c.480delG	6.37:g.42075170delC	ENSP00000341368:p.Gly160fs	Somatic	0	34	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	28	9.68	A6NI05	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.S161fs	ENST00000341865.4	37	c.480	CCDS47428.1	6																																																																																			-	NULL		0.672	C6orf132-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	C6orf132	protein_coding	OTTHUMT00000040548.2	C	NM_001164446			42075170	-1	no_errors	ENST00000341865	ensembl	human	putative	74_37	frame_shift_del	DEL	0.105	-
CYP2G1P	22952	genome.wustl.edu	37	19	41404425	41404425	+	IGR	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr19:41404425C>T	ENST00000601627.1	+	0	575				CYP2G1P_ENST00000252909.4_RNA																							ATCCCCAGCACTTTCTGGATG	0.512																																																	0								ENSG00000130612																																			CYP2G1P	SO:0001628	intergenic_variant	0			-	HGNC																													19.37:g.41404425C>T		Somatic	1	154	0.65		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	110	195	36.07		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000601627.1	37	NULL		19																																																																																			-	-		0.512	CTC-490E21.12-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	CYP2G1P	protein_coding	OTTHUMT00000463921.1	C		-		41404425	+1	no_errors	ENST00000252909	ensembl	human	known	74_37	rna	SNP	1.000	T
ORC5	5001	genome.wustl.edu	37	7	103828167	103828168	+	Intron	INS	-	-	A	rs145586918|rs201536259		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr7:103828167_103828168insA	ENST00000297431.4	-	6	827				ORC5_ENST00000447452.2_Intron|ORC5_ENST00000545943.1_Intron|ORC5_ENST00000485726.1_5'UTR	NM_002553.3	NP_002544.1	O43913	ORC5_HUMAN	origin recognition complex, subunit 5						DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			kidney(1)|large_intestine(2)|lung(9)|pancreas(1)|upper_aerodigestive_tract(1)	14						TTCTAATTGttaaaaaaaaaaa	0.302																																																	0								ENSG00000164815																																			ORC5	SO:0001627	intron_variant	0				HGNC		CCDS5734.1, CCDS47681.1	7q22.1	2014-06-13	2010-10-12	2010-10-12	ENSG00000164815	ENSG00000164815			8491	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 117"""	602331	"""origin recognition complex, subunit 5 (yeast homolog)-like"", ""origin recognition complex, subunit 5-like (yeast)"", ""origin recognition complex, subunit 5 homolog (yeast)"""	ORC5L		9417919, 9829972	Standard	NM_002553		Approved	Orc5p, ORC5T, PPP1R117	uc003vcb.3	O43913	OTTHUMG00000157275	ENST00000297431.4:c.684+530->T	7.37:g.103828178_103828178dupA		Somatic	0	9	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	A4D0P8|O60590|O95268	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000297431.4	37	NULL	CCDS5734.1	7																																																																																			-	-		0.302	ORC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC5	protein_coding	OTTHUMT00000348286.1	-	NM_002553			103828168	-1	no_errors	ENST00000485726	ensembl	human	known	74_37	rna	INS	0.013:0.000	A
DMBT1	1755	genome.wustl.edu	37	10	124358313	124358313	+	Missense_Mutation	SNP	A	A	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr10:124358313A>T	ENST00000338354.3	+	26	3086	c.2980A>T	c.(2980-2982)Agg>Tgg	p.R994W	DMBT1_ENST00000344338.3_Missense_Mutation_p.R984W|DMBT1_ENST00000368955.3_Missense_Mutation_p.R984W|DMBT1_ENST00000330163.4_Missense_Mutation_p.R495W|DMBT1_ENST00000368956.2_Missense_Mutation_p.R495W|DMBT1_ENST00000359586.6_Intron|DMBT1_ENST00000368909.3_Missense_Mutation_p.R994W			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	994	SRCR 8. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TTTGGCCCTGAGGCTGGTGAA	0.542																																					Ovarian(182;93 2026 18125 22222 38972)												0								ENSG00000187908						324.0	313.0	316.0					10																	124358313		1955	4159	6114	DMBT1	SO:0001583	missense	0			-	HGNC		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.2980A>T	10.37:g.124358313A>T	ENSP00000342210:p.Arg994Trp	Somatic	0	623	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	245	270	47.39	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SRCR,pfam_CUB_dom,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB_dom,smart_Srcr_rcpt-rel,smart_CUB_dom,smart_ZP_dom,pfscan_CUB_dom,pfscan_SRCR,pfscan_ZP_dom,prints_SRCR	p.R994W	ENST00000338354.3	37	c.2980		10	.	.	.	.	.	.	.	.	.	.	A	20.3	3.963671	0.74016	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956	T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57	3.74	1.14	0.20703	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.80210	0.4581	H	0.99156	4.45	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.982;0.994;0.981;0.958	T	0.77534	-0.2552	9	0.72032	D	0.01	.	6.804	0.23766	0.4047:0.4488:0.0:0.1465	.	994;495;984;994	Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;DMBT1_HUMAN	W	994;994;994;994;994;994;495;984;495;495;994;984;495	ENSP00000342210:R994W;ENSP00000343175:R984W;ENSP00000327747:R495W;ENSP00000357905:R994W;ENSP00000357951:R984W;ENSP00000357952:R495W	ENSP00000331522:R495W	R	+	1	2	DMBT1	124348303	0.991000	0.36638	0.663000	0.29738	0.560000	0.35617	3.100000	0.50275	-0.000000	0.14550	0.456000	0.33151	AGG	-	superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR		0.542	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	protein_coding	OTTHUMT00000050792.2	A	NM_004406	-		124358313	+1	no_errors	ENST00000338354	ensembl	human	known	74_37	missense	SNP	0.964	T
PEG3	5178	genome.wustl.edu	37	19	57328017	57328017	+	Missense_Mutation	SNP	C	C	G			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr19:57328017C>G	ENST00000326441.9	-	10	2156	c.1793G>C	c.(1792-1794)cGt>cCt	p.R598P	ZIM2_ENST00000221722.5_Intron|ZIM2_ENST00000593711.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.R598P|PEG3_ENST00000598410.1_Missense_Mutation_p.R474P|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R472P	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	598					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R598H(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ttcacgttcacgttcatgttc	0.458																																																	2	Substitution - Missense(2)	ovary(2)						ENSG00000198300						106.0	83.0	91.0					19																	57328017		2203	4300	6503	PEG3	SO:0001583	missense	0			-	HGNC	AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1793G>C	19.37:g.57328017C>G	ENSP00000326581:p.Arg598Pro	Somatic	0	103	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	178	8.25	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R598P	ENST00000326441.9	37	c.1793	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	0.021	-1.424393	0.01126	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02763	4.17;4.17	1.08	-0.0769	0.13721	.	.	.	.	.	T	0.06462	0.0166	L	0.50333	1.59	.	.	.	P;B;D	0.71674	0.909;0.006;0.998	B;B;P	0.61201	0.113;0.007;0.885	T	0.31364	-0.9946	8	0.45353	T	0.12	.	3.4582	0.07523	0.0:0.7126:0.0:0.2874	.	474;598;533	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	P	598	ENSP00000326581:R598P;ENSP00000403051:R598P	ENSP00000326581:R598P	R	-	2	0	ZIM2	62019829	0.000000	0.05858	0.010000	0.14722	0.165000	0.22458	-0.044000	0.12023	0.063000	0.16370	0.525000	0.51046	CGT	-	NULL		0.458	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	protein_coding	OTTHUMT00000416099.2	C		-		57328017	-1	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	SNP	0.011	G
