#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
LGMN	5641	genome.wustl.edu	37	14	93182482	93182482	+	Splice_Site	SNP	T	T	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr14:93182482T>A	ENST00000393218.2	-	6	740	c.403A>T	c.(403-405)Agt>Tgt	p.S135C	LGMN_ENST00000334869.4_Splice_Site_p.S135C|LGMN_ENST00000555699.1_Splice_Site_p.S135C|LGMN_ENST00000557434.1_Splice_Site_p.S135C	NM_001008530.2	NP_001008530.1	Q99538	LGMN_HUMAN	legumain	135					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|innate immune response (GO:0045087)|negative regulation of ERBB signaling pathway (GO:1901185)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of neuron apoptotic process (GO:0043524)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|receptor catabolic process (GO:0032801)|renal system process (GO:0003014)|response to acidic pH (GO:0010447)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|toll-like receptor signaling pathway (GO:0002224)|vitamin D metabolic process (GO:0042359)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|peptidase activity (GO:0008233)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(5)|skin(2)	18		all_cancers(154;0.0706)		COAD - Colon adenocarcinoma(157;0.224)		AGACATTACCTCTTCAGGACT	0.468																																																	0								ENSG00000100600						160.0	138.0	145.0					14																	93182482		2203	4300	6503	LGMN	SO:0001630	splice_region_variant	0			-	HGNC	D55696	CCDS9904.1	14q32.12	2011-04-08		2002-01-18	ENSG00000100600	ENSG00000100600			9472	protein-coding gene	gene with protein product		602620	"""protease, cysteine, 1 (legumain)"""	PRSC1		8893817, 9065484	Standard	NM_001008530		Approved	LGMN1	uc001yaw.3	Q99538		ENST00000393218.2:c.404+1A>T	14.37:g.93182482T>A		Somatic	0	53	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	75	12.79	O00123|Q86TV2|Q86TV3|Q9BTY1	Missense_Mutation	SNP	33	0.00	0	44	18.52	10	pfam_Peptidase_C13,prints_Peptidase_C13	p.S135C	ENST00000393218.2	37	c.403	CCDS9904.1	14	.	.	.	.	.	.	.	.	.	.	T	26.1	4.705494	0.89018	.	.	ENSG00000100600	ENST00000555699;ENST00000334869;ENST00000557434;ENST00000334864;ENST00000262004;ENST00000393218;ENST00000539531;ENST00000535855;ENST00000553802	T;T;T;T;T	0.58506	0.52;0.49;0.55;0.49;0.33	5.51	5.51	0.81932	.	0.181563	0.64402	D	0.000001	D	0.84960	0.5588	H	0.98068	4.14	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.90629	0.4565	10	0.87932	D	0	-31.54	15.5875	0.76495	0.0:0.0:0.0:1.0	.	135;135;135	Q99538;Q86TV2;Q86TV3	LGMN_HUMAN;.;.	C	135;135;135;135;135;135;112;100;126	ENSP00000451861:S135C;ENSP00000334052:S135C;ENSP00000452572:S135C;ENSP00000376911:S135C;ENSP00000450854:S126C	ENSP00000262004:S135C	S	-	1	0	LGMN	92252235	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.238000	0.78173	2.232000	0.73038	0.533000	0.62120	AGT	-	pfam_Peptidase_C13,prints_Peptidase_C13		0.468	LGMN-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LGMN	protein_coding	OTTHUMT00000412288.1	T	NM_005606	-	Missense_Mutation	93182482	-1	no_errors	ENST00000334869	ensembl	human	known	74_37	missense	SNP	1.000	A
FCHO1	23149	genome.wustl.edu	37	19	17886830	17886830	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr19:17886830G>A	ENST00000596536.1	+	16	1325	c.1042G>A	c.(1042-1044)Gac>Aac	p.D348N	FCHO1_ENST00000595033.1_Missense_Mutation_p.D298N|FCHO1_ENST00000600676.1_Missense_Mutation_p.D348N|FCHO1_ENST00000389133.4_Missense_Mutation_p.D348N|FCHO1_ENST00000596951.1_Missense_Mutation_p.D348N|FCHO1_ENST00000539407.1_Missense_Mutation_p.D348N|FCHO1_ENST00000252771.7_Missense_Mutation_p.D348N|FCHO1_ENST00000594202.1_Missense_Mutation_p.D348N|FCHO1_ENST00000597512.1_Missense_Mutation_p.D355N	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	348	Mediates interaction with the adaptor protein complex AP-2.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CAGCGACTCCGACTTCGACGA	0.642											OREG0025349	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000130475						50.0	52.0	51.0					19																	17886830		2203	4300	6503	FCHO1	SO:0001583	missense	0			-	HGNC	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.1042G>A	19.37:g.17886830G>A	ENSP00000470731:p.Asp348Asn	Somatic	0	62	0.00	721	0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	91	12.50	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	29	0.00	0	27	12.90	4	pfam_Muniscin_C-term_mu_dom,pfam_FCH_dom,superfamily_Clathrin_mu_C,smart_FCH_dom,pfscan_FCH_dom	p.D348N	ENST00000596536.1	37	c.1042	CCDS32955.1	19	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959749	0.74016	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.48522	0.81;0.81;0.81	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	T	0.62563	0.2438	M	0.72894	2.215	0.54753	D	0.999982	D;D	0.76494	0.997;0.999	P;P	0.62014	0.791;0.897	T	0.62840	-0.6769	10	0.37606	T	0.19	-25.5542	12.8696	0.57957	0.0:0.0:1.0:0.0	.	348;348	O14526;O14526-2	FCHO1_HUMAN;.	N	348	ENSP00000252771:D348N;ENSP00000373785:D348N;ENSP00000437978:D348N	ENSP00000252771:D348N	D	+	1	0	FCHO1	17747830	1.000000	0.71417	0.517000	0.27799	0.286000	0.27126	8.183000	0.89700	2.078000	0.62432	0.491000	0.48974	GAC	-	NULL		0.642	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	protein_coding	OTTHUMT00000466946.2	G	NM_015122	-		17886830	+1	no_errors	ENST00000252771	ensembl	human	known	74_37	missense	SNP	0.994	A
TLL1	7092	genome.wustl.edu	37	4	166915615	166915615	+	Silent	SNP	C	C	A	rs147468832		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr4:166915615C>A	ENST00000061240.2	+	4	1091	c.444C>A	c.(442-444)gcC>gcA	p.A148A	TLL1_ENST00000507499.1_Silent_p.A148A|TLL1_ENST00000513213.1_Silent_p.A148A	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	148	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TTCCCAGAGCCGCTACATCAA	0.418																																																	0								ENSG00000038295						75.0	74.0	74.0					4																	166915615		2203	4300	6503	TLL1	SO:0001819	synonymous_variant	0			-	HGNC	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.444C>A	4.37:g.166915615C>A		Somatic	0	43	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	8	33.33	B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	37	0.00	0	14	57.58	19	pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Peptidase_M12A	p.A148	ENST00000061240.2	37	c.444	CCDS3811.1	4																																																																																			-	pirsf_BMP_1/tolloid-like		0.418	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	protein_coding	OTTHUMT00000363821.1	C		-		166915615	+1	no_errors	ENST00000061240	ensembl	human	known	74_37	silent	SNP	0.976	A
KIAA0040	9674	genome.wustl.edu	37	1	175129948	175129955	+	Frame_Shift_Del	DEL	TCTTCTTG	TCTTCTTG	-	rs3208835|rs542219168|rs71563271|rs202239690|rs386636937|rs57794404		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	TCTTCTTG	TCTTCTTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:175129948_175129955delTCTTCTTG	ENST00000423313.1	-	4	731_738	c.195_202delCAAGAAGA	c.(193-204)aacaagaagaagfs	p.NKK65fs	KIAA0040_ENST00000545251.2_Frame_Shift_Del_p.NKK65fs|KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000444639.1_Frame_Shift_Del_p.NKK65fs	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	ttcttcttcttcttcttgttcttctCTG	0.51																																																	0								ENSG00000235750																																			KIAA0040	SO:0001589	frameshift_variant	0				HGNC	D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.195_202delCAAGAAGA	1.37:g.175129948_175129955delTCTTCTTG	ENSP00000462172:p.Asn65fs	Somatic	NA	NA	NA		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K9H6|Q2NKQ0	Frame_Shift_Del	DEL	33	13.16	5	36	12.20	5	NULL	p.N65fs	ENST00000423313.1	37	c.202_195		1																																																																																			-	NULL		0.510	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	KIAA0040	protein_coding	OTTHUMT00000084420.3	TCTTCTTG	NM_014656			175129955	-1	no_errors	ENST00000423313	ensembl	human	known	74_37	frame_shift_del	DEL	0.979:0.335:0.011:0.006:0.005:0.014:0.019:0.212	-
NKX6-3	157848	genome.wustl.edu	37	8	41505619	41505619	+	5'Flank	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr8:41505619G>A	ENST00000524115.2	-	0	0					NM_152568.2	NP_689781.1	A6NJ46	NKX63_HUMAN	NK6 homeobox 3						cell fate determination (GO:0001709)|glandular epithelial cell differentiation (GO:0002067)|negative regulation of epithelial cell differentiation (GO:0030857)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(1)	1	Ovarian(28;0.00541)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Esophageal squamous(32;0.0844)|Hepatocellular(245;0.154)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CAGTGAGTATGCCAGCCGTGC	0.632																																																	0								ENSG00000165066																																			NKX6-3	SO:0001631	upstream_gene_variant	0			-	HGNC	AK057898	CCDS6118.1	8p11.21	2014-08-12	2007-07-09		ENSG00000165066	ENSG00000165066		"""Homeoboxes / ANTP class : NKL subclass"""	26328	protein-coding gene	gene with protein product		610772	"""NK6 transcription factor related, locus 3 (Drosophila)"""			16326147	Standard	XM_005273422		Approved	FLJ25169	uc003xoa.2	A6NJ46	OTTHUMG00000164083		8.37:g.41505619G>A	Exception_encountered	Somatic	0	61	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	117	14.49	Q96LR0	Missense_Mutation	SNP	34	0.00	0	41	19.23	10	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif,prints_Homeobox_metazoa	p.A173V	ENST00000524115.2	37	c.518	CCDS6118.1	8	.	.	.	.	.	.	.	.	.	.	G	36	5.923680	0.97110	.	.	ENSG00000165066	ENST00000425142;ENST00000518699	D	0.98362	-4.89	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.99777	1.1026	7	0.87932	D	0	.	19.1261	0.93384	0.0:0.0:1.0:0.0	.	.	.	.	V	173	ENSP00000428361:A173V	ENSP00000414183:A173V	A	-	2	0	NKX6-3	41624776	1.000000	0.71417	0.969000	0.41365	0.948000	0.59901	9.238000	0.95380	2.779000	0.95612	0.655000	0.94253	GCA	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif		0.632	NKX6-3-002	KNOWN	basic|exp_conf|CCDS	protein_coding	NKX6-3	protein_coding	OTTHUMT00000377166.2	G	NM_152568	-		41505619	-1	no_errors	ENST00000518699	ensembl	human	known	74_37	missense	SNP	1.000	A
BRINP1	1620	genome.wustl.edu	37	9	121971060	121971060	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:121971060C>T	ENST00000265922.3	-	7	1543	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	BRINP1_ENST00000482797.1_5'UTR	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	361					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)		p.R361H(1)									GAAAAGCTTGCGGGCAGTGCG	0.582																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000078725						226.0	188.0	201.0					9																	121971060		2203	4300	6503	BRINP1	SO:0001583	missense	0			-	HGNC	AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1082G>A	9.37:g.121971060C>T	ENSP00000265922:p.Arg361His	Somatic	0	108	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	57	118	32.57	Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	36	0.00	0	33	19.51	8	pfam_MACPF,smart_MACPF	p.R361H	ENST00000265922.3	37	c.1082	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	C	17.06	3.291614	0.59976	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.15017	2.46	5.79	5.79	0.91817	.	0.049549	0.85682	D	0.000000	T	0.30479	0.0766	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	D	0.69479	0.964	T	0.01316	-1.1387	10	0.18276	T	0.48	-13.1734	19.0317	0.92960	0.0:1.0:0.0:0.0	.	361	O60477	DBC1_HUMAN	H	361	ENSP00000265922:R361H	ENSP00000265922:R361H	R	-	2	0	DBC1	121010881	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.655000	0.61476	2.731000	0.93534	0.650000	0.86243	CGC	-	NULL		0.582	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	protein_coding	OTTHUMT00000055440.2	C	NM_014618	-		121971060	-1	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	SNP	1.000	T
STAB2	55576	genome.wustl.edu	37	12	104156110	104156110	+	Missense_Mutation	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr12:104156110G>C	ENST00000388887.2	+	67	7622	c.7418G>C	c.(7417-7419)gGg>gCg	p.G2473A	RP11-341G23.4_ENST00000550029.1_RNA|RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						CTGGTGACTGGGGCTGTTGCC	0.478																																																	0								ENSG00000136011						143.0	128.0	133.0					12																	104156110		2203	4300	6503	STAB2	SO:0001583	missense	0			-	HGNC	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.7418G>C	12.37:g.104156110G>C	ENSP00000373539:p.Gly2473Ala	Somatic	0	51	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	67	15.19		Missense_Mutation	SNP	36	0.00	0	37	13.95	6	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.G2473A	ENST00000388887.2	37	c.7418	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595518	0.46318	.	.	ENSG00000136011	ENST00000388887	T	0.65916	-0.18	5.25	4.34	0.51931	.	0.144413	0.45126	D	0.000390	T	0.77778	0.4181	M	0.74258	2.255	0.35072	D	0.762556	D	0.89917	1.0	D	0.87578	0.998	T	0.82882	-0.0237	10	0.33141	T	0.24	.	15.6735	0.77297	0.0:0.1376:0.8624:0.0	.	2473	Q8WWQ8	STAB2_HUMAN	A	2473	ENSP00000373539:G2473A	ENSP00000373539:G2473A	G	+	2	0	STAB2	102680240	1.000000	0.71417	0.026000	0.17262	0.003000	0.03518	3.893000	0.56243	1.178000	0.42870	0.561000	0.74099	GGG	-	NULL		0.478	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	protein_coding	OTTHUMT00000407089.1	G		-		104156110	+1	no_errors	ENST00000388887	ensembl	human	known	74_37	missense	SNP	0.724	C
MMP27	64066	genome.wustl.edu	37	11	102575384	102575384	+	Silent	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:102575384A>G	ENST00000260229.4	-	2	316	c.225T>C	c.(223-225)acT>acC	p.T75T		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	75					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	CCAGTTTTCCAGTCACTGTCA	0.453																																																	0								ENSG00000137675						125.0	118.0	120.0					11																	102575384		2203	4299	6502	MMP27	SO:0001819	synonymous_variant	0			-	HGNC	AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.225T>C	11.37:g.102575384A>G		Somatic	0	69	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	51	15.00	Q6UWK6	Silent	SNP	49	0.00	0	27	12.90	4	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,pirsf_Pept_M10A_Metazoans,prints_Pept_M10A	p.T75	ENST00000260229.4	37	c.225	CCDS8319.1	11																																																																																			-	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like,pirsf_Pept_M10A_Metazoans		0.453	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP27	protein_coding	OTTHUMT00000398128.1	A	NM_022122	-		102575384	-1	no_errors	ENST00000260229	ensembl	human	known	74_37	silent	SNP	0.987	G
TGFBRAP1	9392	genome.wustl.edu	37	2	105883847	105883847	+	Missense_Mutation	SNP	C	C	T	rs376885416		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr2:105883847C>T	ENST00000393359.2	-	12	3002	c.2576G>A	c.(2575-2577)cGg>cAg	p.R859Q	AC012360.2_ENST00000595531.1_5'Flank|TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.R859Q			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	859					intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						TTTTCAAGTCCGAGTGCCAGG	0.552																																					Esophageal Squamous(183;794 2019 9730 21801 48859)												0								ENSG00000135966	C	GLN/ARG,GLN/ARG	1,4405		0,1,2202	96.0	83.0	88.0		2576,2576	5.5	1.0	2		88	0,8600		0,0,4300	no	missense,missense	TGFBRAP1	NM_004257.4,NM_001142621.1	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	859/861,859/861	105883847	1,13005	2203	4300	6503	TGFBRAP1	SO:0001583	missense	0			-	HGNC	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.2576G>A	2.37:g.105883847C>T	ENSP00000377027:p.Arg859Gln	Somatic	0	32	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	43	20.37	A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	35	0.00	0	33	32.00	16	pfam_VPS39/TGF_beta_rcpt-assoc_2,pfam_VPS39/TGF_beta_rcpt-assoc_1,pfam_Clathrin_H-chain/VPS_repeat,pfam_Citron	p.R859Q	ENST00000393359.2	37	c.2576	CCDS2067.1	2	.	.	.	.	.	.	.	.	.	.	C	18.48	3.634112	0.67130	2.27E-4	0.0	ENSG00000135966	ENST00000393359;ENST00000258449;ENST00000543724	T;T	0.46063	0.88;0.88	5.5	5.5	0.81552	.	0.165679	0.41500	D	0.000870	T	0.28599	0.0708	N	0.22421	0.69	0.30479	N	0.772514	B;B	0.18166	0.026;0.026	B;B	0.08055	0.003;0.003	T	0.18840	-1.0324	10	0.59425	D	0.04	-24.0118	9.6725	0.40021	0.0:0.8403:0.0:0.1597	.	314;859	B3KMM9;Q8WUH2	.;TGFA1_HUMAN	Q	859;859;314	ENSP00000377027:R859Q;ENSP00000258449:R859Q	ENSP00000258449:R859Q	R	-	2	0	TGFBRAP1	105250279	1.000000	0.71417	0.996000	0.52242	0.874000	0.50279	2.866000	0.48420	2.590000	0.87494	0.557000	0.71058	CGG	-	NULL		0.552	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBRAP1	protein_coding	OTTHUMT00000253354.2	C	NM_004257	-		105883847	-1	no_errors	ENST00000258449	ensembl	human	known	74_37	missense	SNP	1.000	T
WASH6P	653440	genome.wustl.edu	37	X	155252089	155252089	+	RNA	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:155252089C>T	ENST00000461007.1	+	0	1097				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										TCAGCTCTGTCAGCTCCTTGC	0.617																																																	0								ENSG00000270726																																			AJ271736.10			0			-	Clone_based_vega_gene	AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155252089C>T		Somatic	0	70	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	102	28.67	A6NGF1|Q8N305	RNA	SNP	12	0.00	0	14	33.33	7	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			-	-		0.617	WASH6P-016	KNOWN	basic	processed_transcript	ENSG00000270726	pseudogene	OTTHUMT00000058840.1	C	NG_008380	-		155252089	+1	no_errors	ENST00000285718	ensembl	human	known	74_37	rna	SNP	1.000	T
TMEM217	221468	genome.wustl.edu	37	6	37182996	37182996	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:37182996C>T	ENST00000336655.2	-	3	707	c.668G>A	c.(667-669)aGa>aAa	p.R223K	TMEM217_ENST00000497775.1_Intron|TMEM217_ENST00000356757.2_Intron	NM_145316.3	NP_660359.2	Q8N7C4	TM217_HUMAN	transmembrane protein 217	223						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(5)|lung(1)	9						tattgtgtatctacaggtgct	0.403																																																	0								ENSG00000172738						111.0	112.0	111.0					6																	37182996		2203	4300	6503	TMEM217	SO:0001583	missense	0			-	HGNC		CCDS4831.1, CCDS69102.1	6p21.31-p21.2	2008-10-20	2008-07-07	2008-07-07	ENSG00000172738	ENSG00000172738			21238	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 128"""	C6orf128			Standard	NM_001162900		Approved	dJ355M6.2	uc010jws.3	Q8N7C4	OTTHUMG00000014618	ENST00000336655.2:c.668G>A	6.37:g.37182996C>T	ENSP00000338164:p.Arg223Lys	Somatic	0	74	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	469	36	92.87	Q8TC54	Missense_Mutation	SNP	32	0.00	0	55	88.15	409	NULL	p.R223K	ENST00000336655.2	37	c.668	CCDS4831.1	6	.	.	.	.	.	.	.	.	.	.	C	10.74	1.435821	0.25813	.	.	ENSG00000172738	ENST00000336655	.	.	.	1.73	-0.545	0.11843	.	.	.	.	.	T	0.05731	0.0150	N	0.08118	0	0.09310	N	1	B	0.18610	0.029	B	0.08055	0.003	T	0.35251	-0.9796	8	0.87932	D	0	.	4.1463	0.10217	0.0:0.4491:0.0:0.5509	.	223	Q8N7C4	TM217_HUMAN	K	223	.	ENSP00000338164:R223K	R	-	2	0	TMEM217	37290974	0.000000	0.05858	0.000000	0.03702	0.076000	0.17211	-0.360000	0.07622	-0.155000	0.11098	0.462000	0.41574	AGA	-	NULL		0.403	TMEM217-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM217	protein_coding	OTTHUMT00000357542.1	C	NM_145316	-		37182996	-1	no_errors	ENST00000336655	ensembl	human	known	74_37	missense	SNP	0.000	T
SSX2IP	117178	genome.wustl.edu	37	1	85113279	85113279	+	Missense_Mutation	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:85113279A>G	ENST00000342203.3	-	14	1945	c.1682T>C	c.(1681-1683)gTa>gCa	p.V561A	SSX2IP_ENST00000605755.1_Missense_Mutation_p.V534A|SSX2IP_ENST00000437941.2_Missense_Mutation_p.V534A	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	561					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TATATTCAGTACATTGATTGA	0.368																																																	0								ENSG00000117155						148.0	129.0	135.0					1																	85113279		2203	4300	6503	SSX2IP	SO:0001583	missense	0			-	HGNC		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.1682T>C	1.37:g.85113279A>G	ENSP00000340279:p.Val561Ala	Somatic	0	50	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	21	58.82	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	25	0.00	0	9	65.38	17	pfam_Afadin/alpha-actinin-bd	p.V561A	ENST00000342203.3	37	c.1682	CCDS699.1	1	.	.	.	.	.	.	.	.	.	.	A	1.961	-0.438958	0.04636	.	.	ENSG00000117155	ENST00000342203;ENST00000437941	T;T	0.49720	0.77;0.77	5.77	-1.2	0.09554	.	0.945322	0.08876	N	0.880748	T	0.10723	0.0262	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.25467	-1.0131	10	0.24483	T	0.36	0.4097	2.0259	0.03519	0.3909:0.1351:0.3429:0.1311	.	561;534	Q9Y2D8;B4DFE3	ADIP_HUMAN;.	A	561;534	ENSP00000340279:V561A;ENSP00000412781:V534A	ENSP00000340279:V561A	V	-	2	0	SSX2IP	84885867	0.002000	0.14202	0.001000	0.08648	0.132000	0.20833	1.007000	0.29860	-0.132000	0.11557	0.533000	0.62120	GTA	-	NULL		0.368	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX2IP	protein_coding	OTTHUMT00000027469.1	A	NM_014021	-		85113279	-1	no_errors	ENST00000342203	ensembl	human	known	74_37	missense	SNP	0.000	G
