#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PRSS16	10279	genome.wustl.edu	37	6	27222852	27222852	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:27222852G>A	ENST00000230582.3	+	11	1433	c.1418G>A	c.(1417-1419)tGc>tAc	p.C473Y	PRSS16_ENST00000377456.2_3'UTR|PRSS16_ENST00000421826.2_Missense_Mutation_p.C216Y	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	473					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						GGCTCCCACTGCTTGGACATG	0.527																																					NSCLC(178;1118 2105 17078 23587 44429)												0								ENSG00000112812						100.0	111.0	107.0					6																	27222852		2203	4300	6503	PRSS16	SO:0001583	missense	0			-	HGNC	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.1418G>A	6.37:g.27222852G>A	ENSP00000230582:p.Cys473Tyr	Somatic	0	85	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	66	17.50	O75416	Missense_Mutation	SNP	34	0.00	0	53	23.19	16	pfam_Peptidase_S28	p.C473Y	ENST00000230582.3	37	c.1418	CCDS4623.1	6	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874685	0.72180	.	.	ENSG00000112812	ENST00000421826;ENST00000230582	T;T	0.20332	2.08;2.08	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	T	0.50616	0.1626	H	0.94183	3.505	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.62421	-0.6858	10	0.51188	T	0.08	-37.3789	15.2575	0.73596	0.0:0.0:1.0:0.0	.	216;473	F2Z2N5;Q9NQE7	.;TSSP_HUMAN	Y	216;473	ENSP00000404349:C216Y;ENSP00000230582:C473Y	ENSP00000230582:C473Y	C	+	2	0	PRSS16	27330831	1.000000	0.71417	0.988000	0.46212	0.967000	0.64934	4.412000	0.59787	2.546000	0.85860	0.552000	0.68991	TGC	-	pfam_Peptidase_S28		0.527	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS16	protein_coding	OTTHUMT00000043418.2	G		-		27222852	+1	no_errors	ENST00000230582	ensembl	human	known	74_37	missense	SNP	0.994	A
AKAP12	9590	genome.wustl.edu	37	6	151671939	151671939	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:151671939G>A	ENST00000253332.1	+	3	2602	c.2413G>A	c.(2413-2415)Gtc>Atc	p.V805I	AKAP12_ENST00000402676.2_Missense_Mutation_p.V805I|AKAP12_ENST00000359755.5_Missense_Mutation_p.V700I|AKAP12_ENST00000354675.6_Missense_Mutation_p.V707I			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	805	AKAP 3.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		AGAATCCTGGGTCTCAATCAA	0.493																																					Melanoma(141;1616 1805 10049 24534 51979)												0								ENSG00000131016						48.0	56.0	53.0					6																	151671939		2203	4300	6503	AKAP12	SO:0001583	missense	0			-	HGNC	U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.2413G>A	6.37:g.151671939G>A	ENSP00000253332:p.Val805Ile	Somatic	0	13	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	20.00	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Missense_Mutation	SNP	33	0.00	0	68	9.33	7	pfam_Pkinase-A_anch_WSK-motif,pfam_RII_binding_1	p.V805I	ENST00000253332.1	37	c.2413	CCDS5229.1	6	.	.	.	.	.	.	.	.	.	.	G	16.34	3.097175	0.56075	.	.	ENSG00000131016	ENST00000402676;ENST00000253332;ENST00000354675;ENST00000359755	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	5.63	5.63	0.86233	Protein kinase A anchoring, WSK motif (1);	0.000000	0.39615	N	0.001305	T	0.52256	0.1723	L	0.36672	1.1	0.44771	D	0.997777	D;D;D	0.71674	0.997;0.997;0.998	D;D;D	0.71870	0.957;0.957;0.975	T	0.43734	-0.9373	10	0.36615	T	0.2	.	19.7096	0.96089	0.0:0.0:1.0:0.0	.	700;707;805	Q02952-3;Q02952-2;Q02952	.;.;AKA12_HUMAN	I	805;805;707;700	ENSP00000384537:V805I;ENSP00000253332:V805I;ENSP00000346702:V707I;ENSP00000352794:V700I	ENSP00000253332:V805I	V	+	1	0	AKAP12	151713632	1.000000	0.71417	1.000000	0.80357	0.075000	0.17131	7.074000	0.76791	2.652000	0.90054	0.655000	0.94253	GTC	-	pfam_Pkinase-A_anch_WSK-motif		0.493	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	protein_coding	OTTHUMT00000042712.1	G		-		151671939	+1	no_errors	ENST00000253332	ensembl	human	known	74_37	missense	SNP	1.000	A
PP13004	402481	genome.wustl.edu	37	7	36124270	36124270	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr7:36124270G>A	ENST00000381493.2	+	2	421	c.272G>A	c.(271-273)tGg>tAg	p.W91*																								GGAGATCCCTGGGAAGCAAGA	0.577																																																	0								ENSG00000205745																																			PP13004	SO:0001587	stop_gained	0			-	Uniprot_gn																												ENST00000381493.2:c.272G>A	7.37:g.36124270G>A	ENSP00000370904:p.Trp91*	Somatic	0	51	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	29	30.95		Nonsense_Mutation	SNP	35	0.00	0	33	35.29	18	NULL	p.W91*	ENST00000381493.2	37	c.272		7	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577676	0.45902	.	.	ENSG00000205745	ENST00000381493	.	.	.	2.63	2.63	0.31362	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.9248	0.35634	0.0:0.0:1.0:0.0	.	.	.	.	X	91	.	ENSP00000370904:W91X	W	+	2	0	AC083864.4	36090795	0.002000	0.14202	0.006000	0.13384	0.023000	0.10783	0.724000	0.25954	1.771000	0.52183	0.603000	0.83216	TGG	-	NULL		0.577	PP13004-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	ENSG00000205745	protein_coding	OTTHUMT00000338269.2	G		-		36124270	+1	no_errors	ENST00000381493	ensembl	human	novel	74_37	nonsense	SNP	0.007	A
IRF9	10379	genome.wustl.edu	37	14	24632708	24632708	+	Silent	SNP	C	C	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr14:24632708C>A	ENST00000396864.3	+	4	773	c.486C>A	c.(484-486)tcC>tcA	p.S162S	RP11-468E2.4_ENST00000558468.1_3'UTR|IRF9_ENST00000557894.1_Silent_p.S60S	NM_006084.4	NP_006075.3	Q00978	IRF9_HUMAN	interferon regulatory factor 9	162					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon biosynthetic process (GO:0045351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(265;0.00853)		TCCAGGACTCCCTCAATAATG	0.537																																																	0								ENSG00000213928						97.0	86.0	90.0					14																	24632708		2203	4300	6503	IRF9	SO:0001819	synonymous_variant	0			-	HGNC	M87503	CCDS9615.1	14q11.2	2007-07-06	2007-07-06	2007-07-06	ENSG00000213928	ENSG00000213928			6131	protein-coding gene	gene with protein product		147574	"""interferon-stimulated transcription factor 3, gamma (48kD)"", ""interferon-stimulated transcription factor 3, gamma 48kDa"""	ISGF3G		1630447, 10199920	Standard	NM_006084		Approved		uc001wmq.3	Q00978	OTTHUMG00000028799	ENST00000396864.3:c.486C>A	14.37:g.24632708C>A		Somatic	0	38	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	28	17.65	D3DS61	Silent	SNP	22	0.00	0	38	43.28	29	pfam_Interferon_reg_fact_DNA-bd_dom,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.S162	ENST00000396864.3	37	c.486	CCDS9615.1	14																																																																																			-	NULL		0.537	IRF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF9	protein_coding	OTTHUMT00000071927.2	C		-		24632708	+1	no_errors	ENST00000396864	ensembl	human	known	74_37	silent	SNP	0.009	A
FLJ26850	400710	genome.wustl.edu	37	19	50569594	50569594	+	RNA	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr19:50569594G>T	ENST00000527209.1	+	0	1069					NR_027257.1																						TCTTCCCCTCGATCCACACGG	0.602																																																	0								ENSG00000204666																																			CTD-2126E3.1			0			-	Clone_based_vega_gene																													19.37:g.50569594G>T		Somatic	0	42	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	30	25.00		RNA	SNP	25	0.00	0	36	29.41	15	-	NULL	ENST00000527209.1	37	NULL		19																																																																																			-	-		0.602	CTD-2126E3.1-001	KNOWN	basic	sense_overlapping	FLJ26850	sense_overlapping	OTTHUMT00000384643.1	G		-		50569594	+1	no_errors	ENST00000527209	ensembl	human	known	74_37	rna	SNP	0.998	T
PTCHD2	57540	genome.wustl.edu	37	1	11579882	11579882	+	Silent	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr1:11579882G>A	ENST00000294484.6	+	9	2283	c.2145G>A	c.(2143-2145)gaG>gaA	p.E715E	PTCHD2_ENST00000389575.3_Silent_p.E715E	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	715					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		AGCTGCAGGAGCTGCTGCACC	0.672																																																	0								ENSG00000204624						50.0	60.0	57.0					1																	11579882		2076	4210	6286	PTCHD2	SO:0001819	synonymous_variant	0			-	HGNC	AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.2145G>A	1.37:g.11579882G>A		Somatic	0	50	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	25	35.90	Q5VTU9|Q9UJD6	Silent	SNP	29	0.00	0	28	36.36	16	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.E715	ENST00000294484.6	37	c.2145	CCDS41247.1	1																																																																																			-	pfam_Patched		0.672	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	protein_coding	OTTHUMT00000005770.2	G	XM_052561	-		11579882	+1	no_errors	ENST00000294484	ensembl	human	known	74_37	silent	SNP	1.000	A
ANKMY1	51281	genome.wustl.edu	37	2	241420382	241420382	+	Silent	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:241420382C>T	ENST00000272972.3	-	16	2965	c.2751G>A	c.(2749-2751)aaG>aaA	p.K917K	ANKMY1_ENST00000401804.1_Silent_p.K1006K|ANKMY1_ENST00000391987.1_Silent_p.K917K|ANKMY1_ENST00000373320.4_Silent_p.K687K|ANKMY1_ENST00000361678.4_Silent_p.K693K|ANKMY1_ENST00000373318.2_Silent_p.K696K|ANKMY1_ENST00000406958.1_Silent_p.K678K|ANKMY1_ENST00000403283.1_Silent_p.K819K	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	917							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		CGCAGTCCTTCTTGTGGAACT	0.672																																																	0								ENSG00000144504						113.0	103.0	106.0					2																	241420382		2203	4300	6503	ANKMY1	SO:0001819	synonymous_variant	0			-	HGNC	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.2751G>A	2.37:g.241420382C>T		Somatic	0	133	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	119	24.20	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Silent	SNP	37	0.00	0	59	22.37	17	pfam_Ankyrin_rpt,pfam_MORN,pfam_Znf_MYND,superfamily_Ankyrin_rpt-contain_dom,smart_MORN,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_MYND	p.K917	ENST00000272972.3	37	c.2751	CCDS2536.1	2																																																																																			-	pfam_Znf_MYND,pfscan_Znf_MYND		0.672	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKMY1	protein_coding	OTTHUMT00000257187.2	C	NM_017844	-		241420382	-1	no_errors	ENST00000272972	ensembl	human	known	74_37	silent	SNP	0.842	T
ASMTL	8623	genome.wustl.edu	37	X	1554101	1554101	+	Intron	SNP	T	T	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chrX:1554101T>A	ENST00000381317.3	-	5	371				ASMTL_ENST00000416733.2_Intron|ASMTL_ENST00000463763.1_5'UTR|ASMTL_ENST00000381333.4_Intron|ASMTL_ENST00000534940.1_Intron	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like							cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CAGCATCTTCTCCCCGATCGT	0.622																																																	0								ENSG00000169093																																			ASMTL	SO:0001627	intron_variant	0			-	HGNC	Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.339-125A>T	X.37:g.1554101T>A		Somatic	0	38	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	18	34.48	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	RNA	SNP	32	0.00	0	28	47.17	25	-	NULL	ENST00000381317.3	37	NULL	CCDS43917.1	X																																																																																			-	-		0.622	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ASMTL	protein_coding	OTTHUMT00000055595.1	T	NM_004192	-		1554101	-1	no_errors	ENST00000463763	ensembl	human	known	74_37	rna	SNP	0.001	A
SPRED1	161742	genome.wustl.edu	37	15	38641683	38641683	+	Nonsense_Mutation	SNP	C	C	T	rs121434314		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr15:38641683C>T	ENST00000299084.4	+	6	1503	c.643C>T	c.(643-645)Caa>Taa	p.Q215*		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	215					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		CGTACAGCGGCAAATATCCAA	0.338									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)												0			GRCh37	CM074581	SPRED1	M	rs121434314	ENSG00000166068						95.0	89.0	91.0					15																	38641683		2200	4297	6497	SPRED1	SO:0001587	stop_gained	0	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	-	HGNC	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.643C>T	15.37:g.38641683C>T	ENSP00000299084:p.Gln215*	Somatic	0	44	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	16	40.74	B2RPJ8|Q05D53|Q8N256	Nonsense_Mutation	SNP	40	0.00	0	17	62.22	28	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.Q215*	ENST00000299084.4	37	c.643	CCDS32193.1	15	.	.	.	.	.	.	.	.	.	.	C	44	10.853040	0.99478	.	.	ENSG00000166068	ENST00000299084	.	.	.	5.16	5.16	0.70880	.	0.270493	0.30003	N	0.010651	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12430	T	0.62	-20.6426	14.1458	0.65349	0.0:1.0:0.0:0.0	.	.	.	.	X	215	.	ENSP00000299084:Q215X	Q	+	1	0	SPRED1	36428975	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.484000	0.53201	2.428000	0.82296	0.650000	0.86243	CAA	-	NULL		0.338	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED1	protein_coding	OTTHUMT00000418217.1	C		rs121434314		38641683	+1	no_errors	ENST00000299084	ensembl	human	known	74_37	nonsense	SNP	1.000	T
OR51F2	119694	genome.wustl.edu	37	11	4842933	4842933	+	Silent	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr11:4842933C>T	ENST00000322110.5	+	1	383	c.318C>T	c.(316-318)atC>atT	p.I106I	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004753.1	NP_001004753.1	Q8NH61	O51F2_HUMAN	olfactory receptor, family 51, subfamily F, member 2	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCCGAGAAATCAACCTAAATG	0.468																																																	0								ENSG00000176925						161.0	147.0	152.0					11																	4842933		2201	4298	6499	OR51F2	SO:0001819	synonymous_variant	0			-	HGNC	BK004281	CCDS31361.1	11p15.4	2012-08-09			ENSG00000176925	ENSG00000176925		"""GPCR / Class A : Olfactory receptors"""	15197	protein-coding gene	gene with protein product							Standard	NM_001004753		Approved		uc010qyn.2	Q8NH61	OTTHUMG00000066508	ENST00000322110.5:c.318C>T	11.37:g.4842933C>T		Somatic	0	94	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	63	8.70	Q6IFI1	Silent	SNP	37	0.00	0	48	11.11	6	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I106	ENST00000322110.5	37	c.318	CCDS31361.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.468	OR51F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51F2	protein_coding	OTTHUMT00000142181.1	C	NM_001004753	-		4842933	+1	no_errors	ENST00000322110	ensembl	human	known	74_37	silent	SNP	0.173	T
CDK5RAP3	80279	genome.wustl.edu	37	17	46048622	46048622	+	Intron	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr17:46048622C>G	ENST00000338399.4	+	1	112				RP11-6N17.9_ENST00000582262.1_RNA|CDK5RAP3_ENST00000536708.2_Intron	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3						brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						TCGCTCTGGCCCCGTTCTGGC	0.677																																																	0								ENSG00000108465																																			CDK5RAP3	SO:0001627	intron_variant	0			-	HGNC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.6+104C>G	17.37:g.46048622C>G		Somatic	0	95	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	58	34.09	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	Missense_Mutation	SNP	24	0.00	0	30	37.50	18	NULL	p.P37R	ENST00000338399.4	37	c.110	CCDS42356.1	17																																																																																			-	NULL		0.677	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	protein_coding	OTTHUMT00000442913.1	C	NM_176096	-		46048622	+1	no_errors	ENST00000583363	ensembl	human	known	74_37	missense	SNP	0.001	G
SLC20A1	6574	genome.wustl.edu	37	2	113414767	113414767	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:113414767G>T	ENST00000272542.3	+	6	1266	c.727G>T	c.(727-729)Gcc>Tcc	p.A243S	SLC20A1_ENST00000480984.1_3'UTR	NM_005415.4	NP_005406.3	Q8WUM9	S20A1_HUMAN	solute carrier family 20 (phosphate transporter), member 1	243					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	high-affinity inorganic phosphate:sodium symporter activity (GO:0005316)|inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|sodium:phosphate symporter activity (GO:0005436)	p.A243S(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|skin(1)|urinary_tract(3)	28						AGTTTTCTGTGCCCTTATCGT	0.413																																																	1	Substitution - Missense(1)	urinary_tract(1)						ENSG00000144136						192.0	189.0	190.0					2																	113414767		2203	4300	6503	SLC20A1	SO:0001583	missense	0			-	HGNC		CCDS2099.1	2q13	2013-05-22			ENSG00000144136	ENSG00000144136		"""Solute carriers"""	10946	protein-coding gene	gene with protein product	"""gibbon ape leukemia virus receptor 1"""	137570		GLVR1		8041748	Standard	NM_005415		Approved	PiT-1, Glvr-1	uc002tib.3	Q8WUM9	OTTHUMG00000131317	ENST00000272542.3:c.727G>T	2.37:g.113414767G>T	ENSP00000272542:p.Ala243Ser	Somatic	0	56	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q08344|Q6DHX8|Q9UQ82	Missense_Mutation	SNP	35	0.00	0	58	1.69	1	pfam_Phos_transporter	p.A243S	ENST00000272542.3	37	c.727	CCDS2099.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.109240|5.109240	0.94292|0.94292	.|.	.|.	ENSG00000144136|ENSG00000144136	ENST00000272542;ENST00000409095|ENST00000433924	D|.	0.92299|.	-3.01|.	5.93|5.93	5.05|5.05	0.67936|0.67936	.|.	0.046163|.	0.85682|.	D|.	0.000000|.	T|T	0.68888|0.68888	0.3050|0.3050	M|M	0.62016|0.62016	1.91|1.91	0.80722|0.80722	D|D	1|1	P;P|.	0.50156|.	0.932;0.932|.	P;P|.	0.59546|.	0.859;0.859|.	T|T	0.67217|0.67217	-0.5726|-0.5726	10|6	0.62326|0.33940	D|T	0.03|0.23	-32.7026|-32.7026	12.8282|12.8282	0.57731|0.57731	0.0788:0.0:0.9212:0.0|0.0788:0.0:0.9212:0.0	.|.	243;243|.	A7LNJ1;Q8WUM9|.	.;S20A1_HUMAN|.	S|F	243;55|68	ENSP00000272542:A243S|.	ENSP00000272542:A243S|ENSP00000390021:C68F	A|C	+|+	1|2	0|0	SLC20A1|SLC20A1	113131238|113131238	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.715000|7.715000	0.84713|0.84713	1.504000|1.504000	0.48704|0.48704	0.655000|0.655000	0.94253|0.94253	GCC|TGC	-	pfam_Phos_transporter		0.413	SLC20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC20A1	protein_coding	OTTHUMT00000254086.2	G	NM_005415	-		113414767	+1	no_errors	ENST00000272542	ensembl	human	known	74_37	missense	SNP	1.000	T
TCF19	6941	genome.wustl.edu	37	6	31130282	31130282	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:31130282C>T	ENST00000376257.3	+	4	1580	c.826C>T	c.(826-828)Cca>Tca	p.P276S	TCF19_ENST00000496421.1_3'UTR|TCF19_ENST00000376255.4_Missense_Mutation_p.P276S	NM_007109.2	NP_009040.2	Q9Y242	TCF19_HUMAN	transcription factor 19	276	Pro-rich.				cell proliferation (GO:0008283)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)	9						TCGGAAGTACCCAGTGAGCGC	0.612																																																	0								ENSG00000137310						79.0	87.0	84.0					6																	31130282		1276	2550	3826	TCF19	SO:0001583	missense	0			-	HGNC	U25826	CCDS43446.1	6p21.3	2013-01-28	2009-02-05		ENSG00000137310	ENSG00000137310		"""Zinc fingers, PHD-type"""	11629	protein-coding gene	gene with protein product		600912				1868030, 8595903	Standard	NM_001077511		Approved	SC1	uc003nss.3	Q9Y242	OTTHUMG00000031274	ENST00000376257.3:c.826C>T	6.37:g.31130282C>T	ENSP00000365433:p.Pro276Ser	Somatic	0	48	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	26	21.21	A6NCT8|B0UY11|Q0EFA8|Q13176|Q15967|Q5SQ89|Q5STD6|Q5STF5|Q9BUM2|Q9UBH7	Missense_Mutation	SNP	32	0.00	0	41	19.61	10	pfam_FHA_dom,pfam_Znf_PHD-finger,superfamily_SMAD_FHA_domain,superfamily_Znf_FYVE_PHD,smart_FHA_dom,smart_Znf_PHD,pfscan_FHA_dom	p.P276S	ENST00000376257.3	37	c.826	CCDS43446.1	6	.	.	.	.	.	.	.	.	.	.	C	12.52	1.961163	0.34565	.	.	ENSG00000137310	ENST00000376257;ENST00000376255	T;T	0.23552	1.9;1.9	4.86	2.56	0.30785	Zinc finger, FYVE/PHD-type (1);	0.175642	0.50627	D	0.000115	T	0.09949	0.0244	L	0.54323	1.7	0.80722	D	1	B	0.20550	0.046	B	0.17979	0.02	T	0.05632	-1.0873	10	0.66056	D	0.02	-24.3972	5.2786	0.15663	0.1812:0.6796:0.0:0.1392	.	276	Q9Y242	TCF19_HUMAN	S	276	ENSP00000365433:P276S;ENSP00000365431:P276S	ENSP00000365431:P276S	P	+	1	0	TCF19	31238261	0.960000	0.32886	0.924000	0.36721	0.348000	0.29142	0.861000	0.27885	0.327000	0.23409	0.549000	0.68633	CCA	-	superfamily_Znf_FYVE_PHD		0.612	TCF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF19	protein_coding	OTTHUMT00000076595.2	C	NM_007109	-		31130282	+1	no_errors	ENST00000376255	ensembl	human	known	74_37	missense	SNP	0.927	T
MIR205HG	642587	genome.wustl.edu	37	1	209605637	209605648	+	lincRNA	DEL	AGCAGCAGCAGC	AGCAGCAGCAGC	-	rs71788170|rs74820836|rs150848171|rs3842530		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	AGCAGCAGCAGC	AGCAGCAGCAGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr1:209605637_209605648delAGCAGCAGCAGC	ENST00000384891.1	+	0	220					NR_029622.1				MIR205 host gene (non-protein coding)																		ccaccaccgTagcagcagcagcagcagcagca	0.561																																																	0								ENSG00000230937																																			MIR205HG			0				HGNC			1q32.2	2014-02-12	2011-11-07		ENSG00000230937	ENSG00000230937		"""Long non-coding RNAs"""	43562	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 510"""						Standard	NM_001104548		Approved	LINC00510	uc009xcn.3		OTTHUMG00000036267		1.37:g.209605637_209605648delAGCAGCAGCAGC		Somatic	NA	NA	NA		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	11	15.38	2	32	20.00	8	-	NULL	ENST00000384891.1	37	NULL		1																																																																																			-	-		0.561	MIR205HG-202	KNOWN	basic	miRNA	MIR205HG	lincRNA		AGCAGCAGCAGC				209605648	+1	no_errors	ENST00000366437	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.002:0.000:0.000:0.000:0.000:0.000:0.000	-
LZTS3	9762	genome.wustl.edu	37	20	3146263	3146263	+	Silent	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr20:3146263C>T	ENST00000329152.3	-	2	2600	c.1203G>A	c.(1201-1203)aaG>aaA	p.K401K	LZTS3_ENST00000337576.5_Silent_p.K355K|LZTS3_ENST00000360342.3_Silent_p.K355K			O60299	LZTS3_HUMAN		401						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)											CCTGCAGCTGCTTCTTGTCCT	0.701																																																	0								ENSG00000088899						8.0	10.0	9.0					20																	3146263		2065	4085	6150	LZTS3	SO:0001819	synonymous_variant	0			-	Uniprot_gn																												ENST00000329152.3:c.1203G>A	20.37:g.3146263C>T		Somatic	0	42	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	12	45.45	A2A2Q7|D3DVX6|Q8IXX8	Silent	SNP	32	0.00	0	20	25.93	7	NULL	p.K401	ENST00000329152.3	37	c.1203	CCDS13049.1	20																																																																																			-	NULL		0.701	LZTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTS3	protein_coding	OTTHUMT00000077715.2	C		-		3146263	-1	no_errors	ENST00000329152	ensembl	human	known	74_37	silent	SNP	1.000	T
LIFR	3977	genome.wustl.edu	37	5	38530658	38530658	+	Nonsense_Mutation	SNP	G	G	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr5:38530658G>C	ENST00000263409.4	-	2	254	c.92C>G	c.(91-93)tCa>tGa	p.S31*	LIFR_ENST00000453190.2_Nonsense_Mutation_p.S31*|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	31					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					AATAAATGTTGATAACAGCCA	0.363			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)			Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0								ENSG00000113594						105.0	106.0	106.0					5																	38530658		2203	4300	6503	LIFR	SO:0001587	stop_gained	0			-	HGNC	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.92C>G	5.37:g.38530658G>C	ENSP00000263409:p.Ser31*	Somatic	0	36	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	17	39.29	Q6LCD9	Nonsense_Mutation	SNP	43	0.00	0	31	44.64	25	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S31*	ENST00000263409.4	37	c.92	CCDS3927.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.213427	0.95069	.	.	ENSG00000113594	ENST00000263409;ENST00000453190;ENST00000506990;ENST00000511561	.	.	.	5.5	2.12	0.27331	.	1.177030	0.06379	N	0.714899	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-1.4596	9.997	0.41905	0.1425:0.0:0.8575:0.0	.	.	.	.	X	31	.	ENSP00000263409:S31X	S	-	2	0	LIFR	38566415	0.003000	0.15002	0.000000	0.03702	0.050000	0.14768	1.283000	0.33237	0.143000	0.18926	0.650000	0.86243	TCA	-	NULL		0.363	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	protein_coding	OTTHUMT00000253823.1	G	NM_002310	-		38530658	-1	no_errors	ENST00000263409	ensembl	human	known	74_37	nonsense	SNP	0.000	C
PDGFRB	5159	genome.wustl.edu	37	5	149500489	149500489	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr5:149500489C>A	ENST00000261799.4	-	18	3017	c.2548G>T	c.(2548-2550)Gac>Tac	p.D850Y		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	850	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CGCATGATGTCTCGAGCCAGG	0.577			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																			Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	0								ENSG00000113721						138.0	119.0	125.0					5																	149500489		2203	4300	6503	PDGFRB	SO:0001583	missense	0			-	HGNC	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.2548G>T	5.37:g.149500489C>A	ENSP00000261799:p.Asp850Tyr	Somatic	0	81	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	47	16.07	B5A957|Q8N5L4	Missense_Mutation	SNP	22	0.00	0	49	9.26	5	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.D850Y	ENST00000261799.4	37	c.2548	CCDS4303.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.191977	0.94923	.	.	ENSG00000113721	ENST00000261799;ENST00000544453	D	0.83755	-1.76	5.03	5.03	0.67393	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.337088	0.22109	N	0.064509	D	0.88422	0.6432	L	0.45422	1.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.968	D	0.89493	0.3758	10	0.87932	D	0	.	18.746	0.91792	0.0:1.0:0.0:0.0	.	850;850	A8KAM8;P09619	.;PGFRB_HUMAN	Y	850;520	ENSP00000261799:D850Y	ENSP00000261799:D850Y	D	-	1	0	PDGFRB	149480682	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.504000	0.84457	0.655000	0.94253	GAC	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.577	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRB	protein_coding	OTTHUMT00000252332.1	C	NM_002609	-		149500489	-1	no_errors	ENST00000261799	ensembl	human	known	74_37	missense	SNP	1.000	A
CR1	1378	genome.wustl.edu	37	1	207787796	207787796	+	Missense_Mutation	SNP	T	T	C	rs61822976		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr1:207787796T>C	ENST00000367049.4	+	40	6623	c.6623T>C	c.(6622-6624)aTg>aCg	p.M2208T	CR1_ENST00000367052.1_Missense_Mutation_p.M1758T|CR1_ENST00000367051.1_Missense_Mutation_p.M1758T|CR1_ENST00000367053.1_Missense_Mutation_p.M1758T|CR1_ENST00000400960.2_Missense_Mutation_p.M1758T	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1758					complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)	p.M1758T(1)|p.M2208T(1)|p.M1763T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTGGCTGGAATGAAAGCCCTT	0.408																																																	3	Substitution - Missense(3)	prostate(3)						ENSG00000203710						128.0	121.0	123.0					1																	207787796		1882	4112	5994	CR1	SO:0001583	missense	0			-	HGNC	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.6623T>C	1.37:g.207787796T>C	ENSP00000356016:p.Met2208Thr	Somatic	1	139	0.71		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	170	8.06	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	30	0.00	0	72	1.37	1	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.M2208T	ENST00000367049.4	37	c.6623	CCDS44308.1	1	.	.	.	.	.	.	.	.	.	.	T	3.803	-0.041226	0.07452	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000367049	T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96	4.29	-5.87	0.02297	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.09335	0.0230	N	0.20986	0.625	0.09310	N	1	B;P	0.46457	0.043;0.878	B;B	0.42422	0.009;0.387	T	0.19614	-1.0300	9	0.18276	T	0.48	.	1.2481	0.01977	0.4109:0.0944:0.2677:0.2271	rs61822976	1758;2208	P17927;E9PDY4	CR1_HUMAN;.	T	1758;1758;1758;1758;2208	ENSP00000356019:M1758T;ENSP00000356018:M1758T;ENSP00000356020:M1758T;ENSP00000383744:M1758T;ENSP00000356016:M2208T	ENSP00000356016:M2208T	M	+	2	0	CR1	205854419	0.002000	0.14202	0.000000	0.03702	0.554000	0.35429	-0.327000	0.07955	-0.793000	0.04475	0.358000	0.22013	ATG	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.408	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	protein_coding	OTTHUMT00000382527.1	T	NM_000573	rs61822976		207787796	+1	no_errors	ENST00000367049	ensembl	human	known	74_37	missense	SNP	0.000	C
RP11-764K9.1	0	genome.wustl.edu	37	9	68400455	68400455	+	lincRNA	SNP	C	C	T	rs200320813		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr9:68400455C>T	ENST00000417843.2	-	0	1364																											CTCAGGTGGGCGATGCACCTC	0.498																																																	0								ENSG00000225411																																			RP11-764K9.1			0			-	Clone_based_vega_gene																													9.37:g.68400455C>T		Somatic	0	14	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	3	62.50		RNA	SNP	291	19.23	70	472	15.72	89	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			-	-		0.498	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	lincRNA	OTTHUMT00000129817.2	C		rs200320813		68400455	-1	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	SNP	0.022	T