LIMA1	51474	genome.wustl.edu	37	12	50627994	50627995	+	Intron	INS	-	-	T	rs530660438		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr12:50627994_50627995insT	ENST00000341247.4	-	3	269				MIR1293_ENST00000408677.1_RNA|LIMA1_ENST00000394943.3_Intron	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1						actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						CCAGAACAACCttttttttttt	0.475																																																	0								ENSG00000221604																																			MIR1293	SO:0001627	intron_variant	0				HGNC	AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.120-2501->A	12.37:g.50628005_50628005dupT		Somatic	0	74	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	49	9.26	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000341247.4	37	NULL	CCDS8802.1	12																																																																																			-	-		0.475	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	MIR1293	protein_coding	OTTHUMT00000406235.2	-	NM_016357			50627995	-1	no_errors	ENST00000408677	ensembl	human	known	74_37	rna	INS	0.533:0.541	T
NKX2-5	1482	genome.wustl.edu	37	5	172659906	172659908	+	In_Frame_Del	DEL	GGC	GGC	-	rs376340952		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	GGC	GGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr5:172659906_172659908delGGC	ENST00000329198.4	-	2	912_914	c.639_641delGCC	c.(637-642)ccgcct>cct	p.213_214PP>P	NKX2-5_ENST00000424406.2_3'UTR|NKX2-5_ENST00000521848.1_3'UTR	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	213	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CCTGCGGGCAggcggcggcggcg	0.709																																					Esophageal Squamous(72;810 1219 2387 13420 44943)												0								ENSG00000183072		,,	68,3046		17,34,1506					,,	-7.4	0.0			7	131,6185		17,97,3044	no	coding,utr-3,utr-3	NKX2-5	NM_004387.3,NM_001166176.1,NM_001166175.1	,,	34,131,4550	A1A1,A1R,RR		2.0741,2.1837,2.1103	,,	,,		199,9231				NKX2-5	SO:0001651	inframe_deletion	0				HGNC	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.639_641delGCC	5.37:g.172659915_172659917delGGC	ENSP00000327758:p.Pro214del	Somatic	0	52	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A8K3K0|B4DNB6|E9PBU6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.P214in_frame_del	ENST00000329198.4	37	c.641_639	CCDS4387.1	5																																																																																			-	NULL		0.709	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-5	protein_coding	OTTHUMT00000252942.2	GGC				172659908	-1	no_errors	ENST00000329198	ensembl	human	known	74_37	in_frame_del	DEL	0.987:1.000:1.000	-
LOC220729	220729	genome.wustl.edu	37	3	197350172	197350172	+	RNA	SNP	T	T	C	rs200151765		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr3:197350172T>C	ENST00000418868.1	-	0	294					NR_003266.2																						AAAGGCCAAATGCAGCTCGCA	0.498																																																	0								ENSG00000214135																																			AC024560.3			0			-	Clone_based_vega_gene																													3.37:g.197350172T>C		Somatic	0	16	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000418868.1	37	NULL		3																																																																																			-	-		0.498	AC024560.3-001	KNOWN	basic	processed_transcript	LOC220729	pseudogene	OTTHUMT00000340283.1	T		rs200151765		197350172	-1	no_errors	ENST00000414207	ensembl	human	known	74_37	rna	SNP	0.997	C
C2CD5	9847	genome.wustl.edu	37	12	22697070	22697070	+	Silent	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr12:22697070C>T	ENST00000333957.4	-	2	270	c.15G>A	c.(13-15)ctG>ctA	p.L5L	C2CD5_ENST00000542676.1_Silent_p.L5L|C2CD5_ENST00000446597.1_Silent_p.L5L|C2CD5_ENST00000545552.1_Silent_p.L5L|C2CD5_ENST00000544930.1_5'UTR|C2CD5_ENST00000536386.1_Silent_p.L5L|C2CD5_ENST00000396028.2_Silent_p.L5L	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	5	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										TTTTCACCTTCAGCTTCCCTG	0.627																																																	0								ENSG00000111731						157.0	120.0	133.0					12																	22697070		2203	4300	6503	C2CD5	SO:0001819	synonymous_variant	0			-	HGNC	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.15G>A	12.37:g.22697070C>T		Somatic	0	94	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	40	60.40	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L5	ENST00000333957.4	37	c.15	CCDS31758.1	12																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.627	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD5	protein_coding	OTTHUMT00000402257.1	C	NM_014802	-		22697070	-1	no_errors	ENST00000333957	ensembl	human	known	74_37	silent	SNP	1.000	T
GTPBP1	9567	genome.wustl.edu	37	22	39101991	39101991	+	Missense_Mutation	SNP	G	G	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr22:39101991G>T	ENST00000216044.5	+	1	264	c.31G>T	c.(31-33)Gac>Tac	p.D11Y		NM_004286.4	NP_004277.2	O00178	GTPB1_HUMAN	GTP binding protein 1	11					GTP catabolic process (GO:0006184)|immune response (GO:0006955)|positive regulation of mRNA catabolic process (GO:0061014)|signal transduction (GO:0007165)	cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	18	Melanoma(58;0.04)					CTCCGCGATGGACTCGCCGGT	0.662																																																	0								ENSG00000100226						2.0	2.0	2.0					22																	39101991		1608	3325	4933	GTPBP1	SO:0001583	missense	0			-	HGNC	U87964	CCDS13977.2	22q13.1	2008-07-01			ENSG00000100226	ENSG00000100226			4669	protein-coding gene	gene with protein product		602245				9070279	Standard	XM_005261857		Approved	GP-1, HSPC018	uc003awg.3	O00178	OTTHUMG00000151002	ENST00000216044.5:c.31G>T	22.37:g.39101991G>T	ENSP00000216044:p.Asp11Tyr	Somatic	0	26	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	15	50.00	Q6IC67	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_B-barrel	p.D11Y	ENST00000216044.5	37	c.31	CCDS13977.2	22	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410819	0.62399	.	.	ENSG00000100226	ENST00000216044	T	0.35236	1.32	4.76	4.76	0.60689	.	0.371203	0.30510	N	0.009474	T	0.36608	0.0973	L	0.47716	1.5	0.39024	D	0.959808	P	0.38922	0.651	B	0.37943	0.261	T	0.44862	-0.9300	10	0.66056	D	0.02	.	18.1213	0.89572	0.0:0.0:1.0:0.0	.	11	O00178	GTPB1_HUMAN	Y	11	ENSP00000216044:D11Y	ENSP00000216044:D11Y	D	+	1	0	GTPBP1	37431937	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.615000	0.46368	2.346000	0.79739	0.563000	0.77884	GAC	-	NULL		0.662	GTPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP1	protein_coding	OTTHUMT00000075532.1	G	NM_004286	-		39101991	+1	no_errors	ENST00000216044	ensembl	human	known	74_37	missense	SNP	1.000	T
