#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
VSIG10	54621	genome.wustl.edu	37	12	118517303	118517303	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr12:118517303C>A	ENST00000359236.5	-	4	1049	c.773G>T	c.(772-774)tGg>tTg	p.W258L	VSIG10_ENST00000536905.1_5'Flank	NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	258	Ig-like C2-type 3.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						CTCTTCTATCCACAGGAAGTC	0.557																																																	0								ENSG00000176834						110.0	113.0	112.0					12																	118517303		2022	4204	6226	VSIG10	SO:0001583	missense	0			-	HGNC		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.773G>T	12.37:g.118517303C>A	ENSP00000352172:p.Trp258Leu	Somatic	0	49	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	Q9NWQ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.W258L	ENST00000359236.5	37	c.773	CCDS44992.1	12	.	.	.	.	.	.	.	.	.	.	C	29.8	5.035909	0.93630	.	.	ENSG00000176834	ENST00000359236;ENST00000538357	T;T	0.43688	0.94;0.94	6.14	6.14	0.99180	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.43260	D	0.000590	T	0.69895	0.3162	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70714	-0.4796	10	0.87932	D	0	-26.2517	20.8597	0.99761	0.0:1.0:0.0:0.0	.	258	Q8N0Z9	VSI10_HUMAN	L	258;157	ENSP00000352172:W258L;ENSP00000442861:W157L	ENSP00000352172:W258L	W	-	2	0	VSIG10	117001686	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	5.275000	0.65575	2.937000	0.99478	0.650000	0.86243	TGG	-	pfscan_Ig-like_dom		0.557	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSIG10	protein_coding	OTTHUMT00000401273.2	C	NM_019086	-		118517303	-1	no_errors	ENST00000359236	ensembl	human	known	74_37	missense	SNP	1.000	A
AFF2	2334	genome.wustl.edu	37	X	148037568	148037568	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chrX:148037568G>T	ENST00000370460.2	+	11	2472	c.1993G>T	c.(1993-1995)Gac>Tac	p.D665Y	AFF2_ENST00000370457.5_Missense_Mutation_p.D632Y|AFF2_ENST00000286437.5_Missense_Mutation_p.D306Y|AFF2_ENST00000342251.3_Missense_Mutation_p.D632Y	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	665					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					GGAGCTTCATGACCCACCAAG	0.488																																																	0								ENSG00000155966						87.0	91.0	90.0					X																	148037568		2203	4300	6503	AFF2	SO:0001583	missense	0			-	HGNC	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1993G>T	X.37:g.148037568G>T	ENSP00000359489:p.Asp665Tyr	Somatic	0	30	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	12	45.45	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TF_AF4/FMR2	p.D665Y	ENST00000370460.2	37	c.1993	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	G	19.12	3.766252	0.69878	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.67	5.67	0.87782	.	0.536654	0.19612	N	0.110117	T	0.72630	0.3484	L	0.54323	1.7	0.39202	D	0.963165	P;P;P;P;P;P	0.48589	0.912;0.786;0.786;0.786;0.786;0.822	P;B;B;B;B;P	0.54629	0.757;0.319;0.319;0.319;0.44;0.576	T	0.75445	-0.3315	10	0.62326	D	0.03	.	18.7499	0.91810	0.0:0.0:1.0:0.0	.	306;630;632;626;655;665	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	Y	665;632;632;306	ENSP00000359489:D665Y;ENSP00000359486:D632Y;ENSP00000345459:D632Y;ENSP00000286437:D306Y	ENSP00000286437:D306Y	D	+	1	0	AFF2	147845268	1.000000	0.71417	0.991000	0.47740	0.914000	0.54420	6.768000	0.74980	2.372000	0.80975	0.600000	0.82982	GAC	-	pfam_TF_AF4/FMR2		0.488	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	protein_coding	OTTHUMT00000058673.2	G	NM_002025	-		148037568	+1	no_errors	ENST00000370460	ensembl	human	known	74_37	missense	SNP	1.000	T
LOC100129138	100129138	genome.wustl.edu	37	1	104616114	104616114	+	lincRNA	SNP	G	G	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr1:104616114G>T	ENST00000418362.1	+	0	470					NR_033990.1																						CCTGCAAAGGGCACCGGGGAC	0.642																																																	0								ENSG00000215869																																			RP11-364B6.1			0			-	Clone_based_vega_gene																													1.37:g.104616114G>T		Somatic	0	18	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	11	45.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000418362.1	37	NULL		1																																																																																			-	-		0.642	RP11-364B6.1-001	KNOWN	basic	lincRNA	LOC100129138	lincRNA	OTTHUMT00000030377.1	G		-		104616114	+1	no_errors	ENST00000418362	ensembl	human	known	74_37	rna	SNP	0.034	T
KRT8	3856	genome.wustl.edu	37	12	53298675	53298675	+	Missense_Mutation	SNP	A	A	C			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr12:53298675A>C	ENST00000552551.1	-	2	523	c.91T>G	c.(91-93)Tcc>Gcc	p.S31A	KRT8_ENST00000293308.6_Missense_Mutation_p.S31A|KRT8_ENST00000552150.1_Missense_Mutation_p.S59A|KRT8_ENST00000546897.1_Missense_Mutation_p.S31A			P05787	K2C8_HUMAN	keratin 8	31	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)	p.S31A(4)		endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	CTGATGCGGGAACCGGGCCCA	0.662																																																	4	Substitution - Missense(4)	endometrium(2)|prostate(1)|liver(1)						ENSG00000170421						12.0	14.0	13.0					12																	53298675		2120	4158	6278	KRT8	SO:0001583	missense	0			-	HGNC	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.91T>G	12.37:g.53298675A>C	ENSP00000447566:p.Ser31Ala	Somatic	0	75	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	58	10.77	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.S31A	ENST00000552551.1	37	c.91	CCDS8841.1	12	.	.	.	.	.	.	.	.	.	.	-	0.012	-1.651707	0.00785	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.05	-8.11	0.01082	.	0.706613	0.13676	N	0.370518	T	0.40619	0.1124	N	0.01197	-0.965	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.43589	-0.9382	10	0.05351	T	0.99	.	6.5956	0.22672	0.4212:0.312:0.0:0.2668	.	59;31;31	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	A	31;31;31;31;59;31;71;31;109	ENSP00000447566:S31A;ENSP00000293308:S31A;ENSP00000447402:S31A;ENSP00000449404:S59A;ENSP00000447881:S31A;ENSP00000447040:S71A;ENSP00000448681:S31A;ENSP00000450228:S109A	ENSP00000293308:S31A	S	-	1	0	KRT8	51584942	0.005000	0.15991	0.000000	0.03702	0.065000	0.16274	-0.018000	0.12568	-3.264000	0.00201	-0.290000	0.09829	TCC	-	NULL		0.662	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT8	protein_coding	OTTHUMT00000406385.1	A	NM_002273	-		53298675	-1	no_errors	ENST00000293308	ensembl	human	known	74_37	missense	SNP	0.000	C
KRTAP5-10	387273	genome.wustl.edu	37	11	71276808	71276808	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr11:71276808T>C	ENST00000398531.1	+	1	200	c.175T>C	c.(175-177)Tgt>Cgt	p.C59R	KRTAP5-10_ENST00000376536.4_Missense_Mutation_p.C59R	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	59	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						TGTGCCAGCCTGTTCCTGCTC	0.677																																																	0								ENSG00000204572						62.0	81.0	74.0					11																	71276808		2162	4254	6416	KRTAP5-10	SO:0001583	missense	0			-	HGNC	AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.175T>C	11.37:g.71276808T>C	ENSP00000381542:p.Cys59Arg	Somatic	0	97	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	53	41.76	B9EHA4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C59R	ENST00000398531.1	37	c.175	CCDS41684.1	11	.	.	.	.	.	.	.	.	.	.	t	10.08	1.252712	0.22965	.	.	ENSG00000204572	ENST00000398531;ENST00000376536	T;T	0.01265	5.08;5.32	1.84	1.84	0.25277	.	.	.	.	.	T	0.03263	0.0095	M	0.90082	3.085	0.31338	N	0.684027	P	0.42993	0.797	B	0.37422	0.249	T	0.06409	-1.0828	9	0.72032	D	0.01	.	7.6693	0.28449	0.0:0.0:0.0:1.0	.	59	Q6L8G5	KR510_HUMAN	R	59	ENSP00000381542:C59R;ENSP00000365719:C59R	ENSP00000365719:C59R	C	+	1	0	KRTAP5-10	70954456	0.001000	0.12720	0.869000	0.34112	0.771000	0.43674	0.006000	0.13152	1.126000	0.42016	0.333000	0.21579	TGT	-	NULL		0.677	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP5-10	protein_coding	OTTHUMT00000127968.2	T		-		71276808	+1	no_errors	ENST00000398531	ensembl	human	known	74_37	missense	SNP	0.396	C
CCT3	7203	genome.wustl.edu	37	1	156307996	156307996	+	5'UTR	SNP	G	G	C			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr1:156307996G>C	ENST00000295688.3	-	0	260				CCT3_ENST00000368259.2_5'UTR|CCT3_ENST00000472765.2_5'UTR|TSACC_ENST00000481479.1_5'Flank|TSACC_ENST00000368253.2_5'Flank|TSACC_ENST00000368254.1_5'Flank|TSACC_ENST00000466306.1_5'Flank|TSACC_ENST00000368255.3_Intron|TSACC_ENST00000368252.1_5'Flank|TSACC_ENST00000470342.1_5'Flank|CCT3_ENST00000368256.3_5'UTR|TSACC_ENST00000368251.1_5'Flank|CCT3_ENST00000368261.3_5'UTR	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)						'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					TGCAGAGCCGGGTACCCAGAG	0.602																																																	0								ENSG00000163468						47.0	42.0	43.0					1																	156307996		2199	4290	6489	CCT3	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.-21C>G	1.37:g.156307996G>C		Somatic	0	61	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	23	45.24	A6NE14|Q5SZY1|Q9BR64	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000295688.3	37	NULL	CCDS1140.2	1																																																																																			-	-		0.602	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	protein_coding	OTTHUMT00000060602.3	G	NM_005998	-		156307996	-1	no_errors	ENST00000368256	ensembl	human	known	74_37	rna	SNP	0.733	C
LHPP	64077	genome.wustl.edu	37	10	126185567	126185567	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr10:126185567G>A	ENST00000368842.5	+	4	533	c.505G>A	c.(505-507)Gtt>Att	p.V169I	LHPP_ENST00000392757.4_Missense_Mutation_p.V169I|LHPP_ENST00000368839.1_Missense_Mutation_p.V169I	NM_022126.3	NP_071409.3	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic pyrophosphate phosphatase	169					phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|phosphohistidine phosphatase activity (GO:0008969)|protein homodimerization activity (GO:0042803)			large_intestine(2)|lung(2)	4		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		GATGCTGGACGTTGGTCCCTA	0.567																																					GBM(165;1980 2715 15999 18454)												0								ENSG00000107902						225.0	196.0	205.0					10																	126185567		2203	4300	6503	LHPP	SO:0001583	missense	0			-	HGNC	AB049629	CCDS7640.1, CCDS53587.1	10q26.2	2010-02-17			ENSG00000107902	ENSG00000107902	3.6.1.1		30042	protein-coding gene	gene with protein product						12801912, 16430861	Standard	NM_022126		Approved	HDHD2B	uc001lhs.2	Q9H008	OTTHUMG00000019214	ENST00000368842.5:c.505G>A	10.37:g.126185567G>A	ENSP00000357835:p.Val169Ile	Somatic	0	55	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	7	78.79	B3KP20|Q2TBE9|Q5VUV9|Q5VUW0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_hyp2,tigrfam_HAD-SF_hydro_IIA	p.V169I	ENST00000368842.5	37	c.505	CCDS7640.1	10	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754127	0.49362	.	.	ENSG00000107902	ENST00000392757;ENST00000368842;ENST00000368839	T;T;T	0.26660	1.72;1.72;1.72	4.57	4.57	0.56435	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);Nitrophenylphosphatase-like  domain (1);	0.065106	0.64402	D	0.000009	T	0.24736	0.0600	L	0.31120	0.905	0.80722	D	1	P;B	0.45957	0.869;0.079	P;B	0.45138	0.471;0.02	T	0.01748	-1.1282	10	0.25106	T	0.35	-24.9576	17.9367	0.89014	0.0:0.0:1.0:0.0	.	169;169	Q9H008-2;Q9H008	.;LHPP_HUMAN	I	169	ENSP00000376512:V169I;ENSP00000357835:V169I;ENSP00000357832:V169I	ENSP00000357832:V169I	V	+	1	0	LHPP	126175557	1.000000	0.71417	0.754000	0.31244	0.579000	0.36224	5.417000	0.66423	2.551000	0.86045	0.561000	0.74099	GTT	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_hyp2,tigrfam_HAD-SF_hydro_IIA		0.567	LHPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHPP	protein_coding	OTTHUMT00000050870.1	G	NM_022126	-		126185567	+1	no_errors	ENST00000368842	ensembl	human	known	74_37	missense	SNP	1.000	A
ALB	213	genome.wustl.edu	37	4	74272407	74272407	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr4:74272407G>T	ENST00000295897.4	+	3	288	c.199G>T	c.(199-201)Gtg>Ttg	p.V67L	ALB_ENST00000503124.1_5'UTR|ALB_ENST00000401494.3_Intron|ALB_ENST00000415165.2_Intron|ALB_ENST00000509063.1_Missense_Mutation_p.V67L	NM_000477.5	NP_000468.1	Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TGTAAAATTAGTGAATGAAGT	0.333																																																	0								ENSG00000163631						121.0	115.0	117.0					4																	74272407		2203	4300	6503	ALB	SO:0001583	missense	0			-	HGNC	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000295897.4:c.199G>T	4.37:g.74272407G>T	ENSP00000295897:p.Val67Leu	Somatic	0	55	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin/AFP,prints_ALB/AFP/VDB	p.V67L	ENST00000295897.4	37	c.199	CCDS3555.1	4	.	.	.	.	.	.	.	.	.	.	G	16.11	3.029784	0.54790	.	.	ENSG00000163631	ENST00000441319;ENST00000295897;ENST00000329326;ENST00000509063;ENST00000430202	T;T;T	0.75704	-0.96;-0.96;-0.96	5.28	1.63	0.23807	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.235202	0.34853	N	0.003624	T	0.77751	0.4177	M	0.87900	2.915	0.19575	N	0.999968	P;P	0.45474	0.859;0.56	P;P	0.45474	0.482;0.454	T	0.71159	-0.4674	10	0.66056	D	0.02	-5.3343	9.6685	0.39998	0.2962:0.0:0.7038:0.0	.	67;67	A6NBZ8;P02768	.;ALBU_HUMAN	L	69;67;67;67;76	ENSP00000392541:V69L;ENSP00000295897:V67L;ENSP00000422784:V67L	ENSP00000295897:V67L	V	+	1	0	ALB	74491271	0.996000	0.38824	0.084000	0.20598	0.897000	0.52465	1.869000	0.39519	0.397000	0.25310	-0.142000	0.14014	GTG	-	pfam_Serum_albumin_N,superfamily_Serum_albumin-like,smart_Serum_albumin_N,pirsf_Serum_albumin/AFP		0.333	ALB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALB	protein_coding	OTTHUMT00000252173.3	G	NM_000477	-		74272407	+1	no_errors	ENST00000295897	ensembl	human	known	74_37	missense	SNP	0.122	T
