#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ZCCHC4	29063	genome.wustl.edu	37	4	25353250	25353250	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:25353250C>A	ENST00000302874.4	+	8	974	c.950C>A	c.(949-951)cCc>cAc	p.P317H	AC108218.1_ENST00000580712.1_RNA|ZCCHC4_ENST00000505451.1_3'UTR	NM_024936.2	NP_079212.2	Q9H5U6	ZCHC4_HUMAN	zinc finger, CCHC domain containing 4	317							methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)	9		Breast(46;0.0503)				TGGATTTTCCCCTATTTTTTT	0.348																																																	0								ENSG00000168228						143.0	131.0	135.0					4																	25353250		1786	4063	5849	ZCCHC4	SO:0001583	missense	0			-	HGNC	AF161537	CCDS43218.1	4p15.31	2014-02-18			ENSG00000168228	ENSG00000168228		"""Zinc fingers, CCHC domain containing"""	22917	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 4"""	611792				11042152	Standard	NM_024936		Approved	HSPC052, FLJ23024, ZGRF4	uc003grl.4	Q9H5U6	OTTHUMG00000160563	ENST00000302874.4:c.950C>A	4.37:g.25353250C>A	ENSP00000303468:p.Pro317His	Somatic	0	46	0.00		0.5284069354479217	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B2RXF6|B4DRD8|B7ZW20|Q5IW78|Q96AN7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_GRF,pfam_N6_adenine_Mtase-rel_euk,pfscan_Znf_DHHC_palmitoyltrfase	p.P317H	ENST00000302874.4	37	c.950	CCDS43218.1	4	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453933	0.84209	.	.	ENSG00000168228	ENST00000302874	T	0.73681	-0.77	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.88254	0.6387	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.89069	0.3468	10	0.87932	D	0	-21.2399	19.1733	0.93590	0.0:1.0:0.0:0.0	.	317	Q9H5U6	ZCHC4_HUMAN	H	317	ENSP00000303468:P317H	ENSP00000303468:P317H	P	+	2	0	ZCCHC4	24962348	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	5.596000	0.67570	2.815000	0.96918	0.650000	0.86243	CCC	-	NULL		0.348	ZCCHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC4	protein_coding	OTTHUMT00000361151.1	C		-		25353250	+1	no_errors	ENST00000302874	ensembl	human	known	74_37	missense	SNP	1.000	A
FCGBP	8857	genome.wustl.edu	37	19	40433817	40433817	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:40433817G>T	ENST00000221347.6	-	2	459	c.452C>A	c.(451-453)aCc>aAc	p.T151N		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	151	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CCTGGCTGAGGTGCCGGGGGG	0.607																																																	0								ENSG00000090920						51.0	50.0	50.0					19																	40433817		2203	4300	6503	FCGBP	SO:0001583	missense	0			-	HGNC	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.452C>A	19.37:g.40433817G>T	ENSP00000221347:p.Thr151Asn	Somatic	0	36	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	15	21.05	O95784	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.T151N	ENST00000221347.6	37	c.452	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	G	1.822	-0.472039	0.04445	.	.	ENSG00000090920	ENST00000221347	T	0.18810	2.19	4.37	-4.62	0.03370	.	2.116670	0.02483	N	0.088706	T	0.08133	0.0203	N	0.08118	0	0.09310	N	1	B	0.16802	0.019	B	0.06405	0.002	T	0.14980	-1.0453	10	0.21014	T	0.42	.	0.5161	0.00604	0.3821:0.2164:0.1825:0.2189	.	151	Q9Y6R7	FCGBP_HUMAN	N	151	ENSP00000221347:T151N	ENSP00000221347:T151N	T	-	2	0	FCGBP	45125657	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-0.607000	0.05648	-0.743000	0.04784	0.655000	0.94253	ACC	-	NULL		0.607	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	protein_coding	OTTHUMT00000462507.1	G	NM_003890	-		40433817	-1	no_errors	ENST00000221347	ensembl	human	known	74_37	missense	SNP	0.000	T