SCRN3	79634	genome.wustl.edu	37	2	175287648	175287648	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr2:175287648C>T	ENST00000272732.6	+	6	872	c.790C>T	c.(790-792)Cga>Tga	p.R264*	SCRN3_ENST00000548921.1_3'UTR|SCRN3_ENST00000409673.3_Nonsense_Mutation_p.R257*	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	264							dipeptidase activity (GO:0016805)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			GGAAATTCTTCGAGATAAACC	0.348																																																	0								ENSG00000144306						84.0	83.0	83.0					2																	175287648		2203	4300	6503	SCRN3	SO:0001587	stop_gained	0			-	HGNC	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.790C>T	2.37:g.175287648C>T	ENSP00000272732:p.Arg264*	Somatic	0	85	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	4	93.44	B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C69	p.R264*	ENST00000272732.6	37	c.790	CCDS2258.1	2	.	.	.	.	.	.	.	.	.	.	C	33	5.210560	0.95069	.	.	ENSG00000144306	ENST00000409673;ENST00000272732	.	.	.	5.4	4.52	0.55395	.	0.175883	0.49305	D	0.000141	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.588	10.3475	0.43913	0.0:0.8507:0.0:0.1493	.	.	.	.	X	257;264	.	ENSP00000272732:R264X	R	+	1	2	SCRN3	174995894	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	2.376000	0.44292	1.288000	0.44600	-0.258000	0.10820	CGA	-	NULL		0.348	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRN3	protein_coding	OTTHUMT00000255451.2	C	NM_024583	-		175287648	+1	no_errors	ENST00000272732	ensembl	human	known	74_37	nonsense	SNP	1.000	T
NFKBIZ	64332	genome.wustl.edu	37	3	101576029	101576030	+	Splice_Site	INS	-	-	ACTTTTAGAAAGCTTTAATAACC	rs3217713|rs371844266	byFrequency	TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr3:101576029_101576030insACTTTTAGAAAGCTTTAATAACC	ENST00000326172.5	+	10	2050		c.e10+2		NFKBIZ_ENST00000326151.5_Splice_Site|NFKBIZ_ENST00000394054.2_Splice_Site	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta						inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						AATGCAAAGGTACACCAGAGTT	0.465														4063	0.811302	0.9546	0.8012	5008	,	,		21934	0.6528		0.7704	False		,,,				2504	0.8303																0								ENSG00000144802																																			NFKBIZ	SO:0001630	splice_region_variant	0				HGNC	AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1935+2->ACTTTTAGAAAGCTTTAATAACC	3.37:g.101576029_101576030insACTTTTAGAAAGCTTTAATAACC		Somatic	NA	NA	NA		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e10+2	ENST00000326172.5	37	c.1935+2_1935+1	CCDS2946.1	3																																																																																			-	-		0.465	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	protein_coding	OTTHUMT00000353793.1	-	NM_031419		Intron	101576030	+1	no_errors	ENST00000326172	ensembl	human	known	74_37	splice_site_ins	INS	1.000:0.000	ACTTTTAGAAAGCTTTAATAACC
PTENP1	11191	genome.wustl.edu	37	9	33675550	33675550	+	RNA	SNP	G	G	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:33675550G>A	ENST00000532280.1	-	0	1947					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		ACTAACATCTGGTGTTACAGA	0.388																																																	0								ENSG00000237984																																			PTENP1			0			-	HGNC	AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33675550G>A		Somatic	0	114	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	89	99	47.34		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000532280.1	37	NULL		9																																																																																			-	-		0.388	PTENP1-002	KNOWN	basic	processed_transcript	PTENP1	pseudogene	OTTHUMT00000395145.1	G	NR_023917	-		33675550	-1	no_errors	ENST00000532280	ensembl	human	known	74_37	rna	SNP	1.000	A
CYP46A1	10858	genome.wustl.edu	37	14	100173109	100173109	+	Missense_Mutation	SNP	A	A	G			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr14:100173109A>G	ENST00000261835.3	+	6	673	c.569A>G	c.(568-570)gAc>gGc	p.D190G	CYP46A1_ENST00000423126.2_Missense_Mutation_p.D93G|CYP46A1_ENST00000554176.1_Missense_Mutation_p.D37G	NM_006668.1	NP_006659.1	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46, subfamily A, polypeptide 1	190					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|nervous system development (GO:0007399)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol 24-hydroxylase activity (GO:0033781)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)			breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)	25		Melanoma(154;0.0866)|all_epithelial(191;0.179)				ACCGCCATGGACATCCTGGCC	0.597																																																	0								ENSG00000036530						67.0	57.0	61.0					14																	100173109		2203	4300	6503	CYP46A1	SO:0001583	missense	0			-	HGNC	AF094480	CCDS9954.1	14q32.2	2013-05-03	2003-02-14	2003-02-28	ENSG00000036530	ENSG00000036530		"""Cytochrome P450s"""	2641	protein-coding gene	gene with protein product		604087	"""cytochrome P450, subfamily 46 (cholesterol 24-hydroxylase)"""	CYP46		10377398	Standard	NM_006668		Approved		uc001ygo.3	Q9Y6A2	OTTHUMG00000171510	ENST00000261835.3:c.569A>G	14.37:g.100173109A>G	ENSP00000261835:p.Asp190Gly	Somatic	0	47	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	18	69.49	B4DHP8|E7EQG9|Q8N2B0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.D190G	ENST00000261835.3	37	c.569	CCDS9954.1	14	.	.	.	.	.	.	.	.	.	.	A	18.59	3.656969	0.67586	.	.	ENSG00000036530	ENST00000261835;ENST00000423126;ENST00000554176	T;D;D	0.82711	-0.62;-1.64;-1.64	4.17	4.17	0.49024	.	0.049211	0.85682	D	0.000000	D	0.88295	0.6398	M	0.63843	1.955	0.51482	D	0.999924	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.997	D	0.88829	0.3304	10	0.87932	D	0	.	10.2072	0.43120	1.0:0.0:0.0:0.0	.	37;190;161	Q8N2B0;Q9Y6A2;Q59ER2	.;CP46A_HUMAN;.	G	190;93;37	ENSP00000261835:D190G;ENSP00000405779:D93G;ENSP00000450553:D37G	ENSP00000261835:D190G	D	+	2	0	CYP46A1	99242862	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.252000	0.51461	1.830000	0.53286	0.528000	0.53228	GAC	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.597	CYP46A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP46A1	protein_coding	OTTHUMT00000413814.1	A		-		100173109	+1	no_errors	ENST00000261835	ensembl	human	known	74_37	missense	SNP	1.000	G
C2CD5	9847	genome.wustl.edu	37	12	22697034	22697034	+	Silent	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr12:22697034C>T	ENST00000333957.4	-	2	306	c.51G>A	c.(49-51)gtG>gtA	p.V17V	C2CD5_ENST00000542676.1_Silent_p.V17V|C2CD5_ENST00000446597.1_Silent_p.V17V|C2CD5_ENST00000545552.1_Silent_p.V17V|C2CD5_ENST00000544930.1_5'UTR|C2CD5_ENST00000536386.1_Silent_p.V17V|C2CD5_ENST00000396028.2_Silent_p.V17V	NM_014802.1	NP_055617.1	Q86YS7	C2CD5_HUMAN	C2 calcium-dependent domain containing 5	17	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cellular response to insulin stimulus (GO:0032869)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|intracellular protein transmembrane transport (GO:0065002)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of vesicle fusion (GO:0031340)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)										CACGGTCCATCACTGGCAAAT	0.577																																																	0								ENSG00000111731						175.0	130.0	145.0					12																	22697034		2203	4300	6503	C2CD5	SO:0001819	synonymous_variant	0			-	HGNC	AB011100	CCDS31758.1, CCDS66337.1, CCDS66338.1, CCDS66339.1, CCDS66340.1	12p12.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000111731	ENSG00000111731			29062	protein-coding gene	gene with protein product	"""138 kDa C2 domain-containing phosphoprotein"""		"""KIAA0528"""	KIAA0528		21907143	Standard	XM_005253538		Approved	CDP138	uc001rfq.3	Q86YS7	OTTHUMG00000169100	ENST00000333957.4:c.51G>A	12.37:g.22697034C>T		Somatic	0	103	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	36	63.27	B4DJ03|B4DRN7|B7ZLL0|F5H2A1|F5H5R1|O60280|Q17RY7|Q7Z619|Q86SU3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.V17	ENST00000333957.4	37	c.51	CCDS31758.1	12																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.577	C2CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD5	protein_coding	OTTHUMT00000402257.1	C	NM_014802	-		22697034	-1	no_errors	ENST00000333957	ensembl	human	known	74_37	silent	SNP	1.000	T
