#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
PRIM2	5558	genome.wustl.edu	37	6	57244708	57244730	+	Frame_Shift_Del	DEL	GAAGAGAAGACTCTTCGAGAACA	GAAGAGAAGACTCTTCGAGAACA	-	rs371513676		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	GAAGAGAAGACTCTTCGAGAACA	GAAGAGAAGACTCTTCGAGAACA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr6:57244708_57244730delGAAGAGAAGACTCTTCGAGAACA	ENST00000607273.1	+	6	556_578	c.469_491delGAAGAGAAGACTCTTCGAGAACA	c.(469-492)gaagagaagactcttcgagaacagfs	p.EEKTLREQ157fs	PRIM2_ENST00000389488.2_3'UTR	NM_000947.3	NP_000938.2	P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)	157					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)	p.R162*(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GATAAGTGATGAAGAGAAGACTCTTCGAGAACAGGAGATTGTT	0.318																																																	1	Substitution - Nonsense(1)	NS(1)						ENSG00000146143																																			PRIM2	SO:0001589	frameshift_variant	0				HGNC		CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000607273.1:c.469_491delGAAGAGAAGACTCTTCGAGAACA	6.37:g.57244708_57244730delGAAGAGAAGACTCTTCGAGAACA	ENSP00000475738:p.Glu157fs	Somatic	NA	NA	NA		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DNA_primase_lsu_euk/arc	p.E157fs	ENST00000607273.1	37	c.469_491		6																																																																																			-	NULL		0.318	PRIM2-201	KNOWN	basic|appris_principal	protein_coding	PRIM2	protein_coding		GAAGAGAAGACTCTTCGAGAACA	NM_000947			57244730	+1	no_errors	ENST00000607273	ensembl	human	known	74_37	frame_shift_del	DEL	0.969:0.974:0.973:0.998:1.000:0.995:0.997:0.988:0.957:0.200:0.000:0.000:0.000:0.000:0.000:0.155:0.176:0.222:0.283:0.274:0.142:0.120:0.114	-
AADACL4	343066	genome.wustl.edu	37	1	12704626	12704626	+	Missense_Mutation	SNP	G	G	T	rs201386716		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:12704626G>T	ENST00000376221.1	+	1	61	c.61G>T	c.(61-63)Gtc>Ttc	p.V21F		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	21						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		GGGGGTCTTTGTCTGGGCTGT	0.547													G|||	1	0.000199681	0.0	0.0014	5008	,	,		20136	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000204518						199.0	172.0	181.0					1																	12704626		2203	4300	6503	AADACL4	SO:0001583	missense	0			GMAF=0	HGNC		CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.61G>T	1.37:g.12704626G>T	ENSP00000365395:p.Val21Phe	Somatic	0	114	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	99	28.78		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AB_hydrolase_3,pirsf_Arylacetamide_deacetylase	p.V21F	ENST00000376221.1	37	c.61	CCDS30590.1	1	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	14.04	2.417607	0.42918	.	.	ENSG00000204518	ENST00000376221	T	0.05025	3.51	3.89	-3.87	0.04218	.	0.597841	0.14479	N	0.317057	T	0.06142	0.0159	L	0.54323	1.7	0.09310	N	1	P	0.48503	0.911	B	0.43018	0.405	T	0.15178	-1.0446	10	0.49607	T	0.09	-7.0196	5.378	0.16176	0.3058:0.4435:0.2507:0.0	.	21	Q5VUY2	ADCL4_HUMAN	F	21	ENSP00000365395:V21F	ENSP00000365395:V21F	V	+	1	0	AADACL4	12627213	0.000000	0.05858	0.001000	0.08648	0.015000	0.08874	-1.688000	0.01925	-0.503000	0.06586	-0.291000	0.09656	GTC	-	pirsf_Arylacetamide_deacetylase		0.547	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AADACL4	protein_coding	OTTHUMT00000005328.1	G	NM_001013630	rs201386716		12704626	+1	no_errors	ENST00000376221	ensembl	human	known	74_37	missense	SNP	0.000	T
NDUFS2	4720	genome.wustl.edu	37	1	161184059	161184060	+	3'UTR	INS	-	-	TGTGTG	rs10629771|rs201627152		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:161184059_161184060insTGTGTG	ENST00000367993.3	+	0	1916_1917				NDUFS2_ENST00000392179.4_3'UTR|FCER1G_ENST00000367992.3_5'Flank|NDUFS2_ENST00000465923.1_3'UTR|FCER1G_ENST00000289902.1_5'Flank	NM_004550.4	NP_004541.1	O75306	NDUS2_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 2, 49kDa (NADH-coenzyme Q reductase)						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|quinone binding (GO:0048038)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)	18	all_cancers(52;1.16e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Doxorubicin(DB00997)	AAATTGGCCTCtgtgtgtgtgt	0.455																																																	0								ENSG00000158864																																			NDUFS2	SO:0001624	3_prime_UTR_variant	0				HGNC	BC008868	CCDS1224.1, CCDS53404.1	1q23.3	2011-07-04	2002-08-29		ENSG00000158864	ENSG00000158864	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7708	protein-coding gene	gene with protein product	"""complex I 49kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 2, mitochondrial"""	602985	"""NADH dehydrogenase (ubiquinone) Fe-S protein 2 (49kD) (NADH-coenzyme Q reductase)"""			1832859, 9585441	Standard	NM_004550		Approved	CI-49	uc001fyw.3	O75306	OTTHUMG00000034344	ENST00000367993.3:c.*77->TGTGTG	1.37:g.161184060_161184065dupTGTGTG		Somatic	NA	NA	NA		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	D3DVG7|J3KPM7|Q5VTW0|Q969P3|Q9UEV3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367993.3	37	NULL	CCDS1224.1	1																																																																																			-	-		0.455	NDUFS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NDUFS2	protein_coding	OTTHUMT00000083015.1	-	NM_004550			161184060	+1	no_errors	ENST00000465923	ensembl	human	known	74_37	rna	INS	0.811:0.953	TGTGTG
DPM3	54344	genome.wustl.edu	37	1	155112582	155112600	+	Frame_Shift_Del	DEL	CAAGTAGGCGGGCAGTGGC	CAAGTAGGCGGGCAGTGGC	-			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	CAAGTAGGCGGGCAGTGGC	CAAGTAGGCGGGCAGTGGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:155112582_155112600delCAAGTAGGCGGGCAGTGGC	ENST00000341298.3	-	2	252_270	c.117_135delGCCACTGCCCGCCTACTTG	c.(115-135)tggccactgcccgcctacttgfs	p.WPLPAYL39fs	DPM3_ENST00000368399.1_Frame_Shift_Del_p.WPLPAYL69fs|DPM3_ENST00000368400.4_Frame_Shift_Del_p.WPLPAYL39fs			Q9P2X0	DPM3_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 3	39					C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein C-linked glycosylation via 2'-alpha-mannosyl-L-tryptophan (GO:0018406)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)|regulation of protein stability (GO:0031647)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|mannosyltransferase complex (GO:0031501)|membrane (GO:0016020)		p.P72P(1)		endometrium(2)	2	all_epithelial(22;4.71e-30)|all_lung(78;3.15e-27)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;2.28e-10)|all cancers(21;6.16e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000395)|LUSC - Lung squamous cell carcinoma(543;0.193)			CGGACACCAGCAAGTAGGCGGGCAGTGGCCACAGGACTT	0.653																																																	1	Substitution - coding silent(1)	endometrium(1)						ENSG00000179085																																			DPM3	SO:0001589	frameshift_variant	0				HGNC	AB028128	CCDS1094.1, CCDS1095.1	1q22	2013-02-26			ENSG00000179085	ENSG00000179085			3007	protein-coding gene	gene with protein product	"""DPM synthase complex subunit"""	605951				10835346	Standard	NM_018973		Approved	MGC34275, MGC125904, MGC125905	uc001fhm.3	Q9P2X0	OTTHUMG00000035335	ENST00000341298.3:c.117_135delGCCACTGCCCGCCTACTTG	1.37:g.155112582_155112600delCAAGTAGGCGGGCAGTGGC	ENSP00000344338:p.Trp39fs	Somatic	NA	NA	NA		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5SR62|Q5SR63|Q9BXN4|Q9BXN5	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DPM3	p.W39fs	ENST00000341298.3	37	c.135_117	CCDS1095.1	1																																																																																			-	pfam_DPM3		0.653	DPM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DPM3	protein_coding	OTTHUMT00000085519.1	CAAGTAGGCGGGCAGTGGC	NM_153741			155112600	-1	no_errors	ENST00000341298	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:0.999:1.000:1.000:1.000:1.000:1.000:1.000:0.996:1.000:1.000:1.000:1.000:0.996:0.988:1.000:1.000:1.000	-
PRSS53	339105	genome.wustl.edu	37	16	31097417	31097417	+	Nonsense_Mutation	SNP	G	G	A			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr16:31097417G>A	ENST00000280606.6	-	6	904	c.751C>T	c.(751-753)Cag>Tag	p.Q251*		NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	251	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						GCGTCCTCCTGGGCACAGCTT	0.632																																																	0								ENSG00000151006						72.0	76.0	75.0					16																	31097417		2085	4225	6310	PRSS53	SO:0001587	stop_gained	0			-	HGNC		CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.751C>T	16.37:g.31097417G>A	ENSP00000280606:p.Gln251*	Somatic	0	56	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	18	40.00		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.Q251*	ENST00000280606.6	37	c.751	CCDS42153.1	16	.	.	.	.	.	.	.	.	.	.	G	27.1	4.804263	0.90623	.	.	ENSG00000151006	ENST00000280606	.	.	.	5.63	5.63	0.86233	.	0.230236	0.21661	U	0.071014	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	10.5908	0.45308	0.0869:0.0:0.9131:0.0	.	.	.	.	X	251	.	ENSP00000280606:Q251X	Q	-	1	0	PRSS53	31004918	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.344000	0.44010	2.654000	0.90174	0.561000	0.74099	CAG	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.632	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS53	protein_coding	OTTHUMT00000108580.4	G	NM_001081268	-		31097417	-1	no_errors	ENST00000280606	ensembl	human	known	74_37	nonsense	SNP	1.000	A
GJD4	219770	genome.wustl.edu	37	10	35896211	35896212	+	Intron	INS	-	-	TGCTCT	rs374363365|rs112029096|rs374368221|rs56119205	byFrequency	TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr10:35896211_35896212insTGCTCT	ENST00000321660.1	+	2	222				RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa						cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						gaaCTACCTGATGCTGTGAGTA	0.426														4393	0.877196	0.6536	0.9395	5008	,	,		19886	0.9603		0.9801	False		,,,				2504	0.9438																0								ENSG00000273312																																			RP11-425A6.5	SO:0001627	intron_variant	0				Clone_based_vega_gene	AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.65-294->TGCTCT	10.37:g.35896211_35896212insTGCTCT		Somatic	NA	NA	NA		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8N2R7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000321660.1	37	NULL	CCDS7191.1	10																																																																																			-	-		0.426	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000273312	protein_coding	OTTHUMT00000047576.1	-	NM_153368			35896212	-1	no_errors	ENST00000609313	ensembl	human	known	74_37	rna	INS	0.000:0.000	TGCTCT
KRTAP4-5	85289	genome.wustl.edu	37	17	39305800	39305814	+	In_Frame_Del	DEL	TGGATTCACAGCAAT	TGGATTCACAGCAAT	-	rs141998775|rs377168597		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	TGGATTCACAGCAAT	TGGATTCACAGCAAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr17:39305800_39305814delTGGATTCACAGCAAT	ENST00000343246.4	-	1	240_254	c.206_220delATTGCTGTGAATCCA	c.(205-222)tattgctgtgaatccagc>tgc	p.69_74YCCESS>C		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	69	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			cggcagcagctggattcacagcaataggggcggca	0.665																																																	0								ENSG00000198271																																			KRTAP4-5	SO:0001651	inframe_deletion	0				HGNC	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.206_220delATTGCTGTGAATCCA	17.37:g.39305800_39305814delTGGATTCACAGCAAT	ENSP00000340546:p.Tyr69_Ser74delinsCys	Somatic	NA	NA	NA		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.YCCESS69in_frame_delC	ENST00000343246.4	37	c.220_206	CCDS32650.1	17																																																																																			-	NULL		0.665	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-5	protein_coding	OTTHUMT00000257783.1	TGGATTCACAGCAAT				39305814	-1	no_errors	ENST00000343246	ensembl	human	known	74_37	in_frame_del	DEL	0.689:0.524:0.472:0.042:0.004:0.003:0.006:0.126:0.849:0.943:0.982:0.981:0.896:0.000:0.000	-