AZGP1	563	genome.wustl.edu	37	7	99564556	99564556	+	3'UTR	SNP	C	C	G			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:99564556C>G	ENST00000292401.4	-	0	1103				AZGP1_ENST00000483612.1_5'UTR|AZGP1_ENST00000411734.1_3'UTR	NM_001185.3	NP_001176.1	P25311	ZA2G_HUMAN	alpha-2-glycoprotein 1, zinc-binding						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell adhesion (GO:0007155)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein transmembrane transport (GO:0071806)|retina homeostasis (GO:0001895)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|MHC class I protein complex (GO:0042612)|nucleus (GO:0005634)	glycoprotein binding (GO:0001948)|peptide antigen binding (GO:0042605)|protein transmembrane transporter activity (GO:0008320)|ribonuclease activity (GO:0004540)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|stomach(1)	16	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)					TTCTGTGGTTCAGCTCCCACA	0.592																																																	0								ENSG00000160862																																			AZGP1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	BC005306	CCDS5680.1	7q22.1	2013-01-11	2006-11-07		ENSG00000160862	ENSG00000160862		"""Immunoglobulin superfamily / C1-set domain containing"""	910	protein-coding gene	gene with protein product		194460	"""alpha-2-glycoprotein 1, zinc"""			2049092	Standard	NM_001185		Approved	ZA2G, ZAG	uc003ush.3	P25311	OTTHUMG00000023066	ENST00000292401.4:c.*70G>C	7.37:g.99564556C>G		Somatic	0	36	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	12	60.00	D6W5T8|O60386|Q5XKQ4|Q8N4N0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000292401.4	37	NULL	CCDS5680.1	7																																																																																			-	-		0.592	AZGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZGP1	protein_coding	OTTHUMT00000059387.4	C	NM_001185	-		99564556	-1	no_errors	ENST00000483612	ensembl	human	known	74_37	rna	SNP	0.001	G
YARS	8565	genome.wustl.edu	37	1	33256716	33256716	+	Intron	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:33256716C>A	ENST00000373477.4	-	6	1593					NM_003680.3	NP_003671.1	P54577	SYYC_HUMAN	tyrosyl-tRNA synthetase						apoptotic process (GO:0006915)|gene expression (GO:0010467)|signal transduction (GO:0007165)|tRNA aminoacylation for protein translation (GO:0006418)|tyrosyl-tRNA aminoacylation (GO:0006437)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|interleukin-8 receptor binding (GO:0005153)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)|tRNA binding (GO:0000049)|tyrosine-tRNA ligase activity (GO:0004831)			endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)			L-Tyrosine(DB00135)	TCAATCTCTCCATTGAGGCTG	0.403																																																	0								ENSG00000134684						89.0	90.0	90.0					1																	33256716		2203	4300	6503	YARS	SO:0001627	intron_variant	0			-	HGNC	U89436	CCDS368.1	1p35.1	2014-09-17			ENSG00000134684	ENSG00000134684	6.1.1.1	"""Aminoacyl tRNA synthetases / Class I"""	12840	protein-coding gene	gene with protein product	"""tyrosine tRNA ligase 1, cytoplasmic"""	603623				8552597, 9162081	Standard	NM_003680		Approved	YTS, YRS, tyrRS	uc001bvy.1	P54577	OTTHUMG00000003933	ENST00000373477.4:c.684+46G>T	1.37:g.33256716C>A		Somatic	0	46	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	B3KWK4|D3DPQ4|O43276|Q53EN1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373477.4	37	NULL	CCDS368.1	1																																																																																			-	-		0.403	YARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YARS	protein_coding	OTTHUMT00000011225.1	C	NM_003680	-		33256716	-1	no_errors	ENST00000470377	ensembl	human	known	74_37	rna	SNP	0.011	A
IFT57	55081	genome.wustl.edu	37	3	107885832	107885832	+	Splice_Site	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr3:107885832C>A	ENST00000264538.3	-	8	1097	c.850G>T	c.(850-852)Gga>Tga	p.G284*	IFT57_ENST00000468021.1_5'UTR	NM_018010.3	NP_060480.1	Q9NWB7	IFT57_HUMAN	intraflagellar transport 57	284					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cilium assembly (GO:0042384)|heart looping (GO:0001947)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway (GO:0007224)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|dendrite terminus (GO:0044292)|Golgi apparatus (GO:0005794)|intraciliary transport particle B (GO:0030992)|photoreceptor connecting cilium (GO:0032391)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(2)	14			OV - Ovarian serous cystadenocarcinoma(3;0.0428)|Epithelial(53;0.246)			TCCAAAAATCCCTAGAAATTC	