PPP1R21	129285	genome.wustl.edu	37	2	48742386	48742387	+	3'UTR	INS	-	-	C	rs375892360|rs60806016		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr2:48742386_48742387insC	ENST00000294952.8	+	0	3003_3004				PPP1R21_ENST00000476199.1_3'UTR|PPP1R21_ENST00000281394.4_3'UTR	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21							membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						tctctctctcttctttctctct	0.386																																																	0								ENSG00000162869																																			PPP1R21	SO:0001624	3_prime_UTR_variant	0				HGNC	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.*504->C	2.37:g.48742386_48742387insC		Somatic	0	17	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000294952.8	37	NULL	CCDS46278.1	2																																																																																			-	-		0.386	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R21	protein_coding	OTTHUMT00000251238.4	-	NM_152994			48742387	+1	no_errors	ENST00000476199	ensembl	human	known	74_37	rna	INS	0.001:0.001	C
SSC5D	284297	genome.wustl.edu	37	19	56011757	56011768	+	In_Frame_Del	DEL	TGTTAGCACCAC	TGTTAGCACCAC	-			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	TGTTAGCACCAC	TGTTAGCACCAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr19:56011757_56011768delTGTTAGCACCAC	ENST00000389623.6	+	10	2303_2314	c.2280_2291delTGTTAGCACCAC	c.(2278-2292)agtgttagcaccact>agt	p.VSTT761del	SSC5D_ENST00000587166.1_In_Frame_Del_p.VSTT761del	NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	761					defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						CCTCTCCCAGTGTTAGCACCACTGGGGAATCA	0.618																																																	0								ENSG00000179954																																			SSC5D	SO:0001651	inframe_deletion	0				HGNC		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.2280_2291delTGTTAGCACCAC	19.37:g.56011757_56011768delTGTTAGCACCAC	ENSP00000374274:p.Val761_Thr764del	Somatic	NA	NA	NA		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B5MDQ5|C7S7T9|C7S7U0|K7EP70	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.VSTT761in_frame_del	ENST00000389623.6	37	c.2280_2291	CCDS46196.1	19																																																																																			-	NULL		0.618	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSC5D	protein_coding	OTTHUMT00000453345.2	TGTTAGCACCAC	XM_001718392			56011768	+1	no_errors	ENST00000389623	ensembl	human	known	74_37	in_frame_del	DEL	0.028:0.017:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001	-
ICOSLG	23308	genome.wustl.edu	37	21	45649509	45649509	+	Intron	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr21:45649509C>T	ENST00000407780.3	-	6	1026				ICOSLG_ENST00000344330.4_Intron|ICOSLG_ENST00000400379.3_Silent_p.L442L|ICOSLG_ENST00000400377.3_Intron	NM_001283052.1	NP_001269981.1	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand						B cell activation (GO:0042113)|defense response (GO:0006952)|hyperosmotic response (GO:0006972)|positive regulation of activated T cell proliferation (GO:0042104)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(2)|lung(1)|stomach(1)|urinary_tract(1)	5				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		GGACACCCCACAGGGGCTGGG	0.711																																																	0								ENSG00000160223																																			ICOSLG	SO:0001627	intron_variant	0			-	HGNC	AB014553	CCDS42952.1, CCDS63377.1, CCDS63379.1	21q22.3	2014-01-30		2005-01-12	ENSG00000160223	ENSG00000160223		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17087	protein-coding gene	gene with protein product	"""B7-related protein 1"", ""B7 homologue 2"", ""B7 homolog 2"""	605717		ICOSL		9734811, 11007762	Standard	NM_001283050		Approved	KIAA0653, GL50, B7-H2, B7RP-1, B7H2, B7RP1, ICOS-L, CD275	uc002zee.3	O75144	OTTHUMG00000086920	ENST00000407780.3:c.898+427G>A	21.37:g.45649509C>T		Somatic	0	42	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	64	12.33	A8MUZ1|Q9HD18|Q9NRQ1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom	p.L442	ENST00000407780.3	37	c.1326	CCDS42952.1	21																																																																																			-	NULL		0.711	ICOSLG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ICOSLG	protein_coding	OTTHUMT00000195838.1	C	NM_015259	-		45649509	-1	no_errors	ENST00000400379	ensembl	human	putative	74_37	silent	SNP	0.000	T
ICA1	3382	genome.wustl.edu	37	7	8153701	8153701	+	Intron	SNP	A	A	G			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr7:8153701A>G	ENST00000402384.3	-	14	1597				ICA1_ENST00000422063.2_Intron|ICA1_ENST00000265577.7_Intron|ICA1_ENST00000401396.1_Intron|ICA1_ENST00000406470.2_Intron|AC006042.6_ENST00000449931.1_RNA|ICA1_ENST00000396675.3_Intron			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa						neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		AAACATGAGCAAACGCACCTT	0.527																																																	0								ENSG00000227719						83.0	77.0	79.0					7																	8153701		2203	4300	6503	AC006042.6	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.1331-27T>C	7.37:g.8153701A>G		Somatic	0	71	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	64	46.72	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000402384.3	37	NULL	CCDS34602.1	7																																																																																			-	-		0.527	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000227719	protein_coding	OTTHUMT00000324793.1	A	NM_004968	-		8153701	+1	no_errors	ENST00000449931	ensembl	human	known	74_37	rna	SNP	0.000	G
NUTM2F	54754	genome.wustl.edu	37	9	97087709	97087709	+	Missense_Mutation	SNP	G	G	C			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:97087709G>C	ENST00000253262.4	-	2	544	c.524C>G	c.(523-525)gCt>gGt	p.A175G	NUTM2F_ENST00000335456.7_Missense_Mutation_p.A175G|NUTM2F_ENST00000341207.4_Missense_Mutation_p.A175G	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	175																	CCATGGCCTAGCGTTCCCTGG	0.677																																																	0								ENSG00000130950						10.0	24.0	22.0					9																	97087709		437	2286	2723	NUTM2F	SO:0001583	missense	0			-	HGNC		CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.524C>G	9.37:g.97087709G>C	ENSP00000253262:p.Ala175Gly	Somatic	0	565	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	54	588	8.39	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A175G	ENST00000253262.4	37	c.524	CCDS47994.1	9	.	.	.	.	.	.	.	.	.	.	.	9.495	1.101699	0.20632	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207;ENST00000375347	T;T;T	0.26660	1.72;1.72;1.72	1.52	0.437	0.16555	Nuclear Testis  protein, N-terminal (1);	1.669960	0.03214	N	0.176582	T	0.37046	0.0989	M	0.65975	2.015	0.09310	N	1	P	0.45634	0.863	P	0.49140	0.601	T	0.20773	-1.0265	10	0.66056	D	0.02	.	5.2955	0.15751	0.0:0.3687:0.6313:0.0	.	175	A1L443	FA22F_HUMAN	G	175	ENSP00000335067:A175G;ENSP00000253262:A175G;ENSP00000343865:A175G	ENSP00000253262:A175G	A	-	2	0	FAM22F	96127530	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.594000	0.24014	0.160000	0.19432	0.456000	0.33151	GCT	-	NULL		0.677	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUTM2F	protein_coding	OTTHUMT00000053173.2	G	NM_017561	-		97087709	-1	no_errors	ENST00000253262	ensembl	human	known	74_37	missense	SNP	0.000	C