LONRF3	79836	genome.wustl.edu	37	X	118124513	118124513	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:118124513C>G	ENST00000371628.3	+	5	1436	c.1405C>G	c.(1405-1407)Cta>Gta	p.L469V	LONRF3_ENST00000472173.1_3'UTR|LONRF3_ENST00000304778.7_Missense_Mutation_p.L428V|LONRF3_ENST00000422289.2_Missense_Mutation_p.L213V	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	469							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						TGAATGCGCTCTATGTATGAG	0.468																																																	0								ENSG00000175556						308.0	193.0	232.0					X																	118124513		2203	4300	6503	LONRF3	SO:0001583	missense	0			-	HGNC	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1405C>G	X.37:g.118124513C>G	ENSP00000360690:p.Leu469Val	Somatic	0	26	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	11	50.00	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	37	0.00	0	9	64.00	16	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_TPR_repeat,smart_Znf_RING,smart_Pept_S16_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.L469V	ENST00000371628.3	37	c.1405	CCDS35374.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.87|10.87	1.474049|1.474049	0.26423|0.26423	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289|ENST00000439603	T;T;T;T|.	0.15372|.	2.43;2.43;2.43;2.43|.	5.3|5.3	3.53|3.53	0.40419|0.40419	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);|.	0.000000|.	0.64402|.	D|.	0.000007|.	T|T	0.27384|0.27384	0.0672|0.0672	N|N	0.03281|0.03281	-0.365|-0.365	0.80722|0.80722	D|D	1|1	P;P;D|.	0.64830|.	0.529;0.84;0.994|.	P;P;P|.	0.59012|.	0.521;0.767;0.85|.	T|T	0.04017|0.04017	-1.0984|-1.0984	10|5	0.34782|.	T|.	0.22|.	-14.6539|-14.6539	8.0982|8.0982	0.30842|0.30842	0.0:0.7594:0.1542:0.0864|0.0:0.7594:0.1542:0.0864	.|.	213;428;469|.	B3KUN7;Q496Y0-2;Q496Y0|.	.;.;LONF3_HUMAN|.	V|C	428;428;469;213|234	ENSP00000360691:L428V;ENSP00000307732:L428V;ENSP00000360690:L469V;ENSP00000408894:L213V|.	ENSP00000307732:L428V|.	L|S	+|+	1|2	2|0	LONRF3|LONRF3	118008541|118008541	0.938000|0.938000	0.31826|0.31826	0.024000|0.024000	0.17045|0.17045	0.162000|0.162000	0.22319|0.22319	1.477000|1.477000	0.35431|0.35431	0.548000|0.548000	0.28955|0.28955	0.600000|0.600000	0.82982|0.82982	CTA|TCT	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.468	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF3	protein_coding	OTTHUMT00000355124.2	C	NM_024778	-		118124513	+1	no_errors	ENST00000371628	ensembl	human	known	74_37	missense	SNP	0.215	G
PTK2	5747	genome.wustl.edu	37	8	141900797	141900797	+	Missense_Mutation	SNP	G	G	T	rs191376716	byFrequency	TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr8:141900797G>T	ENST00000522684.1	-	3	269	c.40C>A	c.(40-42)Cca>Aca	p.P14T	PTK2_ENST00000395218.2_Missense_Mutation_p.P14T|PTK2_ENST00000519881.1_Missense_Mutation_p.P14T|PTK2_ENST00000517887.1_Missense_Mutation_p.P58T|PTK2_ENST00000340930.3_Missense_Mutation_p.P14T|PTK2_ENST00000535192.1_Missense_Mutation_p.P14T|PTK2_ENST00000521059.1_Missense_Mutation_p.P14T|PTK2_ENST00000520892.1_Missense_Mutation_p.P14T|PTK2_ENST00000519419.1_Missense_Mutation_p.P58T	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	14					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			CTCGAATTTGGTGTGTGATTC	0.383																																																	0								ENSG00000169398						120.0	98.0	106.0					8																	141900797		2203	4300	6503	PTK2	SO:0001583	missense	0			-	HGNC	L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.40C>A	8.37:g.141900797G>T	ENSP00000429911:p.Pro14Thr	Somatic	0	95	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	87	19.44	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	33	0.00	0	38	19.15	9	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.P14T	ENST00000522684.1	37	c.40	CCDS6381.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.12|11.12	1.545147|1.545147	0.27652|0.27652	.|.	.|.	ENSG00000169398|ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000340930;ENST00000519419;ENST00000524357;ENST00000520475;ENST00000519881;ENST00000520892;ENST00000523803;ENST00000521907;ENST00000517453;ENST00000520045;ENST00000521395;ENST00000521332;ENST00000524040|ENST00000519654	T;T;T;T;T;T;T|T	0.76316|0.78003	-1.01;-1.0;-0.98;-1.01;-1.0;-1.0;-0.98|-1.14	5.68|5.68	4.8|4.8	0.61643|0.61643	.|.	0.217942|.	0.48286|.	D|.	0.000193|.	T|T	0.72374|0.72374	0.3452|0.3452	N|N	0.19112|0.19112	0.55|0.55	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0|.	B;B;B;B|.	0.04013|.	0.001;0.001;0.001;0.0|.	T|T	0.69862|0.69862	-0.5030|-0.5030	10|7	0.17832|0.27082	T|T	0.49|0.32	.|.	16.8293|16.8293	0.85940|0.85940	0.0:0.1284:0.8716:0.0|0.0:0.1284:0.8716:0.0	.|.	14;14;36;14|.	B4E2N6;Q05397;Q658W2;Q8IYN9|.	.;FAK1_HUMAN;.;.|.	T|N	14;14;58;14;27;14;14;58;14;14;14;14;14;14;14;14;14;14;14|24	ENSP00000429911:P14T;ENSP00000438009:P14T;ENSP00000429082:P58T;ENSP00000429474:P14T;ENSP00000378644:P14T;ENSP00000341189:P14T;ENSP00000429129:P58T|ENSP00000429929:T24N	ENSP00000341189:P14T|ENSP00000429929:T24N	P|T	-|-	1|2	0|0	PTK2|PTK2	141969979|141969979	1.000000|1.000000	0.71417|0.71417	0.921000|0.921000	0.36526|0.36526	0.937000|0.937000	0.57800|0.57800	3.683000|3.683000	0.54663|0.54663	1.372000|1.372000	0.46190|0.46190	0.650000|0.650000	0.86243|0.86243	CCA|ACC	-	NULL		0.383	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK2	protein_coding	OTTHUMT00000378054.5	G	NM_005607	-		141900797	-1	no_errors	ENST00000395218	ensembl	human	known	74_37	missense	SNP	0.539	T
NUTM1	256646	genome.wustl.edu	37	15	34649175	34649175	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:34649175C>G	ENST00000333756.4	+	7	3037	c.2882C>G	c.(2881-2883)cCc>cGc	p.P961R	NUTM1_ENST00000537011.1_Missense_Mutation_p.P989R|NUTM1_ENST00000438749.3_Missense_Mutation_p.P979R	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	961						cytoplasm (GO:0005737)|nucleus (GO:0005634)											ACTGGGACTCCCAAAGCAACA	0.488																																																	0								ENSG00000184507						55.0	51.0	53.0					15																	34649175		2201	4298	6499	NUTM1	SO:0001583	missense	0			-	HGNC	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.2882C>G	15.37:g.34649175C>G	ENSP00000329448:p.Pro961Arg	Somatic	0	32	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	34	0.00	0	47	20.34	12	NULL	p.P961R	ENST00000333756.4	37	c.2882	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	C	5.722	0.317659	0.10845	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.08102	3.13;3.13;3.14	5.3	-0.119	0.13543	.	0.463917	0.20520	N	0.090709	T	0.06962	0.0177	L	0.54323	1.7	0.09310	N	1	B;B;B	0.20887	0.029;0.049;0.006	B;B;B	0.19666	0.016;0.026;0.008	T	0.31138	-0.9954	10	0.62326	D	0.03	.	1.4332	0.02338	0.1491:0.4545:0.1449:0.2516	.	979;989;961	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	R	989;979;961	ENSP00000444896:P989R;ENSP00000407031:P979R;ENSP00000329448:P961R	ENSP00000329448:P961R	P	+	2	0	C15orf55	32436467	0.000000	0.05858	0.011000	0.14972	0.008000	0.06430	0.079000	0.14782	0.094000	0.17404	-0.137000	0.14449	CCC	-	NULL		0.488	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NUTM1	protein_coding	OTTHUMT00000418026.1	C	NM_175741	-		34649175	+1	no_errors	ENST00000333756	ensembl	human	known	74_37	missense	SNP	0.002	G
HBD	3045	genome.wustl.edu	37	11	5255646	5255646	+	Silent	SNP	A	A	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:5255646A>C	ENST00000380299.3	-	1	232	c.18T>G	c.(16-18)ccT>ccG	p.P6P	HBD_ENST00000292901.3_Silent_p.P6P	NM_000519.3	NP_000510.1	P02042	HBD_HUMAN	hemoglobin, delta	6					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	16		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCTTCTCCTCAGGAGTCAGAT	0.507																																																	0								ENSG00000223609						180.0	145.0	157.0					11																	5255646		2201	4298	6499	HBD	SO:0001819	synonymous_variant	0			-	HGNC	AY034468	CCDS31376.1	11p15.5	2012-10-02			ENSG00000223609	ENSG00000223609			4829	protein-coding gene	gene with protein product		142000				2649166	Standard	NM_000519		Approved		uc001maf.1	P02042	OTTHUMG00000066674	ENST00000380299.3:c.18T>G	11.37:g.5255646A>C		Somatic	0	108	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	117	8.59	Q3Y5H3|Q8WXT7	Silent	SNP	49	0.00	0	51	22.73	15	pfam_Globin,superfamily_Globin-like,prints_Haemoglobin_b,pfscan_Globin	p.P6	ENST00000380299.3	37	c.18	CCDS31376.1	11																																																																																			-	superfamily_Globin-like,pfscan_Globin		0.507	HBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBD	protein_coding	OTTHUMT00000142970.1	A	NM_000519	-		5255646	-1	no_errors	ENST00000380299	ensembl	human	known	74_37	silent	SNP	0.000	C
ACAN	176	genome.wustl.edu	37	15	89398733	89398733	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:89398733C>T	ENST00000561243.1	+	11	2917	c.2917C>T	c.(2917-2919)Ctc>Ttc	p.L973F	ACAN_ENST00000352105.7_Missense_Mutation_p.L973F|ACAN_ENST00000559004.1_Missense_Mutation_p.L973F|ACAN_ENST00000439576.2_Missense_Mutation_p.L973F			P16112	PGCA_HUMAN	aggrecan	972	29 X 19 AA approximate tandem repeats of E-[IVDG]-[LV]-[EV]-[GTI]-[STA]-[ATV]- [SP]-[GA]-[VIFAD]-[GEDL]-[DE]-[LVI]-[SG]- [GERK]-[LV]-P-S-G.|CS-1.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGTAGGAGACCTCAGTGGGCT	0.557																																																	0								ENSG00000157766						142.0	146.0	145.0					15																	89398733		1842	4088	5930	ACAN	SO:0001583	missense	0			-	HGNC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.2917C>T	15.37:g.89398733C>T	ENSP00000453342:p.Leu973Phe	Somatic	0	71	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	69	14.81	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	34	0.00	0	68	17.86	15	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.L973F	ENST00000561243.1	37	c.2917	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	C	8.690	0.907249	0.17833	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	D;D	0.96685	-4.09;-4.09	4.48	-1.44	0.08856	.	1.458670	0.05162	N	0.497976	D	0.96361	0.8813	M	0.71036	2.16	0.09310	N	1	D;D	0.59357	0.985;0.985	P;P	0.61477	0.889;0.889	D	0.87909	0.2696	10	0.13853	T	0.58	-2.7456	4.1285	0.10138	0.543:0.2503:0.1224:0.0842	.	973;973	E7ENV9;E7EX88	.;.	F	973	ENSP00000387356:L973F;ENSP00000341615:L973F	ENSP00000268134:L973F	L	+	1	0	ACAN	87199737	0.000000	0.05858	0.000000	0.03702	0.088000	0.18126	-1.178000	0.03093	-0.158000	0.11040	-0.311000	0.09066	CTC	-	NULL		0.557	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	protein_coding	OTTHUMT00000416267.2	C	NM_001135	-		89398733	+1	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	SNP	0.000	T
PLCE1	51196	genome.wustl.edu	37	10	96012079	96012079	+	Nonsense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr10:96012079G>T	ENST00000371380.3	+	8	3338	c.3103G>T	c.(3103-3105)Gga>Tga	p.G1035*	PLCE1_ENST00000371385.3_Nonsense_Mutation_p.G727*|PLCE1_ENST00000371375.1_Nonsense_Mutation_p.G727*|PLCE1_ENST00000260766.3_Nonsense_Mutation_p.G1035*			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1035					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				ACAGGAGGATGGACGGTATGA	0.493																																																	0								ENSG00000138193						112.0	112.0	112.0					10																	96012079		2071	4217	6288	PLCE1	SO:0001587	stop_gained	0			-	HGNC		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.3103G>T	10.37:g.96012079G>T	ENSP00000360431:p.Gly1035*	Somatic	0	63	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	43	14.00	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Nonsense_Mutation	SNP	37	0.00	0	37	5.13	2	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.G1035*	ENST00000371380.3	37	c.3103	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	G	47	13.437339	0.99742	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	10.6293	0.45527	0.1425:0.0:0.8575:0.0	.	.	.	.	X	1035;1035;727;727	.	ENSP00000260766:G1035X	G	+	1	0	PLCE1	96002069	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.488000	0.60300	2.850000	0.98022	0.650000	0.86243	GGA	-	NULL		0.493	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	protein_coding	OTTHUMT00000049469.3	G	NM_016341	-		96012079	+1	no_errors	ENST00000260766	ensembl	human	known	74_37	nonsense	SNP	1.000	T
KIAA2026	158358	genome.wustl.edu	37	9	5968024	5968024	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:5968024T>C	ENST00000399933.3	-	3	2206	c.2207A>G	c.(2206-2208)aAa>aGa	p.K736R	KIAA2026_ENST00000381461.2_Missense_Mutation_p.K736R	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	736	Lys-rich.									breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CTTACCAGATTTGTGCTTCTT	0.323																																																	0								ENSG00000183354						18.0	18.0	18.0					9																	5968024		1821	4049	5870	KIAA2026	SO:0001583	missense	0			-	HGNC	AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2207A>G	9.37:g.5968024T>C	ENSP00000382815:p.Lys736Arg	Somatic	0	65	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	30	28.57	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	43	0.00	0	31	52.31	34	superfamily_Bromodomain	p.K736R	ENST00000399933.3	37	c.2207		9	.	.	.	.	.	.	.	.	.	.	T	9.831	1.188522	0.21954	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.89	4.75	0.60458	.	.	.	.	.	T	0.48696	0.1514	N	0.14661	0.345	0.37898	D	0.930955	D	0.55385	0.971	P	0.55749	0.783	T	0.57849	-0.7740	8	0.62326	D	0.03	.	11.764	0.51920	0.0:0.0688:0.0:0.9312	.	736	Q5HYC2	K2026_HUMAN	R	736	.	ENSP00000370870:K736R	K	-	2	0	KIAA2026	5958024	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.919000	0.70005	1.052000	0.40392	0.477000	0.44152	AAA	-	NULL		0.323	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	protein_coding	OTTHUMT00000051652.2	T	NM_001017969	-		5968024	-1	no_errors	ENST00000399933	ensembl	human	novel	74_37	missense	SNP	1.000	C
ZNF451	26036	genome.wustl.edu	37	6	57015685	57015685	+	Intron	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:57015685G>C	ENST00000370706.4	+	11	2996				RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|ZNF451_ENST00000491832.2_Intron|RP11-203B9.4_ENST00000586432.1_RNA|ZNF451_ENST00000357489.3_Intron|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AAAAACAAAAGAAAACTTTTT	0.338																																																	0								ENSG00000226803						79.0	73.0	75.0					6																	57015685		1808	4071	5879	RP11-203B9.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2752+25G>C	6.37:g.57015685G>C		Somatic	0	35	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	19	40.62	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	RNA	SNP	42	0.00	0	60	21.05	16	-	NULL	ENST00000370706.4	37	NULL	CCDS43477.1	6																																																																																			-	-		0.338	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927211	protein_coding	OTTHUMT00000041035.2	G	NM_015555	-		57015685	-1	no_errors	ENST00000586466	ensembl	human	known	74_37	rna	SNP	0.000	C
PTPRU	10076	genome.wustl.edu	37	1	29630536	29630536	+	Silent	SNP	C	C	T	rs137880682		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:29630536C>T	ENST00000345512.3	+	17	2805	c.2676C>T	c.(2674-2676)taC>taT	p.Y892Y	PTPRU_ENST00000415600.2_3'UTR|PTPRU_ENST00000428026.2_Silent_p.Y882Y|PTPRU_ENST00000356870.3_Silent_p.Y882Y|PTPRU_ENST00000460170.2_Silent_p.Y882Y|PTPRU_ENST00000373779.3_Silent_p.Y882Y|PTPRU_ENST00000323874.8_Silent_p.Y882Y	NM_005704.4	NP_005695.3	Q92729	PTPRU_HUMAN	protein tyrosine phosphatase, receptor type, U	892	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|homotypic cell-cell adhesion (GO:0034109)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|organ regeneration (GO:0031100)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|response to glucocorticoid (GO:0051384)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cell-cell junction (GO:0005911)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(26)|ovary(1)|prostate(3)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	79		Colorectal(325;0.000399)|Lung NSC(340;0.00953)|all_lung(284;0.0112)|Breast(348;0.0126)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;6.99e-07)|COAD - Colon adenocarcinoma(152;3.18e-05)|STAD - Stomach adenocarcinoma(196;0.0234)|READ - Rectum adenocarcinoma(331;0.0686)|BRCA - Breast invasive adenocarcinoma(304;0.0871)		CCGAGGGTTACGGCTTCAAGC	0.647																																																	0								ENSG00000060656	C	,,,	2,4404	4.2+/-10.8	0,2,2201	44.0	46.0	45.0		2646,2676,2646,2646	-4.5	0.9	1	dbSNP_134	45	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PTPRU	NM_001195001.1,NM_005704.4,NM_133177.3,NM_133178.3	,,,	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	,,,	882/1434,892/1447,882/1441,882/1437	29630536	2,13004	2203	4300	6503	PTPRU	SO:0001819	synonymous_variant	0			-	HGNC	U71075	CCDS334.1, CCDS335.1, CCDS44098.1, CCDS44098.2, CCDS53290.1	1p35.3	2013-02-11			ENSG00000060656	ENSG00000060656		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9683	protein-coding gene	gene with protein product	"""pi R-PTP-Psi"""	602454				8700514, 9434160	Standard	NM_133178		Approved	PTPRO, hPTP-J, PCP-2, FMI, PTP	uc001bru.3	Q92729	OTTHUMG00000003699	ENST00000345512.3:c.2676C>T	1.37:g.29630536C>T		Somatic	0	36	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	52	24.64	A6H8L1|O00197|P78399|Q59HA4|Q5SYU4|Q5SYU5|Q92735|Q92850	Silent	SNP	26	0.00	0	43	12.24	6	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.Y892	ENST00000345512.3	37	c.2676	CCDS334.1	1																																																																																			-	NULL		0.647	PTPRU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRU	protein_coding	OTTHUMT00000010447.1	C		rs137880682		29630536	+1	no_errors	ENST00000345512	ensembl	human	known	74_37	silent	SNP	0.935	T
DENND4B	9909	genome.wustl.edu	37	1	153907279	153907287	+	In_Frame_Del	DEL	CTGCTGCTG	CTGCTGCTG	-	rs3835302|rs368800700|rs375006474|rs199597671		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	CTGCTGCTG	CTGCTGCTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:153907279_153907287delCTGCTGCTG	ENST00000361217.4	-	18	3140_3148	c.2722_2730delCAGCAGCAG	c.(2722-2730)cagcagcagdel	p.QQQ908del	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	908	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ACACctgctcctgctgctgctgctgctgc	0.636																																																	0								ENSG00000198837																																			DENND4B	SO:0001651	inframe_deletion	0				HGNC	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2722_2730delCAGCAGCAG	1.37:g.153907288_153907296delCTGCTGCTG	ENSP00000354597:p.Gln908_Gln910del	Somatic	NA	NA	NA		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5T4K0	In_Frame_Del	DEL	23	17.86	5	39	11.36	5	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.QQQ908in_frame_del	ENST00000361217.4	37	c.2730_2722	CCDS44228.1	1																																																																																			-	NULL		0.636	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4B	protein_coding	OTTHUMT00000090278.2	CTGCTGCTG	XM_375806			153907287	-1	no_errors	ENST00000361217	ensembl	human	known	74_37	in_frame_del	DEL	0.792:0.815:0.846:0.964:0.974:0.990:0.990:0.986:0.989	-
RS1	6247	genome.wustl.edu	37	X	18660178	18660178	+	Silent	SNP	G	G	A	rs281865360		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:18660178G>A	ENST00000379984.3	-	6	661	c.621C>T	c.(619-621)caC>caT	p.H207H	CDKL5_ENST00000379996.3_Intron|RS1_ENST00000476595.1_5'UTR|CDKL5_ENST00000379989.3_Intron	NM_000330.3	NP_000321.1	O15537	XLRS1_HUMAN	retinoschisin 1	207	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.		H -> Q (in XLRS1).		adaptation of rhodopsin mediated signaling (GO:0016062)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|retina layer formation (GO:0010842)|visual perception (GO:0007601)	extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(4)|large_intestine(5)|lung(2)|ovary(2)|skin(1)	15	Hepatocellular(33;0.183)					CAATGCGGACGTGCCAGCCCA	0.652																																																	0			GRCh37	CM981771	RS1	M		ENSG00000102104						62.0	56.0	58.0					X																	18660178		2203	4300	6503	RS1	SO:0001819	synonymous_variant	0			-	HGNC	AF014459	CCDS14187.1	Xp22.2-p22.1	2014-09-17	2008-07-29		ENSG00000102104	ENSG00000102104			10457	protein-coding gene	gene with protein product		300839	"""retinoschisis (X-linked, juvenile) 1"""	RS		9326935, 17804407	Standard	NM_000330		Approved	XLRS1	uc004cyo.3	O15537	OTTHUMG00000021216	ENST00000379984.3:c.621C>T	X.37:g.18660178G>A		Somatic	0	69	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	126	23.64	Q0QD39	Silent	SNP	28	0.00	0	37	19.57	9	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.H207	ENST00000379984.3	37	c.621	CCDS14187.1	X																																																																																			-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.652	RS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RS1	protein_coding	OTTHUMT00000055949.1	G		-		18660178	-1	no_errors	ENST00000379984	ensembl	human	known	74_37	silent	SNP	0.995	A
