#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PRR5L	79899	genome.wustl.edu	37	11	36485195	36485195	+	3'UTR	DEL	A	A	-	rs200390084	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:36485195delA	ENST00000378867.3	+	0	2371				PRR5L_ENST00000311599.5_3'UTR|PRR5L_ENST00000389693.3_3'UTR	NM_024841.4	NP_079117.3	Q6MZQ0	PRR5L_HUMAN	proline rich 5 like						negative regulation of protein phosphorylation (GO:0001933)|negative regulation of signal transduction (GO:0009968)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|regulation of fibroblast migration (GO:0010762)|TORC2 signaling (GO:0038203)	mitochondrion (GO:0005739)|TORC2 complex (GO:0031932)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)	19						TGTATCGTTTAAAAAAAAAAA	0.393													|||unknown(HR)	1189	0.23742	0.2224	0.3184	5008	,	,		21881	0.1944		0.2913	False		,,,				2504	0.1892																0								ENSG00000135362																																			PRR5L	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS31463.1, CCDS53617.1	11p13-p12	2009-07-09				ENSG00000135362			25878	protein-coding gene	gene with protein product	"""protein observed with Rictor-2"""	611728				17461779	Standard	NM_024841		Approved	FLJ14213, PROTOR-2	uc001mwp.3	Q6MZQ0		ENST00000378867.3:c.*909A>-	11.37:g.36485195delA		Somatic	0	16	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	9	25.00	A4QN22|E9PKY1|Q96H46|Q9H7V4	RNA	DEL	24	4.00	1	42	4.55	2	-	NULL	ENST00000378867.3	37	NULL	CCDS31463.1	11																																																																																			-	-		0.393	PRR5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR5L	protein_coding	OTTHUMT00000389209.1	A	NM_024841			36485195	+1	no_errors	ENST00000389693	ensembl	human	known	74_37	rna	DEL	0.022	-
HYDIN	54768	genome.wustl.edu	37	16	70902531	70902531	+	Missense_Mutation	SNP	G	G	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr16:70902531G>C	ENST00000393567.2	-	66	11402	c.11252C>G	c.(11251-11253)aCa>aGa	p.T3751R	SNORD112_ENST00000515891.1_RNA	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	3751					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CCACTTGACTGTGTGCATGCG	0.522																																																	0								ENSG00000157423						62.0	59.0	60.0					16																	70902531		1930	4130	6060	HYDIN	SO:0001583	missense	0			-	HGNC	AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.11252C>G	16.37:g.70902531G>C	ENSP00000377197:p.Thr3751Arg	Somatic	0	98	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	73	23.96	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	22	0.00	0	15	28.57	6	superfamily_P-loop_NTPase,superfamily_PapD-like	p.T3751R	ENST00000393567.2	37	c.11252	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	19.26	3.792792	0.70452	.	.	ENSG00000157423	ENST00000393567;ENST00000316490	T	0.00995	5.46	5.03	4.07	0.47477	.	0.000000	0.33792	U	0.004557	T	0.04137	0.0115	M	0.73598	2.24	0.80722	D	1	D	0.71674	0.998	D	0.64877	0.93	T	0.43925	-0.9361	10	0.46703	T	0.11	.	12.4939	0.55916	0.0824:0.0:0.9176:0.0	.	3750	F8WD23	.	R	3751;3750	ENSP00000377197:T3751R	ENSP00000313052:T3750R	T	-	2	0	HYDIN	69460032	1.000000	0.71417	0.997000	0.53966	0.871000	0.50021	5.087000	0.64480	2.327000	0.79052	0.511000	0.50034	ACA	-	NULL		0.522	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	protein_coding	OTTHUMT00000398624.3	G		-		70902531	-1	no_errors	ENST00000393567	ensembl	human	putative	74_37	missense	SNP	0.998	C
CSRNP3	80034	genome.wustl.edu	37	2	166535783	166535783	+	Silent	SNP	T	T	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr2:166535783T>A	ENST00000342316.4	+	5	1550	c.1278T>A	c.(1276-1278)gcT>gcA	p.A426A	CSRNP3_ENST00000314499.7_Silent_p.A426A|CSRNP3_ENST00000409420.1_Silent_p.A458A	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	426					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						CAAAGAATGCTTCTTTTTATG	0.443																																																	0								ENSG00000178662						134.0	135.0	135.0					2																	166535783		2203	4300	6503	CSRNP3	SO:0001819	synonymous_variant	0			-	HGNC	AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.1278T>A	2.37:g.166535783T>A		Somatic	0	41	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	40	16.67	B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Silent	SNP	38	0.00	0	40	20.00	10	prints_Cys/Ser-rich_nuc_prot	p.A426	ENST00000342316.4	37	c.1278	CCDS2225.1	2																																																																																			-	NULL		0.443	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP3	protein_coding	OTTHUMT00000255191.2	T	NM_024969	-		166535783	+1	no_errors	ENST00000314499	ensembl	human	known	74_37	silent	SNP	0.988	A
KRBOX1	100506243	genome.wustl.edu	37	3	42929043	42929043	+	Intron	SNP	A	A	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr3:42929043A>G	ENST00000426937.1	+	3	131				RP11-141M3.5_ENST00000471537.1_RNA			C9JBD0	KRBX1_HUMAN	KRAB box domain containing 1						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			lung(2)	2						GTGGagaactactgaggactt	0.478																																																	0								ENSG00000144648																																			ACKR2	SO:0001627	intron_variant	0			-	HGNC		CCDS54572.1	3p22.1	2014-02-12	2010-07-29		ENSG00000240747	ENSG00000240747		"""-"""	38708	protein-coding gene	gene with protein product							Standard	NM_001205272		Approved		uc003cmm.4	C9JBD0	OTTHUMG00000156448	ENST00000426937.1:c.-163-21242A>G	3.37:g.42929043A>G		Somatic	0	75	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	60	17.81	B4DJE8	RNA	SNP	27	0.00	0	47	12.96	7	-	NULL	ENST00000426937.1	37	NULL	CCDS54572.1	3																																																																																			-	-		0.478	KRBOX1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ACKR2	protein_coding	OTTHUMT00000344162.1	A	NM_001205272	-		42929043	+1	no_errors	ENST00000460855	ensembl	human	known	74_37	rna	SNP	0.004	G
SLC13A5	284111	genome.wustl.edu	37	17	6606359	6606359	+	Missense_Mutation	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:6606359C>T	ENST00000433363.2	-	5	879	c.646G>A	c.(646-648)Gcc>Acc	p.A216T	SLC13A5_ENST00000293800.6_Missense_Mutation_p.A199T|SLC13A5_ENST00000381074.4_Missense_Mutation_p.A173T|SLC13A5_ENST00000573648.1_Missense_Mutation_p.A216T	NM_001284510.1|NM_177550.3	NP_001271439.1|NP_808218.1	Q86YT5	S13A5_HUMAN	solute carrier family 13 (sodium-dependent citrate transporter), member 5	216					transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	citrate transmembrane transporter activity (GO:0015137)|sodium:dicarboxylate symporter activity (GO:0017153)|succinate transmembrane transporter activity (GO:0015141)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|prostate(5)|skin(3)|urinary_tract(1)	26						CCGATGCTGGCCGCGTAGCAG	0.617																																																	0								ENSG00000141485						140.0	114.0	123.0					17																	6606359		2203	4300	6503	SLC13A5	SO:0001583	missense	0			-	HGNC	AJ489980	CCDS11079.1, CCDS45593.1, CCDS67136.1, CCDS67137.1	17p13.1	2013-05-22			ENSG00000141485	ENSG00000141485		"""Solute carriers"""	23089	protein-coding gene	gene with protein product		608305				12445824	Standard	NM_001284510		Approved	NACT	uc002gdj.3	Q86YT5	OTTHUMG00000102052	ENST00000433363.2:c.646G>A	17.37:g.6606359C>T	ENSP00000406220:p.Ala216Thr	Somatic	0	74	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	70	34.58	B3KXR0|B7Z4P2|B7ZLB4|F8W7N2|Q6ZMG1	Missense_Mutation	SNP	13	0.00	0	35	43.55	27	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.A216T	ENST00000433363.2	37	c.646	CCDS11079.1	17	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332529	0.81801	.	.	ENSG00000141485	ENST00000293800;ENST00000433363;ENST00000381074	T;T	0.02737	4.18;4.18	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.23532	0.0569	M	0.94101	3.495	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.996;0.998;0.998;0.998	T	0.05131	-1.0904	10	0.87932	D	0	.	17.1977	0.86898	0.0:1.0:0.0:0.0	.	216;173;173;199;216	B7ZLB4;F8W7N2;B7Z4P2;B3KXR0;Q86YT5	.;.;.;.;S13A5_HUMAN	T	216;216;173	ENSP00000406220:A216T;ENSP00000370464:A173T	ENSP00000293800:A216T	A	-	1	0	SLC13A5	6547083	1.000000	0.71417	0.971000	0.41717	0.148000	0.21650	5.588000	0.67517	2.746000	0.94184	0.561000	0.74099	GCC	-	pfam_Na/sul_symport		0.617	SLC13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A5	protein_coding	OTTHUMT00000219853.2	C	NM_177550	-		6606359	-1	no_errors	ENST00000433363	ensembl	human	known	74_37	missense	SNP	1.000	T
THOC1	9984	genome.wustl.edu	37	18	215471	215471	+	Missense_Mutation	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:215471C>T	ENST00000261600.6	-	20	1643	c.1636G>A	c.(1636-1638)Gaa>Aaa	p.E546K		NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	546					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				TCCTCATCTTCATCCTCACCT	0.343																																																	0								ENSG00000079134						139.0	123.0	128.0					18																	215471		1852	4094	5946	THOC1	SO:0001583	missense	0			-	HGNC	AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.1636G>A	18.37:g.215471C>T	ENSP00000261600:p.Glu546Lys	Somatic	0	31	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	40	25.93	B2RBP6|Q15219|Q64I72|Q64I73	Missense_Mutation	SNP	34	0.00	0	52	24.64	17	pfam_THO_THOC1,pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain,pfscan_Death_domain	p.E546K	ENST00000261600.6	37	c.1636	CCDS45820.1	18	.	.	.	.	.	.	.	.	.	.	C	16.39	3.111215	0.56398	.	.	ENSG00000079134	ENST00000261600	.	.	.	5.44	5.44	0.79542	.	0.049423	0.85682	D	0.000000	T	0.45216	0.1331	N	0.20685	0.6	0.58432	D	0.999999	P	0.35493	0.505	B	0.37015	0.239	T	0.33548	-0.9864	9	0.16420	T	0.52	-17.9489	18.2487	0.89996	0.0:1.0:0.0:0.0	.	546	Q96FV9	THOC1_HUMAN	K	546	.	ENSP00000261600:E546K	E	-	1	0	THOC1	205471	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.317000	0.72862	2.560000	0.86352	0.563000	0.77884	GAA	-	NULL		0.343	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC1	protein_coding	OTTHUMT00000440348.5	C	NM_005131	-		215471	-1	no_errors	ENST00000261600	ensembl	human	known	74_37	missense	SNP	1.000	T
HDAC5	10014	genome.wustl.edu	37	17	42170476	42170476	+	Missense_Mutation	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:42170476G>T	ENST00000393622.2	-	6	956	c.625C>A	c.(625-627)Cag>Aag	p.Q209K	HDAC5_ENST00000225983.6_Missense_Mutation_p.Q210K|HDAC5_ENST00000586802.1_Missense_Mutation_p.Q209K|HDAC5_ENST00000336057.5_Missense_Mutation_p.Q209K	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	209					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		TTGGGGTGCTGTGGGAGGGAA	0.602																																																	0								ENSG00000108840						65.0	72.0	69.0					17																	42170476		2203	4300	6503	HDAC5	SO:0001583	missense	0			-	HGNC	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.625C>A	17.37:g.42170476G>T	ENSP00000377244:p.Gln209Lys	Somatic	0	55	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	18	0.00	0	35	0.00	0	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.Q210K	ENST00000393622.2	37	c.628	CCDS45696.1	17	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295822	0.40594	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.42131	0.99;0.99;0.98	4.37	4.37	0.52481	.	0.203317	0.35772	N	0.002996	T	0.55832	0.1945	L	0.50333	1.59	0.48696	D	0.999698	P;P;P;P	0.52577	0.954;0.924;0.593;0.458	D;P;P;P	0.65140	0.932;0.857;0.828;0.678	T	0.51124	-0.8745	10	0.30854	T	0.27	-14.6595	15.8174	0.78615	0.0:0.0:1.0:0.0	.	209;209;210;209	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	K	210;209;209	ENSP00000225983:Q210K;ENSP00000377244:Q209K;ENSP00000337290:Q209K	ENSP00000225983:Q210K	Q	-	1	0	HDAC5	39526002	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.799000	0.62517	2.267000	0.75376	0.561000	0.74099	CAG	-	pirsf_Histone_deAcase_II_euk		0.602	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	protein_coding	OTTHUMT00000457686.1	G	NM_001015053	-		42170476	-1	no_errors	ENST00000225983	ensembl	human	known	74_37	missense	SNP	1.000	T
EVPL	2125	genome.wustl.edu	37	17	74017573	74017573	+	Silent	SNP	C	C	G	rs78569674	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:74017573C>G	ENST00000301607.3	-	9	1240	c.987G>C	c.(985-987)ctG>ctC	p.L329L	EVPL_ENST00000586740.1_Silent_p.L329L	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	329	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)	p.L329L(1)		breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCACGTGCTGCAGCTGGGTCT	0.706																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)						ENSG00000167880						29.0	25.0	26.0					17																	74017573		2201	4297	6498	EVPL	SO:0001819	synonymous_variant	0			-	HGNC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.987G>C	17.37:g.74017573C>G		Somatic	0	20	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	9	47.06	A0AUV5	Silent	SNP	12	7.69	1	30	0.00	0	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.L329	ENST00000301607.3	37	c.987	CCDS11737.1	17																																																																																			-	smart_Spectrin/alpha-actinin		0.706	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	protein_coding	OTTHUMT00000449483.1	C	NM_001988	rs78569674		74017573	-1	no_errors	ENST00000301607	ensembl	human	known	74_37	silent	SNP	1.000	G
C12orf43	64897	genome.wustl.edu	37	12	121438758	121438758	+	IGR	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr12:121438758G>T	ENST00000288757.3	-	0	1920				HNF1A_ENST00000257555.6_Intron|HNF1A_ENST00000541395.1_Intron|RP11-216P16.2_ENST00000606238.1_RNA|HNF1A_ENST00000544413.1_Intron	NM_022895.1	NP_075046.1	Q96C57	CL043_HUMAN	chromosome 12 open reading frame 43											cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TATCTGCTGTGATCCAGGAGG	0.627																																																	0								ENSG00000271769																																			RP11-216P16.2	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	AK022510	CCDS66486.1, CCDS66487.1	12q24.31	2012-05-30			ENSG00000157895	ENSG00000157895			25719	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001286195		Approved	FLJ12448	uc001tzh.1	Q96C57	OTTHUMG00000169150		12.37:g.121438758G>T		Somatic	0	34	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q53HF0|Q9H9Z7	RNA	SNP	33	0.00	0	36	0.00	0	-	NULL	ENST00000288757.3	37	NULL	CCDS9210.1	12																																																																																			-	-		0.627	C12orf43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271769	protein_coding		G	NM_022895	-		121438758	-1	no_errors	ENST00000606238	ensembl	human	known	74_37	rna	SNP	0.000	T
ESX1	80712	genome.wustl.edu	37	X	103498855	103498855	+	Silent	SNP	T	T	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chrX:103498855T>C	ENST00000372588.4	-	2	569	c.486A>G	c.(484-486)caA>caG	p.Q162Q		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	162					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						CGTCGGGATATTGAGATTCAT	0.622																																					Pancreas(200;1705 2227 25194 28471 45274)												0								ENSG00000123576						53.0	54.0	53.0					X																	103498855		2203	4298	6501	ESX1	SO:0001819	synonymous_variant	0			-	HGNC	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.486A>G	X.37:g.103498855T>C		Somatic	0	69	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	44	38.89	B0QYU3|Q7Z6K7	Silent	SNP	16	0.00	0	18	35.71	10	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU	p.Q162	ENST00000372588.4	37	c.486	CCDS14516.1	X																																																																																			-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom		0.622	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	protein_coding	OTTHUMT00000057763.2	T	NM_153448	-		103498855	-1	no_errors	ENST00000372588	ensembl	human	known	74_37	silent	SNP	0.000	C