MYH2	4620	genome.wustl.edu	37	17	10426842	10426842	+	Missense_Mutation	SNP	T	T	C			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr17:10426842T>C	ENST00000245503.5	-	37	5827	c.5443A>G	c.(5443-5445)Aag>Gag	p.K1815E	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.K1815E|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1815					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						ATCTGCTTCTTCCCACCCTTC	0.537																																																	0								ENSG00000125414						97.0	102.0	100.0					17																	10426842		2203	4300	6503	MYH2	SO:0001583	missense	0			-	HGNC		CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5443A>G	17.37:g.10426842T>C	ENSP00000245503:p.Lys1815Glu	Somatic	0	188	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	272	14.73	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K1815E	ENST00000245503.5	37	c.5443	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	T	23.9	4.469456	0.84533	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.71461	-0.57;-0.57	5.5	5.5	0.81552	Myosin tail (1);	0.000000	0.41097	U	0.000942	D	0.89150	0.6633	H	0.96518	3.835	0.54753	D	0.999983	D	0.89917	1.0	D	0.91635	0.999	D	0.92488	0.5998	10	0.87932	D	0	.	15.7759	0.78214	0.0:0.0:0.0:1.0	.	1815	Q9UKX2	MYH2_HUMAN	E	1815	ENSP00000245503:K1815E;ENSP00000380367:K1815E	ENSP00000245503:K1815E	K	-	1	0	MYH2	10367567	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.868000	0.87116	2.308000	0.77769	0.533000	0.62120	AAG	-	pfam_Myosin_tail		0.537	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	protein_coding	OTTHUMT00000252726.3	T	NM_017534	-		10426842	-1	no_errors	ENST00000245503	ensembl	human	known	74_37	missense	SNP	1.000	C
TRAPPC6B	122553	genome.wustl.edu	37	14	39627487	39627487	+	Splice_Site	SNP	A	A	G			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr14:39627487A>G	ENST00000330149.5	-	3	494		c.e3+1		TRAPPC6B_ENST00000347691.5_Splice_Site|TRAPPC6B_ENST00000557764.1_Intron	NM_001079537.1	NP_001073005.1	Q86SZ2	TPC6B_HUMAN	trafficking protein particle complex 6B						vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0128)		TAATTTAATTACCTGATGATT	0.269																																																	0								ENSG00000182400						78.0	75.0	76.0					14																	39627487		2198	4294	6492	TRAPPC6B	SO:0001630	splice_region_variant	0			-	HGNC	AK025437	CCDS9670.1, CCDS41947.1	14q13.3	2011-10-10			ENSG00000182400	ENSG00000182400		"""Trafficking protein particle complex"""	23066	protein-coding gene	gene with protein product		610397					Standard	NM_177452		Approved		uc001wut.1	Q86SZ2	OTTHUMG00000140259	ENST00000330149.5:c.267+1T>C	14.37:g.39627487A>G		Somatic	0	166	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	138	23.76	B3KPS2|Q5JPD6|Q86U35|Q86X35	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e3+2	ENST00000330149.5	37	c.267+2	CCDS41947.1	14	.	.	.	.	.	.	.	.	.	.	A	16.65	3.182524	0.57800	.	.	ENSG00000182400	ENST00000330149;ENST00000347691;ENST00000554018	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5435	0.76074	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRAPPC6B	38697238	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	8.187000	0.89708	2.130000	0.65690	0.533000	0.62120	.	-	-		0.269	TRAPPC6B-002	NOVEL	basic|appris_principal|CCDS	protein_coding	TRAPPC6B	protein_coding	OTTHUMT00000276775.1	A	NM_177452	-	Intron	39627487	-1	no_errors	ENST00000347691	ensembl	human	known	74_37	splice_site	SNP	1.000	G
PCSK5	5125	genome.wustl.edu	37	9	78790192	78790192	+	Intron	SNP	C	C	G	rs200914896		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:78790192C>G	ENST00000545128.1	+	14	2438				PCSK5_ENST00000376752.4_Intron|PCSK5_ENST00000376767.3_Missense_Mutation_p.R683G	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						ggaatggaatcgaatcgaatc	0.373																																																	0								ENSG00000099139																																			PCSK5	SO:0001627	intron_variant	0			-	HGNC		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1900+147C>G	9.37:g.78790192C>G		Somatic	0	13	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	7	56.25	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.R683G	ENST00000545128.1	37	c.2047	CCDS55320.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	N|N	0.525|0.525	-0.860634|-0.860634	0.02610|0.02610	.|.	.|.	ENSG00000099139|ENSG00000099139	ENST00000376767|ENST00000396108	T|.	0.65916|.	-0.18|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.35098|0.35098	0.0920|0.0920	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.38045|0.38045	-0.9679|-0.9679	7|4	0.07325|0.87932	T|D	0.83|0	.|.	2.8186|2.8186	0.05465|0.05465	0.5:0.5:0.0:0.0|0.5:0.5:0.0:0.0	.|.	683|.	B1AMG5|.	.|.	G|W	683|681	ENSP00000365958:R683G|.	ENSP00000365958:R683G|ENSP00000379415:S681W	R|S	+|+	1|2	2|0	PCSK5|PCSK5	77980012|77980012	0.000000|0.000000	0.05858|0.05858	0.075000|0.075000	0.20258|0.20258	0.077000|0.077000	0.17291|0.17291	-2.681000|-2.681000	0.00837|0.00837	-0.000000|-0.000000	0.14550|0.14550	0.000000|0.000000	0.15137|0.15137	CGA|TCG	-	NULL		0.373	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	protein_coding		C		rs200914896		78790192	+1	no_errors	ENST00000376767	ensembl	human	known	74_37	missense	SNP	0.006	G
MEP1A	4224	genome.wustl.edu	37	6	46766860	46766860	+	Silent	SNP	G	G	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr6:46766860G>A	ENST00000230588.4	+	5	213	c.204G>A	c.(202-204)ctG>ctA	p.L68L		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	68	Metalloprotease.				digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			GAAATGGCCTGAGAGACCCAA	0.428																																																	0								ENSG00000112818						153.0	144.0	147.0					6																	46766860		2203	4300	6503	MEP1A	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.204G>A	6.37:g.46766860G>A		Somatic	0	158	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	262	19.14	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MATH,pfam_MAM_dom,pfam_EG-like_dom,superfamily_TRAF-like,superfamily_ConA-like_lec_gl_sf,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.L68	ENST00000230588.4	37	c.204	CCDS4918.1	6																																																																																			-	pirsf_Pept_M12A_Meprin		0.428	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEP1A	protein_coding	OTTHUMT00000040803.1	G	NM_005588	-		46766860	+1	no_errors	ENST00000230588	ensembl	human	known	74_37	silent	SNP	0.974	A
OTX2	5015	genome.wustl.edu	37	14	57267296	57267296	+	IGR	DEL	A	A	-			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr14:57267296delA	ENST00000555006.1	-	0	1279				RP11-1085N6.6_ENST00000602485.1_lincRNA			P32243	OTX2_HUMAN	orthodenticle homeobox 2						axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					ATAGATTAGCAAAAAAAAAAA	0.328																																																	0								ENSG00000270163																																			RP11-1085N6.6	SO:0001628	intergenic_variant	0				Clone_based_vega_gene	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338		14.37:g.57267296delA		Somatic	0	23	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000555006.1	37	NULL	CCDS41960.1	14																																																																																			-	-		0.328	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000270163	protein_coding	OTTHUMT00000411522.1	A	NM_021728.			57267296	-1	no_errors	ENST00000602485	ensembl	human	known	74_37	rna	DEL	0.000	-