0.318																																																	0								ENSG00000114446						77.0	75.0	76.0					3																	107885832		2203	4298	6501	IFT57	SO:0001630	splice_region_variant	0			-	HGNC	AK001009	CCDS2951.1	3q13.13	2014-07-03	2014-07-03	2005-11-02	ENSG00000114446	ENSG00000114446		"""Intraflagellar transport homologs"""	17367	protein-coding gene	gene with protein product		606621	"""estrogen-related receptor beta like 1"", ""intraflagellar transport 57 homolog (Chlamydomonas)"""	ESRRBL1			Standard	NM_018010		Approved	FLJ10147, HIPPI, MHS4R2	uc003dwx.4	Q9NWB7	OTTHUMG00000159223	ENST00000264538.3:c.850-1G>T	3.37:g.107885832C>A		Somatic	0	57	0.00		0.5284069354479217	99	1.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	Q96DA9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Intra-flagellar_transport_57,superfamily_t-SNARE	p.G284*	ENST00000264538.3	37	c.850	CCDS2951.1	3	.	.	.	.	.	.	.	.	.	.	C	37	6.540874	0.97650	.	.	ENSG00000114446	ENST00000264538	.	.	.	5.78	5.78	0.91487	.	0.048959	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	20.0216	0.97506	0.0:1.0:0.0:0.0	.	.	.	.	X	284	.	ENSP00000264538:G284X	G	-	1	0	IFT57	109368522	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.130000	0.64745	2.735000	0.93741	0.650000	0.86243	GGA	-	pfam_Intra-flagellar_transport_57,superfamily_t-SNARE		0.318	IFT57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT57	protein_coding	OTTHUMT00000353918.1	C	NM_018010	-	Nonsense_Mutation	107885832	-1	no_errors	ENST00000264538	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ADAMTS12	81792	genome.wustl.edu	37	5	33535070	33535070	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:33535070G>T	ENST00000504830.1	-	23	4809	c.4474C>A	c.(4474-4476)Cag>Aag	p.Q1492K	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.Q1407K	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1492	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GTCCTCTTCTGAAAGCCACCT	0.483										HNSCC(64;0.19)																																							0								ENSG00000151388						89.0	84.0	86.0					5																	33535070		2203	4300	6503	ADAMTS12	SO:0001583	missense	0			-	HGNC	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4474C>A	5.37:g.33535070G>T	ENSP00000422554:p.Gln1492Lys	Somatic	0	25	0.00		0.5284069354479217	12	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.Q1492K	ENST00000504830.1	37	c.4474	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	G	21.2	4.120780	0.77436	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.55052	0.54;0.54	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.71584	0.3357	M	0.77486	2.375	0.80722	D	1	D;D	0.62365	0.989;0.991	D;D	0.74023	0.969;0.982	T	0.73845	-0.3854	10	0.52906	T	0.07	.	14.1242	0.65210	0.0:0.0:1.0:0.0	.	1407;1492	P58397-3;P58397	.;ATS12_HUMAN	K	1492;1407	ENSP00000422554:Q1492K;ENSP00000344847:Q1407K	ENSP00000344847:Q1407K	Q	-	1	0	ADAMTS12	33570827	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	3.606000	0.54095	2.470000	0.83445	0.563000	0.77884	CAG	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.483	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	G	NM_030955	-		33535070	-1	no_errors	ENST00000504830	ensembl	human	known	74_37	missense	SNP	1.000	T
OR2W3	343171	genome.wustl.edu	37	1	248058999	248058999	+	Silent	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:248058999G>T	ENST00000360358.3	+	1	111	c.111G>T	c.(109-111)ctG>ctT	p.L37L	OR2W3_ENST00000537741.1_Silent_p.L37L	NM_001001957.2	NP_001001957.2	Q7Z3T1	OR2W3_HUMAN	olfactory receptor, family 2, subfamily W, member 3	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L37L(1)		breast(1)|kidney(2)|large_intestine(2)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)	49	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CGTACCTCCTGACCCTCGTAG	0.582																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000238243						176.0	155.0	162.0					1																	248058999		2203	4300	6503	OR2W3	SO:0001819	synonymous_variant	0			-	HGNC	N75737	CCDS31099.1	1q44	2012-08-09		2004-03-10	ENSG00000238243	ENSG00000238243		"""GPCR / Class A : Olfactory receptors"""	