WWC1	23286	genome.wustl.edu	37	5	167850929	167850929	+	Missense_Mutation	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:167850929C>A	ENST00000265293.4	+	11	2168	c.1666C>A	c.(1666-1668)Ctg>Atg	p.L556M	WWC1_ENST00000521089.1_Missense_Mutation_p.L556M	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	556					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		TGACCCCCTCCTGGCTGGTGA	0.582																																																	0								ENSG00000113645						72.0	63.0	66.0					5																	167850929		2203	4300	6503	WWC1	SO:0001583	missense	0			-	HGNC	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.1666C>A	5.37:g.167850929C>A	ENSP00000265293:p.Leu556Met	Somatic	0	43	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	23	0.00	0	27	0.00	0	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.L556M	ENST00000265293.4	37	c.1666	CCDS4366.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.556|7.556	0.663802|0.663802	0.14710|0.14710	.|.	.|.	ENSG00000113645|ENSG00000113645	ENST00000265293;ENST00000521089|ENST00000393895;ENST00000524228	T;T|.	0.25912|.	1.77;1.77|.	5.22|5.22	1.96|1.96	0.26148|0.26148	.|.	0.081881|.	0.49916|.	D|.	0.000131|.	T|T	0.61048|0.61048	0.2316|0.2316	M|M	0.75264|0.75264	2.295|2.295	0.50039|0.50039	D|D	0.999842|0.999842	B;B;B;B|.	0.26902|.	0.061;0.116;0.116;0.163|.	B;B;B;B|.	0.33690|.	0.051;0.168;0.168;0.074|.	T|T	0.57464|0.57464	-0.7807|-0.7807	10|5	0.33141|.	T|.	0.24|.	.|.	3.9104|3.9104	0.09201|0.09201	0.1712:0.4953:0.0:0.3334|0.1712:0.4953:0.0:0.3334	.|.	556;462;462;556|.	Q8IX03-2;F5H498;B3KX05;Q8IX03|.	.;.;.;KIBRA_HUMAN|.	M|H	556|517;332	ENSP00000265293:L556M;ENSP00000427772:L556M|.	ENSP00000265293:L556M|.	L|P	+|+	1|2	2|0	WWC1|WWC1	167783507|167783507	0.984000|0.984000	0.35163|0.35163	0.997000|0.997000	0.53966|0.53966	0.161000|0.161000	0.22273|0.22273	1.514000|1.514000	0.35834|0.35834	0.571000|0.571000	0.29365|0.29365	0.655000|0.655000	0.94253|0.94253	CTG|CCT	-	NULL		0.582	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	protein_coding	OTTHUMT00000252791.2	C	NM_015238	-		167850929	+1	no_errors	ENST00000265293	ensembl	human	known	74_37	missense	SNP	0.993	A
TMC1	117531	genome.wustl.edu	37	9	75309519	75309519	+	Missense_Mutation	SNP	G	G	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr9:75309519G>C	ENST00000297784.5	+	7	665	c.125G>C	c.(124-126)aGg>aCg	p.R42T	TMC1_ENST00000340019.3_Missense_Mutation_p.R42T|TMC1_ENST00000396237.3_Missense_Mutation_p.R42T	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	42	Arg/Asp/Glu/Lys-rich (highly charged).				auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						AGACCAAAGAGGAAACGGACC	0.448																																					Pancreas(75;173 1345 14232 34245 43413)												0								ENSG00000165091						154.0	142.0	146.0					9																	75309519		2202	4300	6502	TMC1	SO:0001583	missense	0			-	HGNC	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.125G>C	9.37:g.75309519G>C	ENSP00000297784:p.Arg42Thr	Somatic	0	28	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	47	11.32	A8MVZ2|B1AM91	Missense_Mutation	SNP	32	0.00	0	39	7.14	3	pfam_TMC	p.R42T	ENST00000297784.5	37	c.125	CCDS6643.1	9	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149552	0.78001	.	.	ENSG00000165091	ENST00000297784;ENST00000340019;ENST00000396235;ENST00000537917;ENST00000538054;ENST00000542143;ENST00000396237	T;T;T	0.15834	2.39;2.39;2.39	5.33	5.33	0.75918	.	0.123609	0.53938	D	0.000048	T	0.29749	0.0743	L	0.40543	1.245	0.28220	N	0.926545	P;D	0.54601	0.909;0.967	P;P	0.60789	0.879;0.879	T	0.03773	-1.1005	10	0.36615	T	0.2	-21.8422	15.7578	0.78051	0.0:0.0:1.0:0.0	.	51;42	A4FUA6;Q8TDI8	.;TMC1_HUMAN	T	42;42;51;51;51;36;42	ENSP00000297784:R42T;ENSP00000341433:R42T;ENSP00000379538:R42T	ENSP00000297784:R42T	R	+	2	0	TMC1	74499339	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.196000	0.51020	2.484000	0.83849	0.650000	0.86243	AGG	-	NULL		0.448	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMC1	protein_coding	OTTHUMT00000052655.1	G		-		75309519	+1	no_errors	ENST00000297784	ensembl	human	known	74_37	missense	SNP	1.000	C
ZNF345	25850	genome.wustl.edu	37	19	37367976	37367976	+	Nonsense_Mutation	SNP	C	C	T	rs202011849		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr19:37367976C>T	ENST00000529555.1	+	2	1032	c.244C>T	c.(244-246)Cga>Tga	p.R82*	ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000589046.1_Nonsense_Mutation_p.R82*|ZNF345_ENST00000420450.1_Nonsense_Mutation_p.R82*|ZNF345_ENST00000526123.1_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	82					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R82*(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCGACATCAGCGAATTCATAC	0.403																																																	1	Substitution - Nonsense(1)	endometrium(1)						ENSG00000251247						104.0	109.0	108.0					19																	37367976		2203	4300	6503	ZNF345	SO:0001587	stop_gained	0			-	HGNC	X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.244C>T	19.37:g.37367976C>T	ENSP00000431202:p.Arg82*	Somatic	0	25	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	23.26		Nonsense_Mutation	SNP	36	0.00	0	39	23.53	12	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R82*	ENST00000529555.1	37	c.244	CCDS12497.1	19	.	.	.	.	.	.	.	.	.	.	C	16.24	3.066976	0.55539	.	.	ENSG00000251247	ENST00000420450;ENST00000529555;ENST00000331800	.	.	.	4.28	1.85	0.25348	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5385	0.45018	0.3427:0.6573:0.0:0.0	.	.	.	.	X	82	.	.	R	+	1	2	ZNF345	42059816	0.000000	0.05858	1.000000	0.80357	0.999000	0.98932	-1.759000	0.01808	1.064000	0.40671	0.655000	0.94253	CGA	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.403	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF345	protein_coding	OTTHUMT00000388258.1	C		rs202011849		37367976	+1	no_errors	ENST00000420450	ensembl	human	known	74_37	nonsense	SNP	1.000	T
JMJD7	100137047	genome.wustl.edu	37	15	42120356	42120356	+	Missense_Mutation	SNP	G	G	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr15:42120356G>C	ENST00000397299.4	+	1	74	c.34G>C	c.(34-36)Gag>Cag	p.E12Q	JMJD7-PLA2G4B_ENST00000382448.4_Missense_Mutation_p.E12Q|RP11-23P13.4_ENST00000512295.1_RNA|RP11-23P13.4_ENST00000510176.1_RNA|PLA2G4B_ENST00000542534.2_Missense_Mutation_p.E12Q|JMJD7_ENST00000405106.2_3'UTR|JMJD7-PLA2G4B_ENST00000342159.4_Missense_Mutation_p.E12Q|JMJD7_ENST00000408047.1_5'UTR	NM_001114632.1	NP_001108104.1	P0C870	JMJD7_HUMAN	jumonji domain containing 7	12										NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)	8						CGTGCGGAGCGAGTTACGAGA	0.706																																																	0								ENSG00000168970						16.0	19.0	18.0					15																	42120356		2199	4298	6497	JMJD7-PLA2G4B	SO:0001583	missense	0			-	HGNC		CCDS45240.1	15q15.1	2011-02-10			ENSG00000243789	ENSG00000243789			34397	protein-coding gene	gene with protein product							Standard	NM_001114632		Approved			P0C870	OTTHUMG00000156810	ENST00000397299.4:c.34G>C	15.37:g.42120356G>C	ENSP00000380467:p.Glu12Gln	Somatic	0	38	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	A5D6V5|O95712|Q59GF9|Q8TB10|Q9UKV7	Missense_Mutation	SNP	8	0.00	0	28	20.00	7	pfam_LysoPLipase_cat_dom,pfam_C2_dom,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_dom,smart_JmjC_dom,smart_C2_dom,smart_LysoPLipase_cat_dom,pfscan_JmjC_dom,pfscan_C2_dom,pfscan_LysoPLipase_cat_dom	p.E12Q	ENST00000397299.4	37	c.34	CCDS45240.1	15	.	.	.	.	.	.	.	.	.	.	.	17.68	3.448325	0.63178	.	.	ENSG00000243789;ENSG00000168970;ENSG00000168970;ENSG00000168970	ENST00000397299;ENST00000542534;ENST00000382448;ENST00000342159	T;T;T;T	0.30448	1.53;1.53;5.12;4.81	4.98	0.272	0.15645	.	0.641843	0.13573	N	0.377923	T	0.18341	0.0440	L	0.40543	1.245	0.20821	N	0.999841	B;P;B	0.41393	0.006;0.748;0.29	B;B;B	0.38985	0.007;0.287;0.073	T	0.11616	-1.0580	10	0.19147	T	0.46	-7.5476	2.715	0.05185	0.1764:0.2697:0.4293:0.1246	.	12;12;12	P0C869-7;P0C869-6;P0C870	.;.;JMJD7_HUMAN	Q	12	ENSP00000380467:E12Q;ENSP00000441905:E12Q;ENSP00000371886:E12Q;ENSP00000342785:E12Q	ENSP00000380467:E12Q	E	+	1	0	JMJD7-PLA2G4B;JMJD7	39907648	0.423000	0.25482	0.522000	0.27862	0.476000	0.33039	0.549000	0.23329	0.129000	0.18514	0.561000	0.74099	GAG	-	NULL		0.706	JMJD7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	JMJD7-PLA2G4B	protein_coding	OTTHUMT00000326082.1	G	NM_001114632	-		42120356	+1	no_errors	ENST00000382448	ensembl	human	known	74_37	missense	SNP	0.000	C
PSD2	84249	genome.wustl.edu	37	5	139216824	139216824	+	Splice_Site	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:139216824G>T	ENST00000274710.3	+	11	1870		c.e11+1			NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2						neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGCAGAAGGTGAGAGACTG	0.637																																																	0								ENSG00000146005						65.0	67.0	66.0					5																	139216824		2203	4300	6503	PSD2	SO:0001630	splice_region_variant	0			-	HGNC	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1665+1G>T	5.37:g.139216824G>T		Somatic	0	49	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	D3DQD3|Q8N3J8	Splice_Site	SNP	17	0.00	0	33	10.81	4	-	e10+1	ENST00000274710.3	37	c.1665+1	CCDS4216.1	5	.	.	.	.	.	.	.	.	.	.	G	25.1	4.605765	0.87157	.	.	ENSG00000146005	ENST00000274710	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7524	0.91820	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PSD2	139197008	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	9.826000	0.99387	2.441000	0.82636	0.484000	0.47621	.	-	-		0.637	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	protein_coding	OTTHUMT00000251339.1	G	NM_032289	-	Intron	139216824	+1	no_errors	ENST00000274710	ensembl	human	known	74_37	splice_site	SNP	1.000	T
TRPV2	51393	genome.wustl.edu	37	17	16342924	16342925	+	IGR	DEL	GT	GT	-	rs11540320		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:16342924_16342925delGT	ENST00000338560.7	+	0	2808				C17orf76-AS1_ENST00000470491.2_RNA|C17orf76-AS1_ENST00000475953.1_RNA|C17orf76-AS1_ENST00000483140.1_RNA|C17orf76-AS1_ENST00000487066.1_RNA|RP11-138I1.3_ENST00000585048.1_lincRNA|C17orf76-AS1_ENST00000580180.1_RNA|C17orf76-AS1_ENST00000478103.2_RNA|C17orf76-AS1_ENST00000472367.1_RNA|C17orf76-AS1_ENST00000460249.1_RNA|C17orf76-AS1_ENST00000580770.1_RNA|C17orf76-AS1_ENST00000579473.1_RNA|C17orf76-AS1_ENST00000491009.1_RNA|C17orf76-AS1_ENST00000481898.1_RNA|C17orf76-AS1_ENST00000582911.1_RNA|C17orf76-AS1_ENST00000578380.2_RNA|C17orf76-AS1_ENST00000584926.1_RNA|C17orf76-AS1_ENST00000581913.1_RNA|C17orf76-AS1_ENST00000481027.1_RNA|C17orf76-AS1_ENST00000480811.1_RNA|C17orf76-AS1_ENST00000584141.1_RNA|C17orf76-AS1_ENST00000365172.1_RNA|C17orf76-AS1_ENST00000484836.1_RNA|C17orf76-AS1_ENST00000391079.1_RNA|C17orf76-AS1_ENST00000584177.1_RNA|C17orf76-AS1_ENST00000477249.2_RNA|C17orf76-AS1_ENST00000492250.1_RNA|C17orf76-AS1_ENST00000475947.2_RNA|C17orf76-AS1_ENST00000583400.2_RNA|C17orf76-AS1_ENST00000581718.1_RNA|C17orf76-AS1_ENST00000384229.1_RNA	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2						calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TTAGTTGACCGTAACTGCCAGA	0.505																																																	0								ENSG00000175061																																			C17orf76-AS1	SO:0001628	intergenic_variant	0				HGNC	AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989		17.37:g.16342924_16342925delGT		Somatic	0	52	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	51	35.44	A6NML2|A8K0Z0|Q9Y670	RNA	DEL	20	0.00	0	33	36.54	19	-	NULL	ENST00000338560.7	37	NULL	CCDS32576.1	17																																																																																			-	-		0.505	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf76-AS1	protein_coding	OTTHUMT00000130464.2	GT	NM_016113			16342925	+1	no_errors	ENST00000460249	ensembl	human	known	74_37	rna	DEL	0.000:0.000	-
PRICKLE4	29964	genome.wustl.edu	37	6	41752638	41752638	+	Intron	SNP	G	G	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr6:41752638G>C	ENST00000394260.1	+	2	120				PRICKLE4_ENST00000458694.1_Intron|PRICKLE4_ENST00000394259.1_Intron|TOMM6_ENST00000398884.3_5'Flank|TOMM6_ENST00000398881.3_5'Flank|PRICKLE4_ENST00000463606.1_3'UTR|PRICKLE4_ENST00000394263.1_Intron|PRICKLE4_ENST00000359201.5_Intron			Q2TBC4	PRIC4_HUMAN	prickle homolog 4 (Drosophila)							nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	13	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TTCTGCTGGAGCTCTCCCAGT	0.562																																																	0								ENSG00000124593						53.0	60.0	58.0					6																	41752638		2203	4300	6503	PRICKLE4	SO:0001627	intron_variant	0			-	HGNC	AF216754	CCDS34449.1	6p21.1	2010-08-05	2007-09-18	2007-09-18	ENSG00000124593	ENSG00000124593			16805	protein-coding gene	gene with protein product		611389	"""chromosome 6 open reading frame 49"""	C6orf49		15702247	Standard	NM_013397		Approved	OEBT, DKFZp761H221	uc011duf.1	Q2TBC4	OTTHUMG00000014685	ENST00000394260.1:c.121-35G>C	6.37:g.41752638G>C		Somatic	0	82	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	87	23.68	A2A3M0|A6PVU1|B3KQ15|Q5T3D4|Q9NSV1	RNA	SNP	25	0.00	0	38	26.92	14	-	NULL	ENST00000394260.1	37	NULL		6																																																																																			-	-		0.562	PRICKLE4-007	KNOWN	basic	protein_coding	PRICKLE4	protein_coding	OTTHUMT00000303948.1	G	NM_013397	-		41752638	+1	no_errors	ENST00000463606	ensembl	human	putative	74_37	rna	SNP	0.000	C
SOAT1	6646	genome.wustl.edu	37	1	179322767	179322767	+	Nonsense_Mutation	SNP	C	C	A	rs149858295		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:179322767C>A	ENST00000367619.3	+	16	1787	c.1644C>A	c.(1642-1644)taC>taA	p.Y548*	SOAT1_ENST00000540564.1_Nonsense_Mutation_p.Y490*|SOAT1_ENST00000535686.1_Nonsense_Mutation_p.Y284*|SOAT1_ENST00000539888.1_Nonsense_Mutation_p.Y483*	NM_003101.5	NP_003092.4	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1	548					cholesterol efflux (GO:0033344)|cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol storage (GO:0010878)|macrophage derived foam cell differentiation (GO:0010742)|positive regulation of amyloid precursor protein biosynthetic process (GO:0042986)|very-low-density lipoprotein particle assembly (GO:0034379)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|cholesterol O-acyltransferase activity (GO:0034736)|fatty-acyl-CoA binding (GO:0000062)|sterol O-acyltransferase activity (GO:0004772)			central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|stomach(1)	20					Ezetimibe(DB00973)|Hesperetin(DB01094)	CTTGTCGTTACGTGTTTTAGA	0.433																																																	0								ENSG00000057252						247.0	223.0	231.0					1																	179322767		2203	4300	6503	SOAT1	SO:0001587	stop_gained	0			-	HGNC	L21934	CCDS1330.1, CCDS58047.1, CCDS58048.1	1q25	2008-08-26	2008-08-26		ENSG00000057252	ENSG00000057252	2.3.1.26		11177	protein-coding gene	gene with protein product	"""acyl-Coenzyme A: cholesterol acyltransferase"""	102642	"""sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1"""	SOAT, STAT		8407899	Standard	NM_003101		Approved	ACAT	uc001gml.3	P35610	OTTHUMG00000035253	ENST00000367619.3:c.1644C>A	1.37:g.179322767C>A	ENSP00000356591:p.Tyr548*	Somatic	0	57	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	49	39.51	A6NC40|A8K3P4|A9Z1V7|B4DU95|Q5T0X4|Q8N1E4	Nonsense_Mutation	SNP	28	0.00	0	40	42.86	30	pfam_MBOAT_fam	p.Y548*	ENST00000367619.3	37	c.1644	CCDS1330.1	1	.	.	.	.	.	.	.	.	.	.	C	41	8.899765	0.98996	.	.	ENSG00000057252	ENST00000539888;ENST00000540564;ENST00000535686;ENST00000367619	.	.	.	5.65	-3.18	0.05186	.	0.496841	0.20464	N	0.091833	.	.	.	.	.	.	0.27977	N	0.936188	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.335	12.7012	0.57034	0.0:0.2988:0.0:0.7012	.	.	.	.	X	483;490;284;548	.	ENSP00000356591:Y548X	Y	+	3	2	SOAT1	177589390	0.646000	0.27295	0.100000	0.21137	0.992000	0.81027	-0.478000	0.06575	-0.708000	0.05015	0.563000	0.77884	TAC	-	NULL		0.433	SOAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOAT1	protein_coding	OTTHUMT00000085286.2	C	NM_003101	-		179322767	+1	no_errors	ENST00000367619	ensembl	human	known	74_37	nonsense	SNP	0.036	A
TYR	7299	genome.wustl.edu	37	11	88911582	88911582	+	Missense_Mutation	SNP	G	G	A	rs200471520		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:88911582G>A	ENST00000263321.5	+	1	963	c.461G>A	c.(460-462)gGg>gAg	p.G154E	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	154					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	ATCCCCATAGGGACCTATGGC	0.403													G|||	1	0.000199681	0.0	0.0	5008	,	,		21568	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000077498						155.0	147.0	150.0					11																	88911582		2201	4299	6500	TYR	SO:0001583	missense	0			GMAF=0.0005	HGNC	M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.461G>A	11.37:g.88911582G>A	ENSP00000263321:p.Gly154Glu	Somatic	0	34	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	34	24.44	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	34	0.00	0	41	22.64	12	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.G154E	ENST00000263321.5	37	c.461	CCDS8284.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	16.44	3.125230	0.56721	.	.	ENSG00000077498	ENST00000263321	D	0.83673	-1.75	5.97	5.97	0.96955	Uncharacterised domain, di-copper centre (2);	0.042698	0.85682	D	0.000000	D	0.86289	0.5897	M	0.76328	2.33	0.58432	D	0.999999	P	0.49358	0.923	P	0.45794	0.493	D	0.85729	0.1330	9	.	.	.	.	20.4238	0.99064	0.0:0.0:1.0:0.0	.	154	P14679	TYRO_HUMAN	E	154	ENSP00000263321:G154E	.	G	+	2	0	TYR	88551230	1.000000	0.71417	0.979000	0.43373	0.541000	0.35023	7.396000	0.79891	2.828000	0.97474	0.655000	0.94253	GGG	-	superfamily_Unchr_di-copper_centre		0.403	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	protein_coding	OTTHUMT00000394045.2	G	NM_000372	rs200471520		88911582	+1	no_errors	ENST00000263321	ensembl	human	known	74_37	missense	SNP	1.000	A