TMEM35	59353	genome.wustl.edu	37	X	100349695	100349695	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chrX:100349695G>A	ENST00000372930.4	+	2	537	c.254G>A	c.(253-255)cGt>cAt	p.R85H	TRMT2B-AS1_ENST00000443801.2_RNA|TMEM35_ENST00000478351.1_3'UTR	NM_021637.2	NP_067650.1	Q53FP2	TMM35_HUMAN	transmembrane protein 35	85						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)				NS(1)|large_intestine(3)|liver(1)|skin(1)|urinary_tract(1)	7						GTGCCTGGGCGTCCCAAAGAT	0.537																																																	0								ENSG00000126950						286.0	216.0	240.0					X																	100349695		2203	4300	6503	TMEM35	SO:0001583	missense	0			-	HGNC	AK024146	CCDS14478.1	Xq22	2008-02-05			ENSG00000126950	ENSG00000126950			25864	protein-coding gene	gene with protein product							Standard	NM_021637		Approved	FLJ14084	uc004egw.3	Q53FP2	OTTHUMG00000022016	ENST00000372930.4:c.254G>A	X.37:g.100349695G>A	ENSP00000362021:p.Arg85His	Somatic	0	221	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	73	91	44.51	Q9H7Y3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R85H	ENST00000372930.4	37	c.254	CCDS14478.1	X	.	.	.	.	.	.	.	.	.	.	G	25.4	4.630416	0.87660	.	.	ENSG00000126950	ENST00000372930	.	.	.	5.32	5.32	0.75619	.	0.087663	0.64402	D	0.000003	T	0.73218	0.3559	L	0.40543	1.245	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.75414	-0.3326	9	0.59425	D	0.04	.	18.0613	0.89378	0.0:0.0:1.0:0.0	.	85	Q53FP2	TMM35_HUMAN	H	85	.	ENSP00000362021:R85H	R	+	2	0	TMEM35	100236351	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.141000	0.71744	2.201000	0.70794	0.594000	0.82650	CGT	-	NULL		0.537	TMEM35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM35	protein_coding	OTTHUMT00000057508.1	G	NM_021637	-		100349695	+1	no_errors	ENST00000372930	ensembl	human	known	74_37	missense	SNP	1.000	A
ZCCHC12	170261	genome.wustl.edu	37	X	117959330	117959330	+	Silent	SNP	A	A	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chrX:117959330A>T	ENST00000310164.2	+	4	630	c.123A>T	c.(121-123)gcA>gcT	p.A41A		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	41					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						CCAGCATGGCAGACAgaaaca	0.572																																																	0								ENSG00000174460						75.0	68.0	70.0					X																	117959330		2203	4300	6503	ZCCHC12	SO:0001819	synonymous_variant	0			-	HGNC	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.123A>T	X.37:g.117959330A>T		Somatic	0	83	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	31	48.33	B3KV48|Q6PID5|Q8N1C1	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_CCHC	p.A41	ENST00000310164.2	37	c.123	CCDS14574.1	X																																																																																			-	NULL		0.572	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	protein_coding	OTTHUMT00000058014.1	A	NM_173798	-		117959330	+1	no_errors	ENST00000310164	ensembl	human	known	74_37	silent	SNP	0.996	T
CSTF2T	23283	genome.wustl.edu	37	10	53457702	53457702	+	Silent	SNP	G	G	A	rs148098627		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr10:53457702G>A	ENST00000331173.4	-	1	1653	c.1608C>T	c.(1606-1608)gtC>gtT	p.V536V	PRKG1_ENST00000373980.4_Intron|PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373985.1_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	536	9 X 5 AA tandem repeats of G-[AT]-G-[MI]- Q.|Gly-rich.				mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		cttgtatactgactccttgta	0.552																																																	0								ENSG00000177613						142.0	103.0	117.0					10																	53457702		2203	4300	6503	CSTF2T	SO:0001819	synonymous_variant	0			-	HGNC	AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.1608C>T	10.37:g.53457702G>A		Somatic	0	175	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	210	21.05	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.V536	ENST00000331173.4	37	c.1608	CCDS7245.1	10																																																																																			-	NULL		0.552	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF2T	protein_coding	OTTHUMT00000048097.1	G	NM_015235	-		53457702	-1	no_errors	ENST00000331173	ensembl	human	known	74_37	silent	SNP	0.676	A
ADNP2	22850	genome.wustl.edu	37	18	77896692	77896692	+	Silent	SNP	A	A	G			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr18:77896692A>G	ENST00000262198.4	+	4	3851	c.3396A>G	c.(3394-3396)taA>taG	p.*1132*		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	0					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		ATGAACCATAAAACTTGCAAA	0.303																																																	0								ENSG00000101544						8.0	9.0	9.0					18																	77896692		1982	4129	6111	ADNP2	SO:0001819	synonymous_variant	0			-	HGNC	AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.3396A>G	18.37:g.77896692A>G		Somatic	0	36	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	148	10.30	A8K951|O94943|Q9H9P3	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.*1132	ENST00000262198.4	37	c.3396	CCDS32853.1	18																																																																																			-	NULL		0.303	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	protein_coding	OTTHUMT00000418979.1	A	NM_014913	-		77896692	+1	no_errors	ENST00000262198	ensembl	human	known	74_37	silent	SNP	0.133	G
CELP	1057	genome.wustl.edu	37	9	135959920	135959920	+	RNA	SNP	G	G	A	rs557377810		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:135959920G>A	ENST00000411440.2	+	0	166					NR_001275.2				carboxyl ester lipase pseudogene																		CAACCTGTACGCCAACGCCGC	0.567													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18763	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000170827																																			CELP			0			-	HGNC	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135959920G>A		Somatic	0	43	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	33	26.67		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			-	-		0.567	CELP-002	KNOWN	basic	processed_transcript	CELP	pseudogene	OTTHUMT00000339837.1	G	NM_001808	-		135959920	+1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	SNP	0.858	A
TRIO	7204	genome.wustl.edu	37	5	14359550	14359550	+	Silent	SNP	G	G	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr5:14359550G>T	ENST00000344204.4	+	13	2325	c.2301G>T	c.(2299-2301)gcG>gcT	p.A767A	TRIO_ENST00000537187.1_Silent_p.A767A|TRIO_ENST00000509967.2_Silent_p.A718A	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	767					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					TGGACGAGGCGCAGTCGCAGA	0.597																																																	0								ENSG00000038382						82.0	74.0	77.0					5																	14359550		2203	4300	6503	TRIO	SO:0001819	synonymous_variant	0			-	HGNC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2301G>T	5.37:g.14359550G>T		Somatic	0	110	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	90	87	50.56	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.A767	ENST00000344204.4	37	c.2301	CCDS3883.1	5																																																																																			-	smart_Spectrin/alpha-actinin		0.597	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	protein_coding	OTTHUMT00000253711.2	G	NM_007118	-		14359550	+1	no_errors	ENST00000344204	ensembl	human	known	74_37	silent	SNP	0.964	T