KIAA1045	23349	genome.wustl.edu	37	9	34971603	34971603	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr9:34971603C>T	ENST00000242315.3	+	2	390	c.308C>T	c.(307-309)gCg>gTg	p.A103V	KIAA1045_ENST00000544237.1_Missense_Mutation_p.A103V|KIAA1045_ENST00000476115.2_Intron	NM_015297.1	NP_056112.1	Q9UPV7	K1045_HUMAN	KIAA1045	103							metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			LUSC - Lung squamous cell carcinoma(32;0.00575)			ACACCCCCTGCGTTCATCCGC	0.607																																																	0								ENSG00000122733						119.0	131.0	127.0					9																	34971603		1964	4158	6122	KIAA1045	SO:0001583	missense	0			-	HGNC	AB028968	CCDS43796.1	9p13.2	2008-02-05			ENSG00000122733	ENSG00000122733			29180	protein-coding gene	gene with protein product						10470851	Standard	NM_015297		Approved		uc003zvr.3	Q9UPV7	OTTHUMG00000019844	ENST00000242315.3:c.308C>T	9.37:g.34971603C>T	ENSP00000242315:p.Ala103Val	Somatic	0	33	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	19	44.12	B7Z253|Q58FE9|Q5T662	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_FYVE_PHD	p.A103V	ENST00000242315.3	37	c.308	CCDS43796.1	9	.	.	.	.	.	.	.	.	.	.	c	32	5.178381	0.94846	.	.	ENSG00000122733	ENST00000544237;ENST00000242315	.	.	.	5.93	5.93	0.95920	.	0.189219	0.45361	D	0.000361	T	0.76271	0.3964	L	0.59436	1.845	0.58432	D	0.999998	D	0.89917	1.0	D	0.67103	0.949	T	0.73072	-0.4098	8	.	.	.	-5.47	19.3291	0.94278	0.0:1.0:0.0:0.0	.	103	Q9UPV7	K1045_HUMAN	V	103	.	.	A	+	2	0	KIAA1045	34961603	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	7.342000	0.79310	2.814000	0.96858	0.655000	0.94253	GCG	-	NULL		0.607	KIAA1045-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1045	protein_coding	OTTHUMT00000052256.2	C	XM_048592	-		34971603	+1	no_errors	ENST00000242315	ensembl	human	known	74_37	missense	SNP	1.000	T
SMARCAL1	50485	genome.wustl.edu	37	2	217340155	217340155	+	Missense_Mutation	SNP	A	A	G			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr2:217340155A>G	ENST00000357276.4	+	15	2738	c.2408A>G	c.(2407-2409)gAg>gGg	p.E803G	SMARCAL1_ENST00000358207.5_Missense_Mutation_p.E803G	NM_014140.3	NP_054859.2	Q9NZC9	SMAL1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1	803	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA metabolic process (GO:0006259)|DNA strand renaturation (GO:0000733)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|replication fork processing (GO:0031297)	nucleus (GO:0005634)|site of double-strand break (GO:0035861)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(15)|ovary(3)|prostate(1)|skin(1)	42		Renal(323;0.0458)		Epithelial(149;9.48e-06)|all cancers(144;0.000621)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0111)		GTGTTTGCTGAGCTGTTTTGG	0.582									Schimke Immuno-Osseous Dysplasia																																								0								ENSG00000138375						108.0	99.0	102.0					2																	217340155		2203	4300	6503	SMARCAL1	SO:0001583	missense	0	Familial Cancer Database	SIOD	-	HGNC	AF210833	CCDS2403.1	2q35	2014-09-17			ENSG00000138375	ENSG00000138375			11102	protein-coding gene	gene with protein product	"""HepA-related protein"", ""ATP-driven annealing helicase"""	606622				10713074, 10857751, 18974355	Standard	NM_014140		Approved	HHARP, HARP	uc002vgd.4	Q9NZC9	OTTHUMG00000133055	ENST00000357276.4:c.2408A>G	2.37:g.217340155A>G	ENSP00000349823:p.Glu803Gly	Somatic	0	63	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	19	58.70	A6NEH0|Q53R00|Q96AY1|Q9NXQ5|Q9UFH3|Q9UI93	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HARP_dom,pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E803G	ENST00000357276.4	37	c.2408	CCDS2403.1	2	.	.	.	.	.	.	.	.	.	.	A	23.5	4.427445	0.83667	.	.	ENSG00000138375	ENST00000357276;ENST00000358207;ENST00000392128	D;D;T	0.92647	-3.08;-3.08;-0.93	5.13	5.13	0.70059	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.97164	0.9073	H	0.95224	3.64	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98243	1.0489	10	0.87932	D	0	-28.7131	14.2793	0.66200	1.0:0.0:0.0:0.0	.	803	Q9NZC9	SMAL1_HUMAN	G	803;803;645	ENSP00000349823:E803G;ENSP00000350940:E803G;ENSP00000375974:E645G	ENSP00000349823:E803G	E	+	2	0	SMARCAL1	217048400	1.000000	0.71417	0.735000	0.30896	0.967000	0.64934	8.951000	0.93025	2.154000	0.67381	0.528000	0.53228	GAG	-	pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C		0.582	SMARCAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCAL1	protein_coding	OTTHUMT00000256671.2	A		-		217340155	+1	no_errors	ENST00000357276	ensembl	human	known	74_37	missense	SNP	1.000	G
NOS1	4842	genome.wustl.edu	37	12	117768721	117768721	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr12:117768721C>T	ENST00000338101.4	-	1	158	c.154G>A	c.(154-156)Gca>Aca	p.A52T	NOS1_ENST00000317775.6_Missense_Mutation_p.A52T|NOS1_ENST00000549189.1_5'Flank|NOS1_ENST00000344089.3_Missense_Mutation_p.A52T			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0	Essential for its translational repressor activity. {ECO:0000250}.				cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CTCTGCTCTGCGGCGCCCCCA	0.612																																					Esophageal Squamous(162;1748 2599 51982 52956)												0								ENSG00000089250						39.0	42.0	41.0					12																	117768721		1947	4142	6089	NOS1	SO:0001583	missense	0			-	HGNC		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.154G>A	12.37:g.117768721C>T	ENSP00000337459:p.Ala52Thr	Somatic	0	65	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	11	54.17		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.A52T	ENST00000338101.4	37	c.154	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	C	19.48	3.835301	0.71373	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000344089;ENST00000338101	T;T;T	0.44482	0.92;0.92;0.92	4.92	4.92	0.64577	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.74283	0.3696	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82182	-0.0584	10	0.87932	D	0	-29.5159	18.3171	0.90225	0.0:1.0:0.0:0.0	.	52	P29475	NOS1_HUMAN	T	52	ENSP00000320758:A52T;ENSP00000339862:A52T;ENSP00000337459:A52T	ENSP00000320758:A52T	A	-	1	0	NOS1	116253104	1.000000	0.71417	0.112000	0.21494	0.003000	0.03518	7.320000	0.79064	2.554000	0.86153	0.561000	0.74099	GCA	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_NOS_euk,pfscan_PDZ		0.612	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	protein_coding	OTTHUMT00000268053.1	C		-		117768721	-1	no_errors	ENST00000317775	ensembl	human	known	74_37	missense	SNP	0.998	T
ZFHX4	79776	genome.wustl.edu	37	8	77767606	77767606	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr8:77767606G>T	ENST00000521891.2	+	10	8897	c.8449G>T	c.(8449-8451)Gac>Tac	p.D2817Y	ZFHX4_ENST00000050961.6_Missense_Mutation_p.D2772Y|ZFHX4_ENST00000455469.2_Missense_Mutation_p.D2772Y|ZFHX4_ENST00000518282.1_Missense_Mutation_p.D2791Y	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2772					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CACCACCGGAGACGAGGGAAA	0.468										HNSCC(33;0.089)																																							0								ENSG00000091656						51.0	52.0	51.0					8																	77767606		1959	4154	6113	ZFHX4	SO:0001583	missense	0			-	HGNC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8449G>T	8.37:g.77767606G>T	ENSP00000430497:p.Asp2817Tyr	Somatic	0	33	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.D2817Y	ENST00000521891.2	37	c.8449	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480011	0.26598	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.61158	0.13;0.19;0.16;0.15	4.98	4.98	0.66077	.	0.000000	0.45867	U	0.000325	T	0.73148	0.3550	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	T	0.75682	-0.3233	10	0.87932	D	0	.	18.4359	0.90646	0.0:0.0:1.0:0.0	.	2772;2772;2817	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	Y	2817;2801;2772;2772;2791	ENSP00000430497:D2817Y;ENSP00000399605:D2772Y;ENSP00000050961:D2772Y;ENSP00000430848:D2791Y	ENSP00000050961:D2772Y	D	+	1	0	ZFHX4	77930161	1.000000	0.71417	0.112000	0.21494	0.218000	0.24690	9.657000	0.98554	2.588000	0.87417	0.561000	0.74099	GAC	-	NULL		0.468	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	protein_coding	OTTHUMT00000379197.2	G	NM_024721	-		77767606	+1	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	SNP	1.000	T
BMS1P8	653557	genome.wustl.edu	37	16	33497291	33497291	+	RNA	SNP	G	G	A	rs201348007		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr16:33497291G>A	ENST00000565156.1	-	0	543									BMS1 pseudogene 8																		CAAATTTAACGTTAGACTTTA	0.338																																																	0								ENSG00000260518																																			BMS1P8			0			-	HGNC			16p11.2	2013-09-20			ENSG00000260518	ENSG00000260518			49152	pseudogene	pseudogene							Standard	NG_011420		Approved				OTTHUMG00000176352		16.37:g.33497291G>A		Somatic	0	57	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	42	10.64		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000565156.1	37	NULL		16																																																																																			-	-		0.338	BMS1P8-003	KNOWN	basic	processed_transcript	BMS1P8	pseudogene	OTTHUMT00000431810.1	G		rs201348007		33497291	-1	no_errors	ENST00000565156	ensembl	human	known	74_37	rna	SNP	0.227	A
IFNE	338376	genome.wustl.edu	37	9	21481376	21481376	+	Silent	SNP	C	C	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr9:21481376C>T	ENST00000448696.3	-	1	936	c.318G>A	c.(316-318)acG>acA	p.T106T	MIR31HG_ENST00000304425.3_RNA	NM_176891.4	NP_795372.1	Q86WN2	IFNE_HUMAN	interferon, epsilon	106					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)	extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(2)|lung(1)|skin(1)	4						GGAATTTCTCCGTGTGGTTTT	0.453																																																	0								ENSG00000184995						154.0	147.0	149.0					9																	21481376		2203	4300	6503	IFNE	SO:0001819	synonymous_variant	0			-	HGNC	AY190045	CCDS34997.1	9p21.1	2008-12-12			ENSG00000184995	ENSG00000184995			18163	protein-coding gene	gene with protein product		615223				15546383, 17287131	Standard	NM_176891		Approved	IFNE1	uc003zpg.3	Q86WN2	OTTHUMG00000019672	ENST00000448696.3:c.318G>A	9.37:g.21481376C>T		Somatic	0	30	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	16	52.94		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.T106	ENST00000448696.3	37	c.318	CCDS34997.1	9																																																																																			-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta		0.453	IFNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNE	protein_coding	OTTHUMT00000051901.2	C	NM_176891	-		21481376	-1	no_errors	ENST00000448696	ensembl	human	known	74_37	silent	SNP	0.000	T
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