PLCB2	5330	genome.wustl.edu	37	15	40591138	40591138	+	Silent	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:40591138C>T	ENST00000260402.3	-	9	960	c.711G>A	c.(709-711)acG>acA	p.T237T	PLCB2_ENST00000456256.2_Silent_p.T237T|PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000557821.1_Silent_p.T237T	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	237					activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GGTGCTCCTTCGTCATGTAGG	0.577																																																	0								ENSG00000137841						94.0	98.0	97.0					15																	40591138		2031	4182	6213	PLCB2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.711G>A	15.37:g.40591138C>T		Somatic	0	71	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	130	10.96	A8K6J2|B9EGH5	Silent	SNP	37	0.00	0	55	15.38	10	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLC-beta_C,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.T237	ENST00000260402.3	37	c.711	CCDS42020.1	15																																																																																			-	pirsf_PLC-beta,pfam_PLipase_C_EF-hand-like		0.577	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCB2	protein_coding	OTTHUMT00000418430.1	C		-		40591138	-1	no_errors	ENST00000260402	ensembl	human	known	74_37	silent	SNP	0.989	T
ANKFN1	162282	genome.wustl.edu	37	17	54554883	54554883	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:54554883G>A	ENST00000318698.2	+	15	1852	c.1817G>A	c.(1816-1818)cGt>cAt	p.R606H	ANKFN1_ENST00000566473.2_Missense_Mutation_p.R606H	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	606										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						AGTCATCAGCGTCTCTTTCCT	0.378																																																	0								ENSG00000153930						112.0	104.0	107.0					17																	54554883		2203	4300	6503	ANKFN1	SO:0001583	missense	0			-	HGNC	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1817G>A	17.37:g.54554883G>A	ENSP00000321627:p.Arg606His	Somatic	0	36	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	11	56.00		Missense_Mutation	SNP	23	0.00	0	20	51.22	21	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Fibronectin_type3,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3	p.R606H	ENST00000318698.2	37	c.1817	CCDS32686.1	17	.	.	.	.	.	.	.	.	.	.	G	19.54	3.847275	0.71603	.	.	ENSG00000153930	ENST00000318698	T	0.25579	1.79	5.82	5.82	0.92795	.	0.101764	0.64402	D	0.000003	T	0.37210	0.0995	L	0.61218	1.895	0.50313	D	0.999862	D	0.61697	0.99	P	0.46299	0.511	T	0.16928	-1.0386	10	0.62326	D	0.03	-9.4834	20.1012	0.97876	0.0:0.0:1.0:0.0	.	606	Q8N957	ANKF1_HUMAN	H	606	ENSP00000321627:R606H	ENSP00000321627:R606H	R	+	2	0	ANKFN1	51909882	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.779000	0.62375	2.754000	0.94517	0.650000	0.86243	CGT	-	NULL		0.378	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKFN1	protein_coding	OTTHUMT00000338043.1	G	NM_153228	-		54554883	+1	no_errors	ENST00000318698	ensembl	human	known	74_37	missense	SNP	1.000	A
CTC-305H11.1	0	genome.wustl.edu	37	5	13174884	13174884	+	lincRNA	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:13174884G>A	ENST00000513283.1	+	0	0				AC016553.1_ENST00000410785.1_RNA																							GTTATAttaggttggtacaaa	0.259																																																	0								ENSG00000222717																																			AC016553.1			0			-	Clone_based_ensembl_gene																													5.37:g.13174884G>A		Somatic	0	66	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53		RNA	SNP	46	0.00	0	41	24.07	13	-	NULL	ENST00000513283.1	37	NULL		5																																																																																			-	-		0.259	CTC-305H11.1-001	KNOWN	basic	lincRNA	ENSG00000222717	lincRNA	OTTHUMT00000367808.1	G		-		13174884	-1	no_errors	ENST00000410785	ensembl	human	novel	74_37	rna	SNP	0.001	A
DOPEY2	9980	genome.wustl.edu	37	21	37617593	37617593	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr21:37617593C>G	ENST00000399151.3	+	19	3400	c.3315C>G	c.(3313-3315)gaC>gaG	p.D1105E		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	1105					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCGCCCCGGACAGCAGCGAGC	0.642																																																	0								ENSG00000142197						120.0	88.0	99.0					21																	37617593		2203	4300	6503	DOPEY2	SO:0001583	missense	0			-	HGNC	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.3315C>G	21.37:g.37617593C>G	ENSP00000382104:p.Asp1105Glu	Somatic	0	10	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	33	31.25	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	28	0.00	0	29	40.82	20	pfam_Dopey_N	p.D1105E	ENST00000399151.3	37	c.3315	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	C	4.325	0.059765	0.08339	.	.	ENSG00000142197	ENST00000399151	T	0.26373	1.74	5.36	2.41	0.29592	.	0.520028	0.20825	N	0.084988	T	0.20210	0.0486	L	0.49350	1.555	0.32917	D	0.515257	B;B	0.13594	0.008;0.004	B;B	0.15870	0.014;0.006	T	0.14615	-1.0466	10	0.27785	T	0.31	.	6.9775	0.24683	0.0:0.5937:0.1332:0.273	.	1105;1105	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	E	1105	ENSP00000382104:D1105E	ENSP00000382104:D1105E	D	+	3	2	DOPEY2	36539463	0.320000	0.24616	0.971000	0.41717	0.292000	0.27327	-0.651000	0.05372	0.685000	0.31468	0.650000	0.86243	GAC	-	NULL		0.642	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	protein_coding	OTTHUMT00000194636.1	C	NM_005128	-		37617593	+1	no_errors	ENST00000399151	ensembl	human	known	74_37	missense	SNP	0.987	G
SREBF2	6721	genome.wustl.edu	37	22	42276779	42276779	+	Silent	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr22:42276779A>G	ENST00000361204.4	+	10	1987	c.1821A>G	c.(1819-1821)gcA>gcG	p.A607A		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	607					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						TGGGCCGGGCACTGCCCACCT	0.587																																																	0								ENSG00000198911						49.0	53.0	52.0					22																	42276779		2203	4300	6503	SREBF2	SO:0001819	synonymous_variant	0			-	HGNC	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1821A>G	22.37:g.42276779A>G		Somatic	0	46	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	56	25.33	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	28	0.00	0	23	38.46	15	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.T641A	ENST00000361204.4	37	c.1921	CCDS14023.1	22	.	.	.	.	.	.	.	.	.	.	A	10.23	1.294067	0.23564	.	.	ENSG00000198911	ENST00000444813	.	.	.	4.95	-9.89	0.00464	.	.	.	.	.	T	0.41880	0.1178	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47947	-0.9077	4	.	.	.	-7.2948	4.9726	0.14123	0.3077:0.1776:0.427:0.0877	.	.	.	.	A	641	.	.	T	+	1	0	SREBF2	40606725	0.000000	0.05858	0.530000	0.27963	0.845000	0.48019	-3.534000	0.00439	-2.328000	0.00635	-0.436000	0.05848	ACT	-	NULL		0.587	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SREBF2	protein_coding	OTTHUMT00000321956.1	A	NM_004599	-		42276779	+1	no_errors	ENST00000424354	ensembl	human	known	74_37	missense	SNP	0.045	G
METTL16	79066	genome.wustl.edu	37	17	2310396	2310396	+	Nonsense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:2310396G>A	ENST00000609667.1	-	3	455	c.376C>T	c.(376-378)Cag>Tag	p.Q126*																								GAGCTCTTCTGAGAAACCAGA	0.557																																																	0								ENSG00000205821						59.0	63.0	62.0					17																	2310396		1926	4131	6057	AC006435.1	SO:0001587	stop_gained	0			-	Clone_based_ensembl_gene																												ENST00000609667.1:c.376C>T	17.37:g.2310396G>A	ENSP00000476359:p.Gln126*	Somatic	0	49	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76		Nonsense_Mutation	SNP	30	0.00	0	40	13.04	6	NULL	p.Q126*	ENST00000609667.1	37	c.376		17	.	.	.	.	.	.	.	.	.	.	G	12.44	1.938292	0.34189	.	.	ENSG00000205821	ENST00000381977	.	.	.	4.31	-0.349	0.12609	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	3.3053	0.06997	0.3856:0.2091:0.4054:0.0	.	.	.	.	X	126	.	ENSP00000371404:Q126X	Q	-	1	0	AC006435.1	2257146	1.000000	0.71417	0.987000	0.45799	0.349000	0.29174	0.949000	0.29109	0.096000	0.17463	-0.373000	0.07131	CAG	-	NULL		0.557	AC006435.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000205821	protein_coding		G		-		2310396	-1	no_errors	ENST00000609667	ensembl	human	known	74_37	nonsense	SNP	0.982	A
AMZ1	155185	genome.wustl.edu	37	7	2748796	2748796	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr7:2748796C>T	ENST00000312371.4	+	5	1057	c.689C>T	c.(688-690)gCa>gTa	p.A230V	AMZ1_ENST00000407112.1_Intron|AMZ1_ENST00000489665.1_Intron	NM_133463.1	NP_597720.1	Q400G9	AMZ1_HUMAN	archaelysin family metallopeptidase 1	230							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	16		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;5.03e-14)		GTAGAGGCAGCAGCAGACGGC	0.682																																																	0								ENSG00000174945						15.0	19.0	17.0					7																	2748796		2200	4296	6496	AMZ1	SO:0001583	missense	0			-	HGNC	AB075830	CCDS34589.1, CCDS64582.1	7p22.3	2008-01-17			ENSG00000174945	ENSG00000174945			22231	protein-coding gene	gene with protein product	"""archaemetzincin-1"""	615168				15972818	Standard	NM_133463		Approved	KIAA1950	uc003smr.1	Q400G9	OTTHUMG00000152111	ENST00000312371.4:c.689C>T	7.37:g.2748796C>T	ENSP00000308149:p.Ala230Val	Somatic	0	15	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00	B3KRS0|Q8TF51	Missense_Mutation	SNP	26	0.00	0	29	17.14	6	pfam_Pept_M54_archaemetzincn	p.A230V	ENST00000312371.4	37	c.689	CCDS34589.1	7	.	.	.	.	.	.	.	.	.	.	C	11.45	1.641105	0.29157	.	.	ENSG00000174945	ENST00000312371	T	0.24350	1.86	4.49	1.61	0.23674	.	0.194108	0.25578	N	0.029715	T	0.14056	0.0340	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.20042	-1.0287	10	0.27082	T	0.32	-10.2357	3.8725	0.09042	0.1163:0.5381:0.1983:0.1473	.	230	Q400G9	AMZ1_HUMAN	V	230	ENSP00000308149:A230V	ENSP00000308149:A230V	A	+	2	0	AMZ1	2715322	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.067000	0.14510	0.088000	0.17205	-0.448000	0.05591	GCA	-	NULL		0.682	AMZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ1	protein_coding	OTTHUMT00000325244.1	C	NM_133463	-		2748796	+1	no_errors	ENST00000312371	ensembl	human	known	74_37	missense	SNP	0.000	T
ZNF273	10793	genome.wustl.edu	37	7	64388928	64388928	+	Frame_Shift_Del	DEL	G	G	-			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr7:64388928delG	ENST00000476120.1	+	4	1293	c.1222delG	c.(1222-1224)ggtfs	p.G408fs	ZNF273_ENST00000527278.1_3'UTR|ZNF273_ENST00000319636.5_Frame_Shift_Del_p.G343fs	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	408					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				TGAAGAATGTGGTAAAGCCTT	0.358																																					Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												0								ENSG00000198039						45.0	49.0	47.0					7																	64388928		2203	4297	6500	ZNF273	SO:0001589	frameshift_variant	0				HGNC	X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.1222delG	7.37:g.64388928delG	ENSP00000418719:p.Gly408fs	Somatic	0	73	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	15	11.76	B3KQZ5|Q6P3V4	Frame_Shift_Del	DEL	39	0.00	0	86	0.00	0	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G408fs	ENST00000476120.1	37	c.1222	CCDS5528.2	7																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.358	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF273	protein_coding	OTTHUMT00000313502.1	G				64388928	+1	no_errors	ENST00000476120	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
ATG2A	23130	genome.wustl.edu	37	11	64678645	64678645	+	Missense_Mutation	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:64678645G>C	ENST00000377264.3	-	10	1443	c.1331C>G	c.(1330-1332)cCa>cGa	p.P444R	ATG2A_ENST00000421419.2_Missense_Mutation_p.P444R	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	444					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						TCCGGAAGATGGGGCAGACGT	0.602																																																	0								ENSG00000110046						124.0	114.0	117.0					11																	64678645		2201	4297	6498	ATG2A	SO:0001583	missense	0			-	HGNC		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.1331C>G	11.37:g.64678645G>C	ENSP00000366475:p.Pro444Arg	Somatic	0	32	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	34	33.33	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	39	0.00	0	24	35.14	13	pfam_Autophagy-rel_C	p.P444R	ENST00000377264.3	37	c.1331	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	G	17.13	3.310179	0.60414	.	.	ENSG00000110046	ENST00000421419;ENST00000377264	T;T	0.07800	3.16;3.16	4.69	3.78	0.43462	.	0.190463	0.45361	D	0.000367	T	0.08980	0.0222	L	0.61218	1.895	0.44254	D	0.997104	P	0.44877	0.845	B	0.39379	0.298	T	0.09357	-1.0678	10	0.44086	T	0.13	.	5.8198	0.18520	0.0975:0.0:0.711:0.1915	.	444	Q2TAZ0	ATG2A_HUMAN	R	444	ENSP00000410522:P444R;ENSP00000366475:P444R	ENSP00000366475:P444R	P	-	2	0	ATG2A	64435221	0.967000	0.33354	0.846000	0.33378	0.951000	0.60555	1.639000	0.37176	1.345000	0.45676	0.462000	0.41574	CCA	-	NULL		0.602	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	protein_coding	OTTHUMT00000143224.1	G	NM_015104	-		64678645	-1	no_errors	ENST00000421419	ensembl	human	known	74_37	missense	SNP	0.971	C
NPTN	27020	genome.wustl.edu	37	15	73879883	73879883	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:73879883C>T	ENST00000345330.4	-	4	885	c.688G>A	c.(688-690)Gcc>Acc	p.A230T	NPTN_ENST00000545878.1_Missense_Mutation_p.A230T|NPTN_ENST00000351217.6_Missense_Mutation_p.A114T|NPTN_ENST00000542234.1_Intron|NPTN_ENST00000562924.1_Missense_Mutation_p.A114T|NPTN_ENST00000563691.1_Missense_Mutation_p.A230T|NPTN_ENST00000564551.1_5'UTR|NPTN_ENST00000287226.8_Missense_Mutation_p.A230T	NM_001161363.1|NM_012428.3	NP_001154835.1|NP_036560.1	Q9Y639	NPTN_HUMAN	neuroplastin	230	Ig-like 2.				homophilic cell adhesion (GO:0007156)|long-term synaptic potentiation (GO:0060291)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)	cell adhesion molecule binding (GO:0050839)|type 1 fibroblast growth factor receptor binding (GO:0005105)	p.A230T(2)		breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	13						TCAATGGTGGCGTTTGCTTTA	0.498																																					Pancreas(101;1519 1568 9459 19537 41286)|Esophageal Squamous(143;1278 1787 35254 36835 44843)												2	Substitution - Missense(2)	upper_aerodigestive_tract(1)|prostate(1)						ENSG00000156642						131.0	120.0	124.0					15																	73879883		2198	4297	6495	NPTN	SO:0001583	missense	0			-	HGNC	AF035287	CCDS10249.1, CCDS10250.1, CCDS58379.1, CCDS58380.1	15q24.1	2013-01-29	2006-02-22	2006-02-22	ENSG00000156642	ENSG00000156642		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17867	protein-coding gene	gene with protein product		612820	"""stromal cell derived factor receptor 1"""	SDFR1		8619474, 9110174	Standard	NM_012428		Approved	SDR1, GP55, GP65, np65, np55	uc002avs.3	Q9Y639	OTTHUMG00000137586	ENST00000345330.4:c.688G>A	15.37:g.73879883C>T	ENSP00000290401:p.Ala230Thr	Somatic	0	42	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	75	16.67	B2RAL7|B7Z4D3|B7ZLL2|Q17R52|Q59EJ9|Q6NVX7|Q9Y640	Missense_Mutation	SNP	31	0.00	0	50	9.09	5	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_MFS_dom_general_subst_transpt,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A230T	ENST00000345330.4	37	c.688	CCDS10249.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.441587	0.96187	.	.	ENSG00000156642	ENST00000345330;ENST00000351217;ENST00000545878;ENST00000287226	T;T;T;T	0.37752	1.18;2.91;2.8;2.91	5.59	5.59	0.84812	Immunoglobulin subtype (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.64929	0.2643	M	0.81942	2.565	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.77004	0.954;0.989;0.973;0.981	T	0.67975	-0.5531	10	0.66056	D	0.02	.	19.5805	0.95465	0.0:1.0:0.0:0.0	.	230;114;230;114	Q9Y639-5;B2RAL7;Q9Y639;Q9Y639-3	.;.;NPTN_HUMAN;.	T	230;114;230;230	ENSP00000290401:A230T;ENSP00000342958:A114T;ENSP00000444548:A230T;ENSP00000287226:A230T	ENSP00000287226:A230T	A	-	1	0	NPTN	71666936	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	2.627000	0.46469	2.616000	0.88540	0.563000	0.77884	GCC	-	smart_Ig_sub,pfscan_Ig-like_dom		0.498	NPTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPTN	protein_coding	OTTHUMT00000268980.1	C	NM_012428	-		73879883	-1	no_errors	ENST00000345330	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC9A8	23315	genome.wustl.edu	37	20	48467301	48467301	+	Intron	DEL	T	T	-	rs564652819		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr20:48467301delT	ENST00000361573.2	+	7	576				SLC9A8_ENST00000417961.1_Frame_Shift_Del_p.G179fs|SLC9A8_ENST00000539601.1_Intron|SLC9A8_ENST00000541138.1_Intron			Q9Y2E8	SL9A8_HUMAN	solute carrier family 9, subfamily A (NHE8, cation proton antiporter 8), member 8						ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	potassium:proton antiporter activity (GO:0015386)|sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	30			BRCA - Breast invasive adenocarcinoma(9;3.91e-07)			TTCTCCAGGGTTTTTTTTTTG	0.333																																																	0								ENSG00000197818			105,169,3990		0,0,105,2,165,1860	46.0	46.0	46.0			3.5	0.9	20		47	200,298,7756		0,0,200,6,286,3635	no	intron	SLC9A8	NM_015266.1		0,0,305,8,451,5495	A1A1,A1A2,A1R,A2A2,A2R,RR		6.0334,6.4259,6.1671			48467301	305,467,11746	2203	4300	6503	SLC9A8	SO:0001627	intron_variant	0				HGNC	AB023156	CCDS13421.1, CCDS58774.1	20q13.13	2013-05-22	2012-03-22		ENSG00000197818	ENSG00000197818		"""Solute carriers"""	20728	protein-coding gene	gene with protein product		612730	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 8"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 8"""			12409279	Standard	NM_001260491		Approved	KIAA0939, NHE8	uc002xuv.2	Q9Y2E8	OTTHUMG00000032710	ENST00000361573.2:c.535-46T>-	20.37:g.48467301delT		Somatic	0	14	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	B4DTQ8|Q2M1U9|Q68CZ8|Q9BX15|Q9Y507	Frame_Shift_Del	DEL	51	0.00	0	90	1.10	1	pfam_Cation/H_exchanger,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.F182fs	ENST00000361573.2	37	c.537	CCDS13421.1	20																																																																																			-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger		0.333	SLC9A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A8	protein_coding	OTTHUMT00000106483.3	T	XM_030524			48467301	+1	no_errors	ENST00000417961	ensembl	human	known	74_37	frame_shift_del	DEL	0.189	-
PKP2	5318	genome.wustl.edu	37	12	32975533	32975533	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr12:32975533G>T	ENST00000070846.6	-	9	1863	c.1839C>A	c.(1837-1839)aaC>aaA	p.N613K	PKP2_ENST00000340811.4_Missense_Mutation_p.N569K	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	613					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					GGTAGGAGAGGTTATGAAGAA	0.408																																																	0			GRCh37	CM085058	PKP2	M		ENSG00000057294						95.0	93.0	94.0					12																	32975533		2203	4300	6503	PKP2	SO:0001583	missense	0			-	HGNC	X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1839C>A	12.37:g.32975533G>T	ENSP00000070846:p.Asn613Lys	Somatic	0	37	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	53	11.67	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	39	0.00	0	57	16.18	11	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.N613K	ENST00000070846.6	37	c.1839	CCDS8731.1	12	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637682	0.67130	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	D;D	0.84944	-1.92;-1.92	5.05	3.2	0.36748	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.90511	0.7027	M	0.81497	2.545	0.54753	D	0.999987	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.995;0.989;0.983	D	0.89744	0.3935	10	0.87932	D	0	-7.0754	7.1379	0.25539	0.3194:0.0:0.6806:0.0	.	569;569;613	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	K	569;613;613	ENSP00000342800:N569K;ENSP00000070846:N613K	ENSP00000070846:N613K	N	-	3	2	PKP2	32866800	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.824000	0.48088	1.114000	0.41781	0.563000	0.77884	AAC	-	superfamily_ARM-type_fold,smart_Armadillo		0.408	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	protein_coding	OTTHUMT00000404449.1	G	NM_004572	-		32975533	-1	no_errors	ENST00000070846	ensembl	human	known	74_37	missense	SNP	1.000	T