DNAH3	55567	genome.wustl.edu	37	16	20944659	20944659	+	Silent	SNP	G	G	A	rs567061014		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr16:20944659G>A	ENST00000261383.3	-	62	12167	c.12168C>T	c.(12166-12168)agC>agT	p.S4056S	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	4056					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		GAAACATTGCGCTCTCCCCAG	0.522													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18099	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000158486						163.0	159.0	161.0					16																	20944659		2201	4300	6501	DNAH3	SO:0001819	synonymous_variant	0			-	HGNC	U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.12168C>T	16.37:g.20944659G>A		Somatic	0	68	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	44	42.11	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.S4056	ENST00000261383.3	37	c.12168	CCDS10594.1	16																																																																																			-	pfam_Dynein_heavy_dom		0.522	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	protein_coding	OTTHUMT00000207361.1	G	NM_017539	-		20944659	-1	no_errors	ENST00000261383	ensembl	human	known	74_37	silent	SNP	0.987	A
SYK	6850	genome.wustl.edu	37	9	93627356	93627356	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr9:93627356C>T	ENST00000375754.4	+	6	971	c.823C>T	c.(823-825)Caa>Taa	p.Q275*	SYK_ENST00000375746.1_Nonsense_Mutation_p.Q275*|SYK_ENST00000375751.4_Nonsense_Mutation_p.Q275*|SYK_ENST00000375747.1_Nonsense_Mutation_p.Q275*	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	275	Interdomain B.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						AGGCCGTCCACAACTTCCAGG	0.448			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																			Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	0								ENSG00000165025						132.0	125.0	127.0					9																	93627356		2203	4300	6503	SYK	SO:0001587	stop_gained	0			-	HGNC	L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.823C>T	9.37:g.93627356C>T	ENSP00000364907:p.Gln275*	Somatic	0	42	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.Q275*	ENST00000375754.4	37	c.823	CCDS6688.1	9	.	.	.	.	.	.	.	.	.	.	C	32	5.159145	0.94686	.	.	ENSG00000165025	ENST00000375754;ENST00000375751;ENST00000375747;ENST00000375746	.	.	.	4.46	3.54	0.40534	.	1.420570	0.04366	N	0.358238	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	10.3047	0.43674	0.0:0.79:0.21:0.0	.	.	.	.	X	275	.	ENSP00000364898:Q275X	Q	+	1	0	SYK	92667177	0.005000	0.15991	0.003000	0.11579	0.252000	0.25951	1.965000	0.40471	1.438000	0.47492	0.561000	0.74099	CAA	-	pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70		0.448	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYK	protein_coding	OTTHUMT00000053018.1	C		-		93627356	+1	no_errors	ENST00000375746	ensembl	human	known	74_37	nonsense	SNP	0.003	T
EEF1G	1937	genome.wustl.edu	37	11	62327654	62327654	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr11:62327654G>A	ENST00000329251.4	-	9	1172	c.1042C>T	c.(1042-1044)Cga>Tga	p.R348*	MIR3654_ENST00000496634.2_3'UTR|EEF1G_ENST00000378019.3_Nonsense_Mutation_p.R398*	NM_001404.4	NP_001395.1	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1 gamma	348	EF-1-gamma C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00519}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to virus (GO:0009615)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	translation elongation factor activity (GO:0003746)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						TTGTCCAGTCGCTGGAACATT	0.512																																																	0								ENSG00000254772						44.0	42.0	43.0					11																	62327654		1988	4165	6153	EEF1G	SO:0001587	stop_gained	0			-	HGNC	X63526	CCDS44626.1	11q12.3	2008-02-05			ENSG00000254772	ENSG00000254772			3213	protein-coding gene	gene with protein product		130593				1598220, 1461723	Standard	NM_001404		Approved	EF1G	uc001ntm.1	P26641	OTTHUMG00000167567	ENST00000329251.4:c.1042C>T	11.37:g.62327654G>A	ENSP00000331901:p.Arg348*	Somatic	0	34	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	B4DTG2|Q6PJ62|Q6PK31|Q96CU2|Q9P196	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transl_elong_EF1_G_con,pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Transl_elong_EF1_G_con,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,pfscan_Transl_elong_EF1_G_con	p.R398*	ENST00000329251.4	37	c.1192	CCDS44626.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.557225	0.96514	.	.	ENSG00000254772	ENST00000329251;ENST00000378019;ENST00000424909	.	.	.	4.67	4.67	0.58626	.	0.056763	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1667	0.72833	0.0:0.0:1.0:0.0	.	.	.	.	X	348;398;117	.	ENSP00000331901:R348X	R	-	1	2	EEF1G	62084230	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.427000	0.80284	2.456000	0.83038	0.537000	0.68136	CGA	-	pfam_Transl_elong_EF1_G_con,superfamily_Transl_elong_EF1_G_con,pfscan_Transl_elong_EF1_G_con		0.512	EEF1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1G	protein_coding	OTTHUMT00000395047.1	G	NM_001404	-		62327654	-1	no_errors	ENST00000378019	ensembl	human	known	74_37	nonsense	SNP	1.000	A
MAP3K19	80122	genome.wustl.edu	37	2	135744087	135744087	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr2:135744087delG	ENST00000375845.3	-	7	2385	c.2355delC	c.(2353-2355)cccfs	p.P785fs	MAP3K19_ENST00000375844.3_Intron|MAP3K19_ENST00000392917.3_Intron|MAP3K19_ENST00000358371.4_Frame_Shift_Del_p.P672fs|MAP3K19_ENST00000392918.3_Intron|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000392915.1_Frame_Shift_Del_p.P802fs	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	785							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										CCAAGTTCATGGGATGAATTT	0.393																																																	0								ENSG00000176601						64.0	64.0	64.0					2																	135744087		2203	4300	6503	MAP3K19	SO:0001589	frameshift_variant	0				HGNC	AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.2355delC	2.37:g.135744087delG	ENSP00000365005:p.Pro785fs	Somatic	0	31	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	22	40.54	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.M786fs	ENST00000375845.3	37	c.2355	CCDS2176.2	2																																																																																			-	NULL		0.393	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K19	protein_coding	OTTHUMT00000158244.1	G	NM_025052			135744087	-1	no_errors	ENST00000375845	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
MORC3	23515	genome.wustl.edu	37	21	37692480	37692480	+	5'Flank	SNP	T	T	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr21:37692480T>A	ENST00000400485.1	+	0	0				AP000692.10_ENST00000608391.1_RNA	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3						cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						AAGTGGGCGGTACCCATAGGG	0.662																																																	0								ENSG00000273199																																			AP000692.10	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620		21.37:g.37692480T>A	Exception_encountered	Somatic	0	8	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	14	30.00	A8KA92|Q9UEZ2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000400485.1	37	NULL	CCDS42924.1	21																																																																																			-	-		0.662	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000273199	protein_coding	OTTHUMT00000194640.1	T	NM_015358	-		37692480	-1	no_errors	ENST00000608391	ensembl	human	known	74_37	rna	SNP	0.000	A
SYCP1	6847	genome.wustl.edu	37	1	115524091	115524091	+	Silent	SNP	G	G	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr1:115524091G>T	ENST00000369522.3	+	29	2757	c.2517G>T	c.(2515-2517)ctG>ctT	p.L839L	SYCP1_ENST00000369518.1_Silent_p.L839L|SYCP1_ENST00000477590.1_3'UTR	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	839					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)		RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAGACTATCTGTGGACATCTG	0.303																																																	0								ENSG00000198765						78.0	80.0	80.0					1																	115524091		2203	4297	6500	SYCP1	SO:0001819	synonymous_variant	0			-	HGNC	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2517G>T	1.37:g.115524091G>T		Somatic	0	31	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	O14963|Q5VXJ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SCP-1	p.L839	ENST00000369522.3	37	c.2517	CCDS879.1	1																																																																																			-	NULL		0.303	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	protein_coding	OTTHUMT00000033386.1	G	NM_003176	-		115524091	+1	no_errors	ENST00000369518	ensembl	human	known	74_37	silent	SNP	0.025	T
FGF9	2254	genome.wustl.edu	37	13	22275847	22275848	+	3'UTR	DEL	TA	TA	-	rs138451360|rs112896362|rs61706549|rs201279299|rs79021222|rs9796160|rs71093347|rs398037423	byFrequency	TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr13:22275847_22275848delTA	ENST00000382353.5	+	0	1430_1431				FGF9_ENST00000478546.1_3'UTR	NM_002010.2	NP_002001.1	P31371	FGF9_HUMAN	fibroblast growth factor 9						angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte differentiation (GO:0002062)|embryonic digestive tract development (GO:0048566)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|male gonad development (GO:0008584)|male sex determination (GO:0030238)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neurotrophin TRK receptor signaling pathway (GO:0048011)|osteoblast differentiation (GO:0001649)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein import into nucleus (GO:0006606)|regulation of timing of cell differentiation (GO:0048505)|signal transduction (GO:0007165)|substantia nigra development (GO:0021762)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|skin(2)	9		all_cancers(29;1.23e-20)|all_epithelial(30;9.83e-19)|all_lung(29;9.64e-17)|Lung SC(185;0.0262)|Breast(139;0.106)		all cancers(112;3.92e-05)|Epithelial(112;0.000166)|OV - Ovarian serous cystadenocarcinoma(117;0.00314)|Lung(94;0.163)		GGAgtgtgtgtatgtgtgtgtg	0.525																																					Melanoma(195;1939 2127 12623 13963 52730)												0								ENSG00000102678																																			FGF9	SO:0001624	3_prime_UTR_variant	0				HGNC	D14838	CCDS9298.1	13q11-q12	2014-01-30	2013-06-18		ENSG00000102678	ENSG00000102678		"""Endogenous ligands"""	3687	protein-coding gene	gene with protein product	"""glia-activating factor"""	600921	"""fibroblast growth factor 9 (glia-activating factor)"""			8321227	Standard	NM_002010		Approved		uc001uog.2	P31371	OTTHUMG00000017412	ENST00000382353.5:c.*274TA>-	13.37:g.22275847_22275848delTA		Somatic	0	44	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A8K427|Q3SY32	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000382353.5	37	NULL	CCDS9298.1	13																																																																																			-	-		0.525	FGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF9	protein_coding	OTTHUMT00000046002.2	TA				22275848	+1	no_errors	ENST00000478546	ensembl	human	known	74_37	rna	DEL	0.000:0.004	-
C12orf56	115749	genome.wustl.edu	37	12	64712546	64712547	+	In_Frame_Ins	INS	-	-	GTT	rs10671017|rs113411861|rs374938611	byFrequency	TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr12:64712546_64712547insGTT	ENST00000543942.2	-	4	1328_1329	c.702_703insAAC	c.(700-705)aactcc>aacAACtcc	p.234_235insN	RPS11P6_ENST00000535684.1_RNA|C12orf56_ENST00000333722.5_Intron	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	234										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		TCACTTATGGAGTTGTGATCTG	0.45														2194	0.438099	0.5802	0.3905	5008	,	,		18583	0.3452		0.4185	False		,,,				2504	0.3957																0								ENSG00000185306		,	1186,942		392,402,270					,	3.8	0.0		dbSNP_132	112	1695,2515		450,795,860	no	coding,intron	C12orf56	NM_001170633.1,NM_001099676.2	,	842,1197,1130	A1A1,A1R,RR		40.2613,44.2669,45.456	,	,		2881,3457				C12orf56	SO:0001652	inframe_insertion	0				HGNC		CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.700_702dupAAC	12.37:g.64712547_64712549dupGTT	ENSP00000446101:p.Asn234_Asn234dup	Somatic	0	68	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	55	15.38		In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	NULL	p.234in_frame_insN	ENST00000543942.2	37	c.703_702		12																																																																																			-	NULL		0.450	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf56	protein_coding	OTTHUMT00000401058.2	-	NM_001099676			64712547	-1	no_errors	ENST00000543942	ensembl	human	putative	74_37	in_frame_ins	INS	0.101:0.105	GTT