CD276	80381	genome.wustl.edu	37	15	73994860	73994860	+	Missense_Mutation	SNP	C	C	T	rs537842985	byFrequency	TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr15:73994860C>T	ENST00000318443.5	+	3	646	c.344C>T	c.(343-345)gCg>gTg	p.A115V	CD276_ENST00000318424.5_Missense_Mutation_p.A115V|CD276_ENST00000564751.1_Missense_Mutation_p.A115V|CD276_ENST00000561213.1_Missense_Mutation_p.A115V|CD276_ENST00000537340.2_5'UTR	NM_001024736.1	NP_001019907.1	Q5ZPR3	CD276_HUMAN	CD276 molecule	115	Ig-like V-type 1.				cell proliferation (GO:0008283)|immune response (GO:0006955)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of bone mineralization (GO:0030501)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			endometrium(3)|lung(5)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	13						GTGCGTGTGGCGGACGAGGGC	0.697													C|||	2	0.000399361	0.0	0.0	5008	,	,		18352	0.002		0.0	False		,,,				2504	0.0																0								ENSG00000103855						43.0	38.0	39.0					15																	73994860		2198	4295	6493	CD276	SO:0001583	missense	0			-	HGNC	AF302102	CCDS10251.1, CCDS32288.1	15q23-q24	2013-01-11	2006-03-28		ENSG00000103855	ENSG00000103855		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19137	protein-coding gene	gene with protein product		605715	"""CD276 antigen"""			11224528, 12055244	Standard	XM_005254699		Approved	B7-H3, B7H3, B7RP-2	uc002avv.1	Q5ZPR3	OTTHUMG00000137585	ENST00000318443.5:c.344C>T	15.37:g.73994860C>T	ENSP00000320084:p.Ala115Val	Somatic	0	95	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	41	38.81	Q6P5Y4|Q6UXI2|Q8NBI8|Q8NC34|Q8NCB6|Q9BXR1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_CD80_C2-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ig_C1-set,pfscan_Ig-like_dom	p.A115V	ENST00000318443.5	37	c.344	CCDS32288.1	15	.	.	.	.	.	.	.	.	.	.	C	11.44	1.640230	0.29157	.	.	ENSG00000103855	ENST00000318424;ENST00000318443;ENST00000379823	T;T	0.02837	4.14;4.14	2.79	2.79	0.32731	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.03520	0.0101	L	0.49455	1.56	0.34625	D	0.71896	B;B;B;B	0.28178	0.105;0.189;0.202;0.168	B;B;B;B	0.24701	0.014;0.046;0.055;0.032	T	0.18304	-1.0341	9	0.44086	T	0.13	-14.8162	8.486	0.33071	0.0:0.8833:0.0:0.1167	.	61;115;115;115	B4DK26;Q5ZPR3-2;Q5ZPR3;Q5ZPR3-4	.;.;CD276_HUMAN;.	V	115	ENSP00000320058:A115V;ENSP00000320084:A115V	ENSP00000320058:A115V	A	+	2	0	CD276	71781913	0.993000	0.37304	0.907000	0.35723	0.716000	0.41182	3.294000	0.51787	1.866000	0.54105	0.313000	0.20887	GCG	-	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom		0.697	CD276-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD276	protein_coding	OTTHUMT00000268979.1	C	NM_025240	-		73994860	+1	no_errors	ENST00000318443	ensembl	human	known	74_37	missense	SNP	0.959	T
ZNF679	168417	genome.wustl.edu	37	7	63727246	63727246	+	Nonstop_Mutation	SNP	A	A	C			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr7:63727246A>C	ENST00000421025.1	+	5	1504	c.1235A>C	c.(1234-1236)tAa>tCa	p.*412S	ZNF679_ENST00000255746.4_Nonstop_Mutation_p.*412S	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						AAATGTGAATAATGTGATAAA	0.348																																																	0								ENSG00000197123						15.0	14.0	14.0					7																	63727246		692	1589	2281	ZNF679	SO:0001578	stop_lost	0			-	HGNC	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.1235A>C	7.37:g.63727246A>C	ENSP00000416809:p.*412Serext*18	Somatic	0	27	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	27	34.15		Nonstop_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.*412S	ENST00000421025.1	37	c.1235	CCDS47592.1	7	.	.	.	.	.	.	.	.	.	.	A	2.116	-0.402482	0.04865	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	.	.	.	0.819	0.819	0.18785	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.7374	0.08515	1.0:0.0:0.0:0.0	.	.	.	.	S	412	.	.	X	+	2	2	ZNF679	63364681	0.000000	0.05858	0.184000	0.23157	0.184000	0.23303	0.147000	0.16202	0.165000	0.19558	0.163000	0.16589	TAA	-	NULL		0.348	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF679	protein_coding	OTTHUMT00000344317.2	A	NM_153363	-		63727246	+1	no_errors	ENST00000255746	ensembl	human	known	74_37	nonstop	SNP	0.004	C
CCDC91	55297	genome.wustl.edu	37	12	28459799	28459799	+	Missense_Mutation	SNP	A	A	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr12:28459799A>T	ENST00000545336.1	+	8	811	c.392A>T	c.(391-393)aAc>aTc	p.N131I	CCDC91_ENST00000540401.1_3'UTR|CCDC91_ENST00000381259.1_Missense_Mutation_p.N131I|CCDC91_ENST00000539107.1_Missense_Mutation_p.N131I|CCDC91_ENST00000306172.5_Missense_Mutation_p.N101I|CCDC91_ENST00000381256.1_Missense_Mutation_p.N131I			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	131					protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					AATGTATCTAACATACAGCTT	0.348																																																	0								ENSG00000123106						79.0	83.0	82.0					12																	28459799		2203	4300	6503	CCDC91	SO:0001583	missense	0			-	HGNC	AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.392A>T	12.37:g.28459799A>T	ENSP00000438040:p.Asn131Ile	Somatic	0	35	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	9	55.00	B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.N131I	ENST00000545336.1	37	c.392	CCDS8716.1	12	.	.	.	.	.	.	.	.	.	.	A	17.35	3.368607	0.61624	.	.	ENSG00000123106	ENST00000539107;ENST00000536442;ENST00000545336;ENST00000545737;ENST00000381259;ENST00000381256;ENST00000306172	T;T;T;T;T;T;T	0.40476	1.03;1.37;1.37;1.37;1.37;1.03;1.36	5.52	4.36	0.52297	.	0.303905	0.28589	N	0.014820	T	0.42698	0.1214	N	0.24115	0.695	0.29969	N	0.818711	D;P	0.58268	0.982;0.739	P;B	0.57911	0.829;0.221	T	0.41288	-0.9517	10	0.62326	D	0.03	-7.3256	9.6662	0.39986	0.8249:0.1751:0.0:0.0	.	131;101	Q7Z6B0;Q7Z6B0-2	CCD91_HUMAN;.	I	131;131;131;131;131;131;101	ENSP00000440513:N131I;ENSP00000445660:N131I;ENSP00000438040:N131I;ENSP00000442544:N131I;ENSP00000370658:N131I;ENSP00000370655:N131I;ENSP00000305075:N101I	ENSP00000305075:N101I	N	+	2	0	CCDC91	28351066	0.995000	0.38212	0.976000	0.42696	0.914000	0.54420	2.430000	0.44766	0.899000	0.36444	0.528000	0.53228	AAC	-	NULL		0.348	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC91	protein_coding	OTTHUMT00000402447.1	A	NM_018318	-		28459799	+1	no_errors	ENST00000381259	ensembl	human	known	74_37	missense	SNP	0.934	T
USP4	7375	genome.wustl.edu	37	3	49363168	49363168	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr3:49363168G>T	ENST00000265560.4	-	4	517	c.471C>A	c.(469-471)agC>agA	p.S157R	USP4_ENST00000351842.4_Missense_Mutation_p.S157R|USP4_ENST00000415188.1_Missense_Mutation_p.S157R|USP4_ENST00000416417.1_Missense_Mutation_p.S157R	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	157	Necessary for interaction with SART3. {ECO:0000269|PubMed:20595234}.|Ubiquitin-like 1.				negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		TGTCTGCCTTGCTGAAATGGC	0.517																																																	0								ENSG00000114316						226.0	219.0	222.0					3																	49363168		2203	4300	6503	USP4	SO:0001583	missense	0			-	HGNC	U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.471C>A	3.37:g.49363168G>T	ENSP00000265560:p.Ser157Arg	Somatic	0	69	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19/C67	p.S157R	ENST00000265560.4	37	c.471	CCDS2793.1	3	.	.	.	.	.	.	.	.	.	.	G	18.73	3.685738	0.68157	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.38560	1.7;1.78;1.13	5.69	4.82	0.62117	.	0.147023	0.85682	D	0.000000	T	0.57858	0.2082	L	0.52126	1.63	0.54753	D	0.999981	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.979	T	0.61133	-0.7124	10	0.87932	D	0	-8.1852	13.3845	0.60789	0.0761:0.0:0.9238:0.0	.	157;157	Q13107-2;Q13107	.;UBP4_HUMAN	R	157	ENSP00000341028:S157R;ENSP00000265560:S157R;ENSP00000400623:S157R	ENSP00000265560:S157R	S	-	3	2	USP4	49338172	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	4.465000	0.60141	1.433000	0.47394	-0.361000	0.07541	AGC	-	NULL		0.517	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP4	protein_coding	OTTHUMT00000346069.1	G	NM_199443	-		49363168	-1	no_errors	ENST00000265560	ensembl	human	known	74_37	missense	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000359597.4_Missense_Mutation_p.R248W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	GRCh37	CM010465|CM900211	TP53	M	rs121912651	ENSG00000141510						151.0	112.0	125.0					17																	7577539		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic	0	68	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	64	5	92.75	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	G	NM_000546	rs121912651		7577539	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	A
PLSCR1	5359	genome.wustl.edu	37	3	146234963	146234963	+	Intron	DEL	A	A	-			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr3:146234963delA	ENST00000342435.4	-	8	1149				PLSCR1_ENST00000484560.1_5'UTR|PLSCR1_ENST00000487389.1_Intron|PLSCR1_ENST00000448787.2_Intron|PLSCR1_ENST00000448205.1_Intron	NM_021105.2	NP_066928.1	O15162	PLS1_HUMAN	phospholipid scramblase 1						acute-phase response (GO:0006953)|apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|negative regulation of viral genome replication (GO:0045071)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid scrambling (GO:0017121)|platelet activation (GO:0030168)|positive regulation of DNA topoisomerase (ATP-hydrolyzing) activity (GO:2000373)|positive regulation of gene expression (GO:0010628)|positive regulation of innate immune response (GO:0045089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060368)|regulation of mast cell activation (GO:0033003)|response to interferon-beta (GO:0035456)	cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|CD4 receptor binding (GO:0042609)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|epidermal growth factor receptor binding (GO:0005154)|phospholipid scramblase activity (GO:0017128)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)	15						ATCTAAATTGAAAAAAAAAAG	0.294																																																	0								ENSG00000188313						29.0	31.0	30.0					3																	146234963		2200	4299	6499	PLSCR1	SO:0001627	intron_variant	0				HGNC	AF098642	CCDS3135.1	3q23	2004-02-27			ENSG00000188313	ENSG00000188313			9092	protein-coding gene	gene with protein product		604170				9218461	Standard	NM_021105		Approved	MMTRA1B	uc003evx.4	O15162	OTTHUMG00000159427	ENST00000342435.4:c.739-9T>-	3.37:g.146234963delA		Somatic	0	23	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	B2R8H8|B4DTE8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000342435.4	37	NULL	CCDS3135.1	3																																																																																			-	-		0.294	PLSCR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLSCR1	protein_coding	OTTHUMT00000355257.2	A	NM_021105			146234963	-1	no_errors	ENST00000484560	ensembl	human	putative	74_37	rna	DEL	0.163	-
ZNF175	7728	genome.wustl.edu	37	19	52090454	52090454	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr19:52090454G>T	ENST00000262259.2	+	5	1228	c.870G>T	c.(868-870)caG>caT	p.Q290H	ZNF175_ENST00000436511.2_Intron	NM_007147.2	NP_009078.1	Q9Y473	ZN175_HUMAN	zinc finger protein 175	290					defense response to virus (GO:0051607)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		GCTTCACCCAGAAGTCACACC	0.438																																																	0								ENSG00000105497						101.0	104.0	103.0					19																	52090454		2203	4299	6502	ZNF175	SO:0001583	missense	0			-	HGNC	D50419	CCDS12837.1	19q13.4	2013-01-08			ENSG00000105497	ENSG00000105497		"""Zinc fingers, C2H2-type"", ""-"""	12964	protein-coding gene	gene with protein product		601139				8838321	Standard	NM_007147		Approved	OTK18	uc002pxb.3	Q9Y473	OTTHUMG00000167771	ENST00000262259.2:c.870G>T	19.37:g.52090454G>T	ENSP00000262259:p.Gln290His	Somatic	0	32	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	9	66.67	A8K9H2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q290H	ENST00000262259.2	37	c.870	CCDS12837.1	19	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.830557	0.00584	.	.	ENSG00000105497	ENST00000262259	T	0.60797	0.16	2.43	-2.5	0.06384	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.45577	0.1349	L	0.53729	1.69	0.09310	N	0.999998	B	0.09022	0.002	B	0.06405	0.002	T	0.31475	-0.9942	9	0.39692	T	0.17	.	5.3186	0.15870	0.4222:0.1486:0.4292:0.0	.	290	Q9Y473	ZN175_HUMAN	H	290	ENSP00000262259:Q290H	ENSP00000262259:Q290H	Q	+	3	2	ZNF175	56782266	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.929000	0.00332	-0.880000	0.03997	-1.731000	0.00696	CAG	-	pfscan_Znf_C2H2		0.438	ZNF175-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF175	protein_coding	OTTHUMT00000396205.1	G	NM_007147	-		52090454	+1	no_errors	ENST00000262259	ensembl	human	known	74_37	missense	SNP	0.000	T