15021	protein-coding gene	gene with protein product				OR2W8P, OR2W3P		14983052	Standard	NM_001001957		Approved	OST718	uc010pzb.2	Q7Z3T1	OTTHUMG00000040204	ENST00000360358.3:c.111G>T	1.37:g.248058999G>T		Somatic	0	54	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q6IF06|Q8NG86	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L37	ENST00000360358.3	37	c.111	CCDS31099.1	1																																																																																			-	prints_GPCR_Rhodpsn		0.582	OR2W3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2W3	protein_coding	OTTHUMT00000096861.1	G	NM_001001957	-		248058999	+1	no_errors	ENST00000360358	ensembl	human	known	74_37	silent	SNP	0.078	T
CXorf36	79742	genome.wustl.edu	37	X	45013192	45013192	+	Silent	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chrX:45013192C>A	ENST00000398000.2	-	4	998	c.924G>T	c.(922-924)cgG>cgT	p.R308R	CXorf36_ENST00000477281.1_5'UTR	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	308						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						CACTGGCATCCCGGATGAACA	0.532																																																	0								ENSG00000147113						62.0	49.0	53.0					X																	45013192		1568	3582	5150	CXorf36	SO:0001819	synonymous_variant	0			-	HGNC	AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.924G>T	X.37:g.45013192C>A		Somatic	0	29	0.00		0.5284069354479217	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	A8MUU5|B2RPN7|Q6UWJ5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R308	ENST00000398000.2	37	c.924	CCDS48096.1	X																																																																																			-	NULL		0.532	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf36	protein_coding	OTTHUMT00000056333.2	C	NM_024689	-		45013192	-1	no_errors	ENST00000398000	ensembl	human	known	74_37	silent	SNP	0.994	A
RHBDL3	162494	genome.wustl.edu	37	17	30621407	30621407	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr17:30621407C>A	ENST00000269051.4	+	5	628	c.614C>A	c.(613-615)cCa>cAa	p.P205Q	RHBDL3_ENST00000538145.1_Missense_Mutation_p.P197Q|RHBDL3_ENST00000536287.1_Missense_Mutation_p.P107Q	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	205						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				GTTTACCACCCACAGCTGCGA	0.478																																																	0								ENSG00000141314						159.0	131.0	140.0					17																	30621407		2203	4300	6503	RHBDL3	SO:0001583	missense	0			-	HGNC	AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.614C>A	17.37:g.30621407C>A	ENSP00000269051:p.Pro205Gln	Somatic	0	81	0.00		0.5284069354479217	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S54_rhomboid_dom,pirsf_Peptidase_S54_rhomboid_met,pfscan_EF_hand_dom	p.P205Q	ENST00000269051.4	37	c.614	CCDS32613.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.137629	0.94517	.	.	ENSG00000141314	ENST00000431505;ENST00000269051;ENST00000538145;ENST00000536287	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.46600	0.1401	M	0.85710	2.77	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.42068	-0.9473	10	0.87932	D	0	-38.6186	20.8794	0.99867	0.0:1.0:0.0:0.0	.	205;197;205	E9PD28;Q495Y5;P58872	.;.;RHBL3_HUMAN	Q	205;205;197;107	ENSP00000394849:P205Q;ENSP00000269051:P205Q;ENSP00000442092:P197Q;ENSP00000466508:P107Q	ENSP00000269051:P205Q	P	+	2	0	RHBDL3	27645520	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CCA	-	pirsf_Peptidase_S54_rhomboid_met		0.478	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RHBDL3	protein_coding	OTTHUMT00000447120.1	C	NM_138328	-		30621407	+1	no_errors	ENST00000269051	ensembl	human	known	74_37	missense	SNP	1.000	A