NPLOC4	55666	genome.wustl.edu	37	17	79563206	79563206	+	Silent	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:79563206G>T	ENST00000331134.6	-	11	1271	c.1056C>A	c.(1054-1056)ccC>ccA	p.P352P	NPLOC4_ENST00000539314.1_Silent_p.P191P|NPLOC4_ENST00000374747.5_Silent_p.P352P	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	352					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GGCACATGTTGGGATGCTTGT	0.438																																																	0								ENSG00000182446						105.0	104.0	105.0					17																	79563206		1898	4116	6014	NPLOC4	SO:0001819	synonymous_variant	0			-	HGNC	AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.1056C>A	17.37:g.79563206G>T		Somatic	0	44	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Silent	SNP	27	0.00	0	40	0.00	0	pfam_NPL4,pfam_NPL4_Zn-bd_put,pfam_Npl4_Ub-like_dom,pirsf_PolyUb_recognition_cplx_Npl4	p.P352	ENST00000331134.6	37	c.1056	CCDS45812.1	17																																																																																			-	pfam_NPL4,pirsf_PolyUb_recognition_cplx_Npl4		0.438	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPLOC4	protein_coding	OTTHUMT00000440140.1	G		-		79563206	-1	no_errors	ENST00000374747	ensembl	human	known	74_37	silent	SNP	1.000	T
AKAP6	9472	genome.wustl.edu	37	14	33015886	33015886	+	Nonsense_Mutation	SNP	C	C	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr14:33015886C>G	ENST00000280979.4	+	4	2197	c.2027C>G	c.(2026-2028)tCa>tGa	p.S676*	AKAP6_ENST00000557272.1_Nonsense_Mutation_p.S676*|AKAP6_ENST00000557354.1_Nonsense_Mutation_p.S676*	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	676					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GAAATGAATTCAGATTCTGAA	0.428																																					Melanoma(49;821 1200 7288 13647 42351)												0								ENSG00000151320						98.0	97.0	97.0					14																	33015886		2203	4300	6503	AKAP6	SO:0001587	stop_gained	0			-	HGNC	AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.2027C>G	14.37:g.33015886C>G	ENSP00000280979:p.Ser676*	Somatic	0	15	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	13	31.58	A7E242|A7E2D4|O15028	Nonsense_Mutation	SNP	33	0.00	0	34	39.29	22	smart_Spectrin/alpha-actinin	p.S676*	ENST00000280979.4	37	c.2027	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	39	7.551497	0.98352	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	.	.	.	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-9.2338	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	676	.	ENSP00000280979:S676X	S	+	2	0	AKAP6	32085637	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.149000	0.58091	2.941000	0.99782	0.655000	0.94253	TCA	-	NULL		0.428	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	protein_coding	OTTHUMT00000276617.2	C	NM_004274	-		33015886	+1	no_errors	ENST00000280979	ensembl	human	known	74_37	nonsense	SNP	1.000	G
ELP4	26610	genome.wustl.edu	37	11	31804979	31804979	+	Silent	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:31804979C>T	ENST00000350638.5	+	10	1217	c.1182C>T	c.(1180-1182)agC>agT	p.S394S	ELP4_ENST00000395934.2_3'UTR|ELP4_ENST00000379163.5_Missense_Mutation_p.P442S	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	394					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					ACACAGTGAGCCGCTCAAGCA	0.488																																																	0								ENSG00000109911						85.0	91.0	89.0					11																	31804979		1896	4130	6026	ELP4	SO:0001819	synonymous_variant	0			-	HGNC	AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.1182C>T	11.37:g.31804979C>T		Somatic	0	25	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Missense_Mutation	SNP	45	2.17	1	29	0.00	0	pfam_Elongator_complex_protein_4,superfamily_P-loop_NTPase	p.P442S	ENST00000350638.5	37	c.1324	CCDS7875.2	11	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944681	0.73672	.	.	ENSG00000109911	ENST00000379163	T	0.52295	0.67	5.73	4.82	0.62117	.	.	.	.	.	T	0.33118	0.0852	.	.	.	0.80722	D	1	B	0.28350	0.208	B	0.23716	0.048	T	0.10520	-1.0626	7	.	.	.	.	11.0451	0.47855	0.0:0.8578:0.0:0.1422	.	442	B4E3W0	.	S	442	ENSP00000368461:P442S	.	P	+	1	0	ELP4	31761555	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.721000	0.38032	1.553000	0.49476	0.557000	0.71058	CCG	-	NULL		0.488	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELP4	protein_coding	OTTHUMT00000286640.1	C	NM_019040	-		31804979	+1	no_errors	ENST00000379163	ensembl	human	novel	74_37	missense	SNP	1.000	T
PCDHGB3	56102	genome.wustl.edu	37	5	140750156	140750156	+	Missense_Mutation	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:140750156C>A	ENST00000576222.1	+	1	326	c.195C>A	c.(193-195)aaC>aaA	p.N65K	PCDHGB1_ENST00000523390.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	65	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTACTAGGAACCTGCGGGTTA	0.547																																																	0								ENSG00000262209						116.0	123.0	121.0					5																	140750156		1847	4101	5948	PCDHGB3	SO:0001583	missense	0			-	HGNC	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.195C>A	5.37:g.140750156C>A	ENSP00000461862:p.Asn65Lys	Somatic	0	22	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	29	23.68	A7E229|Q9Y5C7	Missense_Mutation	SNP	28	0.00	0	25	21.88	7	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N65K	ENST00000576222.1	37	c.195	CCDS58980.1	5																																																																																			-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.547	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB3	protein_coding	OTTHUMT00000437094.1	C	NM_018924	-		140750156	+1	no_errors	ENST00000576222	ensembl	human	known	74_37	missense	SNP	0.691	A
NBPF1	55672	genome.wustl.edu	37	1	16913618	16913618	+	Missense_Mutation	SNP	T	T	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:16913618T>G	ENST00000430580.2	-	11	1592	c.705A>C	c.(703-705)aaA>aaC	p.K235N		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	235	NBPF 1. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TTGAGTTGACTTTGTCTTCCT	0.448																																																	0								ENSG00000219481						498.0	430.0	453.0					1																	16913618		2198	4295	6493	NBPF1	SO:0001583	missense	0			-	HGNC	AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.705A>C	1.37:g.16913618T>G	ENSP00000474456:p.Lys235Asn	Somatic	0	177	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	180	23.40	Q8N4E8|Q9C0H0	Missense_Mutation	SNP	36	0.00	0	37	27.45	14	pfam_NBPF_dom	p.K235N	ENST00000430580.2	37	c.705		1																																																																																			-	pfam_NBPF_dom		0.448	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	protein_coding	OTTHUMT00000106436.3	T	NM_017940	-		16913618	-1	no_errors	ENST00000430580	ensembl	human	novel	74_37	missense	SNP	0.004	G
RCAN2	10231	genome.wustl.edu	37	6	46216533	46216533	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr6:46216533G>A	ENST00000330430.6	-	2	376	c.188C>T	c.(187-189)tCt>tTt	p.S63F	RCAN2_ENST00000371374.1_Missense_Mutation_p.S109F|RCAN2_ENST00000405162.1_Missense_Mutation_p.S109F|RCAN2_ENST00000306764.7_Missense_Mutation_p.S109F	NM_005822.3	NP_005813.2	Q14206	RCAN2_HUMAN	regulator of calcineurin 2	63					calcineurin-NFAT signaling cascade (GO:0033173)|locomotion involved in locomotory behavior (GO:0031987)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)		nucleotide binding (GO:0000166)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						TCGGGCTGCAGATTTAGGATT	0.393																																																	0								ENSG00000172348						101.0	90.0	93.0					6																	46216533		1837	4105	5942	RCAN2	SO:0001583	missense	0			-	HGNC	D83407	CCDS43469.1, CCDS59023.1	6p12.3	2008-10-31	2007-06-26	2007-06-26	ENSG00000172348	ENSG00000172348			3041	protein-coding gene	gene with protein product		604876	"""Down syndrome critical region gene 1-like 1"""	DSCR1L1		8662924	Standard	NM_001251973		Approved	ZAKI-4	uc003oyc.2	Q14206	OTTHUMG00000014782	ENST00000330430.6:c.188C>T	6.37:g.46216533G>A	ENSP00000329454:p.Ser63Phe	Somatic	0	42	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	23	64.62	A6ND07|B3KR46|Q5VWF7|Q5VWF8|Q8N116	Missense_Mutation	SNP	39	0.00	0	7	87.50	49	pfam_Calcipressin	p.S109F	ENST00000330430.6	37	c.326	CCDS43469.1	6	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403432	0.62288	.	.	ENSG00000172348	ENST00000330430;ENST00000371374;ENST00000306764;ENST00000405162	.	.	.	5.82	4.95	0.65309	Nucleotide-binding, alpha-beta plait (1);	0.215254	0.40640	N	0.001047	T	0.66416	0.2787	M	0.61703	1.905	0.44359	D	0.997259	P;D	0.54047	0.468;0.964	P;P	0.59546	0.664;0.859	T	0.72327	-0.4327	9	0.87932	D	0	-21.9795	14.1686	0.65493	0.0716:0.0:0.9284:0.0	.	109;63	Q14206-2;Q14206	.;RCAN2_HUMAN	F	63;109;109;109	.	ENSP00000305223:S109F	S	-	2	0	RCAN2	46324492	1.000000	0.71417	1.000000	0.80357	0.558000	0.35554	7.568000	0.82369	1.466000	0.48025	-0.150000	0.13652	TCT	-	pfam_Calcipressin		0.393	RCAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCAN2	protein_coding	OTTHUMT00000040782.1	G		-		46216533	-1	no_errors	ENST00000306764	ensembl	human	known	74_37	missense	SNP	1.000	A
SETBP1	26040	genome.wustl.edu	37	18	42530827	42530827	+	Missense_Mutation	SNP	A	A	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:42530827A>G	ENST00000282030.5	+	4	1818	c.1522A>G	c.(1522-1524)Acg>Gcg	p.T508A		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	508						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GACACCTCCAACGTGCACAGA	0.512									Schinzel-Giedion syndrome																																								0								ENSG00000152217						77.0	76.0	76.0					18																	42530827		2203	4300	6503	SETBP1	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	-	HGNC	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.1522A>G	18.37:g.42530827A>G	ENSP00000282030:p.Thr508Ala	Somatic	0	38	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	24	29.41	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	28	0.00	0	18	45.45	15	smart_AT_hook_DNA-bd_motif	p.T508A	ENST00000282030.5	37	c.1522	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	A	1.283	-0.609690	0.03690	.	.	ENSG00000152217	ENST00000282030	T	0.68181	-0.31	6.08	-2.61	0.06171	.	0.931883	0.09236	N	0.829920	T	0.36276	0.0961	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22661	-1.0210	10	0.09084	T	0.74	.	0.926	0.01324	0.4453:0.1549:0.2194:0.1804	.	508	Q9Y6X0	SETBP_HUMAN	A	508	ENSP00000282030:T508A	ENSP00000282030:T508A	T	+	1	0	SETBP1	40784825	0.000000	0.05858	0.000000	0.03702	0.973000	0.67179	-0.086000	0.11233	-0.080000	0.12685	0.533000	0.62120	ACG	-	NULL		0.512	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	protein_coding	OTTHUMT00000255854.4	A	NM_001130110	-		42530827	+1	no_errors	ENST00000282030	ensembl	human	known	74_37	missense	SNP	0.000	G
MUC4	4585	genome.wustl.edu	37	3	195515857	195515857	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr3:195515857G>A	ENST00000463781.3	-	2	3053	c.2594C>T	c.(2593-2595)tCt>tTt	p.S865F	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.S865F	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	870	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.S865F(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACGATCGAAGACGCCATTCC	0.587																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000145113						66.0	70.0	69.0					3																	195515857		2095	4198	6293	MUC4	SO:0001583	missense	0			-	HGNC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2594C>T	3.37:g.195515857G>A	ENSP00000417498:p.Ser865Phe	Somatic	0	29	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	45	28.57	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	22	0.00	0	36	18.18	8	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.S865F	ENST00000463781.3	37	c.2594	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	7.545	0.661571	0.14645	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.48836	0.8;0.82	2.78	2.78	0.32641	.	1.183160	0.06260	N	0.693658	T	0.52125	0.1715	N	0.19112	0.55	0.09310	N	1	D;D	0.89917	0.997;1.0	D;D	0.65987	0.936;0.94	T	0.49790	-0.8902	10	0.56958	D	0.05	-8.1738	9.3672	0.38232	0.0:0.0:1.0:0.0	.	865;870	E7ESK3;Q99102	.;MUC4_HUMAN	F	865;865;839	ENSP00000417498:S865F;ENSP00000420243:S865F	ENSP00000376209:S839F	S	-	2	0	MUC4	197000252	0.000000	0.05858	0.002000	0.10522	0.018000	0.09664	0.188000	0.17018	1.875000	0.54330	0.579000	0.79373	TCT	-	NULL		0.587	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	protein_coding	OTTHUMT00000324081.6	G	NM_018406	-		195515857	-1	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	SNP	0.004	A
ITGAD	3681	genome.wustl.edu	37	16	31409218	31409218	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr16:31409218G>A	ENST00000389202.2	+	5	464	c.415G>A	c.(415-417)Gac>Aac	p.D139N		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	139					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GACAGTCCCCGACGCCACGCC	0.647																																																	0								ENSG00000156886						30.0	26.0	27.0					16																	31409218		2197	4300	6497	ITGAD	SO:0001583	missense	0			-	HGNC	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.415G>A	16.37:g.31409218G>A	ENSP00000373854:p.Asp139Asn	Somatic	0	51	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	76	13.64	Q15575|Q15576	Missense_Mutation	SNP	27	0.00	0	44	22.81	13	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.D139N	ENST00000389202.2	37	c.415	CCDS32438.1	16	.	.	.	.	.	.	.	.	.	.	G	7.713	0.695643	0.15106	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.58506	0.33	3.73	2.78	0.32641	.	.	.	.	.	T	0.30103	0.0754	N	0.08118	0	0.09310	N	1	P;P;B	0.44578	0.838;0.458;0.312	B;B;B	0.35353	0.201;0.067;0.067	T	0.08186	-1.0734	9	0.51188	T	0.08	.	5.414	0.16363	0.1145:0.2059:0.6796:0.0	.	139;155;139	B7Z6V7;Q59H14;Q13349	.;.;ITAD_HUMAN	N	155;139	ENSP00000373854:D139N	ENSP00000373854:D139N	D	+	1	0	ITGAD	31316719	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-0.139000	0.10358	0.893000	0.36288	0.563000	0.77884	GAC	-	NULL		0.647	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAD	protein_coding	OTTHUMT00000432836.1	G	NM_005353	-		31409218	+1	no_errors	ENST00000389202	ensembl	human	known	74_37	missense	SNP	0.002	A
DLGAP1	9229	genome.wustl.edu	37	18	3879582	3879582	+	Missense_Mutation	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:3879582C>T	ENST00000315677.3	-	4	1082	c.487G>A	c.(487-489)Gtc>Atc	p.V163I	DLGAP1_ENST00000581527.1_Missense_Mutation_p.V163I|DLGAP1-AS3_ENST00000577649.1_RNA|DLGAP1_ENST00000515196.2_Missense_Mutation_p.V163I|DLGAP1_ENST00000584874.1_Missense_Mutation_p.V163I	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	163					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				CCCCCGTTGACGCTGCCCTTG	0.716																																																	0								ENSG00000170579						54.0	65.0	61.0					18																	3879582		2203	4299	6502	DLGAP1	SO:0001583	missense	0			-	HGNC	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.487G>A	18.37:g.3879582C>T	ENSP00000316377:p.Val163Ile	Somatic	0	42	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	33	34.00	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	23	0.00	0	28	34.88	15	pfam_GKAP	p.V163I	ENST00000315677.3	37	c.487	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	C	11.67	1.706466	0.30232	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.16743	2.32;2.32	5.75	2.49	0.30216	.	0.358888	0.31427	N	0.007674	T	0.10937	0.0267	L	0.29908	0.895	0.32176	N	0.580964	B;B;B	0.13145	0.002;0.007;0.003	B;B;B	0.08055	0.001;0.003;0.001	T	0.12889	-1.0530	10	0.25751	T	0.34	-22.8096	8.4744	0.33005	0.0:0.6726:0.1241:0.2033	.	163;163;163	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	I	163	ENSP00000316377:V163I;ENSP00000445973:V163I	ENSP00000316377:V163I	V	-	1	0	DLGAP1	3869582	0.978000	0.34361	0.998000	0.56505	0.994000	0.84299	0.320000	0.19540	0.754000	0.32968	0.655000	0.94253	GTC	-	NULL		0.716	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	protein_coding	OTTHUMT00000254394.4	C		-		3879582	-1	no_errors	ENST00000315677	ensembl	human	known	74_37	missense	SNP	0.993	T