CDH18	1016	genome.wustl.edu	37	5	19838992	19838992	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:19838992C>A	ENST00000507958.1	-	5	1094	c.104G>T	c.(103-105)aGa>aTa	p.R35I	CDH18_ENST00000502796.1_Missense_Mutation_p.R35I|CDH18_ENST00000382275.1_Missense_Mutation_p.R35I|CDH18_ENST00000274170.4_Missense_Mutation_p.R35I|CDH18_ENST00000506372.1_Missense_Mutation_p.R35I|CDH18_ENST00000511273.1_Missense_Mutation_p.R35I			Q13634	CAD18_HUMAN	cadherin 18, type 2	35					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GGTTTGGTTTCTCATCACCTT	0.433																																																	0								ENSG00000145526						231.0	190.0	204.0					5																	19838992		2203	4300	6503	CDH18	SO:0001583	missense	0			-	HGNC	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.104G>T	5.37:g.19838992C>A	ENSP00000425093:p.Arg35Ile	Somatic	0	143	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	177	9.23	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	35	0.00	0	42	12.50	6	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R35I	ENST00000507958.1	37	c.104	CCDS3889.1	5	.	.	.	.	.	.	.	.	.	.	C	14.48	2.548075	0.45383	.	.	ENSG00000145526	ENST00000382275;ENST00000507958;ENST00000542864;ENST00000274170;ENST00000506372;ENST00000502796;ENST00000511273	T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39	5.93	4.16	0.48862	.	0.525108	0.21879	N	0.067763	T	0.19846	0.0477	N	0.08118	0	0.49915	D	0.999833	B;B	0.28512	0.214;0.012	B;B	0.31812	0.136;0.01	T	0.05599	-1.0875	9	.	.	.	.	11.2906	0.49247	0.0:0.8525:0.0:0.1475	.	35;35	B4DHG6;Q13634	.;CAD18_HUMAN	I	35	ENSP00000371710:R35I;ENSP00000425093:R35I;ENSP00000274170:R35I;ENSP00000424931:R35I;ENSP00000422138:R35I;ENSP00000425854:R35I	.	R	-	2	0	CDH18	19874749	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	2.350000	0.44063	0.844000	0.35094	0.655000	0.94253	AGA	-	NULL		0.433	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDH18	protein_coding	OTTHUMT00000366747.1	C	NM_004934	-		19838992	-1	no_errors	ENST00000274170	ensembl	human	known	74_37	missense	SNP	1.000	A
DCHS2	54798	genome.wustl.edu	37	4	155160445	155160445	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr4:155160445G>A	ENST00000357232.4	-	24	6003	c.6004C>T	c.(6004-6006)Cct>Tct	p.P2002S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2002	Cadherin 18. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATTGATTCAGGAACTGTGACC	0.403																																																	0								ENSG00000197410						66.0	63.0	64.0					4																	155160445		2203	4300	6503	DCHS2	SO:0001583	missense	0			-	HGNC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.6004C>T	4.37:g.155160445G>A	ENSP00000349768:p.Pro2002Ser	Somatic	0	46	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	29	21.62	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	43	0.00	0	21	40.00	14	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P2002S	ENST00000357232.4	37	c.6004	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	G	11.35	1.614114	0.28712	.	.	ENSG00000197410	ENST00000357232	T	0.52983	0.64	5.95	4.13	0.48395	Cadherin (3);Cadherin-like (1);	0.161498	0.43110	N	0.000617	T	0.34745	0.0908	L	0.33710	1.025	0.80722	D	1	B	0.27166	0.17	B	0.26310	0.068	T	0.12760	-1.0535	10	0.30078	T	0.28	.	10.3418	0.43882	0.1577:0.0:0.8423:0.0	.	2002	Q6V1P9	PCD23_HUMAN	S	2002	ENSP00000349768:P2002S	ENSP00000349768:P2002S	P	-	1	0	DCHS2	155379895	0.996000	0.38824	0.954000	0.39281	0.938000	0.57974	1.442000	0.35046	1.403000	0.46800	0.650000	0.86243	CCT	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.403	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	protein_coding	OTTHUMT00000365281.2	G	NM_001142552	-		155160445	-1	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	SNP	1.000	A
ARHGEF15	22899	genome.wustl.edu	37	17	8218893	8218893	+	Splice_Site	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:8218893G>T	ENST00000361926.3	+	7	1531		c.e7+1		ARHGEF15_ENST00000421050.1_Splice_Site|AC135178.7_ENST00000458568.1_RNA	NM_173728.3	NP_776089.2	O94989	ARHGF_HUMAN	Rho guanine nucleotide exchange factor (GEF) 15						negative regulation of synapse maturation (GO:2000297)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|regulation of catalytic activity (GO:0050790)|retina vasculature morphogenesis in camera-type eye (GO:0061299)	cytoplasm (GO:0005737)|dendrite (GO:0030425)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(9)|large_intestine(5)|lung(11)|ovary(5)|prostate(3)|skin(2)|urinary_tract(1)	37						TCAGCGAGCGGTCAGTGGCTT	0.627																																																	0								ENSG00000198844						69.0	56.0	60.0					17																	8218893		2203	4300	6503	ARHGEF15	SO:0001630	splice_region_variant	0			-	HGNC	AB020722	CCDS11139.1	17p13.1	2011-11-16			ENSG00000198844	ENSG00000198844		"""Rho guanine nucleotide exchange factors"""	15590	protein-coding gene	gene with protein product	"""Rho guanine exchange factor (GEF) 15"""	608504				10048485	Standard	NM_173728		Approved	KIAA0915, Vsm-RhoGEF, ARGEF15, FLJ13791, MGC44868	uc002glc.3	O94989	OTTHUMG00000108187	ENST00000361926.3:c.1421+1G>T	17.37:g.8218893G>T		Somatic	0	34	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	43	20.37	A8K6G1|Q8N449|Q9H8B4	Splice_Site	SNP	27	0.00	0	36	26.53	13	-	e6+1	ENST00000361926.3	37	c.1421+1	CCDS11139.1	17	.	.	.	.	.	.	.	.	.	.	G	18.44	3.623867	0.66901	.	.	ENSG00000198844	ENST00000361926;ENST00000455564;ENST00000421050	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9743	0.64262	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGEF15	8159618	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	7.579000	0.82511	2.686000	0.91538	0.561000	0.74099	.	-	-		0.627	ARHGEF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF15	protein_coding	OTTHUMT00000226993.2	G	NM_173728	-	Intron	8218893	+1	no_errors	ENST00000361926	ensembl	human	known	74_37	splice_site	SNP	1.000	T
SLC25A19	60386	genome.wustl.edu	37	17	73269841	73269842	+	Intron	INS	-	-	TTATT	rs3082641|rs35986946|rs55758835	byFrequency	TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:73269841_73269842insTTATT	ENST00000402418.3	-	6	1684				MIF4GD_ENST00000577542.1_5'Flank|MIF4GD_ENST00000245551.5_5'Flank|MIF4GD_ENST00000579297.1_5'Flank|SLC25A19_ENST00000580994.1_Intron|MIF4GD_ENST00000578305.1_5'Flank|RP11-649A18.12_ENST00000582668.1_RNA|SLC25A19_ENST00000375261.4_Intron|SLC25A19_ENST00000442286.2_Intron|RP11-649A18.12_ENST00000585075.1_RNA|MIF4GD_ENST00000325102.8_5'Flank|SLC25A19_ENST00000416858.2_Intron|SLC25A19_ENST00000320362.3_Intron|MIF4GD_ENST00000580571.1_5'Flank			Q9HC21	TPC_HUMAN	solute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19						deoxynucleotide transport (GO:0030302)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	deoxynucleotide transmembrane transporter activity (GO:0030233)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_cancers(13;5.98e-08)|all_epithelial(9;1.16e-08)|Breast(9;3.1e-08)		all cancers(21;6.82e-07)|Epithelial(20;6.86e-06)			AAAATAGCAAAttattttattt	0.465														4192	0.837061	0.7103	0.879	5008	,	,		24978	0.9256		0.7992	False		,,,				2504	0.9264																0								ENSG00000263843																																			RP11-649A18.12	SO:0001627	intron_variant	0				Clone_based_vega_gene		CCDS11720.1	17q25.1	2013-05-22	2007-03-08		ENSG00000125454	ENSG00000125454		"""Solute carriers"""	14409	protein-coding gene	gene with protein product		606521	"""solute carrier family 25 (mitochondrial deoxynucleotide carrier), member 19"", ""microcephaly, Amish"""	MCPHA		11474176, 11226231, 19798730	Standard	NM_021734		Approved	DNC, MUP1, TPC	uc002jnw.4	Q9HC21		ENST00000402418.3:c.775-121->AATAA	17.37:g.73269847_73269851dupTTATT		Somatic	NA	NA	NA		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	E9PF74|Q6V9R7	RNA	INS	31	26.19	11	29	51.67	31	-	NULL	ENST00000402418.3	37	NULL	CCDS11720.1	17																																																																																			-	-		0.465	SLC25A19-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100287042	protein_coding	OTTHUMT00000447282.1	-	NM_021734			73269842	+1	no_errors	ENST00000585075	ensembl	human	known	74_37	rna	INS	0.003:0.004	TTATT
FOLH1B	219595	genome.wustl.edu	37	11	89405054	89405054	+	RNA	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:89405054G>T	ENST00000532352.1	+	0	994							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						ATGCTTTCTAGACAGATATGT	0.413																																																	0								ENSG00000134612						86.0	85.0	85.0					11																	89405054		2201	4296	6497	FOLH1B			0			-	HGNC	AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89405054G>T		Somatic	0	52	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	48	9.43		Splice_Site	SNP	41	0.00	0	58	4.92	3	-	NULL	ENST00000532352.1	37	c.NULL		11																																																																																			-	-		0.413	FOLH1B-004	KNOWN	basic	processed_transcript	FOLH1B	pseudogene	OTTHUMT00000395421.1	G	NM_153696	-		89405054	+1	no_errors	ENST00000525540	ensembl	human	known	74_37	splice_site	SNP	1.000	T
WNK3	65267	genome.wustl.edu	37	X	54264792	54264792	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:54264792G>T	ENST00000375159.2	-	18	3996	c.3997C>A	c.(3997-3999)Cag>Aag	p.Q1333K	WNK3_ENST00000354646.2_Missense_Mutation_p.Q1333K|WNK3_ENST00000375169.3_Missense_Mutation_p.Q1286K			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1333					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CGACCCCGCTGAAATGATCCA	0.443																																																	0								ENSG00000196632						104.0	89.0	95.0					X																	54264792		2203	4300	6503	WNK3	SO:0001583	missense	0			-	HGNC	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.3997C>A	X.37:g.54264792G>T	ENSP00000364301:p.Gln1333Lys	Somatic	0	60	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	91	13.33	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	38	0.00	0	64	15.79	12	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q1333K	ENST00000375159.2	37	c.3997	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	G	5.519	0.280619	0.10458	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.70164	-0.45;-0.46;-0.46	5.17	5.17	0.71159	.	0.000000	0.53938	D	0.000056	T	0.46600	0.1401	N	0.19112	0.55	0.26287	N	0.978182	B;B	0.29136	0.234;0.057	B;B	0.30782	0.12;0.027	T	0.34950	-0.9808	10	0.02654	T	1	-6.2791	11.6912	0.51516	0.0:0.0:0.8229:0.1771	.	1286;1333	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	K	1286;1333;1333	ENSP00000364312:Q1286K;ENSP00000346667:Q1333K;ENSP00000364301:Q1333K	ENSP00000346667:Q1333K	Q	-	1	0	WNK3	54281517	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.358000	0.52284	2.144000	0.66660	0.600000	0.82982	CAG	-	NULL		0.443	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	protein_coding	OTTHUMT00000056799.2	G	NM_020922	-		54264792	-1	no_errors	ENST00000354646	ensembl	human	known	74_37	missense	SNP	1.000	T
GCM2	9247	genome.wustl.edu	37	6	10877424	10877424	+	Missense_Mutation	SNP	G	G	A	rs536827295		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:10877424G>A	ENST00000379491.4	-	2	439	c.292C>T	c.(292-294)Cgc>Tgc	p.R98C	SYCP2L_ENST00000543878.1_Intron|RP11-637O19.3_ENST00000480294.1_Intron	NM_004752.3	NP_004743.1	O75603	GCM2_HUMAN	glial cells missing homolog 2 (Drosophila)	98					cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)|cellular phosphate ion homeostasis (GO:0030643)|cellular response to organic substance (GO:0071310)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|parathyroid gland development (GO:0060017)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	30	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				AGCTGCAGGCGGGAACCGTCG	0.607																																																	0								ENSG00000124827						76.0	71.0	73.0					6																	10877424		2203	4300	6503	GCM2	SO:0001583	missense	0			-	HGNC	AF079550	CCDS4517.1	6p24.2	2008-08-29	2001-11-28	2002-09-27	ENSG00000124827	ENSG00000124827			4198	protein-coding gene	gene with protein product		603716	"""glial cells missing (Drosophila) homolog b"""	GCMB		9928992	Standard	NM_004752		Approved	hGCMb	uc003mzn.4	O75603	OTTHUMG00000014249	ENST00000379491.4:c.292C>T	6.37:g.10877424G>A	ENSP00000368805:p.Arg98Cys	Somatic	0	36	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	88	12.87	D3GDV6|Q5THN5	Missense_Mutation	SNP	33	0.00	0	40	23.08	12	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.R98C	ENST00000379491.4	37	c.292	CCDS4517.1	6	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434355	0.62955	.	.	ENSG00000124827	ENST00000379491	T	0.74632	-0.86	5.69	1.33	0.21861	.	0.360015	0.31963	N	0.006784	T	0.43942	0.1270	L	0.48642	1.525	0.58432	D	0.999998	B	0.30236	0.274	B	0.23275	0.045	T	0.44937	-0.9295	10	0.87932	D	0	-5.0006	3.9707	0.09452	0.0845:0.1031:0.2908:0.5215	.	98	O75603	GCM2_HUMAN	C	98	ENSP00000368805:R98C	ENSP00000368805:R98C	R	-	1	0	GCM2	10985410	0.992000	0.36948	0.885000	0.34714	0.712000	0.41017	1.838000	0.39211	0.303000	0.22785	0.650000	0.86243	CGC	-	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif		0.607	GCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM2	protein_coding	OTTHUMT00000039844.1	G		-		10877424	-1	no_errors	ENST00000379491	ensembl	human	known	74_37	missense	SNP	0.869	A
ZNF451	26036	genome.wustl.edu	37	6	57015498	57015498	+	Intron	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:57015498G>C	ENST00000370706.4	+	11	2852				RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|ZNF451_ENST00000491832.2_Intron|RP11-203B9.4_ENST00000586432.1_RNA|ZNF451_ENST00000357489.3_Intron|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AACTCATGTTGATATTTCTCT	0.333																																																	0								ENSG00000226803						74.0	68.0	70.0					6																	57015498		1815	4072	5887	RP11-203B9.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2609-19G>C	6.37:g.57015498G>C		Somatic	0	44	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	35	21.74	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	RNA	SNP	34	0.00	0	57	21.92	16	-	NULL	ENST00000370706.4	37	NULL	CCDS43477.1	6																																																																																			-	-		0.333	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101927211	protein_coding	OTTHUMT00000041035.2	G	NM_015555	-		57015498	-1	no_errors	ENST00000589263	ensembl	human	known	74_37	rna	SNP	0.001	C
HEY2	23493	genome.wustl.edu	37	6	126070965	126070965	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:126070965G>T	ENST00000368364.3	+	1	240	c.43G>T	c.(43-45)Gac>Tac	p.D15Y	RP11-624M8.1_ENST00000451660.2_RNA|RP11-624M8.1_ENST00000606001.1_RNA|HEY2_ENST00000368365.1_Intron|RP11-624M8.1_ENST00000432121.1_RNA	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	15					anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		GAGCGACATGGACGAGACCAT	0.701																																																	0								ENSG00000135547						25.0	24.0	24.0					6																	126070965		2182	4283	6465	HEY2	SO:0001583	missense	0			-	HGNC	AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.43G>T	6.37:g.126070965G>T	ENSP00000357348:p.Asp15Tyr	Somatic	0	39	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.09		Missense_Mutation	SNP	32	3.03	1	52	0.00	0	pfam_bHLH_dom,pfam_Orange,superfamily_bHLH_dom,smart_bHLH_dom,smart_Orange_subgr,pfscan_Orange,pfscan_bHLH_dom,prints_Antifreeze_1	p.D15Y	ENST00000368364.3	37	c.43	CCDS5131.1	6	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486008	0.84854	.	.	ENSG00000135547	ENST00000368364	T	0.66460	-0.21	4.65	4.65	0.58169	.	0.062795	0.64402	D	0.000013	T	0.67392	0.2888	M	0.64404	1.975	0.80722	D	1	D	0.67145	0.996	P	0.51453	0.67	T	0.73827	-0.3860	10	0.87932	D	0	1.8526	17.887	0.88858	0.0:0.0:1.0:0.0	.	15	Q9UBP5	HEY2_HUMAN	Y	15	ENSP00000357348:D15Y	ENSP00000357348:D15Y	D	+	1	0	HEY2	126112658	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	9.168000	0.94781	2.277000	0.76020	0.462000	0.41574	GAC	-	NULL		0.701	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEY2	protein_coding	OTTHUMT00000042077.1	G		-		126070965	+1	no_errors	ENST00000368364	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC25A48	153328	genome.wustl.edu	37	5	135188461	135188461	+	Silent	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:135188461G>T	ENST00000420621.1	+	4	544	c.372G>T	c.(370-372)gtG>gtT	p.V124V	SLC25A48_ENST00000274513.5_Silent_p.V124V|SLC25A48_ENST00000433282.2_Silent_p.V70V|SLC25A48_ENST00000425402.1_Intron|SLC25A48_ENST00000412661.2_Silent_p.V124V			Q6ZT89	S2548_HUMAN	solute carrier family 25, member 48	124					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						GAGGGCCCGTGGACCTCATCA	0.667																																																	0								ENSG00000145832						32.0	35.0	34.0					5																	135188461		1970	4135	6105	SLC25A48	SO:0001819	synonymous_variant	0			-	HGNC		CCDS43366.2	5q31.1	2013-05-22			ENSG00000145832	ENSG00000145832		"""Solute carriers"""	30451	protein-coding gene	gene with protein product	"""HCC-down-regulated mitochondrial carrier protein"""					15322095, 19303656	Standard	NM_145282		Approved	FLJ44862, HDMCP	uc003lba.3	Q6ZT89	OTTHUMG00000157007	ENST00000420621.1:c.372G>T	5.37:g.135188461G>T		Somatic	0	59	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	68	22.73	Q8TAV9	Silent	SNP	30	0.00	0	42	17.65	9	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.V124	ENST00000420621.1	37	c.372		5																																																																																			-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier		0.667	SLC25A48-201	KNOWN	basic|appris_principal	protein_coding	SLC25A48	protein_coding		G	NM_145282	-		135188461	+1	no_errors	ENST00000420621	ensembl	human	known	74_37	silent	SNP	1.000	T
AMZ2	51321	genome.wustl.edu	37	17	66247426	66247427	+	Intron	INS	-	-	CTGTATAG	rs200969552|rs58359332	byFrequency	TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:66247426_66247427insCTGTATAG	ENST00000359904.3	+	4	1718				AMZ2_ENST00000577273.1_Intron|AMZ2_ENST00000580753.1_Intron|AMZ2_ENST00000359783.4_Intron|AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000392720.2_Intron|AMZ2_ENST00000577866.1_Intron|AMZ2_ENST00000577985.1_Intron	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2								metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			GATATTTAAAATATTTTCAGTT	0.356														1657	0.330871	0.5121	0.3487	5008	,	,		15358	0.2768		0.1918	False		,,,				2504	0.272																0								ENSG00000196704																																			AMZ2	SO:0001627	intron_variant	0				HGNC	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.586+107->CTGTATAG	17.37:g.66247426_66247427insCTGTATAG		Somatic	NA	NA	NA		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	RNA	INS	9	60.87	14	15	72.73	40	-	NULL	ENST00000359904.3	37	NULL	CCDS11674.1	17																																																																																			-	-		0.356	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMZ2	protein_coding	OTTHUMT00000448261.1	-	NM_016627			66247427	+1	no_errors	ENST00000581779	ensembl	human	known	74_37	rna	INS	0.001:0.003	CTGTATAG
PNMA2	10687	genome.wustl.edu	37	8	26366390	26366390	+	5'UTR	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr8:26366390G>A	ENST00000522362.2	-	0	776				PNMA2_ENST00000522764.1_5'Flank	NM_007257.5	NP_009188.1	Q9UL42	PNMA2_HUMAN	paraneoplastic Ma antigen 2						positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)	11		all_cancers(63;0.109)|Ovarian(32;2.61e-05)|all_epithelial(46;0.105)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0196)|Epithelial(17;3.13e-11)|Colorectal(74;0.123)		ACCCACCAATGAATGGGTCCC	0.438																																																	0								ENSG00000240694																																			PNMA2	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS34868.1	8p21.1	2012-02-09	2012-02-09		ENSG00000240694	ENSG00000240694		"""Paraneoplastic Ma antigens"""	9159	protein-coding gene	gene with protein product		603970	"""paraneoplastic antigen MA2"""			10362822	Standard	NM_007257		Approved	MA2, RGAG2	uc003xez.2	Q9UL42	OTTHUMG00000163816	ENST00000522362.2:c.-119C>T	8.37:g.26366390G>A		Somatic	0	34	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	23	30.30	B3KNY9|O94959|O95145|Q49A18|Q9UL43	RNA	SNP	39	0.00	0	50	35.06	27	-	NULL	ENST00000522362.2	37	NULL	CCDS34868.1	8																																																																																			-	-		0.438	PNMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA2	protein_coding	OTTHUMT00000375709.2	G	NM_007257	-		26366390	-1	no_errors	ENST00000518212	ensembl	human	known	74_37	rna	SNP	0.000	A