ALAS2	212	genome.wustl.edu	37	X	55047609	55047609	+	Missense_Mutation	SNP	C	C	A	rs137852304		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chrX:55047609C>A	ENST00000330807.5	-	5	651	c.514G>T	c.(514-516)Gct>Tct	p.A172S	ALAS2_ENST00000498636.1_5'Flank|ALAS2_ENST00000396198.3_Missense_Mutation_p.A159S|ALAS2_ENST00000335854.4_Missense_Mutation_p.A135S	NM_000032.4	NP_000023.2	P22557	HEM0_HUMAN	aminolevulinate, delta-, synthase 2	172					cellular iron ion homeostasis (GO:0006879)|erythrocyte differentiation (GO:0030218)|heme biosynthetic process (GO:0006783)|hemoglobin biosynthetic process (GO:0042541)|oxygen homeostasis (GO:0032364)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to hypoxia (GO:0001666)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5-aminolevulinate synthase activity (GO:0003870)|coenzyme binding (GO:0050662)|glycine binding (GO:0016594)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(2)|skin(1)	17					Glycine(DB00145)	TATGCATCAGCCCAGCGGTTC	0.478																																																	0			GRCh37	CM950022	ALAS2	M	rs137852304	ENSG00000158578						169.0	120.0	137.0					X																	55047609		2203	4300	6503	ALAS2	SO:0001583	missense	0			-	HGNC		CCDS14366.1, CCDS35303.1, CCDS43960.1	Xp11.21	2008-02-05	2008-02-04		ENSG00000158578	ENSG00000158578	2.3.1.37		397	protein-coding gene	gene with protein product	"""sideroblastic/hypochromic anemia"""	301300	"""aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia)"""	ASB		1577484	Standard	NM_000032		Approved		uc004dua.4	P22557	OTTHUMG00000021641	ENST00000330807.5:c.514G>T	X.37:g.55047609C>A	ENSP00000332369:p.Ala172Ser	Somatic	0	45	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	21	44.74	A8K3F0|A8K6C4|Q13735|Q5JZF5|Q8N6H3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aminotransferase_I/II,pfam_5aminolev_synth_preseq,pfam_Aminotrans_V/Cys_dSase,pfam_Cys/Met-Metab_PyrdxlP-dep_enz,superfamily_PyrdxlP-dep_Trfase,tigrfam_4pyrrol_synth_NH2levulA_synth	p.A172S	ENST00000330807.5	37	c.514	CCDS14366.1	X	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963109	0.92791	.	.	ENSG00000158578	ENST00000330807;ENST00000396198;ENST00000335854	D;D;D	0.94966	-3.57;-3.57;-3.57	4.92	4.92	0.64577	Tetrapyrrole biosynthesis, 5-aminolevulinic acid synthase (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.97081	0.9046	M	0.82132	2.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.74348	0.976;0.983;0.983	D	0.97692	1.0179	10	0.66056	D	0.02	-12.927	16.2829	0.82707	0.0:1.0:0.0:0.0	.	135;159;172	A8K6C4;Q5JZF5;P22557	.;.;HEM0_HUMAN	S	172;159;135	ENSP00000332369:A172S;ENSP00000379501:A159S;ENSP00000337131:A135S	ENSP00000332369:A172S	A	-	1	0	ALAS2	55064334	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.185000	0.69588	0.529000	0.55759	GCT	-	superfamily_PyrdxlP-dep_Trfase,tigrfam_4pyrrol_synth_NH2levulA_synth		0.478	ALAS2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ALAS2	protein_coding	OTTHUMT00000056843.3	C	NM_000032	-		55047609	-1	no_errors	ENST00000330807	ensembl	human	known	74_37	missense	SNP	1.000	A
SPATA17	128153	genome.wustl.edu	37	1	217822309	217822309	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr1:217822309A>G	ENST00000366933.4	+	2	209	c.154A>G	c.(154-156)Atc>Gtc	p.I52V		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	52	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.					cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TCGGGCATATATCAGGTATAT	0.299																																																	0								ENSG00000162814						108.0	106.0	107.0					1																	217822309		2203	4299	6502	SPATA17	SO:0001583	missense	0			-	HGNC	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.154A>G	1.37:g.217822309A>G	ENSP00000355900:p.Ile52Val	Somatic	0	35	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	19	26.92	A5D6N2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.I52V	ENST00000366933.4	37	c.154	CCDS1519.1	1	.	.	.	.	.	.	.	.	.	.	A	14.25	2.479535	0.44044	.	.	ENSG00000162814	ENST00000366933	T	0.71341	-0.56	5.33	1.62	0.23740	.	0.425883	0.24037	N	0.042137	T	0.70622	0.3245	M	0.62723	1.935	0.27295	N	0.957742	P	0.48998	0.918	P	0.51742	0.678	T	0.62338	-0.6875	10	0.48119	T	0.1	-1.6865	6.1218	0.20157	0.6067:0.3111:0.0822:0.0	.	52	Q96L03	SPT17_HUMAN	V	52	ENSP00000355900:I52V	ENSP00000355900:I52V	I	+	1	0	SPATA17	215888932	0.995000	0.38212	0.937000	0.37676	0.848000	0.48234	0.903000	0.28475	0.076000	0.16826	-1.300000	0.01332	ATC	-	superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS		0.299	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA17	protein_coding	OTTHUMT00000092433.2	A	NM_138796	-		217822309	+1	no_errors	ENST00000366933	ensembl	human	known	74_37	missense	SNP	0.992	G
LRRC37BP1	147172	genome.wustl.edu	37	17	28959016	28959016	+	RNA	SNP	T	T	G			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr17:28959016T>G	ENST00000417404.1	+	0	0									leucine rich repeat containing 37B pseudogene 1																		TCAATATTGTTACCGTTCACT	0.418																																																	0								ENSG00000250462																																			LRRC37BP1			0			-	HGNC	BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28959016T>G		Somatic	0	65	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	37	28.85		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000417404.1	37	NULL		17																																																																																			-	-		0.418	LRRC37BP1-003	KNOWN	basic	processed_transcript	LRRC37BP1	pseudogene	OTTHUMT00000256203.1	T	NR_015341	-		28959016	+1	no_errors	ENST00000412831	ensembl	human	known	74_37	rna	SNP	0.024	G
GRK7	131890	genome.wustl.edu	37	3	141535883	141535883	+	Silent	SNP	G	G	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr3:141535883G>A	ENST00000264952.2	+	4	1790	c.1653G>A	c.(1651-1653)ttG>ttA	p.L551L		NM_139209.2	NP_631948.1	Q8WTQ7	GRK7_HUMAN	G protein-coupled receptor kinase 7	551					protein autophosphorylation (GO:0046777)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	26						GCGTGTGTTTGTTATTGTAAA	0.458																																																	0								ENSG00000114124						129.0	120.0	123.0					3																	141535883		2203	4300	6503	GRK7	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3120.1	3q24	2004-02-04	2004-02-04	2004-02-04	ENSG00000114124	ENSG00000114124			17031	protein-coding gene	gene with protein product		606987		GPRK7		11717351, 11754336	Standard	NM_139209		Approved		uc011bnd.2	Q8WTQ7	OTTHUMG00000159068	ENST00000264952.2:c.1653G>A	3.37:g.141535883G>A		Somatic	0	16	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	5	44.44		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.L551	ENST00000264952.2	37	c.1653	CCDS3120.1	3																																																																																			-	NULL		0.458	GRK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK7	protein_coding	OTTHUMT00000353168.1	G	NM_139209	-		141535883	+1	no_errors	ENST00000264952	ensembl	human	known	74_37	silent	SNP	0.938	A
KRT8	3856	genome.wustl.edu	37	12	53298699	53298699	+	Missense_Mutation	SNP	G	G	A	rs201807576	byFrequency	TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr12:53298699G>A	ENST00000552551.1	-	2	499	c.67C>T	c.(67-69)Cgc>Tgc	p.R23C	KRT8_ENST00000293308.6_Missense_Mutation_p.R23C|KRT8_ENST00000552150.1_Missense_Mutation_p.R51C|KRT8_ENST00000546897.1_Missense_Mutation_p.R23C			P05787	K2C8_HUMAN	keratin 8	23	Head.|Ser-rich.				cell differentiation involved in embryonic placenta development (GO:0060706)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatocyte apoptotic process (GO:0097284)|response to hydrostatic pressure (GO:0051599)|response to other organism (GO:0051707)|sarcomere organization (GO:0045214)|tumor necrosis factor-mediated signaling pathway (GO:0033209)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	scaffold protein binding (GO:0097110)|structural molecule activity (GO:0005198)			endometrium(5)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(357;0.108)	Tenecteplase(DB00031)	GTGTAGGAGCGGCTGCTGAAG	0.667																																																	0								ENSG00000170421						11.0	13.0	13.0					12																	53298699		1953	3904	5857	KRT8	SO:0001583	missense	0			-	HGNC	BC000654	CCDS8841.1, CCDS58234.1	12q13.13	2013-01-16			ENSG00000170421	ENSG00000170421		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6446	protein-coding gene	gene with protein product		148060				2434381, 1705144, 16831889	Standard	NM_002273		Approved	CARD2, K8, CK8, CYK8, K2C8, KO	uc009zmk.1	P05787	OTTHUMG00000169881	ENST00000552551.1:c.67C>T	12.37:g.53298699G>A	ENSP00000447566:p.Arg23Cys	Somatic	0	67	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	45	15.09	A8K4H3|B0AZN5|F8VXB4|Q14099|Q14716|Q14717|Q53GJ0|Q6DHW5|Q6GMY0|Q6P4C7|Q96J60	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_II,prints_Keratin_I	p.R23C	ENST00000552551.1	37	c.67	CCDS8841.1	12	.	.	.	.	.	.	.	.	.	.	-	13.69	2.312705	0.40895	.	.	ENSG00000170421	ENST00000552551;ENST00000293308;ENST00000547916;ENST00000546897;ENST00000552150;ENST00000546826;ENST00000548998;ENST00000547413;ENST00000546542	D;D;D;D;D;D;D;T	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-0.98	4.71	4.71	0.59529	.	0.431059	0.26883	N	0.022003	T	0.75824	0.3902	L	0.33293	1	0.41950	D	0.99065	B;B;B	0.12630	0.006;0.003;0.003	B;B;B	0.15484	0.013;0.005;0.002	T	0.69450	-0.5142	10	0.27082	T	0.32	.	9.653	0.39908	0.0974:0.0:0.9026:0.0	.	51;23;23	F8VXB4;F8VU64;P05787	.;.;K2C8_HUMAN	C	23;23;23;23;51;23;63;23;101	ENSP00000447566:R23C;ENSP00000293308:R23C;ENSP00000447402:R23C;ENSP00000449404:R51C;ENSP00000447881:R23C;ENSP00000447040:R63C;ENSP00000448681:R23C;ENSP00000450228:R101C	ENSP00000293308:R23C	R	-	1	0	KRT8	51584966	0.070000	0.21116	1.000000	0.80357	0.819000	0.46315	0.097000	0.15168	2.582000	0.87167	0.531000	0.56144	CGC	-	NULL		0.667	KRT8-001	KNOWN	alternative_5_UTR|overlapping_uORF|basic|appris_principal|CCDS	protein_coding	KRT8	protein_coding	OTTHUMT00000406385.1	G	NM_002273	rs201807576		53298699	-1	no_errors	ENST00000293308	ensembl	human	known	74_37	missense	SNP	1.000	A
CNTLN	54875	genome.wustl.edu	37	9	17235703	17235703	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr9:17235703A>T	ENST00000380647.3	+	4	666	c.582A>T	c.(580-582)aaA>aaT	p.K194N	CNTLN_ENST00000380641.4_Missense_Mutation_p.K194N|CNTLN_ENST00000425824.1_Missense_Mutation_p.K194N|CNTLN_ENST00000262360.5_Missense_Mutation_p.K194N			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	194					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		TAAAACGGAAAATTGCAGTAG	0.308																																																	0								ENSG00000044459						107.0	105.0	106.0					9																	17235703		1806	4061	5867	CNTLN	SO:0001583	missense	0			-	HGNC	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.582A>T	9.37:g.17235703A>T	ENSP00000370021:p.Lys194Asn	Somatic	0	32	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	19	38.71	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.K194N	ENST00000380647.3	37	c.582	CCDS43789.1	9	.	.	.	.	.	.	.	.	.	.	A	9.621	1.133838	0.21123	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360;ENST00000380641	T;T;T;T	0.07216	3.21;3.21;3.21;3.21	5.42	3.51	0.40186	.	.	.	.	.	T	0.20455	0.0492	M	0.64997	1.995	0.25834	N	0.984139	D;D;D	0.76494	0.996;0.996;0.999	P;P;D	0.65443	0.866;0.866;0.935	T	0.05162	-1.0902	9	0.41790	T	0.15	.	7.3967	0.26939	0.3706:0.0:0.6294:0.0	.	194;194;194	C9J1F9;Q9NXG0-2;Q9NXG0-3	.;.;.	N	194	ENSP00000370021:K194N;ENSP00000392798:K194N;ENSP00000262360:K194N;ENSP00000370015:K194N	ENSP00000262360:K194N	K	+	3	2	CNTLN	17225703	1.000000	0.71417	0.413000	0.26509	0.199000	0.23934	1.272000	0.33109	0.758000	0.33059	-0.182000	0.12963	AAA	-	superfamily_Prefoldin		0.308	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTLN	protein_coding	OTTHUMT00000051793.3	A	NM_017738	-		17235703	+1	no_errors	ENST00000380647	ensembl	human	known	74_37	missense	SNP	0.993	T