AZGP1	563	genome.wustl.edu	37	7	99569380	99569380	+	Missense_Mutation	SNP	T	T	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr7:99569380T>C	ENST00000292401.4	-	2	462	c.326A>G	c.(325-327)aAc>aGc	p.N109S	AZGP1_ENST00000411734.1_Missense_Mutation_p.N106S	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding	109					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					GTTACTGTCGTTGTAATACTC	0.527																																																	0								ENSG00000160862						156.0	126.0	136.0					7																	99569380		2203	4300	6503	AZGP1	SO:0001583	missense	0			-	HGNC	BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.326A>G	7.37:g.99569380T>C	ENSP00000292401:p.Asn109Ser	Somatic	0	113	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	71	33.94	D6W5T8|O60386|Q5XKQ4|Q8N4N0	Missense_Mutation	SNP	20	0.00	0	20	33.33	10	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.N109S	ENST00000292401.4	37	c.326	CCDS5680.1	7	.	.	.	.	.	.	.	.	.	.	T	10.64	1.406331	0.25378	.	.	ENSG00000160862	ENST00000292401;ENST00000411734	T;T	0.01455	4.87;4.87	1.51	1.51	0.23008	MHC class I, alpha chain, alpha1/alpha2 (2);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.820344	0.09870	U	0.745080	T	0.04861	0.0131	M	0.93062	3.375	0.29261	N	0.871304	B	0.23891	0.093	B	0.19666	0.026	T	0.11717	-1.0576	10	0.87932	D	0	.	5.1124	0.14815	0.0:0.0:0.0:1.0	.	109	P25311	ZA2G_HUMAN	S	109;106	ENSP00000292401:N109S;ENSP00000396093:N106S	ENSP00000292401:N109S	N	-	2	0	AZGP1	99407316	0.949000	0.32298	0.733000	0.30861	0.035000	0.12851	1.269000	0.33074	0.933000	0.37291	0.260000	0.18958	AAC	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a		0.527	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZGP1	protein_coding	OTTHUMT00000059387.4	T	NM_001185	-		99569380	-1	no_errors	ENST00000292401	ensembl	human	known	74_37	missense	SNP	0.932	C
EVPL	2125	genome.wustl.edu	37	17	74017594	74017594	+	Silent	SNP	A	A	G	rs193119748	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:74017594A>G	ENST00000301607.3	-	9	1219	c.966T>C	c.(964-966)tgT>tgC	p.C322C	EVPL_ENST00000586740.1_Silent_p.C322C	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	322	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCTGGCAGATACACAGGTTCA	0.721																																																	0								ENSG00000167880						29.0	26.0	27.0					17																	74017594		2202	4299	6501	EVPL	SO:0001819	synonymous_variant	0			-	HGNC	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.966T>C	17.37:g.74017594A>G		Somatic	0	19	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	11	38.89	A0AUV5	Silent	SNP	16	0.00	0	27	0.00	0	pfam_Plectin_repeat,superfamily_Ferritin-like_SF,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.C322	ENST00000301607.3	37	c.966	CCDS11737.1	17																																																																																			-	smart_Spectrin/alpha-actinin		0.721	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	protein_coding	OTTHUMT00000449483.1	A	NM_001988	rs193119748		74017594	-1	no_errors	ENST00000301607	ensembl	human	known	74_37	silent	SNP	1.000	G
CR1	1378	genome.wustl.edu	37	1	207726288	207726289	+	Intron	INS	-	-	T	rs557359271	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:207726288_207726289insT	ENST00000367049.4	+	19	3101				CR1_ENST00000367051.1_Intron|RP11-78B10.2_ENST00000439443.1_RNA|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000367050.4_Intron|CR1_ENST00000367052.1_Intron|CR1_ENST00000367053.1_Intron|CR1_ENST00000400960.2_Intron	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)						complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AGGCTATTGCCACCTGCTCTTA	0.441													-|-|T|insertion	866	0.172923	0.1029	0.1614	5008	,	,		18024	0.2183		0.1044	False		,,,				2504	0.2996																0								ENSG00000236911																																			RP11-78B10.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.3101+92->T	1.37:g.207726288_207726289insT		Somatic	0	11	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	10	28.57	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	RNA	INS	3	0.00	0	11	31.25	5	-	NULL	ENST00000367049.4	37	NULL	CCDS44308.1	1																																																																																			-	-		0.441	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000236911	protein_coding	OTTHUMT00000382527.1	-	NM_000573			207726289	-1	no_errors	ENST00000439443	ensembl	human	known	74_37	rna	INS	0.000:0.000	T
FLNA	2316	genome.wustl.edu	37	X	153588251	153588251	+	Silent	SNP	A	A	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chrX:153588251A>T	ENST00000369850.3	-	23	4064	c.3828T>A	c.(3826-3828)acT>acA	p.T1276T	FLNA_ENST00000344736.4_Silent_p.T1276T|FLNA_ENST00000360319.4_Silent_p.T1276T|FLNA_ENST00000422373.1_Silent_p.T1276T|FLNA_ENST00000369856.3_5'Flank	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1276					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CACTGAACTCAGTGGTGGCCT	0.657																																																	0								ENSG00000196924						43.0	45.0	44.0					X																	153588251		2000	4130	6130	FLNA	SO:0001819	synonymous_variant	0			-	HGNC	X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.3828T>A	X.37:g.153588251A>T		Somatic	0	50	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	45	31.82	E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	10	0.00	0	15	42.31	11	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.T1276	ENST00000369850.3	37	c.3828	CCDS48194.1	X																																																																																			-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.657	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	protein_coding	OTTHUMT00000058942.3	A		-		153588251	-1	no_errors	ENST00000369850	ensembl	human	known	74_37	silent	SNP	0.136	T
ZSCAN29	146050	genome.wustl.edu	37	15	43656522	43656522	+	Silent	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr15:43656522C>T	ENST00000396976.2	-	4	1415	c.1281G>A	c.(1279-1281)caG>caA	p.Q427Q	ZSCAN29_ENST00000568898.1_Intron|ZSCAN29_ENST00000396972.1_Intron|ZSCAN29_ENST00000562072.1_Silent_p.Q426Q	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	427					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		CTTCATAAAACTGGGTCTCAC	0.493																																																	0								ENSG00000140265						89.0	85.0	86.0					15																	43656522		2201	4299	6500	ZSCAN29	SO:0001819	synonymous_variant	0			-	HGNC	AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.1281G>A	15.37:g.43656522C>T		Somatic	0	78	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	79	14.89	B3KVB9|Q32M75|Q32M76|Q8NA40	Silent	SNP	30	0.00	0	48	18.64	11	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q427	ENST00000396976.2	37	c.1281	CCDS10095.2	15																																																																																			-	NULL		0.493	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN29	protein_coding	OTTHUMT00000253278.1	C	NM_152455	-		43656522	-1	no_errors	ENST00000396976	ensembl	human	known	74_37	silent	SNP	1.000	T
PFAS	5198	genome.wustl.edu	37	17	8167128	8167128	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:8167128G>A	ENST00000314666.6	+	15	1798	c.1665G>A	c.(1663-1665)tgG>tgA	p.W555*	PFAS_ENST00000585319.1_3'UTR|PFAS_ENST00000545834.1_Nonsense_Mutation_p.W131*	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	555					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TGGAAATCTGGGGGGCTGAGT	0.602																																																	0								ENSG00000178921						68.0	69.0	69.0					17																	8167128		2203	4300	6503	PFAS	SO:0001587	stop_gained	0			-	HGNC	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.1665G>A	17.37:g.8167128G>A	ENSP00000313490:p.Trp555*	Somatic	0	77	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	68	21.59	A6H8V8	Nonsense_Mutation	SNP	25	0.00	0	38	26.92	14	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_PurM_N-like,superfamily_AIR_synth_C_dom,tigrfam_PRibForGlyAmidine_synth	p.W555*	ENST00000314666.6	37	c.1665	CCDS11136.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.904652	0.98554	.	.	ENSG00000178921	ENST00000545834;ENST00000314666	.	.	.	5.84	5.84	0.93424	.	0.063315	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.304	17.6372	0.88125	0.0:0.0:1.0:0.0	.	.	.	.	X	131;555	.	ENSP00000313490:W555X	W	+	3	0	PFAS	8107853	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.531000	0.90610	2.769000	0.95229	0.563000	0.77884	TGG	-	pfam_AIR_synth_C_dom,superfamily_AIR_synth_C_dom,tigrfam_PRibForGlyAmidine_synth		0.602	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFAS	protein_coding	OTTHUMT00000226994.2	G		-		8167128	+1	no_errors	ENST00000314666	ensembl	human	known	74_37	nonsense	SNP	1.000	A
FDPS	2224	genome.wustl.edu	37	1	155287648	155287648	+	Intron	SNP	T	T	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:155287648T>G	ENST00000356657.6	+	5	642				FDPS_ENST00000447866.1_Intron|FDPS_ENST00000368356.4_Intron|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000446880.1_RNA	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase						cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	agcaaaaCTATATACAGATAT	0.448																																																	0								ENSG00000225855																																			RUSC1-AS1	SO:0001627	intron_variant	0			-	HGNC	J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.481-84T>G	1.37:g.155287648T>G		Somatic	0	24	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	37	35.09	D3DV91|E9PCI9|Q96G29	RNA	SNP	31	0.00	0	27	42.55	20	-	NULL	ENST00000356657.6	37	NULL	CCDS1110.1	1																																																																																			-	-		0.448	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1-AS1	protein_coding	OTTHUMT00000039053.1	T	NM_002004	-		155287648	-1	no_errors	ENST00000446880	ensembl	human	known	74_37	rna	SNP	0.092	G
NCF4	4689	genome.wustl.edu	37	22	37266539	37266539	+	Missense_Mutation	SNP	A	A	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr22:37266539A>T	ENST00000248899.6	+	5	609	c.425A>T	c.(424-426)cAg>cTg	p.Q142L	CTA-833B7.2_ENST00000330602.2_RNA|NCF4_ENST00000397147.4_Missense_Mutation_p.Q142L|CTA-833B7.2_ENST00000431290.1_RNA	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	142					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	GACTCAGAGCAGGTGCCCCAG	0.647																																																	0								ENSG00000100365						83.0	75.0	78.0					22																	37266539		2203	4300	6503	NCF4	SO:0001583	missense	0			-	HGNC	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.425A>T	22.37:g.37266539A>T	ENSP00000248899:p.Gln142Leu	Somatic	0	30	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	23	25.81	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Missense_Mutation	SNP	26	0.00	0	20	31.03	9	pfam_Phox,pfam_SH3_domain,pfam_SH3_2,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain,prints_NCF_P40,prints_p67phox	p.Q142L	ENST00000248899.6	37	c.425	CCDS13934.1	22	.	.	.	.	.	.	.	.	.	.	a	18.22	3.576541	0.65878	.	.	ENSG00000100365	ENST00000447071;ENST00000248899;ENST00000397147	T;T;T	0.65916	-0.18;1.62;1.62	4.95	4.95	0.65309	Phox homologous domain (2);	0.391386	0.25786	N	0.028317	T	0.63046	0.2478	M	0.69823	2.125	0.47153	D	0.99933	P;P	0.51057	0.941;0.935	P;B	0.47402	0.546;0.348	T	0.61647	-0.7020	10	0.23302	T	0.38	-37.3348	9.2296	0.37428	0.9186:0.0:0.0814:0.0	.	142;142	A8K4F9;Q15080	.;NCF4_HUMAN	L	39;142;142	ENSP00000414958:Q39L;ENSP00000248899:Q142L;ENSP00000380334:Q142L	ENSP00000248899:Q142L	Q	+	2	0	NCF4	35596485	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	6.379000	0.73154	1.850000	0.53721	0.524000	0.50904	CAG	-	superfamily_Phox,prints_NCF_P40		0.647	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF4	protein_coding	OTTHUMT00000318863.1	A	NM_000631	-		37266539	+1	no_errors	ENST00000397147	ensembl	human	known	74_37	missense	SNP	1.000	T
AK2	204	genome.wustl.edu	37	1	33480148	33480148	+	Missense_Mutation	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:33480148G>T	ENST00000373449.2	-	5	514	c.473C>A	c.(472-474)cCt>cAt	p.P158H	AK2_ENST00000354858.6_Missense_Mutation_p.P158H|AK2_ENST00000467905.1_Missense_Mutation_p.P158H|RP1-117O3.2_ENST00000427524.1_RNA|AK2_ENST00000491241.1_5'Flank|AK2_ENST00000548033.1_Missense_Mutation_p.P116H|AK2_ENST00000480134.1_Silent_p.P126P	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CTCTTTTGGAGGGTTGAACTC	0.428																																																	0								ENSG00000004455						211.0	221.0	217.0					1																	33480148		2203	4300	6503	AK2	SO:0001583	missense	0			-	HGNC	U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.473C>A	1.37:g.33480148G>T	ENSP00000362548:p.Pro158His	Somatic	0	35	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51		Missense_Mutation	SNP	33	0.00	0	62	0.00	0	pfam_Adenylate_kin,pfam_Adenylate_kinase_lid-dom,superfamily_P-loop_NTPase,prints_Adenylate_kin,tigrfam_Adenyl_kin_sub	p.P158H	ENST00000373449.2	37	c.473	CCDS373.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.087857	0.94100	.	.	ENSG00000004455	ENST00000373449;ENST00000548033;ENST00000467905;ENST00000354858;ENST00000398192	D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86	5.12	5.12	0.69794	Adenylate kinase, active site lid domain (1);	0.000000	0.85682	D	0.000000	D	0.96710	0.8926	H	0.99927	4.965	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.98565	1.0643	10	0.87932	D	0	-18.2157	19.4503	0.94863	0.0:0.0:1.0:0.0	.	150;116;158;158	P54819-5;F8VY04;P54819;P54819-2	.;.;KAD2_HUMAN;.	H	158;116;158;158;158	ENSP00000362548:P158H;ENSP00000449003:P116H;ENSP00000447082:P158H;ENSP00000346921:P158H	ENSP00000346921:P158H	P	-	2	0	AK2	33252735	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.827000	0.99397	2.760000	0.94817	0.655000	0.94253	CCT	-	pfam_Adenylate_kin,pfam_Adenylate_kinase_lid-dom,superfamily_P-loop_NTPase,tigrfam_Adenyl_kin_sub		0.428	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AK2	protein_coding	OTTHUMT00000011884.1	G	NM_001625	-		33480148	-1	no_errors	ENST00000354858	ensembl	human	known	74_37	missense	SNP	1.000	T
GLS	2744	genome.wustl.edu	37	2	191745647	191745647	+	5'UTR	SNP	C	C	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr2:191745647C>G	ENST00000320717.3	+	0	95				GLS_ENST00000338435.4_5'UTR|AC005540.3_ENST00000413911.1_RNA	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase						cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	agcagcagcaCCCGCATCCGC	0.662																																																	0								ENSG00000235852																																			AC005540.3	SO:0001623	5_prime_UTR_variant	0			-	Clone_based_vega_gene	AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.-164C>G	2.37:g.191745647C>G		Somatic	0	8	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	8	30.77	Q9UL05|Q9UL06|Q9UL07|Q9UN40	RNA	SNP	15	15.79	3	26	16.13	5	-	NULL	ENST00000320717.3	37	NULL	CCDS2308.1	2																																																																																			-	-		0.662	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000235852	protein_coding	OTTHUMT00000255999.2	C		-		191745647	-1	no_errors	ENST00000413911	ensembl	human	known	74_37	rna	SNP	0.000	G
MT-ND1	4535	genome.wustl.edu	37	M	932	932	+	5'Flank	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chrM:932C>A	ENST00000361390.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TF_ENST00000387314.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	GTCAATAGAAGCCGGCGTAAA	0.428																																																	0								ENSG00000211459																																			MT-RNR1	SO:0001631	upstream_gene_variant	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.932C>A	Exception_encountered	Somatic	0	104	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	C0JKH6|Q37523	RNA	SNP	6603	0.11	7	1253	0.16	2	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			-	-		0.428	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	protein_coding		C	YP_003024026	-		932	+1	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	SNP	NULL	A