ZNF347	84671	genome.wustl.edu	37	19	53645440	53645440	+	Missense_Mutation	SNP	A	A	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr19:53645440A>C	ENST00000334197.7	-	5	709	c.641T>G	c.(640-642)tTc>tGc	p.F214C	ZNF347_ENST00000601469.2_Missense_Mutation_p.F215C|ZNF347_ENST00000452676.2_Missense_Mutation_p.F215C|ZNF347_ENST00000601804.1_Intron	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	214					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		ATTATTGTTGAAAGACTTCTC	0.328																																					Melanoma(64;205 1597 17324 45721)												0								ENSG00000197937						114.0	116.0	115.0					19																	53645440		2203	4300	6503	ZNF347	SO:0001583	missense	0			-	HGNC	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.641T>G	19.37:g.53645440A>C	ENSP00000334146:p.Phe214Cys	Somatic	0	47	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	32	28.89	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	42	0.00	0	57	27.85	22	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F215C	ENST00000334197.7	37	c.644	CCDS33097.1	19	.	.	.	.	.	.	.	.	.	.	A	9.182	1.023803	0.19433	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.06849	3.26;3.25	2.67	0.309	0.15820	.	.	.	.	.	T	0.10981	0.0268	L	0.42245	1.32	0.09310	N	1	D;P	0.54964	0.969;0.887	P;B	0.53146	0.719;0.135	T	0.20739	-1.0266	9	0.72032	D	0.01	.	2.2285	0.03991	0.4963:0.0:0.2775:0.2262	.	215;214	G5E9N4;Q96SE7	.;ZN347_HUMAN	C	214;215	ENSP00000334146:F214C;ENSP00000405218:F215C	ENSP00000334146:F214C	F	-	2	0	ZNF347	58337252	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	1.077000	0.30741	-0.124000	0.11724	-0.290000	0.09829	TTC	-	NULL		0.328	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF347	protein_coding	OTTHUMT00000464170.1	A	NM_032584	-		53645440	-1	no_errors	ENST00000452676	ensembl	human	known	74_37	missense	SNP	0.000	C
ABCA8	10351	genome.wustl.edu	37	17	66877272	66877272	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr17:66877272T>C	ENST00000269080.2	-	30	4044	c.3907A>G	c.(3907-3909)Act>Gct	p.T1303A	ABCA8_ENST00000430352.2_Missense_Mutation_p.T1343A|ABCA8_ENST00000586539.1_Missense_Mutation_p.T1343A	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	1303	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					TGTCCAGCAGTTGGTTTTGTG	0.338																																																	0								ENSG00000141338						132.0	118.0	122.0					17																	66877272		2203	4300	6503	ABCA8	SO:0001583	missense	0			-	HGNC	AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.3907A>G	17.37:g.66877272T>C	ENSP00000269080:p.Thr1303Ala	Somatic	0	65	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	38	29.63	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	40	0.00	0	40	46.05	35	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T1343A	ENST00000269080.2	37	c.4027	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	T	21.5	4.161773	0.78226	.	.	ENSG00000141338	ENST00000269080;ENST00000430352	D;D	0.94092	-3.35;-3.35	4.3	4.3	0.51218	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.295501	0.24298	N	0.039750	D	0.94561	0.8248	M	0.74258	2.255	0.43536	D	0.995826	P;P;P	0.44195	0.828;0.648;0.828	P;P;P	0.50934	0.58;0.523;0.654	D	0.95101	0.8230	10	0.87932	D	0	.	13.0633	0.59020	0.0:0.0:0.0:1.0	.	1343;1343;1303	A1L3U3;C9JQE6;O94911	.;.;ABCA8_HUMAN	A	1303;1343	ENSP00000269080:T1303A;ENSP00000402814:T1343A	ENSP00000269080:T1303A	T	-	1	0	ABCA8	64388867	0.997000	0.39634	0.769000	0.31535	0.984000	0.73092	7.011000	0.76359	1.942000	0.56320	0.533000	0.62120	ACT	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.338	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	protein_coding	OTTHUMT00000450172.1	T	NM_007168	-		66877272	-1	no_errors	ENST00000430352	ensembl	human	known	74_37	missense	SNP	0.996	C
RGS12	6002	genome.wustl.edu	37	4	3318447	3318447	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr4:3318447G>T	ENST00000344733.5	+	2	1454	c.550G>T	c.(550-552)Gaa>Taa	p.E184*	RGS12_ENST00000336727.3_Nonsense_Mutation_p.E184*|RGS12_ENST00000543385.1_Nonsense_Mutation_p.E184*|RGS12_ENST00000382788.3_Nonsense_Mutation_p.E184*	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	184					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGTTGGACATGAAAGTATAAA	0.388																																																	0								ENSG00000159788						60.0	63.0	62.0					4																	3318447		2203	4300	6503	RGS12	SO:0001587	stop_gained	0			-	HGNC	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.550G>T	4.37:g.3318447G>T	ENSP00000339381:p.Glu184*	Somatic	0	39	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Nonsense_Mutation	SNP	37	0.00	0	79	0.00	0	pfam_Raf-like_ras-bd,pfam_RGS_dom,pfam_PDZ,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_PTB/PI_dom,smart_Regulat_G_prot_signal_superfam,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_PDZ,pfscan_PTB/PI_dom,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.E184*	ENST00000344733.5	37	c.550	CCDS3366.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.905398	0.97087	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788	.	.	.	3.86	3.86	0.44501	.	0.679383	0.13411	U	0.389868	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-8.917	14.7961	0.69878	0.0:0.0:1.0:0.0	.	.	.	.	X	184	.	ENSP00000338509:E184X	E	+	1	0	RGS12	3288245	0.996000	0.38824	0.002000	0.10522	0.146000	0.21551	6.941000	0.75922	1.705000	0.51264	0.491000	0.48974	GAA	-	NULL		0.388	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	protein_coding	OTTHUMT00000206602.1	G	NM_002926	-		3318447	+1	no_errors	ENST00000344733	ensembl	human	known	74_37	nonsense	SNP	0.420	T
DLX6	1750	genome.wustl.edu	37	7	96637007	96637007	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr7:96637007A>G	ENST00000518156.2	+	2	924	c.494A>G	c.(493-495)aAa>aGa	p.K165R	DLX6-AS2_ENST00000606174.1_RNA|DLX6_ENST00000555308.1_Missense_Mutation_p.K37R|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000430404.2_RNA|DLX6_ENST00000007660.5_Missense_Mutation_p.K137R|DLX6-AS1_ENST00000452769.2_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6_ENST00000493273.2_3'UTR|DLX6-AS1_ENST00000430027.3_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	47					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GGAAAAGGGAAAAAGATTCGG	0.478																																																	0								ENSG00000006377						43.0	43.0	43.0					7																	96637007		1862	4094	5956	DLX6	SO:0001583	missense	0			-	HGNC		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.494A>G	7.37:g.96637007A>G	ENSP00000428480:p.Lys165Arg	Somatic	0	28	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	13	50.00	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Missense_Mutation	SNP	39	0.00	0	42	36.36	24	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.K165R	ENST00000518156.2	37	c.494	CCDS47647.2	7	.	.	.	.	.	.	.	.	.	.	A	26.7	4.764260	0.89932	.	.	ENSG00000006377	ENST00000518156;ENST00000007660;ENST00000555308	D;D;D	0.95377	-3.69;-3.69;-3.69	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.97405	0.9151	M	0.80616	2.505	0.80722	D	1	D	0.60160	0.987	D	0.66351	0.943	D	0.97404	0.9998	10	0.45353	T	0.12	-11.1491	15.8147	0.78592	1.0:0.0:0.0:0.0	.	137	P56179-2	.	R	165;137;37	ENSP00000428480:K165R;ENSP00000007660:K137R;ENSP00000451635:K37R	ENSP00000007660:K137R	K	+	2	0	DLX6	96474943	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.277000	0.95755	2.132000	0.65825	0.459000	0.35465	AAA	-	superfamily_Homeodomain-like,pfscan_Homeobox_dom		0.478	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLX6	protein_coding	OTTHUMT00000334373.4	A	NM_005222	-		96637007	+1	no_errors	ENST00000518156	ensembl	human	known	74_37	missense	SNP	1.000	G
DPEP1	1800	genome.wustl.edu	37	16	89702330	89702330	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr16:89702330C>T	ENST00000393092.3	+	3	410	c.119C>T	c.(118-120)cCc>cTc	p.P40L	DPEP1_ENST00000261615.4_Missense_Mutation_p.P40L|DPEP1_ENST00000421184.1_Missense_Mutation_p.P40L	NM_004413.3	NP_004404.1	P16444	DPEP1_HUMAN	dipeptidase 1 (renal)	40					antibiotic metabolic process (GO:0016999)|arachidonic acid metabolic process (GO:0019369)|cellular lactam catabolic process (GO:0072340)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|cellular response to nitric oxide (GO:0071732)|glutathione metabolic process (GO:0006749)|homocysteine metabolic process (GO:0050667)|leukotriene metabolic process (GO:0006691)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell migration (GO:0030336)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|apical part of cell (GO:0045177)|cell projection (GO:0042995)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|dipeptidyl-peptidase activity (GO:0008239)|GPI anchor binding (GO:0034235)|metallodipeptidase activity (GO:0070573)|metalloexopeptidase activity (GO:0008235)|modified amino acid binding (GO:0072341)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(10)|prostate(1)|urinary_tract(1)	14		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	AATGACCTCCCCTGGCAGCTG	0.657																																																	0								ENSG00000015413						46.0	40.0	42.0					16																	89702330		2184	4287	6471	DPEP1	SO:0001583	missense	0			-	HGNC		CCDS10982.1	16q24	2011-07-22			ENSG00000015413	ENSG00000015413	3.4.13.19		3002	protein-coding gene	gene with protein product		179780					Standard	NM_004413		Approved		uc002fnr.4	P16444	OTTHUMG00000138052	ENST00000393092.3:c.119C>T	16.37:g.89702330C>T	ENSP00000376807:p.Pro40Leu	Somatic	0	81	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	37	35.09	D3DX80|Q96AK2	Missense_Mutation	SNP	34	0.00	0	38	11.63	5	pfam_Peptidase_M19	p.P40L	ENST00000393092.3	37	c.119	CCDS10982.1	16	.	.	.	.	.	.	.	.	.	.	C	17.32	3.359443	0.61403	.	.	ENSG00000015413	ENST00000421184;ENST00000393092;ENST00000261615	T;T;T	0.21361	2.01;2.01;2.01	5.25	4.29	0.51040	.	0.051865	0.85682	D	0.000000	T	0.44244	0.1284	M	0.85197	2.74	0.80722	D	1	D	0.54964	0.969	P	0.55112	0.769	T	0.54563	-0.8275	10	0.72032	D	0.01	-10.297	14.699	0.69142	0.0:0.8536:0.1464:0.0	.	40	P16444	DPEP1_HUMAN	L	40	ENSP00000397313:P40L;ENSP00000376807:P40L;ENSP00000261615:P40L	ENSP00000261615:P40L	P	+	2	0	DPEP1	88229831	1.000000	0.71417	1.000000	0.80357	0.104000	0.19210	5.417000	0.66423	1.183000	0.42943	0.555000	0.69702	CCC	-	pfam_Peptidase_M19		0.657	DPEP1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DPEP1	protein_coding	OTTHUMT00000423058.1	C	NM_001128141	-		89702330	+1	no_errors	ENST00000261615	ensembl	human	known	74_37	missense	SNP	1.000	T
SPNS3	201305	genome.wustl.edu	37	17	4389838	4389838	+	Silent	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr17:4389838C>T	ENST00000355530.2	+	11	1690	c.1410C>T	c.(1408-1410)taC>taT	p.Y470Y	RP13-580F15.2_ENST00000576086.1_RNA|SPNS3_ENST00000333476.2_Silent_p.Y343Y|RP13-580F15.2_ENST00000577064.1_RNA|RP13-580F15.2_ENST00000577176.1_RNA	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	470					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						CTGCGCTGTACCTGGAGAGAG	0.657																																																	0								ENSG00000182557						35.0	39.0	38.0					17																	4389838		2203	4300	6503	SPNS3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.1410C>T	17.37:g.4389838C>T		Somatic	0	46	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	13	55.17	Q8IZ31	Silent	SNP	42	0.00	0	14	46.15	12	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.Y470	ENST00000355530.2	37	c.1410	CCDS11045.1	17																																																																																			-	pfscan_MFS_dom		0.657	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPNS3	protein_coding	OTTHUMT00000438793.1	C	NM_182538	-		4389838	+1	no_errors	ENST00000355530	ensembl	human	known	74_37	silent	SNP	0.998	T
GLTPD2	388323	genome.wustl.edu	37	17	4692361	4692361	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr17:4692361C>T	ENST00000331264.7	+	1	108	c.55C>T	c.(55-57)Cct>Tct	p.P19S	VMO1_ENST00000416307.2_5'Flank|VMO1_ENST00000441199.2_5'Flank|VMO1_ENST00000354194.4_5'Flank|VMO1_ENST00000328739.5_5'Flank	NM_001014985.2	NP_001014985	A6NH11	GLTD2_HUMAN	glycolipid transfer protein domain containing 2	19						cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	4						CCACTCAATTCCTCTCGCTAT	0.662																																																	0								ENSG00000182327						58.0	48.0	52.0					17																	4692361		2203	4300	6503	GLTPD2	SO:0001583	missense	0			-	HGNC	BC029290	CCDS32534.1	17p13.2	2007-12-19				ENSG00000182327			33756	protein-coding gene	gene with protein product							Standard	NM_001014985		Approved		uc002fza.2	A6NH11		ENST00000331264.7:c.55C>T	17.37:g.4692361C>T	ENSP00000328070:p.Pro19Ser	Somatic	1	129	0.77		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	64	20.99	A7E2T2	Missense_Mutation	SNP	33	0.00	0	20	20.00	5	pfam_Glycolipid_transfer_prot_dom,superfamily_Glycolipid_transfer_prot_dom	p.P19S	ENST00000331264.7	37	c.55	CCDS32534.1	17	.	.	.	.	.	.	.	.	.	.	C	12.00	1.807433	0.31961	.	.	ENSG00000182327	ENST00000331264	.	.	.	4.24	2.12	0.27331	.	0.548504	0.17888	N	0.158616	T	0.28200	0.0696	L	0.34521	1.04	0.09310	N	1	B	0.20550	0.046	B	0.15870	0.014	T	0.19976	-1.0289	9	0.59425	D	0.04	-1.0196	5.9975	0.19501	0.0:0.7005:0.1922:0.1072	.	19	A6NH11	GLTD2_HUMAN	S	19	.	ENSP00000328070:P19S	P	+	1	0	GLTPD2	4639101	0.003000	0.15002	0.004000	0.12327	0.010000	0.07245	0.831000	0.27476	0.495000	0.27882	0.561000	0.74099	CCT	-	NULL		0.662	GLTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTPD2	protein_coding	OTTHUMT00000439781.1	C	NM_001014985	-		4692361	+1	no_errors	ENST00000331264	ensembl	human	known	74_37	missense	SNP	0.009	T
PCF11	51585	genome.wustl.edu	37	11	82896850	82896850	+	3'UTR	SNP	T	T	A	rs139014507		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr11:82896850T>A	ENST00000298281.4	+	0	6034				RP11-727A23.11_ENST00000602322.1_lincRNA|RP11-727A23.4_ENST00000528133.1_RNA	NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						TGTTTGTACTTCTTTATTTCT	0.313																																																	0								ENSG00000269939																																			RP11-727A23.11	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.*914T>A	11.37:g.82896850T>A		Somatic	0	56	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	29	21.62	A6H8W7|O43671|Q6P0X8	RNA	SNP	45	0.00	0	39	38.10	24	-	NULL	ENST00000298281.4	37	NULL	CCDS44689.1	11																																																																																			-	-		0.313	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000269939	protein_coding	OTTHUMT00000392548.2	T	NM_015885	-		82896850	-1	no_errors	ENST00000602322	ensembl	human	known	74_37	rna	SNP	0.999	A
TBC1D29	26083	genome.wustl.edu	37	17	28887657	28887657	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr17:28887657G>A	ENST00000580161.1	+	4	2598	c.101G>A	c.(100-102)tGc>tAc	p.C34Y	TBC1D29_ENST00000584297.1_Missense_Mutation_p.C34Y|RP11-218M11.6_ENST00000582125.1_RNA|TBC1D29_ENST00000579181.1_Missense_Mutation_p.C34Y			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	34	Rab-GAP TBC; truncated. {ECO:0000255|PROSITE-ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				CTCACCCCGTGCCTGTGGGAT	0.562																																																	0								ENSG00000266733						138.0	115.0	123.0					17																	28887657		2203	4300	6503	TBC1D29	SO:0001583	missense	0			-	HGNC	BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.101G>A	17.37:g.28887657G>A	ENSP00000462799:p.Cys34Tyr	Somatic	0	131	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	88	12.87		Missense_Mutation	SNP	37	0.00	0	61	15.28	11	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.C34Y	ENST00000580161.1	37	c.101	CCDS32606.1	17	.	.	.	.	.	.	.	.	.	.	.	9.300	1.052824	0.19907	.	.	ENSG00000197689	ENST00000329040;ENST00000378698	.	.	.	.	.	.	Rab-GAP/TBC domain (2);	.	.	.	.	T	0.15825	0.0381	N	0.08118	0	0.26300	N	0.977996	B	0.29909	0.261	B	0.19946	0.027	T	0.16188	-1.0411	6	0.87932	D	0	.	.	.	.	.	34	Q9UFV1	TBC29_HUMAN	Y	34	.	ENSP00000330052:C34Y	C	+	2	0	TBC1D29	25911783	0.863000	0.29885	0.006000	0.13384	0.006000	0.05464	3.222000	0.51223	0.121000	0.18284	0.123000	0.15791	TGC	-	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.562	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TBC1D29	protein_coding	OTTHUMT00000443632.1	G	NM_015594	-		28887657	+1	no_errors	ENST00000579181	ensembl	human	known	74_37	missense	SNP	0.993	A
TAOK3	51347	genome.wustl.edu	37	12	118604636	118604636	+	Intron	SNP	C	C	T	rs61943534	byFrequency	TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr12:118604636C>T	ENST00000392533.3	-	18	2390				AC026366.1_ENST00000408353.1_RNA|TAOK3_ENST00000537952.1_Intron|TAOK3_ENST00000419821.2_Intron	NM_016281.3	NP_057365.3	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|MAPK cascade (GO:0000165)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of JNK cascade (GO:0046329)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)|transferase activity (GO:0016740)			central_nervous_system(1)|lung(5)|skin(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TATATATacacacacacacac	0.413													c|||	419	0.0836661	0.031	0.0879	5008	,	,		16186	0.0387		0.1382	False		,,,				2504	0.1421																0								ENSG00000221280																																			AC026366.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	AF135158	CCDS9188.1	12q	2007-08-03				ENSG00000135090			18133	protein-coding gene	gene with protein product						10559204, 10924369	Standard	NM_016281		Approved	JIK, DPK, MAP3K18	uc001twy.4	Q9H2K8		ENST00000392533.3:c.1900-4804G>A	12.37:g.118604636C>T		Somatic	0	13	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	14	22.22	Q658N1|Q8IUM4|Q9HC79|Q9NZM9|Q9UHG7	RNA	SNP	22	15.38	4	64	18.99	15	-	NULL	ENST00000392533.3	37	NULL	CCDS9188.1	12																																																																																			-	-		0.413	TAOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221280	protein_coding	OTTHUMT00000401456.2	C	NM_016281	rs61943534		118604636	+1	no_errors	ENST00000408353	ensembl	human	novel	74_37	rna	SNP	0.000	T
SULF1	23213	genome.wustl.edu	37	8	70488399	70488399	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr8:70488399C>T	ENST00000260128.4	+	6	1084	c.367C>T	c.(367-369)Cct>Tct	p.P123S	SULF1_ENST00000458141.2_Missense_Mutation_p.P123S|SULF1_ENST00000419716.3_Missense_Mutation_p.P123S|SULF1_ENST00000402687.4_Missense_Mutation_p.P123S	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	123					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			CATGCATGAGCCTCGGACTTT	0.493																																																	0								ENSG00000137573						139.0	123.0	128.0					8																	70488399		2203	4300	6503	SULF1	SO:0001583	missense	0			-	HGNC	AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.367C>T	8.37:g.70488399C>T	ENSP00000260128:p.Pro123Ser	Somatic	0	89	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	28	41.67	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	23	0.00	0	21	47.50	19	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.P123S	ENST00000260128.4	37	c.367	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	C	12.06	1.824892	0.32237	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716;ENST00000525999	D;D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01;-5.01	5.23	5.23	0.72850	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.96084	0.8724	L	0.41961	1.31	0.80722	D	1	B	0.11235	0.004	B	0.09377	0.004	D	0.94506	0.7714	10	0.12430	T	0.62	.	18.7899	0.91969	0.0:1.0:0.0:0.0	.	123	Q8IWU6	SULF1_HUMAN	S	123	ENSP00000403040:P123S;ENSP00000260128:P123S;ENSP00000385704:P123S;ENSP00000390315:P123S;ENSP00000431753:P123S	ENSP00000260128:P123S	P	+	1	0	SULF1	70650953	1.000000	0.71417	0.879000	0.34478	0.779000	0.44077	7.788000	0.85771	2.446000	0.82766	0.650000	0.86243	CCT	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase		0.493	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	protein_coding	OTTHUMT00000378885.2	C	NM_015170	-		70488399	+1	no_errors	ENST00000260128	ensembl	human	known	74_37	missense	SNP	1.000	T
ALK	238	genome.wustl.edu	37	2	29519861	29519861	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:29519861C>G	ENST00000389048.3	-	9	2616	c.1710G>C	c.(1708-1710)gaG>gaC	p.E570D	ALK_ENST00000498037.1_5'UTR|ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	570	MAM 2. {ECO:0000255|PROSITE- ProRule:PRU00128}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	CGGTTTTGTTCTCCACTAGCA	0.552			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0								ENSG00000171094						171.0	134.0	146.0					2																	29519861		2203	4300	6503	ALK	SO:0001583	missense	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	-	HGNC	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.1710G>C	2.37:g.29519861C>G	ENSP00000373700:p.Glu570Asp	Somatic	0	59	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	35	46.97	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	32	0.00	0	36	34.55	19	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E570D	ENST00000389048.3	37	c.1710	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	C	15.83	2.949997	0.53186	.	.	ENSG00000171094	ENST00000389048	T	0.02345	4.33	5.2	4.33	0.51752	Concanavalin A-like lectin/glucanase (1);MAM domain (2);	0.000000	0.46442	U	0.000282	T	0.04137	0.0115	N	0.24115	0.695	0.80722	D	1	P	0.52692	0.955	P	0.51701	0.677	T	0.60722	-0.7207	9	.	.	.	.	10.8377	0.46696	0.0:0.912:0.0:0.088	.	570	Q9UM73	ALK_HUMAN	D	570	ENSP00000373700:E570D	.	E	-	3	2	ALK	29373365	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	1.157000	0.31724	1.197000	0.43143	0.563000	0.77884	GAG	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,pfscan_MAM_dom		0.552	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	protein_coding	OTTHUMT00000324994.1	C	NM_004304	-		29519861	-1	no_errors	ENST00000389048	ensembl	human	known	74_37	missense	SNP	1.000	G
ATL2	64225	genome.wustl.edu	37	2	38536561	38536561	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:38536561C>G	ENST00000378954.4	-	9	1032	c.1031G>C	c.(1030-1032)gGa>gCa	p.G344A	ATL2_ENST00000546051.1_Missense_Mutation_p.G173A|ATL2_ENST00000402054.1_Missense_Mutation_p.G173A|ATL2_ENST00000419554.2_Missense_Mutation_p.G344A|ATL2_ENST00000539122.1_Missense_Mutation_p.G173A|ATL2_ENST00000452935.2_Missense_Mutation_p.G326A|ATL2_ENST00000406122.1_Missense_Mutation_p.G173A|ATL2_ENST00000332337.4_Missense_Mutation_p.G326A	NM_001135673.1|NM_022374.2	NP_001129145.1|NP_071769.2	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2	344					endoplasmic reticulum organization (GO:0007029)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein homooligomerization (GO:0051260)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	22						GACTTTAGATCCACTTATCTC	0.338																																																	0								ENSG00000119787						88.0	88.0	88.0					2																	38536561		2203	4300	6503	ATL2	SO:0001583	missense	0			-	HGNC		CCDS1795.1, CCDS46260.1	2p22.3	2008-09-17	2008-09-17	2008-09-17	ENSG00000119787	ENSG00000119787			24047	protein-coding gene	gene with protein product		609368	"""ADP-ribosylation factor-like 6 interacting protein 2"""	ARL6IP2		10508919, 18270207	Standard	NM_022374		Approved		uc002rqq.3	Q8NHH9	OTTHUMG00000102074	ENST00000378954.4:c.1031G>C	2.37:g.38536561C>G	ENSP00000368237:p.Gly344Ala	Somatic	0	27	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	B7Z1X2|B7Z7X8|Q4ZG30|Q7Z630|Q8NHH8|Q9H5M7	Missense_Mutation	SNP	47	0.00	0	46	23.33	14	pfam_Guanylate-bd_N,pfam_Guanylate-bd_C,superfamily_P-loop_NTPase,superfamily_Guanylate-bd_C	p.G344A	ENST00000378954.4	37	c.1031	CCDS46260.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.350139	0.95830	.	.	ENSG00000119787	ENST00000378954;ENST00000406122;ENST00000402054;ENST00000539122;ENST00000332337;ENST00000419554;ENST00000452935;ENST00000546051;ENST00000449130	T;T;T;T;T;T;T;T;D	0.92699	-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-1.24;-3.09	6.17	6.17	0.99709	Guanylate-binding protein, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.96935	0.8999	M	0.89414	3.03	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.963;0.999;0.996;0.997;0.999	D	0.96813	0.9598	10	0.87932	D	0	-19.45	19.8676	0.96824	0.0:1.0:0.0:0.0	.	173;326;326;344;344	B5MCN0;B7Z7X8;Q8NHH9-4;Q8NHH9-2;Q8NHH9	.;.;.;.;ATLA2_HUMAN	A	344;173;173;173;326;344;326;173;162	ENSP00000368237:G344A;ENSP00000385446:G173A;ENSP00000384062:G173A;ENSP00000446192:G173A;ENSP00000333393:G326A;ENSP00000415336:G344A;ENSP00000390743:G326A;ENSP00000438938:G173A;ENSP00000409811:G162A	ENSP00000333393:G326A	G	-	2	0	ATL2	38390065	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.669000	0.83911	2.941000	0.99782	0.655000	0.94253	GGA	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C		0.338	ATL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATL2	protein_coding	OTTHUMT00000219886.2	C	NM_022374	-		38536561	-1	no_errors	ENST00000378954	ensembl	human	known	74_37	missense	SNP	1.000	G
GLP1R	2740	genome.wustl.edu	37	6	39053689	39053689	+	Missense_Mutation	SNP	T	T	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:39053689T>A	ENST00000373256.4	+	13	1275	c.1232T>A	c.(1231-1233)cTg>cAg	p.L411Q		NM_002062.3	NP_002053.3	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor	411					activation of adenylate cyclase activity (GO:0007190)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|learning or memory (GO:0007611)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucagon receptor activity (GO:0004967)|transmembrane signaling receptor activity (GO:0004888)			breast(5)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	31					Exenatide(DB01276)|Glucagon recombinant(DB00040)|Liraglutide(DB06655)	AAGGTCCAGCTGGAATTTCGG	0.537																																																	0								ENSG00000112164						143.0	146.0	145.0					6																	39053689		2203	4300	6503	GLP1R	SO:0001583	missense	0			-	HGNC		CCDS4839.1	6p21	2012-08-10			ENSG00000112164	ENSG00000112164		"""GPCR / Class B : Glucagon receptors"""	4324	protein-coding gene	gene with protein product		138032					Standard	NM_002062		Approved		uc003ooj.4	P43220	OTTHUMG00000014638	ENST00000373256.4:c.1232T>A	6.37:g.39053689T>A	ENSP00000362353:p.Leu411Gln	Somatic	0	74	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	48	31.43	Q2M229|Q99669	Missense_Mutation	SNP	28	0.00	0	34	40.35	23	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GLP1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_GLP1/glucagon_rcpt,prints_GPCR_2_GIP_rcpt	p.L411Q	ENST00000373256.4	37	c.1232	CCDS4839.1	6	.	.	.	.	.	.	.	.	.	.	T	15.34	2.805493	0.50315	.	.	ENSG00000112164	ENST00000373256	T	0.63096	-0.02	6.17	5.03	0.67393	.	0.460660	0.24010	N	0.042391	T	0.33118	0.0852	L	0.34521	1.04	0.24828	N	0.992541	B	0.17038	0.02	B	0.27262	0.078	T	0.11518	-1.0584	10	0.49607	T	0.09	.	7.8859	0.29651	0.0:0.198:0.0:0.802	.	411	P43220	GLP1R_HUMAN	Q	411	ENSP00000362353:L411Q	ENSP00000362353:L411Q	L	+	2	0	GLP1R	39161667	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	2.868000	0.48436	2.371000	0.80710	0.533000	0.62120	CTG	-	NULL		0.537	GLP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP1R	protein_coding	OTTHUMT00000040443.1	T		-		39053689	+1	no_errors	ENST00000373256	ensembl	human	known	74_37	missense	SNP	0.998	A
LCA5	167691	genome.wustl.edu	37	6	80198915	80198915	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:80198915G>A	ENST00000392959.1	-	8	1728	c.1117C>T	c.(1117-1119)Caa>Taa	p.Q373*	LCA5_ENST00000467898.3_Nonsense_Mutation_p.Q373*|LCA5_ENST00000369846.4_Nonsense_Mutation_p.Q373*	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	373					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		TGCCTGTCTTGCTTTTGAGAT	0.358																																																	0								ENSG00000135338						121.0	112.0	115.0					6																	80198915		2202	4299	6501	LCA5	SO:0001587	stop_gained	0			-	HGNC		CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.1117C>T	6.37:g.80198915G>A	ENSP00000376686:p.Gln373*	Somatic	0	23	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	15	46.43	E1P542|Q9BWX7	Nonsense_Mutation	SNP	28	0.00	0	46	35.21	25	NULL	p.Q373*	ENST00000392959.1	37	c.1117	CCDS4990.1	6	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495437	0.85069	.	.	ENSG00000135338	ENST00000369846;ENST00000392959	.	.	.	5.24	0.308	0.15815	.	1.252340	0.05164	N	0.498341	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	-0.0254	6.6965	0.23201	0.0:0.2845:0.4095:0.306	.	.	.	.	X	373	.	ENSP00000358861:Q373X	Q	-	1	0	LCA5	80255634	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.391000	0.20784	0.156000	0.19299	-0.176000	0.13171	CAA	-	NULL		0.358	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LCA5	protein_coding	OTTHUMT00000259269.1	G	NM_181714	-		80198915	-1	no_errors	ENST00000369846	ensembl	human	known	74_37	nonsense	SNP	0.000	A