CDC42EP1	11135	genome.wustl.edu	37	22	37964613	37964613	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr22:37964613G>T	ENST00000249014.4	+	3	1382	c.962G>T	c.(961-963)tGg>tTg	p.W321L		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	321					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					GGCAGGCACTGGGGAGCAGGC	0.701																																																	0								ENSG00000128283						11.0	13.0	12.0					22																	37964613		2189	4287	6476	CDC42EP1	SO:0001583	missense	0			-	HGNC	M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.962G>T	22.37:g.37964613G>T	ENSP00000249014:p.Trp321Leu	Somatic	0	36	0.00		0.5284069354479217	252	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	A8K825|Q96GN1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CRIB_dom,smart_CRIB_dom,pfscan_CRIB_dom	p.W321L	ENST00000249014.4	37	c.962	CCDS13949.1	22	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027279	0.75390	.	.	ENSG00000128283	ENST00000249014	T	0.52057	0.68	4.81	4.81	0.61882	.	1.594300	0.03911	N	0.281911	T	0.43166	0.1235	L	0.29908	0.895	0.20975	N	0.999815	B	0.15473	0.013	B	0.11329	0.006	T	0.31110	-0.9955	10	0.13470	T	0.59	-5.2856	17.2474	0.87032	0.0:0.0:1.0:0.0	.	321	Q00587	BORG5_HUMAN	L	321	ENSP00000249014:W321L	ENSP00000249014:W321L	W	+	2	0	CDC42EP1	36294559	0.997000	0.39634	0.819000	0.32651	0.239000	0.25481	3.552000	0.53705	2.375000	0.81037	0.561000	0.74099	TGG	-	NULL		0.701	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP1	protein_coding	OTTHUMT00000318993.1	G	NM_152243	-		37964613	+1	no_errors	ENST00000249014	ensembl	human	known	74_37	missense	SNP	0.365	T
UBA6	55236	genome.wustl.edu	37	4	68488624	68488624	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:68488624G>T	ENST00000322244.5	-	32	3007	c.2948C>A	c.(2947-2949)cCa>cAa	p.P983Q		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	983					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						CACCATTGTTGGCTCAATTCC	0.343																																																	0								ENSG00000033178						124.0	116.0	118.0					4																	68488624		2203	4300	6503	UBA6	SO:0001583	missense	0			-	HGNC	AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.2948C>A	4.37:g.68488624G>T	ENSP00000313454:p.Pro983Gln	Somatic	0	44	0.00		0.5284069354479217	24	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.P983Q	ENST00000322244.5	37	c.2948	CCDS3516.1	4	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813879	0.90790	.	.	ENSG00000033178	ENST00000322244	T	0.43294	0.95	6.07	6.07	0.98685	Ubiquitin-activating enzyme e1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65344	0.2682	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.64019	-0.6505	10	0.72032	D	0.01	-21.052	20.6593	0.99626	0.0:0.0:1.0:0.0	.	983	A0AVT1	UBA6_HUMAN	Q	983	ENSP00000313454:P983Q	ENSP00000313454:P983Q	P	-	2	0	UBA6	68171219	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.229000	0.95273	2.885000	0.99019	0.655000	0.94253	CCA	-	pfam_Ub-activating_enz_e1_C,tigrfam_UBQ-activ_enz_E1		0.343	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6	protein_coding	OTTHUMT00000251429.2	G	NM_018227	-		68488624	-1	no_errors	ENST00000322244	ensembl	human	known	74_37	missense	SNP	1.000	T
GABRG3	2567	genome.wustl.edu	37	15	27777805	27777805	+	Silent	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr15:27777805C>T	ENST00000333743.6	+	10	1436	c.1182C>T	c.(1180-1182)tcC>tcT	p.S394S	RP11-100M12.3_ENST00000556642.1_RNA	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	394					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TAAACAATTCCGTTTACTGGC	0.423																																					NSCLC(114;800 1656 7410 37729 45293)												0								ENSG00000182256						97.0	99.0	98.0					15																	27777805		1966	4153	6119	GABRG3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.1182C>T	15.37:g.27777805C>T		Somatic	0	72	0.00		0.5284069354479217	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	67	36	65.05	G3V594|Q9HD46|Q9NYT2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg_rcpt,prints_GABAA_rcpt,prints_GABBAg3_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.S394	ENST00000333743.6	37	c.1182	CCDS45195.1	15																																																																																			-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABBAg3_rcpt,tigrfam_Neur_channel		0.423	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRG3	protein_coding	OTTHUMT00000103584.2	C		-		27777805	+1	no_errors	ENST00000333743	ensembl	human	known	74_37	silent	SNP	1.000	T