AC131094.1	0	genome.wustl.edu	37	4	176394181	176394181	+	RNA	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr4:176394181C>T	ENST00000408209.1	+	0	29																											gttaaaatttcgctggggcct	0.542																																																	0								ENSG00000221136																																			AC131094.1			0			-	Clone_based_ensembl_gene																													4.37:g.176394181C>T		Somatic	0	92	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	62	16.22		RNA	SNP	35	0.00	0	29	29.27	12	-	NULL	ENST00000408209.1	37	NULL		4																																																																																			-	-		0.542	AC131094.1-201	NOVEL	basic	miRNA	ENSG00000221136	miRNA		C		-		176394181	+1	no_errors	ENST00000408209	ensembl	human	novel	74_37	rna	SNP	0.049	T
ZNF451	26036	genome.wustl.edu	37	6	57017071	57017071	+	Silent	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:57017071G>A	ENST00000370706.4	+	12	3049	c.2805G>A	c.(2803-2805)ctG>ctA	p.L935L	RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|ZNF451_ENST00000491832.2_Silent_p.L935L|RP11-203B9.4_ENST00000586432.1_RNA|ZNF451_ENST00000357489.3_Silent_p.L887L|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	935					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			ATAACTACCTGAACAGGATTG	0.363																																																	0								ENSG00000112200						123.0	118.0	120.0					6																	57017071		2203	4300	6503	ZNF451	SO:0001819	synonymous_variant	0			-	HGNC	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2805G>A	6.37:g.57017071G>A		Somatic	0	68	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	90	18.18	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Silent	SNP	43	0.00	0	48	17.24	10	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L935	ENST00000370706.4	37	c.2805	CCDS43477.1	6																																																																																			-	NULL		0.363	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	protein_coding	OTTHUMT00000041035.2	G	NM_015555	-		57017071	+1	no_errors	ENST00000370706	ensembl	human	known	74_37	silent	SNP	0.997	A
FDXACB1	91893	genome.wustl.edu	37	11	111746328	111746328	+	Missense_Mutation	SNP	C	C	T	rs137921139		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:111746328C>T	ENST00000260257.4	-	5	1240	c.1193G>A	c.(1192-1194)gGg>gAg	p.G398E	ALG9_ENST00000524880.1_Intron|ALG9_ENST00000527377.1_Intron|FDXACB1_ENST00000542429.1_Missense_Mutation_p.G249E	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1	398					phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						TTGATTAACCCCAAGGATAAA	0.458													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22224	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000255561						165.0	164.0	164.0					11																	111746328		1883	4111	5994	FDXACB1	SO:0001583	missense	0			GMAF=0.0005	HGNC		CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795	ENST00000260257.4:c.1193G>A	11.37:g.111746328C>T	ENSP00000260257:p.Gly398Glu	Somatic	0	15	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	5	50.00	A0PJW7|B4DUU2	Missense_Mutation	SNP	38	0.00	0	18	21.74	5	pfam_DUF2431,pfam_PheS_beta_Fdx_antiC-bd,superfamily_PheS_beta_Fdx_antiC-bd,smart_PheS_beta_Fdx_antiC-bd	p.G398E	ENST00000260257.4	37	c.1193	CCDS44729.1	11	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	11.85	1.761897	0.31228	.	.	ENSG00000255561	ENST00000260257;ENST00000542429;ENST00000528274	T;T;T	0.35605	1.3;1.3;1.3	6.17	3.28	0.37604	.	0.204938	0.49916	D	0.000134	T	0.28267	0.0698	L	0.50333	1.59	0.31800	N	0.628506	B	0.26445	0.149	B	0.23419	0.046	T	0.25502	-1.0130	10	0.24483	T	0.36	.	7.7225	0.28740	0.1075:0.4893:0.3402:0.063	.	398	Q9BRP7	FDXA1_HUMAN	E	398;249;309	ENSP00000260257:G398E;ENSP00000441304:G249E;ENSP00000435572:G309E	ENSP00000260257:G398E	G	-	2	0	FDXACB1	111251538	0.870000	0.30015	0.356000	0.25785	0.407000	0.30961	1.747000	0.38298	0.472000	0.27344	0.655000	0.94253	GGG	-	NULL		0.458	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FDXACB1	protein_coding	OTTHUMT00000391497.1	C	NM_138378	rs137921139		111746328	-1	no_errors	ENST00000260257	ensembl	human	known	74_37	missense	SNP	0.475	T
PIKFYVE	200576	genome.wustl.edu	37	2	209215655	209215655	+	Silent	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr2:209215655C>A	ENST00000264380.4	+	37	5753	c.5595C>A	c.(5593-5595)gcC>gcA	p.A1865A		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1865	Catalytic.|PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						CAGGAGCTGCCTTCTATGCAA	0.478																																																	0								ENSG00000115020						90.0	83.0	85.0					2																	209215655		2203	4300	6503	PIKFYVE	SO:0001819	synonymous_variant	0			-	HGNC	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.5595C>A	2.37:g.209215655C>A		Somatic	0	81	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	86	14.00	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	45	0.00	0	48	15.79	9	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_GroEL-like_apical_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.A1865	ENST00000264380.4	37	c.5595	CCDS2382.1	2																																																																																			-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub		0.478	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	protein_coding	OTTHUMT00000256477.2	C	NM_015040	-		209215655	+1	no_errors	ENST00000264380	ensembl	human	known	74_37	silent	SNP	0.912	A
ESPNP	284729	genome.wustl.edu	37	1	17034125	17034126	+	RNA	INS	-	-	AGCT	rs141324796|rs79472512	byFrequency	TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:17034125_17034126insAGCT	ENST00000492551.1	-	0	477_478					NR_026567.1				espin pseudogene																		CAGCAGCAGCCAGCTGAGCACC	0.718														1500	0.299521	0.1188	0.3444	5008	,	,		24180	0.4177		0.3101	False		,,,				2504	0.3793																0								ENSG00000268869																																			ESPNP			0				HGNC	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17034126_17034129dupAGCT		Somatic	0	8	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25		RNA	INS	72	6.49	5	91	18.02	20	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			-	-		0.718	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	pseudogene	OTTHUMT00000326311.1	-				17034126	-1	no_errors	ENST00000492551	ensembl	human	known	74_37	rna	INS	1.000:1.000	AGCT
HSPA12B	116835	genome.wustl.edu	37	20	3729966	3729966	+	Splice_Site	SNP	G	G	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr20:3729966G>C	ENST00000254963.2	+	9	1082		c.e9+1		HSPA12B_ENST00000542646.1_Splice_Site	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B								ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						ATGCAAGCAGGTAGGGGGAAA	0.627																																																	0								ENSG00000132622						55.0	55.0	55.0					20																	3729966		2203	4300	6503	HSPA12B	SO:0001630	splice_region_variant	0			-	HGNC	AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.937+1G>C	20.37:g.3729966G>C		Somatic	0	45	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	72	25.77	D3DVX7|Q2TAK3|Q9BR52	Splice_Site	SNP	38	0.00	0	48	21.31	13	-	e8+1	ENST00000254963.2	37	c.937+1	CCDS13061.1	20	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275400	0.80580	.	.	ENSG00000132622	ENST00000254963;ENST00000542646;ENST00000399701	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6736	0.85273	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	HSPA12B	3677966	1.000000	0.71417	0.997000	0.53966	0.761000	0.43186	9.430000	0.97488	2.537000	0.85549	0.561000	0.74099	.	-	-		0.627	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12B	protein_coding	OTTHUMT00000077756.2	G	NM_052970	-	Intron	3729966	+1	no_errors	ENST00000254963	ensembl	human	known	74_37	splice_site	SNP	1.000	C
CMPK2	129607	genome.wustl.edu	37	2	6988912	6988912	+	3'UTR	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr2:6988912C>T	ENST00000256722.5	-	0	2418				CMPK2_ENST00000458098.1_Intron|CMPK2_ENST00000478738.1_5'UTR	NM_207315.3	NP_997198.2	Q5EBM0	CMPK2_HUMAN	cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial						cellular response to lipopolysaccharide (GO:0071222)|dTDP biosynthetic process (GO:0006233)|dUDP biosynthetic process (GO:0006227)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)|thymidylate kinase activity (GO:0004798)|UMP kinase activity (GO:0033862)			large_intestine(1)|lung(13)|prostate(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TATAATTTCCCCCTCACTCAG	0.353																																																	0								ENSG00000134326																																			CMPK2	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS42648.1, CCDS58695.1, CCDS58696.1	2p25.2	2008-01-25			ENSG00000134326	ENSG00000134326	2.7.4.14		27015	protein-coding gene	gene with protein product	"""cytidylate kinase 2"""	611787				17999954	Standard	NM_207315		Approved	TYKi, UMP-CMPK2	uc002qyo.4	Q5EBM0	OTTHUMG00000151629	ENST00000256722.5:c.*1069G>A	2.37:g.6988912C>T		Somatic	0	67	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	27	32.50	A2RUB0|A5D8T2|B7ZM18|Q6ZRU2|Q96AL8	RNA	SNP	42	0.00	0	32	17.95	7	-	NULL	ENST00000256722.5	37	NULL	CCDS42648.1	2																																																																																			-	-		0.353	CMPK2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	CMPK2	protein_coding	OTTHUMT00000323339.2	C	NM_207315	-		6988912	-1	no_errors	ENST00000478738	ensembl	human	known	74_37	rna	SNP	0.000	T
ZNHIT2	741	genome.wustl.edu	37	11	64884288	64884288	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:64884288G>T	ENST00000310597.4	-	1	882	c.838C>A	c.(838-840)Ccc>Acc	p.P280T	AP003068.12_ENST00000527789.1_RNA	NM_014205.2	NP_055020.1	Q9UHR6	ZNHI2_HUMAN	zinc finger, HIT-type containing 2	280							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						GTGCCCAGGGGCCCCGGCGGG	0.701																																																	0								ENSG00000174276						13.0	16.0	15.0					11																	64884288		2186	4276	6462	ZNHIT2	SO:0001583	missense	0			-	HGNC		CCDS8094.1	11q13	2012-08-08	2010-09-15	2004-07-14	ENSG00000174276	ENSG00000174276		"""Zinc fingers, HIT-type"""	1177	protein-coding gene	gene with protein product		604575	"""chromosome 11 open reading frame 5"", ""zinc finger, HIT domain containing 2"""	C11orf5			Standard	NM_014205		Approved	FON	uc001ocw.3	Q9UHR6	OTTHUMG00000165604	ENST00000310597.4:c.838C>A	11.37:g.64884288G>T	ENSP00000308548:p.Pro280Thr	Somatic	0	18	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	18	21.74	Q3SY14|Q8IUV0	Missense_Mutation	SNP	25	0.00	0	29	27.50	11	pfam_Znf_HIT,pfscan_Znf_HIT	p.P280T	ENST00000310597.4	37	c.838	CCDS8094.1	11	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007418	0.54361	.	.	ENSG00000174276	ENST00000310597;ENST00000528598	T	0.30182	1.54	4.67	4.67	0.58626	.	0.706801	0.12776	U	0.440054	T	0.39489	0.1080	N	0.24115	0.695	0.40598	D	0.981551	D	0.76494	0.999	D	0.71184	0.972	T	0.04650	-1.0936	10	0.16420	T	0.52	-16.8793	15.0938	0.72217	0.0:0.0:1.0:0.0	.	280	Q9UHR6	ZNHI2_HUMAN	T	280;115	ENSP00000308548:P280T	ENSP00000308548:P280T	P	-	1	0	ZNHIT2	64640864	0.977000	0.34250	0.959000	0.39883	0.292000	0.27327	2.631000	0.46502	2.417000	0.82017	0.561000	0.74099	CCC	-	NULL		0.701	ZNHIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNHIT2	protein_coding	OTTHUMT00000385260.1	G	NM_014205	-		64884288	-1	no_errors	ENST00000310597	ensembl	human	known	74_37	missense	SNP	0.995	T
ALS2CL	259173	genome.wustl.edu	37	3	46716064	46716064	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr3:46716064A>T	ENST00000318962.4	-	21	2504	c.2421T>A	c.(2419-2421)gaT>gaA	p.D807E	ALS2CL_ENST00000383742.3_Missense_Mutation_p.D154E|ALS2CL_ENST00000415953.1_Missense_Mutation_p.D807E	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	807	VPS9. {ECO:0000255|PROSITE- ProRule:PRU00550}.				endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		ACTTCTGCACATCCAGGAACT	0.557																																																	0								ENSG00000178038						193.0	183.0	186.0					3																	46716064		2203	4300	6503	ALS2CL	SO:0001583	missense	0			-	HGNC	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.2421T>A	3.37:g.46716064A>T	ENSP00000313670:p.Asp807Glu	Somatic	0	21	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	17	59.52	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Missense_Mutation	SNP	35	0.00	0	31	45.61	26	pfam_MORN,pfam_VPS9,superfamily_DH-domain,smart_MORN,pfscan_VPS9	p.D807E	ENST00000318962.4	37	c.2421	CCDS2743.1	3	.	.	.	.	.	.	.	.	.	.	A	10.04	1.242424	0.22796	.	.	ENSG00000178038	ENST00000318962;ENST00000415953;ENST00000383742	T;T;T	0.33438	1.41;1.41;1.41	5.28	-10.6	0.00265	Vacuolar sorting protein 9 (1);	0.177007	0.37577	N	0.002025	T	0.12347	0.0300	L	0.31664	0.95	0.24245	N	0.995342	B	0.22541	0.071	B	0.23150	0.044	T	0.05146	-1.0903	10	0.51188	T	0.08	.	2.2986	0.04156	0.2789:0.1764:0.3813:0.1634	.	807	Q60I27	AL2CL_HUMAN	E	807;807;154	ENSP00000313670:D807E;ENSP00000413223:D807E;ENSP00000373248:D154E	ENSP00000313670:D807E	D	-	3	2	ALS2CL	46691068	0.000000	0.05858	0.192000	0.23308	0.724000	0.41520	-2.618000	0.00880	-2.862000	0.00326	-0.331000	0.08364	GAT	-	pfscan_VPS9		0.557	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CL	protein_coding	OTTHUMT00000250567.3	A	NM_147129	-		46716064	-1	no_errors	ENST00000318962	ensembl	human	known	74_37	missense	SNP	0.031	T
TSKS	60385	genome.wustl.edu	37	19	50247562	50247562	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr19:50247562C>G	ENST00000246801.3	-	8	1369	c.1287G>C	c.(1285-1287)caG>caC	p.Q429H	TSKS_ENST00000358830.3_Missense_Mutation_p.Q229H	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	429					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		TTCGAGAGTTCTGAAATTGCC	0.622																																																	0								ENSG00000126467						78.0	70.0	73.0					19																	50247562		2203	4300	6503	TSKS	SO:0001583	missense	0			-	HGNC	BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.1287G>C	19.37:g.50247562C>G	ENSP00000246801:p.Gln429His	Somatic	0	28	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	21	47.50	Q8WXJ0	Missense_Mutation	SNP	31	0.00	0	23	43.90	18	NULL	p.Q429H	ENST00000246801.3	37	c.1287	CCDS12780.1	19	.	.	.	.	.	.	.	.	.	.	C	16.33	3.092320	0.55968	.	.	ENSG00000126467	ENST00000246801;ENST00000358830	T;T	0.32272	1.46;1.46	4.85	1.25	0.21368	.	0.485483	0.18165	N	0.149647	T	0.24509	0.0594	L	0.27053	0.805	0.26749	N	0.970242	P	0.43094	0.799	P	0.48141	0.568	T	0.07347	-1.0777	10	0.72032	D	0.01	-25.947	4.6896	0.12774	0.0:0.6006:0.1942:0.2052	.	429	Q9UJT2	TSKS_HUMAN	H	429;229	ENSP00000246801:Q429H;ENSP00000351691:Q229H	ENSP00000246801:Q429H	Q	-	3	2	TSKS	54939374	0.498000	0.26075	1.000000	0.80357	0.985000	0.73830	-0.055000	0.11807	0.616000	0.30141	0.555000	0.69702	CAG	-	NULL		0.622	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	protein_coding	OTTHUMT00000465795.1	C	NM_021733	-		50247562	-1	no_errors	ENST00000246801	ensembl	human	known	74_37	missense	SNP	0.974	G
RGS3	5998	genome.wustl.edu	37	9	116356457	116356457	+	Intron	SNP	C	C	A	rs555206859		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:116356457C>A	ENST00000374140.2	+	23	3289				RGS3_ENST00000462403.1_Silent_p.T86T|RGS3_ENST00000462143.1_Intron|RGS3_ENST00000394646.3_Intron|RGS3_ENST00000342620.5_Intron|RGS3_ENST00000374134.3_Intron|RGS3_ENST00000343817.5_Intron|RGS3_ENST00000350696.5_Intron	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3						inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						CAGCCTGCACCGTTGCTGCCC	0.662																																																	0								ENSG00000138835						46.0	52.0	50.0					9																	116356457		2203	4299	6502	RGS3	SO:0001627	intron_variant	0			-	HGNC	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.3081-253C>A	9.37:g.116356457C>A		Somatic	0	13	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	18	33.33	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Silent	SNP	27	0.00	0	24	45.45	20	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.T86	ENST00000374140.2	37	c.258	CCDS43869.1	9																																																																																			-	NULL		0.662	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	protein_coding	OTTHUMT00000055561.3	C	NM_017790	-		116356457	+1	no_errors	ENST00000462403	ensembl	human	known	74_37	silent	SNP	0.000	A
TMEM110	375346	genome.wustl.edu	37	3	52877150	52877150	+	Intron	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr3:52877150C>T	ENST00000355083.5	-	7	764				TMEM110-MUSTN1_ENST00000504329.1_Intron|TMEM110_ENST00000464769.1_5'UTR	NM_198563.2	NP_940965.1	Q86TL2	TM110_HUMAN	transmembrane protein 110							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)	4				BRCA - Breast invasive adenocarcinoma(193;7.72e-05)|Kidney(197;0.000777)|KIRC - Kidney renal clear cell carcinoma(197;0.000915)|OV - Ovarian serous cystadenocarcinoma(275;0.0541)		TTCCCAGTCTCCACATCCTCG	0.502																																																	0								ENSG00000213533																																			TMEM110	SO:0001627	intron_variant	0			-	HGNC	BC047015	CCDS2866.1	3p21.1	2010-08-13			ENSG00000213533	ENSG00000213533			30526	protein-coding gene	gene with protein product						12477932	Standard	NM_198563		Approved	MGC52022		Q86TL2	OTTHUMG00000150346	ENST00000355083.5:c.619-174G>A	3.37:g.52877150C>T		Somatic	0	13	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	4	55.56		RNA	SNP	18	56.10	23	31	49.18	30	-	NULL	ENST00000355083.5	37	NULL	CCDS2866.1	3																																																																																			-	-		0.502	TMEM110-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM110	protein_coding	OTTHUMT00000352949.2	C	NM_198563	-		52877150	-1	no_errors	ENST00000464769	ensembl	human	known	74_37	rna	SNP	0.005	T
TTC23	64927	genome.wustl.edu	37	15	99679888	99679888	+	Intron	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:99679888C>T	ENST00000394132.2	-	13	1961				TTC23_ENST00000394130.1_Intron|RP11-6O2.3_ENST00000564527.1_RNA|TTC23_ENST00000394135.3_Intron|TTC23_ENST00000558663.1_Intron|TTC23_ENST00000394136.1_Intron|TTC23_ENST00000262074.4_Intron|TTC23_ENST00000558613.1_Intron			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23											endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			AAGGCAAGAACCTTGGTACTG	0.303																																																	0								ENSG00000261616																																			RP11-6O2.3	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.1144-284G>A	15.37:g.99679888C>T		Somatic	0	47	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	53	10.17	A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	RNA	SNP	35	0.00	0	89	21.24	24	-	NULL	ENST00000394132.2	37	NULL	CCDS10379.2	15																																																																																			-	-		0.303	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261616	protein_coding	OTTHUMT00000303953.2	C	NM_022905	-		99679888	+1	no_errors	ENST00000564527	ensembl	human	known	74_37	rna	SNP	0.000	T
XRCC3	7517	genome.wustl.edu	37	14	104165290	104165290	+	Silent	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr14:104165290G>A	ENST00000553264.1	-	8	1682	c.886C>T	c.(886-888)Ctg>Ttg	p.L296L	KLC1_ENST00000555836.1_Intron|XRCC3_ENST00000352127.7_Silent_p.L296L|RP11-73M18.8_ENST00000602422.1_RNA|KLC1_ENST00000557450.1_Intron|XRCC3_ENST00000554974.1_Silent_p.L91L|KLC1_ENST00000452929.2_Intron|KLC1_ENST00000348520.6_Intron|XRCC3_ENST00000445556.1_Silent_p.L296L|XRCC3_ENST00000554913.1_Silent_p.L296L|XRCC3_ENST00000555055.1_Silent_p.L296L|KLC1_ENST00000554280.1_Intron|KLC1_ENST00000334553.6_Intron			O43542	XRCC3_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 3	296					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|response to organic substance (GO:0010033)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			endometrium(1)|large_intestine(1)|ovary(1)|prostate(1)	4		Melanoma(154;0.155)|all_epithelial(191;0.19)		Epithelial(152;0.239)		TCAGCCAGCAGTCTCACCAGG	0.667								Direct reversal of damage;Homologous recombination																																									0								ENSG00000126215						23.0	21.0	22.0					14																	104165290		2195	4299	6494	XRCC3	SO:0001819	synonymous_variant	0			-	HGNC	AF035586	CCDS9984.1	14q32.3	2006-05-04				ENSG00000126215			12830	protein-coding gene	gene with protein product	"""RAD51-like"""	600675				7603995	Standard	NM_001100118		Approved		uc001ynz.4	O43542		ENST00000553264.1:c.886C>T	14.37:g.104165290G>A		Somatic	0	24	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.64	O43568|Q9BU18	Silent	SNP	29	0.00	0	33	35.29	18	pfam_DNA_recomb/repair_Rad51_C,superfamily_P-loop_NTPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd	p.L296	ENST00000553264.1	37	c.886	CCDS9984.1	14																																																																																			-	pfam_DNA_recomb/repair_Rad51_C,superfamily_P-loop_NTPase,pirsf_DNA_recomb/repair_RecA-like		0.667	XRCC3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC3	protein_coding	OTTHUMT00000414631.1	G	NM_005432	-		104165290	-1	no_errors	ENST00000352127	ensembl	human	known	74_37	silent	SNP	1.000	A