ME1	4199	genome.wustl.edu	37	6	83933629	83933629	+	Silent	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:83933629G>A	ENST00000369705.3	-	12	1415	c.1299C>T	c.(1297-1299)ggC>ggT	p.G433G	ME1_ENST00000541327.1_Silent_p.G267G|ME1_ENST00000543031.1_Silent_p.G358G	NM_002395.4	NP_002386.1	P48163	MAOX_HUMAN	malic enzyme 1, NADP(+)-dependent, cytosolic	433					carbohydrate metabolic process (GO:0005975)|cellular lipid metabolic process (GO:0044255)|malate metabolic process (GO:0006108)|NADP biosynthetic process (GO:0006741)|protein tetramerization (GO:0051262)|response to carbohydrate (GO:0009743)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|malate dehydrogenase (decarboxylating) (NADP+) activity (GO:0004473)|malic enzyme activity (GO:0004470)|manganese ion binding (GO:0030145)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|oxaloacetate decarboxylase activity (GO:0008948)			NS(2)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)		CAAAAGGACTGCCACTGGCAA	0.413																																																	0								ENSG00000065833						77.0	67.0	70.0					6																	83933629		2203	4300	6503	ME1	SO:0001819	synonymous_variant	0			-	HGNC	X77244	CCDS34492.1	6q12	2012-10-02			ENSG00000065833	ENSG00000065833	1.1.1.40		6983	protein-coding gene	gene with protein product		154250				8187880	Standard	NM_002395		Approved		uc003pjy.3	P48163	OTTHUMG00000015111	ENST00000369705.3:c.1299C>T	6.37:g.83933629G>A		Somatic	0	20	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	B4DZ70|Q16797|Q16855|Q53F72|Q5VWA2|Q9BWX8|Q9H1W3|Q9UIY4	Silent	SNP	34	0.00	0	63	0.00	0	pfam_Malic_NAD-bd,pfam_Malic_N,smart_Malic_NAD-bd,prints_Malic_OxRdtase	p.G433	ENST00000369705.3	37	c.1299	CCDS34492.1	6																																																																																			-	pfam_Malic_NAD-bd,smart_Malic_NAD-bd		0.413	ME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME1	protein_coding	OTTHUMT00000041350.1	G		-		83933629	-1	no_errors	ENST00000369705	ensembl	human	known	74_37	silent	SNP	1.000	A
ANKLE1	126549	genome.wustl.edu	37	19	17397495	17397495	+	3'UTR	SNP	G	G	T	rs576892988|rs563327402	byFrequency	TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr19:17397495G>T	ENST00000394458.3	+	0	2258				ANKLE1_ENST00000594072.1_3'UTR|ANKLE1_ENST00000404085.1_3'UTR|ANKLE1_ENST00000598347.1_Missense_Mutation_p.V589L	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1											large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						gtgtgtgtgtgtgtgtttgtg	0.527													G|||	277	0.0553115	0.0356	0.0605	5008	,	,		14143	0.0327		0.0577	False		,,,				2504	0.0992																0								ENSG00000160117																																			ANKLE1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.*134G>T	19.37:g.17397495G>T		Somatic	0	16	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41	A8VU82|Q8N8J8	Missense_Mutation	SNP	14	12.50	2	25	3.85	1	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Lactate_DH/Glyco_Ohase_4_C,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V589L	ENST00000394458.3	37	c.1765	CCDS12354.2	19	.	.	.	.	.	.	.	.	.	.	G	3.093	-0.186420	0.06340	.	.	ENSG00000160117	ENST00000438921	.	.	.	1.37	-1.1	0.09872	.	.	.	.	.	T	0.16685	0.0401	.	.	.	0.09310	N	0.999999	B	0.28552	0.215	B	0.16289	0.015	T	0.18808	-1.0325	6	.	.	.	.	3.9732	0.09462	0.4687:0.0:0.5313:0.0	.	589	E7ETZ9	.	L	589	.	.	V	+	1	0	ANKLE1	17258495	0.011000	0.17503	0.035000	0.18076	0.094000	0.18550	0.998000	0.29744	-0.222000	0.09958	0.274000	0.19336	GTG	-	NULL		0.527	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE1	protein_coding	OTTHUMT00000325392.2	G	NM_152363	-		17397495	+1	no_errors	ENST00000598347	ensembl	human	putative	74_37	missense	SNP	0.072	T
EEF1G	1937	genome.wustl.edu	37	11	62339327	62339327	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr11:62339327T>C	ENST00000329251.4	-	3	348	c.218A>G	c.(217-219)aAc>aGc	p.N73S	EEF1G_ENST00000378019.3_Missense_Mutation_p.N123S|EEF1G_ENST00000532986.1_5'UTR|MIR3654_ENST00000496634.2_3'UTR	NM_001404.4	NP_001395.1	P26641	EF1G_HUMAN	eukaryotic translation elongation factor 1 gamma	73	GST N-terminal.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to virus (GO:0009615)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	translation elongation factor activity (GO:0003746)			breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GGCAATGGCGTTGCTCTCAAA	0.458																																																	0								ENSG00000254772						48.0	46.0	47.0					11																	62339327		1942	4128	6070	EEF1G	SO:0001583	missense	0			-	HGNC	X63526	CCDS44626.1	11q12.3	2008-02-05			ENSG00000254772	ENSG00000254772			3213	protein-coding gene	gene with protein product		130593				1598220, 1461723	Standard	NM_001404		Approved	EF1G	uc001ntm.1	P26641	OTTHUMG00000167567	ENST00000329251.4:c.218A>G	11.37:g.62339327T>C	ENSP00000331901:p.Asn73Ser	Somatic	0	69	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	30	40.00	B4DTG2|Q6PJ62|Q6PK31|Q96CU2|Q9P196	Missense_Mutation	SNP	49	0.00	0	50	32.43	24	pfam_Transl_elong_EF1_G_con,pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Transl_elong_EF1_G_con,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,pfscan_Transl_elong_EF1_G_con	p.N123S	ENST00000329251.4	37	c.368	CCDS44626.1	11	.	.	.	.	.	.	.	.	.	.	T	19.09	3.759206	0.69763	.	.	ENSG00000254772	ENST00000329251;ENST00000378019	T;T	0.07114	3.22;3.22	4.85	4.85	0.62838	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.056659	0.64402	D	0.000002	T	0.12944	0.0314	M	0.75150	2.29	0.48901	D	0.999723	B;B	0.31459	0.324;0.023	B;B	0.36464	0.225;0.11	T	0.02526	-1.1146	10	0.42905	T	0.14	.	7.4763	0.27378	0.0:0.0976:0.0:0.9024	.	123;73	B4DTG2;P26641	.;EF1G_HUMAN	S	73;123	ENSP00000331901:N73S;ENSP00000367258:N123S	ENSP00000331901:N73S	N	-	2	0	EEF1G	62095903	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.916000	0.69981	1.944000	0.56390	0.460000	0.39030	AAC	-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold		0.458	EEF1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1G	protein_coding	OTTHUMT00000395047.1	T	NM_001404	-		62339327	-1	no_errors	ENST00000378019	ensembl	human	known	74_37	missense	SNP	1.000	C
FAR2P2	100216479	genome.wustl.edu	37	2	131187400	131187400	+	RNA	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:131187400G>T	ENST00000424873.1	-	0	0					NR_046260.1																						TGCTTCAATTGATAGTAAAGT	0.299																																																	0								ENSG00000239402																																			CYP4F43P			0			-	HGNC																													2.37:g.131187400G>T		Somatic	0	32	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	23	20.69		RNA	SNP	28	0.00	0	37	27.45	14	-	NULL	ENST00000424873.1	37	NULL		2																																																																																			-	-		0.299	AC140481.1-001	KNOWN	basic	processed_transcript	CYP4F43P	pseudogene	OTTHUMT00000333044.1	G		-		131187400	-1	no_errors	ENST00000455215	ensembl	human	known	74_37	rna	SNP	0.055	T
SLC4A10	57282	genome.wustl.edu	37	2	162735640	162735640	+	Splice_Site	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:162735640G>A	ENST00000446997.1	+	9	1041		c.e9-1		SLC4A10_ENST00000415876.2_Splice_Site|SLC4A10_ENST00000535165.1_Splice_Site|SLC4A10_ENST00000375514.5_Splice_Site|SLC4A10_ENST00000272716.5_Splice_Site|SLC4A10_ENST00000421911.1_Splice_Site|SLC4A10_ENST00000493021.1_Splice_Site	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10						bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	GATGCTTGCAGGTTGATCTGC	0.368																																																	0								ENSG00000144290						79.0	76.0	77.0					2																	162735640		1860	4092	5952	SLC4A10	SO:0001630	splice_region_variant	0			-	HGNC		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.949-1G>A	2.37:g.162735640G>A		Somatic	0	22	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	27	30.77	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Splice_Site	SNP	38	0.00	0	52	37.35	31	-	e9-1	ENST00000446997.1	37	c.949-1	CCDS54411.1	2	.	.	.	.	.	.	.	.	.	.	G	28.6	4.932462	0.92458	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000535165;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9133	0.97031	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC4A10	162443886	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.869000	0.99810	2.721000	0.93114	0.655000	0.94253	.	-	-		0.368	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC4A10	protein_coding	OTTHUMT00000333090.1	G	NM_022058	-	Intron	162735640	+1	no_errors	ENST00000446997	ensembl	human	known	74_37	splice_site	SNP	1.000	A
SPATA41	388182	genome.wustl.edu	37	15	100889473	100889473	+	lincRNA	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr15:100889473C>G	ENST00000560282.1	-	0	387					NR_028139.1				spermatogenesis associated 41 (non-protein coding)																		CCTAACCTCTCCAGCTTTTTG	0.537											OREG0023514	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000189419																																			SPATA41			0			-	HGNC	AK057536, AK124283, BC028144, DB060272		15q26.3	2013-10-31			ENSG00000189419	ENSG00000189419		"""Long non-coding RNAs"""	48613	non-coding RNA	RNA, long non-coding							Standard	NR_028139		Approved	FLJ42289, HSD47			OTTHUMG00000172281		15.37:g.100889473C>G		Somatic	0	48	0.00	1354	0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	52	17.46		RNA	SNP	26	0.00	0	41	25.45	14	-	NULL	ENST00000560282.1	37	NULL		15																																																																																			-	-		0.537	SPATA41-001	KNOWN	basic	lincRNA	SPATA41	lincRNA	OTTHUMT00000417649.1	C	NR_028139	-		100889473	-1	no_errors	ENST00000560282	ensembl	human	known	74_37	rna	SNP	0.000	G
CACNA1E	777	genome.wustl.edu	37	1	181686247	181686247	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr1:181686247C>A	ENST00000367573.2	+	11	1334	c.1334C>A	c.(1333-1335)gCc>gAc	p.A445D	CACNA1E_ENST00000367567.4_Missense_Mutation_p.A52D|CACNA1E_ENST00000526775.1_Missense_Mutation_p.A445D|CACNA1E_ENST00000367570.1_Missense_Mutation_p.A445D|CACNA1E_ENST00000358338.5_Missense_Mutation_p.A396D|CACNA1E_ENST00000360108.3_Missense_Mutation_p.A445D|CACNA1E_ENST00000357570.5_Missense_Mutation_p.A396D	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	445					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CTGGCCCGAGCCAGTATCAAA	0.522																																																	0								ENSG00000198216						84.0	82.0	83.0					1																	181686247		1888	4112	6000	CACNA1E	SO:0001583	missense	0			-	HGNC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.1334C>A	1.37:g.181686247C>A	ENSP00000356545:p.Ala445Asp	Somatic	0	28	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	21	40.00	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	44	0.00	0	37	39.34	24	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.A445D	ENST00000367573.2	37	c.1334	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916506	0.73098	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96774	-3.97;-3.98;-3.97;-3.96;-4.12;-3.97;-3.97	5.25	5.25	0.73442	.	0.536073	0.19883	N	0.103932	D	0.96234	0.8772	M	0.77103	2.36	0.53005	D	0.999965	P;P	0.44429	0.739;0.835	B;B	0.41894	0.369;0.369	D	0.96700	0.9517	10	0.56958	D	0.05	.	18.8106	0.92056	0.0:1.0:0.0:0.0	.	445;445	Q15878-2;Q15878-3	.;.	D	445;445;396;396;52;445;445	ENSP00000356542:A445D;ENSP00000434814:A445D;ENSP00000350183:A396D;ENSP00000351101:A396D;ENSP00000356539:A52D;ENSP00000353222:A445D;ENSP00000356545:A445D	ENSP00000350183:A396D	A	+	2	0	CACNA1E	179952870	0.995000	0.38212	1.000000	0.80357	0.994000	0.84299	3.263000	0.51546	2.597000	0.87782	0.655000	0.94253	GCC	-	NULL		0.522	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	protein_coding	OTTHUMT00000090793.2	C	NM_000721	-		181686247	+1	no_errors	ENST00000367573	ensembl	human	known	74_37	missense	SNP	1.000	A
NUAK1	9891	genome.wustl.edu	37	12	106461409	106461409	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr12:106461409G>T	ENST00000261402.2	-	7	2536	c.1157C>A	c.(1156-1158)cCt>cAt	p.P386H		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	386					cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						TGGGCTTTCAGGCACTGCATC	0.532																																																	0								ENSG00000074590						115.0	107.0	109.0					12																	106461409		2203	4300	6503	NUAK1	SO:0001583	missense	0			-	HGNC	AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.1157C>A	12.37:g.106461409G>T	ENSP00000261402:p.Pro386His	Somatic	0	45	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	27	25.00	A7MD39|Q96KA8	Missense_Mutation	SNP	26	0.00	0	42	27.59	16	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P386H	ENST00000261402.2	37	c.1157	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	G	12.63	1.996406	0.35226	.	.	ENSG00000074590	ENST00000261402;ENST00000553094	T;T	0.74002	-0.8;1.52	5.55	5.55	0.83447	.	0.101220	0.43260	D	0.000598	T	0.65657	0.2712	N	0.22421	0.69	0.09310	N	1	P	0.40875	0.731	P	0.45913	0.497	T	0.61845	-0.6979	10	0.52906	T	0.07	.	8.7785	0.34776	0.0751:0.0:0.7743:0.1506	.	386	O60285	NUAK1_HUMAN	H	386;101	ENSP00000261402:P386H;ENSP00000446873:P101H	ENSP00000261402:P386H	P	-	2	0	NUAK1	104985539	0.987000	0.35691	0.056000	0.19401	0.726000	0.41606	3.205000	0.51090	2.603000	0.88011	0.555000	0.69702	CCT	-	NULL		0.532	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	protein_coding	OTTHUMT00000405767.2	G	NM_014840	-		106461409	-1	no_errors	ENST00000261402	ensembl	human	known	74_37	missense	SNP	0.054	T
ENTPD8	377841	genome.wustl.edu	37	9	140330683	140330683	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr9:140330683A>G	ENST00000472938.1	-	6	848	c.832T>C	c.(832-834)Tac>Cac	p.Y278H	ENTPD8_ENST00000371506.2_Missense_Mutation_p.Y278H|ENTPD8_ENST00000344119.2_Missense_Mutation_p.Y278H			Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	278					nucleoside diphosphate biosynthetic process (GO:0009133)|nucleoside monophosphate biosynthetic process (GO:0009124)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			biliary_tract(1)|lung(4)|prostate(1)|skin(1)	7	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		GTGGTCTGGTAGCCGCTGAGG	0.701																																																	0								ENSG00000188833						27.0	29.0	28.0					9																	140330683		2196	4294	6490	ENTPD8	SO:0001583	missense	0			-	HGNC	AY359088	CCDS7043.1, CCDS43913.1	9q34.3	2013-09-20			ENSG00000188833	ENSG00000188833			24860	protein-coding gene	gene with protein product	"""GLSR2492"""					12975309	Standard	NM_198585		Approved	UNQ2492, NTPDase-8	uc004cmw.3	Q5MY95	OTTHUMG00000131831	ENST00000472938.1:c.832T>C	9.37:g.140330683A>G	ENSP00000420531:p.Tyr278His	Somatic	0	103	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	60	36.17	A2BG17|Q6UVZ0	Missense_Mutation	SNP	24	0.00	0	23	42.50	17	pfam_GDA1_CD39_NTPase	p.Y278H	ENST00000472938.1	37	c.832	CCDS43913.1	9	.	.	.	.	.	.	.	.	.	.	A	18.61	3.660639	0.67586	.	.	ENSG00000188833	ENST00000344119;ENST00000371506;ENST00000472938	T;T;T	0.12039	2.72;2.72;2.72	4.3	4.3	0.51218	.	0.171789	0.39475	N	0.001347	T	0.41305	0.1153	M	0.86953	2.85	0.48696	D	0.999693	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	T	0.48175	-0.9058	10	0.87932	D	0	-6.788	12.4073	0.55447	1.0:0.0:0.0:0.0	.	278;278	Q5MY95-2;Q5MY95	.;ENTP8_HUMAN	H	278	ENSP00000344089:Y278H;ENSP00000360561:Y278H;ENSP00000420531:Y278H	ENSP00000344089:Y278H	Y	-	1	0	ENTPD8	139450504	1.000000	0.71417	0.976000	0.42696	0.181000	0.23173	8.313000	0.89978	1.810000	0.52873	0.379000	0.24179	TAC	-	pfam_GDA1_CD39_NTPase		0.701	ENTPD8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD8	protein_coding	OTTHUMT00000355991.1	A	NM_198585	-		140330683	-1	no_errors	ENST00000371506	ensembl	human	known	74_37	missense	SNP	0.999	G
SLC22A20	440044	genome.wustl.edu	37	11	65000676	65000676	+	RNA	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr11:65000676C>G	ENST00000525437.1	+	0	1137							A6NK97	S22AK_HUMAN	solute carrier family 22, member 20						ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)	8						GAAGTTTGGGCTCAGCCTATA	0.587																																																	0								ENSG00000197847						70.0	72.0	71.0					11																	65000676		1940	4126	6066	SLC22A20			0			-	HGNC	DQ053017		11q13.1	2014-02-20			ENSG00000197847	ENSG00000197847		"""Solute carriers"""	29867	other	unknown		611696				15369770, 16478971	Standard	NM_001004326		Approved	Oat6, FLJ16331	uc021qlh.1	A6NK97	OTTHUMG00000165615		11.37:g.65000676C>G		Somatic	0	51	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	46	32.86	B9EJB2|Q6ZN88	RNA	SNP	21	0.00	0	37	33.93	19	-	NULL	ENST00000525437.1	37	NULL		11																																																																																			-	-		0.587	SLC22A20-003	KNOWN	basic	processed_transcript	SLC22A20	pseudogene	OTTHUMT00000385336.1	C	NM_001004326	-		65000676	+1	no_errors	ENST00000525437	ensembl	human	known	74_37	rna	SNP	0.982	G
E2F3	1871	genome.wustl.edu	37	6	20481454	20481455	+	Frame_Shift_Ins	INS	-	-	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:20481454_20481455insA	ENST00000346618.3	+	3	589_590	c.523_524insA	c.(523-525)gaafs	p.E175fs	E2F3_ENST00000535432.1_Splice_Site	NM_001949.4	NP_001940.1	O00716	E2F3_HUMAN	E2F transcription factor 3	175					mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)	7	all_cancers(95;0.154)|all_epithelial(95;0.0585)|Breast(50;0.146)|Ovarian(93;0.148)		OV - Ovarian serous cystadenocarcinoma(7;0.0068)|all cancers(50;0.0148)|Epithelial(50;0.0562)			ATCTCCCTCAGAAAAAACGCGG	0.475																																																	0								ENSG00000112242																																			E2F3	SO:0001589	frameshift_variant	0				HGNC	Y10479	CCDS4545.1, CCDS58999.1	6p22	2008-08-29			ENSG00000112242	ENSG00000112242			3115	protein-coding gene	gene with protein product		600427				8246996	Standard	NM_001949		Approved		uc003nda.2	O00716	OTTHUMG00000016389	ENST00000346618.3:c.529dupA	6.37:g.20481460_20481460dupA	ENSP00000262904:p.Glu175fs	Somatic	0	30	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	11	45.00	Q15000|Q68DT0|Q9BZ44	Frame_Shift_Ins	INS	37	0.00	0	57	26.92	21	pfam_E2F_TDP	p.T177fs	ENST00000346618.3	37	c.523_524	CCDS4545.1	6																																																																																			-	NULL		0.475	E2F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	E2F3	protein_coding	OTTHUMT00000043828.1	-				20481455	+1	no_errors	ENST00000346618	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
DDX56	54606	genome.wustl.edu	37	7	44613318	44613318	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr7:44613318C>T	ENST00000258772.5	-	2	192	c.86G>A	c.(85-87)cGa>cAa	p.R29Q	DDX56_ENST00000485367.1_5'UTR|DDX56_ENST00000431640.1_Missense_Mutation_p.R29Q	NM_001257189.1|NM_019082.3	NP_001244118.1|NP_061955.1	Q9NY93	DDX56_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 56	29					ATP catabolic process (GO:0006200)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)	16						CAGCGTAGGTCGCGACCAGCC	0.672																																																	0								ENSG00000136271						52.0	60.0	57.0					7																	44613318		2203	4300	6503	DDX56	SO:0001583	missense	0			-	HGNC	AJ131712	CCDS5492.1, CCDS59053.1	7p13	2012-02-23	2012-02-23		ENSG00000136271	ENSG00000136271		"""DEAD-boxes"""	18193	protein-coding gene	gene with protein product	"""nucleolar helicase of 61 kDa"""	608023	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 56"""			10749921	Standard	NM_019082		Approved	NOH61	uc003tlg.4	Q9NY93	OTTHUMG00000129211	ENST00000258772.5:c.86G>A	7.37:g.44613318C>T	ENSP00000258772:p.Arg29Gln	Somatic	0	55	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	39	26.42	A4D2K9|C9JV95|Q6IAE2|Q9H9I8	Missense_Mutation	SNP	19	0.00	0	36	35.71	20	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R29Q	ENST00000258772.5	37	c.86	CCDS5492.1	7	.	.	.	.	.	.	.	.	.	.	C	17.39	3.377373	0.61735	.	.	ENSG00000136271	ENST00000258772;ENST00000431640	T;T	0.41758	0.99;0.99	5.34	5.34	0.76211	RNA helicase, DEAD-box type, Q motif (1);DEAD-like helicase (1);	0.132350	0.50627	D	0.000104	T	0.27027	0.0662	N	0.21194	0.64	0.40514	D	0.98076	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.11012	-1.0605	10	0.21014	T	0.42	-6.9875	10.1025	0.42513	0.0:0.9085:0.0:0.0915	.	29;29	C9JV95;Q9NY93	.;DDX56_HUMAN	Q	29	ENSP00000258772:R29Q;ENSP00000393488:R29Q	ENSP00000258772:R29Q	R	-	2	0	DDX56	44579843	0.978000	0.34361	1.000000	0.80357	0.995000	0.86356	2.305000	0.43664	2.514000	0.84764	0.650000	0.86243	CGA	-	superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_RNA_helicase_DEAD_Q_motif		0.672	DDX56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX56	protein_coding	OTTHUMT00000251291.1	C	NM_019082	-		44613318	-1	no_errors	ENST00000258772	ensembl	human	known	74_37	missense	SNP	1.000	T
TENM4	26011	genome.wustl.edu	37	11	78383117	78383117	+	Silent	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr11:78383117G>A	ENST00000278550.7	-	31	6216	c.5754C>T	c.(5752-5754)ttC>ttT	p.F1918F		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1918					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TCCCATCAGCGAAGATCCTGG	0.537																																																	0								ENSG00000149256						80.0	79.0	79.0					11																	78383117		2063	4200	6263	TENM4	SO:0001819	synonymous_variant	0			-	HGNC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.5754C>T	11.37:g.78383117G>A		Somatic	0	40	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	28	30.00	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	29	0.00	0	37	43.94	29	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.F1918	ENST00000278550.7	37	c.5754	CCDS44688.1	11																																																																																			-	tigrfam_YD		0.537	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	protein_coding	OTTHUMT00000391406.2	G		-		78383117	-1	no_errors	ENST00000278550	ensembl	human	known	74_37	silent	SNP	0.995	A
ZNF469	84627	genome.wustl.edu	37	16	88502797	88502797	+	Silent	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr16:88502797G>A	ENST00000437464.1	+	2	8835	c.8835G>A	c.(8833-8835)aaG>aaA	p.K2945K	ZNF469_ENST00000565624.1_Silent_p.K2973K	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2945					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GTGCAGAGAAGCTGCCCTCCC	0.692																																																	0								ENSG00000225614						4.0	6.0	5.0					16																	88502797		661	1537	2198	ZNF469	SO:0001819	synonymous_variant	0			-	HGNC	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.8835G>A	16.37:g.88502797G>A		Somatic	0	89	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	79	12.22		Silent	SNP	26	0.00	0	53	15.87	10	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K2945	ENST00000437464.1	37	c.8835	CCDS45544.1	16																																																																																			-	NULL		0.692	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	protein_coding		G	NG_012236	-		88502797	+1	no_errors	ENST00000437464	ensembl	human	known	74_37	silent	SNP	0.001	A
COBL	23242	genome.wustl.edu	37	7	51141048	51141048	+	Intron	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr7:51141048C>G	ENST00000265136.7	-	7	1262				COBL_ENST00000441453.1_Missense_Mutation_p.K377N|COBL_ENST00000395540.2_Intron|COBL_ENST00000395542.2_Intron	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein						actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					ATCAGAAGCGCTTGGCCTGAG	0.488																																					NSCLC(189;2119 2138 12223 30818 34679)												0								ENSG00000106078																																			COBL	SO:0001627	intron_variant	0			-	HGNC	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.1096+11814G>C	7.37:g.51141048C>G		Somatic	0	24	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	14	26.32	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	46	0.00	0	58	12.12	8	pfam_Cordon-bleu_ubiquitin_domain	p.K377N	ENST00000265136.7	37	c.1131	CCDS34637.1	7	.	.	.	.	.	.	.	.	.	.	C	18.66	3.670693	0.67814	.	.	ENSG00000106078	ENST00000441453	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	D	0.83714	0.5314	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84031	0.0359	7	0.62326	D	0.03	.	19.545	0.95291	0.0:1.0:0.0:0.0	.	377	O75128-5	.	N	377	.	ENSP00000399500:K377N	K	-	3	2	COBL	51108542	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	2.428000	0.44749	2.861000	0.98227	0.655000	0.94253	AAG	-	NULL		0.488	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COBL	protein_coding	OTTHUMT00000342682.1	C	NM_015198	-		51141048	-1	no_errors	ENST00000441453	ensembl	human	known	74_37	missense	SNP	1.000	G
FREM2	341640	genome.wustl.edu	37	13	39263070	39263070	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr13:39263070A>G	ENST00000280481.7	+	1	1805	c.1589A>G	c.(1588-1590)gAc>gGc	p.D530G		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	530					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCGCTGAGCGACAACCTGGTG	0.592																																																	0								ENSG00000150893						43.0	35.0	38.0					13																	39263070		2203	4300	6503	FREM2	SO:0001583	missense	0			-	HGNC	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1589A>G	13.37:g.39263070A>G	ENSP00000280481:p.Asp530Gly	Somatic	0	32	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	16	30.43	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	28	0.00	0	25	7.41	2	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.D530G	ENST00000280481.7	37	c.1589	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	A	15.34	2.804175	0.50315	.	.	ENSG00000150893	ENST00000280481	T	0.37584	1.19	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.68970	0.3059	M	0.92555	3.32	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77814	-0.2448	10	0.72032	D	0.01	.	15.4185	0.74991	1.0:0.0:0.0:0.0	.	530	Q5SZK8	FREM2_HUMAN	G	530	ENSP00000280481:D530G	ENSP00000280481:D530G	D	+	2	0	FREM2	38161070	1.000000	0.71417	1.000000	0.80357	0.316000	0.28119	9.293000	0.96082	2.052000	0.61016	0.459000	0.35465	GAC	-	NULL		0.592	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	protein_coding	OTTHUMT00000044599.2	A	NM_207361	-		39263070	+1	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	SNP	1.000	G
MZT2A	653784	genome.wustl.edu	37	2	132250386	132250386	+	5'Flank	SNP	T	T	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:132250386T>C	ENST00000309451.6	-	0	0				MZT2A_ENST00000410036.2_5'Flank|AC093838.4_ENST00000438378.2_RNA|MIR4784_ENST00000579560.1_RNA	NM_001085365.1	NP_001078834.1	Q6P582	MZT2A_HUMAN	mitotic spindle organizing protein 2A							centrosome (GO:0005813)|gamma-tubulin ring complex (GO:0008274)|spindle (GO:0005819)				breast(1)|lung(1)	2						TCAACAACCCTGCTTACGCGC	0.597																																																	0								ENSG00000152117																																			AC093838.4	SO:0001631	upstream_gene_variant	0			-	Clone_based_vega_gene	BC018206	CCDS42758.1	2q21.1	2013-10-11	2010-07-22	2010-07-22	ENSG00000173272	ENSG00000173272			33187	protein-coding gene	gene with protein product	"""mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2A"""	613449	"""family with sequence similarity 128, member A"""	FAM128A		20360068	Standard	NM_001085365		Approved	MOZART2A	uc002tsw.4	Q6P582	OTTHUMG00000153606		2.37:g.132250386T>C	Exception_encountered	Somatic	0	78	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	58	30.95	Q3SWV8|Q8WVB2	RNA	SNP	24	0.00	0	28	34.88	15	-	NULL	ENST00000309451.6	37	NULL	CCDS42758.1	2																																																																																			-	-		0.597	MZT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC150776	protein_coding	OTTHUMT00000331811.2	T		-		132250386	+1	no_errors	ENST00000438378	ensembl	human	known	74_37	rna	SNP	0.004	C
PHYHIP	9796	genome.wustl.edu	37	8	22079120	22079120	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr8:22079120C>T	ENST00000321613.3	-	6	1195	c.739G>A	c.(739-741)Gac>Aac	p.D247N	PHYHIP_ENST00000454243.2_Missense_Mutation_p.D247N	NM_001099335.1	NP_001092805.1	Q92561	PHYIP_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein	247										endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	10				Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0629)		CAGAAGCGGTCCCCCAGGGAG	0.622																																																	0								ENSG00000168490						26.0	37.0	33.0					8																	22079120		2098	4193	6291	PHYHIP	SO:0001583	missense	0			-	HGNC	D87463	CCDS43723.1	8p21.2	2010-02-17	2006-01-09		ENSG00000168490	ENSG00000168490			16865	protein-coding gene	gene with protein product		608511	"""phytanoyl-CoA hydroxylase interacting protein"", ""DYRK1A interacting protein 3"""	DYRK1AP3		9039502, 10686344	Standard	NM_014759		Approved	KIAA0273, PAHX-AP	uc003xbj.4	Q92561	OTTHUMG00000163776	ENST00000321613.3:c.739G>A	8.37:g.22079120C>T	ENSP00000320017:p.Asp247Asn	Somatic	0	46	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	D3DSR1|Q8N4I9	Missense_Mutation	SNP	26	0.00	0	29	9.38	3	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.D247N	ENST00000321613.3	37	c.739	CCDS43723.1	8	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240367	0.79912	.	.	ENSG00000168490	ENST00000321613;ENST00000454243;ENST00000456132;ENST00000523252	T;T	0.52526	0.66;0.66	5.48	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.55657	0.1934	M	0.81802	2.56	0.51767	D	0.999939	P	0.35821	0.523	B	0.40702	0.338	T	0.61613	-0.7027	10	0.72032	D	0.01	-48.0826	12.9328	0.58296	0.0:0.9204:0.0:0.0796	.	247	Q92561	PHYIP_HUMAN	N	247;247;154;199	ENSP00000320017:D247N;ENSP00000415491:D247N	ENSP00000320017:D247N	D	-	1	0	PHYHIP	22135065	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.813000	0.86123	1.311000	0.45024	0.555000	0.69702	GAC	-	NULL		0.622	PHYHIP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PHYHIP	protein_coding	OTTHUMT00000375388.1	C	NM_014759	-		22079120	-1	no_errors	ENST00000454243	ensembl	human	known	74_37	missense	SNP	1.000	T