KCND3	3752	genome.wustl.edu	37	1	112525032	112525032	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:112525032G>T	ENST00000315987.2	-	2	796	c.317C>A	c.(316-318)cCg>cAg	p.P106Q	KCND3_ENST00000369697.1_Missense_Mutation_p.P106Q|KCND3_ENST00000302127.4_Missense_Mutation_p.P106Q	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	106					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CTCGTAGCGCGGGTAGTGCAG	0.602																																																	0								ENSG00000171385						113.0	98.0	103.0					1																	112525032		2203	4300	6503	KCND3	SO:0001583	missense	0			-	HGNC	AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.317C>A	1.37:g.112525032G>T	ENSP00000319591:p.Pro106Gln	Somatic	0	27	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.30	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_volt-dep_Kv4_C,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Shal-type,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.3,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.P106Q	ENST00000315987.2	37	c.317	CCDS843.1	1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.368782	0.82463	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	T;T;T	0.52754	0.65;0.65;0.65	5.61	5.61	0.85477	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	T	0.77191	0.4094	H	0.96333	3.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.83835	0.0254	10	0.62326	D	0.03	.	19.2336	0.93849	0.0:0.0:1.0:0.0	.	106;106	Q14D71;Q9UK17	.;KCND3_HUMAN	Q	106	ENSP00000358711:P106Q;ENSP00000319591:P106Q;ENSP00000306923:P106Q	ENSP00000306923:P106Q	P	-	2	0	KCND3	112326555	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	9.869000	0.99810	2.648000	0.89879	0.563000	0.77884	CCG	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3		0.602	KCND3-001	KNOWN	basic|CCDS	protein_coding	KCND3	protein_coding	OTTHUMT00000033144.1	G	NM_172198	-		112525032	-1	no_errors	ENST00000315987	ensembl	human	known	74_37	missense	SNP	1.000	T
CD19	930	genome.wustl.edu	37	16	28943879	28943879	+	Missense_Mutation	SNP	C	C	A	rs566183838		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:28943879C>A	ENST00000324662.3	+	2	345	c.301C>A	c.(301-303)Ccc>Acc	p.P101T	CD19_ENST00000567541.1_Missense_Mutation_p.P101T|CD19_ENST00000538922.1_Missense_Mutation_p.P101T			P15391	CD19_HUMAN	CD19 molecule	101	Ig-like C2-type 1.				B cell receptor signaling pathway (GO:0050853)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor signaling protein activity (GO:0005057)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|ovary(2)|skin(4)|urinary_tract(1)	29						CCAGCCGGGGCCCCCCTCTGA	0.657																																																	0								ENSG00000177455						12.0	15.0	14.0					16																	28943879		2186	4272	6458	CD19	SO:0001583	missense	0			-	HGNC		CCDS10644.1, CCDS53998.1	16p11.2	2014-09-17	2006-03-28		ENSG00000177455	ENSG00000177455		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1633	protein-coding gene	gene with protein product		107265	"""CD19 antigen"""				Standard	NM_001770		Approved		uc010byo.2	P15391	OTTHUMG00000097049	ENST00000324662.3:c.301C>A	16.37:g.28943879C>A	ENSP00000313419:p.Pro101Thr	Somatic	0	38	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	A0N0P9|F5H635|Q96S68|Q9BRD6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,pfscan_Ig-like_dom	p.P101T	ENST00000324662.3	37	c.301	CCDS10644.1	16	.	.	.	.	.	.	.	.	.	.	C	7.398	0.632139	0.14322	.	.	ENSG00000177455	ENST00000538922;ENST00000324662	T;T	0.39997	1.05;1.05	5.64	4.69	0.59074	Immunoglobulin subtype (1);	0.392571	0.21964	N	0.066550	T	0.35068	0.0919	L	0.32530	0.975	0.09310	N	1	B;B	0.33413	0.358;0.411	B;B	0.38225	0.175;0.268	T	0.24941	-1.0146	10	0.40728	T	0.16	-6.9123	10.6353	0.45560	0.0:0.911:0.0:0.089	.	101;101	F5H635;P15391	.;CD19_HUMAN	T	101	ENSP00000437940:P101T;ENSP00000313419:P101T	ENSP00000313419:P101T	P	+	1	0	CD19	28851380	0.001000	0.12720	0.003000	0.11579	0.050000	0.14768	0.942000	0.29017	1.379000	0.46325	0.514000	0.50259	CCC	-	smart_Ig_sub		0.657	CD19-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD19	protein_coding	OTTHUMT00000214152.2	C		-		28943879	+1	no_errors	ENST00000538922	ensembl	human	known	74_37	missense	SNP	0.005	A