OR52L1	338751	genome.wustl.edu	37	11	6007208	6007208	+	Missense_Mutation	SNP	C	C	T	rs377354838		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr11:6007208C>T	ENST00000332249.4	-	1	1007	c.953G>A	c.(952-954)cGc>cAc	p.R318H		NM_001005173.2	NP_001005173.2	Q8NGH7	O52L1_HUMAN	olfactory receptor, family 52, subfamily L, member 1	318						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|pancreas(1)|skin(3)|soft_tissue(1)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.98e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACTCGCTGGCGGATCTGCTG	0.502																																					Melanoma(121;653 1666 10547 22796 51255)												0								ENSG00000183313	C	HIS/ARG	1,4045		0,1,2022	46.0	46.0	46.0		953	2.7	1.0	11		46	0,8392		0,0,4196	no	missense	OR52L1	NM_001005173.2	29	0,1,6218	TT,TC,CC		0.0,0.0247,0.0080	benign	318/330	6007208	1,12437	2023	4196	6219	OR52L1	SO:0001583	missense	0			-	HGNC	AB065819	CCDS44529.1	11p15.4	2012-08-09			ENSG00000183313	ENSG00000183313		"""GPCR / Class A : Olfactory receptors"""	14785	protein-coding gene	gene with protein product							Standard	NM_001005173		Approved		uc001mcd.2	Q8NGH7	OTTHUMG00000165374	ENST00000332249.4:c.953G>A	11.37:g.6007208C>T	ENSP00000330338:p.Arg318His	Somatic	0	48	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	40	32.79	B2RPA6|Q6IFK9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R318H	ENST00000332249.4	37	c.953	CCDS44529.1	11	.	.	.	.	.	.	.	.	.	.	C	7.057	0.565582	0.13560	2.47E-4	0.0	ENSG00000183313	ENST00000332249	T	0.58358	0.34	3.57	2.66	0.31614	.	0.000000	0.43747	D	0.000530	T	0.39200	0.1069	.	.	.	0.25900	N	0.983364	B	0.14438	0.01	B	0.08055	0.003	T	0.37776	-0.9691	9	0.72032	D	0.01	.	7.926	0.29874	0.0:0.7896:0.0:0.2104	.	318	Q8NGH7	O52L1_HUMAN	H	318	ENSP00000330338:R318H	ENSP00000330338:R318H	R	-	2	0	OR52L1	5963784	0.002000	0.14202	0.999000	0.59377	0.005000	0.04900	0.220000	0.17660	0.844000	0.35094	-0.671000	0.03813	CGC	-	prints_GPCR_Rhodpsn		0.502	OR52L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52L1	protein_coding	OTTHUMT00000383754.1	C	NM_001005173	-		6007208	-1	no_errors	ENST00000332249	ensembl	human	known	74_37	missense	SNP	0.990	T
MUC3A	4584	genome.wustl.edu	37	7	100608194	100608195	+	Intron	INS	-	-	GTCTGGG			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr7:100608194_100608195insGTCTGGG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GTGGCCCCTCCACACTCCCCCA	0.614																																																	0								ENSG00000225946																																			RP11-395B7.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-112->GTCTGGG	7.37:g.100608194_100608195insGTCTGGG		Somatic	NA	NA	NA		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			-	-		0.614	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	protein_coding	OTTHUMT00000347215.1	-	XM_001725354			100608195	-1	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	INS	0.001:0.000	GTCTGGG
AC026320.1	0	genome.wustl.edu	37	3	191693737	191693749	+	RNA	DEL	TCTCTCCGTGTGT	TCTCTCCGTGTGT	-	rs199865256|rs371584059		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	TCTCTCCGTGTGT	TCTCTCCGTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr3:191693737_191693749delTCTCTCCGTGTGT	ENST00000401201.1	+	0	0_7																											tctctctctctctctcCgtgtgtgtgtgtgtgt	0.484																																																	0								ENSG00000216020																																			AC026320.1			0				Clone_based_ensembl_gene																													3.37:g.191693737_191693749delTCTCTCCGTGTGT		Somatic	NA	NA	NA		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401201.1	37	NULL		3																																																																																			-	-		0.484	AC026320.1-201	NOVEL	basic	miRNA	ENSG00000216020	miRNA		TCTCTCCGTGTGT				191693749	+1	no_errors	ENST00000401201	ensembl	human	novel	74_37	rna	DEL	0.003:0.003:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000	-
CEP152	22995	genome.wustl.edu	37	15	49048344	49048344	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr15:49048344C>T	ENST00000380950.2	-	20	3288	c.3101G>A	c.(3100-3102)cGg>cAg	p.R1034Q	CEP152_ENST00000325747.5_Missense_Mutation_p.R941Q|CEP152_ENST00000399334.3_Missense_Mutation_p.R1034Q	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	1034					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CAGTTGGATCCGCTTGGCTTC	0.413																																																	0								ENSG00000103995						148.0	136.0	140.0					15																	49048344		1920	4126	6046	CEP152	SO:0001583	missense	0			-	HGNC	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.3101G>A	15.37:g.49048344C>T	ENSP00000370337:p.Arg1034Gln	Somatic	0	63	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	47	35.62	E7ER66|Q17RV1|Q6NTA0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R1034Q	ENST00000380950.2	37	c.3101	CCDS58361.1	15	.	.	.	.	.	.	.	.	.	.	C	13.71	2.317423	0.40996	.	.	ENSG00000103995	ENST00000380950;ENST00000325747;ENST00000399334	T;T;T	0.57595	0.42;0.46;0.39	5.49	1.41	0.22369	.	0.226653	0.34555	N	0.003865	T	0.35998	0.0951	L	0.33245	0.995	0.24042	N	0.996071	B;P;P	0.51653	0.41;0.761;0.947	B;B;B	0.38225	0.031;0.077;0.268	T	0.26087	-1.0113	10	0.42905	T	0.14	-8.4016	11.3473	0.49567	0.0:0.7421:0.0:0.2579	.	941;1034;1034	O94986-1;E7ER66;O94986	.;.;CE152_HUMAN	Q	1034;941;1034	ENSP00000370337:R1034Q;ENSP00000321000:R941Q;ENSP00000382271:R1034Q	ENSP00000321000:R941Q	R	-	2	0	CEP152	46835636	0.007000	0.16637	0.814000	0.32528	0.866000	0.49608	0.979000	0.29500	0.359000	0.24239	-0.229000	0.12294	CGG	-	NULL		0.413	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP152	protein_coding	OTTHUMT00000417365.1	C	NM_014985	-		49048344	-1	no_errors	ENST00000380950	ensembl	human	known	74_37	missense	SNP	0.500	T
FRMPD2	143162	genome.wustl.edu	37	10	49452869	49452869	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr10:49452869C>T	ENST00000374201.3	-	4	635	c.333G>A	c.(331-333)atG>atA	p.M111I	FRMPD2_ENST00000407470.4_Intron|FRMPD2_ENST00000305531.3_Intron	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	111	KIND. {ECO:0000255|PROSITE- ProRule:PRU00709}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		AGTAGAGGGTCATTCCTAAAG	0.423																																																	0								ENSG00000170324						127.0	110.0	116.0					10																	49452869		2203	4300	6503	FRMPD2	SO:0001583	missense	0			-	HGNC	AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.333G>A	10.37:g.49452869C>T	ENSP00000363317:p.Met111Ile	Somatic	0	25	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	18	35.71	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.M111I	ENST00000374201.3	37	c.333	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134705	0.77662	.	.	ENSG00000170324	ENST00000374201	T	0.38077	1.16	5.1	4.2	0.49525	KIND (2);	.	.	.	.	T	0.56688	0.2002	M	0.79258	2.445	0.80722	D	1	D	0.69078	0.997	D	0.69479	0.964	T	0.60182	-0.7313	9	0.87932	D	0	.	9.4916	0.38962	0.0:0.9018:0.0:0.0982	.	111	Q68DX3	FRPD2_HUMAN	I	111	ENSP00000363317:M111I	ENSP00000363317:M111I	M	-	3	0	FRMPD2	49122875	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.196000	0.51020	1.157000	0.42530	0.467000	0.42956	ATG	-	superfamily_Kinase-like_dom,smart_KIND		0.423	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	protein_coding	OTTHUMT00000047923.3	C	NM_152428	-		49452869	-1	no_errors	ENST00000374201	ensembl	human	known	74_37	missense	SNP	1.000	T
DTWD1	56986	genome.wustl.edu	37	15	49926974	49926974	+	Missense_Mutation	SNP	C	C	G	rs547674376		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr15:49926974C>G	ENST00000251250.6	+	5	857	c.650C>G	c.(649-651)aCt>aGt	p.T217S	DTWD1_ENST00000558653.1_Missense_Mutation_p.T217S|DTWD1_ENST00000403028.3_Missense_Mutation_p.T217S|DTWD1_ENST00000415425.1_Missense_Mutation_p.T130S	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1	217										endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		AAAATATTCACTGATGAGCGA	0.328																																																	0								ENSG00000104047						58.0	69.0	65.0					15																	49926974		2104	4242	6346	DTWD1	SO:0001583	missense	0			-	HGNC	BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.650C>G	15.37:g.49926974C>G	ENSP00000251250:p.Thr217Ser	Somatic	0	22	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	10	33.33	Q567Q3|Q8WVG9|Q9NRU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DTW	p.T217S	ENST00000251250.6	37	c.650	CCDS10132.1	15	.	.	.	.	.	.	.	.	.	.	C	10.51	1.370829	0.24771	.	.	ENSG00000104047	ENST00000403028;ENST00000251250;ENST00000415425	T;T	0.22336	1.96;1.96	4.66	3.72	0.42706	DTW (1);	0.215828	0.47852	N	0.000216	T	0.11879	0.0289	N	0.11201	0.11	0.80722	D	1	B;B	0.09022	0.001;0.002	B;B	0.16722	0.009;0.016	T	0.08249	-1.0731	9	.	.	.	-5.5929	14.8165	0.70039	0.0:0.8548:0.1452:0.0	.	130;217	Q8N5C7-2;Q8N5C7	.;DTWD1_HUMAN	S	217;217;130	ENSP00000385399:T217S;ENSP00000251250:T217S	.	T	+	2	0	DTWD1	47714266	1.000000	0.71417	0.939000	0.37840	0.968000	0.65278	3.132000	0.50523	1.042000	0.40150	0.655000	0.94253	ACT	-	pfam_DTW		0.328	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTWD1	protein_coding	OTTHUMT00000254431.2	C	NM_020234	-		49926974	+1	no_errors	ENST00000251250	ensembl	human	known	74_37	missense	SNP	0.947	G
TP53	7157	genome.wustl.edu	37	17	7577130	7577130	+	Missense_Mutation	SNP	A	A	C			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr17:7577130A>C	ENST00000269305.4	-	8	997	c.808T>G	c.(808-810)Ttt>Gtt	p.F270V	TP53_ENST00000420246.2_Missense_Mutation_p.F270V|TP53_ENST00000445888.2_Missense_Mutation_p.F270V|TP53_ENST00000359597.4_Missense_Mutation_p.F270V|TP53_ENST00000455263.2_Missense_Mutation_p.F270V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	270	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F270L(15)|p.0?(8)|p.F270V(7)|p.F270I(5)|p.S269_F270>I(2)|p.?(2)|p.G266_E271delGRNSFE(2)|p.G262_F270delGNLLGRNSF(2)|p.F270fs*72(1)|p.S269fs*75(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.S269_F270insX(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CGCACCTCAAAGCTGTTCCGT	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	51	Substitution - Missense(27)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Unknown(2)|Complex - deletion inframe(2)|Insertion - In frame(1)	stomach(8)|large_intestine(7)|breast(5)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|oesophagus(4)|bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(3)|urinary_tract(2)|soft_tissue(1)|biliary_tract(1)|testis(1)|eye(1)|ovary(1)|liver(1)						ENSG00000141510						58.0	51.0	53.0					17																	7577130		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.808T>G	17.37:g.7577130A>C	ENSP00000269305:p.Phe270Val	Somatic	0	29	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	7	65.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F270V	ENST00000269305.4	37	c.808	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	22.4	4.279586	0.80692	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99778	-6.73;-6.73;-6.73;-6.73;-6.73;-6.73	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99420	0.9795	L	0.28556	0.865	0.58432	D	0.999999	D;B;D;D	0.89917	0.999;0.043;1.0;0.998	D;B;D;D	0.85130	0.997;0.196;0.997;0.996	D	0.98038	1.0380	10	0.87932	D	0	-25.5181	12.9367	0.58319	1.0:0.0:0.0:0.0	.	270;270;270;270	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	V	270;270;270;270;270;259;138	ENSP00000352610:F270V;ENSP00000269305:F270V;ENSP00000398846:F270V;ENSP00000391127:F270V;ENSP00000391478:F270V;ENSP00000425104:F138V	ENSP00000269305:F270V	F	-	1	0	TP53	7517855	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	9.060000	0.93907	2.154000	0.67381	0.379000	0.24179	TTT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546	-		7577130	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	C
MAPRE3	22924	genome.wustl.edu	37	2	27235945	27235945	+	Intron	SNP	G	G	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr2:27235945G>T	ENST00000233121.2	+	2	191				MAPRE3_ENST00000402218.1_5'Flank|AC013472.3_ENST00000455081.2_RNA|MAPRE3_ENST00000491354.1_Intron|MAPRE3_ENST00000405074.3_Intron|AC013472.3_ENST00000380387.3_RNA|AC013472.3_ENST00000411685.2_RNA			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3						mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGAGACATGGATGTGCTTTT	0.453																																																	0								ENSG00000205500																																			AC013472.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.-7-9135G>T	2.37:g.27235945G>T		Somatic	0	30	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000233121.2	37	NULL	CCDS1731.1	2																																																																																			-	-		0.453	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000205500	protein_coding	OTTHUMT00000214183.1	G	NM_012326	-		27235945	-1	no_errors	ENST00000380387	ensembl	human	known	74_37	rna	SNP	0.000	T
C2orf42	54980	genome.wustl.edu	37	2	70387846	70387846	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr2:70387846A>T	ENST00000264434.2	-	9	1806	c.1427T>A	c.(1426-1428)gTg>gAg	p.V476E	C2orf42_ENST00000420306.1_Missense_Mutation_p.V476E	NM_017880.1	NP_060350.1	Q9NWW7	CB042_HUMAN	chromosome 2 open reading frame 42	476										endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	12						TTCTACTTCCACTTTAGGGCA	0.413																																																	0								ENSG00000115998						137.0	134.0	135.0					2																	70387846		2203	4300	6503	C2orf42	SO:0001583	missense	0			-	HGNC	AK000565	CCDS1899.1	2p14	2011-03-08			ENSG00000115998	ENSG00000115998			26056	protein-coding gene	gene with protein product						12477932	Standard	XM_005264389		Approved	FLJ20558	uc002sgh.3	Q9NWW7	OTTHUMG00000129642	ENST00000264434.2:c.1427T>A	2.37:g.70387846A>T	ENSP00000264434:p.Val476Glu	Somatic	0	56	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	41	48.75	D6W5G3|Q9H629	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V476E	ENST00000264434.2	37	c.1427	CCDS1899.1	2	.	.	.	.	.	.	.	.	.	.	A	14.84	2.655515	0.47467	.	.	ENSG00000115998	ENST00000264434;ENST00000420306	D;D	0.93189	-3.18;-3.18	5.24	5.24	0.73138	.	0.230495	0.45361	D	0.000369	D	0.94394	0.8197	L	0.36672	1.1	0.47994	D	0.999567	D	0.64830	0.994	D	0.73380	0.98	D	0.94890	0.8047	10	0.66056	D	0.02	-19.916	14.1248	0.65213	1.0:0.0:0.0:0.0	.	476	Q9NWW7	CB042_HUMAN	E	476	ENSP00000264434:V476E;ENSP00000404515:V476E	ENSP00000264434:V476E	V	-	2	0	C2orf42	70241350	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.267000	0.72546	2.201000	0.70794	0.528000	0.53228	GTG	-	NULL		0.413	C2orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf42	protein_coding	OTTHUMT00000251840.1	A	NM_017880	-		70387846	-1	no_errors	ENST00000264434	ensembl	human	known	74_37	missense	SNP	1.000	T