TLE4	7091	genome.wustl.edu	37	9	82308573	82308575	+	Intron	DEL	GTT	GTT	-			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	GTT	GTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr9:82308573_82308575delGTT	ENST00000376552.2	+	9	1627				TLE4_ENST00000265284.6_Intron|TLE4_ENST00000376544.3_Splice_Site_p.206_207SL>I|TLE4_ENST00000376537.4_Intron|TLE4_ENST00000376520.4_Splice_Site_p.206_207SL>I|TLE4_ENST00000376534.4_Intron	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						AACCACAAAAGTTGTACCTCTGC	0.429																																																	0								ENSG00000106829																																			TLE4	SO:0001627	intron_variant	0				HGNC	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.610-11123GTT>-	9.37:g.82308573_82308575delGTT		Somatic	0	45	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	34	34.62	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	In_Frame_Del	DEL	44	0.00	0	46	30.30	20	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.SL206in_frame_delI	ENST00000376552.2	37	c.617_619	CCDS43837.1	9																																																																																			-	NULL		0.429	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE4	protein_coding	OTTHUMT00000052792.4	GTT	XM_212237			82308575	+1	no_errors	ENST00000376520	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.000	-
CBLB	868	genome.wustl.edu	37	3	105421207	105421207	+	Missense_Mutation	SNP	G	G	A	rs542952599		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr3:105421207G>A	ENST00000264122.4	-	12	2011	c.1690C>T	c.(1690-1692)Cca>Tca	p.P564S	CBLB_ENST00000405772.1_Missense_Mutation_p.P564S|CBLB_ENST00000394027.3_Missense_Mutation_p.P586S|CBLB_ENST00000403724.1_Missense_Mutation_p.P564S	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	564	Interaction with VAV1.|Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						GGTGGGATTGGTGGAGGTCTT	0.527			Mis S		AML								G|||	1	0.000199681	0.0	0.0	5008	,	,		13834	0.0		0.001	False		,,,				2504	0.0				GBM(93;588 1337 9788 29341 43499)			Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0								ENSG00000114423						87.0	78.0	81.0					3																	105421207		2203	4300	6503	CBLB	SO:0001583	missense	0			-	HGNC	U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1690C>T	3.37:g.105421207G>A	ENSP00000264122:p.Pro564Ser	Somatic	0	74	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	17	41.38	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	33	0.00	0	26	31.58	12	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/Ts_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.P564S	ENST00000264122.4	37	c.1690	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	G	14.74	2.624157	0.46840	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.82984	-1.65;-1.63;-1.65;-1.67	5.36	5.36	0.76844	.	0.164723	0.56097	D	0.000039	T	0.71492	0.3346	N	0.16166	0.38	0.80722	D	1	B;B;B	0.26809	0.041;0.16;0.1	B;B;B	0.27715	0.037;0.082;0.054	T	0.67260	-0.5715	9	.	.	.	-12.1098	17.255	0.87053	0.0:0.0:1.0:0.0	.	586;564;564	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	S	564;586;564;564	ENSP00000264122:P564S;ENSP00000377595:P586S;ENSP00000384816:P564S;ENSP00000384938:P564S	.	P	-	1	0	CBLB	106903897	1.000000	0.71417	0.442000	0.26870	0.887000	0.51463	7.757000	0.85209	2.485000	0.83878	0.404000	0.27445	CCA	-	NULL		0.527	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	protein_coding	OTTHUMT00000319417.2	G	NM_170662	-		105421207	-1	no_errors	ENST00000264122	ensembl	human	known	74_37	missense	SNP	0.992	A
GAPDH	2597	genome.wustl.edu	37	12	6647317	6647317	+	Missense_Mutation	SNP	A	A	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr12:6647317A>C	ENST00000229239.5	+	9	1655	c.989A>C	c.(988-990)cAc>cCc	p.H330P	GAPDH_ENST00000396861.1_Missense_Mutation_p.H330P|GAPDH_ENST00000396856.1_Missense_Mutation_p.H255P|GAPDH_ENST00000396858.1_Missense_Mutation_p.H288P|GAPDH_ENST00000396859.1_Missense_Mutation_p.H330P|RP5-940J5.9_ENST00000602946.1_RNA	NM_002046.4	NP_002037.2	P04406	G3P_HUMAN	glyceraldehyde-3-phosphate dehydrogenase	330					carbohydrate metabolic process (GO:0005975)|cellular response to interferon-gamma (GO:0071346)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of translation (GO:0017148)|neuron apoptotic process (GO:0051402)|peptidyl-cysteine S-trans-nitrosylation (GO:0035606)|protein stabilization (GO:0050821)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GAIT complex (GO:0097452)|lipid particle (GO:0005811)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)|vesicle (GO:0031982)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|identical protein binding (GO:0042802)|microtubule binding (GO:0008017)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|peptidyl-cysteine S-nitrosylase activity (GO:0035605)			central_nervous_system(1)|cervix(1)|endometrium(1)|lung(4)	7						CTCATGGCCCACATGGCCTCC	0.562											OREG0021628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000111640						67.0	71.0	70.0					12																	6647317		2203	4298	6501	GAPDH	SO:0001583	missense	0			-	HGNC	AF261085	CCDS8549.1, CCDS58201.1	12p13.31	2012-10-02		2005-05-06	ENSG00000111640	ENSG00000111640	1.2.1.12		4141	protein-coding gene	gene with protein product		138400		GAPD		3170585	Standard	NM_002046		Approved		uc001qop.2	P04406	OTTHUMG00000137379	ENST00000229239.5:c.989A>C	12.37:g.6647317A>C	ENSP00000229239:p.His330Pro	Somatic	0	25	0.00	635	0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	32	21.95	E7EUT4|P00354|Q53X65	Missense_Mutation	SNP	27	0.00	0	54	18.18	12	pfam_GlycerAld_3-P_DH_cat,pfam_GlycerAld_3-P_DH_NAD(P)-bd,smart_GlycerAld_3-P_DH_NAD(P)-bd,pirsf_GlycerAld/Erythrose_P_DH,prints_GlycerAld/Erythrose_P_DH,tigrfam_Glyceraldehyde-3-P_DH_1	p.H330P	ENST00000229239.5	37	c.989	CCDS8549.1	12	.	.	.	.	.	.	.	.	.	.	A	22.2	4.254468	0.80135	.	.	ENSG00000111640	ENST00000229239;ENST00000396856;ENST00000396861;ENST00000396859;ENST00000396858	T;T;T;T;T	0.44881	1.92;0.91;1.92;1.92;0.92	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.66713	0.2817	M	0.86805	2.84	0.46396	D	0.999021	P;D;P;D	0.76494	0.952;0.981;0.898;0.999	P;P;P;D	0.67103	0.67;0.77;0.693;0.949	T	0.74472	-0.3654	10	0.87932	D	0	.	13.7336	0.62804	1.0:0.0:0.0:0.0	.	288;330;255;330	E7EUT4;Q2TSD0;E7EUT5;P04406	.;.;.;G3P_HUMAN	P	330;255;330;330;288	ENSP00000229239:H330P;ENSP00000380065:H255P;ENSP00000380070:H330P;ENSP00000380068:H330P;ENSP00000380067:H288P	ENSP00000229239:H330P	H	+	2	0	GAPDH	6517578	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.107000	0.94261	1.828000	0.53243	0.459000	0.35465	CAC	-	pirsf_GlycerAld/Erythrose_P_DH		0.562	GAPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAPDH	protein_coding	OTTHUMT00000268059.1	A	NM_002046	-		6647317	+1	no_errors	ENST00000229239	ensembl	human	known	74_37	missense	SNP	1.000	C
NDUFA13	51079	genome.wustl.edu	37	19	19626029	19626029	+	5'Flank	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr19:19626029G>A	ENST00000507754.4	+	0	0				CTC-260F20.3_ENST00000555938.1_5'Flank|NDUFA13_ENST00000428459.2_5'Flank|TSSK6_ENST00000360913.3_Missense_Mutation_p.P70S|NDUFA13_ENST00000512771.3_5'Flank|NDUFA13_ENST00000503283.1_5'Flank|TSSK6_ENST00000585580.3_Missense_Mutation_p.P70S|YJEFN3_ENST00000608404.1_5'Flank|NDUFA13_ENST00000252576.5_5'Flank			Q9P0J0	NDUAD_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 13						apoptotic signaling pathway (GO:0097190)|cellular metabolic process (GO:0044237)|cellular response to interferon-beta (GO:0035458)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell growth (GO:0030308)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of peptidase activity (GO:0010952)|positive regulation of protein catabolic process (GO:0045732)|protein import into mitochondrial inner membrane (GO:0045039)|reactive oxygen species metabolic process (GO:0072593)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain (GO:0005746)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	12						ACGATGTGCGGGTGTCGCACG	0.647																																																	0								ENSG00000178093						63.0	55.0	58.0					19																	19626029		2203	4300	6503	TSSK6	SO:0001631	upstream_gene_variant	0			-	HGNC	AF261134	CCDS12404.1, CCDS12404.2	19p13.11	2011-07-04			ENSG00000186010	ENSG00000186010		"""Mitochondrial respiratory chain complex / Complex I"""	17194	protein-coding gene	gene with protein product	"""complex I B16.6 subunit"""	609435				12837546, 10924506, 15367666	Standard	NM_015965		Approved	CGI-39, CDA016, GRIM-19, GRIM19, B16.6		Q9P0J0	OTTHUMG00000162211		19.37:g.19626029G>A	Exception_encountered	Somatic	0	39	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	34	30.61	B4DF76|K7EK58|Q6PKI0|Q9H2L3|Q9Y327	Missense_Mutation	SNP	25	0.00	0	34	32.00	16	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.P70S	ENST00000507754.4	37	c.208	CCDS12404.2	19	.	.	.	.	.	.	.	.	.	.	G	18.28	3.590217	0.66105	.	.	ENSG00000178093	ENST00000360913	T	0.33216	1.42	4.85	4.85	0.62838	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41396	U	0.000887	T	0.50343	0.1610	M	0.85710	2.77	0.40720	D	0.982651	P	0.46706	0.883	P	0.51297	0.665	T	0.60850	-0.7181	10	0.87932	D	0	.	13.4981	0.61438	0.0:0.0:1.0:0.0	.	70	Q9BXA6	TSSK6_HUMAN	S	70	ENSP00000354168:P70S	ENSP00000354168:P70S	P	-	1	0	TSSK6	19487029	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	5.176000	0.65026	2.252000	0.74401	0.306000	0.20318	CCG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.647	NDUFA13-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TSSK6	protein_coding	OTTHUMT00000367916.6	G	NM_015965	-		19626029	-1	no_errors	ENST00000360913	ensembl	human	known	74_37	missense	SNP	1.000	A
UGT3A2	167127	genome.wustl.edu	37	5	36039667	36039667	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr5:36039667C>T	ENST00000282507.3	-	5	1088	c.987G>A	c.(985-987)tgG>tgA	p.W329*	UGT3A2_ENST00000513300.1_Nonsense_Mutation_p.W295*|UGT3A2_ENST00000504954.1_5'Flank|UGT3A2_ENST00000545528.1_Nonsense_Mutation_p.W27*	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	329					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACTGACACTTCCATATCACCC	0.512																																																	0								ENSG00000168671						155.0	140.0	145.0					5																	36039667		2203	4300	6503	UGT3A2	SO:0001587	stop_gained	0			-	HGNC		CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.987G>A	5.37:g.36039667C>T	ENSP00000282507:p.Trp329*	Somatic	0	60	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	56	15.15	B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Nonsense_Mutation	SNP	31	0.00	0	44	27.87	17	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.W329*	ENST00000282507.3	37	c.987	CCDS3914.1	5	.	.	.	.	.	.	.	.	.	.	C	18.53	3.644889	0.67358	.	.	ENSG00000168671	ENST00000282507;ENST00000513300;ENST00000545528	.	.	.	3.27	1.42	0.22433	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.4882	0.27445	0.0:0.7288:0.1701:0.1011	.	.	.	.	X	329;295;27	.	ENSP00000282507:W329X	W	-	3	0	UGT3A2	36075424	1.000000	0.71417	0.183000	0.23137	0.388000	0.30384	3.964000	0.56780	0.379000	0.24794	0.655000	0.94253	TGG	-	pfam_UDP_glucos_trans		0.512	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A2	protein_coding	OTTHUMT00000253771.2	C	NM_174914	-		36039667	-1	no_errors	ENST00000282507	ensembl	human	known	74_37	nonsense	SNP	0.976	T
JADE1	79960	genome.wustl.edu	37	4	129792902	129792902	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr4:129792902G>A	ENST00000226319.6	+	11	2294	c.2014G>A	c.(2014-2016)Gac>Aac	p.D672N	PHF17_ENST00000452328.2_Missense_Mutation_p.D660N|PHF17_ENST00000512960.1_Missense_Mutation_p.D672N	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CATTAAAGGAGACTTAAAGGA	0.458																																																	0								ENSG00000077684						65.0	64.0	65.0					4																	129792902		2203	4300	6503	PHF17	SO:0001583	missense	0			-	HGNC																												ENST00000226319.6:c.2014G>A	4.37:g.129792902G>A	ENSP00000226319:p.Asp672Asn	Somatic	0	22	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	16	23.81		Missense_Mutation	SNP	34	0.00	0	32	56.76	42	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.D672N	ENST00000226319.6	37	c.2014	CCDS34062.1	4	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777549	0.49786	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.39787	1.06;1.06;1.06	4.59	4.59	0.56863	.	0.431641	0.25762	N	0.028476	T	0.28167	0.0695	L	0.27053	0.805	0.80722	D	1	B;B	0.25105	0.053;0.118	B;B	0.21917	0.013;0.037	T	0.06303	-1.0834	9	.	.	.	.	11.4641	0.50227	0.0821:0.0:0.9179:0.0	.	660;672	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	N	672;660;672;672	ENSP00000226319:D672N;ENSP00000388015:D660N;ENSP00000425730:D672N	.	D	+	1	0	PHF17	130012352	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.973000	0.63763	2.542000	0.85734	0.655000	0.94253	GAC	-	NULL		0.458	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF17	protein_coding	OTTHUMT00000364280.1	G		-		129792902	+1	no_errors	ENST00000226319	ensembl	human	known	74_37	missense	SNP	0.989	A
WDR3	10885	genome.wustl.edu	37	1	118483749	118483749	+	Silent	SNP	A	A	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr1:118483749A>C	ENST00000349139.5	+	8	839	c.792A>C	c.(790-792)cgA>cgC	p.R264R	WDR3_ENST00000369441.3_3'UTR	NM_006784.2	NP_006775.1	Q9UNX4	WDR3_HUMAN	WD repeat domain 3	264						nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(9)|liver(2)|lung(22)|prostate(2)|upper_aerodigestive_tract(1)	49	Esophageal squamous(2;0.162)	all_cancers(81;2.72e-05)|Acute lymphoblastic leukemia(138;1e-08)|all_epithelial(167;4.4e-07)|all_lung(203;1.7e-06)|Lung NSC(69;1.98e-05)|Prostate(1639;0.00955)|Breast(1374;0.244)		OV - Ovarian serous cystadenocarcinoma(397;1.39e-08)|Epithelial(280;1.82e-07)|all cancers(265;2.04e-05)|Lung(183;0.0525)|BRCA - Breast invasive adenocarcinoma(282;0.0695)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.185)		TTCTGTAGCGAATCCTTTCAT	0.408																																																	0								ENSG00000065183						99.0	93.0	95.0					1																	118483749		2203	4300	6503	WDR3	SO:0001819	synonymous_variant	0			-	HGNC	AF083217	CCDS898.1	1p12	2013-01-09			ENSG00000065183	ENSG00000065183		"""WD repeat domain containing"""	12755	protein-coding gene	gene with protein product		604737				10395803	Standard	NM_006784		Approved	FLJ12796, UTP12, DIP2	uc010oxe.1	Q9UNX4	OTTHUMG00000012197	ENST00000349139.5:c.792A>C	1.37:g.118483749A>C		Somatic	0	31	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	30	30.23		Silent	SNP	41	0.00	0	54	33.33	27	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R264	ENST00000349139.5	37	c.792	CCDS898.1	1																																																																																			-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.408	WDR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR3	protein_coding	OTTHUMT00000033720.2	A	NM_006784	-		118483749	+1	no_errors	ENST00000349139	ensembl	human	known	74_37	silent	SNP	0.292	C
UNC13C	440279	genome.wustl.edu	37	15	54630676	54630676	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr15:54630676C>G	ENST00000260323.11	+	16	4702	c.4702C>G	c.(4702-4704)Cta>Gta	p.L1568V	UNC13C_ENST00000545554.1_Missense_Mutation_p.L1568V|UNC13C_ENST00000537900.1_Missense_Mutation_p.L1566V	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1568					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTACTCCCAGCTAACAGACCC	0.388																																																	0								ENSG00000137766						99.0	100.0	99.0					15																	54630676		1839	4098	5937	UNC13C	SO:0001583	missense	0			-	HGNC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4702C>G	15.37:g.54630676C>G	ENSP00000260323:p.Leu1568Val	Somatic	0	43	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	4	84.00	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	38	0.00	0	18	55.00	22	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.L1568V	ENST00000260323.11	37	c.4702	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270572	0.40194	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.79352	-1.26;-1.26;-1.26	5.26	5.26	0.73747	Calcium-dependent secretion activator (1);	0.000000	0.64402	D	0.000002	T	0.78084	0.4228	L	0.47716	1.5	0.49051	D	0.999741	P;D	0.53619	0.841;0.961	P;P	0.50082	0.583;0.63	T	0.75416	-0.3325	10	0.30078	T	0.28	.	16.4203	0.83755	0.0:1.0:0.0:0.0	.	1568;1568	F5H090;Q8NB66	.;UN13C_HUMAN	V	1568;1568;1566	ENSP00000260323:L1568V;ENSP00000438156:L1568V;ENSP00000442569:L1566V	ENSP00000260323:L1568V	L	+	1	2	UNC13C	52417968	1.000000	0.71417	1.000000	0.80357	0.183000	0.23260	2.711000	0.47177	2.734000	0.93682	0.655000	0.94253	CTA	-	pfam_Ca-dep_secretion_activator		0.388	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	C	NM_173166	-		54630676	+1	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	SNP	1.000	G
DPCR1	135656	genome.wustl.edu	37	6	30916955	30916955	+	Missense_Mutation	SNP	G	G	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:30916955G>C	ENST00000462446.1	+	2	742	c.714G>C	c.(712-714)aaG>aaC	p.K238N	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	238	Thr-rich.					integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						CAACATACAAGACCACAGGAA	0.403																																																	0								ENSG00000168631						87.0	83.0	84.0					6																	30916955		692	1591	2283	DPCR1	SO:0001583	missense	0			-	HGNC	AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.714G>C	6.37:g.30916955G>C	ENSP00000417182:p.Lys238Asn	Somatic	0	21	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	43	0.00	0	51	28.17	20	NULL	p.K238N	ENST00000462446.1	37	c.714	CCDS4692.2	6	.	.	.	.	.	.	.	.	.	.	g	9.879	1.201085	0.22121	.	.	ENSG00000168631	ENST00000462446;ENST00000450344	T	0.41065	1.01	2.34	-3.84	0.04256	.	.	.	.	.	T	0.10852	0.0265	L	0.34521	1.04	0.09310	N	0.999998	P	0.52316	0.952	P	0.47528	0.549	T	0.05517	-1.0880	9	0.18276	T	0.48	.	1.0318	0.01540	0.3382:0.1538:0.3524:0.1556	.	238	E9PEI6	.	N	238	ENSP00000417182:K238N	ENSP00000411741:K238N	K	+	3	2	DPCR1	31024934	0.000000	0.05858	0.000000	0.03702	0.292000	0.27327	-0.352000	0.07701	-1.161000	0.02800	0.424000	0.28305	AAG	-	NULL		0.403	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	DPCR1	protein_coding	OTTHUMT00000076173.3	G	NM_080870	-		30916955	+1	no_errors	ENST00000462446	ensembl	human	novel	74_37	missense	SNP	0.000	C
ZNF268	10795	genome.wustl.edu	37	12	133779947	133779947	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr12:133779947C>A	ENST00000536435.2	+	6	2005	c.1675C>A	c.(1675-1677)Cat>Aat	p.H559N	ZNF268_ENST00000542986.2_3'UTR|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000537565.1_Missense_Mutation_p.H398N|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000228289.5_Missense_Mutation_p.H559N	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	559					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CTATGAATGCCATGAATGTGG	0.433																																																	0								ENSG00000090612						45.0	44.0	44.0					12																	133779947		692	1591	2283	ZNF268	SO:0001583	missense	0			-	HGNC	X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.1675C>A	12.37:g.133779947C>A	ENSP00000444412:p.His559Asn	Somatic	0	11	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	10	52.38	Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	40	0.00	0	37	37.29	22	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H559N	ENST00000536435.2	37	c.1675	CCDS45012.1	12	.	.	.	.	.	.	.	.	.	.	C	0.001	-3.070256	0.00036	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565;ENST00000541019	T;T	0.13196	2.61;2.61	4.21	-8.43	0.00953	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02610	0.0079	N	0.01209	-0.955	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.37957	-0.9683	8	.	.	.	.	1.9107	0.03287	0.4637:0.2155:0.0868:0.2339	.	559;398	Q14587;Q14587-2	ZN268_HUMAN;.	N	559;559;398;398	ENSP00000228289:H559N;ENSP00000445713:H398N	.	H	+	1	0	ZNF268	.	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-4.402000	0.00240	-1.493000	0.01835	-0.140000	0.14226	CAT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	protein_coding	OTTHUMT00000397191.2	C	NM_152943	-		133779947	+1	no_errors	ENST00000228289	ensembl	human	known	74_37	missense	SNP	0.000	A
HERC2P3	283755	genome.wustl.edu	37	15	20644374	20644374	+	RNA	SNP	A	A	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr15:20644374A>T	ENST00000428453.1	-	0	3189							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						CTCAGCGTGGACTCTGAGGAG	0.672																																																	0								ENSG00000180229						5.0	4.0	5.0					15																	20644374		1962	3759	5721	HERC2P3			0			-	HGNC	AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20644374A>T		Somatic	0	82	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	50	27.54		RNA	SNP	21	0.00	0	36	28.00	14	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			-	-		0.672	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	pseudogene	OTTHUMT00000347772.2	A	NG_008269	-		20644374	-1	no_errors	ENST00000426501	ensembl	human	known	74_37	rna	SNP	0.999	T
MBD3	53615	genome.wustl.edu	37	19	1584657	1584657	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr19:1584657G>A	ENST00000434436.3	-	3	419	c.290C>T	c.(289-291)aCg>aTg	p.T97M	MBD3_ENST00000156825.1_Missense_Mutation_p.T97M|MBD3_ENST00000590550.2_Missense_Mutation_p.T41M|MBD3_ENST00000585967.1_5'UTR|AC005943.4_ENST00000592406.1_RNA|MBD3_ENST00000592012.1_Missense_Mutation_p.T65M|UQCR11_ENST00000585937.1_3'UTR	NM_001281453.1	NP_001268382.1	O95983	MBD3_HUMAN	methyl-CpG binding domain protein 3	97					ATP-dependent chromatin remodeling (GO:0043044)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|tissue development (GO:0009888)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	8		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.179)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGCAGCGCCGTGTTCAGGTC	0.701																																																	0								ENSG00000071655						70.0	59.0	63.0					19																	1584657		2203	4300	6503	MBD3	SO:0001583	missense	0			-	HGNC	AF072247	CCDS12072.1, CCDS62481.1	19p13	2008-07-17				ENSG00000071655			6918	protein-coding gene	gene with protein product		603573				9774669, 10441743	Standard	NM_001281454		Approved		uc002ltl.1	O95983		ENST00000434436.3:c.290C>T	19.37:g.1584657G>A	ENSP00000412302:p.Thr97Met	Somatic	0	49	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	17	50.00	A8K4B7|D6W5Z2|Q6PIL9|Q6PJZ9|Q86XF4	Missense_Mutation	SNP	30	0.00	0	19	48.65	18	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_dom,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.T97M	ENST00000434436.3	37	c.290	CCDS12072.1	19	.	.	.	.	.	.	.	.	.	.	G	24.1	4.497123	0.85069	.	.	ENSG00000071655	ENST00000434436;ENST00000156825	D	0.98633	-5.04	4.89	4.89	0.63831	Methyl-CpG DNA binding (1);DNA-binding, integrase-type (1);	0.000000	0.85682	D	0.000000	D	0.98893	0.9625	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;0.995	D;D	0.87578	0.998;0.926	D	0.99513	1.0956	10	0.34782	T	0.22	-37.2615	17.0256	0.86446	0.0:0.0:1.0:0.0	.	65;97	O95983-2;O95983	.;MBD3_HUMAN	M	65;97	ENSP00000156825:T97M	ENSP00000156825:T97M	T	-	2	0	MBD3	1535657	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	9.493000	0.97960	2.249000	0.74217	0.462000	0.41574	ACG	-	superfamily_DNA-bd_dom		0.701	MBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3	protein_coding	OTTHUMT00000449658.2	G	NM_003926	-		1584657	-1	no_errors	ENST00000156825	ensembl	human	known	74_37	missense	SNP	1.000	A
OTOF	9381	genome.wustl.edu	37	2	26698230	26698230	+	Silent	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:26698230G>A	ENST00000272371.2	-	25	3249	c.3123C>T	c.(3121-3123)tcC>tcT	p.S1041S	OTOF_ENST00000402415.3_Silent_p.S351S|OTOF_ENST00000338581.6_Silent_p.S294S|OTOF_ENST00000403946.3_Silent_p.S1041S|OTOF_ENST00000339598.3_Silent_p.S294S	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1041	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCATACCATGGAATCCTGGT	0.587																																					GBM(102;732 1451 20652 24062 31372)												0								ENSG00000115155						85.0	72.0	77.0					2																	26698230		2203	4300	6503	OTOF	SO:0001819	synonymous_variant	0			-	HGNC	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3123C>T	2.37:g.26698230G>A		Somatic	0	56	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	46	44.58	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	23	0.00	0	36	40.00	24	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.S1041	ENST00000272371.2	37	c.3123	CCDS1725.1	2																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.587	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	G		-		26698230	-1	no_errors	ENST00000272371	ensembl	human	known	74_37	silent	SNP	0.999	A
OTOF	9381	genome.wustl.edu	37	2	26698260	26698260	+	Silent	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:26698260G>A	ENST00000272371.2	-	25	3219	c.3093C>T	c.(3091-3093)atC>atT	p.I1031I	OTOF_ENST00000402415.3_Silent_p.I341I|OTOF_ENST00000338581.6_Silent_p.I284I|OTOF_ENST00000403946.3_Silent_p.I1031I|OTOF_ENST00000339598.3_Silent_p.I284I	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1031	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAATGACAATGATGGGCGGAT	0.567																																					GBM(102;732 1451 20652 24062 31372)												0								ENSG00000115155						100.0	83.0	89.0					2																	26698260		2203	4300	6503	OTOF	SO:0001819	synonymous_variant	0			-	HGNC	AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3093C>T	2.37:g.26698260G>A		Somatic	0	57	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	46	35.21	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	34	0.00	0	35	36.36	20	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.I1031	ENST00000272371.2	37	c.3093	CCDS1725.1	2																																																																																			-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom		0.567	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	protein_coding	OTTHUMT00000214047.3	G		-		26698260	-1	no_errors	ENST00000272371	ensembl	human	known	74_37	silent	SNP	1.000	A
ZAK	51776	genome.wustl.edu	37	2	174131048	174131048	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:174131048G>A	ENST00000375213.3	+	20	2051	c.1973G>A	c.(1972-1974)gGc>gAc	p.G658D	MLTK_ENST00000409176.2_Missense_Mutation_p.G658D|MLK7-AS1_ENST00000423106.2_RNA|MLK7-AS1_ENST00000422703.1_RNA	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		658					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										AGGGACAGTGGCTTTTCCAGT	0.458																																																	0								ENSG00000091436						87.0	89.0	88.0					2																	174131048		1938	4149	6087	MLTK	SO:0001583	missense	0			-	Uniprot_gn																												ENST00000375213.3:c.1973G>A	2.37:g.174131048G>A	ENSP00000364361:p.Gly658Asp	Somatic	0	29	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	31	18.42	B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	36	0.00	0	59	21.33	16	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G658D	ENST00000375213.3	37	c.1973	CCDS42777.1	2	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493692	0.26774	.	.	ENSG00000091436	ENST00000409176;ENST00000375213	T;T	0.75050	-0.9;-0.9	5.87	4.05	0.47172	.	0.136590	0.64402	D	0.000004	T	0.60753	0.2293	N	0.24115	0.695	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.56577	-0.7956	10	0.66056	D	0.02	.	11.2243	0.48875	0.0659:0.0:0.8065:0.1276	.	658	Q9NYL2	MLTK_HUMAN	D	658	ENSP00000387259:G658D;ENSP00000364361:G658D	ENSP00000364361:G658D	G	+	2	0	AC013461.1	173839294	1.000000	0.71417	0.950000	0.38849	0.047000	0.14425	4.669000	0.61575	0.799000	0.34018	0.585000	0.79938	GGC	-	NULL		0.458	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	protein_coding	OTTHUMT00000255401.1	G		-		174131048	+1	no_errors	ENST00000375213	ensembl	human	known	74_37	missense	SNP	1.000	A
FOXK2	3607	genome.wustl.edu	37	17	80540673	80540673	+	Silent	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr17:80540673C>T	ENST00000335255.5	+	5	1140	c.966C>T	c.(964-966)tcC>tcT	p.S322S	snoU13_ENST00000459591.1_RNA	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	322					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			TGCCGCGTTCCCAGGAAGAAC	0.423																																																	0								ENSG00000141568						58.0	60.0	59.0					17																	80540673		2203	4300	6503	FOXK2	SO:0001819	synonymous_variant	0			-	HGNC	U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.966C>T	17.37:g.80540673C>T		Somatic	0	30	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	25	30.56	A6NEP5|Q13622|Q13623|Q13624	Silent	SNP	44	0.00	0	77	12.50	11	pfam_TF_fork_head,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_TF_fork_head,pfscan_FHA_dom,pfscan_TF_fork_head,prints_TF_fork_head	p.S322	ENST00000335255.5	37	c.966	CCDS11813.1	17																																																																																			-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head		0.423	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK2	protein_coding	OTTHUMT00000277099.2	C	NM_181430	-		80540673	+1	no_errors	ENST00000335255	ensembl	human	known	74_37	silent	SNP	1.000	T