PNMA2	10687	genome.wustl.edu	37	8	26366391	26366391	+	5'UTR	SNP	A	A	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr8:26366391A>T	ENST00000522362.2	-	0	775				PNMA2_ENST00000522764.1_5'Flank	NM_007257.5	NP_009188.1	Q9UL42	PNMA2_HUMAN	paraneoplastic Ma antigen 2						positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)	11		all_cancers(63;0.109)|Ovarian(32;2.61e-05)|all_epithelial(46;0.105)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0196)|Epithelial(17;3.13e-11)|Colorectal(74;0.123)		CCCACCAATGAATGGGTCCCA	0.443																																																	0								ENSG00000240694																																			PNMA2	SO:0001623	5_prime_UTR_variant	0			-	HGNC		CCDS34868.1	8p21.1	2012-02-09	2012-02-09		ENSG00000240694	ENSG00000240694		"""Paraneoplastic Ma antigens"""	9159	protein-coding gene	gene with protein product		603970	"""paraneoplastic antigen MA2"""			10362822	Standard	NM_007257		Approved	MA2, RGAG2	uc003xez.2	Q9UL42	OTTHUMG00000163816	ENST00000522362.2:c.-120T>A	8.37:g.26366391A>T		Somatic	0	35	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	23	32.35	B3KNY9|O94959|O95145|Q49A18|Q9UL43	RNA	SNP	37	2.63	1	50	35.06	27	-	NULL	ENST00000522362.2	37	NULL	CCDS34868.1	8																																																																																			-	-		0.443	PNMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMA2	protein_coding	OTTHUMT00000375709.2	A	NM_007257	-		26366391	-1	no_errors	ENST00000518212	ensembl	human	known	74_37	rna	SNP	0.000	T
POTEM	641455	genome.wustl.edu	37	14	20007611	20007611	+	Silent	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr14:20007611G>A	ENST00000551509.1	-	6	1128	c.1077C>T	c.(1075-1077)gaC>gaT	p.D359D	RNU6-1268P_ENST00000391214.1_RNA|RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	359										endometrium(4)|kidney(1)|lung(4)	9						TTTCTTTGTAGTCAGAAAGTA	0.269																																																	0								ENSG00000187537						1.0	1.0	1.0					14																	20007611		2	5	7	POTEM	SO:0001819	synonymous_variant	0			-	HGNC		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.1077C>T	14.37:g.20007611G>A		Somatic	0	64	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81		Silent	SNP	13	0.00	0	14	12.50	2	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D359	ENST00000551509.1	37	c.1077	CCDS45076.1	14																																																																																			-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt		0.269	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	POTEM	protein_coding	OTTHUMT00000409490.3	G	NM_001145442	-		20007611	-1	no_errors	ENST00000547848	ensembl	human	known	74_37	silent	SNP	0.230	A
IDUA	3425	genome.wustl.edu	37	4	995781	995781	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr4:995781C>A	ENST00000247933.4	+	7	892	c.804C>A	c.(802-804)agC>agA	p.S268R	IDUA_ENST00000514224.1_Missense_Mutation_p.S136R|IDUA_ENST00000453894.1_Missense_Mutation_p.L255I	NM_000203.3	NP_000194.2	P35475	IDUA_HUMAN	iduronidase, alpha-L-	268					carbohydrate metabolic process (GO:0005975)|cell morphogenesis (GO:0000902)|chemical homeostasis (GO:0048878)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate catabolic process (GO:0030209)|disaccharide metabolic process (GO:0005984)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|limb morphogenesis (GO:0035108)|lysosome organization (GO:0007040)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)	coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	L-iduronidase activity (GO:0003940)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(23;0.0158)			GTGCGCGCAGCTCCATCTCCA	0.711																																																	0								ENSG00000127415						19.0	20.0	20.0					4																	995781		2172	4256	6428	IDUA	SO:0001583	missense	0			-	HGNC	M74715	CCDS3343.1	4p16.3	2012-10-02			ENSG00000127415	ENSG00000127415	3.2.1.76		5391	protein-coding gene	gene with protein product		252800				1832239	Standard	NM_000203		Approved	MPS1	uc003gby.3	P35475	OTTHUMG00000088901	ENST00000247933.4:c.804C>A	4.37:g.995781C>A	ENSP00000247933:p.Ser268Arg	Somatic	0	14	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	19	42.42	B3KWK6	Missense_Mutation	SNP	22	0.00	0	37	43.94	29	pfam_Glyco_hydro_39,superfamily_Glycoside_hydrolase_SF,superfamily_Fibronectin_type3,prints_Glyco_hydro_39	p.L255I	ENST00000247933.4	37	c.763	CCDS3343.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.612|8.612	0.889279|0.889279	0.17540|0.17540	.|.	.|.	ENSG00000127415|ENSG00000127415	ENST00000453894|ENST00000247933;ENST00000502910;ENST00000514192;ENST00000514224	D|D;D;D;D	0.94497|0.95482	-3.44|-3.72;-3.35;-3.35;-3.72	4.91|4.91	2.19|2.19	0.27852|0.27852	.|Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.|0.273028	.|0.42294	.|D	.|0.000724	D|D	0.88894|0.88894	0.6561|0.6561	L|L	0.38838|0.38838	1.175|1.175	0.21675|0.21675	N|N	0.999598|0.999598	D|B	0.58268|0.31077	0.982|0.307	P|B	0.48738|0.26693	0.588|0.072	T|T	0.76798|0.76798	-0.2826|-0.2826	9|10	0.33141|0.15066	T|T	0.24|0.55	4.9721|4.9721	6.5043|6.5043	0.22186|0.22186	0.0:0.619:0.0:0.381|0.0:0.619:0.0:0.381	.|.	255|268	B3KWK6|P35475	.|IDUA_HUMAN	I|R	255|268;221;207;136	ENSP00000396458:L255I|ENSP00000247933:S268R;ENSP00000422952:S221R;ENSP00000423685:S207R;ENSP00000425081:S136R	ENSP00000396458:L255I|ENSP00000247933:S268R	L|S	+|+	1|3	0|2	IDUA|IDUA	985781|985781	0.975000|0.975000	0.34042|0.34042	1.000000|1.000000	0.80357|0.80357	0.187000|0.187000	0.23431|0.23431	0.334000|0.334000	0.19787|0.19787	0.603000|0.603000	0.29913|0.29913	0.561000|0.561000	0.74099|0.74099	CTC|AGC	-	NULL		0.711	IDUA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IDUA	protein_coding	OTTHUMT00000201812.1	C	NM_000203	-		995781	+1	no_errors	ENST00000453894	ensembl	human	known	74_37	missense	SNP	1.000	A
CADM1	23705	genome.wustl.edu	37	11	115080312	115080314	+	In_Frame_Del	DEL	TGG	TGG	-	rs370430583		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	TGG	TGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr11:115080312_115080314delTGG	ENST00000452722.3	-	8	1078_1080	c.1058_1060delCCA	c.(1057-1062)accatc>atc	p.T353del	CADM1_ENST00000542447.2_Intron|CADM1_ENST00000536727.1_Intron|CADM1_ENST00000537140.1_Intron|CADM1_ENST00000331581.6_In_Frame_Del_p.T353del|CADM1_ENST00000537058.1_In_Frame_Del_p.T353del	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		atggtaaggatggtggtggtggt	0.429																																																	0								ENSG00000182985																																			CADM1	SO:0001651	inframe_deletion	0				HGNC	AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1058_1060delCCA	11.37:g.115080321_115080323delTGG	ENSP00000395359:p.Thr353del	Somatic	0	38	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	24	11.11		In_Frame_Del	DEL	22	0.00	0	26	0.00	0	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like_dom	p.T353in_frame_del	ENST00000452722.3	37	c.1060_1058	CCDS8373.1	11																																																																																			-	NULL		0.429	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CADM1	protein_coding	OTTHUMT00000398753.2	TGG	NM_014333			115080314	-1	no_errors	ENST00000452722	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
CYP4Z1	199974	genome.wustl.edu	37	1	47583592	47583592	+	Nonsense_Mutation	SNP	A	A	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:47583592A>T	ENST00000334194.3	+	12	1507	c.1504A>T	c.(1504-1506)Aaa>Taa	p.K502*	CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4Z1_ENST00000471598.1_3'UTR	NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1	502						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						TGTGTTTGCAAAAAAAGTTTG	0.383																																																	0								ENSG00000186160						53.0	47.0	49.0					1																	47583592		2203	4300	6503	CYP4Z1	SO:0001587	stop_gained	0			-	HGNC	AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.1504A>T	1.37:g.47583592A>T	ENSP00000334246:p.Lys502*	Somatic	0	44	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	20	37.50	Q5VVE4	Nonsense_Mutation	SNP	50	0.00	0	43	34.85	23	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.K502*	ENST00000334194.3	37	c.1504	CCDS545.1	1	.	.	.	.	.	.	.	.	.	.	a	18.47	3.631623	0.67015	.	.	ENSG00000186160	ENST00000334194	.	.	.	1.23	1.23	0.21249	.	0.154606	0.41823	U	0.000809	.	.	.	.	.	.	0.25997	N	0.982163	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.0122	0.30359	1.0:0.0:0.0:0.0	.	.	.	.	X	502	.	ENSP00000334246:K502X	K	+	1	0	CYP4Z1	47356179	0.520000	0.26250	0.006000	0.13384	0.485000	0.33311	0.964000	0.29306	0.847000	0.35167	0.225000	0.17782	AAA	-	superfamily_Cyt_P450		0.383	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4Z1	protein_coding	OTTHUMT00000022020.1	A	NM_178134	-		47583592	+1	no_errors	ENST00000334194	ensembl	human	known	74_37	nonsense	SNP	0.507	T
RB1	5925	genome.wustl.edu	37	13	48951157	48951157	+	Frame_Shift_Del	DEL	A	A	-			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr13:48951157delA	ENST00000267163.4	+	13	1457	c.1319delA	c.(1318-1320)gaafs	p.E440fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	440	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GGTTGTGTCGAAATTGGATCA	0.343		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	23	Whole gene deletion(15)|Unknown(8)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)						ENSG00000139687						107.0	115.0	112.0					13																	48951157		2203	4299	6502	RB1	SO:0001589	frameshift_variant	0	Familial Cancer Database			HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1319delA	13.37:g.48951157delA	ENSP00000267163:p.Glu440fs	Somatic	0	48	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	11	59.26	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	46	0.00	0	19	52.50	21	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.I441fs	ENST00000267163.4	37	c.1319	CCDS31973.1	13																																																																																			-	pfam_RB_A,superfamily_Cyclin-like		0.343	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	A				48951157	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
IQCK	124152	genome.wustl.edu	37	16	19800230	19800230	+	Missense_Mutation	SNP	T	T	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr16:19800230T>A	ENST00000320394.6	+	8	1375	c.676T>A	c.(676-678)Tgg>Agg	p.W226R	IQCK_ENST00000564186.1_Missense_Mutation_p.W226R|IQCK_ENST00000433597.2_Missense_Mutation_p.W138R|IQCK_ENST00000541926.1_Intron|IQCK_ENST00000562762.1_3'UTR	NM_153208.1	NP_694940.1	Q8N0W5	IQCK_HUMAN	IQ motif containing K	226										kidney(1)|large_intestine(2)|lung(2)|skin(1)	6						TCAATCCTTCTGGAGAGCCTG	0.478																																																	0								ENSG00000174628						109.0	106.0	107.0					16																	19800230		2197	4300	6497	IQCK	SO:0001583	missense	0			-	HGNC	AF520569	CCDS10580.1	16p12.3	2008-02-05			ENSG00000174628	ENSG00000174628			28556	protein-coding gene	gene with protein product						10493829	Standard	NM_153208		Approved	MGC35048, FLJ36575	uc002dgr.3	Q8N0W5	OTTHUMG00000131453	ENST00000320394.6:c.676T>A	16.37:g.19800230T>A	ENSP00000324901:p.Trp226Arg	Somatic	0	62	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	54	34.15	B2RDU0|O43327|Q8NFF4	Missense_Mutation	SNP	43	0.00	0	40	38.46	25	NULL	p.W226R	ENST00000320394.6	37	c.676	CCDS10580.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.66|18.66	3.671814|3.671814	0.67928|0.67928	.|.	.|.	ENSG00000174628|ENSG00000174628	ENST00000308214|ENST00000320394;ENST00000433597	.|T;T	.|0.24350	.|1.86;1.86	5.61|5.61	5.61|5.61	0.85477|0.85477	.|.	.|0.000000	.|0.51477	.|D	.|0.000090	T|T	0.49779|0.49779	0.1577|0.1577	M|M	0.70275|0.70275	2.135|2.135	0.44345|0.44345	D|D	0.997239|0.997239	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.48007|0.48007	-0.9072|-0.9072	5|9	.|.	.|.	.|.	-11.6879|-11.6879	14.0439|14.0439	0.64693|0.64693	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|226	.|Q8N0W5	.|IQCK_HUMAN	Q|R	182|226;138	.|ENSP00000324901:W226R;ENSP00000406013:W138R	.|.	L|W	+|+	2|1	0|0	IQCK|IQCK	19707731|19707731	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.655000|0.655000	0.38815|0.38815	4.848000|4.848000	0.62874|0.62874	2.125000|2.125000	0.65367|0.65367	0.533000|0.533000	0.62120|0.62120	CTG|TGG	-	NULL		0.478	IQCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCK	protein_coding	OTTHUMT00000254273.2	T	NM_153208	-		19800230	+1	no_errors	ENST00000320394	ensembl	human	known	74_37	missense	SNP	1.000	A
MT-CO1	4512	genome.wustl.edu	37	M	6264	6264	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrM:6264G>A	ENST00000361624.2	+	1	361	c.361G>A	c.(361-363)Gga>Aga	p.G121R	MT-TW_ENST00000387382.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	121					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TAGTGGAGGCCGGAGCAGGAA	0.547																																																	0								ENSG00000198804																																			MT-CO1	SO:0001583	missense	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.361G>A	M.37:g.6264G>A	ENSP00000354499:p.Gly121Arg	Somatic	0	99	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	24	45.45	Q34770	Nonsense_Mutation	SNP	3404	0.06	2	6374	47.24	5713	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.G121*	ENST00000361624.2	37	c.361		MT																																																																																			-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom		0.547	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	protein_coding		G	YP_003024028	-		6264	+1	no_errors	ENST00000361624	ensembl	human	known	74_37	nonsense	SNP	NULL	A
DMPK	1760	genome.wustl.edu	37	19	46275980	46275980	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr19:46275980C>G	ENST00000291270.4	-	10	1388	c.1263G>C	c.(1261-1263)atG>atC	p.M421I	AC074212.6_ENST00000591530.1_RNA|DMPK_ENST00000447742.2_Missense_Mutation_p.M416I|DMPK_ENST00000354227.5_Missense_Mutation_p.M416I|AC074212.5_ENST00000592217.2_RNA|DMPK_ENST00000458663.2_Missense_Mutation_p.M416I|AC074212.6_ENST00000586251.1_RNA|DMPK_ENST00000600757.1_Missense_Mutation_p.M426I|AC074212.6_ENST00000590076.1_RNA|DMPK_ENST00000595361.1_5'Flank|DMPK_ENST00000343373.4_Missense_Mutation_p.M431I|AC074212.6_ENST00000586498.1_RNA	NM_004409.3	NP_004400.4	Q09013	DMPK_HUMAN	dystrophia myotonica-protein kinase	421					cellular calcium ion homeostasis (GO:0006874)|muscle cell apoptotic process (GO:0010657)|nuclear envelope organization (GO:0006998)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|regulation of excitatory postsynaptic membrane potential involved in skeletal muscle contraction (GO:0014853)|regulation of heart contraction (GO:0008016)|regulation of myotube differentiation (GO:0010830)|regulation of skeletal muscle contraction by calcium ion signaling (GO:0014722)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of mitochondrial outer membrane (GO:0031307)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|myosin phosphatase regulator activity (GO:0017020)|protein serine/threonine kinase activity (GO:0004674)			endometrium(5)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)|urinary_tract(2)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		CCTCCAGTTCCATGGGTGTGG	0.617																																					Esophageal Squamous(35;307 869 9153 24033 28903)												0								ENSG00000104936						41.0	42.0	42.0					19																	46275980		2203	4300	6503	DMPK	SO:0001583	missense	0			-	HGNC	L19268	CCDS12674.1, CCDS46117.1, CCDS46118.1, CCDS46119.1, CCDS74400.1	19q13.3	2014-02-05					2.7.11.1		2933	protein-coding gene	gene with protein product	"""dystrophia myotonica 1"", ""DM protein kinase"", ""myotonin protein kinase A"", ""myotonic dystrophy associated protein kinase"", ""thymopoietin homolog"""	605377	"""dystrophia myotonica 1 (includes dystrophia myotonia protein kinase)"""	DM1, DM		1546325, 1546326	Standard	NM_001288765		Approved	DMK, DM1PK, MDPK, MT-PK	uc002pdf.1	Q09013		ENST00000291270.4:c.1263G>C	19.37:g.46275980C>G	ENSP00000291270:p.Met421Ile	Somatic	0	44	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	87	20.18	E5KR08|Q16205|Q6P5Z6	Missense_Mutation	SNP	27	0.00	0	36	12.20	5	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.M431I	ENST00000291270.4	37	c.1293	CCDS12674.1	19	.	.	.	.	.	.	.	.	.	.	c	13.63	2.293352	0.40594	.	.	ENSG00000104936	ENST00000458663;ENST00000342805;ENST00000291270;ENST00000447742;ENST00000377750;ENST00000343373;ENST00000348168;ENST00000354227	T;T;T;T;T	0.66099	-0.19;-0.17;-0.18;-0.18;-0.11	3.87	3.87	0.44632	AGC-kinase, C-terminal (1);	0.000000	0.52532	D	0.000072	T	0.53254	0.1785	L	0.50333	1.59	0.80722	D	1	B;B;B;B;B;B;B;B	0.32781	0.065;0.228;0.274;0.085;0.146;0.062;0.384;0.179	B;B;B;B;B;B;B;B	0.31290	0.098;0.083;0.112;0.026;0.038;0.036;0.127;0.058	T	0.54788	-0.8241	10	0.35671	T	0.21	.	11.5239	0.50569	0.0:1.0:0.0:0.0	.	416;421;447;416;416;421;463;431	Q09013-12;Q09013-16;G5E982;E5KR07;E5KR05;Q09013;Q59FU6;E5KR08	.;.;.;.;.;DMPK_HUMAN;.;.	I	416;447;421;416;416;431;431;416	ENSP00000401753:M416I;ENSP00000291270:M421I;ENSP00000413417:M416I;ENSP00000345997:M431I;ENSP00000346168:M416I	ENSP00000291270:M421I	M	-	3	0	DMPK	50967820	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	1.947000	0.40293	2.157000	0.67596	0.561000	0.74099	ATG	-	NULL		0.617	DMPK-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DMPK	protein_coding	OTTHUMT00000460572.1	C	NM_004409	-		46275980	-1	no_errors	ENST00000343373	ensembl	human	known	74_37	missense	SNP	1.000	G
TOPORS	10210	genome.wustl.edu	37	9	32552393	32552393	+	Intron	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:32552393G>A	ENST00000360538.2	-	1	120				TOPORS_ENST00000379858.1_Intron|TOPORS-AS1_ENST00000453396.1_RNA|TOPORS-AS1_ENST00000425533.1_RNA|TOPORS-AS1_ENST00000458036.1_RNA|TOPORS-AS1_ENST00000450093.1_RNA|TOPORS-AS1_ENST00000540066.1_RNA	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase						cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		AAGGCCCGCAGCTCCCGCCAG	0.652																																																	0								ENSG00000235453						11.0	13.0	12.0					9																	32552393		2201	4290	6491	TOPORS-AS1	SO:0001627	intron_variant	0			-	HGNC	AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.3+38C>T	9.37:g.32552393G>A		Somatic	0	33	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	42	33.85	O43273|Q6P987|Q9NS55|Q9UNR9	RNA	SNP	24	0.00	0	36	32.08	17	-	NULL	ENST00000360538.2	37	NULL	CCDS6527.1	9																																																																																			-	-		0.652	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS-AS1	protein_coding	OTTHUMT00000052007.1	G	NM_005802	-		32552393	+1	no_errors	ENST00000425533	ensembl	human	known	74_37	rna	SNP	0.000	A
ZNF462	58499	genome.wustl.edu	37	9	109691436	109691436	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:109691436C>T	ENST00000277225.5	+	3	5532	c.5243C>T	c.(5242-5244)cCg>cTg	p.P1748L	ZNF462_ENST00000457913.1_Missense_Mutation_p.P1748L|ZNF462_ENST00000441147.2_Missense_Mutation_p.P593L			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1748					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						ATCCCATCCCCGCCCAAGGAC	0.567																																																	0								ENSG00000148143						106.0	87.0	93.0					9																	109691436		2203	4300	6503	ZNF462	SO:0001583	missense	0			-	HGNC	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.5243C>T	9.37:g.109691436C>T	ENSP00000277225:p.Pro1748Leu	Somatic	0	32	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	39	23.53	Q5T0T4|Q8N408	Missense_Mutation	SNP	30	0.00	0	46	6.12	3	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P1748L	ENST00000277225.5	37	c.5243	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	C	19.78	3.890472	0.72524	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	T;T;T;T	0.06768	3.26;3.69;3.74;3.81	6.08	6.08	0.98989	.	0.103096	0.64402	D	0.000002	T	0.13756	0.0333	N	0.14661	0.345	0.80722	D	1	D;D	0.71674	0.998;0.992	P;P	0.56751	0.805;0.644	T	0.08229	-1.0732	10	0.40728	T	0.16	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	1748;1748	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	L	1748;1748;631;593	ENSP00000277225:P1748L;ENSP00000414570:P1748L;ENSP00000363818:P631L;ENSP00000397306:P593L	ENSP00000277225:P1748L	P	+	2	0	ZNF462	108731257	0.988000	0.35896	0.915000	0.36163	0.953000	0.61014	5.545000	0.67237	2.894000	0.99253	0.591000	0.81541	CCG	-	NULL		0.567	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	protein_coding	OTTHUMT00000053532.2	C	NM_021224	-		109691436	+1	no_errors	ENST00000457913	ensembl	human	known	74_37	missense	SNP	0.994	T