ADAMTSL4	54507	genome.wustl.edu	37	1	150524368	150524368	+	Intron	DEL	A	A	-	rs199813152		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:150524368delA	ENST00000271643.4	+	3	152				RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000369038.2_5'Flank|ADAMTSL4_ENST00000483335.1_3'UTR|MIR4257_ENST00000581735.1_RNA|ADAMTSL4_ENST00000369041.5_Intron|ADAMTSL4_ENST00000369039.5_Intron	NM_019032.4	NP_061905.2	Q6UY14	ATL4_HUMAN	ADAMTS-like 4						apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			tctccatctcaaaaaaaaaaa	0.527																																																	0								ENSG00000143382																																			ADAMTSL4	SO:0001627	intron_variant	0				HGNC	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000271643.4:c.-84-313A>-	1.37:g.150524368delA		Somatic	0	25	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	20	23.08	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000271643.4	37	NULL	CCDS955.1	1																																																																																			-	-		0.527	ADAMTSL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL4	protein_coding		A	NM_019032			150524368	+1	no_errors	ENST00000483335	ensembl	human	known	74_37	rna	DEL	0.000	-
SHROOM2	357	genome.wustl.edu	37	X	9905320	9905320	+	Missense_Mutation	SNP	A	A	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chrX:9905320A>T	ENST00000380913.3	+	7	3824	c.3734A>T	c.(3733-3735)gAc>gTc	p.D1245V	SHROOM2_ENST00000418909.2_Missense_Mutation_p.D80V	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1245			D -> H (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				CTGGAGAAAGACCAGATCAAG	0.647																																																	0								ENSG00000146950						47.0	40.0	42.0					X																	9905320		2198	4299	6497	SHROOM2	SO:0001583	missense	0			-	HGNC	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.3734A>T	X.37:g.9905320A>T	ENSP00000370299:p.Asp1245Val	Somatic	0	96	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	42	38.24	B9EIQ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D1245V	ENST00000380913.3	37	c.3734	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	A	18.93	3.727425	0.69074	.	.	ENSG00000146950	ENST00000380913;ENST00000418909;ENST00000452575;ENST00000540923	T;T;T	0.46451	2.37;1.46;0.87	4.98	4.98	0.66077	.	0.183785	0.47455	D	0.000239	T	0.60431	0.2268	L	0.58101	1.795	0.58432	D	0.999999	P;D	0.89917	0.941;1.0	B;D	0.85130	0.35;0.997	T	0.63883	-0.6536	10	0.72032	D	0.01	-38.6128	13.8783	0.63667	1.0:0.0:0.0:0.0	.	80;1245	Q68DU3;Q13796	.;SHRM2_HUMAN	V	1245;80;80;80	ENSP00000370299:D1245V;ENSP00000415229:D80V;ENSP00000406724:D80V	ENSP00000370299:D1245V	D	+	2	0	SHROOM2	9865320	1.000000	0.71417	0.981000	0.43875	0.943000	0.58893	2.479000	0.45197	1.652000	0.50683	0.481000	0.45027	GAC	-	NULL		0.647	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	protein_coding	OTTHUMT00000055721.1	A	NM_001649	-		9905320	+1	no_errors	ENST00000380913	ensembl	human	known	74_37	missense	SNP	0.991	T
C6orf15	29113	genome.wustl.edu	37	6	31079360	31079360	+	Missense_Mutation	SNP	C	C	G			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr6:31079360C>G	ENST00000259870.3	-	2	779	c.776G>C	c.(775-777)gGc>gCc	p.G259A		NM_014070.2	NP_054789.2	Q6UXA7	CF015_HUMAN	chromosome 6 open reading frame 15	259	Gly-rich.				extracellular matrix organization (GO:0030198)	interstitial matrix (GO:0005614)	heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			endometrium(3)|large_intestine(2)|lung(9)|prostate(1)|skin(1)|stomach(1)	17						TCCCCAGCTGCCTCCTGGATA	0.517																																																	0								ENSG00000204542						60.0	71.0	67.0					6																	31079360		1734	3327	5061	C6orf15	SO:0001583	missense	0			-	HGNC	AB031481	CCDS4693.1	6p21	2011-12-12			ENSG00000204542	ENSG00000204542			13927	protein-coding gene	gene with protein product		611401					Standard	NM_014070		Approved	STG	uc003nsk.1	Q6UXA7	OTTHUMG00000031111	ENST00000259870.3:c.776G>C	6.37:g.31079360C>G	ENSP00000259870:p.Gly259Ala	Somatic	0	35	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B0S7V8|Q0EFA6|Q2L6G7|Q5SQ81|Q86Z05|Q9UIG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G259A	ENST00000259870.3	37	c.776	CCDS4693.1	6	.	.	.	.	.	.	.	.	.	.	C	5.808	0.333313	0.11013	.	.	ENSG00000204542	ENST00000259870	T	0.06142	3.34	3.45	1.39	0.22231	.	1.539810	0.04087	N	0.310585	T	0.02304	0.0071	L	0.43152	1.355	0.09310	N	1	P	0.35192	0.489	B	0.39465	0.3	T	0.44832	-0.9302	10	0.07482	T	0.82	.	10.8849	0.46962	0.0:0.6133:0.3867:0.0	.	259	Q6UXA7	CF015_HUMAN	A	259	ENSP00000259870:G259A	ENSP00000259870:G259A	G	-	2	0	C6orf15	31187339	0.001000	0.12720	0.002000	0.10522	0.043000	0.13939	-0.035000	0.12205	0.607000	0.29982	0.391000	0.25812	GGC	-	NULL		0.517	C6orf15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf15	protein_coding	OTTHUMT00000076184.2	C	NM_014070	-		31079360	-1	no_errors	ENST00000259870	ensembl	human	known	74_37	missense	SNP	0.000	G
VPS16	64601	genome.wustl.edu	37	20	2845867	2845867	+	Missense_Mutation	SNP	A	A	G			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr20:2845867A>G	ENST00000380445.3	+	21	2150	c.2078A>G	c.(2077-2079)gAc>gGc	p.D693G	PTPRA_ENST00000380393.3_5'UTR|VPS16_ENST00000380443.3_Missense_Mutation_p.D379G|VPS16_ENST00000380469.3_Missense_Mutation_p.D549G	NM_022575.2	NP_072097.2	Q9H269	VPS16_HUMAN	vacuolar protein sorting 16 homolog (S. cerevisiae)	693					intracellular protein transport (GO:0006886)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|axon (GO:0030424)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|recycling endosome (GO:0055037)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	37						CAGTTCCTAGACCTGTCTCTA	0.577																																																	0								ENSG00000215305						81.0	76.0	78.0					20																	2845867		2203	4300	6503	VPS16	SO:0001583	missense	0			-	HGNC	AF308801	CCDS13036.1, CCDS13037.1	20p13	2009-07-07	2009-07-07	2009-07-07	ENSG00000215305	ENSG00000215305			14584	protein-coding gene	gene with protein product		608550					Standard	NM_022575		Approved		uc002whe.3	Q9H269	OTTHUMG00000031714	ENST00000380445.3:c.2078A>G	20.37:g.2845867A>G	ENSP00000369810:p.Asp693Gly	Somatic	0	31	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	14	58.82	Q5JUB1|Q8WU31|Q96EE7|Q96N92|Q9H1Q4|Q9H1Q5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Vps16_N,pfam_Vps16_C,pirsf_VPS16	p.D693G	ENST00000380445.3	37	c.2078	CCDS13036.1	20	.	.	.	.	.	.	.	.	.	.	A	2.049	-0.418175	0.04766	.	.	ENSG00000215305	ENST00000380445;ENST00000380469;ENST00000380443	T;T;T	0.46063	0.88;0.88;0.88	4.89	4.89	0.63831	Vps16, C-terminal (1);	0.148562	0.64402	D	0.000010	T	0.14227	0.0344	N	0.01122	-1.005	0.80722	D	1	B;B;B;B	0.15930	0.001;0.015;0.005;0.005	B;B;B;B	0.12837	0.003;0.008;0.008;0.005	T	0.19386	-1.0307	10	0.05959	T	0.93	-16.7413	12.7566	0.57339	1.0:0.0:0.0:0.0	.	169;379;549;693	A1A4H0;Q5JUA8;Q9H269-2;Q9H269	.;.;.;VPS16_HUMAN	G	693;549;379	ENSP00000369810:D693G;ENSP00000369836:D549G;ENSP00000369808:D379G	ENSP00000369808:D379G	D	+	2	0	VPS16	2793867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.301000	0.65727	1.967000	0.57214	0.533000	0.62120	GAC	-	pfam_Vps16_C,pirsf_VPS16		0.577	VPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS16	protein_coding	OTTHUMT00000077658.2	A	NM_022575	-		2845867	+1	no_errors	ENST00000380445	ensembl	human	known	74_37	missense	SNP	1.000	G
ATP2B1	490	genome.wustl.edu	37	12	89997635	89997635	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr12:89997635G>T	ENST00000428670.3	-	17	3158	c.2702C>A	c.(2701-2703)gCt>gAt	p.A901D	ATP2B1_ENST00000393164.2_Missense_Mutation_p.A644D|ATP2B1_ENST00000348959.3_Missense_Mutation_p.A901D|ATP2B1_ENST00000261173.2_Missense_Mutation_p.A901D|ATP2B1_ENST00000359142.3_Missense_Mutation_p.A901D			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	901					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						CGTTGCCAGAGCCAGGGAAGC	0.448																																																	0								ENSG00000070961						99.0	87.0	91.0					12																	89997635		2203	4300	6503	ATP2B1	SO:0001583	missense	0			-	HGNC	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.2702C>A	12.37:g.89997635G>T	ENSP00000392043:p.Ala901Asp	Somatic	0	66	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.A901D	ENST00000428670.3	37	c.2702	CCDS9035.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.327511	0.95733	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	D;D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44;-4.44	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.99299	0.9755	H	0.99286	4.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.994;0.997	D	0.98429	1.0581	10	0.87932	D	0	-13.2784	20.3242	0.98691	0.0:0.0:1.0:0.0	.	901;901;901	P20020-3;P20020-2;P20020-6	.;.;.	D	901;901;901;901;644	ENSP00000261173:A901D;ENSP00000343599:A901D;ENSP00000352054:A901D;ENSP00000392043:A901D;ENSP00000376869:A644D	ENSP00000261173:A901D	A	-	2	0	ATP2B1	88521766	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.882000	0.98803	0.655000	0.94253	GCT	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_Ca-transp_plasma		0.448	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	protein_coding	OTTHUMT00000406653.1	G	NM_001682	-		89997635	-1	no_errors	ENST00000261173	ensembl	human	known	74_37	missense	SNP	1.000	T
HELZ2	85441	genome.wustl.edu	37	20	62202709	62202709	+	Intron	SNP	C	C	A			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr20:62202709C>A	ENST00000467148.1	-	2	348				HELZ2_ENST00000479540.1_5'UTR	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator						cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)										GTGGTGGGCTCCTGCCCCGCT	0.692																																																	0								ENSG00000130589																																			HELZ2	SO:0001627	intron_variant	0			-	HGNC	AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.279-488G>T	20.37:g.62202709C>A		Somatic	0	29	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	30	16.67	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467148.1	37	NULL	CCDS33508.1	20																																																																																			-	-		0.692	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	protein_coding	OTTHUMT00000354127.1	C	NM_001037335	-		62202709	-1	no_errors	ENST00000479540	ensembl	human	known	74_37	rna	SNP	0.865	A