PM20D1	148811	genome.wustl.edu	37	1	205811878	205811878	+	Splice_Site	SNP	A	A	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr1:205811878A>G	ENST00000367136.4	-	7	873	c.829T>C	c.(829-831)Ttg>Ctg	p.L277L	PM20D1_ENST00000460624.1_5'UTR	NM_152491.4	NP_689704.4	Q6GTS8	P20D1_HUMAN	peptidase M20 domain containing 1	277					negative regulation of neuron death (GO:1901215)|regulation of defense response to virus by host (GO:0050691)|regulation of viral process (GO:0050792)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|peptidase activity (GO:0008233)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)	28	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			GTCTGCTCCAATCTGGAAGAG	0.478																																																	0								ENSG00000162877						97.0	88.0	91.0					1																	205811878		2203	4300	6503	PM20D1	SO:0001630	splice_region_variant	0			-	HGNC		CCDS1460.1	1q32.1	2008-02-05			ENSG00000162877	ENSG00000162877			26518	protein-coding gene	gene with protein product							Standard	NM_152491		Approved	FLJ32569, Cps1	uc001hdj.3	Q6GTS8	OTTHUMG00000035999	ENST00000367136.4:c.828-1T>C	1.37:g.205811878A>G		Somatic	0	46	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	33	31.25	Q6P4E3|Q96DM4	Silent	SNP	49	0.00	0	37	41.27	26	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,superfamily_Peptidase_M20_dimer	p.L277	ENST00000367136.4	37	c.829	CCDS1460.1	1																																																																																			-	pfam_Peptidase_M20,pfam_Peptidase_M20_dimer,superfamily_Peptidase_M20_dimer		0.478	PM20D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PM20D1	protein_coding	OTTHUMT00000087736.1	A	NM_152491	-	Silent	205811878	-1	no_errors	ENST00000367136	ensembl	human	known	74_37	silent	SNP	1.000	G
TUBB4B	10383	genome.wustl.edu	37	9	140137556	140137556	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr9:140137556G>A	ENST00000340384.4	+	4	1034	c.886G>A	c.(886-888)Gcc>Acc	p.A296T		NM_006088.5	NP_006079.1	P68371	TBB4B_HUMAN	tubulin, beta 4B class IVb	296					'de novo' posttranslational protein folding (GO:0051084)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|unfolded protein binding (GO:0051082)									Albendazole(DB00518)|Mebendazole(DB00643)	GATGTTTGATGCCAAGAACAT	0.647																																																	0								ENSG00000188229						42.0	44.0	44.0					9																	140137556		2202	4291	6493	TUBB4B	SO:0001583	missense	0			-	HGNC	BC019359	CCDS7039.1	9q34.3	2011-10-10	2011-10-10	2011-10-10	ENSG00000188229	ENSG00000188229		"""Tubulins"""	20771	protein-coding gene	gene with protein product	"""class IVb beta-tubulin"""	602660	"""tubulin, beta 2C"""	TUBB2C		3999141	Standard	NM_006088		Approved	Beta2	uc004cmh.1	P68371	OTTHUMG00000131783	ENST00000340384.4:c.886G>A	9.37:g.140137556G>A	ENSP00000341289:p.Ala296Thr	Somatic	0	136	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	89	8.25	A2BFA2|P05217	Missense_Mutation	SNP	31	0.00	0	32	27.27	12	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.A296T	ENST00000340384.4	37	c.886	CCDS7039.1	9	.	.	.	.	.	.	.	.	.	.	G	17.00	3.275588	0.59649	.	.	ENSG00000188229	ENST00000340384	T	0.80994	-1.44	5.57	5.57	0.84162	.	0.225857	0.37857	N	0.001916	D	0.84479	0.5481	M	0.72353	2.195	0.80722	D	1	B	0.25206	0.12	B	0.37833	0.259	T	0.83312	-0.0022	10	0.87932	D	0	.	18.1378	0.89627	0.0:0.0:1.0:0.0	.	296	P68371	TBB4B_HUMAN	T	296	ENSP00000341289:A296T	ENSP00000341289:A296T	A	+	1	0	TUBB2C	139257377	1.000000	0.71417	0.972000	0.41901	0.962000	0.63368	5.377000	0.66184	2.625000	0.88918	0.655000	0.94253	GCC	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Gamma_tubulin		0.647	TUBB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB4B	protein_coding	OTTHUMT00000254715.1	G	NM_006088	-		140137556	+1	no_errors	ENST00000340384	ensembl	human	known	74_37	missense	SNP	1.000	A
SLC6A7	6534	genome.wustl.edu	37	5	149582250	149582250	+	Missense_Mutation	SNP	C	C	G	rs560979440		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr5:149582250C>G	ENST00000230671.2	+	8	1442	c.1071C>G	c.(1069-1071)gaC>gaG	p.D357E	SLC6A7_ENST00000524041.1_Missense_Mutation_p.D357E	NM_014228.3	NP_055043.2	Q99884	SC6A7_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 7	357					proline transport (GO:0015824)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)|stomach(1)	16		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Proline(DB00172)	TGCCTGTGGACCAAGTAGCCA	0.602																																																	0								ENSG00000011083						52.0	40.0	44.0					5																	149582250		2203	4300	6503	SLC6A7	SO:0001583	missense	0			-	HGNC	S80071	CCDS4305.1	5q32	2013-07-19	2013-07-19		ENSG00000011083	ENSG00000011083		"""Solute carriers"""	11054	protein-coding gene	gene with protein product	"""brain-specific L-proline transporter"", ""sodium-dependent proline transporter"""	606205	"""solute carrier family 6 (neurotransmitter transporter, L-proline), member 7"""			7651355	Standard	NM_014228		Approved	PROT	uc003lrr.3	Q99884	OTTHUMG00000130046	ENST00000230671.2:c.1071C>G	5.37:g.149582250C>G	ENSP00000230671:p.Asp357Glu	Somatic	0	46	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	27	30.77	Q0VG81|Q52LU6	Missense_Mutation	SNP	30	0.00	0	25	44.44	20	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	p.D357E	ENST00000230671.2	37	c.1071	CCDS4305.1	5	.	.	.	.	.	.	.	.	.	.	C	8.159	0.789007	0.16258	.	.	ENSG00000011083	ENST00000230671;ENST00000524041	T;T	0.73363	-0.74;-0.74	5.3	3.51	0.40186	.	0.245454	0.43260	D	0.000589	T	0.52773	0.1755	N	0.17723	0.515	0.35907	D	0.830829	B	0.06786	0.001	B	0.17722	0.019	T	0.46091	-0.9216	10	0.06891	T	0.86	.	7.7872	0.29099	0.137:0.74:0.0:0.123	.	357	Q99884	SC6A7_HUMAN	E	357	ENSP00000230671:D357E;ENSP00000428200:D357E	ENSP00000230671:D357E	D	+	3	2	SLC6A7	149562443	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.847000	0.27696	0.607000	0.29982	0.561000	0.74099	GAC	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.602	SLC6A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A7	protein_coding	OTTHUMT00000252325.1	C	NM_014228	-		149582250	+1	no_errors	ENST00000230671	ensembl	human	known	74_37	missense	SNP	1.000	G
PHLDB1	23187	genome.wustl.edu	37	11	118513087	118513087	+	Missense_Mutation	SNP	C	C	T	rs554925590		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr11:118513087C>T	ENST00000361417.2	+	14	3263	c.2852C>T	c.(2851-2853)cCc>cTc	p.P951L	PHLDB1_ENST00000356063.5_Intron|PHLDB1_ENST00000524713.1_Missense_Mutation_p.P94L|PHLDB1_ENST00000534672.1_Intron|PHLDB1_ENST00000527898.1_Intron	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	951										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCGCCTCTGCCCGCCAAAGCT	0.637																																																	0								ENSG00000019144						70.0	72.0	71.0					11																	118513087		2200	4295	6495	PHLDB1	SO:0001583	missense	0			-	HGNC		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2852C>T	11.37:g.118513087C>T	ENSP00000354498:p.Pro951Leu	Somatic	0	96	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	64	34.69	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	26	0.00	0	23	39.47	15	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.P951L	ENST00000361417.2	37	c.2852	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	C	18.68	3.675489	0.67928	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000524713	T;T	0.64618	1.03;-0.11	4.89	4.89	0.63831	.	0.502101	0.20824	N	0.085008	T	0.75671	0.3881	L	0.61218	1.895	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.049	D;D;B	0.91635	0.999;0.998;0.016	T	0.74134	-0.3763	10	0.36615	T	0.2	-20.7788	14.7972	0.69886	0.0:1.0:0.0:0.0	.	89;94;951	B7Z2B9;B4DK17;Q86UU1	.;.;PHLB1_HUMAN	L	951;710;315;94	ENSP00000354498:P951L;ENSP00000434905:P94L	ENSP00000350921:P315L	P	+	2	0	PHLDB1	118018297	1.000000	0.71417	0.992000	0.48379	0.976000	0.68499	6.589000	0.74080	2.254000	0.74563	0.455000	0.32223	CCC	-	NULL		0.637	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	protein_coding	OTTHUMT00000389279.1	C	NM_015157	-		118513087	+1	no_errors	ENST00000361417	ensembl	human	known	74_37	missense	SNP	0.998	T
ZNF733P	643955	genome.wustl.edu	37	7	62752551	62752551	+	RNA	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr7:62752551G>A	ENST00000331425.6	-	0	884					NR_003952.1				zinc finger protein 733, pseudogene																		TACGCTAAAGGCTTTGCCACA	0.483																																																	0								ENSG00000185037																																			ZNF733P			0			-	HGNC			7q11.21	2012-04-20	2012-04-20	2012-04-20	ENSG00000185037	ENSG00000185037			32473	pseudogene	pseudogene			"""zinc finger protein 733"""	ZNF733			Standard	NR_003952		Approved		uc011kdj.2		OTTHUMG00000156270		7.37:g.62752551G>A		Somatic	0	51	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79		RNA	SNP	20	0.00	0	42	14.29	7	-	NULL	ENST00000331425.6	37	NULL		7																																																																																			-	-		0.483	ZNF733P-002	KNOWN	basic	processed_transcript	ZNF733P	pseudogene	OTTHUMT00000343679.1	G		-		62752551	-1	no_errors	ENST00000331425	ensembl	human	known	74_37	rna	SNP	0.970	A
PRR32	100130613	genome.wustl.edu	37	X	125955076	125955076	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chrX:125955076A>T	ENST00000371125.3	+	2	535	c.455A>T	c.(454-456)gAg>gTg	p.E152V		NM_001122716.1	NP_001116188.1	B1ATL7	PRR32_HUMAN		152																	GGGGGCACTGAGAGAGGCAGT	0.542																																																	0								ENSG00000183631						24.0	23.0	24.0					X																	125955076		692	1591	2283	CXorf64	SO:0001583	missense	0			-	HGNC																												ENST00000371125.3:c.455A>T	X.37:g.125955076A>T	ENSP00000360166:p.Glu152Val	Somatic	0	100	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	79	8.14		Missense_Mutation	SNP	25	0.00	0	46	22.03	13	NULL	p.E152V	ENST00000371125.3	37	c.455	CCDS48163.1	X	.	.	.	.	.	.	.	.	.	.	A	14.33	2.502186	0.44455	.	.	ENSG00000183631	ENST00000371125	T	0.50277	0.75	4.01	2.82	0.32997	.	0.000000	0.34223	N	0.004157	T	0.50973	0.1647	L	0.34521	1.04	0.09310	N	1	D	0.89917	1.0	D	0.79784	0.993	T	0.32402	-0.9908	10	0.87932	D	0	-6.1704	5.4387	0.16496	0.8717:0.0:0.1283:0.0	.	152	B1ATL7	CX064_HUMAN	V	152	ENSP00000360166:E152V	ENSP00000360166:E152V	E	+	2	0	CXorf64	125782757	0.868000	0.29978	0.072000	0.20136	0.025000	0.11179	1.742000	0.38248	0.685000	0.31468	0.481000	0.45027	GAG	-	NULL		0.542	CXorf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf64	protein_coding	OTTHUMT00000058188.1	A		-		125955076	+1	no_errors	ENST00000371125	ensembl	human	known	74_37	missense	SNP	0.065	T
OPA1	4976	genome.wustl.edu	37	3	193372786	193372786	+	Silent	SNP	T	T	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr3:193372786T>A	ENST00000392438.3	+	20	2217	c.1983T>A	c.(1981-1983)acT>acA	p.T661T	OPA1_ENST00000361510.2_Silent_p.T716T|OPA1_ENST00000361150.2_Silent_p.T662T|OPA1_ENST00000361828.2_Silent_p.T679T|OPA1_ENST00000361908.3_Silent_p.T698T|OPA1_ENST00000361715.2_Silent_p.T680T	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	661					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		AACAGTGGACTGATAAACAAC	0.363																																																	0								ENSG00000198836						86.0	86.0	86.0					3																	193372786		2203	4300	6503	OPA1	SO:0001819	synonymous_variant	0			-	HGNC	AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.1983T>A	3.37:g.193372786T>A		Somatic	0	36	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	24	29.41	D3DNW4	Silent	SNP	38	2.56	1	71	8.97	7	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	p.T716	ENST00000392438.3	37	c.2148	CCDS43186.1	3																																																																																			-	NULL		0.363	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	protein_coding	OTTHUMT00000313812.2	T	NM_130837	-		193372786	+1	no_errors	ENST00000361510	ensembl	human	known	74_37	silent	SNP	1.000	A
UTP3	57050	genome.wustl.edu	37	4	71555634	71555634	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr4:71555634C>T	ENST00000254803.2	+	1	1439	c.1240C>T	c.(1240-1242)Caa>Taa	p.Q414*		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	414					brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			TATTACCTATCAAATTGCTAA	0.373																																																	0								ENSG00000132467						77.0	83.0	81.0					4																	71555634		2203	4300	6503	UTP3	SO:0001587	stop_gained	0			-	HGNC	AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.1240C>T	4.37:g.71555634C>T	ENSP00000254803:p.Gln414*	Somatic	0	21	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	10	42.11	Q6FI82	Nonsense_Mutation	SNP	29	0.00	0	52	33.33	26	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.Q414*	ENST00000254803.2	37	c.1240	CCDS3546.1	4	.	.	.	.	.	.	.	.	.	.	C	37	6.633910	0.97722	.	.	ENSG00000132467	ENST00000254803	.	.	.	5.46	5.46	0.80206	.	0.115349	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-13.0402	19.6793	0.95956	0.0:1.0:0.0:0.0	.	.	.	.	X	414	.	ENSP00000254803:Q414X	Q	+	1	0	UTP3	71774498	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.079000	0.64431	2.713000	0.92767	0.655000	0.94253	CAA	-	pfam_Sas10_C_dom		0.373	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	protein_coding	OTTHUMT00000252163.2	C	NM_020368	-		71555634	+1	no_errors	ENST00000254803	ensembl	human	known	74_37	nonsense	SNP	1.000	T
FAM220A	84792	genome.wustl.edu	37	7	6370316	6370316	+	Missense_Mutation	SNP	C	C	T	rs576104923		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr7:6370316C>T	ENST00000313324.4	-	2	937	c.470G>A	c.(469-471)cGc>cAc	p.R157H	FAM220A_ENST00000533877.1_5'Flank	NM_001037163.1	NP_001032240.1	Q7Z4H9	F220A_HUMAN	family with sequence similarity 220, member A	157						nucleus (GO:0005634)											TTTTTGATGGCGTGGCAGTCG	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16538	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000178397						46.0	54.0	51.0					7																	6370316		2203	4300	6503	FAM220A	SO:0001583	missense	0			-	HGNC	BC006110	CCDS34599.1	7p22.1	2012-03-19	2012-03-19	2012-03-19	ENSG00000178397	ENSG00000178397			22422	protein-coding gene	gene with protein product	"""STAT3-interacting protein as a repressor"""		"""chromosome 7 open reading frame 70"""	C7orf70			Standard	NM_001037163		Approved	SIPAR, MGC12966	uc003spu.3	Q7Z4H9	OTTHUMG00000122091	ENST00000313324.4:c.470G>A	7.37:g.6370316C>T	ENSP00000317289:p.Arg157His	Somatic	0	74	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	30	45.45	Q75ML2|Q8NA52|Q9BRR7	Missense_Mutation	SNP	28	0.00	0	38	38.71	24	NULL	p.R157H	ENST00000313324.4	37	c.470	CCDS34599.1	7	.	.	.	.	.	.	.	.	.	.	C	6.770	0.511014	0.12883	.	.	ENSG00000178397	ENST00000313324	T	0.08102	3.13	5.42	2.19	0.27852	.	1.224330	0.06033	U	0.653410	T	0.03053	0.0090	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.44314	-0.9336	10	0.14252	T	0.57	3.0244	4.3237	0.11029	0.3067:0.488:0.0:0.2053	.	157	Q7Z4H9	SIPAR_HUMAN	H	157	ENSP00000317289:R157H	ENSP00000317289:R157H	R	-	2	0	C7orf70	6336841	0.000000	0.05858	0.001000	0.08648	0.032000	0.12392	-0.209000	0.09358	0.648000	0.30732	-0.137000	0.14449	CGC	-	NULL		0.622	FAM220A-001	KNOWN	basic|CCDS	protein_coding	FAM220A	protein_coding	OTTHUMT00000242853.2	C	NM_001037163	-		6370316	-1	no_errors	ENST00000313324	ensembl	human	known	74_37	missense	SNP	0.000	T
DGCR2	9993	genome.wustl.edu	37	22	19050736	19050736	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr22:19050736G>A	ENST00000263196.7	-	5	851	c.604C>T	c.(604-606)Cgc>Tgc	p.R202C	DGCR2_ENST00000537045.1_Missense_Mutation_p.R161C|DGCR2_ENST00000473832.1_5'UTR|DGCR2_ENST00000545799.1_Missense_Mutation_p.R199C	NM_001184781.1|NM_005137.2	NP_001171710.1|NP_005128.1	P98153	IDD_HUMAN	DiGeorge syndrome critical region gene 2	202	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell adhesion (GO:0007155)|cognition (GO:0050890)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)	18	Colorectal(54;0.0993)					ACCTCCCAGCGACCTTCCAAG	0.587																																																	0								ENSG00000070413						114.0	88.0	97.0					22																	19050736		2203	4300	6503	DGCR2	SO:0001583	missense	0			-	HGNC	D79985	CCDS33598.1, CCDS54496.1	22q11.21	2008-06-12			ENSG00000070413	ENSG00000070413			2845	protein-coding gene	gene with protein product	"""integral membrane protein DGCR2"""	600594				7655455, 8630060	Standard	NM_005137		Approved	KIAA0163, LAN, IDD, DGS-C, SEZ-12	uc002zoq.1	P98153	OTTHUMG00000150141	ENST00000263196.7:c.604C>T	22.37:g.19050736G>A	ENSP00000263196:p.Arg202Cys	Somatic	0	27	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	18	45.45	A6NIB5|A8K6K5|B5TY34|B7Z935	Missense_Mutation	SNP	39	0.00	0	27	34.15	14	pfam_LDrepeatLR_classA_rpt,superfamily_C-type_lectin_fold,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_C-type_lectin,smart_VWF_C,pfscan_LDrepeatLR_classA_rpt,pfscan_C-type_lectin	p.R202C	ENST00000263196.7	37	c.604	CCDS33598.1	22	.	.	.	.	.	.	.	.	.	.	G	29.5	5.011039	0.93346	.	.	ENSG00000070413	ENST00000537045;ENST00000263196;ENST00000545799;ENST00000447928	T;T;T	0.19394	2.15;2.15;2.15	5.66	5.66	0.87406	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.399207	0.32081	N	0.006611	T	0.33702	0.0872	L	0.46157	1.445	0.80722	D	1	D;D	0.63880	0.993;0.978	P;P	0.51945	0.685;0.591	T	0.02226	-1.1192	10	0.72032	D	0.01	.	19.3521	0.94393	0.0:0.0:1.0:0.0	.	158;202	B7Z3T5;P98153	.;IDD_HUMAN	C	161;202;199;202	ENSP00000440062:R161C;ENSP00000263196:R202C;ENSP00000445069:R199C	ENSP00000263196:R202C	R	-	1	0	DGCR2	17430736	1.000000	0.71417	0.964000	0.40570	0.720000	0.41350	9.697000	0.98697	2.667000	0.90743	0.563000	0.77884	CGC	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.587	DGCR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DGCR2	protein_coding	OTTHUMT00000316504.1	G	NM_005137	-		19050736	-1	no_errors	ENST00000263196	ensembl	human	known	74_37	missense	SNP	1.000	A
BMP8B	656	genome.wustl.edu	37	1	40230633	40230633	+	Intron	SNP	T	T	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr1:40230633T>A	ENST00000372827.3	-	4	1049				BMP8B_ENST00000397360.2_Missense_Mutation_p.M241L	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b						cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGTTTCCACATCTGAAGCCTG	0.652																																																	0								ENSG00000116985																																			BMP8B	SO:0001627	intron_variant	0			-	HGNC	BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.674-144A>T	1.37:g.40230633T>A		Somatic	0	43	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Missense_Mutation	SNP	15	6.25	1	24	11.11	3	pfam_TGF-b_N	p.M241L	ENST00000372827.3	37	c.721	CCDS444.1	1	.	.	.	.	.	.	.	.	.	.	T	9.146	1.014961	0.19355	.	.	ENSG00000116985	ENST00000397360	T	0.57107	0.42	3.04	0.699	0.18093	.	.	.	.	.	T	0.37461	0.1004	.	.	.	0.80722	P	0.0	B	0.25850	0.136	B	0.24394	0.053	T	0.36578	-0.9742	7	0.52906	T	0.07	.	4.7925	0.13256	0.0:0.2801:0.0:0.7199	.	241	E7EMY8	.	L	241	ENSP00000380518:M241L	ENSP00000380518:M241L	M	-	1	0	BMP8B	40003220	0.014000	0.17966	0.224000	0.23877	0.017000	0.09413	1.013000	0.29937	0.120000	0.18254	-0.376000	0.06991	ATG	-	NULL		0.652	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP8B	protein_coding	OTTHUMT00000025641.1	T	NM_001720	-		40230633	-1	no_errors	ENST00000397360	ensembl	human	known	74_37	missense	SNP	0.658	A
SPACA1	81833	genome.wustl.edu	37	6	88768470	88768470	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:88768470G>A	ENST00000237201.1	+	4	521	c.404G>A	c.(403-405)aGa>aAa	p.R135K		NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	135					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		GAAAGTGTTAGATTGGCATGT	0.333																																																	0								ENSG00000118434						96.0	99.0	98.0					6																	88768470		2203	4300	6503	SPACA1	SO:0001583	missense	0			-	HGNC	AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.404G>A	6.37:g.88768470G>A	ENSP00000237201:p.Arg135Lys	Somatic	0	13	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18		Missense_Mutation	SNP	35	0.00	0	43	47.56	39	NULL	p.R135K	ENST00000237201.1	37	c.404	CCDS5014.1	6	.	.	.	.	.	.	.	.	.	.	G	10.19	1.280840	0.23392	.	.	ENSG00000118434	ENST00000237201	T	0.20332	2.08	5.86	0.0675	0.14366	.	0.512237	0.21166	N	0.079076	T	0.04363	0.0120	L	0.39898	1.24	0.18873	N	0.999985	B	0.06786	0.001	B	0.10450	0.005	T	0.41378	-0.9512	10	0.23302	T	0.38	-4.253	5.0982	0.14745	0.5822:0.0:0.2586:0.1592	.	135	Q9HBV2	SACA1_HUMAN	K	135	ENSP00000237201:R135K	ENSP00000237201:R135K	R	+	2	0	SPACA1	88825189	0.419000	0.25449	0.194000	0.23346	0.941000	0.58515	0.587000	0.23909	0.066000	0.16515	0.650000	0.86243	AGA	-	NULL		0.333	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPACA1	protein_coding	OTTHUMT00000041459.1	G		-		88768470	+1	no_errors	ENST00000237201	ensembl	human	known	74_37	missense	SNP	0.059	A
MYZAP	100820829	genome.wustl.edu	37	15	57924644	57924644	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr15:57924644C>A	ENST00000267853.5	+	7	785	c.691C>A	c.(691-693)Caa>Aaa	p.Q231K	GCOM1_ENST00000380561.2_Missense_Mutation_p.Q200K|GCOM1_ENST00000587652.1_Missense_Mutation_p.Q231K|GCOM1_ENST00000380560.2_Missense_Mutation_p.Q162K|GCOM1_ENST00000380569.2_Missense_Mutation_p.Q231K|GCOM1_ENST00000380568.3_Missense_Mutation_p.Q231K|POLR2M_ENST00000380563.2_5'UTR|GCOM1_ENST00000574161.1_Missense_Mutation_p.Q231K|GCOM1_ENST00000396180.1_Missense_Mutation_p.Q200K|MYZAP_ENST00000380565.4_Missense_Mutation_p.Q231K|GCOM1_ENST00000572390.1_Missense_Mutation_p.Q231K			P0CAP1	MYZAP_HUMAN	myocardial zonula adherens protein	231					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|I band (GO:0031674)											GGAATCGTCCCAAGAAGCCAA	0.512																																																	0								ENSG00000137878						203.0	180.0	188.0					15																	57924644		2192	4292	6484	GCOM1	SO:0001583	missense	0			-	HGNC	FJ970029		15q21.3	2012-10-05			ENSG00000263155	ENSG00000263155			43444	protein-coding gene	gene with protein product	"""myocardium-enriched zonula adherens protein"""	614071				20093627, 21992629, 22160502	Standard	NM_001018100		Approved	MYOZAP, Gup, Gup1, GCOM1		P0CAP1	OTTHUMG00000132453	ENST00000267853.5:c.691C>A	15.37:g.57924644C>A	ENSP00000267853:p.Gln231Lys	Somatic	1	189	0.53		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	77	62	55.40	D2E9U7|Q6EER8|Q6EES2|Q6EEV3|Q6EF00|Q6EF01|Q6EF02|Q6EF46|Q6EFN8|Q6EM48|Q6K046|Q6K050|Q6K051|Q6ZQZ3|Q8NC58|Q8NCF3|Q96DI5|Q96JB7|Q96NF5	Missense_Mutation	SNP	30	0.00	0	11	64.52	20	NULL	p.Q231K	ENST00000267853.5	37	c.691	CCDS10162.1	15	.	.	.	.	.	.	.	.	.	.	C	19.85	3.903007	0.72754	.	.	ENSG00000137878	ENST00000380569;ENST00000380561;ENST00000396180;ENST00000380560;ENST00000267853;ENST00000380565;ENST00000380568	T;T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47;1.47	5.36	5.36	0.76844	.	0.247102	0.42053	D	0.000761	T	0.35624	0.0938	L	0.50333	1.59	0.80722	D	1	P;B;P;P	0.45176	0.852;0.214;0.852;0.765	P;B;P;B	0.44359	0.447;0.199;0.447;0.297	T	0.04593	-1.0940	10	0.34782	T	0.22	-11.4559	17.8563	0.88764	0.0:1.0:0.0:0.0	.	231;231;231;231	P0CAP1-2;P0CAP1-11;P0CAP1-4;P0CAP1	.;.;.;GCOM1_HUMAN	K	231;200;200;162;231;231;231	ENSP00000369943:Q231K;ENSP00000369935:Q200K;ENSP00000379483:Q200K;ENSP00000369933:Q162K;ENSP00000267853:Q231K;ENSP00000369939:Q231K;ENSP00000369942:Q231K	ENSP00000267853:Q231K	Q	+	1	0	GCOM1	55711936	1.000000	0.71417	0.983000	0.44433	0.837000	0.47467	6.663000	0.74431	2.518000	0.84900	0.650000	0.86243	CAA	-	NULL		0.512	MYZAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCOM1	protein_coding	OTTHUMT00000255716.2	C	NM_001018100	-		57924644	+1	no_errors	ENST00000380569	ensembl	human	known	74_37	missense	SNP	1.000	A
TENM2	57451	genome.wustl.edu	37	5	167297559	167297560	+	Intron	INS	-	-	AT	rs60172043|rs371549205		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr5:167297559_167297560insAT	ENST00000518659.1	+	3	541				TENM2_ENST00000520393.1_Intron|AC093304.1_ENST00000408814.1_RNA|TENM2_ENST00000545108.1_Intron|TENM2_ENST00000519204.1_Intron|TENM2_ENST00000520394.1_Intron	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2						axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										aatgtgtatacatatatatata	0.252																																																	0								ENSG00000221741																																			AC093304.1	SO:0001627	intron_variant	0				Clone_based_ensembl_gene	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.503-5431->AT	5.37:g.167297568_167297569dupAT		Somatic	0	9	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	Q9ULU2	RNA	INS	21	32.26	10	38	25.49	13	-	NULL	ENST00000518659.1	37	NULL		5																																																																																			-	-		0.252	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ENSG00000221741	protein_coding	OTTHUMT00000376096.1	-	NM_001122679			167297560	-1	no_errors	ENST00000408814	ensembl	human	novel	74_37	rna	INS	0.001:0.001	AT
MAGED1	9500	genome.wustl.edu	37	X	51640322	51640322	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chrX:51640322T>C	ENST00000375722.1	+	5	1693	c.1441T>C	c.(1441-1443)Tac>Cac	p.Y481H	MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375695.2_Missense_Mutation_p.Y537H|MAGED1_ENST00000326587.7_Missense_Mutation_p.Y481H|MAGED1_ENST00000375772.3_Missense_Mutation_p.Y481H			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	481	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					GTTGGTCAAGTACTTGATGCT	0.423										Multiple Myeloma(10;0.10)																																							0								ENSG00000179222						93.0	72.0	79.0					X																	51640322		2203	4300	6503	MAGED1	SO:0001583	missense	0			-	HGNC	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.1441T>C	X.37:g.51640322T>C	ENSP00000364874:p.Tyr481His	Somatic	0	43	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	24	0.00	0	50	26.47	18	pfam_MAGE,pfscan_MAGE	p.Y537H	ENST00000375722.1	37	c.1609	CCDS14337.1	X	.	.	.	.	.	.	.	.	.	.	T	11.95	1.790274	0.31685	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.06768	3.26;3.26;3.26;3.26	3.54	2.37	0.29283	.	0.000000	0.34314	N	0.004066	T	0.09862	0.0242	M	0.73372	2.23	0.36454	D	0.866265	B;B	0.13594	0.008;0.003	B;B	0.15052	0.012;0.007	T	0.07214	-1.0784	10	0.87932	D	0	.	4.7164	0.12898	0.0:0.1466:0.0:0.8534	.	537;481	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	H	481;481;481;537	ENSP00000364927:Y481H;ENSP00000364874:Y481H;ENSP00000325333:Y481H;ENSP00000364847:Y537H	ENSP00000325333:Y481H	Y	+	1	0	MAGED1	51657062	1.000000	0.71417	0.999000	0.59377	0.884000	0.51177	4.099000	0.57755	0.570000	0.29347	0.350000	0.21858	TAC	-	pfam_MAGE,pfscan_MAGE		0.423	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	protein_coding	OTTHUMT00000056593.1	T	NM_001005332	-		51640322	+1	no_errors	ENST00000375695	ensembl	human	known	74_37	missense	SNP	0.998	C
DAGLA	747	genome.wustl.edu	37	11	61504767	61504767	+	Missense_Mutation	SNP	T	T	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr11:61504767T>G	ENST00000257215.5	+	14	1601	c.1485T>G	c.(1483-1485)ttT>ttG	p.F495L		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	495					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		TCAAGTGCTTTGCCTACTCCC	0.642																																																	0								ENSG00000134780						151.0	164.0	160.0					11																	61504767		2202	4299	6501	DAGLA	SO:0001583	missense	0			-	HGNC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1485T>G	11.37:g.61504767T>G	ENSP00000257215:p.Phe495Leu	Somatic	0	83	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	64	32.63	A7E233|Q6WQJ0	Missense_Mutation	SNP	34	0.00	0	33	36.54	19	pfam_Lipase_3	p.F495L	ENST00000257215.5	37	c.1485	CCDS31578.1	11	.	.	.	.	.	.	.	.	.	.	t	14.99	2.699419	0.48307	.	.	ENSG00000134780	ENST00000257215	T	0.25579	1.79	3.9	-2.37	0.06643	.	0.064498	0.64402	D	0.000006	T	0.20088	0.0483	L	0.49256	1.55	0.42084	D	0.99126	B	0.23650	0.089	B	0.25759	0.063	T	0.02751	-1.1115	10	0.54805	T	0.06	-13.1437	8.8518	0.35203	0.0:0.4071:0.0:0.5929	.	495	Q9Y4D2	DGLA_HUMAN	L	495	ENSP00000257215:F495L	ENSP00000257215:F495L	F	+	3	2	DAGLA	61261343	0.989000	0.36119	0.989000	0.46669	0.706000	0.40770	0.219000	0.17641	-0.733000	0.04850	0.255000	0.18592	TTT	-	pfam_Lipase_3		0.642	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	protein_coding	OTTHUMT00000398516.1	T	NM_006133	-		61504767	+1	no_errors	ENST00000257215	ensembl	human	known	74_37	missense	SNP	0.999	G