MUC3A	4584	genome.wustl.edu	37	7	100608194	100608195	+	Intron	INS	-	-	GTCTGGG			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr7:100608194_100608195insGTCTGGG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GTGGCCCCTCCACACTCCCCCA	0.614																																																	0								ENSG00000225946																																			RP11-395B7.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-112->GTCTGGG	7.37:g.100608194_100608195insGTCTGGG		Somatic	NA	NA	NA		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	32	11.11	4	20	13.04	3	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			-	-		0.614	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	protein_coding	OTTHUMT00000347215.1	-	XM_001725354			100608195	-1	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	INS	0.001:0.000	GTCTGGG
YTHDF3	253943	genome.wustl.edu	37	8	64100288	64100288	+	Silent	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr8:64100288G>A	ENST00000539294.1	+	4	2032	c.1716G>A	c.(1714-1716)gaG>gaA	p.E572E	YTHDF3_ENST00000521674.1_3'UTR|YTHDF3_ENST00000542911.2_Silent_p.E383E|YTHDF3_ENST00000517371.1_Intron	NM_001277817.1|NM_001277818.1|NM_152758.4	NP_001264746.1|NP_001264747.1|NP_689971.4	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3	573							N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			AAGAAGAGGAGGAAGCCATGC	0.378																																																	0								ENSG00000185728						23.0	21.0	21.0					8																	64100288		1834	4073	5907	YTHDF3	SO:0001819	synonymous_variant	0			-	HGNC	BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000539294.1:c.1716G>A	8.37:g.64100288G>A		Somatic	0	8	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	B3KXL4|Q63Z37|Q659A3	Silent	SNP	40	0.00	0	51	22.73	15	pfam_YTH_domain,pfscan_YTH_domain	p.E572	ENST00000539294.1	37	c.1716		8																																																																																			-	NULL		0.378	YTHDF3-201	KNOWN	basic|appris_principal	protein_coding	YTHDF3	protein_coding		G	NM_152758	-		64100288	+1	no_errors	ENST00000539294	ensembl	human	known	74_37	silent	SNP	1.000	A
WDR7	23335	genome.wustl.edu	37	18	54605777	54605777	+	Missense_Mutation	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:54605777C>T	ENST00000254442.3	+	24	4056	c.3845C>T	c.(3844-3846)aCg>aTg	p.T1282M	WDR7_ENST00000357574.3_Missense_Mutation_p.T1249M|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1282					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		CACAGACATACGGCTCTTGCA	0.348																																																	0								ENSG00000091157						92.0	85.0	87.0					18																	54605777		2203	4300	6503	WDR7	SO:0001583	missense	0			-	HGNC	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.3845C>T	18.37:g.54605777C>T	ENSP00000254442:p.Thr1282Met	Somatic	0	33	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	25	24.24	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	36	0.00	0	24	40.00	16	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T1282M	ENST00000254442.3	37	c.3845	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	C	14.63	2.591866	0.46214	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	T;T	0.42900	0.96;0.96	5.99	5.99	0.97316	.	0.095167	0.64402	D	0.000001	T	0.46889	0.1416	N	0.24115	0.695	0.42178	D	0.991674	D;D	0.64830	0.994;0.989	P;P	0.53861	0.736;0.548	T	0.45818	-0.9235	10	0.66056	D	0.02	.	20.0728	0.97731	0.0:1.0:0.0:0.0	.	1249;1282	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	M	1282;1249;607;1249	ENSP00000254442:T1282M;ENSP00000350187:T1249M	ENSP00000254442:T1282M	T	+	2	0	WDR7	52756775	1.000000	0.71417	0.270000	0.24601	0.307000	0.27823	5.935000	0.70145	2.840000	0.97914	0.655000	0.94253	ACG	-	superfamily_ARM-type_fold		0.348	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	protein_coding	OTTHUMT00000256062.1	C		-		54605777	+1	no_errors	ENST00000254442	ensembl	human	known	74_37	missense	SNP	0.951	T
ZNF610	162963	genome.wustl.edu	37	19	52869687	52869687	+	Silent	SNP	C	C	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr19:52869687C>G	ENST00000403906.3	+	6	1512	c.1056C>G	c.(1054-1056)gtC>gtG	p.V352V	ZNF610_ENST00000601151.1_Silent_p.V309V|ZNF610_ENST00000327920.8_Silent_p.V352V|ZNF610_ENST00000321287.8_Silent_p.V352V	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	352					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		GTGGCAAGGTCTTTAGTCTGC	0.418																																																	0								ENSG00000167554						89.0	90.0	90.0					19																	52869687		2203	4300	6503	ZNF610	SO:0001819	synonymous_variant	0			-	HGNC	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.1056C>G	19.37:g.52869687C>G		Somatic	0	22	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22	A8K4C3|Q86YH8|Q8NDS9	Silent	SNP	41	0.00	0	40	28.07	16	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V352	ENST00000403906.3	37	c.1056	CCDS12851.1	19																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	protein_coding	OTTHUMT00000462880.1	C	NM_173530	-		52869687	+1	no_errors	ENST00000321287	ensembl	human	known	74_37	silent	SNP	0.015	G
MIEF1	54471	genome.wustl.edu	37	22	39909888	39909888	+	Missense_Mutation	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr22:39909888C>T	ENST00000325301.2	+	6	1376	c.952C>T	c.(952-954)Ctc>Ttc	p.L318F	MIEF1_ENST00000404569.1_Missense_Mutation_p.L318F|MIEF1_ENST00000402881.1_Missense_Mutation_p.L318F	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	318					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)										ATCAGTGACCCTCGGTGACAC	0.622											OREG0026577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000100335						85.0	78.0	81.0					22																	39909888		2203	4300	6503	MIEF1	SO:0001583	missense	0			-	HGNC	AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.952C>T	22.37:g.39909888C>T	ENSP00000327124:p.Leu318Phe	Somatic	0	59	0.00	889	0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	47	24.19	Q7L890|Q9BUI3	Missense_Mutation	SNP	20	0.00	0	16	44.83	13	NULL	p.L318F	ENST00000325301.2	37	c.952	CCDS13995.1	22	.	.	.	.	.	.	.	.	.	.	C	12.93	2.085790	0.36758	.	.	ENSG00000100335	ENST00000402881;ENST00000325301;ENST00000404569	T;T;T	0.09445	2.98;2.98;2.98	6.07	5.04	0.67666	.	0.048280	0.85682	D	0.000000	T	0.15522	0.0374	L	0.40543	1.245	0.48452	D	0.999659	P;D	0.58268	0.78;0.982	B;P	0.57620	0.329;0.824	T	0.02950	-1.1090	10	0.09084	T	0.74	-14.4569	11.2099	0.48793	0.1265:0.8072:0.0:0.0663	.	318;318	Q9NQG6;B0QY95	MID51_HUMAN;.	F	318	ENSP00000385110:L318F;ENSP00000327124:L318F;ENSP00000385191:L318F	ENSP00000327124:L318F	L	+	1	0	SMCR7L	38239834	0.992000	0.36948	1.000000	0.80357	0.990000	0.78478	2.742000	0.47434	2.884000	0.98904	0.655000	0.94253	CTC	-	NULL		0.622	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEF1	protein_coding	OTTHUMT00000321325.1	C	NM_019008	-		39909888	+1	no_errors	ENST00000325301	ensembl	human	known	74_37	missense	SNP	1.000	T
MBL1P	8512	genome.wustl.edu	37	10	81664709	81664709	+	IGR	SNP	T	T	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr10:81664709T>G								NUTM2E (54077 upstream) : MBL1P (15224 downstream)																							GGTCTTTTTTTTCTGCCTTTT	0.592																																																	0								ENSG00000242600																																			MBL1P	SO:0001628	intergenic_variant	0			-	HGNC																													10.37:g.81664709T>G		Somatic	0	39	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	8	63.64		RNA	SNP	30	0.00	0	9	40.00	6	-	NULL		37	NULL		10																																																																																			-	-	0	0.592					MBL1P			T		-		81664709	+1	no_errors	ENST00000453174	ensembl	human	known	74_37	rna	SNP	0.047	G
IQCA1	79781	genome.wustl.edu	37	2	237374267	237374267	+	Missense_Mutation	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr2:237374267C>A	ENST00000409907.3	-	6	1081	c.807G>T	c.(805-807)aaG>aaT	p.K269N	IQCA1_ENST00000309507.5_Missense_Mutation_p.K265N|IQCA1_ENST00000431676.2_Missense_Mutation_p.K269N	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	269							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						CCTCTTCATGCTTTATCTGCA	0.463																																																	0								ENSG00000132321						160.0	147.0	151.0					2																	237374267		1963	4147	6110	IQCA1	SO:0001583	missense	0			-	HGNC	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.807G>T	2.37:g.237374267C>A	ENSP00000387347:p.Lys269Asn	Somatic	0	42	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	53	26.39	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	35	0.00	0	50	15.25	9	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	p.K269N	ENST00000409907.3	37	c.807	CCDS46549.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.74|12.74	2.027292|2.027292	0.35797|0.35797	.|.	.|.	ENSG00000132321|ENSG00000132321	ENST00000418802|ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437	.|D;D;D	.|0.94330	.|-3.28;-3.28;-3.4	5.37|5.37	3.54|3.54	0.40534|0.40534	.|.	.|0.583249	.|0.16413	.|N	.|0.215498	D|D	0.90518|0.90518	0.7029|0.7029	L|L	0.54323|0.54323	1.7|1.7	0.27653|0.27653	N|N	0.947319|0.947319	.|B;B;B	.|0.30326	.|0.036;0.276;0.061	.|B;B;B	.|0.35278	.|0.011;0.199;0.017	D|D	0.84641|0.84641	0.0695|0.0695	5|10	.|0.48119	.|T	.|0.1	.|.	7.1246|7.1246	0.25465|0.25465	0.0:0.656:0.0:0.344|0.0:0.656:0.0:0.344	.|.	.|269;276;269	.|E7EWQ0;E9PH78;Q86XH1	.|.;.;IQCA1_HUMAN	S|N	288|269;276;265;269;265	.|ENSP00000387347:K269N;ENSP00000311951:K265N;ENSP00000407213:K269N	.|ENSP00000254653:K269N	A|K	-|-	1|3	0|2	IQCA1|IQCA1	237039006|237039006	0.874000|0.874000	0.30092|0.30092	0.347000|0.347000	0.25668|0.25668	0.037000|0.037000	0.13140|0.13140	0.926000|0.926000	0.28804|0.28804	1.236000|1.236000	0.43740|0.43740	0.563000|0.563000	0.77884|0.77884	GCA|AAG	-	NULL		0.463	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	protein_coding	OTTHUMT00000329266.1	C	NM_024726	-		237374267	-1	no_errors	ENST00000409907	ensembl	human	known	74_37	missense	SNP	0.787	A
ZNF519	162655	genome.wustl.edu	37	18	14132371	14132371	+	5'UTR	SNP	T	T	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:14132371T>A	ENST00000590202.1	-	0	58				ZNF519_ENST00000589498.1_5'UTR|ZNF519_ENST00000589203.1_5'UTR	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519						negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						ATCACCGAAGTCTCCCGGAGC	0.577																																																	0								ENSG00000175322						30.0	28.0	29.0					18																	14132371		692	1591	2283	ZNF519	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.-95A>T	18.37:g.14132371T>A		Somatic	0	50	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	40	32.20		RNA	SNP	22	0.00	0	35	27.08	13	-	NULL	ENST00000590202.1	37	NULL	CCDS32797.1	18																																																																																			-	-		0.577	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	protein_coding	OTTHUMT00000459037.1	T	NM_145287	-		14132371	-1	no_errors	ENST00000586507	ensembl	human	known	74_37	rna	SNP	0.003	A
CSMD1	64478	genome.wustl.edu	37	8	3266956	3266956	+	Missense_Mutation	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr8:3266956G>T	ENST00000520002.1	-	14	2291	c.1736C>A	c.(1735-1737)cCc>cAc	p.P579H	CSMD1_ENST00000602557.1_Missense_Mutation_p.P579H|CSMD1_ENST00000400186.3_Missense_Mutation_p.P579H|CSMD1_ENST00000539096.1_Missense_Mutation_p.P578H|CSMD1_ENST00000542608.1_Missense_Mutation_p.P578H|CSMD1_ENST00000602723.1_Missense_Mutation_p.P579H|CSMD1_ENST00000537824.1_Missense_Mutation_p.P578H			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	579	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TACACAGCTGGGCTTGTTGCC	0.522																																																	0								ENSG00000183117						49.0	50.0	50.0					8																	3266956		1974	4167	6141	CSMD1	SO:0001583	missense	0			-	HGNC			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.1736C>A	8.37:g.3266956G>T	ENSP00000430733:p.Pro579His	Somatic	0	53	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	41	24.07	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	30	0.00	0	35	23.91	11	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P579H	ENST00000520002.1	37	c.1736		8	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765743	0.90020	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11	5.26	5.26	0.73747	.	0.000000	0.64402	D	0.000001	D	0.93245	0.7848	H	0.98388	4.22	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.95870	0.8890	10	0.87932	D	0	.	18.8659	0.92292	0.0:0.0:1.0:0.0	.	579	E5RIG2	.	H	579;579;441;578;578;578	ENSP00000383047:P579H;ENSP00000430733:P579H;ENSP00000441462:P578H;ENSP00000446243:P578H;ENSP00000441675:P578H	ENSP00000320445:P441H	P	-	2	0	CSMD1	3254363	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.549000	0.98106	2.443000	0.82685	0.573000	0.79308	CCC	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.522	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	protein_coding	OTTHUMT00000374500.2	G	NM_033225	-		3266956	-1	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	SNP	1.000	T
ANKRD20A19P	400110	genome.wustl.edu	37	13	24519966	24519966	+	RNA	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr13:24519966C>T	ENST00000442969.1	-	0	955									ankyrin repeat domain 20 family, member A19, pseudogene																		CCTTGACAGCCGCCCTTGGAT	0.697																																																	0								ENSG00000196593						9.0	11.0	11.0					13																	24519966		691	1590	2281	ANKRD20A19P			0			-	HGNC			13q12.12	2012-10-16			ENSG00000196593	ENSG00000196593			42737	pseudogene	pseudogene							Standard	NR_073430		Approved		uc001upb.2		OTTHUMG00000016572		13.37:g.24519966C>T		Somatic	0	120	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	52	45.83		RNA	SNP	29	0.00	0	19	48.65	18	-	NULL	ENST00000442969.1	37	NULL		13																																																																																			-	-		0.697	ANKRD20A19P-001	KNOWN	basic	processed_transcript	ANKRD20A19P	pseudogene	OTTHUMT00000044167.2	C		-		24519966	-1	no_errors	ENST00000420143	ensembl	human	known	74_37	rna	SNP	0.092	T
RB1	5925	genome.wustl.edu	37	13	48953730	48953730	+	Splice_Site	SNP	C	C	T	rs3092891	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr13:48953730C>T	ENST00000267163.4	+	14	1471	c.1333C>T	c.(1333-1335)Cga>Tga	p.R445*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	445	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.R445*(2)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTGTTTGTAGCGATACAAACT	0.333		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	25	Whole gene deletion(15)|Unknown(8)|Substitution - Nonsense(2)	bone(11)|breast(5)|eye(3)|central_nervous_system(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	GRCh37	CM900192|CX011720	RB1	M|X	rs3092891	ENSG00000139687						18.0	19.0	19.0					13																	48953730		2200	4300	6500	RB1	SO:0001630	splice_region_variant	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1333-1C>T	13.37:g.48953730C>T		Somatic	0	52	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	12	76.00	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	33	0.00	0	6	77.78	21	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R445*	ENST00000267163.4	37	c.1333	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	38	7.075321	0.98048	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.74	4.88	0.63580	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7109	0.62667	0.3973:0.6027:0.0:0.0	rs3092891;rs3092891	.	.	.	X	424;445	.	.	R	+	1	2	RB1	47851731	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.278000	0.43426	1.383000	0.46405	0.557000	0.71058	CGA	-	pfam_RB_A,superfamily_Cyclin-like		0.333	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	C		rs3092891	Nonsense_Mutation	48953730	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ZNF644	84146	genome.wustl.edu	37	1	91404037	91404037	+	Missense_Mutation	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:91404037C>A	ENST00000370440.1	-	3	3091	c.2874G>T	c.(2872-2874)ttG>ttT	p.L958F	ZNF644_ENST00000337393.5_Missense_Mutation_p.L958F|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	958					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TCTCAAGAGACAAATCAGTCC	0.398																																																	0								ENSG00000122482						74.0	66.0	69.0					1																	91404037		2203	4299	6502	ZNF644	SO:0001583	missense	0			-	HGNC	AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.2874G>T	1.37:g.91404037C>A	ENSP00000359469:p.Leu958Phe	Somatic	0	28	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	32	3.03	1	76	11.63	10	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L958F	ENST00000370440.1	37	c.2874	CCDS731.1	1	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729856	0.48833	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000536941	T;T	0.00856	5.61;5.61	5.84	4.92	0.64577	.	0.000000	0.64402	D	0.000001	T	0.01489	0.0048	L	0.34521	1.04	0.49915	D	0.99983	D	0.89917	1.0	D	0.80764	0.994	T	0.69165	-0.5217	10	0.66056	D	0.02	-4.2518	12.5795	0.56383	0.0:0.8695:0.0:0.1305	.	958	Q9H582	ZN644_HUMAN	F	958;958;530	ENSP00000359469:L958F;ENSP00000337008:L958F	ENSP00000337008:L958F	L	-	3	2	ZNF644	91176625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.336000	0.33850	2.779000	0.95612	0.591000	0.81541	TTG	-	NULL		0.398	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	protein_coding	OTTHUMT00000027846.2	C	NM_032186	-		91404037	-1	no_errors	ENST00000337393	ensembl	human	known	74_37	missense	SNP	1.000	A