ADK	132	genome.wustl.edu	37	10	76154021	76154021	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr10:76154021G>T	ENST00000286621.2	+	5	446	c.396G>T	c.(394-396)caG>caT	p.Q132H	ADK_ENST00000539909.1_Missense_Mutation_p.Q132H|ADK_ENST00000541550.1_Missense_Mutation_p.Q97H|ADK_ENST00000372734.3_Missense_Mutation_p.Q115H	NM_006721.3	NP_006712.2	P55263	ADK_HUMAN	adenosine kinase	132					adenosine metabolic process (GO:0046085)|AMP salvage (GO:0044209)|circadian regulation of gene expression (GO:0032922)|dATP biosynthetic process (GO:0006175)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of T cell proliferation (GO:0042102)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|type B pancreatic cell proliferation (GO:0044342)	cytosol (GO:0005829)|nucleus (GO:0005634)	adenosine kinase activity (GO:0004001)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)|poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(2)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	8	Prostate(51;0.0112)|Ovarian(15;0.148)				Abacavir(DB01048)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Adenosine(DB00640)|Ribavirin(DB00811)	ACTACGAGCAGAATGAGCAGC	0.433																																																	0								ENSG00000156110						92.0	90.0	91.0					10																	76154021		2203	4300	6503	ADK	SO:0001583	missense	0			-	HGNC	U50196	CCDS7343.1, CCDS7344.1, CCDS55716.1, CCDS55717.1	10q22.2	2006-02-21			ENSG00000156110	ENSG00000156110	2.7.1.20		257	protein-coding gene	gene with protein product	"""adenosine 5'-phosphotransferase"""	102750				8577746	Standard	NM_001123		Approved	AK	uc001jwi.3	P55263	OTTHUMG00000018506	ENST00000286621.2:c.396G>T	10.37:g.76154021G>T	ENSP00000286621:p.Gln132His	Somatic	0	34	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B7Z783|B7Z800|O00741|O00742|Q16710|Q5JQ10|Q5JQ11|Q9BTN2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PfkB_dom,prints_Adenokinase	p.Q132H	ENST00000286621.2	37	c.396	CCDS7343.1	10	.	.	.	.	.	.	.	.	.	.	G	15.68	2.905807	0.52333	.	.	ENSG00000156110	ENST00000539909;ENST00000286621;ENST00000372734;ENST00000541550	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	5.68	4.75	0.60458	Carbohydrate/purine kinase (1);	0.000000	0.85682	D	0.000000	D	0.84719	0.5534	L	0.58428	1.81	0.58432	D	0.999997	D;B;D;B	0.89917	0.999;0.126;1.0;0.127	D;B;D;B	0.97110	0.982;0.246;1.0;0.071	T	0.83148	-0.0105	10	0.32370	T	0.25	-10.9712	13.8237	0.63338	0.0762:0.0:0.9238:0.0	.	97;132;115;132	B7Z800;B7Z783;Q5JQ10;P55263	.;.;.;ADK_HUMAN	H	132;132;115;97	ENSP00000443965:Q132H;ENSP00000286621:Q132H;ENSP00000361819:Q115H;ENSP00000438321:Q97H	ENSP00000286621:Q132H	Q	+	3	2	ADK	75824027	1.000000	0.71417	0.999000	0.59377	0.612000	0.37316	4.479000	0.60236	1.328000	0.45358	0.563000	0.77884	CAG	-	pfam_PfkB_dom		0.433	ADK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADK	protein_coding	OTTHUMT00000048763.1	G	NM_001123, NM_006721	-		76154021	+1	no_errors	ENST00000286621	ensembl	human	known	74_37	missense	SNP	1.000	T
VCPIP1	80124	genome.wustl.edu	37	8	67577245	67577245	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr8:67577245G>C	ENST00000310421.4	-	1	2207	c.1949C>G	c.(1948-1950)aCt>aGt	p.T650S	C8orf44_ENST00000519561.1_5'Flank|C8orf44-SGK3_ENST00000519289.1_5'Flank|C8orf44_ENST00000521889.1_5'Flank	NM_025054.4	NP_079330.2	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex interacting protein 1	650					endoplasmic reticulum membrane fusion (GO:0016320)|Golgi reassembly (GO:0090168)|mitotic nuclear division (GO:0007067)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)	ubiquitin-specific protease activity (GO:0004843)			breast(7)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(6)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			ATGCAATATAGTGTGGACAAC	0.388																																					NSCLC(179;265 2915 6144 43644)												0								ENSG00000175073						167.0	173.0	171.0					8																	67577245		2203	4300	6503	VCPIP1	SO:0001583	missense	0			-	HGNC	AB058753	CCDS6192.1	8q13	2014-02-24			ENSG00000175073	ENSG00000175073		"""OTU domain containing"""	30897	protein-coding gene	gene with protein product		611745				11347906, 12509440	Standard	NM_025054		Approved	VCIP135, KIAA1850, FLJ23132, DUBA3	uc003xwn.3	Q96JH7	OTTHUMG00000164560	ENST00000310421.4:c.1949C>G	8.37:g.67577245G>C	ENSP00000309031:p.Thr650Ser	Somatic	0	41	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	32	42.86	Q504T4|Q86T93|Q86W01|Q8N3A9|Q9H5R8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OTU,pfscan_OTU	p.T650S	ENST00000310421.4	37	c.1949	CCDS6192.1	8	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614303	0.46631	.	.	ENSG00000175073	ENST00000310421	T	0.33654	1.4	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.44603	0.1301	L	0.54323	1.7	0.80722	D	1	P	0.45902	0.868	P	0.46110	0.504	T	0.46219	-0.9207	10	0.72032	D	0.01	-12.7381	19.2059	0.93729	0.0:0.0:1.0:0.0	.	650	Q96JH7	VCIP1_HUMAN	S	650	ENSP00000309031:T650S	ENSP00000309031:T650S	T	-	2	0	VCPIP1	67739799	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.809000	0.99208	2.587000	0.87381	0.655000	0.94253	ACT	-	NULL		0.388	VCPIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VCPIP1	protein_coding	OTTHUMT00000379227.1	G		-		67577245	-1	no_errors	ENST00000310421	ensembl	human	known	74_37	missense	SNP	1.000	C
MAGEL2	54551	genome.wustl.edu	37	15	23890948	23890948	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr15:23890948G>T	ENST00000532292.1	-	1	227	c.133C>A	c.(133-135)Ccc>Acc	p.P45T		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	0					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CCCTGAAAGGGCTGCTCCAGC	0.701																																																	0								ENSG00000254585						5.0	6.0	5.0					15																	23890948		1735	3811	5546	MAGEL2	SO:0001583	missense	0			-	HGNC	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.133C>A	15.37:g.23890948G>T	ENSP00000433433:p.Pro45Thr	Somatic	0	34	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	7	68.18		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfscan_MAGE	p.P45T	ENST00000532292.1	37	c.133		15	.	.	.	.	.	.	.	.	.	.	g	12.22	1.871707	0.33069	.	.	ENSG00000254585	ENST00000532292	.	.	.	3.43	3.43	0.39272	.	.	.	.	.	T	0.41673	0.1169	L	0.47716	1.5	0.28725	N	0.902808	.	.	.	.	.	.	T	0.27331	-1.0077	5	.	.	.	.	8.9717	0.35910	0.0:0.2279:0.7721:0.0	.	.	.	.	R	76	.	.	S	-	3	2	MAGEL2	21442041	0.998000	0.40836	1.000000	0.80357	0.222000	0.24845	2.985000	0.49362	2.196000	0.70406	0.197000	0.17608	AGC	-	NULL		0.701	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	MAGEL2	protein_coding	OTTHUMT00000395182.2	G	NM_019066	-		23890948	-1	no_errors	ENST00000532292	ensembl	human	known	74_37	missense	SNP	1.000	T
OR1S2	219958	genome.wustl.edu	37	11	57970682	57970682	+	Silent	SNP	G	G	C			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr11:57970682G>C	ENST00000302592.6	-	1	971	c.972C>G	c.(970-972)tcC>tcG	p.S324S		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	324						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				GGCATCAAAGGGAAGAAATTT	0.413																																																	0								ENSG00000197887						127.0	129.0	129.0					11																	57970682		2201	4296	6497	OR1S2	SO:0001819	synonymous_variant	0			-	HGNC	BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.972C>G	11.37:g.57970682G>C		Somatic	0	42	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	2	83.33	Q6IFG5|Q96R85	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S324	ENST00000302592.6	37	c.972	CCDS31545.1	11																																																																																			-	NULL		0.413	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S2	protein_coding	OTTHUMT00000394703.2	G	NM_001004459	-		57970682	-1	no_errors	ENST00000302592	ensembl	human	known	74_37	silent	SNP	0.023	C
C21orf49	54067	genome.wustl.edu	37	21	34157085	34157086	+	Intron	INS	-	-	T	rs376234765		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr21:34157085_34157086insT	ENST00000477513.1	+	2	121				C21orf49_ENST00000382378.1_Intron|C21orf49_ENST00000382377.3_Intron|C21orf49_ENST00000382375.4_Intron|C21orf49_ENST00000453404.1_Intron					chromosome 21 open reading frame 49																		gtcctcatcagttttttttttt	0.436																																																	0								ENSG00000205930																																			C21orf49	SO:0001627	intron_variant	0				HGNC			21q22.11	2013-01-15			ENSG00000205930	ENSG00000205930			1290	other	unknown							Standard	NR_024622		Approved		uc002yqu.4	Q17RA5	OTTHUMG00000064992	ENST00000477513.1:c.-81-22->T	21.37:g.34157096_34157096dupT		Somatic	0	22	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11		Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e1-1	ENST00000477513.1	37	c.1-1_0		21																																																																																			-	-		0.436	C21orf49-006	NOVEL	basic|appris_candidate|exp_conf	protein_coding	C21orf49	protein_coding	OTTHUMT00000193339.1	-	NR_024622			34157086	+1	no_errors	ENST00000454365	ensembl	human	known	74_37	splice_site_ins	INS	0.122:0.122	T
GSTM5	2949	genome.wustl.edu	37	1	110257879	110257879	+	Intron	SNP	C	C	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:110257879C>T	ENST00000256593.3	+	7	625				GSTM5_ENST00000492718.1_3'UTR|GSTM5_ENST00000369813.1_Missense_Mutation_p.S154F|GSTM5_ENST00000369812.5_Intron	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5						glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)			NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	CCCCCATCCTCCTTTCTCTTT	0.478																																																	0								ENSG00000134201						122.0	117.0	119.0					1																	110257879		2203	4300	6503	GSTM5	SO:0001627	intron_variant	0			-	HGNC	L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.567+17C>T	1.37:g.110257879C>T		Somatic	0	109	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	74	33.93	A8K0V8|Q6PD78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GST_C,pfam_Glutathione_S-Trfase_N,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_mu	p.S154F	ENST00000256593.3	37	c.461	CCDS811.1	1	.	.	.	.	.	.	.	.	.	.	C	19.22	3.785950	0.70337	.	.	ENSG00000134201	ENST00000369813	T	0.08282	3.11	4.46	-4.83	0.03161	.	.	.	.	.	T	0.04724	0.0128	.	.	.	0.09310	N	1	D	0.58970	0.984	P	0.57960	0.83	T	0.07404	-1.0774	7	.	.	.	.	2.5339	0.04710	0.1244:0.2707:0.1225:0.4824	.	154	Q5T8Q9	.	F	154	ENSP00000358828:S154F	.	S	+	2	0	GSTM5	110059402	0.000000	0.05858	0.000000	0.03702	0.482000	0.33219	-0.716000	0.04991	-1.036000	0.03287	0.597000	0.82753	TCC	-	NULL		0.478	GSTM5-001	KNOWN	basic|CCDS	protein_coding	GSTM5	protein_coding	OTTHUMT00000032200.1	C	NM_000851	-		110257879	+1	no_errors	ENST00000369813	ensembl	human	known	74_37	missense	SNP	0.000	T
ZNF337	26152	genome.wustl.edu	37	20	25657393	25657393	+	Nonsense_Mutation	SNP	C	C	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr20:25657393C>T	ENST00000376436.1	-	4	1070	c.531G>A	c.(529-531)tgG>tgA	p.W177*	ZNF337_ENST00000538750.1_Nonsense_Mutation_p.W145*|RP4-694B14.5_ENST00000428254.1_RNA|RP4-694B14.5_ENST00000455791.1_RNA|ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000421829.1_RNA|RP4-694B14.5_ENST00000414393.1_RNA|ZNF337_ENST00000252979.5_Nonsense_Mutation_p.W177*|RP4-694B14.5_ENST00000439498.1_RNA			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	177					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						TGAATGCTCCCCATCTTGAAT	0.423																																																	0								ENSG00000130684						169.0	162.0	164.0					20																	25657393		2203	4300	6503	ZNF337	SO:0001587	stop_gained	0			-	HGNC		CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.531G>A	20.37:g.25657393C>T	ENSP00000365619:p.Trp177*	Somatic	0	82	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	47	46.59	B4DSM2|Q9Y3Y5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.W177*	ENST00000376436.1	37	c.531	CCDS13174.1	20	.	.	.	.	.	.	.	.	.	.	.	23.5	4.419065	0.83559	.	.	ENSG00000130684	ENST00000376436;ENST00000252979;ENST00000376412;ENST00000538750	.	.	.	1.45	0.277	0.15668	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	6.2241	0.20698	0.2984:0.7016:0.0:0.0	.	.	.	.	X	177;177;177;145	.	ENSP00000252979:W177X	W	-	3	0	ZNF337	25605393	0.191000	0.23288	0.004000	0.12327	0.870000	0.49936	1.773000	0.38563	-0.093000	0.12396	0.306000	0.20318	TGG	-	NULL		0.423	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF337	protein_coding	OTTHUMT00000078454.1	C		-		25657393	-1	no_errors	ENST00000252979	ensembl	human	known	74_37	nonsense	SNP	0.666	T