SNAPC4	6621	genome.wustl.edu	37	9	139277995	139277997	+	In_Frame_Del	DEL	GCT	GCT	-	rs147271628|rs34427285|rs35266724|rs34222232	byFrequency	TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:139277995_139277997delGCT	ENST00000298532.2	-	15	1992_1994	c.1624_1626delAGC	c.(1624-1626)agcdel	p.S542del		NM_003086.2	NP_003077.2			small nuclear RNA activating complex, polypeptide 4, 190kDa									p.S542delS(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	33		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		CGTCCTCCTCgctgctgctgctg	0.69														955	0.190695	0.1808	0.3184	5008	,	,		11493	0.0565		0.2356	False		,,,				2504	0.2055																2	Deletion - In frame(2)	prostate(1)|central_nervous_system(1)						ENSG00000165684																																			SNAPC4	SO:0001651	inframe_deletion	0				HGNC	AF032387	CCDS6998.1	9q34.3	2008-07-21	2002-08-29		ENSG00000165684	ENSG00000165684			11137	protein-coding gene	gene with protein product		602777	"""small nuclear RNA activating complex, polypeptide 4, 190kD"""			9418884	Standard	XM_005266096		Approved	SNAP190, PTFalpha, FLJ13451	uc004chh.3	Q5SXM2	OTTHUMG00000020929	ENST00000298532.2:c.1624_1626delAGC	9.37:g.139278004_139278006delGCT	ENSP00000298532:p.Ser542del	Somatic	0	14	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00		In_Frame_Del	DEL	17	32.00	8	23	20.69	6	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S542in_frame_del	ENST00000298532.2	37	c.1626_1624	CCDS6998.1	9																																																																																			-	NULL		0.690	SNAPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC4	protein_coding	OTTHUMT00000055071.1	GCT	NM_003086			139277997	-1	no_errors	ENST00000298532	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.005:0.005	-
ZNF451	26036	genome.wustl.edu	37	6	57017129	57017129	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:57017129G>A	ENST00000370706.4	+	12	3107	c.2863G>A	c.(2863-2865)Gat>Aat	p.D955N	RP11-203B9.4_ENST00000592500.1_RNA|RP11-203B9.4_ENST00000587815.1_RNA|RP11-203B9.4_ENST00000585792.1_RNA|RP11-203B9.4_ENST00000416069.2_RNA|RP11-203B9.4_ENST00000589263.1_RNA|RP11-203B9.4_ENST00000589549.1_RNA|RP11-203B9.4_ENST00000591553.1_RNA|RP11-203B9.4_ENST00000586466.1_RNA|RP11-203B9.4_ENST00000586668.1_RNA|RP11-203B9.4_ENST00000592038.1_RNA|ZNF451_ENST00000491832.2_Missense_Mutation_p.D955N|RP11-203B9.4_ENST00000586432.1_RNA|ZNF451_ENST00000357489.3_Missense_Mutation_p.D907N|RP11-203B9.4_ENST00000586053.1_RNA|RP11-203B9.4_ENST00000588811.1_RNA	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451	955					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			AGATGCTGCTGATTTTGCCAT	0.378																																																	0								ENSG00000112200						150.0	142.0	145.0					6																	57017129		2203	4300	6503	ZNF451	SO:0001583	missense	0			-	HGNC	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.2863G>A	6.37:g.57017129G>A	ENSP00000359740:p.Asp955Asn	Somatic	0	56	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	72	15.29	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	34	0.00	0	51	8.93	5	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D955N	ENST00000370706.4	37	c.2863	CCDS43477.1	6	.	.	.	.	.	.	.	.	.	.	G	29.4	5.000296	0.93227	.	.	ENSG00000112200	ENST00000370706;ENST00000357489;ENST00000491832	T;T;T	0.07908	3.15;3.15;3.15	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.25232	0.0613	M	0.78801	2.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.02226	-1.1192	10	0.87932	D	0	-20.7387	19.1881	0.93653	0.0:0.0:1.0:0.0	.	907;955;955	Q9Y4E5-2;Q9Y4E5;E9PH99	.;ZN451_HUMAN;.	N	955;907;955	ENSP00000359740:D955N;ENSP00000350083:D907N;ENSP00000421645:D955N	ENSP00000350083:D907N	D	+	1	0	ZNF451	57125088	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.722000	0.74735	2.604000	0.88044	0.655000	0.94253	GAT	-	NULL		0.378	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF451	protein_coding	OTTHUMT00000041035.2	G	NM_015555	-		57017129	+1	no_errors	ENST00000370706	ensembl	human	known	74_37	missense	SNP	1.000	A
IQGAP3	128239	genome.wustl.edu	37	1	156507018	156507018	+	Missense_Mutation	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:156507018G>A	ENST00000361170.2	-	27	3387	c.3377C>T	c.(3376-3378)aCt>aTt	p.T1126I	IQGAP3_ENST00000498755.1_5'UTR	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1126	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GAACTTATCAGTCATGGCGAG	0.572																																																	0								ENSG00000183856						170.0	142.0	151.0					1																	156507018		2203	4300	6503	IQGAP3	SO:0001583	missense	0			-	HGNC	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.3377C>T	1.37:g.156507018G>A	ENSP00000354451:p.Thr1126Ile	Somatic	0	78	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	105	23.91	Q5T3H8	Missense_Mutation	SNP	38	0.00	0	44	16.98	9	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.T1126I	ENST00000361170.2	37	c.3377	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.883267	0.91740	.	.	ENSG00000183856	ENST00000361170	T	0.79653	-1.29	4.93	4.93	0.64822	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.85682	D	0.000000	D	0.87426	0.6174	M	0.72894	2.215	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.88594	0.3145	10	0.87932	D	0	-14.6168	16.8795	0.86060	0.0:0.0:1.0:0.0	.	1126	Q86VI3	IQGA3_HUMAN	I	1126	ENSP00000354451:T1126I	ENSP00000354451:T1126I	T	-	2	0	IQGAP3	154773642	1.000000	0.71417	0.339000	0.25562	0.991000	0.79684	9.657000	0.98554	2.566000	0.86566	0.561000	0.74099	ACT	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP		0.572	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	protein_coding	OTTHUMT00000080657.1	G	NM_178229	-		156507018	-1	no_errors	ENST00000361170	ensembl	human	known	74_37	missense	SNP	1.000	A
OR13D1	286365	genome.wustl.edu	37	9	107456942	107456942	+	Silent	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr9:107456942C>A	ENST00000318763.5	+	1	283	c.240C>A	c.(238-240)atC>atA	p.I80I		NM_001004484.1	NP_001004484.1	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D, member 1	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(10)|ovary(1)|prostate(2)|skin(2)	19						TCATTATCATCACCATCTTGG	0.453																																																	0								ENSG00000179055						222.0	222.0	222.0					9																	107456942		2203	4300	6503	OR13D1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS35094.1	9q31.1	2013-09-24			ENSG00000179055	ENSG00000179055		"""GPCR / Class A : Olfactory receptors"""	14695	protein-coding gene	gene with protein product							Standard	NM_001004484		Approved		uc011lvs.2	Q8NGV5	OTTHUMG00000020412	ENST00000318763.5:c.240C>A	9.37:g.107456942C>A		Somatic	0	81	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	84	13.40	B9EIS1|Q6IFL1	Silent	SNP	51	0.00	0	36	21.74	10	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I80	ENST00000318763.5	37	c.240	CCDS35094.1	9																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.453	OR13D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13D1	protein_coding	OTTHUMT00000053483.1	C		-		107456942	+1	no_errors	ENST00000318763	ensembl	human	known	74_37	silent	SNP	0.000	A
APEX2	27301	genome.wustl.edu	37	X	55033727	55033727	+	Missense_Mutation	SNP	C	C	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:55033727C>A	ENST00000374987.3	+	6	1482	c.1416C>A	c.(1414-1416)caC>caA	p.H472Q	ALAS2_ENST00000498636.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	472					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						GTGGGGGCCACAGGGAGCCAT	0.612								Other BER factors																																									0								ENSG00000169188						29.0	24.0	26.0					X																	55033727		2203	4298	6501	APEX2	SO:0001583	missense	0			-	HGNC	AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.1416C>A	X.37:g.55033727C>A	ENSP00000364126:p.His472Gln	Somatic	0	37	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	114	17.39	Q9Y5X7	Missense_Mutation	SNP	22	0.00	0	71	8.86	7	pfam_Endo/exonuclease/phosphatase,pfam_Znf_GRF,superfamily_Endo/exonuclease/phosphatase,tigrfam_AP_endonuc_1	p.H472Q	ENST00000374987.3	37	c.1416	CCDS14365.1	X	.	.	.	.	.	.	.	.	.	.	C	17.28	3.350825	0.61183	.	.	ENSG00000169188	ENST00000374987	T	0.26223	1.75	4.87	1.9	0.25705	Zinc finger, GRF-type (1);	0.000000	0.85682	D	0.000000	T	0.57198	0.2037	H	0.95645	3.7	0.52501	D	0.99995	D	0.71674	0.998	D	0.77004	0.989	T	0.59043	-0.7528	10	0.87932	D	0	-25.6851	7.7494	0.28888	0.0:0.4789:0.0:0.5211	.	472	Q9UBZ4	APEX2_HUMAN	Q	472	ENSP00000364126:H472Q	ENSP00000364126:H472Q	H	+	3	2	APEX2	55050452	0.816000	0.29132	0.435000	0.26784	0.963000	0.63663	0.467000	0.22035	0.113000	0.18004	0.513000	0.50165	CAC	-	pfam_Znf_GRF		0.612	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX2	protein_coding	OTTHUMT00000056845.1	C		-		55033727	+1	no_errors	ENST00000374987	ensembl	human	known	74_37	missense	SNP	0.973	A
SERPIND1	3053	genome.wustl.edu	37	22	21138335	21138335	+	Missense_Mutation	SNP	A	A	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr22:21138335A>T	ENST00000215727.5	+	3	1248	c.965A>T	c.(964-966)aAg>aTg	p.K322M	PI4KA_ENST00000255882.6_Intron|PI4KA_ENST00000572273.1_Intron|PI4KA_ENST00000466162.1_Intron|SERPIND1_ENST00000406799.1_Missense_Mutation_p.K322M	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	322					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	GAGGTAGTTAAGGTTTCCATG	0.522											OREG0026325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000099937						166.0	149.0	155.0					22																	21138335		2203	4300	6503	SERPIND1	SO:0001583	missense	0			-	HGNC	M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.965A>T	22.37:g.21138335A>T	ENSP00000215727:p.Lys322Met	Somatic	0	36	0.00	746	0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	59	18.06	B2RAI1|D3DX34|Q6IBZ5	Missense_Mutation	SNP	42	0.00	0	37	27.45	14	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.K322M	ENST00000215727.5	37	c.965	CCDS13783.1	22	.	.	.	.	.	.	.	.	.	.	A	17.58	3.425615	0.62733	.	.	ENSG00000099937	ENST00000215727;ENST00000406799	D;D	0.85339	-1.97;-1.97	4.25	4.25	0.50352	Serpin domain (3);	0.049932	0.85682	D	0.000000	D	0.84497	0.5485	M	0.62154	1.92	0.51012	D	0.999909	P;P	0.35894	0.526;0.526	B;B	0.39971	0.315;0.315	D	0.85319	0.1083	10	0.49607	T	0.09	.	13.8128	0.63273	1.0:0.0:0.0:0.0	.	322;322	Q8IVC0;P05546	.;HEP2_HUMAN	M	322	ENSP00000215727:K322M;ENSP00000384050:K322M	ENSP00000215727:K322M	K	+	2	0	SERPIND1	19468335	1.000000	0.71417	0.932000	0.37286	0.783000	0.44284	5.892000	0.69790	1.913000	0.55393	0.533000	0.62120	AAG	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.522	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPIND1	protein_coding	OTTHUMT00000319961.1	A	NM_000185	-		21138335	+1	no_errors	ENST00000215727	ensembl	human	known	74_37	missense	SNP	1.000	T
ZSWIM8	23053	genome.wustl.edu	37	10	75553404	75553404	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr10:75553404G>T	ENST00000605216.1	+	11	2589	c.2372G>T	c.(2371-2373)cGt>cTt	p.R791L	ZSWIM8_ENST00000431225.1_3'UTR|ZSWIM8_ENST00000398706.2_Missense_Mutation_p.R791L|ZSWIM8-AS1_ENST00000456638.2_RNA|ZSWIM8_ENST00000603114.1_Missense_Mutation_p.R758L|ZSWIM8_ENST00000604729.1_Missense_Mutation_p.R791L|ZSWIM8_ENST00000604524.1_Missense_Mutation_p.R791L	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	791							zinc ion binding (GO:0008270)										GAGGCCTCCCGTCTCACTGTG	0.597																																																	0								ENSG00000214655						81.0	85.0	84.0					10																	75553404		2062	4181	6243	ZSWIM8	SO:0001583	missense	0			-	HGNC	BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.2372G>T	10.37:g.75553404G>T	ENSP00000474748:p.Arg791Leu	Somatic	0	22	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	16	52.94	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Missense_Mutation	SNP	24	0.00	0	11	62.07	18	pfscan_Znf_SWIM	p.R791L	ENST00000605216.1	37	c.2372		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.8|21.8	4.195309|4.195309	0.78902|0.78902	.|.	.|.	ENSG00000214655|ENSG00000214655	ENST00000398706|ENST00000431225;ENST00000412198	T|.	0.43688|.	0.94|.	5.44|5.44	5.44|5.44	0.79542|0.79542	.|.	0.096864|.	0.42172|.	U|.	0.000751|.	T|T	0.73118|0.73118	0.3546|0.3546	L|L	0.59436|0.59436	1.845|1.845	0.54753|0.54753	D|D	0.999987|0.999987	P;P;P;P|.	0.38020|.	0.462;0.615;0.462;0.462|.	B;B;B;B|.	0.35931|.	0.153;0.21;0.214;0.153|.	T|T	0.69209|0.69209	-0.5205|-0.5205	10|5	0.51188|.	T|.	0.08|.	-6.1033|-6.1033	19.4432|19.4432	0.94831|0.94831	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	791;791;791;791|.	A7E2V4;A7E2V4-3;A7E2V4-5;A7E2V4-4|.	K0913_HUMAN;.;.;.|.	L|F	791|288;61	ENSP00000381693:R791L|.	ENSP00000381693:R791L|.	R|V	+|+	2|1	0|0	KIAA0913|KIAA0913	75223410|75223410	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.981000|0.981000	0.71138|0.71138	5.540000|5.540000	0.67205|0.67205	2.833000|2.833000	0.97629|0.97629	0.650000|0.650000	0.86243|0.86243	CGT|GTC	-	NULL		0.597	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	ZSWIM8	protein_coding	OTTHUMT00000468545.1	G	NM_001242487	-		75553404	+1	no_errors	ENST00000398706	ensembl	human	known	74_37	missense	SNP	1.000	T
RIT2	6014	genome.wustl.edu	37	18	40503652	40503652	+	Missense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr18:40503652C>T	ENST00000326695.5	-	4	482	c.311G>A	c.(310-312)cGt>cAt	p.R104H	RIT2_ENST00000589109.1_Missense_Mutation_p.R104H|RIT2_ENST00000282028.4_Missense_Mutation_p.R104H|RIT2_ENST00000590910.1_Missense_Mutation_p.V125I	NM_002930.2	NP_002921.1	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	104					neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						AAATGATTGACGGTCAGTGAC	0.468																																																	0								ENSG00000152214						218.0	222.0	220.0					18																	40503652		2203	4300	6503	RIT2	SO:0001583	missense	0			-	HGNC	BC018060	CCDS11921.1, CCDS62431.1	18q12.3	2014-05-09	2002-09-11	2002-09-13	ENSG00000152214	ENSG00000152214			10017	protein-coding gene	gene with protein product		609592	"""Ric (Drosophila)-like, expressed in neurons"""	RIN		8824319, 8918462	Standard	NM_002930		Approved	RIBA	uc002lav.4	Q99578	OTTHUMG00000132611	ENST00000326695.5:c.311G>A	18.37:g.40503652C>T	ENSP00000321805:p.Arg104His	Somatic	0	28	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	20	48.72	B2R9L1|O15295|Q8TD69|Q8WVF6|Q92964	Missense_Mutation	SNP	30	3.23	1	40	36.51	23	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R104H	ENST00000326695.5	37	c.311	CCDS11921.1	18	.	.	.	.	.	.	.	.	.	.	C	25.7	4.664843	0.88251	.	.	ENSG00000152214	ENST00000326695;ENST00000282028	T;T	0.78364	-1.17;-1.17	5.45	4.58	0.56647	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000002	D	0.86920	0.6049	M	0.81802	2.56	0.48087	D	0.99958	D;D	0.89917	1.0;1.0	D;D	0.63703	0.917;0.911	D	0.88331	0.2968	10	0.56958	D	0.05	.	14.4894	0.67639	0.0:0.9291:0.0:0.0709	.	104;104	Q99578-2;Q99578	.;RIT2_HUMAN	H	104	ENSP00000321805:R104H;ENSP00000282028:R104H	ENSP00000282028:R104H	R	-	2	0	RIT2	38757650	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.704000	0.54815	1.444000	0.47605	0.655000	0.94253	CGT	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom		0.468	RIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIT2	protein_coding	OTTHUMT00000255852.1	C	NM_002930	-		40503652	-1	no_errors	ENST00000326695	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF793	390927	genome.wustl.edu	37	19	38024339	38024339	+	Intron	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr19:38024339A>G	ENST00000587143.1	+	5	473				ZNF793_ENST00000587986.1_Missense_Mutation_p.E91G|ZNF793_ENST00000589319.1_Intron|ZNF793_ENST00000542455.1_Intron|ZNF793_ENST00000588578.1_Intron|ZNF793_ENST00000445217.1_Intron			Q6ZN11	ZN793_HUMAN	zinc finger protein 793						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGGGGTACTGAAGGAGGCTGG	0.498																																					Melanoma(44;400 1431 1499 19093)												0								ENSG00000188227						54.0	55.0	54.0					19																	38024339		1922	4122	6044	ZNF793	SO:0001627	intron_variant	0			-	HGNC	AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.238+34A>G	19.37:g.38024339A>G		Somatic	0	97	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	46	39.47	E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	43	0.00	0	28	45.10	23	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.E91G	ENST00000587143.1	37	c.272	CCDS46062.1	19																																																																																			-	NULL		0.498	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF793	protein_coding	OTTHUMT00000458621.1	A	NM_001013659	-		38024339	+1	no_errors	ENST00000587986	ensembl	human	putative	74_37	missense	SNP	0.000	G
MT-ND5	4540	genome.wustl.edu	37	M	12986	12986	+	Missense_Mutation	SNP	T	T	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrM:12986T>C	ENST00000361567.2	+	1	650	c.650T>C	c.(649-651)cTc>cCc	p.L217P	MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	217					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ACTAGGCCTCCTCCTAGCAGC	0.542																																																	0								ENSG00000198786																																			MT-ND5	SO:0001583	missense	0			-	HGNC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.650T>C	M.37:g.12986T>C	ENSP00000354813:p.Leu217Pro	Somatic	0	73	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	4	92.86	Q34773|Q8WCY3	Missense_Mutation	SNP	3364	0.27	9	884	92.59	11249	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.L217P	ENST00000361567.2	37	c.650		MT																																																																																			-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5		0.542	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	protein_coding		T	YP_003024036	-		12986	+1	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	SNP	NULL	C
TMEM217	221468	genome.wustl.edu	37	6	37186212	37186212	+	Missense_Mutation	SNP	C	C	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:37186212C>G	ENST00000336655.2	-	2	634	c.595G>C	c.(595-597)Gag>Cag	p.E199Q	TMEM217_ENST00000497775.1_Intron|TMEM217_ENST00000356757.2_Missense_Mutation_p.E199Q	NM_145316.3	NP_660359.2	Q8N7C4	TM217_HUMAN	transmembrane protein 217	199						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(5)|lung(1)	9						ctctgcctctcaaagtactgg	0.473																																																	0								ENSG00000172738						26.0	28.0	27.0					6																	37186212		2203	4297	6500	TMEM217	SO:0001583	missense	0			-	HGNC		CCDS4831.1, CCDS69102.1	6p21.31-p21.2	2008-10-20	2008-07-07	2008-07-07	ENSG00000172738	ENSG00000172738			21238	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 128"""	C6orf128			Standard	NM_001162900		Approved	dJ355M6.2	uc010jws.3	Q8N7C4	OTTHUMG00000014618	ENST00000336655.2:c.595G>C	6.37:g.37186212C>G	ENSP00000338164:p.Glu199Gln	Somatic	0	19	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	192	20	90.14	Q8TC54	Missense_Mutation	SNP	29	0.00	0	26	93.62	396	NULL	p.E199Q	ENST00000336655.2	37	c.595	CCDS4831.1	6	.	.	.	.	.	.	.	.	.	.	C	0.548	-0.850621	0.02651	.	.	ENSG00000172738	ENST00000356757;ENST00000336655	.	.	.	0.149	0.149	0.14863	.	.	.	.	.	T	0.06416	0.0165	N	0.14661	0.345	0.09310	N	1	B;B	0.23891	0.001;0.093	B;B	0.17979	0.0;0.02	T	0.37407	-0.9707	7	0.30078	T	0.28	.	.	.	.	.	199;199	Q8N7C4-2;Q8N7C4	.;TM217_HUMAN	Q	199	.	ENSP00000338164:E199Q	E	-	1	0	TMEM217	37294190	0.001000	0.12720	0.010000	0.14722	0.016000	0.09150	-0.338000	0.07842	0.192000	0.20272	0.195000	0.17529	GAG	-	NULL		0.473	TMEM217-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM217	protein_coding	OTTHUMT00000357542.1	C	NM_145316	-		37186212	-1	no_errors	ENST00000336655	ensembl	human	known	74_37	missense	SNP	0.013	G
TP53	7157	genome.wustl.edu	37	17	7574017	7574017	+	Missense_Mutation	SNP	C	C	A	rs121912664		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:7574017C>A	ENST00000269305.4	-	10	1199	c.1010G>T	c.(1009-1011)cGc>cTc	p.R337L	TP53_ENST00000420246.2_3'UTR|TP53_ENST00000359597.4_Intron|TP53_ENST00000455263.2_3'UTR|TP53_ENST00000445888.2_Missense_Mutation_p.R337L|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	337	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9452042}.|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11481490}.|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R337L(15)|p.0?(8)|p.R337H(4)|p.I332fs*5(1)|p.?(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CATCTCGAAGCGCTCACGCCC	0.527		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	29	Substitution - Missense(19)|Whole gene deletion(8)|Unknown(1)|Deletion - Frameshift(1)	lung(8)|liver(8)|bone(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|central_nervous_system(2)|stomach(1)|breast(1)	GRCh37	CM012663	TP53	M	rs121912664	ENSG00000141510						57.0	45.0	49.0					17																	7574017		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1010G>T	17.37:g.7574017C>A	ENSP00000269305:p.Arg337Leu	Somatic	0	20	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	4	83.33	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	27	0.00	0	21	68.18	45	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R337L	ENST00000269305.4	37	c.1010	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	14.45	2.539589	0.45176	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	D;D	0.95137	-3.62;-3.62	5.43	3.45	0.39498	p53, tetramerisation domain (3);	0.000000	0.85682	D	0.000000	D	0.96558	0.8877	M	0.82323	2.585	0.42190	D	0.991726	D	0.65815	0.995	D	0.66716	0.946	D	0.95854	0.8877	10	0.66056	D	0.02	-7.3279	9.8868	0.41266	0.0:0.8331:0.0:0.1669	.	337	P04637	P53_HUMAN	L	337;337;326	ENSP00000269305:R337L;ENSP00000391478:R337L	ENSP00000269305:R337L	R	-	2	0	TP53	7514742	0.593000	0.26840	0.008000	0.14137	0.280000	0.26924	0.875000	0.28079	0.671000	0.31185	0.561000	0.74099	CGC	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor		0.527	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7574017	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	0.896	A