CDK13	8621	genome.wustl.edu	37	7	40134028	40134028	+	Missense_Mutation	SNP	G	G	A	rs527978475		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr7:40134028G>A	ENST00000181839.4	+	14	4593	c.3988G>A	c.(3988-3990)Gtg>Atg	p.V1330M	CDK13_ENST00000340829.5_Missense_Mutation_p.V1270M	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1330					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						AGACACTTACGTGTCCACTTC	0.493																																																	0								ENSG00000065883						171.0	165.0	167.0					7																	40134028		2203	4300	6503	CDK13	SO:0001583	missense	0			-	HGNC	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.3988G>A	7.37:g.40134028G>A	ENSP00000181839:p.Val1330Met	Somatic	0	52	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Missense_Mutation	SNP	29	0.00	0	50	18.03	11	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V1330M	ENST00000181839.4	37	c.3988	CCDS5461.1	7	.	.	.	.	.	.	.	.	.	.	G	6.937	0.542561	0.13250	.	.	ENSG00000065883	ENST00000181839;ENST00000340829	T;T	0.70164	-0.44;-0.46	5.54	4.66	0.58398	.	.	.	.	.	T	0.52191	0.1719	L	0.36672	1.1	0.09310	N	1	B;B	0.24675	0.109;0.066	B;B	0.14578	0.011;0.005	T	0.37384	-0.9708	8	.	.	.	-1.7932	7.4497	0.27231	0.1457:0.1372:0.717:0.0	.	1270;1330	Q14004-2;Q14004	.;CDK13_HUMAN	M	1330;1270	ENSP00000181839:V1330M;ENSP00000340557:V1270M	.	V	+	1	0	CDK13	40100553	0.791000	0.28800	0.284000	0.24805	0.873000	0.50193	3.291000	0.51764	1.342000	0.45619	0.655000	0.94253	GTG	-	NULL		0.493	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK13	protein_coding	OTTHUMT00000250726.2	G	NM_003718	-		40134028	+1	no_errors	ENST00000181839	ensembl	human	known	74_37	missense	SNP	0.109	A
CCDC130	81576	genome.wustl.edu	37	19	13869915	13869915	+	Splice_Site	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr19:13869915G>T	ENST00000586600.1	+	9	905	c.402G>T	c.(400-402)gaG>gaT	p.E134D	CCDC130_ENST00000587019.1_3'UTR|CCDC130_ENST00000221554.8_Splice_Site_p.E134D			P13994	CC130_HUMAN	coiled-coil domain containing 130	134					response to virus (GO:0009615)					endometrium(2)|kidney(1)|large_intestine(3)|ovary(1)|skin(2)|urinary_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(19;6.02e-23)|Epithelial(5;2.58e-18)			TCGTTGCAGAGCATGAGAAGA	0.657																																																	0								ENSG00000104957						25.0	26.0	25.0					19																	13869915		2203	4298	6501	CCDC130	SO:0001630	splice_region_variant	0			-	HGNC	AF250306	CCDS12296.1	19p13.13	2008-02-05				ENSG00000104957			28118	protein-coding gene	gene with protein product						3203696	Standard	NM_030818		Approved	MGC10471	uc002mxc.1	P13994		ENST00000586600.1:c.401-1G>T	19.37:g.13869915G>T		Somatic	0	47	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q9BQ72	Missense_Mutation	SNP	27	0.00	0	39	0.00	0	pfam_CWC16	p.E134D	ENST00000586600.1	37	c.402	CCDS12296.1	19	.	.	.	.	.	.	.	.	.	.	G	9.969	1.224824	0.22457	.	.	ENSG00000104957	ENST00000221554	T	0.32753	1.44	5.27	2.01	0.26516	.	0.000000	0.85682	D	0.000000	T	0.20210	0.0486	L	0.41573	1.285	0.80722	D	1	B;B	0.23937	0.053;0.094	B;B	0.25291	0.059;0.04	T	0.06734	-1.0810	10	0.13108	T	0.6	.	7.1288	0.25488	0.3576:0.0:0.6424:0.0	.	134;134	B3KUZ1;P13994	.;CC130_HUMAN	D	134	ENSP00000221554:E134D	ENSP00000221554:E134D	E	+	3	2	CCDC130	13730915	1.000000	0.71417	0.993000	0.49108	0.620000	0.37586	1.403000	0.34612	0.242000	0.21303	-0.254000	0.11334	GAG	-	pfam_CWC16		0.657	CCDC130-001	KNOWN	alternative_5_UTR|upstream_uORF|basic|appris_principal|CCDS	protein_coding	CCDC130	protein_coding	OTTHUMT00000453216.2	G	NM_030818	-	Missense_Mutation	13869915	+1	no_errors	ENST00000221554	ensembl	human	known	74_37	missense	SNP	1.000	T
UGP2	7360	genome.wustl.edu	37	2	64109736	64109736	+	Missense_Mutation	SNP	G	G	T	rs533756550		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr2:64109736G>T	ENST00000337130.5	+	4	868	c.392G>T	c.(391-393)gGt>gTt	p.G131V	UGP2_ENST00000445915.2_Missense_Mutation_p.G140V|UGP2_ENST00000394417.2_Missense_Mutation_p.G120V|UGP2_ENST00000487469.1_3'UTR|UGP2_ENST00000467648.2_Missense_Mutation_p.G120V|ACA59_ENST00000515966.1_RNA	NM_006759.3	NP_006750.3	Q16851	UGPA_HUMAN	UDP-glucose pyrophosphorylase 2	131					carbohydrate metabolic process (GO:0005975)|cellular glucuronidation (GO:0052695)|glucose 1-phosphate metabolic process (GO:0019255)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|small molecule metabolic process (GO:0044281)|UDP-glucose metabolic process (GO:0006011)|UDP-glucuronate biosynthetic process (GO:0006065)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	glucose binding (GO:0005536)|metal ion binding (GO:0046872)|pyrimidine ribonucleotide binding (GO:0032557)|UTP:glucose-1-phosphate uridylyltransferase activity (GO:0003983)			endometrium(2)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)	18						AGTCTGATTGGTGTGAGGAAT	0.393																																																	0								ENSG00000169764						140.0	142.0	141.0					2																	64109736		2203	4300	6503	UGP2	SO:0001583	missense	0			-	HGNC		CCDS1875.1, CCDS42690.1	2p14-p13	2012-10-02			ENSG00000169764	ENSG00000169764	2.7.7.9		12527	protein-coding gene	gene with protein product		191760	"""UDP-glucose pyrophosphorylase 1"""	UGP1			Standard	NM_006759		Approved	UGPP1	uc002scm.3	Q16851	OTTHUMG00000129513	ENST00000337130.5:c.392G>T	2.37:g.64109736G>T	ENSP00000338703:p.Gly131Val	Somatic	0	41	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	Q07131|Q0P6K2|Q86Y81|Q9BU15	Missense_Mutation	SNP	31	0.00	0	53	0.00	0	pfam_UDPGP_trans,pirsf_UDPGP_trans_subgr	p.G131V	ENST00000337130.5	37	c.392	CCDS1875.1	2	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210162	0.79240	.	.	ENSG00000169764	ENST00000394417;ENST00000467648;ENST00000337130;ENST00000488245;ENST00000497883;ENST00000445915;ENST00000475462;ENST00000491621;ENST00000472047	T;T;T;T;T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25;2.25	5.95	5.95	0.96441	.	0.041877	0.85682	D	0.000000	T	0.12178	0.0296	N	0.08118	0	0.80722	D	1	P;B	0.34909	0.475;0.336	B;B	0.33121	0.158;0.158	T	0.15065	-1.0450	10	0.52906	T	0.07	-0.8915	20.3931	0.98965	0.0:0.0:1.0:0.0	.	140;131	E7EUC7;Q16851	.;UGPA_HUMAN	V	120;120;131;120;123;140;120;120;120	ENSP00000377939:G120V;ENSP00000420793:G120V;ENSP00000338703:G131V;ENSP00000419442:G120V;ENSP00000420131:G123V;ENSP00000411803:G140V;ENSP00000419335:G120V;ENSP00000420342:G120V;ENSP00000419238:G120V	ENSP00000338703:G131V	G	+	2	0	UGP2	63963240	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.824000	0.97209	0.655000	0.94253	GGT	-	pfam_UDPGP_trans,pirsf_UDPGP_trans_subgr		0.393	UGP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGP2	protein_coding	OTTHUMT00000251688.1	G	NM_006759	-		64109736	+1	no_errors	ENST00000337130	ensembl	human	known	74_37	missense	SNP	1.000	T
COL6A5	256076	genome.wustl.edu	37	3	130187932	130187932	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr3:130187932G>A	ENST00000432398.2	+	38	7578	c.7084G>A	c.(7084-7086)Gtt>Att	p.V2362I	COL6A5_ENST00000265379.6_Missense_Mutation_p.V2362I	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2362	Nonhelical region.|VWFA 10. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						ATTTGATTTGGTTACTTATAA	0.443																																																	0								ENSG00000172752						77.0	72.0	73.0					3																	130187932		1961	4135	6096	COL6A5	SO:0001583	missense	0			-	HGNC	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.7084G>A	3.37:g.130187932G>A	ENSP00000390895:p.Val2362Ile	Somatic	0	33	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	17	52.78	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	31	0.00	0	27	41.30	19	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.V2362I	ENST00000432398.2	37	c.7084		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.083|2.083	-0.410308|-0.410308	0.04799|0.04799	.|.	.|.	ENSG00000172752|ENSG00000172752	ENST00000512836|ENST00000432398;ENST00000265379;ENST00000373157;ENST00000512482	.|T;T;T;T	.|0.13538	.|2.58;2.58;2.58;2.58	5.35|5.35	-6.19|-6.19	0.02078|0.02078	.|von Willebrand factor, type A (3);	.|0.804236	.|0.10560	.|N	.|0.660409	T|T	0.06826|0.06826	0.0174|0.0174	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	.|B;B	.|0.17038	.|0.02;0.007	.|B;B	.|0.20384	.|0.029;0.011	T|T	0.39143|0.39143	-0.9628|-0.9628	5|10	.|0.20519	.|T	.|0.43	.|.	7.2781|7.2781	0.26296|0.26296	0.3315:0.4103:0.2582:0.0|0.3315:0.4103:0.2582:0.0	.|.	.|2362;2362	.|A8TX70;A8TX70-2	.|CO6A5_HUMAN;.	D|I	613|2362;2362;305;197	.|ENSP00000390895:V2362I;ENSP00000265379:V2362I;ENSP00000362250:V305I;ENSP00000424968:V197I	.|ENSP00000265379:V2362I	G|V	+|+	2|1	0|0	COL6A5|COL6A5	131670622|131670622	0.000000|0.000000	0.05858|0.05858	0.027000|0.027000	0.17364|0.17364	0.158000|0.158000	0.22134|0.22134	-0.591000|-0.591000	0.05753|0.05753	-1.479000|-1.479000	0.01867|0.01867	-0.175000|-0.175000	0.13238|0.13238	GGT|GTT	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.443	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	protein_coding		G	NM_153264	-		130187932	+1	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	SNP	0.059	A
C1QTNF9	338872	genome.wustl.edu	37	13	24889933	24889933	+	Intron	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr13:24889933C>T	ENST00000382071.2	+	2	63				C1QTNF9-AS1_ENST00000449656.1_RNA|RP11-307N16.6_ENST00000382141.4_Intron|C1QTNF9_ENST00000332018.4_Intron			P0C862	C1T9A_HUMAN	C1q and tumor necrosis factor related protein 9							collagen trimer (GO:0005581)|extracellular region (GO:0005576)				endometrium(1)|kidney(2)|lung(6)	9		all_cancers(29;3.55e-20)|all_epithelial(30;4.25e-17)|all_lung(29;1.04e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.00565)|Epithelial(112;0.027)|OV - Ovarian serous cystadenocarcinoma(117;0.115)|Lung(94;0.159)		GTGTTACCTTCCAAGGACAGT	0.478																																																	0								ENSG00000240868																																			C1QTNF9-AS1	SO:0001627	intron_variant	0			-	HGNC	BC040438	CCDS9306.1	13q12.12	2010-08-18			ENSG00000240654	ENSG00000240654			28732	protein-coding gene	gene with protein product		614285				12975309, 18787108	Standard	NM_178540		Approved	MGC48915, CTRP9, C1QTNF9A, AQL1	uc001upj.3	P0C862	OTTHUMG00000016576	ENST00000382071.2:c.-22-187C>T	13.37:g.24889933C>T		Somatic	0	11	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	5	50.00	A2A3T6|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	RNA	SNP	36	0.00	0	39	44.29	31	-	NULL	ENST00000382071.2	37	NULL	CCDS9306.1	13																																																																																			-	-		0.478	C1QTNF9-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1QTNF9-AS1	protein_coding	OTTHUMT00000044177.1	C	NM_178540	-		24889933	-1	no_errors	ENST00000449656	ensembl	human	known	74_37	rna	SNP	0.000	T
FAR2P1	440905	genome.wustl.edu	37	2	130807609	130807609	+	RNA	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr2:130807609G>T	ENST00000325390.3	-	0	1095					NR_026758.1																						CCGGGGAGGGGTAGGTACCAA	0.532																																																	0								ENSG00000180178																																			AC018865.8			0			-	Clone_based_vega_gene																													2.37:g.130807609G>T		Somatic	0	67	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	47	22.95		RNA	SNP	14	0.00	0	13	27.78	5	-	NULL	ENST00000325390.3	37	NULL		2																																																																																			-	-		0.532	AC018865.8-002	KNOWN	basic	processed_transcript	LOC440905	pseudogene	OTTHUMT00000331630.3	G		-		130807609	-1	no_errors	ENST00000325390	ensembl	human	known	74_37	rna	SNP	0.026	T
NADSYN1	55191	genome.wustl.edu	37	11	71164372	71164372	+	Silent	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:71164372C>T	ENST00000319023.2	+	1	218	c.30C>T	c.(28-30)tgC>tgT	p.C10C	RP11-660L16.2_ENST00000529369.1_RNA	NM_018161.4	NP_060631.2	Q6IA69	NADE_HUMAN	NAD synthetase 1	10	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				NAD biosynthetic process (GO:0009435)|NAD metabolic process (GO:0019674)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)|NAD+ synthase (glutamine-hydrolyzing) activity (GO:0003952)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	25					L-Glutamine(DB00130)	TGGCCACCTGCGCACTCAACC	0.667																																					Ovarian(79;763 1781 6490 50276)												0								ENSG00000172890						38.0	37.0	38.0					11																	71164372		2200	4293	6493	NADSYN1	SO:0001819	synonymous_variant	0			-	HGNC	AB091316	CCDS8201.1	11q13.4	2008-02-05				ENSG00000172890			29832	protein-coding gene	gene with protein product		608285				12547821	Standard	NM_018161		Approved	FLJ10631	uc001oqn.3	Q6IA69		ENST00000319023.2:c.30C>T	11.37:g.71164372C>T		Somatic	0	63	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	80	29.57	B3KUU4|Q86SN2|Q9HA25|Q9NVM8	Silent	SNP	29	0.00	0	34	27.66	13	pfam_C-N_Hydrolase,pfam_NAD/GMP_synthase,superfamily_C-N_Hydrolase,pirsf_Gln-dep_NAD_synthase,pfscan_C-N_Hydrolase,tigrfam_NAD_synthase	p.C10	ENST00000319023.2	37	c.30	CCDS8201.1	11																																																																																			-	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Gln-dep_NAD_synthase,pfscan_C-N_Hydrolase		0.667	NADSYN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NADSYN1	protein_coding	OTTHUMT00000394356.1	C	NM_018161	-		71164372	+1	no_errors	ENST00000319023	ensembl	human	known	74_37	silent	SNP	1.000	T
LDLRAP1	26119	genome.wustl.edu	37	1	25883732	25883732	+	Missense_Mutation	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:25883732G>T	ENST00000374338.4	+	4	552	c.433G>T	c.(433-435)Gcc>Tcc	p.A145S	LDLRAP1_ENST00000488127.1_3'UTR	NM_015627.2	NP_056442.2	Q5SW96	ARH_HUMAN	low density lipoprotein receptor adaptor protein 1	145	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				amyloid precursor protein metabolic process (GO:0042982)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|positive regulation of cholesterol metabolic process (GO:0090205)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of signal transduction (GO:0009967)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein binding (GO:0043393)|transport (GO:0006810)	axon (GO:0030424)|basal plasma membrane (GO:0009925)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|neurofilament (GO:0005883)|recycling endosome (GO:0055037)	AP-2 adaptor complex binding (GO:0035612)|beta-amyloid binding (GO:0001540)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphotyrosine binding (GO:0001784)|receptor signaling complex scaffold activity (GO:0030159)|signaling adaptor activity (GO:0035591)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)|urinary_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.63e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|GBM - Glioblastoma multiforme(114;0.00914)|READ - Rectum adenocarcinoma(331;0.0649)		CGAGTGCCACGCCTTCCTCTG	0.617																																																	0								ENSG00000157978						98.0	74.0	82.0					1																	25883732		2203	4300	6503	LDLRAP1	SO:0001583	missense	0			-	HGNC	BC029770	CCDS30639.1	1p36-p35	2014-09-17			ENSG00000157978	ENSG00000157978			18640	protein-coding gene	gene with protein product		605747					Standard	NM_015627		Approved	ARH, ARH2, FHCB1, FHCB2, MGC34705, DKFZp586D0624	uc001bkl.4	Q5SW96	OTTHUMG00000007386	ENST00000374338.4:c.433G>T	1.37:g.25883732G>T	ENSP00000363458:p.Ala145Ser	Somatic	0	41	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A2BHI5|Q6TQS9|Q8N2Y0|Q9UFI9	Missense_Mutation	SNP	24	0.00	0	41	0.00	0	pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pfscan_PTB/PI_dom	p.A145S	ENST00000374338.4	37	c.433	CCDS30639.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.622766	0.96660	.	.	ENSG00000157978	ENST00000374338	T	0.20200	2.09	5.61	5.61	0.85477	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.44350	0.1289	M	0.79123	2.44	0.80722	D	1	D	0.56746	0.977	P	0.56648	0.803	T	0.31110	-0.9955	10	0.46703	T	0.11	-24.9807	18.6267	0.91342	0.0:0.0:1.0:0.0	.	145	Q5SW96	ARH_HUMAN	S	145	ENSP00000363458:A145S	ENSP00000363458:A145S	A	+	1	0	LDLRAP1	25756319	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	9.452000	0.97615	2.648000	0.89879	0.563000	0.77884	GCC	-	pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pfscan_PTB/PI_dom		0.617	LDLRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAP1	protein_coding	OTTHUMT00000019350.3	G	NM_015627	-		25883732	+1	no_errors	ENST00000374338	ensembl	human	known	74_37	missense	SNP	1.000	T