GOLGA4	2803	genome.wustl.edu	37	3	37360696	37360697	+	Intron	INS	-	-	T	rs532989212		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr3:37360696_37360697insT	ENST00000361924.2	+	12	1919				GOLGA4_ENST00000435830.2_3'UTR|GOLGA4_ENST00000356847.4_Intron|GOLGA4_ENST00000444882.1_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4						Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GTAAGTGACTATTTTTTTTTTT	0.416																																																	0								ENSG00000144674																																			GOLGA4	SO:0001627	intron_variant	0				HGNC	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.1545+11->T	3.37:g.37360707_37360707dupT		Somatic	0	18	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000361924.2	37	NULL	CCDS2666.1	3																																																																																			-	-		0.416	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	protein_coding	OTTHUMT00000253339.2	-	NM_002078			37360697	+1	no_errors	ENST00000435830	ensembl	human	known	74_37	rna	INS	0.000:0.005	T
OR51V1	283111	genome.wustl.edu	37	11	5221043	5221043	+	Missense_Mutation	SNP	C	C	T	rs534810680		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr11:5221043C>T	ENST00000321255.1	-	1	887	c.888G>A	c.(886-888)atG>atA	p.M296I		NM_001004760.2	NP_001004760.2	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V, member 1	296					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(13)|lung(19)|skin(2)|upper_aerodigestive_tract(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGATGGGATTCATTAAAGGTG	0.433																																																	0								ENSG00000176742						91.0	86.0	87.0					11																	5221043		2201	4298	6499	OR51V1	SO:0001583	missense	0			-	HGNC	BK004432	CCDS31375.1	11p15.4	2012-08-09			ENSG00000176742	ENSG00000176742		"""GPCR / Class A : Olfactory receptors"""	19597	protein-coding gene	gene with protein product				OR51A12			Standard	NM_001004760		Approved		uc010qyz.2	Q9H2C8	OTTHUMG00000066671	ENST00000321255.1:c.888G>A	11.37:g.5221043C>T	ENSP00000321729:p.Met296Ile	Somatic	0	91	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	46	46.51		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M296I	ENST00000321255.1	37	c.888	CCDS31375.1	11	.	.	.	.	.	.	.	.	.	.	C	11.04	1.523217	0.27299	.	.	ENSG00000176742	ENST00000321255	T	0.34072	1.38	5.27	5.27	0.74061	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000005	T	0.33933	0.0880	L	0.48642	1.525	0.26584	N	0.973317	B	0.26672	0.156	B	0.29267	0.1	T	0.30475	-0.9977	10	0.56958	D	0.05	.	12.6682	0.56853	0.1651:0.8349:0.0:0.0	.	296	Q9H2C8	O51V1_HUMAN	I	296	ENSP00000321729:M296I	ENSP00000321729:M296I	M	-	3	0	OR51V1	5177619	0.189000	0.23263	1.000000	0.80357	0.376000	0.30014	-0.362000	0.07602	2.742000	0.94016	0.655000	0.94253	ATG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.433	OR51V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51V1	protein_coding	OTTHUMT00000142965.1	C	NM_001004760	-		5221043	-1	no_errors	ENST00000321255	ensembl	human	known	74_37	missense	SNP	0.997	T
ZFAND3	60685	genome.wustl.edu	37	6	38120497	38120497	+	3'UTR	SNP	C	C	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr6:38120497C>T	ENST00000287218.4	+	0	1463				ZFAND3_ENST00000373391.2_3'UTR|ZFAND3_ENST00000463847.1_3'UTR	NM_021943.2	NP_068762.1	Q9H8U3	ZFAN3_HUMAN	zinc finger, AN1-type domain 3								DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(4)|lung(2)|ovary(1)	9						GAAAGTGTTCCAGACGGAGAC	0.403																																																	0								ENSG00000156639																																			ZFAND3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK023284	CCDS4836.1	6p21.2	2013-09-19	2005-12-15	2005-12-15	ENSG00000156639	ENSG00000156639		"""Zinc fingers, AN1-type domain containing"""	18019	protein-coding gene	gene with protein product		607455	"""testis expressed sequence 27"""	TEX27			Standard	NM_021943		Approved	FLJ13222	uc003onx.3	Q9H8U3	OTTHUMG00000014629	ENST00000287218.4:c.*332C>T	6.37:g.38120497C>T		Somatic	0	31	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	14	50.00	Q5SZZ0|Q5SZZ1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000287218.4	37	NULL	CCDS4836.1	6																																																																																			-	-		0.403	ZFAND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAND3	protein_coding	OTTHUMT00000040424.3	C	NM_021943	-		38120497	+1	no_errors	ENST00000440482	ensembl	human	known	74_37	rna	SNP	1.000	T
PML	5371	genome.wustl.edu	37	15	74315216	74315216	+	Missense_Mutation	SNP	T	T	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr15:74315216T>A	ENST00000268058.3	+	3	746	c.650T>A	c.(649-651)cTc>cAc	p.L217H	PML_ENST00000359928.4_Missense_Mutation_p.L217H|PML_ENST00000395135.3_Missense_Mutation_p.L217H|PML_ENST00000436891.3_Missense_Mutation_p.L217H|PML_ENST00000569477.1_Missense_Mutation_p.L217H|PML_ENST00000435786.2_Missense_Mutation_p.L217H|PML_ENST00000567543.1_Missense_Mutation_p.L217H|PML_ENST00000569965.1_Missense_Mutation_p.L217H|PML_ENST00000268059.6_Missense_Mutation_p.L217H|PML_ENST00000395132.2_Missense_Mutation_p.L217H|PML_ENST00000354026.6_Missense_Mutation_p.L217H|PML_ENST00000563500.1_Missense_Mutation_p.L217H|PML_ENST00000564428.1_Missense_Mutation_p.L217H|PML_ENST00000565898.1_Missense_Mutation_p.L217H	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	217					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						TCGTGCGCGCTCCTTGACAGC	0.597			T	"""RARA, PAX5"""	"""APL, ALL"""																																			Dom	yes		15	15q22	5371	promyelocytic leukemia		L	0								ENSG00000140464						40.0	37.0	38.0					15																	74315216		2198	4297	6495	PML	SO:0001583	missense	0			-	HGNC	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.650T>A	15.37:g.74315216T>A	ENSP00000268058:p.Leu217His	Somatic	0	24	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3583,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.L217H	ENST00000268058.3	37	c.650	CCDS10255.1	15	.	.	.	.	.	.	.	.	.	.	T	16.17	3.046639	0.55110	.	.	ENSG00000140464	ENST00000395135;ENST00000435786;ENST00000359928;ENST00000436891;ENST00000268058;ENST00000395132;ENST00000268059;ENST00000354026;ENST00000418568	T;T;T;T	0.59638	0.25;0.25;0.51;0.25	4.82	4.82	0.62117	Zinc finger, B-box (1);	0.000000	0.46442	D	0.000285	T	0.65903	0.2736	L	0.36672	1.1	0.35438	D	0.79467	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.996;1.0;1.0;0.999;0.998;1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D;D;D;D;D;P	0.85130	0.91;0.969;0.982;0.946;0.959;0.972;0.997;0.982;0.995;0.971;0.997;0.864	T	0.75513	-0.3291	10	0.87932	D	0	-31.7679	11.7659	0.51930	0.0:0.0:0.0:1.0	.	167;217;217;217;217;217;217;217;217;217;217;220	Q59GQ8;P29590;P29590-11;P29590-12;P29590-5;E9PBR7;P29590-13;P29590-4;P29590-2;P29590-14;P29590-8;Q59H09	.;PML_HUMAN;.;.;.;.;.;.;.;.;.;.	H	217	ENSP00000353004:L217H;ENSP00000394642:L217H;ENSP00000268058:L217H;ENSP00000378564:L217H	ENSP00000268058:L217H	L	+	2	0	PML	72102269	0.422000	0.25473	0.994000	0.49952	0.412000	0.31113	4.307000	0.59123	1.805000	0.52779	0.260000	0.18958	CTC	-	pfscan_Znf_B-box		0.597	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PML	protein_coding	OTTHUMT00000269021.3	T	NM_002675	-		74315216	+1	no_errors	ENST00000268058	ensembl	human	known	74_37	missense	SNP	0.990	A
WNK4	65266	genome.wustl.edu	37	17	40936573	40936573	+	Silent	SNP	G	G	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr17:40936573G>A	ENST00000246914.5	+	4	1167	c.1146G>A	c.(1144-1146)gcG>gcA	p.A382A		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	382	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		AGAATGCCGCGCAAATCTACC	0.612																																					Esophageal Squamous(6;201 374 4964 23855 42828)												0								ENSG00000126562						73.0	60.0	65.0					17																	40936573		2203	4300	6503	WNK4	SO:0001819	synonymous_variant	0			-	HGNC	AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.1146G>A	17.37:g.40936573G>A		Somatic	0	44	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	41	24.07	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A382	ENST00000246914.5	37	c.1146	CCDS11439.1	17																																																																																			-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.612	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK4	protein_coding	OTTHUMT00000452389.1	G		-		40936573	+1	no_errors	ENST00000246914	ensembl	human	known	74_37	silent	SNP	0.708	A
SETD1B	23067	genome.wustl.edu	37	12	122257636	122257636	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr12:122257636A>G	ENST00000604567.1	+	11	3813	c.3745A>G	c.(3745-3747)Atg>Gtg	p.M1249V	SETD1B_ENST00000542440.1_Missense_Mutation_p.M1206V|SETD1B_ENST00000267197.5_Missense_Mutation_p.M1206V			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	1249	Glu-rich.|Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GCGGCCCTCCATGCTGGACGA	0.672																																																	0								ENSG00000139718						63.0	85.0	78.0					12																	122257636		692	1591	2283	SETD1B	SO:0001583	missense	0			-	HGNC	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.3745A>G	12.37:g.122257636A>G	ENSP00000474253:p.Met1249Val	Somatic	0	118	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	101	24.06	F6MFW1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.M1206V	ENST00000604567.1	37	c.3616		12	.	.	.	.	.	.	.	.	.	.	A	7.278	0.608510	0.14002	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	T;T	0.32753	1.44;1.44	4.63	-8.32	0.00996	.	4.216450	0.00357	N	0.000035	T	0.16599	0.0399	N	0.05441	-0.05	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10753	-1.0616	10	0.25106	T	0.35	.	15.0501	0.71862	0.1427:0.116:0.7412:0.0	.	1206	Q9UPS6	SET1B_HUMAN	V	1206	ENSP00000442924:M1206V;ENSP00000267197:M1206V	ENSP00000267197:M1206V	M	+	1	0	SETD1B	120742019	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.388000	0.02533	-1.836000	0.01190	-0.451000	0.05528	ATG	-	NULL		0.672	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	protein_coding	OTTHUMT00000468264.1	A	XM_037523	-		122257636	+1	no_errors	ENST00000267197	ensembl	human	known	74_37	missense	SNP	0.000	G
MIR9-2	407047	genome.wustl.edu	37	5	87968913	87968913	+	IGR	DEL	A	A	-			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr5:87968913delA								LINC00461 (6156 upstream) : CTC-467M3.1 (3122 downstream)																							CGGCGTCTCCAAAAAAAAAAA	0.478																																																	0								ENSG00000245526																																			LINC00461	SO:0001628	intergenic_variant	0				HGNC																													5.37:g.87968913delA		Somatic	0	9	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL		37	NULL		5																																																																																			-	-	0	0.478					LINC00461			A				87968913	-1	no_errors	ENST00000505030	ensembl	human	known	74_37	rna	DEL	0.805	-
USH1C	10083	genome.wustl.edu	37	11	17515733	17515733	+	3'UTR	SNP	G	G	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr11:17515733G>T	ENST00000318024.4	-	0	1945				USH1C_ENST00000527720.1_3'UTR|USH1C_ENST00000527020.1_3'UTR|USH1C_ENST00000529563.1_5'UTR	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)						auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						TCCTTATCTGGCCCTGGTTCA	0.537																																																	0								ENSG00000006611																																			USH1C	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.*178C>A	11.37:g.17515733G>T		Somatic	0	50	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	27	28.95	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000318024.4	37	NULL	CCDS31438.1	11																																																																																			-	-		0.537	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	protein_coding	OTTHUMT00000389146.1	G	NM_005709	-		17515733	-1	no_errors	ENST00000529563	ensembl	human	known	74_37	rna	SNP	0.001	T