HSPA6	3310	genome.wustl.edu	37	1	161494965	161494965	+	Silent	SNP	C	C	A			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:161494965C>A	ENST00000309758.4	+	1	930	c.517C>A	c.(517-519)Cgg>Agg	p.R173R	RP11-25K21.6_ENST00000537821.2_RNA	NM_002155.3	NP_002146.2	P17066	HSP76_HUMAN	heat shock 70kDa protein 6 (HSP70B')	173			R -> P (in dbSNP:rs41297708). {ECO:0000269|Ref.2}.		ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|centriole (GO:0005814)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			endometrium(3)|large_intestine(5)|lung(9)|prostate(2)|skin(2)	21	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)			CAACGTGTTGCGGATCATCAA	0.662																																																	0								ENSG00000173110						32.0	36.0	35.0					1																	161494965		2203	4298	6501	HSPA6	SO:0001819	synonymous_variant	0			-	HGNC		CCDS1231.1	1q23.3	2011-09-02	2002-08-29		ENSG00000173110	ENSG00000173110		"""Heat shock proteins / HSP70"""	5239	protein-coding gene	gene with protein product		140555	"""heat shock 70kD protein 6 (HSP70B')"""			1346391	Standard	NM_002155		Approved		uc001gaq.3	P17066	OTTHUMG00000034461	ENST00000309758.4:c.517C>A	1.37:g.161494965C>A		Somatic	0	52	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	21	52.27	Q1HBA8|Q8IYK7|Q9BT95	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.R173	ENST00000309758.4	37	c.517	CCDS1231.1	1																																																																																			-	pfam_Hsp_70_fam,pfam_MreB_Mrl		0.662	HSPA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA6	protein_coding	OTTHUMT00000083308.1	C	NM_002155	-		161494965	+1	no_errors	ENST00000309758	ensembl	human	known	74_37	silent	SNP	0.998	A
COL4A6	1288	genome.wustl.edu	37	X	107422569	107422569	+	Missense_Mutation	SNP	C	C	G			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chrX:107422569C>G	ENST00000372216.4	-	26	2334	c.2234G>C	c.(2233-2235)gGt>gCt	p.G745A	COL4A6_ENST00000394872.2_Missense_Mutation_p.G745A|COL4A6_ENST00000538570.1_Missense_Mutation_p.G744A|COL4A6_ENST00000334504.7_Missense_Mutation_p.G744A|COL4A6_ENST00000545689.1_Missense_Mutation_p.G744A	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	745	Triple-helical region.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						TCCCTTGGAACCAGGTAAGCC	0.552									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)												0								ENSG00000197565						79.0	63.0	68.0					X																	107422569		2203	4300	6503	COL4A6	SO:0001583	missense	0	Familial Cancer Database		-	HGNC	U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.2234G>C	X.37:g.107422569C>G	ENSP00000361290:p.Gly745Ala	Somatic	0	68	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	11	67.65	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G745A	ENST00000372216.4	37	c.2234	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697064	0.48202	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.99607	-6.27;-6.27;-6.27;-6.27;-6.27	4.59	4.59	0.56863	.	0.000000	0.42053	D	0.000763	D	0.99701	0.9886	M	0.92555	3.32	0.47547	D	0.999453	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.97436	1.0018	10	0.59425	D	0.04	.	17.3695	0.87372	0.0:1.0:0.0:0.0	.	744;744;745;744	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	A	745;744;745;744;744;744	ENSP00000361290:G745A;ENSP00000334733:G744A;ENSP00000378340:G745A;ENSP00000443707:G744A;ENSP00000445236:G744A	ENSP00000334733:G744A	G	-	2	0	COL4A6	107309225	0.999000	0.42202	0.992000	0.48379	0.655000	0.38815	4.898000	0.63238	2.223000	0.72356	0.523000	0.50628	GGT	-	pfam_Collagen		0.552	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	protein_coding	OTTHUMT00000057875.2	C		-		107422569	-1	no_errors	ENST00000372216	ensembl	human	known	74_37	missense	SNP	1.000	G
KALRN	8997	genome.wustl.edu	37	3	124376359	124376359	+	Missense_Mutation	SNP	T	T	A	rs537115296		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr3:124376359T>A	ENST00000291478.5	+	7	996	c.833T>A	c.(832-834)gTg>gAg	p.V278E	KALRN_ENST00000459915.1_Missense_Mutation_p.V67E|KALRN_ENST00000360013.3_Missense_Mutation_p.V1975E|KALRN_ENST00000393496.1_Missense_Mutation_p.V316E|KALRN_ENST00000428018.2_Missense_Mutation_p.V246E	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1974					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GACAAAATCGTGTTTGGAAAT	0.443																																																	0								ENSG00000160145						130.0	122.0	124.0					3																	124376359		2203	4300	6503	KALRN	SO:0001583	missense	0			-	HGNC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.833T>A	3.37:g.124376359T>A	ENSP00000291478:p.Val278Glu	Somatic	0	41	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	34	27.66	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Prot_kinase_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,pfscan_DH-domain	p.V1975E	ENST00000291478.5	37	c.5924	CCDS3028.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.6|26.6	4.752132|4.752132	0.89753|0.89753	.|.	.|.	ENSG00000160145|ENSG00000160145	ENST00000354186|ENST00000360013;ENST00000393496;ENST00000291478;ENST00000428018;ENST00000459915	.|T;T;T;T;T	.|0.70869	.|-0.52;-0.52;-0.52;-0.52;-0.52	5.08|5.08	5.08|5.08	0.68730|0.68730	.|Dbl homology (DH) domain (5);	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.88559|0.88559	0.6469|0.6469	H|H	0.95187|0.95187	3.635|3.635	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;1.0;0.999;1.0	D|D	0.91977|0.91977	0.5591|0.5591	5|10	.|0.87932	.|D	.|0	.|.	15.0251|15.0251	0.71663|0.71663	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|67;278;316;1974	.|E7EUZ8;C9JQ37;O60229-5;O60229	.|.;.;.;KALRN_HUMAN	S|E	1944|1975;316;278;246;67	.|ENSP00000353109:V1975E;ENSP00000377134:V316E;ENSP00000291478:V278E;ENSP00000402419:V246E;ENSP00000420318:V67E	.|ENSP00000291478:V278E	C|V	+|+	1|2	0|0	KALRN|KALRN	125859049|125859049	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.718000|7.718000	0.84743|0.84743	2.127000|2.127000	0.65507|0.65507	0.533000|0.533000	0.62120|0.62120	TGT|GTG	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.443	KALRN-001	KNOWN	basic|CCDS	protein_coding	KALRN	protein_coding	OTTHUMT00000246891.5	T	NM_003947	-		124376359	+1	no_errors	ENST00000360013	ensembl	human	known	74_37	missense	SNP	1.000	A
ESPN	83715	genome.wustl.edu	37	1	6521041	6521041	+	IGR	SNP	G	G	C			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:6521041G>C	ENST00000377828.1	+	0	3531				TNFRSF25_ENST00000461703.2_5'Flank	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin						locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		CCTTCTCGGGGTAATTGAGCC	0.627																																																	0								ENSG00000187017																																			ESPN	SO:0001628	intergenic_variant	0			-	HGNC	AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753		1.37:g.6521041G>C		Somatic	0	30	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	19	24.00	Q6XYB2|Q9H0A2|Q9Y329	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000377828.1	37	c.NULL	CCDS70.1	1																																																																																			-	-		0.627	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPN	protein_coding	OTTHUMT00000001887.3	G	NM_031475	-		6521041	+1	no_errors	ENST00000468561	ensembl	human	known	74_37	splice_site	SNP	0.000	C
MED12	9968	genome.wustl.edu	37	X	70339254	70339254	+	Missense_Mutation	SNP	G	G	A	rs199469676|rs199469692|rs199469688|rs199469689|rs199469672|rs199469677|rs199469678|rs199469680|rs199469681|rs199469691|rs199469690|rs199469684|rs199469685|rs199469686|rs199469687		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chrX:70339254G>A	ENST00000374080.3	+	2	163	c.131G>A	c.(130-132)gGt>gAt	p.G44D	MED12_ENST00000333646.6_Missense_Mutation_p.G44D|MED12_ENST00000374102.1_Missense_Mutation_p.G44D			Q93074	MED12_HUMAN	mediator complex subunit 12	44					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)	p.G44D(105)|p.G44V(28)|p.G44A(17)|p.?(5)|p.K42_N46del(3)|p.L39_N47del(2)|p.V41_P49del(2)|p.K42_F45del(2)|p.E35_N46del(2)|p.Q43_N46>H(1)|p.V41_D54del(1)|p.A38_N46del(1)|p.V41_S52del(1)|p.L39_V51del(1)|p.N40_P49>F(1)|p.K42_V51del(1)|p.Q43_Q48del(1)|p.A38_S52del(1)|p.N40_G44del(1)|p.V41_N46del(1)|p.K42_G44>N(1)|p.Q43_G44>H(1)|p.G44_Q48del(1)		breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GTAAAACAAGGTTTCAATAAC	0.527			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	180	Substitution - Missense(150)|Deletion - In frame(21)|Unknown(5)|Complex - deletion inframe(4)	soft_tissue(177)|breast(2)|endometrium(1)						ENSG00000184634						40.0	35.0	37.0					X																	70339254		1900	4109	6009	MED12	SO:0001583	missense	0			-	HGNC	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.131G>A	X.37:g.70339254G>A	ENSP00000363193:p.Gly44Asp	Somatic	0	43	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	8	75.76	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.G44D	ENST00000374080.3	37	c.131	CCDS43970.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	24.7|24.7	4.560065|4.560065	0.86335|0.86335	.|.	.|.	ENSG00000184634|ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072|ENST00000429213	D;D;D;D|.	0.87412|.	-2.25;-2.21;-2.22;-1.86|.	4.29|4.29	4.29|4.29	0.51040|0.51040	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73040|0.73040	0.3536|0.3536	M|M	0.69358|0.69358	2.11|2.11	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	T|T	0.73594|0.73594	-0.3933|-0.3933	10|5	0.87932|.	D|.	0|.	-13.5074|-13.5074	16.9324|16.9324	0.86193|0.86193	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	44;44;44|.	F5H3Y1;Q93074-3;Q93074|.	.;.;MED12_HUMAN|.	D|I	44;44;44;44;12|29	ENSP00000333125:G44D;ENSP00000363215:G44D;ENSP00000363193:G44D;ENSP00000414203:G12D|.	ENSP00000333125:G44D|.	G|V	+|+	2|1	0|0	MED12|MED12	70255979|70255979	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.325000|9.325000	0.96381|0.96381	2.385000|2.385000	0.81259|0.81259	0.513000|0.513000	0.50165|0.50165	GGT|GTT	-	NULL		0.527	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	protein_coding	OTTHUMT00000057105.1	G	NM_005120	rs199469672		70339254	+1	no_errors	ENST00000333646	ensembl	human	known	74_37	missense	SNP	1.000	A