OR5AP2	338675	genome.wustl.edu	37	11	56409671	56409671	+	Missense_Mutation	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:56409671G>A	ENST00000302981.1	-	1	244	c.245C>T	c.(244-246)tCc>tTc	p.S82F	OR5AP2_ENST00000544374.1_Missense_Mutation_p.S83F	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						GGGAGTGACGGAAGAAGAGTA	0.458																																																	0								ENSG00000172464						61.0	62.0	62.0					11																	56409671		2201	4296	6497	OR5AP2	SO:0001583	missense	0			-	HGNC	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.245C>T	11.37:g.56409671G>A	ENSP00000303111:p.Ser82Phe	Somatic	0	28	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	15	34.78	B2RNM8	Missense_Mutation	SNP	35	0.00	0	24	36.84	14	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S83F	ENST00000302981.1	37	c.248	CCDS31534.1	11	.	.	.	.	.	.	.	.	.	.	G	14.44	2.536290	0.45176	.	.	ENSG00000172464	ENST00000544374;ENST00000302981	T;T	0.00428	7.44;7.44	4.97	4.06	0.47325	GPCR, rhodopsin-like superfamily (1);	0.292311	0.24942	N	0.034365	T	0.00412	0.0013	L	0.54908	1.71	0.09310	N	1	P	0.47604	0.898	P	0.44477	0.451	T	0.52087	-0.8622	10	0.87932	D	0	.	7.9236	0.29861	0.2475:0.0:0.7525:0.0	.	82	Q8NGF4	O5AP2_HUMAN	F	83;82	ENSP00000442701:S83F;ENSP00000303111:S82F	ENSP00000303111:S82F	S	-	2	0	OR5AP2	56166247	0.000000	0.05858	0.998000	0.56505	0.994000	0.84299	0.291000	0.18994	1.320000	0.45209	0.637000	0.83480	TCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.458	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OR5AP2	protein_coding	OTTHUMT00000391613.1	G	NM_001002925	-		56409671	-1	no_errors	ENST00000544374	ensembl	human	known	74_37	missense	SNP	0.002	A
FCRL1	115350	genome.wustl.edu	37	1	157771769	157771769	+	Silent	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:157771769G>A	ENST00000368176.3	-	5	889	c.822C>T	c.(820-822)taC>taT	p.Y274Y	FCRL1_ENST00000491942.1_Silent_p.Y274Y|FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000358292.3_Silent_p.Y274Y	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	274	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCTCACAGGAGTAGTTTCCAG	0.552																																					GBM(54;482 1003 11223 30131 35730)												0								ENSG00000163534						78.0	82.0	81.0					1																	157771769		2203	4300	6503	FCRL1	SO:0001819	synonymous_variant	0			-	HGNC	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.822C>T	1.37:g.157771769G>A		Somatic	0	34	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	32	25.58	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Silent	SNP	18	0.00	0	42	37.31	25	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Y274	ENST00000368176.3	37	c.822	CCDS1170.1	1																																																																																			-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.552	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	protein_coding	OTTHUMT00000051401.1	G	NM_052938	-		157771769	-1	no_errors	ENST00000368176	ensembl	human	known	74_37	silent	SNP	0.626	A
SMURF1	57154	genome.wustl.edu	37	7	98630588	98630588	+	Intron	DEL	A	A	-	rs530940240	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr7:98630588delA	ENST00000361125.1	-	18	2494				SMURF1_ENST00000361368.2_Intron|AC004893.11_ENST00000468960.2_RNA|AC004893.11_ENST00000360902.1_RNA	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1						BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			AAAAAACAACAAAAAAAAAAC	0.473																																																	0								ENSG00000242687																																			AC004893.11	SO:0001627	intron_variant	0				Clone_based_vega_gene	AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.2174+71T>-	7.37:g.98630588delA		Somatic	0	24	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	RNA	DEL	37	0.00	0	29	6.45	2	-	NULL	ENST00000361125.1	37	NULL	CCDS34690.1	7																																																																																			-	-		0.473	SMURF1-001	KNOWN	basic|CCDS	protein_coding	LOC101927550	protein_coding	OTTHUMT00000335001.2	A	NM_020429			98630588	+1	no_errors	ENST00000360902	ensembl	human	known	74_37	rna	DEL	0.000	-
MT-CO2	4513	genome.wustl.edu	37	M	8156	8156	+	Missense_Mutation	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chrM:8156G>T	ENST00000361739.1	+	1	571	c.571G>T	c.(571-573)Gta>Tta	p.V191L	MT-TS1_ENST00000387416.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TR_ENST00000387439.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-ND3_ENST00000361227.2_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TK_ENST00000387421.1_RNA			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	191					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						CACGACCGGGGGTATACTACG	0.468																																																	0								ENSG00000198712																																			MT-CO2	SO:0001583	missense	0			-	HGNC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.571G>T	M.37:g.8156G>T	ENSP00000354876:p.Val191Leu	Somatic	0	71	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00	Q37526	Missense_Mutation	SNP	7609	0.05	4	1638	0.00	0	pfam_Cyt_c_oxidase_su2_C,pfam_Cyt_c_oxidase_su2_TM_dom,superfamily_Cupredoxin,superfamily_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_TM_dom,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2	p.V191L	ENST00000361739.1	37	c.571		MT																																																																																			-	pfam_Cyt_c_oxidase_su2_C,superfamily_Cupredoxin,pfscan_Cyt_c_oxidase_su2_C,tigrfam_Cyt_c_oxidase_su2		0.468	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	MT-CO2	protein_coding		G	YP_003024029	-		8156	+1	no_errors	ENST00000361739	ensembl	human	known	74_37	missense	SNP	NULL	T
POMGNT2	84892	genome.wustl.edu	37	3	43121738	43121738	+	Missense_Mutation	SNP	T	T	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr3:43121738T>C	ENST00000344697.2	-	2	1531	c.1186A>G	c.(1186-1188)Atg>Gtg	p.M396V	POMGNT2_ENST00000441964.1_Missense_Mutation_p.M396V	NM_032806.5	NP_116195.2	Q8NAT1	PMGT2_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 2 (beta 1,4-)	396					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein O-GlcNAc transferase activity (GO:0097363)										TCTGGCATCATGTTCCGCCAG	0.592																																																	0								ENSG00000144647						80.0	70.0	74.0					3																	43121738		2203	4300	6503	POMGNT2	SO:0001583	missense	0			-	HGNC	AK092147	CCDS2709.1	3p22.1	2014-07-15	2013-08-22	2013-08-22	ENSG00000144647	ENSG00000144647			25902	protein-coding gene	gene with protein product		614828	"""chromosome 3 open reading frame 39"", ""glycosyltransferase-like domain containing 2"""	C3orf39, GTDC2		12477932	Standard	NM_032806		Approved	FLJ14566, AGO61	uc003cmr.2	Q8NAT1	OTTHUMG00000133038	ENST00000344697.2:c.1186A>G	3.37:g.43121738T>C	ENSP00000344125:p.Met396Val	Somatic	0	35	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	26	38.10	B3KWC3|Q96SY3	Missense_Mutation	SNP	25	0.00	0	27	41.30	19	pfam_Glycosyltransferase_AER61,superfamily_Fibronectin_type3	p.M396V	ENST00000344697.2	37	c.1186	CCDS2709.1	3	.	.	.	.	.	.	.	.	.	.	T	9.764	1.170750	0.21621	.	.	ENSG00000144647	ENST00000441964;ENST00000344697	T;T	0.75589	-0.95;-0.95	5.53	3.09	0.35607	.	0.210813	0.49305	D	0.000160	T	0.53367	0.1792	N	0.14661	0.345	0.25675	N	0.985851	B	0.02656	0.0	B	0.01281	0.0	T	0.38045	-0.9679	10	0.31617	T	0.26	-22.0436	7.6273	0.28220	0.0:0.0733:0.1412:0.7855	.	396	Q8NAT1	AGO61_HUMAN	V	396	ENSP00000408992:M396V;ENSP00000344125:M396V	ENSP00000344125:M396V	M	-	1	0	C3orf39	43096742	0.973000	0.33851	0.612000	0.29024	0.956000	0.61745	1.441000	0.35035	0.379000	0.24794	0.529000	0.55759	ATG	-	NULL		0.592	POMGNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT2	protein_coding	OTTHUMT00000256643.1	T	NM_032806	-		43121738	-1	no_errors	ENST00000344697	ensembl	human	known	74_37	missense	SNP	0.983	C
GPR98	84059	genome.wustl.edu	37	5	90052854	90052854	+	Missense_Mutation	SNP	T	T	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:90052854T>A	ENST00000405460.2	+	57	11912	c.11816T>A	c.(11815-11817)gTt>gAt	p.V3939D		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	3939	Calx-beta 26. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTTCTTCAAGTTCCTGTAGTC	0.453																																																	0								ENSG00000164199						96.0	94.0	94.0					5																	90052854		1853	4093	5946	GPR98	SO:0001583	missense	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.11816T>A	5.37:g.90052854T>A	ENSP00000384582:p.Val3939Asp	Somatic	0	34	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	16	68.00	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	32	0.00	0	15	63.41	26	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.V3939D	ENST00000405460.2	37	c.11816	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.9|22.9	4.350101|4.350101	0.82132|0.82132	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000509621|ENST00000405460;ENST00000296619	.|T	.|0.32753	.|1.44	5.3|5.3	5.3|5.3	0.74995|0.74995	.|Na-Ca exchanger/integrin-beta4 (2);	.|0.391921	.|0.28760	.|N	.|0.014240	T|T	0.50343|0.50343	0.1610|0.1610	M|M	0.76938|0.76938	2.355|2.355	0.80722|0.80722	D|D	1|1	.|D;P	.|0.56521	.|0.976;0.921	.|P;P	.|0.54312	.|0.748;0.478	T|T	0.57551|0.57551	-0.7792|-0.7792	5|10	.|0.87932	.|D	.|0	.|.	15.5333|15.5333	0.75980|0.75980	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|3939;3939	.|E7ETI5;Q8WXG9	.|.;GPR98_HUMAN	I|D	1505|3939	.|ENSP00000384582:V3939D	.|ENSP00000296619:V3939D	F|V	+|+	1|2	0|0	GPR98|GPR98	90088610|90088610	0.991000|0.991000	0.36638|0.36638	0.285000|0.285000	0.24819|0.24819	0.872000|0.872000	0.50106|0.50106	7.073000|7.073000	0.76784|0.76784	2.129000|2.129000	0.65627|0.65627	0.383000|0.383000	0.25322|0.25322	TTC|GTT	-	pfam_Calx_beta,smart_Calx_beta		0.453	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	T	NM_032119	-		90052854	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	SNP	0.763	A
CD22	933	genome.wustl.edu	37	19	35832259	35832259	+	Silent	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr19:35832259C>T	ENST00000085219.5	+	8	1587	c.1521C>T	c.(1519-1521)gaC>gaT	p.D507D	CD22_ENST00000341773.6_Silent_p.D330D|CD22_ENST00000536635.2_Silent_p.D419D|CD22_ENST00000270311.6_Silent_p.D387D|CD22_ENST00000594250.1_Silent_p.D330D|CD22_ENST00000419549.2_Silent_p.D335D|CD22_ENST00000544992.2_Silent_p.D507D	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	507	Ig-like C2-type 5.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CCCCCCGAGACGTGAGGGTCC	0.607																																					Ovarian(42;1009 1133 23674 26041)												0								ENSG00000012124						28.0	28.0	28.0					19																	35832259		2203	4300	6503	CD22	SO:0001819	synonymous_variant	0			-	HGNC	X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.1521C>T	19.37:g.35832259C>T		Somatic	0	35	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	27	32.50	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	12	0.00	0	21	32.26	10	pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.D507	ENST00000085219.5	37	c.1521	CCDS12457.1	19																																																																																			-	pfscan_Ig-like_dom		0.607	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	protein_coding	OTTHUMT00000466099.1	C	NM_001771	-		35832259	+1	no_errors	ENST00000085219	ensembl	human	known	74_37	silent	SNP	0.000	T
CACNA2D4	93589	genome.wustl.edu	37	12	1988202	1988202	+	Splice_Site	SNP	G	G	A	rs572396211		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr12:1988202G>A	ENST00000382722.5	-	15	1926	c.1564C>T	c.(1564-1566)Cga>Tga	p.R522*	CACNA2D4_ENST00000585708.1_Splice_Site_p.R458*|CACNA2D4_ENST00000586184.1_Splice_Site_p.R522*|CACNA2D4_ENST00000588077.1_Splice_Site_p.R458*|CACNA2D4_ENST00000587995.1_Splice_Site_p.R522*|CACNA2D4_ENST00000585732.1_Splice_Site_p.R407*	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	522	Cache.				calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		CCATGGGATCGCTGGAAGGAA	0.607																																					Colon(2;101 179 21030 23310 28141)												0								ENSG00000151062						39.0	44.0	42.0					12																	1988202		2000	4163	6163	CACNA2D4	SO:0001630	splice_region_variant	0			-	HGNC	AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.1564-1C>T	12.37:g.1988202G>A		Somatic	0	20	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	Q7Z3S8|Q86XZ5|Q8IZS9	Nonsense_Mutation	SNP	32	0.00	0	32	33.33	16	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R522*	ENST00000382722.5	37	c.1564	CCDS44785.1	12	.	.	.	.	.	.	.	.	.	.	G	39	7.749322	0.98468	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	.	.	.	5.23	-2.27	0.06846	.	0.061153	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.4151	0.87497	0.0:0.0:0.3435:0.6565	.	.	.	.	X	458;522;522	.	ENSP00000280663:R522X	R	-	1	2	CACNA2D4	1858463	0.745000	0.28261	0.860000	0.33809	0.946000	0.59487	-0.171000	0.09883	-0.256000	0.09473	0.655000	0.94253	CGA	-	pfam_Cache_domain		0.607	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	CACNA2D4	protein_coding	OTTHUMT00000398230.2	G		-	Nonsense_Mutation	1988202	-1	no_errors	ENST00000382722	ensembl	human	known	74_37	nonsense	SNP	0.793	A
OTUB1	55611	genome.wustl.edu	37	11	63764938	63764938	+	Missense_Mutation	SNP	C	C	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:63764938C>G	ENST00000538426.1	+	7	780	c.736C>G	c.(736-738)Ccg>Gcg	p.P246A	OTUB1_ENST00000422031.2_Missense_Mutation_p.P283A|OTUB1_ENST00000541478.1_Missense_Mutation_p.P145A|OTUB1_ENST00000535715.1_Intron|OTUB1_ENST00000428192.2_Missense_Mutation_p.P246A|OTUB1_ENST00000543988.1_Missense_Mutation_p.P216A|OTUB1_ENST00000543004.1_Missense_Mutation_p.P255A	NM_017670.2	NP_060140.2	Q96FW1	OTUB1_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 1	246	Free ubiquitin binding.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|immune system process (GO:0002376)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein K48-linked deubiquitination (GO:0071108)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	NEDD8-specific protease activity (GO:0019784)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	6						CACCACCAATCCGCACATCTT	0.622																																																	0								ENSG00000167770						117.0	110.0	113.0					11																	63764938		2201	4297	6498	OTUB1	SO:0001583	missense	0			-	HGNC	AY177200	CCDS8055.1	11q13.1	2014-02-24	2014-02-24			ENSG00000167770		"""OTU domain containing"""	23077	protein-coding gene	gene with protein product		608337	"""OTU domain, ubiquitin aldehyde binding 1"""			12704427, 19383985	Standard	NM_017670		Approved	FLJ20113, FLJ40710	uc001nyf.1	Q96FW1		ENST00000538426.1:c.736C>G	11.37:g.63764938C>G	ENSP00000444357:p.Pro246Ala	Somatic	0	46	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	33	26.67	Q32Q78|Q96II3|Q9NXQ4|Q9P0B8	Missense_Mutation	SNP	30	0.00	0	31	29.55	13	pfam_Peptidase_C65_otubain,pfam_OTU,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU	p.P283A	ENST00000538426.1	37	c.847	CCDS8055.1	11	.	.	.	.	.	.	.	.	.	.	C	1.247	-0.619652	0.03663	.	.	ENSG00000167770	ENST00000541478;ENST00000428192;ENST00000422031;ENST00000538426;ENST00000543004;ENST00000543988	T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05	5.43	4.52	0.55395	Ovarian tumour, otubain (1);	0.241003	0.41396	D	0.000892	T	0.14485	0.0350	N	0.01482	-0.84	0.30660	N	0.754537	B;B;B;B	0.11235	0.0;0.0;0.004;0.0	B;B;B;B	0.04013	0.0;0.0;0.001;0.0	T	0.17048	-1.0382	10	0.10636	T	0.68	.	8.4158	0.32670	0.1537:0.7664:0.0:0.0799	.	283;145;290;246	B4DPD5;F5H3F0;Q96FW1-2;Q96FW1	.;.;.;OTUB1_HUMAN	A	145;246;283;246;255;216	ENSP00000439142:P145A;ENSP00000402551:P246A;ENSP00000416973:P283A;ENSP00000444357:P246A;ENSP00000437453:P255A;ENSP00000441328:P216A	ENSP00000416973:P283A	P	+	1	0	OTUB1	63521514	1.000000	0.71417	0.716000	0.30569	0.047000	0.14425	3.621000	0.54210	1.426000	0.47256	0.655000	0.94253	CCG	-	pfam_Peptidase_C65_otubain,pfam_OTU,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU		0.622	OTUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUB1	protein_coding	OTTHUMT00000396277.1	C	NM_017670	-		63764938	+1	no_errors	ENST00000422031	ensembl	human	known	74_37	missense	SNP	1.000	G