MKI67	4288	genome.wustl.edu	37	10	129910594	129910594	+	Missense_Mutation	SNP	G	G	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr10:129910594G>C	ENST00000368654.3	-	9	2147	c.1772C>G	c.(1771-1773)gCc>gGc	p.A591G	MKI67_ENST00000484853.1_5'UTR|MKI67_ENST00000368653.3_Missense_Mutation_p.A231G	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	591					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TTGATCACTGGCAACTGGAGT	0.502																																																	0								ENSG00000148773						127.0	127.0	127.0					10																	129910594		2203	4300	6503	MKI67	SO:0001583	missense	0			-	HGNC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.1772C>G	10.37:g.129910594G>C	ENSP00000357643:p.Ala591Gly	Somatic	0	67	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	16	51.52	Q5VWH2	Missense_Mutation	SNP	44	0.00	0	18	55.00	22	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.A591G	ENST00000368654.3	37	c.1772	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	G	11.34	1.610152	0.28712	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609;ENST00000368652	T;T	0.01397	4.97;4.94	3.58	2.67	0.31697	.	1.286870	0.05129	N	0.492180	T	0.02494	0.0076	N	0.25485	0.75	0.09310	N	1	D;D;P	0.56968	0.969;0.978;0.948	P;P;B	0.50659	0.634;0.647;0.431	T	0.50874	-0.8776	10	0.62326	D	0.03	.	6.8615	0.24069	0.1301:0.0:0.8699:0.0	.	591;231;591	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	G	591;231;591;166	ENSP00000357643:A591G;ENSP00000357642:A231G	ENSP00000357641:A166G	A	-	2	0	MKI67	129800584	0.025000	0.19082	0.001000	0.08648	0.075000	0.17131	3.337000	0.52120	0.832000	0.34804	0.563000	0.77884	GCC	-	NULL		0.502	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	protein_coding	OTTHUMT00000050999.1	G	NM_002417	-		129910594	-1	no_errors	ENST00000368654	ensembl	human	known	74_37	missense	SNP	0.001	C
AKAP3	10566	genome.wustl.edu	37	12	4737038	4737038	+	Missense_Mutation	SNP	C	C	T	rs369931580		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr12:4737038C>T	ENST00000545990.2	-	5	1554	c.1030G>A	c.(1030-1032)Gtc>Atc	p.V344I	RP11-500M8.7_ENST00000536588.1_Intron|AKAP3_ENST00000228850.1_Missense_Mutation_p.V344I	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	344					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						GTCCCTGTGACGCTGTGGAGA	0.493																																																	0								ENSG00000111254	C	ILE/VAL	0,4406		0,0,2203	153.0	145.0	148.0		1030	4.8	0.7	12		148	1,8599	1.2+/-3.3	0,1,4299	no	missense	AKAP3	NM_006422.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	344/854	4737038	1,13005	2203	4300	6503	AKAP3	SO:0001583	missense	0			-	HGNC	U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.1030G>A	12.37:g.4737038C>T	ENSP00000440994:p.Val344Ile	Somatic	0	32	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	22	59.26	O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	39	0.00	0	42	63.16	72	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.V344I	ENST00000545990.2	37	c.1030	CCDS8531.1	12	.	.	.	.	.	.	.	.	.	.	C	1.471	-0.559704	0.03967	0.0	1.16E-4	ENSG00000111254	ENST00000228850;ENST00000545990	T;T	0.07327	3.2;3.2	5.67	4.78	0.61160	A-kinase anchor 110kDa, C-terminal (1);	0.206931	0.34386	N	0.004016	T	0.10594	0.0259	L	0.33093	0.98	0.22389	N	0.999145	D	0.61080	0.989	P	0.51777	0.679	T	0.14227	-1.0480	10	0.05959	T	0.93	-19.7276	15.2948	0.73894	0.0:0.9259:0.0:0.0741	.	344	O75969	AKAP3_HUMAN	I	344	ENSP00000228850:V344I;ENSP00000440994:V344I	ENSP00000228850:V344I	V	-	1	0	AKAP3	4607299	0.977000	0.34250	0.706000	0.30403	0.239000	0.25481	1.820000	0.39032	0.871000	0.35750	-0.797000	0.03246	GTC	-	pfam_AKAP_110_C,smart_AKAP_110		0.493	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	protein_coding	OTTHUMT00000398911.2	C	NM_006422	-		4737038	-1	no_errors	ENST00000228850	ensembl	human	known	74_37	missense	SNP	0.915	T
SPINK8	646424	genome.wustl.edu	37	3	48369805	48369805	+	Silent	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr3:48369805G>T	ENST00000434006.1	-	1	26	c.27C>A	c.(25-27)atC>atA	p.I9I		NM_001080525.1	NP_001073994.1	P0C7L1	ISK8_HUMAN	serine peptidase inhibitor, Kazal type 8 (putative)	9						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CTAGAACAAGGATGGCGTCTG	0.443																																																	0								ENSG00000229453						131.0	127.0	129.0					3																	48369805		1966	4160	6126	SPINK8	SO:0001819	synonymous_variant	0			-	HGNC		CCDS46822.1	3p21.31	2011-08-31			ENSG00000229453	ENSG00000229453		"""Serine peptidase inhibitors, Kazal type"""	33160	protein-coding gene	gene with protein product						16930550	Standard	NM_001080525		Approved		uc003csq.1	P0C7L1	OTTHUMG00000156832	ENST00000434006.1:c.27C>A	3.37:g.48369805G>T		Somatic	0	52	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	11	62.07		Silent	SNP	38	0.00	0	16	68.63	35	pfam_Kazal_dom,smart_Kazal_dom	p.I9	ENST00000434006.1	37	c.27	CCDS46822.1	3																																																																																			-	NULL		0.443	SPINK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPINK8	protein_coding	OTTHUMT00000346123.1	G	NM_001080525	-		48369805	-1	no_errors	ENST00000434006	ensembl	human	known	74_37	silent	SNP	0.002	T
SERTAD2	9792	genome.wustl.edu	37	2	64863377	64863377	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:64863377C>T	ENST00000313349.3	-	2	926	c.629G>A	c.(628-630)gGt>gAt	p.G210D	SERTAD2_ENST00000476805.2_5'Flank	NM_014755.2	NP_055570.1	Q14140	SRTD2_HUMAN	SERTA domain containing 2	210					negative regulation of cell growth (GO:0030308)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|skin(1)	12						CTCTTGAGGACCGTCGAGTTT	0.572																																																	0								ENSG00000179833						62.0	65.0	64.0					2																	64863377		2203	4300	6503	SERTAD2	SO:0001583	missense	0			-	HGNC	D50917	CCDS33210.1	2p15	2007-05-01			ENSG00000179833	ENSG00000179833			30784	protein-coding gene	gene with protein product	"""transcriptional regulator interacting with the PHS-bromodomain 2"""					8590280, 11331592	Standard	NM_014755		Approved	TRIP-Br2, KIAA0127, Sei-2	uc002sde.2	Q14140	OTTHUMG00000152678	ENST00000313349.3:c.629G>A	2.37:g.64863377C>T	ENSP00000326933:p.Gly210Asp	Somatic	0	27	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	35	12.50	Q53TS2	Missense_Mutation	SNP	26	0.00	0	42	19.23	10	pfam_SERTA,pfscan_SERTA	p.G210D	ENST00000313349.3	37	c.629	CCDS33210.1	2	.	.	.	.	.	.	.	.	.	.	C	10.13	1.266271	0.23136	.	.	ENSG00000179833	ENST00000313349	.	.	.	5.73	4.85	0.62838	.	0.341559	0.34291	N	0.004091	T	0.57154	0.2034	L	0.58101	1.795	0.45452	D	0.99842	B	0.28713	0.22	B	0.21708	0.036	T	0.54918	-0.8221	9	0.32370	T	0.25	-10.9053	14.591	0.68365	0.0:0.9298:0.0:0.0702	.	210	Q14140	SRTD2_HUMAN	D	210	.	ENSP00000326933:G210D	G	-	2	0	SERTAD2	64716881	0.997000	0.39634	0.632000	0.29296	0.007000	0.05969	3.171000	0.50824	1.420000	0.47138	0.655000	0.94253	GGT	-	NULL		0.572	SERTAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD2	protein_coding	OTTHUMT00000327322.2	C	NM_014755	-		64863377	-1	no_errors	ENST00000313349	ensembl	human	known	74_37	missense	SNP	0.935	T
ANKMY1	51281	genome.wustl.edu	37	2	241420515	241420515	+	Splice_Site	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:241420515C>T	ENST00000272972.3	-	16	2833		c.e16-1		ANKMY1_ENST00000401804.1_Splice_Site|ANKMY1_ENST00000391987.1_Splice_Site|ANKMY1_ENST00000373320.4_Splice_Site|ANKMY1_ENST00000361678.4_Splice_Site|ANKMY1_ENST00000373318.2_Splice_Site|ANKMY1_ENST00000406958.1_Splice_Site|ANKMY1_ENST00000403283.1_Splice_Site	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1								metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GAAGGGAATTCTGCAACAGAG	0.632																																																	0								ENSG00000144504						65.0	67.0	66.0					2																	241420515		2203	4300	6503	ANKMY1	SO:0001630	splice_region_variant	0			-	HGNC	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.2619-1G>A	2.37:g.241420515C>T		Somatic	0	76	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	83	24.55	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Splice_Site	SNP	44	0.00	0	70	23.91	22	-	e15-1	ENST00000272972.3	37	c.2619-1	CCDS2536.1	2	.	.	.	.	.	.	.	.	.	.	C	16.55	3.154067	0.57259	.	.	ENSG00000144504	ENST00000373318;ENST00000406958;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000407275	.	.	.	3.89	3.89	0.44902	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7095	0.62659	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ANKMY1	241069188	0.999000	0.42202	0.362000	0.25862	0.917000	0.54804	5.315000	0.65810	1.892000	0.54788	0.467000	0.42956	.	-	-		0.632	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKMY1	protein_coding	OTTHUMT00000257187.2	C	NM_017844	-	Intron	241420515	-1	no_errors	ENST00000272972	ensembl	human	known	74_37	splice_site	SNP	0.828	T
TEX11	56159	genome.wustl.edu	37	X	69843849	69843849	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chrX:69843849G>A	ENST00000395889.2	-	21	1902	c.1747C>T	c.(1747-1749)Ctt>Ttt	p.L583F	TEX11_ENST00000374320.2_Missense_Mutation_p.L258F|TEX11_ENST00000344304.3_Missense_Mutation_p.L583F|TEX11_ENST00000374333.2_Missense_Mutation_p.L568F	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	583					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					AGAAAACGAAGCAAACACCTG	0.328																																																	0								ENSG00000120498						91.0	88.0	89.0					X																	69843849		2203	4299	6502	TEX11	SO:0001583	missense	0			-	HGNC	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.1747C>T	X.37:g.69843849G>A	ENSP00000379226:p.Leu583Phe	Somatic	0	58	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	40	0.00	0	72	0.00	0	pfam_Meiosis_specific_SPO22,smart_TPR_repeat	p.L583F	ENST00000395889.2	37	c.1747	CCDS35323.1	X	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.569041	0.00895	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	3.78	-6.25	0.02039	.	0.546766	0.17688	N	0.165367	T	0.06416	0.0165	N	0.00347	-1.61	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.35201	-0.9798	9	.	.	.	.	0.6603	0.00842	0.21:0.1457:0.2101:0.4342	.	568;583	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	F	568;583;258;583	ENSP00000363453:L568F;ENSP00000379226:L583F;ENSP00000363440:L258F;ENSP00000340995:L583F	.	L	-	1	0	TEX11	69760574	0.421000	0.25465	0.003000	0.11579	0.019000	0.09904	-0.258000	0.08733	-1.097000	0.03042	-1.399000	0.01144	CTT	-	NULL		0.328	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	protein_coding	OTTHUMT00000359072.1	G		-		69843849	-1	no_errors	ENST00000344304	ensembl	human	known	74_37	missense	SNP	0.008	A
ALS2CR11	151254	genome.wustl.edu	37	2	202358884	202358884	+	Intron	SNP	T	T	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:202358884T>C	ENST00000286195.3	-	14	1626				ALS2CR11_ENST00000439140.1_Missense_Mutation_p.E727G|ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000482942.1_Intron	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11											NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						TTGTTTTTTTTCCAATACGTT	0.299																																																	0								ENSG00000155754						30.0	23.0	25.0					2																	202358884		692	1579	2271	ALS2CR11	SO:0001627	intron_variant	0			-	HGNC	AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1581+1733A>G	2.37:g.202358884T>C		Somatic	0	35	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	49	0.00	0	68	21.84	19	superfamily_C2_dom	p.E727G	ENST00000286195.3	37	c.2180	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	t	6.231	0.410796	0.11812	.	.	ENSG00000155754	ENST00000439140	T	0.53857	0.6	5.19	-4.75	0.03239	.	.	.	.	.	T	0.18045	0.0433	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11372	-1.0590	9	0.27082	T	0.32	.	2.0996	0.03676	0.1192:0.2579:0.1222:0.5007	.	727	E9PGG4	.	G	727	ENSP00000409937:E727G	ENSP00000409937:E727G	E	-	2	0	ALS2CR11	202067129	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.120000	0.10660	-0.999000	0.03442	-2.080000	0.00379	GAA	-	NULL		0.299	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	protein_coding	OTTHUMT00000256296.2	T	NM_152525	-		202358884	-1	no_errors	ENST00000439140	ensembl	human	novel	74_37	missense	SNP	0.000	C
ZSCAN20	7579	genome.wustl.edu	37	1	33956909	33956909	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr1:33956909C>G	ENST00000361328.3	+	6	1204	c.1051C>G	c.(1051-1053)Cac>Gac	p.H351D	ZSCAN20_ENST00000373413.2_Missense_Mutation_p.H297D	NM_145238.3	NP_660281	P17040	ZSC20_HUMAN	zinc finger and SCAN domain containing 20	351					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(2)|pancreas(1)|stomach(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CCGGACTTGTCACCAGAACCG	0.522																																																	0								ENSG00000121903						70.0	76.0	74.0					1																	33956909		1947	4154	6101	ZSCAN20	SO:0001583	missense	0			-	HGNC	X52360	CCDS41300.1	1p34.3	2013-01-08	2007-02-20	2007-02-20	ENSG00000121903	ENSG00000121903		"""-"", ""Zinc fingers, C2H2-type"""	13093	protein-coding gene	gene with protein product		611315	"""zinc finger protein 31 (KOX 29)"", ""zinc finger protein 31"""	ZNF360, ZNF31		2288909	Standard	NM_145238		Approved	KOX29	uc001bxj.4	P17040	OTTHUMG00000004173	ENST00000361328.3:c.1051C>G	1.37:g.33956909C>G	ENSP00000355053:p.His351Asp	Somatic	0	45	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	17	51.43	A8K2D0|B1ALI4|B1ALI5|B1ALI6|Q6ZN23|Q96FA9|Q96H84	Missense_Mutation	SNP	34	0.00	0	19	64.15	34	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_SANT/Myb,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.H351D	ENST00000361328.3	37	c.1051	CCDS41300.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979700	0.74360	.	.	ENSG00000121903	ENST00000373411;ENST00000326544;ENST00000373413;ENST00000361328;ENST00000401072	T	0.41758	0.99	5.74	5.74	0.90152	SANT domain, DNA binding (1);	0.000000	0.64402	D	0.000003	T	0.70928	0.3280	M	0.92459	3.31	0.42249	D	0.991961	D;B;D	0.89917	0.999;0.42;1.0	D;B;D	0.87578	0.973;0.12;0.998	T	0.71676	-0.4521	10	0.23302	T	0.38	-31.027	15.8024	0.78463	0.0:1.0:0.0:0.0	.	351;297;351	P17040-3;P17040-4;P17040	.;.;ZSC20_HUMAN	D	297;351;297;285;285	ENSP00000362512:H297D	ENSP00000324450:H351D	H	+	1	0	ZSCAN20	33729496	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.956000	0.49129	2.884000	0.98904	0.655000	0.94253	CAC	-	smart_SANT/Myb		0.522	ZSCAN20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN20	protein_coding	OTTHUMT00000277003.2	C	NM_145238	-		33956909	+1	no_errors	ENST00000361328	ensembl	human	known	74_37	missense	SNP	1.000	G
MUC16	94025	genome.wustl.edu	37	19	9085355	9085355	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr19:9085355A>T	ENST00000397910.4	-	1	6663	c.6460T>A	c.(6460-6462)Tca>Aca	p.S2154T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2154	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAAACATCTGATCTAGAAGTT	0.488																																																	0								ENSG00000181143						64.0	63.0	63.0					19																	9085355		1916	4130	6046	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6460T>A	19.37:g.9085355A>T	ENSP00000381008:p.Ser2154Thr	Somatic	0	52	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	29	38.30	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	45	0.00	0	30	41.18	21	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S2154T	ENST00000397910.4	37	c.6460	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	1.837	-0.468341	0.04445	.	.	ENSG00000181143	ENST00000397910	T	0.02552	4.25	0.235	0.235	0.15431	.	.	.	.	.	T	0.02929	0.0087	N	0.08118	0	.	.	.	P	0.46395	0.877	P	0.51866	0.682	T	0.46091	-0.9216	7	0.87932	D	0	.	.	.	.	.	2154	B5ME49	.	T	2154	ENSP00000381008:S2154T	ENSP00000381008:S2154T	S	-	1	0	MUC16	8946355	0.001000	0.12720	0.017000	0.16124	0.016000	0.09150	-0.250000	0.08830	0.263000	0.21812	0.260000	0.18958	TCA	-	NULL		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	A	NM_024690	-		9085355	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.019	T
ANKMY1	51281	genome.wustl.edu	37	2	241420409	241420409	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:241420409C>G	ENST00000272972.3	-	16	2938	c.2724G>C	c.(2722-2724)aaG>aaC	p.K908N	ANKMY1_ENST00000401804.1_Missense_Mutation_p.K997N|ANKMY1_ENST00000391987.1_Missense_Mutation_p.K908N|ANKMY1_ENST00000373320.4_Missense_Mutation_p.K678N|ANKMY1_ENST00000361678.4_Missense_Mutation_p.K684N|ANKMY1_ENST00000373318.2_Missense_Mutation_p.K687N|ANKMY1_ENST00000406958.1_Missense_Mutation_p.K669N|ANKMY1_ENST00000403283.1_Missense_Mutation_p.K810N	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	908							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		AGGCCTTGGTCTTGCAGTACT	0.637																																																	0								ENSG00000144504						117.0	108.0	111.0					2																	241420409		2203	4300	6503	ANKMY1	SO:0001583	missense	0			-	HGNC	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.2724G>C	2.37:g.241420409C>G	ENSP00000272972:p.Lys908Asn	Somatic	0	135	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	135	24.02	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	30	0.00	0	50	28.57	20	pfam_Ankyrin_rpt,pfam_MORN,pfam_Znf_MYND,superfamily_Ankyrin_rpt-contain_dom,smart_MORN,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_MYND	p.K908N	ENST00000272972.3	37	c.2724	CCDS2536.1	2	.	.	.	.	.	.	.	.	.	.	C	15.54	2.864497	0.51482	.	.	ENSG00000144504	ENST00000373318;ENST00000406958;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804	T;T;T;T;T;T;T;T	0.68331	2.32;3.17;-0.28;1.71;-0.28;3.87;1.83;-0.32	3.65	1.76	0.24704	Zinc finger, MYND-type (3);	0.195489	0.32624	U	0.005841	T	0.73853	0.3640	L	0.58101	1.795	0.80722	D	1	D;D;D;D;D;D	0.89917	0.993;0.999;0.983;1.0;0.999;0.993	D;D;P;D;D;D	0.85130	0.955;0.974;0.863;0.997;0.976;0.955	T	0.72567	-0.4254	10	0.87932	D	0	-29.5151	6.803	0.23762	0.0:0.7539:0.0:0.2461	.	908;678;687;669;684;908	Q4ZFV3;Q9P2S6-4;Q6GPI0;B5MBY4;Q9P2S6-2;Q9P2S6	.;.;.;.;.;ANKY1_HUMAN	N	687;669;908;684;908;678;810;997	ENSP00000362415:K687N;ENSP00000384555:K669N;ENSP00000272972:K908N;ENSP00000355097:K684N;ENSP00000375847:K908N;ENSP00000362417:K678N;ENSP00000383968:K810N;ENSP00000385887:K997N	ENSP00000272972:K908N	K	-	3	2	ANKMY1	241069082	0.999000	0.42202	0.913000	0.36048	0.600000	0.36913	1.844000	0.39269	0.657000	0.30906	0.467000	0.42956	AAG	-	pfam_Znf_MYND,pfscan_Znf_MYND		0.637	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKMY1	protein_coding	OTTHUMT00000257187.2	C	NM_017844	-		241420409	-1	no_errors	ENST00000272972	ensembl	human	known	74_37	missense	SNP	0.899	G
PRRC2C	23215	genome.wustl.edu	37	1	171519345	171519345	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr1:171519345A>G	ENST00000338920.4	+	18	5324	c.5087A>G	c.(5086-5088)gAa>gGa	p.E1696G	PRRC2C_ENST00000426496.2_Missense_Mutation_p.E1696G|PRRC2C_ENST00000367742.3_Missense_Mutation_p.E1698G|PRRC2C_ENST00000392078.3_Missense_Mutation_p.E1698G	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1696					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TTACAGGATGAAGAACGCCGA	0.358																																																	0								ENSG00000117523						72.0	62.0	65.0					1																	171519345		2203	4300	6503	PRRC2C	SO:0001583	missense	0			-	HGNC	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.5087A>G	1.37:g.171519345A>G	ENSP00000343629:p.Glu1696Gly	Somatic	0	63	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	36	33.33	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	35	0.00	0	46	30.30	20	pfam_BAT2_N	p.E1698G	ENST00000338920.4	37	c.5093	CCDS1296.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.00|13.00	2.107413|2.107413	0.37145|0.37145	.|.	.|.	ENSG00000117523|ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080|ENST00000495585	T;T;T;T|.	0.02552|.	4.26;4.26;4.25;4.26|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.000000|.	0.45606|.	U|.	0.000349|.	T|T	0.63792|0.63792	0.2541|0.2541	M|M	0.64997|0.64997	1.995|1.995	0.58432|0.58432	D|D	0.999999|0.999999	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.64546|0.64546	-0.6382|-0.6382	10|5	0.87932|.	D|.	0|.	.|.	15.4747|15.4747	0.75468|0.75468	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	1696|.	Q9Y520-4|.	.|.	G|E	1698;1697;1696;1698;1696;1453|244	ENSP00000375928:E1698G;ENSP00000410219:E1696G;ENSP00000356716:E1698G;ENSP00000343629:E1696G|.	ENSP00000343629:E1696G|.	E|K	+|+	2|1	0|0	PRRC2C|PRRC2C	169785969|169785969	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.519000|0.519000	0.34347|0.34347	8.952000|8.952000	0.93031|0.93031	2.065000|2.065000	0.61736|0.61736	0.451000|0.451000	0.29950|0.29950	GAA|AAG	-	NULL		0.358	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	protein_coding	OTTHUMT00000314826.4	A	NM_015172	-		171519345	+1	no_errors	ENST00000392078	ensembl	human	known	74_37	missense	SNP	1.000	G
PIGG	54872	genome.wustl.edu	37	4	515060	515060	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr4:515060G>T	ENST00000453061.2	+	7	1436	c.1330G>T	c.(1330-1332)Gag>Tag	p.E444*	PIGG_ENST00000509768.1_Nonsense_Mutation_p.E355*|PIGG_ENST00000536264.1_Intron|PIGG_ENST00000503111.1_Intron|PIGG_ENST00000504346.1_Nonsense_Mutation_p.E355*|PIGG_ENST00000296306.7_Intron|PIGG_ENST00000310340.5_Intron|PIGG_ENST00000383028.4_Nonsense_Mutation_p.E311*	NM_001127178.1	NP_001120650.1	Q5H8A4	PIGG_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class G	444					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	CP2 mannose-ethanolamine phosphotransferase activity (GO:0051267)|phosphotransferase activity, for other substituted phosphate groups (GO:0016780)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	39						CGTGGTTTTGGAGGTACAGAT	0.428																																																	0								ENSG00000174227						92.0	69.0	76.0					4																	515060		2203	4300	6503	PIGG	SO:0001587	stop_gained	0			-	HGNC		CCDS3336.1, CCDS46992.1, CCDS75080.1, CCDS75081.1, CCDS75082.1, CCDS75083.1	4p16.3	2013-02-26	2006-06-28		ENSG00000174227	ENSG00000174227		"""Phosphatidylinositol glycan anchor biosynthesis"""	25985	protein-coding gene	gene with protein product			"""phosphatidylinositol glycan, class G"""			15632136	Standard	XM_005272287		Approved	FLJ20265, GPI7, LAS21	uc003gak.4	Q5H8A4	OTTHUMG00000112457	ENST00000453061.2:c.1330G>T	4.37:g.515060G>T	ENSP00000415203:p.Glu444*	Somatic	0	28	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	27	12.90	B4DKC7|Q2TAK5|Q6UX31|Q7L5Y4|Q8N866|Q8NCC9|Q96SY9|Q9BVT7|Q9NXG5	Nonsense_Mutation	SNP	40	0.00	0	84	0.00	0	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.E444*	ENST00000453061.2	37	c.1330	CCDS46992.1	4	.	.	.	.	.	.	.	.	.	.	G	38	7.275506	0.98179	.	.	ENSG00000174227	ENST00000453061;ENST00000504346;ENST00000383028;ENST00000509768	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5831	0.87973	0.0:0.0:1.0:0.0	.	.	.	.	X	444;355;311;355	.	.	E	+	1	0	PIGG	505060	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.560000	0.67332	2.761000	0.94854	0.655000	0.94253	GAG	-	NULL		0.428	PIGG-001	KNOWN	basic|CCDS	protein_coding	PIGG	protein_coding	OTTHUMT00000357494.1	G	NM_017733	-		515060	+1	no_errors	ENST00000453061	ensembl	human	known	74_37	nonsense	SNP	1.000	T
MYLK2	85366	genome.wustl.edu	37	20	30421644	30421644	+	3'UTR	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr20:30421644G>A	ENST00000375994.2	+	0	2108				MYLK2_ENST00000468730.1_3'UTR|MYLK2_ENST00000375985.4_3'UTR			Q9H1R3	MYLK2_HUMAN	myosin light chain kinase 2						cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|neuromuscular synaptic transmission (GO:0007274)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of gene expression (GO:0010628)|protein autophosphorylation (GO:0046777)|regulation of muscle filament sliding (GO:0032971)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle satellite cell differentiation (GO:0014816)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|myosin light chain kinase activity (GO:0004687)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	33			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CACAGTGGCCGGGGCTGAAGC	0.662											OREG0025857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000101306						15.0	17.0	16.0					20																	30421644		2202	4290	6492	MYLK2	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF325549	CCDS13191.1	20q13.31	2014-09-17	2008-01-23		ENSG00000101306	ENSG00000101306	2.7.11.18		16243	protein-coding gene	gene with protein product	"""skeletal muscle myosin light chain kinase"""	606566	"""myosin light chain kinase 2, skeletal muscle"""				Standard	NM_033118		Approved	skMLCK, KMLC, MLCK2	uc002wwq.2	Q9H1R3	OTTHUMG00000032194	ENST00000375994.2:c.*44G>A	20.37:g.30421644G>A		Somatic	0	23	0.00	817	0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	20	37.50	Q569L1|Q96I84	RNA	SNP	36	0.00	0	25	43.18	19	-	NULL	ENST00000375994.2	37	NULL	CCDS13191.1	20																																																																																			-	-		0.662	MYLK2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYLK2	protein_coding	OTTHUMT00000078583.2	G	NM_033118	-		30421644	+1	no_errors	ENST00000468730	ensembl	human	known	74_37	rna	SNP	0.003	A
ZIC4	84107	genome.wustl.edu	37	3	147111638	147111638	+	Intron	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr3:147111638C>T	ENST00000383075.3	-	3	1201				ZIC4_ENST00000472749.2_5'Flank|ZIC4_ENST00000525172.2_Intron|ZIC4_ENST00000473123.1_Intron|ZIC4_ENST00000491672.1_Intron|ZIC4_ENST00000425731.3_Intron|ZIC4_ENST00000484399.1_Intron	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						CCTCCCTCCCCGAGGCACCAT	0.687																																																	0								ENSG00000174963																																			ZIC4	SO:0001627	intron_variant	0			-	HGNC	AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.688+2000G>A	3.37:g.147111638C>T		Somatic	0	32	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	8	61.90	A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	32	0.00	0	16	60.98	25	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			-	-		0.687	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	protein_coding	OTTHUMT00000355504.1	C		-		147111638	-1	no_errors	ENST00000464502	ensembl	human	putative	74_37	rna	SNP	0.000	T
CLDN4	1364	genome.wustl.edu	37	7	73245579	73245579	+	Silent	SNP	G	G	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr7:73245579G>C	ENST00000435050.1	+	2	2728	c.48G>C	c.(46-48)ctG>ctC	p.L16L	CLDN4_ENST00000340958.2_Silent_p.L16L|CLDN4_ENST00000431918.1_Silent_p.L16L			O14493	CLD4_HUMAN	claudin 4	16	Interaction with EPHA2.				calcium-independent cell-cell adhesion (GO:0016338)|establishment of skin barrier (GO:0061436)|female pregnancy (GO:0007565)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basal plasma membrane (GO:0009925)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)|transmembrane signaling receptor activity (GO:0004888)			kidney(2)|lung(4)|urinary_tract(1)	7		Lung NSC(55;0.159)				TGGCCGTCCTGGGCTGGCTGG	0.652																																																	0								ENSG00000189143						52.0	48.0	50.0					7																	73245579		2203	4299	6502	CLDN4	SO:0001819	synonymous_variant	0			-	HGNC	AB000712	CCDS5560.1	7q11.23	2008-07-18			ENSG00000189143	ENSG00000189143		"""Claudins"""	2046	protein-coding gene	gene with protein product	"""Clostridium perfringens enterotoxin receptor 1"", ""Williams-Beuren syndrome chromosomal region 8 protein"""	602909		CPETR, CPETR1		9334247, 9892664	Standard	NM_001305		Approved	CPE-R, WBSCR8, hCPE-R	uc003tzi.4	O14493	OTTHUMG00000023425	ENST00000435050.1:c.48G>C	7.37:g.73245579G>C		Somatic	0	138	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	109	17.42		Silent	SNP	32	0.00	0	48	29.41	20	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin4	p.L16	ENST00000435050.1	37	c.48	CCDS5560.1	7																																																																																			-	pfam_PMP22/EMP/MP20/Claudin		0.652	CLDN4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLDN4	protein_coding	OTTHUMT00000348030.1	G	NM_001305	-		73245579	+1	no_errors	ENST00000340958	ensembl	human	known	74_37	silent	SNP	1.000	C
NHLRC2	374354	genome.wustl.edu	37	10	115661629	115661629	+	Silent	SNP	C	C	T	rs539942915		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr10:115661629C>T	ENST00000369301.3	+	7	1556	c.1344C>T	c.(1342-1344)caC>caT	p.H448H		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	448										breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		CAGTGAAGCACCTCGTAGGAG	0.478																																																	0								ENSG00000196865						123.0	125.0	124.0					10																	115661629		2203	4300	6503	NHLRC2	SO:0001819	synonymous_variant	0			-	HGNC	AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.1344C>T	10.37:g.115661629C>T		Somatic	0	35	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53	Q8N1H1|Q8N5A6	Silent	SNP	35	0.00	0	35	23.91	11	pfam_NHL_repeat,superfamily_Thioredoxin-like_fold,pfscan_NHL_repeat_subgr	p.H448	ENST00000369301.3	37	c.1344	CCDS7585.1	10																																																																																			-	NULL		0.478	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC2	protein_coding	OTTHUMT00000050446.1	C	NM_198514	-		115661629	+1	no_errors	ENST00000369301	ensembl	human	known	74_37	silent	SNP	1.000	T