PCSK5	5125	genome.wustl.edu	37	9	78790212	78790212	+	Intron	SNP	A	A	C	rs386735190|rs62556620	byFrequency	TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:78790212A>C	ENST00000545128.1	+	14	2438				PCSK5_ENST00000376752.4_Intron|PCSK5_ENST00000376767.3_Silent_p.I689I	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5						anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						cgaatcgaatagaatagaata	0.333																																																	0								ENSG00000099139																																			PCSK5	SO:0001627	intron_variant	0			-	HGNC		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.1900+167A>C	9.37:g.78790212A>C		Somatic	0	9	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	4	63.64	F5H2G7|Q13527|Q96EP4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.I689	ENST00000545128.1	37	c.2067	CCDS55320.1	9																																																																																			-	NULL		0.333	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	protein_coding		A		rs62556620		78790212	+1	no_errors	ENST00000376767	ensembl	human	known	74_37	silent	SNP	0.000	C
TRHR	7201	genome.wustl.edu	37	8	110099856	110099856	+	Missense_Mutation	SNP	G	G	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr8:110099856G>A	ENST00000518632.1	+	2	466	c.115G>A	c.(115-117)Ggc>Agc	p.G39S	TRHR_ENST00000311762.2_Missense_Mutation_p.G39S			P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	39					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thyrotropin-releasing hormone receptor activity (GO:0004997)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(12)|prostate(4)|skin(4)|urinary_tract(1)	37			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			TTGTGGCCTGGGCATTGTAGG	0.502																																																	0								ENSG00000174417						139.0	121.0	127.0					8																	110099856		2203	4300	6503	TRHR	SO:0001583	missense	0			-	HGNC		CCDS6311.1	8q23.1	2013-09-20			ENSG00000174417	ENSG00000174417			12299	protein-coding gene	gene with protein product		188545				8128317	Standard	NM_003301		Approved		uc003ymz.4	P34981	OTTHUMG00000164910	ENST00000518632.1:c.115G>A	8.37:g.110099856G>A	ENSP00000430711:p.Gly39Ser	Somatic	0	158	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	63	49.60	Q2M339	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_TRH_rcpt_1,prints_GPCR_Rhodpsn	p.G39S	ENST00000518632.1	37	c.115	CCDS6311.1	8	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829029	0.90955	.	.	ENSG00000174417	ENST00000518632;ENST00000311762	T;T	0.48836	0.8;0.8	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.71417	0.3337	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73745	-0.3886	10	0.72032	D	0.01	-38.1771	18.8271	0.92123	0.0:0.0:1.0:0.0	.	39	P34981	TRFR_HUMAN	S	39	ENSP00000430711:G39S;ENSP00000309818:G39S	ENSP00000309818:G39S	G	+	1	0	TRHR	110169032	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.860000	0.99555	2.703000	0.92315	0.655000	0.94253	GGC	-	pfam_7TM_GPCR_olfarory/Srsx,prints_TRH_rcpt_1,prints_GPCR_Rhodpsn		0.502	TRHR-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	TRHR	protein_coding	OTTHUMT00000380892.1	G		-		110099856	+1	no_errors	ENST00000311762	ensembl	human	known	74_37	missense	SNP	1.000	A
ROR2	4920	genome.wustl.edu	37	9	94499672	94499672	+	Splice_Site	SNP	C	C	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:94499672C>T	ENST00000375708.3	-	5	821		c.e5+1		ROR2_ENST00000375715.1_Splice_Site|ROR2_ENST00000550066.1_Splice_Site	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GCAGCTCCTACCTGTGATTCG	0.522																																																	0								ENSG00000169071						148.0	115.0	126.0					9																	94499672		2203	4300	6503	ROR2	SO:0001630	splice_region_variant	0			-	HGNC	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.622+1G>A	9.37:g.94499672C>T		Somatic	0	106	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	83	35.16	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e5+1	ENST00000375708.3	37	c.622+1	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024902	0.54683	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	.	.	.	4.42	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.587	0.87984	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ROR2	93539493	1.000000	0.71417	0.938000	0.37757	0.376000	0.30014	7.518000	0.81795	2.431000	0.82371	0.655000	0.94253	.	-	-		0.522	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	protein_coding	OTTHUMT00000053040.1	C		-	Intron	94499672	-1	no_errors	ENST00000375708	ensembl	human	known	74_37	splice_site	SNP	1.000	T
ANO7	50636	genome.wustl.edu	37	2	242147068	242147068	+	Missense_Mutation	SNP	G	G	A	rs137878201		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr2:242147068G>A	ENST00000274979.8	+	11	1325	c.1222G>A	c.(1222-1224)Gcc>Acc	p.A408T	ANO7_ENST00000402430.3_Missense_Mutation_p.A407T	NM_001001891.3	NP_001001891.2	Q6IWH7	ANO7_HUMAN	anoctamin 7	408					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(14)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	32						GCTCTCCAGCGCCTGTGCCCT	0.622																																																	0								ENSG00000146205	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	91.0	86.0	88.0		1222	-0.6	0.2	2	dbSNP_134	88	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ANO7	NM_001001891.3	58	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	408/934	242147068	2,13004	2203	4300	6503	ANO7	SO:0001583	missense	0			-	HGNC	AY617079	CCDS33423.1, CCDS46563.1	2q37.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000146205	ENSG00000146205		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	31677	protein-coding gene	gene with protein product		605096	"""transmembrane protein 16G"""	PCANAP5, TMEM16G		14981236, 15375614, 24692353	Standard	NM_001001891		Approved	NGEP, PCANAP5L, IPCA-5	uc002wax.2	Q6IWH7	OTTHUMG00000151702	ENST00000274979.8:c.1222G>A	2.37:g.242147068G>A	ENSP00000274979:p.Ala408Thr	Somatic	0	114	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	104	7	92.86	Q6IWH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Anoctamin	p.A408T	ENST00000274979.8	37	c.1222	CCDS33423.1	2	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.355048	0.00217	2.27E-4	1.16E-4	ENSG00000146205	ENST00000274979;ENST00000402430	T;T	0.69175	-0.27;-0.38	2.49	-0.572	0.11745	.	0.903236	0.09240	N	0.829372	T	0.38904	0.1058	N	0.16266	0.395	0.24836	N	0.992495	B	0.28258	0.205	B	0.15870	0.014	T	0.25398	-1.0133	10	0.02654	T	1	.	6.5956	0.22672	0.5116:0.0:0.4884:0.0	.	408	Q6IWH7	ANO7_HUMAN	T	408;407	ENSP00000274979:A408T;ENSP00000385418:A407T	ENSP00000274979:A408T	A	+	1	0	ANO7	241795741	0.052000	0.20516	0.153000	0.22517	0.127000	0.20565	0.092000	0.15066	-0.049000	0.13379	0.313000	0.20887	GCC	-	pfam_Anoctamin		0.622	ANO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO7	protein_coding	OTTHUMT00000323509.1	G	NM_001001891	rs137878201		242147068	+1	no_errors	ENST00000274979	ensembl	human	known	74_37	missense	SNP	0.854	A
CEACAM21	90273	genome.wustl.edu	37	19	42085857	42085857	+	Silent	SNP	G	G	A			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr19:42085857G>A	ENST00000401445.2	+	3	602	c.576G>A	c.(574-576)ctG>ctA	p.L192L	CEACAM21_ENST00000187608.9_Silent_p.L192L|CEACAM21_ENST00000482870.2_3'UTR|CEACAM21_ENST00000407170.2_Silent_p.L64L			Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 21	192	Ig-like C2-type.					integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	13						GGATGAAGCTGTCCTGGTTTA	0.542																																																	0								ENSG00000007129						51.0	51.0	51.0					19																	42085857		2055	4201	6256	CEACAM21	SO:0001819	synonymous_variant	0			-	HGNC	AK023602	CCDS46086.1, CCDS46087.1, CCDS74373.1	19q13.2	2013-01-29			ENSG00000007129	ENSG00000007129		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28834	protein-coding gene	gene with protein product						12477932	Standard	XM_005278397		Approved	R29124_1, FLJ13540	uc002ore.4	Q3KPI0	OTTHUMG00000151062	ENST00000401445.2:c.576G>A	19.37:g.42085857G>A		Somatic	0	59	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	83	40.29	B7WNQ6|O75296|Q6UY47|Q96ER7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L192	ENST00000401445.2	37	c.576	CCDS46086.1	19																																																																																			-	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.542	CEACAM21-005	KNOWN	non_canonical_polymorphism|basic|appris_candidate_longest|CCDS	protein_coding	CEACAM21	protein_coding	OTTHUMT00000321140.1	G	NM_033543	-		42085857	+1	no_errors	ENST00000401445	ensembl	human	known	74_37	silent	SNP	0.013	A