YARS2	51067	genome.wustl.edu	37	12	32908155	32908155	+	Missense_Mutation	SNP	C	C	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr12:32908155C>A	ENST00000324868.8	-	1	681	c.654G>T	c.(652-654)gaG>gaT	p.E218D		NM_001040436.2	NP_001035526.1	Q9Y2Z4	SYYM_HUMAN	tyrosyl-tRNA synthetase 2, mitochondrial	218					gene expression (GO:0010467)|mitochondrial tyrosyl-tRNA aminoacylation (GO:0070184)|translation (GO:0006412)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)|tyrosine binding (GO:0072545)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	16	Lung NSC(5;2.43e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)				L-Tyrosine(DB00135)	GGTAAAAGAACTCGGCCAAGC	0.602											OREG0021729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000139131						74.0	81.0	79.0					12																	32908155		2203	4300	6503	YARS2	SO:0001583	missense	0			-	HGNC	AF132939	CCDS31770.1	12p11.21	2014-03-19	2007-02-23		ENSG00000139131	ENSG00000139131	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	24249	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 2, mitochondrial"""	610957				15779907, 15840810	Standard	NM_001040436		Approved	FLJ13995, CGI-04, mt-TyrRS	uc001rli.3	Q9Y2Z4	OTTHUMG00000169454	ENST00000324868.8:c.654G>T	12.37:g.32908155C>A	ENSP00000320658:p.Glu218Asp	Somatic	0	51	0.00	836	0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	43	21.82	D3DUW8|Q9H817	Missense_Mutation	SNP	34	0.00	0	40	23.08	12	pfam_aa-tRNA-synth_Ic,prints_Tyr-tRNA-ligase,tigrfam_Tyr-tRNA-ligase	p.E218D	ENST00000324868.8	37	c.654	CCDS31770.1	12	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069589	0.76301	.	.	ENSG00000139131	ENST00000324868	T	0.56941	0.43	5.09	3.24	0.37175	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.165303	0.53938	D	0.000045	T	0.74589	0.3736	M	0.91561	3.22	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.76788	-0.2830	10	0.87932	D	0	-1.3071	9.2659	0.37641	0.0:0.7584:0.0:0.2416	.	218	Q9Y2Z4	SYYM_HUMAN	D	218	ENSP00000320658:E218D	ENSP00000320658:E218D	E	-	3	2	YARS2	32799422	1.000000	0.71417	0.981000	0.43875	0.938000	0.57974	1.709000	0.37909	0.687000	0.31509	-0.212000	0.12691	GAG	-	pfam_aa-tRNA-synth_Ic,prints_Tyr-tRNA-ligase,tigrfam_Tyr-tRNA-ligase		0.602	YARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS2	protein_coding	OTTHUMT00000404153.1	C	NM_015936	-		32908155	-1	no_errors	ENST00000324868	ensembl	human	known	74_37	missense	SNP	1.000	A
INTS4	92105	genome.wustl.edu	37	11	77629129	77629129	+	Intron	SNP	T	T	C			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:77629129T>C	ENST00000534064.1	-	15	1957				AAMDC_ENST00000532481.1_Missense_Mutation_p.L84S	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4						snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			ggggcacagttagatctgaat	0.473																																																	0								ENSG00000087884																																			AAMDC	SO:0001627	intron_variant	0			-	HGNC	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1922+737A>G	11.37:g.77629129T>C		Somatic	0	79	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	89	18.35	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	28	0.00	0	38	13.64	6	pfam_NADH_Ub_cplx-1_asu_assmbl-fac3,superfamily_NADH_Ub_cplx-1_asu_assmbl-fac3	p.L84S	ENST00000534064.1	37	c.251	CCDS31644.1	11	.	.	.	.	.	.	.	.	.	.	T	3.766	-0.048663	0.07407	.	.	ENSG00000087884	ENST00000532481	.	.	.	3.39	0.849	0.18972	.	.	.	.	.	T	0.22003	0.0530	.	.	.	0.09310	N	1	B	0.30281	0.275	B	0.24269	0.052	T	0.22871	-1.0204	7	0.87932	D	0	.	2.9104	0.05734	0.2152:0.1228:0.0:0.6621	.	84	Q9H7C9-3	.	S	84	.	ENSP00000433293:L84S	L	+	2	0	C11orf67	77306777	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-0.370000	0.07523	0.146000	0.19002	0.528000	0.53228	TTA	-	NULL		0.473	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAMDC	protein_coding	OTTHUMT00000390927.1	T	NM_033547	-		77629129	+1	no_errors	ENST00000532481	ensembl	human	putative	74_37	missense	SNP	0.002	C
OR4D5	219875	genome.wustl.edu	37	11	123810923	123810923	+	Silent	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr11:123810923G>A	ENST00000307033.2	+	1	674	c.600G>A	c.(598-600)gtG>gtA	p.V200V		NM_001001965.1	NP_001001965.1	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D, member 5	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TTTTAATGGTGTCTAACAATG	0.502																																																	0								ENSG00000171014						251.0	238.0	242.0					11																	123810923		2202	4299	6501	OR4D5	SO:0001819	synonymous_variant	0			-	HGNC	BK004316	CCDS31699.1	11q24.1	2012-08-09			ENSG00000171014	ENSG00000171014		"""GPCR / Class A : Olfactory receptors"""	14852	protein-coding gene	gene with protein product							Standard	NM_001001965		Approved		uc001pzk.1	Q8NGN0	OTTHUMG00000165961	ENST00000307033.2:c.600G>A	11.37:g.123810923G>A		Somatic	0	54	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	32	27.27	B9EGZ4|Q6IFE6	Silent	SNP	29	0.00	0	32	31.91	15	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V200	ENST00000307033.2	37	c.600	CCDS31699.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.502	OR4D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D5	protein_coding	OTTHUMT00000387263.1	G	NM_001001965	-		123810923	+1	no_errors	ENST00000307033	ensembl	human	known	74_37	silent	SNP	0.346	A
SLMO1	10650	genome.wustl.edu	37	18	12427223	12427223	+	Silent	SNP	C	C	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr18:12427223C>T	ENST00000440960.1	+	5	446	c.366C>T	c.(364-366)acC>acT	p.T122T	SLMO1_ENST00000592149.1_Silent_p.T101T|SLMO1_ENST00000590956.1_Silent_p.T32T|SLMO1_ENST00000587735.1_Silent_p.T32T|SLMO1_ENST00000336990.4_Silent_p.T122T	NM_001142405.1	NP_001135877.1	Q96N28	SLMO1_HUMAN	slowmo homolog 1 (Drosophila)	122	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(1)	1						TTTGCAGGACCGTGCTCACAC	0.498																																																	0								ENSG00000141391						121.0	106.0	111.0					18																	12427223		2203	4300	6503	SLMO1	SO:0001819	synonymous_variant	0			-	HGNC	AK056046	CCDS11860.1	18p11.21	2007-02-20	2007-02-06	2007-02-06	ENSG00000141391	ENSG00000141391			24639	protein-coding gene	gene with protein product	"""erythroid differentiation and denucleation factor 1"""		"""chromosome 18 open reading frame 43"""	C18orf43			Standard	NM_006553		Approved	HFL-EDDG1, FLJ31484, PRELID3A	uc010wzu.2	Q96N28	OTTHUMG00000131694	ENST00000440960.1:c.366C>T	18.37:g.12427223C>T		Somatic	0	92	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	58	46	55.77	B0YJ10|B4E0C9|D3DUJ1|Q6AHX2	Silent	SNP	21	0.00	0	26	49.02	25	pfam_PRELI/MSF1,pfscan_PRELI/MSF1	p.T122	ENST00000440960.1	37	c.366	CCDS11860.1	18																																																																																			-	pfam_PRELI/MSF1,pfscan_PRELI/MSF1		0.498	SLMO1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLMO1	protein_coding	OTTHUMT00000254602.2	C	NM_006553	-		12427223	+1	no_errors	ENST00000336990	ensembl	human	known	74_37	silent	SNP	0.027	T
SYCP1	6847	genome.wustl.edu	37	1	115419372	115419372	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr1:115419372G>T	ENST00000369522.3	+	11	982	c.742G>T	c.(742-744)Gaa>Taa	p.E248*	SYCP1_ENST00000369518.1_Nonsense_Mutation_p.E248*	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	248					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGAAGATTATGAAAAAATCCA	0.229																																																	0								ENSG00000198765						20.0	22.0	21.0					1																	115419372		2099	4111	6210	SYCP1	SO:0001587	stop_gained	0			-	HGNC	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.742G>T	1.37:g.115419372G>T	ENSP00000358535:p.Glu248*	Somatic	0	50	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	60	16.67	O14963|Q5VXJ6	Nonsense_Mutation	SNP	30	0.00	0	54	18.18	12	pfam_SCP-1	p.E248*	ENST00000369522.3	37	c.742	CCDS879.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.456930	0.96223	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	.	.	.	4.92	4.92	0.64577	.	0.192207	0.45606	D	0.000356	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-15.3342	15.9721	0.80027	0.0:0.0:1.0:0.0	.	.	.	.	X	248	.	ENSP00000358531:E248X	E	+	1	0	SYCP1	115220895	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.768000	0.68858	2.432000	0.82394	0.650000	0.86243	GAA	-	pfam_SCP-1		0.229	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	protein_coding	OTTHUMT00000033386.1	G	NM_003176	-		115419372	+1	no_errors	ENST00000369518	ensembl	human	known	74_37	nonsense	SNP	1.000	T
SMC2	10592	genome.wustl.edu	37	9	106888987	106888987	+	Silent	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr9:106888987G>A	ENST00000286398.7	+	19	2805	c.2517G>A	c.(2515-2517)caG>caA	p.Q839Q	SMC2_ENST00000303219.8_Silent_p.Q839Q|SMC2_ENST00000374787.3_Silent_p.Q839Q|SMC2_ENST00000374793.3_Silent_p.Q839Q	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	839					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						ACAAACAACAGCTTGAAGCTG	0.353																																																	0								ENSG00000136824						82.0	84.0	83.0					9																	106888987		2203	4300	6503	SMC2	SO:0001819	synonymous_variant	0			-	HGNC	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.2517G>A	9.37:g.106888987G>A		Somatic	0	43	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	31	31.11	Q6IEE0|Q9P1P2	Silent	SNP	31	0.00	0	38	24.00	12	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.Q839	ENST00000286398.7	37	c.2517	CCDS35086.1	9																																																																																			-	superfamily_P-loop_NTPase		0.353	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	protein_coding	OTTHUMT00000053470.1	G		-		106888987	+1	no_errors	ENST00000286398	ensembl	human	known	74_37	silent	SNP	1.000	A
LOC441666	441666	genome.wustl.edu	37	10	42832502	42832503	+	RNA	INS	-	-	TATCA	rs368679059		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr10:42832502_42832503insTATCA	ENST00000609841.1	-	0	1400_1401					NR_024380.1																						CCCCTATCAATTATGTTTAGTA	0.366																																																	0								ENSG00000215146																																			RP11-313J2.1			0				Clone_based_vega_gene																													10.37:g.42832502_42832503insTATCA		Somatic	NA	NA	NA		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	32	0.00	0	26	10.34	3	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			-	-		0.366	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	pseudogene	OTTHUMT00000472483.1	-				42832503	-1	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	INS	0.995:0.996	TATCA
PCDHB8	56128	genome.wustl.edu	37	5	140559085	140559085	+	Silent	SNP	G	G	A	rs145141248	byFrequency	TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:140559085G>A	ENST00000239444.2	+	1	1715	c.1470G>A	c.(1468-1470)tcG>tcA	p.S490S	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	490	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCACCTACTCGCTGCTGCCGC	0.662																																																	0								ENSG00000120322						92.0	141.0	125.0					5																	140559085		2203	4297	6500	PCDHB8	SO:0001819	synonymous_variant	0			-	HGNC	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1470G>A	5.37:g.140559085G>A		Somatic	0	454	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	332	14.21	B9EGV1	Silent	SNP	54	0.00	0	61	11.43	8	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S490	ENST00000239444.2	37	c.1470	CCDS4250.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.662	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	protein_coding	OTTHUMT00000251816.2	G	NM_019120	-		140559085	+1	no_errors	ENST00000239444	ensembl	human	known	74_37	silent	SNP	0.988	A
ALOX12	239	genome.wustl.edu	37	17	6913105	6913105	+	Missense_Mutation	SNP	A	A	G			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr17:6913105A>G	ENST00000251535.6	+	12	1633	c.1580A>G	c.(1579-1581)cAt>cGt	p.H527R	AC027763.2_ENST00000573939.1_Intron|RNASEK_ENST00000548577.1_5'Flank|RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000574377.1_Intron|RNASEK_ENST00000402093.1_5'Flank|AC027763.2_ENST00000399540.2_Intron|AC027763.2_ENST00000575727.1_Intron|AC027763.2_ENST00000399541.2_Intron	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase	527	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						CAACTCTGCCATTTCCTCACC	0.547																																																	0								ENSG00000108839						139.0	117.0	124.0					17																	6913105		2203	4300	6503	ALOX12	SO:0001583	missense	0			-	HGNC	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1580A>G	17.37:g.6913105A>G	ENSP00000251535:p.His527Arg	Somatic	0	53	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	56	36.36	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	26	0.00	0	36	40.00	24	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C	p.H527R	ENST00000251535.6	37	c.1580	CCDS11084.1	17	.	.	.	.	.	.	.	.	.	.	A	10.95	1.494755	0.26774	.	.	ENSG00000108839	ENST00000251535	T	0.06218	3.33	5.28	4.2	0.49525	Lipoxygenase, C-terminal (3);	0.132515	0.51477	D	0.000093	T	0.05227	0.0139	L	0.35542	1.07	0.35859	D	0.827347	B	0.22800	0.075	B	0.19666	0.026	T	0.35176	-0.9799	10	0.17369	T	0.5	-4.4808	9.3901	0.38367	0.916:0.0:0.084:0.0	.	527	P18054	LOX12_HUMAN	R	527	ENSP00000251535:H527R	ENSP00000251535:H527R	H	+	2	0	ALOX12	6853829	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.795000	0.62489	1.025000	0.39708	0.460000	0.39030	CAT	-	pfam_LipOase_C,superfamily_LipOase_C		0.547	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX12	protein_coding	OTTHUMT00000219922.2	A		-		6913105	+1	no_errors	ENST00000251535	ensembl	human	known	74_37	missense	SNP	0.983	G
MUC3A	4584	genome.wustl.edu	37	7	100608197	100608198	+	Intron	INS	-	-	GGG	rs373235112		TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr7:100608197_100608198insGGG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GCCCCTCCACACTCCCCCAGAC	0.609																																																	0								ENSG00000225946																																			RP11-395B7.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-109->GGG	7.37:g.100608197_100608198insGGG		Somatic	0	30	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	24	14.29	4	18	14.29	3	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			-	-		0.609	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	protein_coding	OTTHUMT00000347215.1	-	XM_001725354			100608198	-1	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	INS	0.000:0.000	GGG
DIAPH1	1729	genome.wustl.edu	37	5	140896391	140896391	+	3'UTR	SNP	G	G	A			TCGA-IF-A4AJ-01A-11D-A24N-09	TCGA-IF-A4AJ-11A-12D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d53c2680-89ac-4f87-a7ba-f4c669546b76	e8f6f409-7ff3-4eda-ad53-419f91052d25	g.chr5:140896391G>A	ENST00000398557.4	-	0	3986				DIAPH1_ENST00000518047.1_3'UTR|DIAPH1_ENST00000253811.6_3'UTR|DIAPH1_ENST00000398566.3_3'UTR|DIAPH1_ENST00000520569.1_3'UTR|DIAPH1_ENST00000389057.5_3'UTR|DIAPH1_ENST00000398562.2_3'UTR|DIAPH1_ENST00000389054.3_3'UTR	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1						actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCCGCTGAGGAGCTGCCGC	0.587																																																	0								ENSG00000131504						67.0	68.0	68.0					5																	140896391		2088	4201	6289	DIAPH1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.*27C>T	5.37:g.140896391G>A		Somatic	0	65	0.00		0.5791740796517943	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	27	37.21	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	RNA	SNP	23	0.00	0	20	39.39	13	-	NULL	ENST00000398557.4	37	NULL	CCDS43374.1	5																																																																																			-	-		0.587	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	protein_coding		G	NM_005219	-		140896391	-1	no_errors	ENST00000468119	ensembl	human	putative	74_37	rna	SNP	0.005	A