BAG6	7917	genome.wustl.edu	37	6	31613261	31613261	+	Nonsense_Mutation	SNP	G	G	A	rs556160544		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr6:31613261G>A	ENST00000375964.6	-	9	1370	c.1057C>T	c.(1057-1059)Cga>Tga	p.R353*	BAG6_ENST00000470875.1_5'Flank|BAG6_ENST00000404765.2_Nonsense_Mutation_p.R347*|BAG6_ENST00000362049.6_Nonsense_Mutation_p.R347*|BAG6_ENST00000439687.2_Nonsense_Mutation_p.R347*|BAG6_ENST00000375976.4_Nonsense_Mutation_p.R347*|BAG6_ENST00000211379.5_Nonsense_Mutation_p.R347*	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	353	4 X 29 AA approximate repeats.				brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						TGCAGGTGTCGTGGGGGCGTG	0.607																																																	0								ENSG00000204463						105.0	93.0	97.0					6																	31613261		1509	2709	4218	BAG6	SO:0001587	stop_gained	0			-	HGNC	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.1057C>T	6.37:g.31613261G>A	ENSP00000365131:p.Arg353*	Somatic	0	35	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	33	17.50	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3538,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.R347*	ENST00000375964.6	37	c.1039	CCDS47403.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	41|41	8.852138|8.852138	0.98978|0.98978	.|.	.|.	ENSG00000204463|ENSG00000204463	ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000439687;ENST00000362049;ENST00000437771;ENST00000436214;ENST00000435080|ENST00000453833	.|.	.|.	.|.	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.51024	.|0.1650	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.54111	.|-0.8342	.|3	0.02654|.	T|.	1|.	.|.	12.2768|12.2768	0.54739|0.54739	0.0:0.0:0.83:0.1699|0.0:0.0:0.83:0.1699	.|.	.|.	.|.	.|.	X|M	347;353;347;347;347;347;347;3;347|7	.|.	ENSP00000211379:R347X|.	R|T	-|-	1|2	2|0	BAG6|BAG6	31721240|31721240	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.310000|4.310000	0.59141|0.59141	2.322000|2.322000	0.78497|0.78497	0.650000|0.650000	0.86243|0.86243	CGA|ACG	-	pfam_DUF3538		0.607	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAG6	protein_coding		G	NM_080703	-		31613261	-1	no_errors	ENST00000404765	ensembl	human	known	74_37	nonsense	SNP	1.000	A
RP11-467N20.5	0	genome.wustl.edu	37	15	23407257	23407257	+	Missense_Mutation	SNP	G	G	A			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr15:23407257G>A	ENST00000558241.1	-	8	1669	c.1579C>T	c.(1579-1581)Cgg>Tgg	p.R527W																	endometrium(1)	1						tcctgctcccgtatcttctcc	0.567																																																	0								ENSG00000259455																																			RP11-467N20.5	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000558241.1:c.1579C>T	15.37:g.23407257G>A	ENSP00000453436:p.Arg527Trp	Somatic	0	35	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	19	17.39		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.R527W	ENST00000558241.1	37	c.1579		15																																																																																			-	NULL		0.567	RP11-467N20.5-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000259455	protein_coding	OTTHUMT00000415942.1	G		-		23407257	-1	no_errors	ENST00000558241	ensembl	human	novel	74_37	missense	SNP	0.125	A
TIE1	7075	genome.wustl.edu	37	1	43779614	43779614	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:43779614G>C	ENST00000372476.3	+	14	2463	c.2384G>C	c.(2383-2385)cGc>cCc	p.R795P	TIE1_ENST00000473014.1_3'UTR|TIE1_ENST00000433781.2_Missense_Mutation_p.R440P	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	795					angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CATCGGAGACGCACCTTCACC	0.607																																																	0								ENSG00000066056						65.0	58.0	60.0					1																	43779614		2203	4300	6503	TIE1	SO:0001583	missense	0			-	HGNC	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2384G>C	1.37:g.43779614G>C	ENSP00000361554:p.Arg795Pro	Somatic	0	60	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	54	16.92	B5A949|B5A950	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R795P	ENST00000372476.3	37	c.2384	CCDS482.1	1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582389	0.86748	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000536913;ENST00000433781	T;T	0.77750	-1.08;-1.12	5.73	4.81	0.61882	.	0.187103	0.26190	N	0.025807	T	0.78723	0.4328	L	0.43923	1.385	0.80722	D	1	D;P;P;P	0.53885	0.963;0.921;0.938;0.937	P;P;P;P	0.55545	0.778;0.712;0.605;0.774	T	0.74115	-0.3769	10	0.13853	T	0.58	.	14.7759	0.69732	0.0709:0.0:0.9291:0.0	.	440;750;440;795	E9PG63;B4DTW8;B4DKW0;P35590	.;.;.;TIE1_HUMAN	P	795;198;78;440	ENSP00000361554:R795P;ENSP00000411728:R440P	ENSP00000361553:R198P	R	+	2	0	TIE1	43552201	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.471000	0.80985	1.399000	0.46721	0.655000	0.94253	CGC	-	NULL		0.607	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIE1	protein_coding	OTTHUMT00000019011.1	G	NM_005424	-		43779614	+1	no_errors	ENST00000372476	ensembl	human	known	74_37	missense	SNP	1.000	C
AC026781.1	0	genome.wustl.edu	37	5	92053145	92053146	+	RNA	INS	-	-	TGTGTGTG	rs369530763		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr5:92053145_92053146insTGTGTGTG	ENST00000408883.1	-	0	74_75																											CATAgtgtgtctgtgtgtgtgt	0.262																																																	0								ENSG00000221810																																			AC026781.1			0				Clone_based_ensembl_gene																													5.37:g.92053146_92053153dupTGTGTGTG		Somatic	NA	NA	NA		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408883.1	37	NULL		5																																																																																			-	-		0.262	AC026781.1-201	NOVEL	basic	miRNA	ENSG00000221810	miRNA		-				92053146	-1	no_errors	ENST00000408883	ensembl	human	novel	74_37	rna	INS	0.000:0.002	TGTGTGTG
HCK	3055	genome.wustl.edu	37	20	30681783	30681783	+	Missense_Mutation	SNP	C	C	T	rs145632103		TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr20:30681783C>T	ENST00000520553.1	+	11	1393	c.1147C>T	c.(1147-1149)Cgg>Tgg	p.R383W	HCK_ENST00000534862.1_Missense_Mutation_p.R384W|HCK_ENST00000538448.1_Missense_Mutation_p.R383W|HCK_ENST00000375852.2_Missense_Mutation_p.R404W|HCK_ENST00000375862.2_Missense_Mutation_p.R403W|HCK_ENST00000518730.1_Missense_Mutation_p.R382W	NM_001172129.1|NM_001172130.1|NM_001172131.1|NM_002110.3	NP_001165600.1|NP_001165601.1|NP_001165602.1|NP_002101.2	P08631	HCK_HUMAN	HCK proto-oncogene, Src family tyrosine kinase	404	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|innate immune response-activating signal transduction (GO:0002758)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte degranulation (GO:0043299)|leukocyte migration involved in immune response (GO:0002522)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|regulation of inflammatory response (GO:0050727)|regulation of phagocytosis (GO:0050764)|regulation of podosome assembly (GO:0071801)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|respiratory burst after phagocytosis (GO:0045728)|viral process (GO:0016032)	caveola (GO:0005901)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(4)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Bosutinib(DB06616)	TGGCCTGGCCCGGGTCATTGA	0.557																																																	0								ENSG00000101336	C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	176.0	138.0	151.0		1147,1207,1144,1150,1147,1210	2.8	0.3	20	dbSNP_134	151	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	HCK	NM_001172129.1,NM_001172130.1,NM_001172131.1,NM_001172132.1,NM_001172133.1,NM_002110.3	101,101,101,101,101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	383/506,403/526,382/505,384/507,383/506,404/527	30681783	1,13005	2203	4300	6503	HCK	SO:0001583	missense	0			-	HGNC	AK026432	CCDS33460.1, CCDS54453.1, CCDS54455.1, CCDS54456.1	20q11-q12	2014-06-25	2014-06-25		ENSG00000101336	ENSG00000101336		"""SH2 domain containing"""	4840	protein-coding gene	gene with protein product		142370	"""hemopoietic cell kinase"""			3496523	Standard	NM_002110		Approved	JTK9	uc002wxh.3	P08631	OTTHUMG00000032204	ENST00000520553.1:c.1147C>T	20.37:g.30681783C>T	ENSP00000429848:p.Arg383Trp	Somatic	0	56	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	24	54.72	A8K1I1|B4DQB6|E1P5M2|Q29RX1|Q2VPE2|Q504R5|Q5T7K1|Q5T7K2|Q96CC0|Q9H5Y5|Q9NUA4|Q9UMJ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.R404W	ENST00000520553.1	37	c.1210	CCDS54455.1	20	.	.	.	.	.	.	.	.	.	.	C	18.74	3.687811	0.68271	0.0	1.16E-4	ENSG00000101336	ENST00000534862;ENST00000538448;ENST00000375862;ENST00000520553;ENST00000518730;ENST00000375852	D;D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99;-1.99	4.87	2.8	0.32819	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.94788	0.8317	H	0.98089	4.145	0.47245	D	0.999366	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95866	0.8887	10	0.87932	D	0	.	12.8574	0.57892	0.399:0.601:0.0:0.0	.	382;404	P08631-3;P08631	.;HCK_HUMAN	W	384;383;403;383;382;404	ENSP00000444986:R384W;ENSP00000441169:R383W;ENSP00000365022:R403W;ENSP00000429848:R383W;ENSP00000427757:R382W;ENSP00000365012:R404W	ENSP00000365012:R404W	R	+	1	2	HCK	30145444	0.891000	0.30450	0.323000	0.25347	0.857000	0.48899	1.850000	0.39328	1.245000	0.43885	0.542000	0.68232	CGG	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.557	HCK-006	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	HCK	protein_coding	OTTHUMT00000375751.1	C		rs145632103		30681783	+1	no_errors	ENST00000375852	ensembl	human	known	74_37	missense	SNP	0.714	T
SPATA31A3	727830	genome.wustl.edu	37	9	40705285	40705285	+	Missense_Mutation	SNP	A	A	G			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr9:40705285A>G	ENST00000356699.5	+	4	2971	c.2942A>G	c.(2941-2943)gAg>gGg	p.E981G	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	981					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CATGGTTTCGAGGCTCCAGGG	0.517																																																	0								ENSG00000147926						1.0	1.0	1.0					9																	40705285		42	103	145	SPATA31A3	SO:0001583	missense	0			-	HGNC			9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.2942A>G	9.37:g.40705285A>G	ENSP00000349132:p.Glu981Gly	Somatic	0	13	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	3	72.73		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.E981G	ENST00000356699.5	37	c.2942	CCDS47969.1	9	.	.	.	.	.	.	.	.	.	.	A	9.519	1.107787	0.20714	.	.	ENSG00000147926	ENST00000356699	T	0.04706	3.57	1.57	0.357	0.16079	.	.	.	.	.	T	0.03136	0.0092	N	0.13235	0.315	0.09310	N	1	D	0.53312	0.959	P	0.49252	0.604	T	0.21518	-1.0243	9	0.07813	T	0.8	.	3.0914	0.06295	0.6946:0.0:0.3054:0.0	.	981	Q5VYP0	F75A3_HUMAN	G	981	ENSP00000349132:E981G	ENSP00000349132:E981G	E	+	2	0	FAM75A3	40695285	0.000000	0.05858	0.000000	0.03702	0.269000	0.26545	-0.294000	0.08309	0.097000	0.17492	0.156000	0.16432	GAG	-	NULL		0.517	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A3	protein_coding	OTTHUMT00000036919.1	A	NM_001083124	-		40705285	+1	no_errors	ENST00000356699	ensembl	human	known	74_37	missense	SNP	0.000	G
PTCRA	171558	genome.wustl.edu	37	6	42893006	42893006	+	Silent	SNP	G	G	A			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr6:42893006G>A	ENST00000304672.1	+	4	513	c.432G>A	c.(430-432)ccG>ccA	p.P144P	PTCRA_ENST00000446507.1_Silent_p.P37P|PTCRA_ENST00000441198.1_Silent_p.P119P	NM_001243168.1|NM_138296.2	NP_001230097.1|NP_612153.2	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha	144					negative regulation of thymocyte apoptotic process (GO:0070244)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(4)|ovary(2)	8	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			CAGGGACACCGGGTGGGGCGC	0.706																																																	0								ENSG00000171611																																			PTCRA	SO:0001819	synonymous_variant	0			-	HGNC	AF084941	CCDS4874.1, CCDS59019.1, CCDS59020.1, CCDS75457.1	6p21.3	2008-02-05			ENSG00000171611	ENSG00000171611			21290	protein-coding gene	gene with protein product		606817				8618853, 9842925	Standard	NM_138296		Approved	PTA, PT-ALPHA	uc021yzp.1	Q6ISU1	OTTHUMG00000014709	ENST00000304672.1:c.432G>A	6.37:g.42893006G>A		Somatic	0	23	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	16	38.46	Q5TFZ7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P144	ENST00000304672.1	37	c.432	CCDS4874.1	6																																																																																			-	NULL		0.706	PTCRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCRA	protein_coding	OTTHUMT00000040565.2	G	NM_138296	-		42893006	+1	no_errors	ENST00000304672	ensembl	human	known	74_37	silent	SNP	0.000	A