CCDC122	160857	genome.wustl.edu	37	13	44443482	44443482	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr13:44443482C>G	ENST00000444614.3	-	3	289	c.31G>C	c.(31-33)Gga>Cga	p.G11R	CCDC122_ENST00000281508.3_Missense_Mutation_p.G11R|CCDC122_ENST00000476570.2_5'UTR	NM_144974.3	NP_659411.2	Q5T0U0	CC122_HUMAN	coiled-coil domain containing 122	11										endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9		Lung NSC(96;7.5e-06)|Breast(139;0.00765)|Hepatocellular(98;0.00826)|Prostate(109;0.0143)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000767)|BRCA - Breast invasive adenocarcinoma(63;0.128)		TTAGGAAATCCTTGACTCTTC	0.308																																																	0								ENSG00000151773						171.0	144.0	153.0					13																	44443482		2203	4297	6500	CCDC122	SO:0001583	missense	0			-	HGNC	AK056408	CCDS9390.2	13q14.11	2008-10-30			ENSG00000151773	ENSG00000151773			26478	protein-coding gene	gene with protein product		613408					Standard	NM_144974		Approved	FLJ31846	uc010acf.3	Q5T0U0	OTTHUMG00000017413	ENST00000444614.3:c.31G>C	13.37:g.44443482C>G	ENSP00000407763:p.Gly11Arg	Somatic	0	48	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	34	32.00	B2RP70|B7ZMI9|Q96MV0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G11R	ENST00000444614.3	37	c.31	CCDS9390.2	13	.	.	.	.	.	.	.	.	.	.	c	4.900	0.167294	0.09339	.	.	ENSG00000151773	ENST00000444614;ENST00000281508	T;T	0.39997	1.05;1.05	5.21	3.37	0.38596	.	1.655060	0.03147	N	0.167370	T	0.30696	0.0773	N	0.22421	0.69	0.09310	N	1	B;B	0.24258	0.1;0.003	B;B	0.18263	0.021;0.005	T	0.16364	-1.0405	10	0.25106	T	0.35	-7.8285	7.1328	0.25510	0.0:0.7809:0.0:0.2191	.	11;11	B7ZMJ0;Q5T0U0	.;CC122_HUMAN	R	11	ENSP00000407763:G11R;ENSP00000281508:G11R	ENSP00000281508:G11R	G	-	1	0	CCDC122	43341482	0.002000	0.14202	0.045000	0.18777	0.380000	0.30137	0.657000	0.24963	1.358000	0.45922	0.454000	0.30748	GGA	-	NULL		0.308	CCDC122-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	CCDC122	protein_coding	OTTHUMT00000276172.4	C	NM_144974	-		44443482	-1	no_errors	ENST00000281508	ensembl	human	known	74_37	missense	SNP	0.006	G
HERC2P2	400322	genome.wustl.edu	37	15	23285254	23285258	+	RNA	DEL	TCCCT	TCCCT	-	rs371652666|rs376132915	byFrequency	TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	TCCCT	TCCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr15:23285254_23285258delTCCCT	ENST00000560464.1	-	0	5097									hect domain and RLD 2 pseudogene 2																		CTTTCTTCTCtcccttcccttccct	0.478																																																	0								ENSG00000140181																																			HERC2P2			0				HGNC	AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23285264_23285268delTCCCT		Somatic	NA	NA	NA		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560464.1	37	NULL		15																																																																																			-	-		0.478	HERC2P2-001	KNOWN	basic	processed_transcript	HERC2P2	pseudogene	OTTHUMT00000415936.1	TCCCT				23285258	-1	no_errors	ENST00000558398	ensembl	human	known	74_37	rna	DEL	0.002:0.001:0.002:0.002:0.006	-
STAT2	6773	genome.wustl.edu	37	12	56743168	56743168	+	Intron	SNP	C	C	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr12:56743168C>T	ENST00000314128.4	-	15	1365				STAT2_ENST00000556539.1_Intron|STAT2_ENST00000418572.2_Nonsense_Mutation_p.W457*|STAT2_ENST00000557235.1_Intron			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa						cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						ATGCCTTCTTCCAAAGCTGCT	0.473																																																	0								ENSG00000170581						130.0	134.0	133.0					12																	56743168		2203	4300	6503	STAT2	SO:0001627	intron_variant	0			-	HGNC	BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.1341+41G>A	12.37:g.56743168C>T		Somatic	0	85	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	79	9.20	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_STAT_TF_alpha,pfam_STAT_TF_DNA-bd,pfam_STAT_TF_prot_interaction,superfamily_STAT_TF_coiled-coil,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction	p.W457*	ENST00000314128.4	37	c.1371	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	C	15.13	2.742219	0.49151	.	.	ENSG00000170581	ENST00000418572	.	.	.	5.3	0.333	0.15943	.	.	.	.	.	.	.	.	.	.	.	0.25495	N	0.98761	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.0791	0.09917	0.1531:0.5088:0.0:0.3381	.	.	.	.	X	457	.	ENSP00000387354:W457X	W	-	3	0	STAT2	55029435	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.056000	0.11787	-0.135000	0.11495	-0.244000	0.11960	TGG	-	NULL		0.473	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	protein_coding	OTTHUMT00000410277.1	C	NM_005419	-		56743168	-1	no_errors	ENST00000418572	ensembl	human	putative	74_37	nonsense	SNP	0.000	T
SDR9C7	121214	genome.wustl.edu	37	12	57327965	57327965	+	Silent	SNP	G	G	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr12:57327965G>A	ENST00000293502.1	-	1	224	c.81C>T	c.(79-81)taC>taT	p.Y27Y		NM_148897.2	NP_683695.1	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C, member 7	27					oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	retinol dehydrogenase activity (GO:0004745)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|pancreas(1)	7						TGATGAAGACGTACTTCTCTG	0.547																																																	0								ENSG00000170426						77.0	73.0	75.0					12																	57327965		2203	4300	6503	SDR9C7	SO:0001819	synonymous_variant	0			-	HGNC	AY044434	CCDS8926.1	12q13.3	2014-09-04			ENSG00000170426	ENSG00000170426	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	29958	protein-coding gene	gene with protein product		609769				12234675, 19027726	Standard	NM_148897		Approved	SDR-O, RDHS	uc010sqw.2	Q8NEX9	OTTHUMG00000171004	ENST00000293502.1:c.81C>T	12.37:g.57327965G>A		Somatic	0	33	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	24	38.46	B3KVB4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.Y27	ENST00000293502.1	37	c.81	CCDS8926.1	12																																																																																			-	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH		0.547	SDR9C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDR9C7	protein_coding	OTTHUMT00000411211.1	G	NM_148897	-		57327965	-1	no_errors	ENST00000293502	ensembl	human	known	74_37	silent	SNP	0.983	A
MUC3A	4584	genome.wustl.edu	37	7	100608197	100608198	+	Intron	INS	-	-	GGG	rs373235112		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr7:100608197_100608198insGGG	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						GCCCCTCCACACTCCCCCAGAC	0.609																																																	0								ENSG00000225946																																			RP11-395B7.2	SO:0001627	intron_variant	0				Clone_based_vega_gene	AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-109->GGG	7.37:g.100608197_100608198insGGG		Somatic	0	23	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			-	-		0.609	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	protein_coding	OTTHUMT00000347215.1	-	XM_001725354			100608198	-1	no_errors	ENST00000420080	ensembl	human	known	74_37	rna	INS	0.000:0.000	GGG
RWDD3	25950	genome.wustl.edu	37	1	95712051	95712058	+	Intron	DEL	GAGACTCA	GAGACTCA	-	rs71588551|rs148395594	byFrequency	TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	GAGACTCA	GAGACTCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr1:95712051_95712058delGAGACTCA	ENST00000370202.4	+	3	649				RWDD3_ENST00000263893.6_Intron|RP11-57H12.5_ENST00000598739.1_RNA|RWDD3_ENST00000495272.1_Intron|RP11-57H12.5_ENST00000444665.1_RNA	NM_001199682.1|NM_015485.4	NP_001186611.1|NP_056300	Q9Y3V2	RWDD3_HUMAN	RWD domain containing 3						negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of hypoxia-inducible factor-1alpha signaling pathway (GO:1902073)|positive regulation of protein sumoylation (GO:0033235)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(2)|lung(6)|ovary(1)	10		all_epithelial(167;5.99e-05)|all_lung(203;0.00168)|Lung NSC(277;0.00769)		all cancers(265;0.112)|Epithelial(280;0.229)		CTGGGACTTTGAGACTCAGAGTAAGATA	0.317														160	0.0319489	0.0303	0.0389	5008	,	,		18982	0.0		0.0795	False		,,,				2504	0.0133																0								ENSG00000122481		,,	132,3340		3,126,1607					,,	1.8	0.0		dbSNP_130	33	622,7168		28,566,3301	no	intron,intron,intron	RWDD3	NM_015485.4,NM_001199682.1,NM_001128142.1	,,	31,692,4908	A1A1,A1R,RR		7.9846,3.8018,6.6951	,,	,,		754,10508				RWDD3	SO:0001627	intron_variant	0				HGNC	BC010936	CCDS41357.1, CCDS44177.1	1p22.1	2012-12-07			ENSG00000122481	ENSG00000122481			21393	protein-coding gene	gene with protein product		615875				11230166	Standard	NM_015485		Approved	DKFZP566K023	uc009wdu.3	Q9Y3V2	OTTHUMG00000010910	ENST00000370202.4:c.574-40GAGACTCA>-	1.37:g.95712051_95712058delGAGACTCA		Somatic	NA	NA	NA		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NP44|A8K9F0|C9J9L7|C9JI45|Q08AJ7|Q6FID3|Q9BX35	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370202.4	37	NULL	CCDS41357.1	1																																																																																			-	-		0.317	RWDD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RWDD3	protein_coding	OTTHUMT00000030078.1	GAGACTCA	NM_015485			95712058	+1	no_errors	ENST00000460571	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.000:0.000:0.000:0.002:0.010:0.069	-
GCA	25801	genome.wustl.edu	37	2	163204108	163204108	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr2:163204108G>T	ENST00000437150.2	+	2	209	c.48G>T	c.(46-48)caG>caT	p.Q16H	GCA_ENST00000233612.4_5'UTR|GCA_ENST00000473240.1_3'UTR|GCA_ENST00000429691.2_5'UTR	NM_012198.3	NP_036330.1	P28676	GRAN_HUMAN	grancalcin, EF-hand calcium binding protein	16					membrane fusion (GO:0061025)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|lung(4)|ovary(1)	9						TTAGCATTCAGGTGCCAGGAA	0.393																																																	0								ENSG00000115271						75.0	73.0	74.0					2																	163204108		2203	4300	6503	GCA	SO:0001583	missense	0			-	HGNC	M81637	CCDS2218.1	2q24.2	2013-01-10	2001-11-28		ENSG00000115271	ENSG00000115271		"""EF-hand domain containing"""	15990	protein-coding gene	gene with protein product		607030	"""grancalcin, EF-hand calcium-binding protein"""			1737748, 1530588, 12804766	Standard	NM_012198		Approved	GCL	uc002ucg.3	P28676	OTTHUMG00000132057	ENST00000437150.2:c.48G>T	2.37:g.163204108G>T	ENSP00000394842:p.Gln16His	Somatic	0	57	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B2R5X3|Q53TB5|Q59EP3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.Q16H	ENST00000437150.2	37	c.48	CCDS2218.1	2	.	.	.	.	.	.	.	.	.	.	G	8.888	0.953274	0.18431	.	.	ENSG00000115271	ENST00000446271;ENST00000437150	D;T	0.89552	-2.53;-1.04	4.64	0.692	0.18050	.	8.914510	0.01307	U	0.010499	D	0.85102	0.5620	L	0.51422	1.61	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.70223	-0.4931	10	0.66056	D	0.02	.	1.8595	0.03186	0.1575:0.1357:0.4277:0.2791	.	16	P28676	GRAN_HUMAN	H	42;16	ENSP00000393218:Q42H;ENSP00000394842:Q16H	ENSP00000394842:Q16H	Q	+	3	2	GCA	162912354	0.998000	0.40836	0.942000	0.38095	0.425000	0.31504	0.154000	0.16343	-0.096000	0.12329	-0.218000	0.12543	CAG	-	NULL		0.393	GCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCA	protein_coding	OTTHUMT00000255080.3	G	NM_012198	-		163204108	+1	no_errors	ENST00000437150	ensembl	human	known	74_37	missense	SNP	0.999	T
SIK1	150094	genome.wustl.edu	37	21	44836772	44836772	+	Silent	SNP	A	A	T	rs368699653		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr21:44836772A>T	ENST00000270162.6	-	14	2334	c.2202T>A	c.(2200-2202)atT>atA	p.I734I		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	734					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	GGCCGGTGCCAATGTGCAGGT	0.741																																																	0								ENSG00000142178						9.0	10.0	10.0					21																	44836772		2154	4204	6358	SIK1	SO:0001819	synonymous_variant	0			-	HGNC	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.2202T>A	21.37:g.44836772A>T		Somatic	0	16	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I734	ENST00000270162.6	37	c.2202	CCDS33575.1	21																																																																																			-	pirsf_Ser/Thr_kinase_SIK1/2		0.741	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK1	protein_coding	OTTHUMT00000195654.1	A	NM_173354	-		44836772	-1	no_errors	ENST00000270162	ensembl	human	known	74_37	silent	SNP	1.000	T
LINC01317	104355287	genome.wustl.edu	37	2	33951529	33951530	+	lincRNA	INS	-	-	T	rs397714251|rs146470076	byFrequency	TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr2:33951529_33951530insT	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							AGATACATACATTTTTTTTAAT	0.515														770	0.153754	0.2534	0.1254	5008	,	,		16160	0.0327		0.1252	False		,,,				2504	0.1933																0								ENSG00000239649																																			MYADML			0				HGNC																													2.37:g.33951537_33951537dupT		Somatic	0	10	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	9	30.77		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			-	-		0.515	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	lincRNA	OTTHUMT00000325406.1	-				33951530	-1	no_errors	ENST00000474610	ensembl	human	known	74_37	rna	INS	0.000:0.004	T