UBA1	7317	genome.wustl.edu	37	X	47060958	47060958	+	Nonsense_Mutation	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chrX:47060958C>T	ENST00000335972.6	+	8	943	c.760C>T	c.(760-762)Cag>Tag	p.Q254*	UBA1_ENST00000377351.4_Nonsense_Mutation_p.Q254*	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	254	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TTCAGAAGTACAGGGCATGGT	0.537																																																	0								ENSG00000130985						40.0	33.0	35.0					X																	47060958		2203	4300	6503	UBA1	SO:0001587	stop_gained	0			-	HGNC	AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.760C>T	X.37:g.47060958C>T	ENSP00000338413:p.Gln254*	Somatic	0	33	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	68	22.73	Q5JRR8|Q96E13	Nonsense_Mutation	SNP	43	0.00	0	55	20.29	14	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.Q254*	ENST00000335972.6	37	c.760	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	C	36	5.677928	0.96764	.	.	ENSG00000130985	ENST00000377351;ENST00000412206;ENST00000442035;ENST00000335972	.	.	.	4.74	4.74	0.60224	.	0.061537	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-19.7391	12.1745	0.54178	0.0:0.8304:0.1696:0.0	.	.	.	.	X	254;254;268;254	.	ENSP00000338413:Q254X	Q	+	1	0	UBA1	46945902	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.847000	0.55895	2.339000	0.79563	0.509000	0.49947	CAG	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1		0.537	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	protein_coding	OTTHUMT00000056389.1	C	NM_003334	-		47060958	+1	no_errors	ENST00000335972	ensembl	human	known	74_37	nonsense	SNP	1.000	T
RUNDC3B	154661	genome.wustl.edu	37	7	87329764	87329764	+	Missense_Mutation	SNP	G	G	A	rs139503670		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr7:87329764G>A	ENST00000338056.3	+	4	728	c.317G>A	c.(316-318)aGt>aAt	p.S106N	RUNDC3B_ENST00000394654.3_Missense_Mutation_p.S89N|RUNDC3B_ENST00000493037.1_Missense_Mutation_p.S89N|ABCB1_ENST00000265724.3_Intron	NM_001134405.1|NM_138290.2	NP_001127877.1|NP_612147.1	Q96NL0	RUN3B_HUMAN	RUN domain containing 3B	106	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(2)	26	Esophageal squamous(14;0.00164)					GGTTATGAAAGTCCTCGTAGC	0.348																																																	0								ENSG00000105784						81.0	77.0	79.0					7																	87329764		2203	4300	6503	RUNDC3B	SO:0001583	missense	0			-	HGNC		CCDS5609.1, CCDS47635.1, CCDS47636.1	7q21.12	2009-01-14			ENSG00000105784	ENSG00000105784			30286	protein-coding gene	gene with protein product						12645870	Standard	NM_138290		Approved	RPIP9, RPIB9	uc003ujb.3	Q96NL0	OTTHUMG00000131035	ENST00000338056.3:c.317G>A	7.37:g.87329764G>A	ENSP00000337732:p.Ser106Asn	Somatic	0	28	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	40	21.57	B4DFD0|E9PBR4|Q8IWW5|Q8NB55|Q8TBG7	Missense_Mutation	SNP	34	0.00	0	48	25.00	16	pfam_Run,smart_Run,pfscan_Run	p.S106N	ENST00000338056.3	37	c.317	CCDS5609.1	7	.	.	.	.	.	.	.	.	.	.	G	29.1	4.978403	0.92982	.	.	ENSG00000105784	ENST00000338056;ENST00000493037;ENST00000394654	T;T;T	0.11169	2.8;2.8;2.8	5.18	5.18	0.71444	RUN (2);	0.000000	0.85682	D	0.000000	T	0.24624	0.0597	L	0.40543	1.245	0.80722	D	1	P;P;P;D;P	0.57899	0.896;0.896;0.728;0.981;0.741	P;P;B;D;P	0.66351	0.649;0.649;0.42;0.943;0.665	T	0.00577	-1.1662	10	0.37606	T	0.19	-12.1603	18.2905	0.90129	0.0:0.0:1.0:0.0	.	89;89;11;89;106	E9PBR4;B4DFD0;Q96NL0-2;Q96NL0-4;Q96NL0	.;.;.;.;RUN3B_HUMAN	N	106;89;89	ENSP00000337732:S106N;ENSP00000420394:S89N;ENSP00000378149:S89N	ENSP00000337732:S106N	S	+	2	0	RUNDC3B	87167700	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.566000	0.82347	2.402000	0.81655	0.585000	0.79938	AGT	-	pfam_Run,pfscan_Run		0.348	RUNDC3B-001	KNOWN	basic|CCDS	protein_coding	RUNDC3B	protein_coding	OTTHUMT00000253679.1	G	NM_138290	-		87329764	+1	no_errors	ENST00000338056	ensembl	human	known	74_37	missense	SNP	1.000	A
PLXNB1	5364	genome.wustl.edu	37	3	48462755	48462756	+	Frame_Shift_Ins	INS	-	-	GGCCACA			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr3:48462755_48462756insGGCCACA	ENST00000358536.4	-	8	1960_1961	c.1691_1692insTGTGGCC	c.(1690-1692)ccafs	p.-564fs	PLXNB1_ENST00000448774.2_Intron|PLXNB1_ENST00000456774.1_Frame_Shift_Ins_p.-564fs|PLXNB1_ENST00000296440.6_Frame_Shift_Ins_p.-564fs|PLXNB1_ENST00000358459.4_Frame_Shift_Ins_p.-564fs	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1						axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		ATGACTCCCCTGGCCACAGGGG	0.594																																																	0								ENSG00000164050																																			PLXNB1	SO:0001589	frameshift_variant	0				HGNC	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.1685_1691dupTGTGGCC	3.37:g.48462756_48462762dupGGCCACA	ENSP00000351338:p.Pro564fs	Somatic	NA	NA	NA		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Frame_Shift_Ins	INS	29	0.00	0	46	13.21	7	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.G565fs	ENST00000358536.4	37	c.1692_1691	CCDS2765.1	3																																																																																			-	NULL		0.594	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLXNB1	protein_coding	OTTHUMT00000344454.1	-	NM_002673			48462756	-1	no_errors	ENST00000296440	ensembl	human	known	74_37	frame_shift_ins	INS	0.457:0.965	GGCCACA
ALDH7A1	501	genome.wustl.edu	37	5	125887816	125887816	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:125887816G>T	ENST00000409134.3	-	14	1433	c.1214C>A	c.(1213-1215)cCt>cAt	p.P405H	RNU6-963P_ENST00000363477.1_RNA|ALDH7A1_ENST00000553117.1_Missense_Mutation_p.P341H|ALDH7A1_ENST00000447989.2_Missense_Mutation_p.P368H	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	405					cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)			endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		ATAATTTCCAGGGCGATCCAT	0.403																																																	0								ENSG00000164904						70.0	63.0	65.0					5																	125887816		2203	4300	6503	ALDH7A1	SO:0001583	missense	0			-	HGNC	S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.1214C>A	5.37:g.125887816G>T	ENSP00000387123:p.Pro405His	Somatic	0	34	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Missense_Mutation	SNP	45	0.00	0	71	0.00	0	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.P405H	ENST00000409134.3	37	c.1214	CCDS4137.2	5	.	.	.	.	.	.	.	.	.	.	G	19.64	3.866353	0.71949	.	.	ENSG00000164904	ENST00000409134;ENST00000553117;ENST00000447989;ENST00000437170	D;D;D	0.90844	-2.74;-2.74;-2.74	4.88	4.88	0.63580	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.048568	0.85682	D	0.000000	D	0.92932	0.7751	L	0.43646	1.37	0.38535	D	0.949077	D;D	0.76494	0.994;0.999	P;D	0.65323	0.885;0.934	D	0.93976	0.7254	10	0.62326	D	0.03	.	18.1741	0.89756	0.0:0.0:1.0:0.0	.	368;405	E7EPT3;P49419	.;AL7A1_HUMAN	H	405;341;368;213	ENSP00000387123:P405H;ENSP00000448593:P341H;ENSP00000414132:P368H	ENSP00000387123:P405H	P	-	2	0	ALDH7A1	125915715	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.394000	0.97261	2.688000	0.91661	0.655000	0.94253	CCT	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH		0.403	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH7A1	protein_coding	OTTHUMT00000250921.2	G	NM_001182	-		125887816	-1	no_errors	ENST00000409134	ensembl	human	known	74_37	missense	SNP	1.000	T
OR4M2	390538	genome.wustl.edu	37	15	22368626	22368626	+	Silent	SNP	A	A	G			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr15:22368626A>G	ENST00000332663.2	+	1	149	c.51A>G	c.(49-51)ctA>ctG	p.L17L	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	17						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TCACTGGCCTATCCCAGACTC	0.348																																																	0								ENSG00000182974						265.0	234.0	245.0					15																	22368626		2203	4300	6503	OR4M2	SO:0001819	synonymous_variant	0			-	HGNC	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.51A>G	15.37:g.22368626A>G		Somatic	0	138	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	75	21.05	B9EH16|Q6IEY2	Silent	SNP	105	0.00	0	130	16.13	25	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L17	ENST00000332663.2	37	c.51	CCDS32172.1	15																																																																																			-	NULL		0.348	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	OR4M2	protein_coding	OTTHUMT00000414921.1	A		-		22368626	+1	no_errors	ENST00000332663	ensembl	human	putative	74_37	silent	SNP	0.984	G
CASP8AP2	9994	genome.wustl.edu	37	6	90584050	90584050	+	RNA	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr6:90584050C>T	ENST00000551025.1	+	0	14688									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		cacacataAACGGCTTTGCCT	0.244																																					Colon(187;1656 2025 17045 31481 39901)												0								ENSG00000118412																																			CASP8AP2			0			-	HGNC	AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90584050C>T		Somatic	0	84	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	59	10.61		RNA	SNP	33	0.00	0	83	10.64	10	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			-	-		0.244	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	processed_transcript		C	NM_001137667	-		90584050	+1	no_errors	ENST00000237177	ensembl	human	known	74_37	rna	SNP	0.826	T
FAM188B	84182	genome.wustl.edu	37	7	30921893	30921893	+	Missense_Mutation	SNP	G	G	A	rs199649103		TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr7:30921893G>A	ENST00000265299.6	+	16	2146	c.2069G>A	c.(2068-2070)cGt>cAt	p.R690H	INMT-FAM188B_ENST00000458257.1_3'UTR|AQP1_ENST00000434909.2_Missense_Mutation_p.R36H|AQP1_ENST00000509504.1_Missense_Mutation_p.R153H	NM_032222.2	NP_115598.2	Q4G0A6	F188B_HUMAN	family with sequence similarity 188, member B	690										endometrium(1)|large_intestine(5)|lung(19)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						GGGCTCCTGCGTGACTGGAGG	0.607																																																	0								ENSG00000106125	G	HIS/ARG	0,3910		0,0,1955	60.0	63.0	62.0		2069	-1.3	0.1	7		62	4,8282		0,4,4139	yes	missense	FAM188B	NM_032222.2	29	0,4,6094	AA,AG,GG		0.0483,0.0,0.0328	probably-damaging	690/758	30921893	4,12192	1955	4143	6098	FAM188B	SO:0001583	missense	0			-	HGNC	AK026027	CCDS43565.1	7p14.3	2010-08-17	2009-07-14	2009-07-14	ENSG00000106125	ENSG00000106125			21916	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 67"""	C7orf67			Standard	NM_032222		Approved	FLJ22374	uc003tbt.3	Q4G0A6	OTTHUMG00000152800	ENST00000265299.6:c.2069G>A	7.37:g.30921893G>A	ENSP00000265299:p.Arg690His	Somatic	0	29	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	71	21.11	Q71AZ7|Q9H6D2	Missense_Mutation	SNP	28	0.00	0	46	28.12	18	NULL	p.R690H	ENST00000265299.6	37	c.2069	CCDS43565.1	7	.	.	.	.	.	.	.	.	.	.	G	13.09	2.133261	0.37630	0.0	4.83E-4	ENSG00000106125;ENSG00000106125;ENSG00000240583;ENSG00000250424	ENST00000265299;ENST00000409881;ENST00000434909;ENST00000509504	T;T;T	0.31247	1.5;1.5;1.5	5.38	-1.28	0.09318	.	0.985940	0.08295	N	0.967772	T	0.36635	0.0974	L	0.47190	1.495	0.09310	N	1	P;D;D	0.69078	0.579;0.994;0.997	B;P;P	0.54590	0.147;0.756;0.756	T	0.36187	-0.9758	10	0.87932	D	0	1.4457	7.4316	0.27131	0.2962:0.14:0.5638:0.0	.	36;210;690	B4E220;B8ZZX1;Q4G0A6	.;.;F188B_HUMAN	H	690;210;36;153	ENSP00000265299:R690H;ENSP00000395059:R36H;ENSP00000421315:R153H	ENSP00000265299:R690H	R	+	2	0	RP5-877J2.1;FAM188B;AQP1	30888418	0.032000	0.19561	0.091000	0.20842	0.290000	0.27261	1.215000	0.32431	-0.058000	0.13177	0.655000	0.94253	CGT	-	NULL		0.607	FAM188B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM188B	protein_coding	OTTHUMT00000327962.1	G	NM_032222	rs199649103		30921893	+1	no_errors	ENST00000265299	ensembl	human	known	74_37	missense	SNP	0.004	A
PCDHGA3	56112	genome.wustl.edu	37	5	140724710	140724710	+	Silent	SNP	C	C	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr5:140724710C>T	ENST00000253812.6	+	1	1110	c.1110C>T	c.(1108-1110)gaC>gaT	p.D370D	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	370	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTTATCGACGTGCATGACC	0.433																																																	0								ENSG00000254245						116.0	120.0	119.0					5																	140724710		1986	4182	6168	PCDHGA3	SO:0001819	synonymous_variant	0			-	HGNC	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.1110C>T	5.37:g.140724710C>T		Somatic	0	21	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	25	26.47	Q9Y5D4	Silent	SNP	39	0.00	0	44	18.52	10	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D370	ENST00000253812.6	37	c.1110	CCDS47290.1	5																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.433	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	protein_coding	OTTHUMT00000377017.1	C	NM_018916	-		140724710	+1	no_errors	ENST00000253812	ensembl	human	known	74_37	silent	SNP	0.415	T
CEP131	22994	genome.wustl.edu	37	17	79173312	79173312	+	Missense_Mutation	SNP	G	G	T			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr17:79173312G>T	ENST00000269392.4	-	10	1308	c.1061C>A	c.(1060-1062)gCg>gAg	p.A354E	AZI1_ENST00000575907.1_Missense_Mutation_p.A354E|AZI1_ENST00000450824.2_Missense_Mutation_p.A354E|AZI1_ENST00000374782.3_Missense_Mutation_p.A354E|AZI1_ENST00000570482.2_5'Flank|RP11-455O6.2_ENST00000571085.1_RNA	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		354					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GGCAGTGCTCGCCTTCTGGGC	0.652																																																	0								ENSG00000141577						40.0	31.0	34.0					17																	79173312		2192	4295	6487	AZI1	SO:0001583	missense	0			-	HGNC																												ENST00000269392.4:c.1061C>A	17.37:g.79173312G>T	ENSP00000269392:p.Ala354Glu	Somatic	0	44	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	99	8.33	A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	24	0.00	0	45	6.25	3	superfamily_t-SNARE	p.A354E	ENST00000269392.4	37	c.1061		17	.	.	.	.	.	.	.	.	.	.	G	13.07	2.127383	0.37533	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.30448	1.53;1.53;1.53	4.33	2.26	0.28386	.	0.815154	0.10370	N	0.682887	T	0.26955	0.0660	L	0.34521	1.04	0.09310	N	1	P;P;D;P	0.60575	0.688;0.815;0.988;0.815	B;B;P;B	0.51324	0.209;0.287;0.666;0.287	T	0.08229	-1.0732	10	0.10111	T	0.7	.	6.3599	0.21422	0.0977:0.0:0.7222:0.1801	.	354;354;354;354	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	E	354	ENSP00000393583:A354E;ENSP00000363914:A354E;ENSP00000269392:A354E	ENSP00000269392:A354E	A	-	2	0	AZI1	76787907	0.000000	0.05858	0.057000	0.19452	0.048000	0.14542	0.577000	0.23758	0.422000	0.26005	-0.657000	0.03884	GCG	-	NULL		0.652	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	AZI1	protein_coding	OTTHUMT00000256070.1	G		-		79173312	-1	no_errors	ENST00000269392	ensembl	human	known	74_37	missense	SNP	0.005	T
IRF5	3663	genome.wustl.edu	37	7	128587352	128587381	+	In_Frame_Del	DEL	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	-	rs199508964|rs113806178|rs60344245|rs566635242|rs202130620|rs375983447|rs534043449|rs79724471	byFrequency	TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr7:128587352_128587381delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ENST00000402030.2	+	6	574_603	c.502_531delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	c.(502-531)actctgcagccgcccactctgcggccgcctdel	p.TLQPPTLRPP168del	IRF5_ENST00000249375.4_In_Frame_Del_p.TLQPPTLRPP168del|IRF5_ENST00000357234.5_In_Frame_Del_p.TLQPPTLRPP184del|IRF5_ENST00000477535.1_Intron|IRF5_ENST00000473745.1_In_Frame_Del_p.TLQPPTLRPP168del	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	168					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						GTGGCCGCCCACTCTGCAGCCGCCCACTCTGCGGCCGCCTACTCTGCAGC	0.652														2428	0.484824	0.534	0.366	5008	,	,		17245	0.4425		0.5338	False		,,,				2504	0.4959																1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000128604		,,,,	1942,1932		603,736,598					,,,,	0.1	0.9		dbSNP_129	14	3856,4082		1083,1690,1196	no	coding,intron,coding,coding,coding	IRF5	NM_032643.3,NM_001242452.1,NM_001098630.1,NM_001098629.1,NM_001098627.2	,,,,	1686,2426,1794	A1A1,A1R,RR		48.5765,49.8709,49.0857	,,,,	,,,,		5798,6014				IRF5	SO:0001651	inframe_deletion	0				HGNC		CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.502_531delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	7.37:g.128587352_128587381delACTCTGCAGCCGCCCACTCTGCGGCCGCCT	ENSP00000385352:p.Thr168_Pro177del	Somatic	NA	NA	NA		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	In_Frame_Del	DEL	19	13.64	3	19	13.64	3	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.PPTLRPPTLQ187in_frame_del	ENST00000402030.2	37	c.550_579	CCDS5808.1	7																																																																																			-	NULL		0.652	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF5	protein_coding	OTTHUMT00000350934.1	ACTCTGCAGCCGCCCACTCTGCGGCCGCCT	NM_001098627			128587381	+1	no_errors	ENST00000357234	ensembl	human	known	74_37	in_frame_del	DEL	0.766:0.707:0.638:0.562:0.538:0.511:0.480:0.444:0.402:0.360:0.317:0.273:0.262:0.251:0.239:0.226:0.213:0.199:0.185:0.170:0.155:0.138:0.122:0.120:0.118:0.116:0.113:0.110:0.107:0.104	-
HPCA	3208	genome.wustl.edu	37	1	33354493	33354493	+	5'UTR	SNP	G	G	A			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr1:33354493G>A	ENST00000373467.3	+	0	96				HPCA_ENST00000480118.1_3'UTR	NM_002143.2	NP_002134.2	P84074	HPCA_HUMAN	hippocalcin						inner ear development (GO:0048839)		actin binding (GO:0003779)|calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				GACTTGGCTCGGCGGCCATGG	0.627																																																	0								ENSG00000121905						46.0	49.0	48.0					1																	33354493		2203	4299	6502	HPCA	SO:0001623	5_prime_UTR_variant	0			-	HGNC	BC001777	CCDS370.1	1p35-p34.2	2013-01-10			ENSG00000121905	ENSG00000121905		"""EF-hand domain containing"""	5144	protein-coding gene	gene with protein product		142622				8166736, 9931466	Standard	NM_002143		Approved		uc001bwh.3	P84074	OTTHUMG00000004017	ENST00000373467.3:c.-7G>A	1.37:g.33354493G>A		Somatic	0	26	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	46	17.86	B2R9T3|D3DPQ7|P32076|P41211|P70510	RNA	SNP	27	0.00	0	35	16.28	7	-	NULL	ENST00000373467.3	37	NULL	CCDS370.1	1																																																																																			-	-		0.627	HPCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPCA	protein_coding	OTTHUMT00000011480.1	G	NM_002143	-		33354493	+1	no_errors	ENST00000480118	ensembl	human	known	74_37	rna	SNP	0.000	A
BOC	91653	genome.wustl.edu	37	3	112969691	112969691	+	Intron	SNP	T	T	C			TCGA-IS-A3KA-01A-11D-A21Q-09	TCGA-IS-A3KA-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d8f0becd-fda8-41f4-a424-e082f9eae22c	5f7a0fb0-9477-462c-959e-7fc6f0125fec	g.chr3:112969691T>C	ENST00000495514.1	+	4	1080				BOC_ENST00000484034.1_Silent_p.A129A|BOC_ENST00000273395.4_Intron|BOC_ENST00000485230.1_Silent_p.A129A|BOC_ENST00000355385.3_Intron			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			GTGAGTCTGCTCCTTTGCCTC	0.597																																																	0								ENSG00000144857						31.0	31.0	31.0					3																	112969691		2203	4300	6503	BOC	SO:0001627	intron_variant	0			-	HGNC	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.376+11T>C	3.37:g.112969691T>C		Somatic	0	37	0.00		0.5256533675334113	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	67	18.29	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Silent	SNP	35	0.00	0	38	24.00	12	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A129	ENST00000495514.1	37	c.387	CCDS2971.1	3																																																																																			-	NULL		0.597	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	protein_coding	OTTHUMT00000354485.3	T	NM_033254	-		112969691	+1	no_errors	ENST00000484034	ensembl	human	putative	74_37	silent	SNP	0.000	C