SNX6	58533	genome.wustl.edu	37	14	35037108	35037108	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr14:35037108G>T	ENST00000362031.4	-	12	1099	c.1069C>A	c.(1069-1071)Caa>Aaa	p.Q357K	SNX6_ENST00000396534.3_Missense_Mutation_p.Q229K|SNX6_ENST00000396526.3_Missense_Mutation_p.Q229K|SNX6_ENST00000355110.5_Missense_Mutation_p.Q233K	NM_152233.2	NP_689419.2	Q9UNH7	SNX6_HUMAN	sorting nexin 6	345					intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome membrane (GO:0031901)|intracellular (GO:0005622)|nucleus (GO:0005634)	phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)			endometrium(4)|lung(1)|ovary(1)	6	Breast(36;0.0473)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00199)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.0245)		CAACATAATTGTTGGGAAGTT	0.333																																																	0								ENSG00000129515						77.0	79.0	79.0					14																	35037108		2201	4300	6501	SNX6	SO:0001583	missense	0			-	HGNC	AF121856	CCDS9648.1, CCDS41942.1	14q13	2010-08-05			ENSG00000129515	ENSG00000129515		"""Sorting nexins"""	14970	protein-coding gene	gene with protein product		606098				11279102	Standard	XM_006720224		Approved		uc001wsf.1	Q9UNH7	OTTHUMG00000140213	ENST00000362031.4:c.1069C>A	14.37:g.35037108G>T	ENSP00000355217:p.Gln357Lys	Somatic	0	59	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	21	41.67	C0H5W9|Q9Y449	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phox,pfam_Vps5_C,pfam_BAR_dom,superfamily_Phox,pirsf_Snx5_Snx6,pfscan_Phox	p.Q357K	ENST00000362031.4	37	c.1069	CCDS41942.1	14	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977956	0.53720	.	.	ENSG00000129515	ENST00000396526;ENST00000396534;ENST00000362031;ENST00000355110	T;T;T;T	0.58506	0.33;0.33;0.33;0.33	4.96	4.96	0.65561	Vps5 C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.66906	0.2837	L	0.33339	1.005	0.80722	D	1	P;P	0.44776	0.843;0.843	D;P	0.64506	0.926;0.893	T	0.60551	-0.7241	10	0.27082	T	0.32	-16.7495	19.1801	0.93620	0.0:0.0:1.0:0.0	.	233;345	B4DJS7;Q9UNH7	.;SNX6_HUMAN	K	229;229;357;233	ENSP00000379779:Q229K;ENSP00000379785:Q229K;ENSP00000355217:Q357K;ENSP00000347230:Q233K	ENSP00000347230:Q233K	Q	-	1	0	SNX6	34106859	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	9.542000	0.98086	2.714000	0.92807	0.552000	0.68991	CAA	-	pfam_Vps5_C,pfam_BAR_dom,pirsf_Snx5_Snx6		0.333	SNX6-002	KNOWN	downstream_ATG|basic|appris_principal|CCDS	protein_coding	SNX6	protein_coding	OTTHUMT00000276642.3	G		-		35037108	-1	no_errors	ENST00000362031	ensembl	human	known	74_37	missense	SNP	1.000	T
OR14A2	388761	genome.wustl.edu	37	1	247886543	247886543	+	Missense_Mutation	SNP	A	A	G			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:247886543A>G	ENST00000366485.1	-	1	802	c.803T>C	c.(802-804)aTt>aCt	p.I268T	RP11-634B7.4_ENST00000449298.1_RNA|RP11-634B7.5_ENST00000426444.1_RNA			Q96R54	O14A2_HUMAN	olfactory receptor, family 14, subfamily A, member 2	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										CAGCCTGTCAATAACAGATGG	0.408																																																	0								ENSG00000241128																																			OR14A2	SO:0001583	missense	0			-	HGNC	AB065620		1q44	2013-01-16	2008-04-02	2008-04-02	ENSG00000241128	ENSG00000241128		"""GPCR / Class A : Olfactory receptors"""	15024	other	unknown			"""olfactory receptor, family 5, subfamily AX, member 1 pseudogene"", ""olfactory receptor, family 5, subfamily AX, member 1"""	OR5AX1P, OR5AX1			Standard	NG_002409		Approved			Q96R54	OTTHUMG00000040207	ENST00000366485.1:c.803T>C	1.37:g.247886543A>G	ENSP00000355441:p.Ile268Thr	Somatic	0	38	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	15	59.46		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I268T	ENST00000366485.1	37	c.803		1	.	.	.	.	.	.	.	.	.	.	A	11.18	1.563611	0.27915	.	.	ENSG00000241128	ENST00000366485	T	0.00115	8.71	3.0	0.571	0.17352	.	0.804821	0.10052	U	0.722070	T	0.00073	0.0002	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.00670	-1.1617	7	0.23302	T	0.38	.	2.8326	0.05505	0.5815:0.0:0.23:0.1885	.	.	.	.	T	268	ENSP00000355441:I268T	ENSP00000355441:I268T	I	-	2	0	OR14A2	245953166	0.000000	0.05858	0.000000	0.03702	0.771000	0.43674	-1.007000	0.03667	-0.014000	0.14175	-0.280000	0.10049	ATT	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.408	OR14A2-001	KNOWN	basic|appris_principal	protein_coding	OR14A2	protein_coding	OTTHUMT00000096864.1	A	NG_002409	-		247886543	-1	no_errors	ENST00000366485	ensembl	human	known	74_37	missense	SNP	0.000	G
HS3ST3A1	9955	genome.wustl.edu	37	17	13400122	13400122	+	Missense_Mutation	SNP	T	T	C			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr17:13400122T>C	ENST00000284110.1	-	2	1410	c.613A>G	c.(613-615)Aga>Gga	p.R205G	HS3ST3A1_ENST00000578576.1_Missense_Mutation_p.R3G	NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	205					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TCCAGGGTTCTGGGCATCAGG	0.602																																																	0								ENSG00000153976						45.0	47.0	46.0					17																	13400122		2203	4300	6503	HS3ST3A1	SO:0001583	missense	0			-	HGNC	AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.613A>G	17.37:g.13400122T>C	ENSP00000284110:p.Arg205Gly	Somatic	0	46	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	3	90.62	A8K7N2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.R205G	ENST00000284110.1	37	c.613	CCDS11165.1	17	.	.	.	.	.	.	.	.	.	.	T	13.48	2.248301	0.39697	.	.	ENSG00000153976	ENST00000284110	D	0.82526	-1.62	5.32	1.51	0.23008	Sulfotransferase domain (1);	0.060313	0.64402	U	0.000004	T	0.76751	0.4031	L	0.48174	1.505	0.39706	D	0.971257	B	0.23249	0.082	B	0.27887	0.084	T	0.70174	-0.4944	10	0.30078	T	0.28	.	12.7557	0.57335	0.0:0.0:0.3887:0.6113	.	205	Q9Y663	HS3SA_HUMAN	G	205	ENSP00000284110:R205G	ENSP00000284110:R205G	R	-	1	2	HS3ST3A1	13340847	0.981000	0.34729	0.920000	0.36463	0.987000	0.75469	2.096000	0.41738	0.487000	0.27698	0.460000	0.39030	AGA	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.602	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST3A1	protein_coding	OTTHUMT00000129952.1	T	NM_006042	-		13400122	-1	no_errors	ENST00000284110	ensembl	human	known	74_37	missense	SNP	0.799	C
SULT1B1	27284	genome.wustl.edu	37	4	70596312	70596312	+	Missense_Mutation	SNP	A	A	G			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr4:70596312A>G	ENST00000310613.3	-	7	982	c.685T>C	c.(685-687)Tca>Cca	p.S229P		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	229					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						ACTTCAAATGAGGTGTGATGG	0.363																																																	0								ENSG00000173597						170.0	155.0	160.0					4																	70596312		2203	4300	6503	SULT1B1	SO:0001583	missense	0			-	HGNC	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.685T>C	4.37:g.70596312A>G	ENSP00000308770:p.Ser229Pro	Somatic	0	41	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	33	28.26	O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.S229P	ENST00000310613.3	37	c.685	CCDS3530.1	4	.	.	.	.	.	.	.	.	.	.	A	16.59	3.165765	0.57476	.	.	ENSG00000173597	ENST00000310613	T	0.03035	4.07	4.09	4.09	0.47781	Sulfotransferase domain (1);	0.000000	0.40728	N	0.001021	T	0.28101	0.0693	H	0.98089	4.145	0.42169	D	0.991638	D	0.76494	0.999	D	0.68943	0.961	T	0.45934	-0.9227	10	0.87932	D	0	.	11.3366	0.49507	1.0:0.0:0.0:0.0	.	229	O43704	ST1B1_HUMAN	P	229	ENSP00000308770:S229P	ENSP00000308770:S229P	S	-	1	0	SULT1B1	70630901	0.995000	0.38212	0.795000	0.32087	0.841000	0.47740	3.414000	0.52693	1.633000	0.50488	0.383000	0.25322	TCA	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.363	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1B1	protein_coding	OTTHUMT00000251563.2	A	NM_014465	-		70596312	-1	no_errors	ENST00000310613	ensembl	human	known	74_37	missense	SNP	0.939	G
OBSCN	84033	genome.wustl.edu	37	1	228459496	228459496	+	Intron	SNP	G	G	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr1:228459496G>T	ENST00000422127.1	+	18	5181				RP5-1139B12.2_ENST00000602517.1_RNA|OBSCN_ENST00000359599.6_Intron|RP5-1139B12.3_ENST00000602529.1_RNA|OBSCN_ENST00000570156.2_Intron|OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000284548.11_Intron	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TCCTGGCCACGCAGCCAGTGC	0.572																																																	0								ENSG00000269890																																			RP5-1139B12.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5138-1975G>T	1.37:g.228459496G>T		Somatic	0	28	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	13	18.75	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000422127.1	37	NULL	CCDS58065.1	1																																																																																			-	-		0.572	OBSCN-204	KNOWN	basic|CCDS	protein_coding	ENSG00000269890	protein_coding		G	NM_052843	-		228459496	-1	no_errors	ENST00000602517	ensembl	human	known	74_37	rna	SNP	0.000	T
CBLN1	869	genome.wustl.edu	37	16	49314890	49314891	+	Frame_Shift_Ins	INS	-	-	T			TCGA-JV-A5VF-01A-11D-A29N-09	TCGA-JV-A5VF-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	b19eac77-0659-4b1a-ac98-c04fa531d8a9	e6329e87-a8a3-480f-b4f1-223b9c39fa43	g.chr16:49314890_49314891insT	ENST00000219197.6	-	2	692_693	c.327_328insA	c.(325-330)aaagggfs	p.G110fs	CBLN1_ENST00000536749.1_Frame_Shift_Ins_p.G110fs	NM_004352.3	NP_004343.1	P23435	CBLN1_HUMAN	cerebellin 1 precursor	110	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.|Necessary for interaction with CBLN3, and homotrimerization. {ECO:0000250}.				cerebellar granule cell differentiation (GO:0021707)|heterophilic cell-cell adhesion (GO:0007157)|nervous system development (GO:0007399)|positive regulation of synapse assembly (GO:0051965)|protein secretion (GO:0009306)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|extracellular region (GO:0005576)|postsynaptic membrane (GO:0045211)				breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(37;0.0766)|all_lung(18;0.24)				CTGTAGATCCCTTTGCGCGGGG	0.535																																																	0								ENSG00000102924																																			CBLN1	SO:0001589	frameshift_variant	0				HGNC	M58583	CCDS10736.1	16q12.1	2008-02-05			ENSG00000102924	ENSG00000102924			1543	protein-coding gene	gene with protein product		600432				7877445, 1704129	Standard	NM_004352		Approved		uc002efq.3	P23435	OTTHUMG00000133148	ENST00000219197.6:c.328dupA	16.37:g.49314893_49314893dupT	ENSP00000219197:p.Gly110fs	Somatic	0	61	0.00		0.7447566421552131	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	18	10.00	B2RAN9|P02682|Q52M09	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.G109fs	ENST00000219197.6	37	c.328_327	CCDS10736.1	16																																																																																			-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q		0.535	CBLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN1	protein_coding	OTTHUMT00000256845.4	-	NM_004352			49314891	-1	no_errors	ENST00000219197	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	T