LRFN1	57622	genome.wustl.edu	37	19	39799115	39799115	+	Missense_Mutation	SNP	A	A	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr19:39799115A>C	ENST00000248668.4	-	2	1473	c.1474T>G	c.(1474-1476)Tgc>Ggc	p.C492G		NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	492	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			GCCAGCACGCACAAGTCGTAG	0.682																																																	0								ENSG00000128011						16.0	18.0	17.0					19																	39799115		1999	4104	6103	LRFN1	SO:0001583	missense	0			-	HGNC	BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1474T>G	19.37:g.39799115A>C	ENSP00000248668:p.Cys492Gly	Somatic	0	21	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	16	27.27	Q8TBS9	Missense_Mutation	SNP	30	0.00	0	23	20.69	6	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.C492G	ENST00000248668.4	37	c.1474	CCDS46071.1	19	.	.	.	.	.	.	.	.	.	.	A	18.22	3.576287	0.65878	.	.	ENSG00000128011	ENST00000248668	T	0.56611	0.45	4.49	3.43	0.39272	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.42172	D	0.000746	T	0.71005	0.3289	M	0.83774	2.66	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.72323	-0.4328	10	0.87932	D	0	.	9.1059	0.36698	0.8147:0.1853:0.0:0.0	.	492	Q9P244	LRFN1_HUMAN	G	492	ENSP00000248668:C492G	ENSP00000248668:C492G	C	-	1	0	LRFN1	44490955	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	8.934000	0.92915	0.724000	0.32296	0.379000	0.24179	TGC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.682	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN1	protein_coding	OTTHUMT00000463835.1	A	NM_020862	-		39799115	-1	no_errors	ENST00000248668	ensembl	human	known	74_37	missense	SNP	1.000	C
PCDH10	57575	genome.wustl.edu	37	4	134073855	134073855	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr4:134073855G>A	ENST00000264360.5	+	1	3386	c.2560G>A	c.(2560-2562)Ggg>Agg	p.G854R		NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	854					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		CAACCCCTGCGGGGCCATCGT	0.567																																																	0								ENSG00000138650						84.0	79.0	81.0					4																	134073855		2203	4300	6503	PCDH10	SO:0001583	missense	0			-	HGNC	AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.2560G>A	4.37:g.134073855G>A	ENSP00000264360:p.Gly854Arg	Somatic	0	39	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	38	25.49	Q4W5F6|Q96SF0	Missense_Mutation	SNP	31	0.00	0	37	31.48	17	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G854R	ENST00000264360.5	37	c.2560	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907223	0.52333	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.53423	0.62	5.0	5.0	0.66597	.	0.000000	0.45867	D	0.000325	T	0.32912	0.0845	N	0.19112	0.55	0.80722	D	1	D;D	0.60160	0.987;0.977	B;B	0.40285	0.325;0.219	T	0.10268	-1.0637	10	0.17369	T	0.5	.	17.9193	0.88961	0.0:0.0:1.0:0.0	.	854;854	Q9P2E7;Q96SF0	PCD10_HUMAN;.	R	854	ENSP00000264360:G854R	ENSP00000264360:G854R	G	+	1	0	PCDH10	134293305	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.491000	0.81471	2.318000	0.78349	0.557000	0.71058	GGG	-	NULL		0.567	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	protein_coding	OTTHUMT00000364457.2	G	NM_032961	-		134073855	+1	no_errors	ENST00000264360	ensembl	human	known	74_37	missense	SNP	1.000	A
MRPL44	65080	genome.wustl.edu	37	2	224831683	224831683	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr2:224831683A>G	ENST00000258383.3	+	4	1000	c.931A>G	c.(931-933)Aga>Gga	p.R311G	AC073641.2_ENST00000425192.1_RNA	NM_022915.3	NP_075066.1	Q9H9J2	RM44_HUMAN	mitochondrial ribosomal protein L44	311					mitochondrial translational elongation (GO:0070125)|RNA processing (GO:0006396)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		all_lung(227;0.00679)|Lung NSC(271;0.00855)|Renal(207;0.0112)|all_hematologic(139;0.189)		Epithelial(121;2.51e-10)|all cancers(144;7.89e-08)|Lung(261;0.00705)|LUSC - Lung squamous cell carcinoma(224;0.008)		CACAGAAAATAGACGGCCGTG	0.473																																																	0								ENSG00000135900						80.0	89.0	86.0					2																	224831683		2203	4300	6503	MRPL44	SO:0001583	missense	0			-	HGNC	AK022763	CCDS2459.1	2p24.3-p24.1	2012-09-13			ENSG00000135900	ENSG00000135900		"""Mitochondrial ribosomal proteins / large subunits"""	16650	protein-coding gene	gene with protein product	"""39S ribosomal protein L44, mitochondrial"""	611849					Standard	NM_022915		Approved	FLJ12701, FLJ13990	uc002vnr.4	Q9H9J2	OTTHUMG00000133164	ENST00000258383.3:c.931A>G	2.37:g.224831683A>G	ENSP00000258383:p.Arg311Gly	Somatic	0	38	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	10	60.00	Q53S16|Q6IA62|Q9H821	Missense_Mutation	SNP	35	0.00	0	18	51.35	19	superfamily_RNase_III_dom,pfscan_dsRNA-bd_dom	p.R311G	ENST00000258383.3	37	c.931	CCDS2459.1	2	.	.	.	.	.	.	.	.	.	.	A	12.58	1.979542	0.34942	.	.	ENSG00000135900	ENST00000258383	T	0.53423	0.62	5.88	2.11	0.27256	.	0.000000	0.85682	D	0.000000	T	0.69531	0.3121	M	0.87180	2.865	0.54753	D	0.999988	D	0.89917	1.0	D	0.74023	0.982	T	0.72686	-0.4218	10	0.87932	D	0	-22.4982	12.3816	0.55309	0.5621:0.4379:0.0:0.0	.	311	Q9H9J2	RM44_HUMAN	G	311	ENSP00000258383:R311G	ENSP00000258383:R311G	R	+	1	2	MRPL44	224539927	0.931000	0.31567	0.023000	0.16930	0.018000	0.09664	1.643000	0.37217	0.117000	0.18138	0.482000	0.46254	AGA	-	NULL		0.473	MRPL44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL44	protein_coding	OTTHUMT00000256866.2	A	NM_022915	-		224831683	+1	no_errors	ENST00000258383	ensembl	human	known	74_37	missense	SNP	0.682	G
KMT2D	8085	genome.wustl.edu	37	12	49446096	49446096	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr12:49446096G>A	ENST00000301067.7	-	10	1369	c.1370C>T	c.(1369-1371)cCc>cTc	p.P457L		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	457	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										TGGGGACGTGGGTGATTCCTC	0.642																																																	0								ENSG00000167548						74.0	82.0	79.0					12																	49446096		2160	4232	6392	KMT2D	SO:0001583	missense	0			-	HGNC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1370C>T	12.37:g.49446096G>A	ENSP00000301067:p.Pro457Leu	Somatic	0	44	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	30	21.05	O14687	Missense_Mutation	SNP	22	0.00	0	25	41.86	18	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.P457L	ENST00000301067.7	37	c.1370	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	8.577	0.881312	0.17467	.	.	ENSG00000167548	ENST00000301067	T	0.78246	-1.16	4.31	3.33	0.38152	.	.	.	.	.	T	0.66906	0.2837	N	0.08118	0	0.36043	D	0.840248	D	0.59357	0.985	P	0.50270	0.636	T	0.76424	-0.2964	9	0.87932	D	0	.	12.0345	0.53417	0.0:0.1764:0.8236:0.0	.	457	O14686	MLL2_HUMAN	L	457	ENSP00000301067:P457L	ENSP00000301067:P457L	P	-	2	0	MLL2	47732363	1.000000	0.71417	1.000000	0.80357	0.531000	0.34715	6.679000	0.74513	2.386000	0.81285	0.313000	0.20887	CCC	-	NULL		0.642	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2D	protein_coding	OTTHUMT00000390183.2	G		-		49446096	-1	no_errors	ENST00000301067	ensembl	human	known	74_37	missense	SNP	0.990	A
ZNF226	7769	genome.wustl.edu	37	19	44680347	44680347	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr19:44680347A>T	ENST00000590089.1	+	7	1299	c.932A>T	c.(931-933)gAg>gTg	p.E311V	ZNF226_ENST00000337433.5_Missense_Mutation_p.E311V|ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Missense_Mutation_p.E311V			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				AAGTGTGATGAGTGTGGTAAG	0.433																																					Pancreas(115;581 1665 13228 19278 50070)												0								ENSG00000167380						68.0	71.0	70.0					19																	44680347		2120	4241	6361	ZNF226	SO:0001583	missense	0			-	HGNC	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.932A>T	19.37:g.44680347A>T	ENSP00000465121:p.Glu311Val	Somatic	0	41	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	26	35.00	Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	43	0.00	0	44	31.25	20	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E311V	ENST00000590089.1	37	c.932	CCDS46102.1	19	.	.	.	.	.	.	.	.	.	.	A	0.811	-0.751934	0.03041	.	.	ENSG00000167380	ENST00000536276;ENST00000337433;ENST00000454662	T;T	0.04706	3.57;3.57	3.86	2.82	0.32997	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.818768	0.09964	N	0.733013	T	0.06096	0.0158	L	0.43757	1.38	0.09310	N	1	B	0.15719	0.014	B	0.13407	0.009	T	0.33624	-0.9861	10	0.51188	T	0.08	.	9.6333	0.39793	0.8235:0.1765:0.0:0.0	.	311	Q9NYT6	ZN226_HUMAN	V	19;311;311	ENSP00000336719:E311V;ENSP00000393265:E311V	ENSP00000336719:E311V	E	+	2	0	ZNF226	49372187	0.000000	0.05858	0.006000	0.13384	0.043000	0.13939	0.087000	0.14958	0.638000	0.30545	-0.332000	0.08345	GAG	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF226	protein_coding	OTTHUMT00000460712.1	A		-		44680347	+1	no_errors	ENST00000337433	ensembl	human	known	74_37	missense	SNP	0.017	T
PARP14	54625	genome.wustl.edu	37	3	122437331	122437331	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr3:122437331T>C	ENST00000474629.2	+	14	4599	c.4333T>C	c.(4333-4335)Tgg>Cgg	p.W1445R	PARP14_ENST00000475640.1_3'UTR	NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1445					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		TGCTATCTCCTGGCTACAAGA	0.398																																																	0								ENSG00000173193						87.0	91.0	89.0					3																	122437331		2124	4247	6371	PARP14	SO:0001583	missense	0			-	HGNC	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.4333T>C	3.37:g.122437331T>C	ENSP00000418194:p.Trp1445Arg	Somatic	0	23	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	16	38.46	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Missense_Mutation	SNP	37	0.00	0	46	38.67	29	pfam_Macro_dom,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,smart_Macro_dom,pfscan_Macro_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.W1445R	ENST00000474629.2	37	c.4333	CCDS46894.1	3	.	.	.	.	.	.	.	.	.	.	T	11.21	1.572823	0.28092	.	.	ENSG00000173193	ENST00000474629;ENST00000398162;ENST00000310290;ENST00000398157	T	0.09255	3.0	5.38	5.38	0.77491	.	0.263942	0.34223	N	0.004153	T	0.34279	0.0892	M	0.83223	2.63	0.09310	N	0.999993	P;D	0.89917	0.587;1.0	B;D	0.65684	0.266;0.937	T	0.21861	-1.0233	10	0.56958	D	0.05	.	14.3556	0.66735	0.0:0.0:0.0:1.0	.	1445;1445	Q460N5-4;Q460N5	.;PAR14_HUMAN	R	1445;1364;48;441	ENSP00000418194:W1445R	ENSP00000310633:W48R	W	+	1	0	PARP14	123920021	1.000000	0.71417	0.143000	0.22291	0.034000	0.12701	3.505000	0.53356	2.262000	0.75019	0.528000	0.53228	TGG	-	NULL		0.398	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	protein_coding	OTTHUMT00000356173.2	T	NM_017554	-		122437331	+1	no_errors	ENST00000474629	ensembl	human	known	74_37	missense	SNP	0.099	C
PCDHGA10	56106	genome.wustl.edu	37	5	140793419	140793419	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr5:140793419G>T	ENST00000398610.2	+	1	677	c.677G>T	c.(676-678)cGa>cTa	p.R226L	PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	226	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCCTCTCCGATCTGGCACT	0.572																																																	0								ENSG00000253846						40.0	44.0	43.0					5																	140793419		2065	4209	6274	PCDHGA10	SO:0001583	missense	0			-	HGNC		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.677G>T	5.37:g.140793419G>T	ENSP00000381611:p.Arg226Leu	Somatic	0	75	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	51	29.17	Q9Y5E0	Missense_Mutation	SNP	33	0.00	0	38	28.30	15	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R226L	ENST00000398610.2	37	c.677	CCDS47292.1	5	.	.	.	.	.	.	.	.	.	.	g	9.602	1.128841	0.21041	.	.	ENSG00000253846	ENST00000398610	T	0.01685	4.69	5.69	3.71	0.42584	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.02649	0.0080	L	0.52364	1.645	0.09310	N	1	B;B	0.21381	0.044;0.055	B;B	0.31495	0.055;0.131	T	0.39742	-0.9599	9	0.36615	T	0.2	.	6.5321	0.22332	0.1562:0.0:0.5614:0.2824	.	226;226	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	L	226	ENSP00000381611:R226L	ENSP00000381611:R226L	R	+	2	0	PCDHGA10	140773603	0.000000	0.05858	0.982000	0.44146	0.858000	0.48976	-0.009000	0.12765	1.399000	0.46721	0.557000	0.71058	CGA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.572	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA10	protein_coding	OTTHUMT00000374747.1	G	NM_018913	-		140793419	+1	no_errors	ENST00000398610	ensembl	human	known	74_37	missense	SNP	0.000	T
OR4A47	403253	genome.wustl.edu	37	11	48510756	48510756	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr11:48510756G>A	ENST00000446524.1	+	1	488	c.412G>A	c.(412-414)Gtg>Atg	p.V138M		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	138						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						GAGACAATGGGTGTGTGTTGT	0.473																																																	0								ENSG00000237388						113.0	97.0	102.0					11																	48510756		2201	4298	6499	OR4A47	SO:0001583	missense	0			-	HGNC	BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.412G>A	11.37:g.48510756G>A	ENSP00000412752:p.Val138Met	Somatic	0	24	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81		Missense_Mutation	SNP	43	0.00	0	61	3.17	2	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V138M	ENST00000446524.1	37	c.412	CCDS31490.1	11	.	.	.	.	.	.	.	.	.	.	N	9.989	1.230267	0.22542	.	.	ENSG00000237388	ENST00000446524	T	0.00216	8.53	4.84	3.93	0.45458	GPCR, rhodopsin-like superfamily (1);	0.288709	0.24516	N	0.037842	T	0.00440	0.0014	M	0.65498	2.005	0.09310	N	1	D	0.76494	0.999	D	0.74674	0.984	T	0.48875	-0.8996	10	0.54805	T	0.06	.	11.0743	0.48021	0.0926:0.0:0.9074:0.0	.	138	Q6IF82	O4A47_HUMAN	M	138	ENSP00000412752:V138M	ENSP00000412752:V138M	V	+	1	0	OR4A47	48467332	0.000000	0.05858	0.252000	0.24328	0.006000	0.05464	-0.600000	0.05693	1.017000	0.39495	0.511000	0.50034	GTG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.473	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A47	protein_coding	OTTHUMT00000390559.1	G	NM_001005512	-		48510756	+1	no_errors	ENST00000446524	ensembl	human	known	74_37	missense	SNP	0.011	A
EFCAB3	146779	genome.wustl.edu	37	17	60493435	60493435	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr17:60493435G>A	ENST00000305286.3	+	10	1140	c.1062G>A	c.(1060-1062)tgG>tgA	p.W354*	EFCAB3_ENST00000450662.2_Nonsense_Mutation_p.W406*	NM_173503.3	NP_775774.1	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3	354							calcium ion binding (GO:0005509)			cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)	17			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			TAAACCTCTGGCAGAAGATCC	0.413																																																	0								ENSG00000172421						99.0	102.0	101.0					17																	60493435		2203	4300	6503	EFCAB3	SO:0001587	stop_gained	0			-	HGNC	AK098684	CCDS11632.1, CCDS45751.1	17q23.3	2013-01-10			ENSG00000172421	ENSG00000172421		"""EF-hand domain containing"""	26379	protein-coding gene	gene with protein product						12477932	Standard	NM_173503		Approved	FLJ25818	uc010wpc.2	Q8N7B9	OTTHUMG00000179175	ENST00000305286.3:c.1062G>A	17.37:g.60493435G>A	ENSP00000302649:p.Trp354*	Somatic	0	42	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	J3KQM8	Nonsense_Mutation	SNP	44	0.00	0	86	0.00	0	pfscan_EF_hand_dom	p.W406*	ENST00000305286.3	37	c.1218	CCDS11632.1	17	.	.	.	.	.	.	.	.	.	.	G	21.3	4.134596	0.77662	.	.	ENSG00000172421	ENST00000450662;ENST00000305286	.	.	.	4.7	4.7	0.59300	.	0.000000	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.837	0.70192	0.0:0.0:1.0:0.0	.	.	.	.	X	406;354	.	ENSP00000302649:W354X	W	+	3	0	EFCAB3	57847167	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	4.978000	0.63799	2.615000	0.88500	0.555000	0.69702	TGG	-	NULL		0.413	EFCAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB3	protein_coding	OTTHUMT00000379114.1	G	NM_173503	-		60493435	+1	no_errors	ENST00000450662	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ERAS	3266	genome.wustl.edu	37	X	48688009	48688009	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chrX:48688009C>G	ENST00000338270.1	+	1	727	c.476C>G	c.(475-477)gCt>gGt	p.A159G	PCSK1N_ENST00000478242.1_5'Flank	NM_181532.2	NP_853510.1	Q7Z444	RASE_HUMAN	ES cell expressed Ras	159					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(2)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	14						GTGACCACTGCTGGAGATGCT	0.642																																																	0								ENSG00000187682						32.0	27.0	29.0					X																	48688009		2202	4300	6502	ERAS	SO:0001583	missense	0			-	HGNC	X00419	CCDS35246.1	Xp11.23	2014-05-09	2003-07-14	2003-07-16	ENSG00000187682	ENSG00000187682			5174	protein-coding gene	gene with protein product		300437	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog pseudogene"""	HRAS2, HRASP		12774123	Standard	NM_181532		Approved		uc031tjl.1	Q7Z444	OTTHUMG00000059533	ENST00000338270.1:c.476C>G	X.37:g.48688009C>G	ENSP00000339136:p.Ala159Gly	Somatic	0	67	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	50	26.47		Missense_Mutation	SNP	31	0.00	0	43	29.51	18	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A159G	ENST00000338270.1	37	c.476	CCDS35246.1	X	.	.	.	.	.	.	.	.	.	.	c	5.114	0.206625	0.09704	.	.	ENSG00000187682	ENST00000338270	T	0.77098	-1.07	4.66	3.8	0.43715	Small GTP-binding protein domain (1);	0.699216	0.11652	N	0.542706	T	0.62048	0.2396	N	0.16233	0.39	0.09310	N	1	P	0.34587	0.458	B	0.34824	0.19	T	0.56189	-0.8020	10	0.87932	D	0	.	5.8001	0.18410	0.0:0.6999:0.1926:0.1075	.	159	Q7Z444	RASE_HUMAN	G	159	ENSP00000339136:A159G	ENSP00000339136:A159G	A	+	2	0	ERAS	48572953	0.334000	0.24739	0.002000	0.10522	0.002000	0.02628	1.863000	0.39459	1.096000	0.41439	0.597000	0.82753	GCT	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom		0.642	ERAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAS	protein_coding	OTTHUMT00000132402.1	C	NM_181532	-		48688009	+1	no_errors	ENST00000338270	ensembl	human	known	74_37	missense	SNP	0.003	G
MMRN2	79812	genome.wustl.edu	37	10	88704031	88704031	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr10:88704031G>A	ENST00000372027.5	-	5	964	c.643C>T	c.(643-645)Caa>Taa	p.Q215*	MMRN2_ENST00000488950.1_Intron	NM_024756.2	NP_079032.2	Q9H8L6	MMRN2_HUMAN	multimerin 2	215					angiogenesis (GO:0001525)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|skin(1)|stomach(1)	19						TGCCCTGTTTGATTTGCTTCC	0.622																																																	0								ENSG00000173269						158.0	147.0	151.0					10																	88704031		2203	4300	6503	MMRN2	SO:0001587	stop_gained	0			-	HGNC	AK023527	CCDS7379.1	10q23.31	2004-03-10	2004-03-02	2004-03-02	ENSG00000173269	ENSG00000173269		"""EMI domain containing"""	19888	protein-coding gene	gene with protein product		608925	"""elastin microfibril interfacer 3"""	EMILIN3		11559704	Standard	NM_024756		Approved	EndoGlyx-1, FLJ13465	uc001kea.3	Q9H8L6	OTTHUMG00000018663	ENST00000372027.5:c.643C>T	10.37:g.88704031G>A	ENSP00000361097:p.Gln215*	Somatic	0	58	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	31	13.89	Q504V7|Q6P2N2	Nonsense_Mutation	SNP	29	0.00	0	46	2.13	1	pfam_C1q,pfam_EMI_domain,superfamily_Tumour_necrosis_fac-like_dom,superfamily_tRNA-bd_arm,smart_C1q,prints_C1q,pfscan_C1q,pfscan_EMI_domain	p.Q215*	ENST00000372027.5	37	c.643	CCDS7379.1	10	.	.	.	.	.	.	.	.	.	.	G	18.49	3.635592	0.67130	.	.	ENSG00000173269	ENST00000372027	.	.	.	5.23	2.24	0.28232	.	1.277080	0.05434	N	0.546530	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-1.5574	14.1986	0.65686	0.0:0.4712:0.5288:0.0	.	.	.	.	X	215	.	ENSP00000361097:Q215X	Q	-	1	0	MMRN2	88694011	0.002000	0.14202	0.000000	0.03702	0.035000	0.12851	0.998000	0.29744	0.175000	0.19841	-0.311000	0.09066	CAA	-	NULL		0.622	MMRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN2	protein_coding	OTTHUMT00000049179.2	G	NM_024756	-		88704031	-1	no_errors	ENST00000372027	ensembl	human	known	74_37	nonsense	SNP	0.001	A
LCORL	254251	genome.wustl.edu	37	4	17885560	17885560	+	Missense_Mutation	SNP	T	T	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr4:17885560T>G	ENST00000382226.5	-	7	1700	c.1592A>C	c.(1591-1593)gAa>gCa	p.E531A	LCORL_ENST00000382224.1_Missense_Mutation_p.E447A|LCORL_ENST00000539056.1_Intron|LCORL_ENST00000326877.4_Intron	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	531	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						AATAGCTTCTTCCATTATTTC	0.398																																																	0								ENSG00000178177						256.0	202.0	219.0					4																	17885560		692	1591	2283	LCORL	SO:0001583	missense	0			-	HGNC		CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.1592A>C	4.37:g.17885560T>G	ENSP00000371661:p.Glu531Ala	Somatic	0	47	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	Q96NK1	Missense_Mutation	SNP	36	0.00	0	52	29.73	22	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq	p.E531A	ENST00000382226.5	37	c.1592	CCDS54749.1	4	.	.	.	.	.	.	.	.	.	.	T	16.63	3.176091	0.57692	.	.	ENSG00000178177	ENST00000382224;ENST00000382226	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	T	0.51398	0.1672	N	0.14661	0.345	0.80722	D	1	.	.	.	.	.	.	T	0.59762	-0.7393	7	0.72032	D	0.01	.	14.8748	0.70485	0.0:0.0:0.0:1.0	.	.	.	.	A	447;531	.	ENSP00000371659:E447A	E	-	2	0	LCORL	17494658	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	1.965000	0.57142	0.533000	0.62120	GAA	-	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq		0.398	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LCORL	protein_coding		T	NM_153686	-		17885560	-1	no_errors	ENST00000382226	ensembl	human	known	74_37	missense	SNP	1.000	G
NTRK2	4915	genome.wustl.edu	37	9	87563475	87563475	+	Silent	SNP	C	C	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr9:87563475C>A	ENST00000323115.4	+	14	2168	c.1815C>A	c.(1813-1815)ggC>ggA	p.G605G	NTRK2_ENST00000376213.1_Silent_p.G605G|NTRK2_ENST00000277120.3_Silent_p.G621G|NTRK2_ENST00000376214.1_Silent_p.G621G			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	605	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	AGTTCTATGGCGTCTGCGTGG	0.577										TSP Lung(25;0.17)																																							0								ENSG00000148053						112.0	81.0	92.0					9																	87563475		2203	4300	6503	NTRK2	SO:0001819	synonymous_variant	0			-	HGNC	AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.1815C>A	9.37:g.87563475C>A		Somatic	0	73	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	44	32.31	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Silent	SNP	35	0.00	0	26	50.94	27	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_2	p.G621	ENST00000323115.4	37	c.1863	CCDS35050.1	9																																																																																			-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.577	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	protein_coding	OTTHUMT00000052882.1	C		-		87563475	+1	no_errors	ENST00000277120	ensembl	human	known	74_37	silent	SNP	0.012	A
MEX3C	51320	genome.wustl.edu	37	18	48723146	48723154	+	Intron	DEL	GCCGCCGCG	GCCGCCGCG	-	rs78074704|rs530394988|rs147438518|rs201868643|rs62092914|rs530602218	byFrequency	TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	GCCGCCGCG	GCCGCCGCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr18:48723146_48723154delGCCGCCGCG	ENST00000591040.1	-	2	43				MEX3C_ENST00000592416.1_5'Flank			Q5U5Q3	MEX3C_HUMAN	mex-3 RNA binding family member C						chondrocyte hypertrophy (GO:0003415)|energy homeostasis (GO:0097009)|regulation of fat cell differentiation (GO:0045598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|skin(1)	17		Colorectal(6;0.003)|all_epithelial(6;0.0473)		Colorectal(16;0.0175)|READ - Rectum adenocarcinoma(32;0.15)		CCccgccgccgccgccgcggccgccgccT	0.78																																																	0								ENSG00000176624			429,1467		144,141,663						-0.2	0.9		dbSNP_131	4	2100,2286		804,492,897	no	coding	MEX3C	NM_016626.4		948,633,1560	A1A1,A1R,RR		47.8796,22.6266,40.2579				2529,3753				MEX3C	SO:0001627	intron_variant	0				HGNC	BC041122	CCDS11951.2	18q21.1	2013-08-21	2013-08-21	2007-07-18	ENSG00000176624	ENSG00000176624		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	28040	protein-coding gene	gene with protein product		611005	"""ring finger and KH domain containing 2"", ""mex-3 homolog C (C. elegans)"""	RKHD2		17267406	Standard	NM_016626		Approved	FLJ38871, RNF194	uc002lfc.4	Q5U5Q3	OTTHUMG00000132693	ENST00000591040.1:c.757-19200CGCGGCGGC>-	18.37:g.48723146_48723154delGCCGCCGCG		Somatic	NA	NA	NA		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L022|Q9NZE3	In_Frame_Del	DEL	13	27.78	5	25	16.67	5	pfam_KH_dom_type_1,smart_KH_dom,smart_Znf_RING,pfscan_Znf_RING,pfscan_KH_dom_type_1	p.AAA182in_frame_del	ENST00000591040.1	37	c.545_537		18																																																																																			-	NULL		0.780	MEX3C-003	KNOWN	mRNA_end_NF|basic	processed_transcript	MEX3C	protein_coding	OTTHUMT00000449559.1	GCCGCCGCG	NM_016626			48723154	-1	no_errors	ENST00000406189	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.997	-
MED14	9282	genome.wustl.edu	37	X	40573854	40573854	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chrX:40573854C>T	ENST00000324817.1	-	4	575	c.457G>A	c.(457-459)Gcc>Acc	p.A153T		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	153					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TATGGGATGGCAAAACTAGGC	0.493																																																	0								ENSG00000180182						130.0	96.0	108.0					X																	40573854		2203	4300	6503	MED14	SO:0001583	missense	0			-	HGNC	AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.457G>A	X.37:g.40573854C>T	ENSP00000323720:p.Ala153Thr	Somatic	0	53	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	37	22.92	Q4KMR7|Q9UNB3	Missense_Mutation	SNP	33	0.00	0	54	25.00	18	pfam_Mediator_Med14	p.A153T	ENST00000324817.1	37	c.457	CCDS14254.1	X	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626350	0.87560	.	.	ENSG00000180182	ENST00000324817	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.57184	0.2036	L	0.29908	0.895	0.80722	D	1	P	0.43633	0.813	P	0.48166	0.569	T	0.58662	-0.7597	9	0.46703	T	0.11	.	18.2797	0.90094	0.0:1.0:0.0:0.0	.	153	O60244	MED14_HUMAN	T	153	.	ENSP00000323720:A153T	A	-	1	0	MED14	40458798	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.254000	0.74563	0.529000	0.55759	GCC	-	pfam_Mediator_Med14		0.493	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	protein_coding	OTTHUMT00000060692.1	C	NM_004229	-		40573854	-1	no_errors	ENST00000324817	ensembl	human	known	74_37	missense	SNP	1.000	T
OR4C15	81309	genome.wustl.edu	37	11	55321796	55321796	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr11:55321796C>A	ENST00000314644.2	+	1	14	c.14C>A	c.(13-15)aCa>aAa	p.T5K		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	0						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						TTCTCAATGACAACAGAAGCA	0.308										HNSCC(20;0.049)																																							0								ENSG00000181939						100.0	100.0	100.0					11																	55321796		2201	4296	6497	OR4C15	SO:0001583	missense	0			-	HGNC	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.14C>A	11.37:g.55321796C>A	ENSP00000324958:p.Thr5Lys	Somatic	0	37	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	24	38.46	Q6IFE2	Missense_Mutation	SNP	30	0.00	0	57	34.48	30	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T5K	ENST00000314644.2	37	c.14	CCDS31501.1	11	.	.	.	.	.	.	.	.	.	.	C	7.884	0.730898	0.15507	.	.	ENSG00000181939	ENST00000314644	T	0.00005	9.79	4.3	-8.6	0.00889	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.19386	-1.0307	6	0.87932	D	0	.	1.8663	0.03199	0.3073:0.1302:0.1018:0.4607	.	.	.	.	K	5	ENSP00000324958:T5K	ENSP00000324958:T5K	T	+	2	0	OR4C15	55078372	0.000000	0.05858	0.000000	0.03702	0.247000	0.25773	-5.169000	0.00145	-2.103000	0.00844	0.385000	0.25706	ACA	-	NULL		0.308	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	protein_coding	OTTHUMT00000391164.1	C	NM_001001920	-		55321796	+1	no_errors	ENST00000314644	ensembl	human	known	74_37	missense	SNP	0.000	A
ATP9A	10079	genome.wustl.edu	37	20	50255956	50255956	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr20:50255956G>A	ENST00000338821.5	-	15	1858	c.1594C>T	c.(1594-1596)Cag>Tag	p.Q532*	ATP9A_ENST00000311637.5_Nonsense_Mutation_p.Q396*|ATP9A_ENST00000402822.1_Nonsense_Mutation_p.Q411*	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	532					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TTCAGGATCTGGTCGCCAGGG	0.517											OREG0026043	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000054793						165.0	137.0	147.0					20																	50255956		2203	4300	6503	ATP9A	SO:0001587	stop_gained	0			-	HGNC	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1594C>T	20.37:g.50255956G>A	ENSP00000342481:p.Gln532*	Somatic	0	53	0.00	968	0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	31	44.64	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Nonsense_Mutation	SNP	25	0.00	0	46	33.33	23	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.Q532*	ENST00000338821.5	37	c.1594	CCDS33489.1	20	.	.	.	.	.	.	.	.	.	.	G	42	9.293927	0.99127	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	.	.	.	5.32	5.32	0.75619	.	0.084158	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	-31.9848	19.0003	0.92830	0.0:0.0:1.0:0.0	.	.	.	.	X	396;532;411	.	ENSP00000309086:Q396X	Q	-	1	0	ATP9A	49689363	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.739000	0.98837	2.487000	0.83934	0.655000	0.94253	CAG	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp		0.517	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP9A	protein_coding	OTTHUMT00000106494.1	G	NM_006045	-		50255956	-1	no_errors	ENST00000338821	ensembl	human	known	74_37	nonsense	SNP	1.000	A