GSN	2934	genome.wustl.edu	37	9	124045961	124045974	+	Intron	DEL	ATTCATTCATTCAT	ATTCATTCATTCAT	-	rs13302134|rs369237356|rs150215555|rs71370645|rs78220606|rs13283432|rs386738236|rs4837831|rs4837830		TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	ATTCATTCATTCAT	ATTCATTCATTCAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:124045961_124045974delATTCATTCATTCAT	ENST00000373823.3	+	9	896				GSN_ENST00000341272.2_Intron|GSN_ENST00000394353.2_Intron|RP11-477J21.6_ENST00000437135.1_RNA|GSN_ENST00000449733.1_Intron|GSN_ENST00000373808.2_Intron|GSN_ENST00000436847.1_Intron|GSN_ENST00000545652.1_5'Flank|GSN-AS1_ENST00000414544.1_RNA|GSN_ENST00000412819.1_Intron			P06396	GELS_HUMAN	gelsolin						actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						tcattcattcattcattcattcattcattcattc	0.416																																																	0								ENSG00000235865																																			GSN-AS1	SO:0001627	intron_variant	0				HGNC	X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373823.3:c.-10+2121ATTCATTCATTCAT>-	9.37:g.124045961_124045974delATTCATTCATTCAT		Somatic	NA	NA	NA		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373823.3	37	NULL	CCDS6829.1	9																																																																																			-	-		0.416	GSN-013	KNOWN	basic|appris_principal|CCDS	protein_coding	GSN-AS1	protein_coding	OTTHUMT00000254323.3	ATTCATTCATTCAT	NM_000177			124045974	-1	no_errors	ENST00000414544	ensembl	human	known	74_37	rna	DEL	0.050:0.056:0.057:0.054:0.002:0.004:0.004:0.002:0.002:0.002:0.004:0.006:0.003:0.000	-
LMO7	4008	genome.wustl.edu	37	13	76395653	76395653	+	Nonsense_Mutation	SNP	A	A	T			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr13:76395653A>T	ENST00000321797.8	+	12	2570	c.1849A>T	c.(1849-1851)Aaa>Taa	p.K617*	LMO7_ENST00000526202.1_Nonsense_Mutation_p.K467*|LMO7_ENST00000357063.3_Nonsense_Mutation_p.K902*|LMO7_ENST00000377534.3_Nonsense_Mutation_p.K902*|LMO7_ENST00000341547.4_Nonsense_Mutation_p.K568*|LMO7_ENST00000465261.2_Nonsense_Mutation_p.K617*			Q8WWI1	LMO7_HUMAN	LIM domain 7	902					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		AAGTTACCGGAAAACTGATAC	0.473																																																	0								ENSG00000136153						75.0	73.0	74.0					13																	76395653		2203	4300	6503	LMO7	SO:0001587	stop_gained	0			-	HGNC	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.1849A>T	13.37:g.76395653A>T	ENSP00000317802:p.Lys617*	Somatic	0	95	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	8	77.14	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.K902*	ENST00000321797.8	37	c.2704		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	50|50	16.827111|16.827111	0.99873|0.99873	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000447038|ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261	.|.	.|.	.|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	.|0.350346	.|0.37012	.|N	.|0.002291	T|.	0.38852|.	0.1056|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34675|.	-0.9819|.	3|.	.|0.02654	.|T	.|1	-13.6847|-13.6847	16.3364|16.3364	0.83064|0.83064	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	525|568;902;902;516;617;467;617	.|.	.|ENSP00000317802:K617X	E|K	+|+	2|1	0|0	LMO7|LMO7	75293654|75293654	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.016000|8.016000	0.88706|0.88706	2.252000|2.252000	0.74401|0.74401	0.528000|0.528000	0.53228|0.53228	GAA|AAA	-	NULL		0.473	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	LMO7	protein_coding	OTTHUMT00000045301.3	A	NM_005358	-		76395653	+1	no_errors	ENST00000357063	ensembl	human	known	74_37	nonsense	SNP	1.000	T
TMEM8B	51754	genome.wustl.edu	37	9	35829952	35829952	+	5'UTR	SNP	G	G	C			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr9:35829952G>C	ENST00000377991.4	+	0	167				FAM221B_ENST00000423537.2_5'Flank|TMEM8B_ENST00000439587.2_5'UTR|TMEM8B_ENST00000377996.1_Intron|TMEM8B_ENST00000473947.1_3'UTR|TMEM8B_ENST00000377988.2_5'UTR	NM_001042589.2	NP_001036054.1	A6NDV4	TMM8B_HUMAN	transmembrane protein 8B						cell-matrix adhesion (GO:0007160)|regulation of growth (GO:0040008)|regulation of mitotic cell cycle (GO:0007346)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|large_intestine(2)|lung(1)|ovary(1)	7						CCCAGGGGCTGGTGAGTGCAG	0.597																																																	0								ENSG00000137103																																			TMEM8B	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC043384	CCDS6595.1, CCDS43800.1	9p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000137103	ENSG00000137103			21427	protein-coding gene	gene with protein product	"""nasopharyngeal carcinoma expressed 6"""		"""chromosome 9 open reading frame 127"""	C9orf127		12918109, 8619474	Standard	NM_016446		Approved	NAG-5, NGX6	uc003zym.4	A6NDV4	OTTHUMG00000019885	ENST00000377991.4:c.-849G>C	9.37:g.35829952G>C		Somatic	0	19	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	19	40.62	B3KQF3|O75539|Q49AB1|Q4KMX5|Q5TCW5|Q9HBY2|Q9P0U7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000377991.4	37	NULL	CCDS43800.1	9																																																																																			-	-		0.597	TMEM8B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM8B	protein_coding	OTTHUMT00000052388.2	G	NM_016446	-		35829952	+1	no_errors	ENST00000472010	ensembl	human	known	74_37	rna	SNP	1.000	C
TMEM254	80195	genome.wustl.edu	37	10	81841422	81841422	+	Intron	DEL	A	A	-			TCGA-IE-A6BZ-01A-11D-A307-09	TCGA-IE-A6BZ-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	201198d0-2d2c-4d33-9c31-f82d4daf7057	530f54b3-8d78-4d13-9b9d-17390fb27d29	g.chr10:81841422delA	ENST00000372281.3	+	2	117				TMEM254_ENST00000372277.3_Intron|TMEM254_ENST00000467529.1_Intron|TMEM254-AS1_ENST00000412298.1_RNA|TMEM254_ENST00000372274.1_Intron|TMEM254_ENST00000372275.1_Intron|TMEM254-AS1_ENST00000448729.2_RNA|TMEM254-AS1_ENST00000432070.2_RNA	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254							integral component of membrane (GO:0016021)											agaccctgtcaaaaaaaaaag	0.478																																																	0								ENSG00000133678																																			TMEM254	SO:0001627	intron_variant	0				HGNC	BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.88-175A>-	10.37:g.81841422delA		Somatic	0	32	0.00		0.7041138616532453	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000372281.3	37	NULL	CCDS7363.1	10																																																																																			-	-		0.478	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM254	protein_coding	OTTHUMT00000049030.1	A	NM_025125			81841422	+1	no_errors	ENST00000463029	ensembl	human	known	74_37	rna	DEL	0.038	-