ARFGEF1	10565	genome.wustl.edu	37	8	68115436	68115436	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr8:68115436C>T	ENST00000262215.3	-	36	5399	c.5010G>A	c.(5008-5010)atG>atA	p.M1670I	ARFGEF1_ENST00000517955.1_5'Flank|ARFGEF1_ENST00000518230.1_Missense_Mutation_p.M508I|ARFGEF1_ENST00000520381.1_Missense_Mutation_p.M1124I	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1670					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AAAAGCGGTACATTCCTTGGT	0.388																																																	0								ENSG00000066777						172.0	142.0	152.0					8																	68115436		2203	4300	6503	ARFGEF1	SO:0001583	missense	0			-	HGNC	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.5010G>A	8.37:g.68115436C>T	ENSP00000262215:p.Met1670Ile	Somatic	0	55	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	33	26.67	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sec7_dom,pfam_DUF1981_Sec7_assoc,superfamily_Sec7_dom,superfamily_ARM-type_fold,smart_Sec7_dom,pfscan_Sec7_dom	p.M1670I	ENST00000262215.3	37	c.5010	CCDS6199.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.113656	0.94339	.	.	ENSG00000066777	ENST00000520381;ENST00000262215;ENST00000518789;ENST00000518230	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.68412	0.2998	M	0.70595	2.14	0.80722	D	1	D;D;P;D	0.71674	0.998;0.97;0.949;0.97	D;P;P;P	0.79784	0.993;0.77;0.642;0.77	T	0.71869	-0.4462	10	0.59425	D	0.04	.	17.7834	0.88530	0.0:1.0:0.0:0.0	.	1670;1148;494;1124	Q9Y6D6;Q59FY5;B3KMS9;E5RIF2	BIG1_HUMAN;.;.;.	I	1124;1670;1;508	ENSP00000428429:M1124I;ENSP00000262215:M1670I;ENSP00000429560:M1I;ENSP00000430891:M508I	ENSP00000262215:M1670I	M	-	3	0	ARFGEF1	68277990	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.357000	0.79964	0.650000	0.86243	ATG	-	NULL		0.388	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	protein_coding	OTTHUMT00000379441.4	C	NM_006421	-		68115436	-1	no_errors	ENST00000262215	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF880	400713	genome.wustl.edu	37	19	52888544	52888544	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr19:52888544A>G	ENST00000422689.2	+	4	1726	c.1711A>G	c.(1711-1713)Act>Gct	p.T571A		NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880	571					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						CAGAATCCATACTGGAGAGAA	0.388																																																	0								ENSG00000221923						70.0	64.0	66.0					19																	52888544		692	1591	2283	ZNF880	SO:0001583	missense	0			-	HGNC	BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.1711A>G	19.37:g.52888544A>G	ENSP00000406318:p.Thr571Ala	Somatic	0	30	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	16	48.39	B4DNA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T571A	ENST00000422689.2	37	c.1711	CCDS46164.1	19	.	.	.	.	.	.	.	.	.	.	A	9.083	0.999814	0.19121	.	.	ENSG00000221923	ENST00000422689	T	0.06528	3.29	1.79	0.314	0.15847	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07593	0.0191	M	0.70903	2.155	0.19775	N	0.999959	P	0.47191	0.891	B	0.38755	0.281	T	0.22906	-1.0203	8	.	.	.	.	5.9488	0.19234	0.7182:0.0:0.0:0.2818	.	571	Q6PDB4	ZN880_HUMAN	A	571	ENSP00000406318:T571A	.	T	+	1	0	ZNF880	57580356	0.041000	0.20044	0.012000	0.15200	0.088000	0.18126	0.778000	0.26732	-0.300000	0.08895	0.363000	0.22086	ACT	-	pfscan_Znf_C2H2		0.388	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	protein_coding	OTTHUMT00000397374.1	A	NM_001145434	-		52888544	+1	no_errors	ENST00000422689	ensembl	human	known	74_37	missense	SNP	0.992	G
BNC2	54796	genome.wustl.edu	37	9	16738393	16738393	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr9:16738393C>T	ENST00000380672.4	-	2	151	c.94G>A	c.(94-96)Gtc>Atc	p.V32I	BNC2_ENST00000380667.2_Missense_Mutation_p.V32I|BNC2_ENST00000380666.2_Missense_Mutation_p.V32I|BNC2_ENST00000545497.1_Intron	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CAACATGGGACCTTGAAATAT	0.443																																																	0								ENSG00000173068						179.0	147.0	158.0					9																	16738393		2203	4300	6503	BNC2	SO:0001583	missense	0			-	HGNC	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.94G>A	9.37:g.16738393C>T	ENSP00000370047:p.Val32Ile	Somatic	0	68	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	45	39.19		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V32I	ENST00000380672.4	37	c.94	CCDS6482.2	9	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063110	0.36373	.	.	ENSG00000173068	ENST00000380672;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000380666;ENST00000540340	T;T;T	0.03889	3.77;3.77;3.77	4.07	0.559	0.17272	.	1.262830	0.05974	N	0.642836	T	0.02848	0.0085	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45264	-0.9273	10	0.87932	D	0	0.0215	3.1172	0.06379	0.324:0.4654:0.0:0.2107	.	32;32;32	Q06HC4;Q6ZN30-2;Q6ZN30	.;.;BNC2_HUMAN	I	32	ENSP00000370047:V32I;ENSP00000370042:V32I;ENSP00000370041:V32I	ENSP00000370041:V32I	V	-	1	0	BNC2	16728393	0.003000	0.15002	0.000000	0.03702	0.469000	0.32828	0.514000	0.22786	0.085000	0.17107	0.579000	0.79373	GTC	-	NULL		0.443	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	protein_coding	OTTHUMT00000216901.5	C	NM_017637	-		16738393	-1	no_errors	ENST00000380672	ensembl	human	known	74_37	missense	SNP	0.001	T
TJP2	9414	genome.wustl.edu	37	9	71866189	71866189	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr9:71866189C>T	ENST00000377245.4	+	21	3438	c.3230C>T	c.(3229-3231)tCa>tTa	p.S1077L	TJP2_ENST00000453658.2_Intron|TJP2_ENST00000535702.1_Missense_Mutation_p.S1044L|TJP2_ENST00000539225.1_Missense_Mutation_p.S1108L|TJP2_ENST00000348208.4_Intron	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2	1077					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						GCTCCCAAATCAGTCCTGGGC	0.502																																																	0								ENSG00000119139						82.0	78.0	79.0					9																	71866189		2203	4300	6503	TJP2	SO:0001583	missense	0			-	HGNC	L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.3230C>T	9.37:g.71866189C>T	ENSP00000366453:p.Ser1077Leu	Somatic	0	32	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	18	37.93	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_SH3_2,superfamily_PDZ,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_PDZ,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like,prints_ZonOcculS2,prints_ZonOcculdens	p.S1108L	ENST00000377245.4	37	c.3323	CCDS6627.1	9	.	.	.	.	.	.	.	.	.	.	C	34	5.301528	0.95601	.	.	ENSG00000119139	ENST00000377245;ENST00000535702;ENST00000539225	T;T;T	0.22945	2.24;1.93;2.26	6.17	6.17	0.99709	.	0.066704	0.64402	D	0.000008	T	0.50069	0.1594	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;0.963;0.999	D;P;D	0.83275	0.996;0.692;0.93	T	0.16100	-1.0414	10	0.44086	T	0.13	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1108;1044;1077	F5H301;F5H886;Q9UDY2	.;.;ZO2_HUMAN	L	1077;1044;1108	ENSP00000366453:S1077L;ENSP00000442090:S1044L;ENSP00000438262:S1108L	ENSP00000366453:S1077L	S	+	2	0	TJP2	71056009	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	6.817000	0.75252	2.941000	0.99782	0.655000	0.94253	TCA	-	NULL		0.502	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP2	protein_coding	OTTHUMT00000052572.2	C	NM_201629	-		71866189	+1	no_errors	ENST00000539225	ensembl	human	known	74_37	missense	SNP	1.000	T
CCNT1	904	genome.wustl.edu	37	12	49088156	49088156	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr12:49088156G>A	ENST00000261900.3	-	9	1063	c.841C>T	c.(841-843)Cag>Tag	p.Q281*		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	281					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						AGGATTGTCTGCTCTGAAGTC	0.448																																																	0								ENSG00000129315						160.0	144.0	150.0					12																	49088156		2203	4300	6503	CCNT1	SO:0001587	stop_gained	0			-	HGNC	AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.841C>T	12.37:g.49088156G>A	ENSP00000261900:p.Gln281*	Somatic	0	71	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	51	24.64	A9XU13|E7EX76|O60581	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.Q281*	ENST00000261900.3	37	c.841	CCDS8766.1	12	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914275	0.92178	.	.	ENSG00000129315	ENST00000261900	.	.	.	5.33	5.33	0.75918	.	0.125203	0.56097	D	0.000035	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-9.7714	13.5253	0.61591	0.0:0.1569:0.8431:0.0	.	.	.	.	X	281	.	ENSP00000261900:Q281X	Q	-	1	0	CCNT1	47374423	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.894000	0.63206	2.504000	0.84457	0.491000	0.48974	CAG	-	NULL		0.448	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNT1	protein_coding	OTTHUMT00000408853.1	G	NM_001240	-		49088156	-1	no_errors	ENST00000261900	ensembl	human	known	74_37	nonsense	SNP	1.000	A
LRRN2	10446	genome.wustl.edu	37	1	204587896	204587896	+	Missense_Mutation	SNP	G	G	A	rs141763834		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr1:204587896G>A	ENST00000367175.1	-	1	3437	c.1225C>T	c.(1225-1227)Cgt>Tgt	p.R409C	RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367177.3_Missense_Mutation_p.R409C|LRRN2_ENST00000367176.3_Missense_Mutation_p.R409C			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	409	LRRCT.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)	p.R409C(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			GGCACCTCACGGACCGGGAGG	0.657																																																	1	Substitution - Missense(1)	prostate(1)						ENSG00000170382	G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	39.0	43.0	41.0		1225,1225	5.7	0.9	1	dbSNP_134	41	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	LRRN2	NM_006338.2,NM_201630.1	180,180	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	409/714,409/714	204587896	2,13004	2203	4300	6503	LRRN2	SO:0001583	missense	0			-	HGNC	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1225C>T	1.37:g.204587896G>A	ENSP00000356143:p.Arg409Cys	Somatic	0	68	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	21	56.25	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R409C	ENST00000367175.1	37	c.1225	CCDS1448.1	1	.	.	.	.	.	.	.	.	.	.	G	16.97	3.269596	0.59540	0.0	2.33E-4	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.61040	0.14;0.14;0.14	5.69	5.69	0.88448	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.42420	D	0.000712	T	0.72399	0.3455	M	0.64404	1.975	0.53005	D	0.999968	D	0.89917	1.0	D	0.70935	0.971	T	0.74453	-0.3660	10	0.87932	D	0	.	14.2667	0.66123	0.0:0.0:0.851:0.149	.	409	O75325	LRRN2_HUMAN	C	409	ENSP00000356144:R409C;ENSP00000356145:R409C;ENSP00000356143:R409C	ENSP00000356143:R409C	R	-	1	0	LRRN2	202854519	0.985000	0.35326	0.898000	0.35279	0.887000	0.51463	4.083000	0.57643	2.684000	0.91462	0.557000	0.71058	CGT	-	smart_Cys-rich_flank_reg_C		0.657	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	protein_coding	OTTHUMT00000089894.1	G	NM_006338	rs141763834		204587896	-1	no_errors	ENST00000367175	ensembl	human	known	74_37	missense	SNP	0.998	A
CHD7	55636	genome.wustl.edu	37	8	61763141	61763141	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr8:61763141G>T	ENST00000423902.2	+	26	5973	c.5494G>T	c.(5494-5496)Gag>Tag	p.E1832*	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1832					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CATAGCTGCCGAGCAAAGAGG	0.493																																																	0								ENSG00000171316						54.0	65.0	61.0					8																	61763141		2129	4243	6372	CHD7	SO:0001587	stop_gained	0			-	HGNC	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.5494G>T	8.37:g.61763141G>T	ENSP00000392028:p.Glu1832*	Somatic	0	46	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	27	34.15	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E1832*	ENST00000423902.2	37	c.5494	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	G	50	16.489793	0.99864	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-25.5359	19.0723	0.93145	0.0:0.0:1.0:0.0	.	.	.	.	X	1832	.	ENSP00000307304:E1832X	E	+	1	0	CHD7	61925695	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.579000	0.87056	0.650000	0.86243	GAG	-	NULL		0.493	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	protein_coding	OTTHUMT00000383468.2	G	XM_098762	-		61763141	+1	no_errors	ENST00000423902	ensembl	human	known	74_37	nonsense	SNP	1.000	T
AC092965.1	0	genome.wustl.edu	37	3	166743250	166743251	+	RNA	INS	-	-	ACACAC	rs368676011|rs71176624|rs373486571		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr3:166743250_166743251insACACAC	ENST00000401103.1	+	0	50_51																											CATATATGTATacacacacaca	0.322																																																	0								ENSG00000215922																																			AC092965.1			0				Clone_based_ensembl_gene																													3.37:g.166743251_166743256dupACACAC		Somatic	NA	NA	NA		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401103.1	37	NULL		3																																																																																			-	-		0.322	AC092965.1-201	NOVEL	basic	miRNA	ENSG00000215922	miRNA		-				166743251	+1	no_errors	ENST00000401103	ensembl	human	novel	74_37	rna	INS	0.013:0.018	ACACAC