GPR123	84435	genome.wustl.edu	37	10	134885552	134885552	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr10:134885552T>C	ENST00000607359.1	+	2	311	c.311T>C	c.(310-312)gTc>gCc	p.V104A				Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	0					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		GGGCTTCCCGTCTCCACCCGA	0.662																																																	0								ENSG00000197177						20.0	24.0	23.0					10																	134885552		1540	3549	5089	GPR123	SO:0001583	missense	0			-	HGNC	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000607359.1:c.311T>C	10.37:g.134885552T>C	ENSP00000475778:p.Val104Ala	Somatic	0	150	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	85	9.57	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	40	0.00	0	33	2.94	1	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	p.V104A	ENST00000607359.1	37	c.311		10	.	.	.	.	.	.	.	.	.	.	t	2.919	-0.223704	0.06061	.	.	ENSG00000197177	ENST00000368577;ENST00000392609	.	.	.	0.75	-1.03	0.10102	.	22.844600	0.00817	N	0.001554	T	0.26666	0.0652	.	.	.	.	.	.	B	0.20052	0.041	B	0.14578	0.011	T	0.24404	-1.0161	6	0.87932	D	0	.	.	.	.	.	104	Q86SQ6-1	.	A	104	.	ENSP00000357566:V104A	V	+	2	0	GPR123	134735542	0.000000	0.05858	0.002000	0.10522	0.057000	0.15508	-0.178000	0.09782	-0.350000	0.08262	0.166000	0.16787	GTC	-	NULL		0.662	GPR123-004	PUTATIVE	basic|appris_candidate_longest	protein_coding	GPR123	protein_coding	OTTHUMT00000316904.2	T		-		134885552	+1	no_errors	ENST00000607359	ensembl	human	putative	74_37	missense	SNP	0.002	C
AC026320.1	0	genome.wustl.edu	37	3	191693744	191693749	+	RNA	DEL	GTGTGT	GTGTGT	-	rs199865256|rs371584059		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	GTGTGT	GTGTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr3:191693744_191693749delGTGTGT	ENST00000401201.1	+	0	2_7																											ctctctctcCgtgtgtgtgtgtgtgt	0.49																																																	0								ENSG00000216020																																			AC026320.1			0				Clone_based_ensembl_gene																													3.37:g.191693750_191693755delGTGTGT		Somatic	NA	NA	NA		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	27	20.59	7	28	30.00	12	-	NULL	ENST00000401201.1	37	NULL		3																																																																																			-	-		0.490	AC026320.1-201	NOVEL	basic	miRNA	ENSG00000216020	miRNA		GTGTGT				191693749	+1	no_errors	ENST00000401201	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000	-
HTR3E	285242	genome.wustl.edu	37	3	183818417	183818417	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr3:183818417C>T	ENST00000415389.2	+	2	678	c.212C>T	c.(211-213)gCg>gTg	p.A71V	HTR3E_ENST00000335304.2_Missense_Mutation_p.A86V|HTR3E_ENST00000440596.2_Missense_Mutation_p.A86V|HTR3E_ENST00000425359.2_Missense_Mutation_p.A71V|HTR3E-AS1_ENST00000431427.1_RNA|HTR3E_ENST00000436361.2_Missense_Mutation_p.A86V	NM_001256613.1|NM_198313.2	NP_001243542.1|NP_938055.1	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine (serotonin) receptor 3E, ionotropic	71			A -> T (in dbSNP:rs7627615). {ECO:0000269|PubMed:19012743}.		ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	40	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	ATCTCCTTCGCGATGTCTGCC	0.562																																					Melanoma(7;227 727 6634 44770)												0								ENSG00000186038						131.0	123.0	126.0					3																	183818417		2203	4300	6503	HTR3E	SO:0001583	missense	0			-	HGNC	AY159813	CCDS3251.1, CCDS58868.1, CCDS58869.1, CCDS58870.1, CCDS58871.1	3q27	2012-05-22	2012-02-03		ENSG00000186038	ENSG00000186038		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24005	protein-coding gene	gene with protein product		610123	"""5-hydroxytryptamine (serotonin) receptor 3, family member E"""			12801637, 15157181	Standard	NM_001256613		Approved		uc010hxr.3	A5X5Y0	OTTHUMG00000156857	ENST00000415389.2:c.212C>T	3.37:g.183818417C>T	ENSP00000401444:p.Ala71Val	Somatic	0	93	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	89	11.88	A8IKD7|E9PGF1|Q495G1|Q495G3|Q6V706|Q6V707|Q7Z6B2	Missense_Mutation	SNP	40	0.00	0	61	10.29	7	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Neur_channel	p.A86V	ENST00000415389.2	37	c.257	CCDS58868.1	3	.	.	.	.	.	.	.	.	.	.	c	11.12	1.546203	0.27652	.	.	ENSG00000186038	ENST00000415389;ENST00000425359;ENST00000335304;ENST00000436361;ENST00000440596	T;T;T;T;T	0.79352	-1.08;-1.26;-1.08;-1.26;-1.26	3.8	1.95	0.26073	Neurotransmitter-gated ion-channel ligand-binding (3);	0.082933	0.45606	U	0.000347	T	0.58206	0.2106	N	0.17474	0.49	0.19300	N	0.999973	B;B;B;B;B	0.25169	0.002;0.045;0.119;0.119;0.036	B;B;B;B;B	0.18263	0.01;0.021;0.02;0.012;0.012	T	0.52495	-0.8568	10	0.72032	D	0.01	.	6.736	0.23409	0.0:0.7134:0.1815:0.1051	.	86;71;86;86;71	E9PGF1;A5X5Y0;A5X5Y0-4;A5X5Y0-3;A5X5Y0-2	.;5HT3E_HUMAN;.;.;.	V	71;71;86;86;86	ENSP00000401444:A71V;ENSP00000401900:A71V;ENSP00000335511:A86V;ENSP00000395833:A86V;ENSP00000406050:A86V	ENSP00000335511:A86V	A	+	2	0	HTR3E	185301111	0.513000	0.26194	0.693000	0.30195	0.800000	0.45204	0.970000	0.29383	0.368000	0.24481	0.655000	0.94253	GCG	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd		0.562	HTR3E-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HTR3E	protein_coding	OTTHUMT00000346284.1	C	NM_182589	-		183818417	+1	no_errors	ENST00000335304	ensembl	human	known	74_37	missense	SNP	0.940	T
SNAI3	333929	genome.wustl.edu	37	16	88747687	88747687	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr16:88747687C>T	ENST00000332281.5	-	2	598	c.512G>A	c.(511-513)cGg>cAg	p.R171Q	SNAI3-AS1_ENST00000563261.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3	171					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		GTGCAGCTGCCGGTGCCTGGC	0.647																																					Colon(27;366 710 19748 23199 27567)												0								ENSG00000185669						49.0	52.0	51.0					16																	88747687		2198	4299	6497	SNAI3	SO:0001583	missense	0			-	HGNC	BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.512G>A	16.37:g.88747687C>T	ENSP00000327968:p.Arg171Gln	Somatic	0	72	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	49	33.78	Q86SU5	Missense_Mutation	SNP	23	0.00	0	35	31.37	16	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R171Q	ENST00000332281.5	37	c.512	CCDS32505.1	16	.	.	.	.	.	.	.	.	.	.	C	9.781	1.175333	0.21704	.	.	ENSG00000185669	ENST00000332281	T	0.06294	3.32	4.37	0.591	0.17465	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.481301	0.19523	N	0.112227	T	0.01835	0.0058	N	0.03903	-0.33	0.33595	D	0.601623	B	0.17465	0.022	B	0.15484	0.013	T	0.45175	-0.9279	10	0.02654	T	1	-9.5172	3.1032	0.06333	0.187:0.3529:0.0:0.4601	.	171	Q3KNW1	SNAI3_HUMAN	Q	171	ENSP00000327968:R171Q	ENSP00000327968:R171Q	R	-	2	0	SNAI3	87275188	0.740000	0.28207	0.995000	0.50966	0.761000	0.43186	0.097000	0.15168	-0.121000	0.11787	0.491000	0.48974	CGG	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.647	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI3	protein_coding	OTTHUMT00000422582.1	C		-		88747687	-1	no_errors	ENST00000332281	ensembl	human	known	74_37	missense	SNP	1.000	T
SPACA1	81833	genome.wustl.edu	37	6	88769229	88769229	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr6:88769229C>T	ENST00000237201.1	+	5	650	c.533C>T	c.(532-534)cCc>cTc	p.P178L	SPACA1_ENST00000462690.1_3'UTR	NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	178					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		GAAAGTCACCCCTTGGCTTTC	0.348																																																	0								ENSG00000118434						92.0	90.0	91.0					6																	88769229		2203	4300	6503	SPACA1	SO:0001583	missense	0			-	HGNC	AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.533C>T	6.37:g.88769229C>T	ENSP00000237201:p.Pro178Leu	Somatic	0	15	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	12	29.41		Missense_Mutation	SNP	42	0.00	0	68	9.21	7	NULL	p.P178L	ENST00000237201.1	37	c.533	CCDS5014.1	6	.	.	.	.	.	.	.	.	.	.	C	14.41	2.525755	0.44969	.	.	ENSG00000118434	ENST00000237201	T	0.30981	1.51	5.5	5.5	0.81552	.	0.094770	0.47093	D	0.000253	T	0.47691	0.1459	M	0.67953	2.075	0.36914	D	0.891034	D	0.89917	1.0	D	0.79108	0.992	T	0.51748	-0.8666	10	0.87932	D	0	-10.3433	17.1731	0.86834	0.0:1.0:0.0:0.0	.	178	Q9HBV2	SACA1_HUMAN	L	178	ENSP00000237201:P178L	ENSP00000237201:P178L	P	+	2	0	SPACA1	88825948	0.494000	0.26043	0.105000	0.21289	0.108000	0.19459	3.173000	0.50839	2.571000	0.86741	0.650000	0.86243	CCC	-	NULL		0.348	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPACA1	protein_coding	OTTHUMT00000041459.1	C		-		88769229	+1	no_errors	ENST00000237201	ensembl	human	known	74_37	missense	SNP	0.470	T
RP11-467N20.5	0	genome.wustl.edu	37	15	23406924	23406924	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr15:23406924G>T	ENST00000558241.1	-	8	2002	c.1912C>A	c.(1912-1914)Cag>Aag	p.Q638K																	endometrium(1)	1						ttctcttcctgttcctgcatc	0.537																																																	0								ENSG00000259455																																			RP11-467N20.5	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000558241.1:c.1912C>A	15.37:g.23406924G>T	ENSP00000453436:p.Gln638Lys	Somatic	0	85	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	68	18.07		Missense_Mutation	SNP	12	0.00	0	7	41.67	5	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.Q638K	ENST00000558241.1	37	c.1912		15																																																																																			-	NULL		0.537	RP11-467N20.5-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000259455	protein_coding	OTTHUMT00000415942.1	G		-		23406924	-1	no_errors	ENST00000558241	ensembl	human	novel	74_37	missense	SNP	0.078	T
ZBTB1	22890	genome.wustl.edu	37	14	64990324	64990324	+	Missense_Mutation	SNP	T	T	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr14:64990324T>G	ENST00000554015.1	+	4	2533	c.2102T>G	c.(2101-2103)aTg>aGg	p.M701R	ZBTB1_ENST00000394712.2_Missense_Mutation_p.M701R|RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000358738.3_Intron			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	701					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		AGGAAAGATATGAGATCACAT	0.333																																																	0								ENSG00000126804						94.0	75.0	81.0					14																	64990324		692	1591	2283	ZBTB1	SO:0001583	missense	0			-	HGNC	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.2102T>G	14.37:g.64990324T>G	ENSP00000451000:p.Met701Arg	Somatic	0	18	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00	A8K6S8|Q86SW8	Missense_Mutation	SNP	36	0.00	0	10	73.68	28	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.M701R	ENST00000554015.1	37	c.2102	CCDS45126.1	14	.	.	.	.	.	.	.	.	.	.	T	14.40	2.522921	0.44866	.	.	ENSG00000126804	ENST00000554015;ENST00000394712	T;T	0.14893	2.47;2.47	5.66	4.49	0.54785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	.	.	.	.	T	0.15565	0.0375	L	0.45051	1.395	0.58432	D	0.999995	B	0.10296	0.003	B	0.10450	0.005	T	0.04090	-1.0978	8	.	.	.	-11.9639	12.82	0.57688	0.0:0.0:0.1366:0.8634	.	701	Q9Y2K1	ZBTB1_HUMAN	R	701	ENSP00000451000:M701R;ENSP00000378201:M701R	.	M	+	2	0	ZBTB1	64060077	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.662000	0.83803	0.954000	0.37851	0.529000	0.55759	ATG	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.333	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB1	protein_coding	OTTHUMT00000411912.1	T		-		64990324	+1	no_errors	ENST00000394712	ensembl	human	known	74_37	missense	SNP	1.000	G
SPRED1	161742	genome.wustl.edu	37	15	38641682	38641682	+	Silent	SNP	G	G	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr15:38641682G>T	ENST00000299084.4	+	6	1502	c.642G>T	c.(640-642)cgG>cgT	p.R214R		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	214					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		ACGTACAGCGGCAAATATCCA	0.333									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)												0								ENSG00000166068						95.0	89.0	91.0					15																	38641682		2200	4297	6497	SPRED1	SO:0001819	synonymous_variant	0	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	-	HGNC	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.642G>T	15.37:g.38641682G>T		Somatic	0	45	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	16	40.74	B2RPJ8|Q05D53|Q8N256	Silent	SNP	41	0.00	0	18	60.00	27	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.R214	ENST00000299084.4	37	c.642	CCDS32193.1	15																																																																																			-	NULL		0.333	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED1	protein_coding	OTTHUMT00000418217.1	G		-		38641682	+1	no_errors	ENST00000299084	ensembl	human	known	74_37	silent	SNP	0.996	T
BRCA2	675	genome.wustl.edu	37	13	32913902	32913902	+	Missense_Mutation	SNP	G	G	A	rs80359512		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr13:32913902G>A	ENST00000380152.3	+	11	5643	c.5410G>A	c.(5410-5412)Gta>Ata	p.V1804I	BRCA2_ENST00000544455.1_Missense_Mutation_p.V1804I			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1804			V -> A (in BC). {ECO:0000269|PubMed:14722926}.		brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		CCCACAAACTGTAAATGAAGA	0.318			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	0			GRCh37	CD042858	BRCA2	D	rs80359512	ENSG00000139618						66.0	70.0	69.0					13																	32913902		2203	4299	6502	BRCA2	SO:0001583	missense	0	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	-	HGNC	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.5410G>A	13.37:g.32913902G>A	ENSP00000369497:p.Val1804Ile	Somatic	0	21	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	8	52.94	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	41	0.00	0	35	35.19	19	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold,pirsf_BRCA2,pfscan_BRCA2_repeat	p.V1804I	ENST00000380152.3	37	c.5410	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	g	1.147	-0.647915	0.03506	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00792	5.69;5.69	5.66	-3.21	0.05140	.	1.155220	0.06217	N	0.685956	T	0.00967	0.0032	L	0.56769	1.78	0.09310	N	1	B	0.17852	0.024	B	0.12156	0.007	T	0.47959	-0.9076	10	0.15952	T	0.53	.	6.8298	0.23902	0.5158:0.0:0.3021:0.1821	.	1804	P51587	BRCA2_HUMAN	I	1804	ENSP00000369497:V1804I;ENSP00000439902:V1804I	ENSP00000369497:V1804I	V	+	1	0	BRCA2	31811902	0.000000	0.05858	0.134000	0.22075	0.025000	0.11179	-0.707000	0.05041	-0.338000	0.08413	-0.119000	0.15052	GTA	-	pirsf_BRCA2		0.318	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	protein_coding	OTTHUMT00000046000.2	G	NM_000059	-		32913902	+1	no_errors	ENST00000380152	ensembl	human	known	74_37	missense	SNP	0.000	A
LRRC30	339291	genome.wustl.edu	37	18	7232042	7232042	+	Nonstop_Mutation	SNP	A	A	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr18:7232042A>T	ENST00000383467.2	+	1	920	c.906A>T	c.(904-906)tgA>tgT	p.*302C		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	0										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						AACACACCTGACCTGGGTCCC	0.562																																																	0								ENSG00000206422						77.0	85.0	82.0					18																	7232042		1922	4135	6057	LRRC30	SO:0001578	stop_lost	0			-	HGNC		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.906A>T	18.37:g.7232042A>T	ENSP00000372959:p.*302Cysext*?	Somatic	0	26	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	4	71.43		Nonstop_Mutation	SNP	31	0.00	0	15	54.55	18	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.*302C	ENST00000383467.2	37	c.906	CCDS42409.1	18	.	.	.	.	.	.	.	.	.	.	A	11.20	1.568266	0.28003	.	.	ENSG00000206422	ENST00000383467	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5132	0.61524	1.0:0.0:0.0:0.0	.	.	.	.	C	302	.	.	X	+	3	0	LRRC30	7222042	1.000000	0.71417	0.472000	0.27241	0.067000	0.16453	6.637000	0.74304	2.132000	0.65825	0.533000	0.62120	TGA	-	NULL		0.562	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC30	protein_coding	OTTHUMT00000442140.1	A	XM_292678	-		7232042	+1	no_errors	ENST00000383467	ensembl	human	known	74_37	nonstop	SNP	0.911	T
ALPK2	115701	genome.wustl.edu	37	18	56204388	56204402	+	In_Frame_Del	DEL	CAGTTGATGTGTCCT	CAGTTGATGTGTCCT	-	rs199745034|rs201560823|rs386803723|rs149103820|rs60644017|rs67925233	byFrequency	TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	CAGTTGATGTGTCCT	CAGTTGATGTGTCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr18:56204388_56204402delCAGTTGATGTGTCCT	ENST00000361673.3	-	5	3230_3244	c.3017_3031delAGGACACATCAACTG	c.(3016-3033)gaggacacatcaactgtt>gtt	p.EDTST1006del	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1006						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						GCAATGGTAACAGTTGATGTGTCCTCAGTCTCCCT	0.493														2013	0.401957	0.4274	0.4251	5008	,	,		24283	0.2371		0.5696	False		,,,				2504	0.3487																0								ENSG00000198796																																			ALPK2	SO:0001651	inframe_deletion	0				HGNC	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.3017_3031delAGGACACATCAACTG	18.37:g.56204388_56204402delCAGTTGATGTGTCCT	ENSP00000354991:p.Glu1006_Thr1010del	Somatic	NA	NA	NA		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6ZUX0|Q8NAT5|Q96L95	In_Frame_Del	DEL	28	0.00	0	45	0.00	0	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.EDTST1006in_frame_del	ENST00000361673.3	37	c.3031_3017	CCDS11966.2	18																																																																																			-	NULL		0.493	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	protein_coding	OTTHUMT00000256126.1	CAGTTGATGTGTCCT	NM_052947			56204402	-1	no_errors	ENST00000361673	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.001:0.002	-
DRP2	1821	genome.wustl.edu	37	X	100515140	100515140	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chrX:100515140C>G	ENST00000395209.3	+	23	3258	c.2731C>G	c.(2731-2733)Cca>Gca	p.P911A	DRP2_ENST00000541709.1_Missense_Mutation_p.P833A|DRP2_ENST00000538510.1_Missense_Mutation_p.P911A|DRP2_ENST00000402866.1_Missense_Mutation_p.P911A	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	911					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						ACAGACTACTCCAGATACCGA	0.607																																																	0								ENSG00000102385						92.0	79.0	83.0					X																	100515140		2203	4300	6503	DRP2	SO:0001583	missense	0			-	HGNC	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.2731C>G	X.37:g.100515140C>G	ENSP00000378635:p.Pro911Ala	Somatic	0	84	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	75	29.91	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Missense_Mutation	SNP	37	0.00	0	40	28.57	16	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,pfam_Spectrin_repeat,pfam_WW_dom,superfamily_WW_dom,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin-related_2,pfscan_WW_dom,pfscan_Znf_ZZ	p.P911A	ENST00000395209.3	37	c.2731	CCDS14480.2	X	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747908	0.30955	.	.	ENSG00000102385	ENST00000402866;ENST00000395209;ENST00000541709;ENST00000538510	T;T;T;T	0.05786	3.49;3.49;3.39;3.49	4.94	4.94	0.65067	.	0.052152	0.85682	D	0.000000	T	0.06416	0.0165	L	0.48362	1.52	0.43678	D	0.996119	P	0.43024	0.798	B	0.32090	0.14	T	0.44298	-0.9337	10	0.28530	T	0.3	-8.2807	15.5866	0.76489	0.0:1.0:0.0:0.0	.	911	Q13474	DRP2_HUMAN	A	911;911;833;911	ENSP00000385038:P911A;ENSP00000378635:P911A;ENSP00000444752:P833A;ENSP00000441051:P911A	ENSP00000378635:P911A	P	+	1	0	DRP2	100401796	1.000000	0.71417	1.000000	0.80357	0.351000	0.29236	3.597000	0.54031	2.037000	0.60232	0.529000	0.55759	CCA	-	pirsf_Dystrophin-related_2		0.607	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DRP2	protein_coding	OTTHUMT00000057522.3	C	NM_001939	-		100515140	+1	no_errors	ENST00000395209	ensembl	human	known	74_37	missense	SNP	1.000	G
TBC1D3P1-DHX40P1	653645	genome.wustl.edu	37	17	58085530	58085530	+	lincRNA	SNP	T	T	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr17:58085530T>C	ENST00000407042.3	-	0	1906									TBC1D3P1-DHX40P1 readthrough transcribed pseudogene																		GTGGTTATCCTTCCATGAGTT	0.453																																																	0								ENSG00000267104																																			TBC1D3P1-DHX40P1			0			-	HGNC			17q23.1	2014-09-10	2012-12-07		ENSG00000267104	ENSG00000267104			42362	other	readthrough			"""TBC1D3P1-DHX40P1 readthrough (non-protein coding)"""				Standard	NR_002924		Approved		uc002iyf.2		OTTHUMG00000179977		17.37:g.58085530T>C		Somatic	0	21	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	13	23.53		RNA	SNP	36	18.18	8	59	14.49	10	-	NULL	ENST00000407042.3	37	NULL		17																																																																																			-	-		0.453	TBC1D3P1-DHX40P1-201	KNOWN	basic	lincRNA	TBC1D3P1-DHX40P1	lincRNA		T	NR_002924	-		58085530	-1	no_errors	ENST00000407042	ensembl	human	known	74_37	rna	SNP	0.068	C
CELP	1057	genome.wustl.edu	37	9	135962508	135962509	+	RNA	INS	-	-	A	rs143895853|rs199612457|rs386739107|rs78041803|rs370277311		TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr9:135962508_135962509insA	ENST00000411440.2	+	0	1015_1016					NR_001275.2				carboxyl ester lipase pseudogene																		CGTGTCCCCCTCAGGTGACTCT	0.663																																																	0								ENSG00000170827																																			CELP			0				HGNC	L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962508_135962509insA		Somatic	0	16	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33		RNA	INS	18	5.26	1	27	0.00	0	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			-	-		0.663	CELP-002	KNOWN	basic	processed_transcript	CELP	pseudogene	OTTHUMT00000339837.1	-	NM_001808			135962509	+1	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	INS	0.002:0.005	A
TP53	7157	genome.wustl.edu	37	17	7576897	7576897	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr17:7576897G>A	ENST00000269305.4	-	9	1138	c.949C>T	c.(949-951)Cag>Tag	p.Q317*	TP53_ENST00000359597.4_Nonsense_Mutation_p.Q317*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q317*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q317*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q317*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	317	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		Q -> H (in a kidney cancer with no family history; germline mutation and in a sporadic cancer; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in a sporadic cancer; somatic mutation).|Q -> P (in a sporadic cancer; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q317*(29)|p.0?(8)|p.Q317K(3)|p.S315fs*22(1)|p.?(1)|p.S314fs*25(1)|p.L308fs*15(1)|p.Q317fs*28(1)|p.Q317fs*45(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCTTTGGCTGGGGAGAGGAG	0.473		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	46	Substitution - Nonsense(29)|Whole gene deletion(8)|Deletion - Frameshift(4)|Substitution - Missense(3)|Insertion - Frameshift(1)|Unknown(1)	breast(7)|large_intestine(5)|skin(4)|bone(4)|upper_aerodigestive_tract(3)|haematopoietic_and_lymphoid_tissue(3)|urinary_tract(3)|ovary(3)|central_nervous_system(2)|lung(2)|NS(2)|pancreas(2)|thyroid(1)|stomach(1)|soft_tissue(1)|liver(1)|endometrium(1)|oesophagus(1)						ENSG00000141510						129.0	119.0	122.0					17																	7576897		2203	4300	6503	TP53	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.949C>T	17.37:g.7576897G>A	ENSP00000269305:p.Gln317*	Somatic	0	73	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	32	45.76	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	34	0.00	0	16	57.89	22	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Q317*	ENST00000269305.4	37	c.949	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	29.7	5.032676	0.93575	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	4.96	2.84	0.33178	.	1.146690	0.06159	N	0.675692	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-0.0856	5.403	0.16306	0.1029:0.0:0.6855:0.2116	.	.	.	.	X	317;317;317;317;317;306;185	.	ENSP00000269305:Q317X	Q	-	1	0	TP53	7517622	0.001000	0.12720	0.022000	0.16811	0.871000	0.50021	0.741000	0.26202	1.318000	0.45170	0.561000	0.74099	CAG	-	NULL		0.473	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546	-		7576897	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	SNP	0.012	A
SNCB	6620	genome.wustl.edu	37	5	176048272	176048272	+	Silent	SNP	T	T	C			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr5:176048272T>C	ENST00000310112.3	-	6	565	c.315A>G	c.(313-315)gaA>gaG	p.E105E	SNCB_ENST00000393693.2_Silent_p.E105E|SNCB_ENST00000510387.1_Silent_p.E105E|SNCB_ENST00000506696.1_Silent_p.E105E	NM_001001502.1	NP_001001502.1	Q16143	SYUB_HUMAN	synuclein, beta	105					dopamine metabolic process (GO:0042417)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)|phospholipase inhibitor activity (GO:0004859)			breast(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	10	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAATCAGTGGTTCTTCAGCAG	0.602																																																	0								ENSG00000074317						59.0	57.0	58.0					5																	176048272		2203	4300	6503	SNCB	SO:0001819	synonymous_variant	0			-	HGNC	AF053134	CCDS4406.1	5q35	2008-07-18			ENSG00000074317	ENSG00000074317			11140	protein-coding gene	gene with protein product		602569				7558013, 9806846	Standard	NM_003085		Approved		uc003meq.3	Q16143	OTTHUMG00000130661	ENST00000310112.3:c.315A>G	5.37:g.176048272T>C		Somatic	0	66	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	55	16.67	Q6IAX7	Silent	SNP	31	0.00	0	53	7.02	4	pfam_Synuclein,prints_Synuclein,prints_Synuclein_beta	p.E105	ENST00000310112.3	37	c.315	CCDS4406.1	5																																																																																			-	pfam_Synuclein,prints_Synuclein_beta		0.602	SNCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCB	protein_coding	OTTHUMT00000253152.2	T	NM_001001502	-		176048272	-1	no_errors	ENST00000310112	ensembl	human	known	74_37	silent	SNP	0.990	C
NOS3	4846	genome.wustl.edu	37	7	150696416	150696416	+	Silent	SNP	G	G	A			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr7:150696416G>A	ENST00000484524.1	+	8	1095	c.1095G>A	c.(1093-1095)agG>agA	p.R365R	NOS3_ENST00000297494.3_Silent_p.R365R|NOS3_ENST00000467517.1_Silent_p.R365R|NOS3_ENST00000461406.1_Silent_p.R159R	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCGGCACGAGGAACCTGTGTG	0.627																																																	0								ENSG00000164867						91.0	90.0	91.0					7																	150696416		2202	4292	6494	NOS3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.1095G>A	7.37:g.150696416G>A		Somatic	0	21	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	17	41.38	Q495E5	Silent	SNP	26	0.00	0	20	37.50	12	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.R365	ENST00000484524.1	37	c.1095	CCDS55182.1	7																																																																																			-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk		0.627	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS3	protein_coding	OTTHUMT00000351550.1	G	NM_000603	-		150696416	+1	no_errors	ENST00000297494	ensembl	human	known	74_37	silent	SNP	0.997	A
ZNF831	128611	genome.wustl.edu	37	20	57829403	57829403	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3K7-01A-11D-A21Q-09	TCGA-IS-A3K7-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	afee5b10-3dff-4e50-9575-bc9fe20c5dea	71896be3-fce7-4266-b6d8-3e20e38337fd	g.chr20:57829403C>T	ENST00000371030.2	+	5	4639	c.4639C>T	c.(4639-4641)Cct>Tct	p.P1547S		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1547							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GCCAGGGAGACCTTCATCTGG	0.498																																																	0								ENSG00000124203						41.0	44.0	43.0					20																	57829403		1996	4183	6179	ZNF831	SO:0001583	missense	0			-	HGNC	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.4639C>T	20.37:g.57829403C>T	ENSP00000360069:p.Pro1547Ser	Somatic	0	25	0.00		0.6271771381095859	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	16	20.00	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	36	2.70	1	34	33.33	17	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P1547S	ENST00000371030.2	37	c.4639	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	C	5.855	0.342013	0.11069	.	.	ENSG00000124203	ENST00000371030	T	0.07216	3.21	5.33	-0.295	0.12828	.	1.070090	0.07267	N	0.868406	T	0.05914	0.0154	L	0.35723	1.085	0.09310	N	1	B	0.24721	0.11	B	0.23150	0.044	T	0.44907	-0.9297	10	0.27082	T	0.32	0.548	1.1336	0.01750	0.1576:0.4283:0.1532:0.2608	.	1547	Q5JPB2	ZN831_HUMAN	S	1547	ENSP00000360069:P1547S	ENSP00000360069:P1547S	P	+	1	0	ZNF831	57262798	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.511000	0.06321	0.068000	0.16574	0.650000	0.86243	CCT	-	NULL		0.498	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	protein_coding	OTTHUMT00000079916.2	C	NM_178457	-		57829403	+1	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	SNP	0.000	T