DNAH5	1767	genome.wustl.edu	37	5	13882857	13882857	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr5:13882857A>T	ENST00000265104.4	-	21	3346	c.3242T>A	c.(3241-3243)aTg>aAg	p.M1081K	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1081	Stem. {ECO:0000250}.		M -> V (in dbSNP:rs16902880).		cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ATTTTCTCCCATTTCAACATC	0.318									Kartagener syndrome																																								0								ENSG00000039139						115.0	123.0	120.0					5																	13882857		2203	4299	6502	DNAH5	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3242T>A	5.37:g.13882857A>T	ENSP00000265104:p.Met1081Lys	Somatic	0	35	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.M1081K	ENST00000265104.4	37	c.3242	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	A	0.006	-2.084381	0.00371	.	.	ENSG00000039139	ENST00000265104	T	0.20881	2.04	5.98	0.884	0.19182	.	0.716858	0.14088	N	0.342213	T	0.11707	0.0285	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31971	-0.9924	10	0.24483	T	0.36	.	4.969	0.14105	0.6147:0.0:0.2629:0.1224	.	1081	Q8TE73	DYH5_HUMAN	K	1081	ENSP00000265104:M1081K	ENSP00000265104:M1081K	M	-	2	0	DNAH5	13935857	0.003000	0.15002	0.000000	0.03702	0.012000	0.07955	0.547000	0.23299	-0.066000	0.12998	-1.281000	0.01382	ATG	-	NULL		0.318	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	protein_coding	OTTHUMT00000207057.2	A	NM_001369	-		13882857	-1	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	SNP	0.000	T
RGS7BP	401190	genome.wustl.edu	37	5	63802483	63802483	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr5:63802483G>A	ENST00000334025.2	+	1	358	c.32G>A	c.(31-33)cGc>cAc	p.R11H	RGS7BP_ENST00000508162.1_3'UTR	NM_001029875.1|NM_001271890.1|NM_001271891.1	NP_001025046.1|NP_001258819.1|NP_001258820.1	Q6MZT1	R7BP_HUMAN	regulator of G-protein signaling 7 binding protein	11					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of signal transduction (GO:0009968)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|stomach(1)	11		Lung NSC(810;0.000518)|Prostate(74;0.0435)|Ovarian(174;0.186)		Lung(70;0.147)		CGCAAAAAGCGCCCCAGCCGG	0.687																																																	0								ENSG00000186479						21.0	28.0	26.0					5																	63802483		2202	4300	6502	RGS7BP	SO:0001583	missense	0			-	HGNC	BX640900	CCDS34170.1	5q12.3	2008-02-05	2007-08-14		ENSG00000186479	ENSG00000186479			23271	protein-coding gene	gene with protein product		610890	"""regulator of G-protein signalling 7 binding protein"""			15632198	Standard	NM_001271890		Approved	R7BP	uc003jtj.4	Q6MZT1	OTTHUMG00000162293	ENST00000334025.2:c.32G>A	5.37:g.63802483G>A	ENSP00000334851:p.Arg11His	Somatic	0	32	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	14	42.86	B7Z3X1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R11H	ENST00000334025.2	37	c.32	CCDS34170.1	5	.	.	.	.	.	.	.	.	.	.	G	26.9	4.780531	0.90195	.	.	ENSG00000186479	ENST00000334025	T	0.44083	0.93	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	T	0.54255	0.1847	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.59134	-0.7511	10	0.72032	D	0.01	-9.8723	17.9759	0.89127	0.0:0.0:1.0:0.0	.	11	Q6MZT1	R7BP_HUMAN	H	11	ENSP00000334851:R11H	ENSP00000334851:R11H	R	+	2	0	RGS7BP	63838239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.491000	0.90468	2.398000	0.81561	0.563000	0.77884	CGC	-	NULL		0.687	RGS7BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS7BP	protein_coding	OTTHUMT00000368464.1	G	NM_001029875	-		63802483	+1	no_errors	ENST00000334025	ensembl	human	known	74_37	missense	SNP	1.000	A
AP5S1	55317	genome.wustl.edu	37	20	3802829	3802829	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr20:3802829G>A	ENST00000246041.2	+	2	284	c.65G>A	c.(64-66)cGa>cAa	p.R22Q	AP5S1_ENST00000379573.2_Missense_Mutation_p.R22Q|AP5S1_ENST00000379567.2_Missense_Mutation_p.R22Q			Q9NUS5	AP5S1_HUMAN	adaptor-related protein complex 5, sigma 1 subunit	22					double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)											GGCCTTTGCCGAGTGCTGTAC	0.592																																																	0								ENSG00000125843						77.0	65.0	69.0					20																	3802829		2203	4300	6503	AP5S1	SO:0001583	missense	0			-	HGNC	AK002030	CCDS13070.1	20p13	2012-02-27	2012-02-27	2012-02-27	ENSG00000125843	ENSG00000125843			15875	protein-coding gene	gene with protein product		614824	"""chromosome 20 open reading frame 29"""	C20orf29		11780052, 22022230	Standard	NM_001204446		Approved	FLJ11168	uc002wjs.2	Q9NUS5	OTTHUMG00000031760	ENST00000246041.2:c.65G>A	20.37:g.3802829G>A	ENSP00000246041:p.Arg22Gln	Somatic	0	65	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	30	44.44	B3KSD0|D3DVY7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R22Q	ENST00000246041.2	37	c.65	CCDS13070.1	20	.	.	.	.	.	.	.	.	.	.	G	20.5	4.007386	0.75046	.	.	ENSG00000125843	ENST00000379573;ENST00000379567;ENST00000455742;ENST00000246041	.	.	.	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.76543	0.4002	M	0.68952	2.095	0.50632	D	0.999886	D	0.89917	1.0	D	0.81914	0.995	T	0.78440	-0.2203	9	0.87932	D	0	-8.125	14.0865	0.64959	0.0:0.0:1.0:0.0	.	22	Q9NUS5	CT029_HUMAN	Q	22	.	ENSP00000246041:R22Q	R	+	2	0	C20orf29	3750829	1.000000	0.71417	0.998000	0.56505	0.082000	0.17680	5.568000	0.67385	2.699000	0.92147	0.561000	0.74099	CGA	-	NULL		0.592	AP5S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5S1	protein_coding	OTTHUMT00000077768.2	G	NM_018347	-		3802829	+1	no_errors	ENST00000246041	ensembl	human	known	74_37	missense	SNP	1.000	A
KIAA1429	25962	genome.wustl.edu	37	8	95507140	95507140	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr8:95507140G>T	ENST00000297591.5	-	20	4664	c.4589C>A	c.(4588-4590)tCt>tAt	p.S1530Y	KIAA1429_ENST00000437199.1_3'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1530					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			GAACCACATAGATTTCAACTG	0.323																																																	0								ENSG00000164944						137.0	146.0	143.0					8																	95507140		2203	4300	6503	KIAA1429	SO:0001583	missense	0			-	HGNC	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.4589C>A	8.37:g.95507140G>T	ENSP00000297591:p.Ser1530Tyr	Somatic	0	25	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.S1530Y	ENST00000297591.5	37	c.4589	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501175	0.85176	.	.	ENSG00000164944	ENST00000297591	T	0.48201	0.82	5.16	5.16	0.70880	.	0.115101	0.64402	D	0.000010	T	0.56247	0.1972	L	0.38175	1.15	0.80722	D	1	D	0.64830	0.994	P	0.56865	0.808	T	0.59526	-0.7438	10	0.72032	D	0.01	-12.3869	19.0186	0.92903	0.0:0.0:1.0:0.0	.	1530	Q69YN4	VIR_HUMAN	Y	1530	ENSP00000297591:S1530Y	ENSP00000297591:S1530Y	S	-	2	0	KIAA1429	95576316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.165000	0.94761	2.579000	0.87056	0.650000	0.86243	TCT	-	NULL		0.323	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	protein_coding	OTTHUMT00000378720.2	G	NM_015496	-		95507140	-1	no_errors	ENST00000297591	ensembl	human	known	74_37	missense	SNP	1.000	T
HLA-DOB	3112	genome.wustl.edu	37	6	32782136	32782136	+	Missense_Mutation	SNP	C	C	A	rs141132227		TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr6:32782136C>A	ENST00000438763.2	-	3	700	c.604G>T	c.(604-606)Gat>Tat	p.D202Y	TAP2_ENST00000452392.2_Missense_Mutation_p.D809Y	NM_002120.3	NP_002111.1	P13765	DOB_HUMAN	major histocompatibility complex, class II, DO beta	202	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)	p.D202N(1)		endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	9						CTGGAGTGATCGACAAGGCAG	0.493																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000241106						163.0	143.0	150.0					6																	32782136		1511	2709	4220	HLA-DOB	SO:0001583	missense	0			-	HGNC		CCDS4754.1	6p21.3	2013-01-11			ENSG00000241106	ENSG00000241106		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4937	protein-coding gene	gene with protein product		600629					Standard	NM_002120		Approved			P13765	OTTHUMG00000031213	ENST00000438763.2:c.604G>T	6.37:g.32782136C>A	ENSP00000390020:p.Asp202Tyr	Somatic	0	73	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	33	36.54	B0V0Y0|Q29746|Q29825|Q6FHC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.D202Y	ENST00000438763.2	37	c.604	CCDS4754.1	6	.	.	.	.	.	.	.	.	.	.	C	11.95	1.791949	0.31685	.	.	ENSG00000241106;ENSG00000250264	ENST00000438763;ENST00000452392	T;T	0.02944	4.1;4.1	3.96	0.0114	0.14087	Immunoglobulin/major histocompatibility complex, conserved site (1);Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.306543	0.39020	N	0.001494	T	0.01029	0.0034	L	0.56199	1.76	0.09310	N	1	B;B;B	0.17465	0.022;0.015;0.022	B;B;B	0.21151	0.033;0.015;0.033	T	0.44112	-0.9349	10	0.87932	D	0	.	4.0189	0.09657	0.1285:0.5693:0.1275:0.1747	.	202;809;202	B7Z742;E7ENX8;P13765	.;.;DOB_HUMAN	Y	202;809	ENSP00000390020:D202Y;ENSP00000391806:D809Y	ENSP00000390020:D202Y	D	-	1	0	XXbac-BPG246D15.9;HLA-DOB	32890114	0.336000	0.24757	0.002000	0.10522	0.682000	0.39822	0.580000	0.23803	-0.259000	0.09432	-0.836000	0.03065	GAT	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like_dom		0.493	HLA-DOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DOB	protein_coding	OTTHUMT00000076439.1	C	NM_002120	-		32782136	-1	no_errors	ENST00000438763	ensembl	human	known	74_37	missense	SNP	0.051	A
RBMXL2	27288	genome.wustl.edu	37	11	7110543	7110543	+	Silent	SNP	C	C	T			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr11:7110543C>T	ENST00000306904.5	+	1	379	c.192C>T	c.(190-192)gcC>gcT	p.A64A		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	64	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		ACGCCAAGGCCGCCGCCAGAG	0.642																																																	0								ENSG00000170748						25.0	24.0	24.0					11																	7110543		2198	4295	6493	RBMXL2	SO:0001819	synonymous_variant	0			-	HGNC	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.192C>T	11.37:g.7110543C>T		Somatic	0	25	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	18	35.71	Q6PEZ2|Q9NQU0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.A64	ENST00000306904.5	37	c.192	CCDS7777.1	11																																																																																			-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom		0.642	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL2	protein_coding	OTTHUMT00000384552.1	C	NM_014469	-		7110543	+1	no_errors	ENST00000306904	ensembl	human	known	74_37	silent	SNP	1.000	T
FCRL3	115352	genome.wustl.edu	37	1	157667713	157667713	+	Intron	DEL	C	C	-			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr1:157667713delC	ENST00000368184.3	-	5	590				FCRL3_ENST00000368186.5_Intron|FCRL3_ENST00000473231.1_5'UTR|RP11-367J7.3_ENST00000453692.1_RNA	NM_052939.3	NP_443171.2	Q96P31	FCRL3_HUMAN	Fc receptor-like 3							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(1)|large_intestine(13)|lung(31)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)	69	all_hematologic(112;0.0378)					AGCCAGTCTGCAAAGAGCACA	0.468																																																	0								ENSG00000160856						44.0	40.0	41.0					1																	157667713		2203	4299	6502	FCRL3	SO:0001627	intron_variant	0				HGNC	AF459027	CCDS1167.1	1q21-q22	2013-01-11			ENSG00000160856	ENSG00000160856		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18506	protein-coding gene	gene with protein product		606510				11493702, 12014205	Standard	XR_241065		Approved	FCRH3, IRTA3, IFGP3, SPAP2a, SPAP2, SPAP2b, SPAP2c, SPAP2d, SPAP2e, CD307c	uc001frb.3	Q96P31	OTTHUMG00000019400	ENST00000368184.3:c.299-4G>-	1.37:g.157667713delC		Somatic	0	22	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	15	31.82	A0N0M4|A8MTH7|D3DVD2|Q5VXZ8|Q8N6S2|Q96LA4|Q96P27|Q96P28|Q96P29|Q96P30	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368184.3	37	NULL	CCDS1167.1	1																																																																																			-	-		0.468	FCRL3-006	NOVEL	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	FCRL3	protein_coding	OTTHUMT00000051419.2	C	NM_052939			157667713	-1	no_errors	ENST00000473231	ensembl	human	known	74_37	rna	DEL	0.944	-
HIST1H4F	8361	genome.wustl.edu	37	6	26240683	26240683	+	Frame_Shift_Del	DEL	T	T	-			TCGA-IS-A3K6-01A-11D-A21Q-09	TCGA-IS-A3K6-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b9f8cfe2-7763-4819-9eba-216402df0178	bc5408cd-0b90-4d80-a68b-4c8ced85ff2a	g.chr6:26240683delT	ENST00000377745.2	+	1	123	c.30delT	c.(28-30)ggtfs	p.G10fs		NM_003540.3	NP_003531.1	P62805	H4_HUMAN	histone cluster 1, H4f	10					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)				GTGGTAAAGGTTTAGGAAAGG	0.517																																																	0								ENSG00000198327						42.0	44.0	43.0					6																	26240683		2203	4300	6503	HIST1H4F	SO:0001589	frameshift_variant	0				HGNC	M60749	CCDS4598.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000198327			"""Histones / Replication-dependent"""	4783	protein-coding gene	gene with protein product		602824	"""H4 histone family, member C"", ""histone 1, H4f"""	H4FC		1916825, 9119399, 12408966	Standard	NM_003540		Approved	H4/c, H4	uc003nhe.1	P62805	OTTHUMG00000014443	ENST00000377745.2:c.30delT	6.37:g.26240683delT	ENSP00000366974:p.Gly10fs	Somatic	0	21	0.00		0.5309349604026797	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	10	37.50	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.L11fs	ENST00000377745.2	37	c.30	CCDS4598.1	6																																																																																			-	superfamily_Histone-fold,prints_Histone_H4		0.517	HIST1H4F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H4F	protein_coding	OTTHUMT00000040106.1	T	NM_003540			26240683	+1	no_errors	ENST00000377745	ensembl	human	known	74_37	frame_shift_del	DEL	0.071	-