NEK8	284086	genome.wustl.edu	37	17	27067518	27067518	+	Frame_Shift_Del	DEL	C	C	-			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr17:27067518delC	ENST00000268766.6	+	11	1489	c.1455delC	c.(1453-1455)tgcfs	p.C485fs	AC010761.6_ENST00000584779.1_RNA|AC010761.6_ENST00000582536.1_RNA	NM_178170.2	NP_835464.1	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	485					organ morphogenesis (GO:0009887)|regulation of hippo signaling (GO:0035330)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|primary cilium (GO:0072372)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Lung NSC(42;0.0158)					CCCACAGCTGCCCCCAGCAGG	0.572																																					NSCLC(6;19 293 14866 25253 49845)												0								ENSG00000160602						87.0	84.0	85.0					17																	27067518		2203	4300	6503	NEK8	SO:0001589	frameshift_variant	0				HGNC	AY267371	CCDS32597.1	17q11.1	2012-11-15	2012-11-15			ENSG00000160602			13387	protein-coding gene	gene with protein product		609799	"""NIMA (never in mitosis gene a)- related kinase 8"""			18199800	Standard	NM_178170		Approved	NPHP9	uc002hcp.3	Q86SG6		ENST00000268766.6:c.1455delC	17.37:g.27067518delC	ENSP00000268766:p.Cys485fs	Somatic	0	24	0.00		0.5284069354479217	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	29	9.38	A6NIC5|Q14CL7|Q2M1S6|Q8NDH1	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_RCC1/BLIP-II,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_dom,prints_Reg_chr_condens,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q487fs	ENST00000268766.6	37	c.1455	CCDS32597.1	17																																																																																			-	pfam_Reg_chr_condens,superfamily_RCC1/BLIP-II,pfscan_Reg_chr_condens		0.572	NEK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK8	protein_coding	OTTHUMT00000446467.2	C				27067518	+1	no_errors	ENST00000268766	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
AC015849.16	0	genome.wustl.edu	37	17	34235476	34235476	+	lincRNA	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr17:34235476C>A	ENST00000587132.1	-	0	2551																											AGACGATTCTCACAGGATGGT	0.512																																																	0								ENSG00000266999																																			AC015849.16			0			-	Clone_based_vega_gene																													17.37:g.34235476C>A		Somatic	0	28	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000587132.1	37	NULL		17																																																																																			-	-		0.512	AC015849.16-001	KNOWN	basic	lincRNA	ENSG00000266999	lincRNA	OTTHUMT00000449325.1	C		-		34235476	-1	no_errors	ENST00000587132	ensembl	human	known	74_37	rna	SNP	0.060	A
PAPPA	5069	genome.wustl.edu	37	9	118950454	118950454	+	Silent	SNP	C	C	A	rs556662763		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr9:118950454C>A	ENST00000328252.3	+	2	1806	c.1437C>A	c.(1435-1437)acC>acA	p.T479T	PAPPA_ENST00000534838.1_5'UTR	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	479	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CTGAAATCACCAATGTCACTC	0.488																																																	0								ENSG00000182752						96.0	72.0	80.0					9																	118950454		2203	4300	6503	PAPPA	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1437C>A	9.37:g.118950454C>A		Somatic	0	23	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.T479	ENST00000328252.3	37	c.1437	CCDS6813.1	9																																																																																			-	NULL		0.488	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	protein_coding	OTTHUMT00000055546.1	C	NM_002581	-		118950454	+1	no_errors	ENST00000328252	ensembl	human	known	74_37	silent	SNP	0.007	A
NFATC3	4775	genome.wustl.edu	37	16	68156082	68156082	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:68156082C>A	ENST00000346183.3	+	2	320	c.296C>A	c.(295-297)cCa>cAa	p.P99Q	RP11-67A1.2_ENST00000548144.1_RNA|NFATC3_ENST00000329524.4_Missense_Mutation_p.P99Q|NFATC3_ENST00000535127.2_3'UTR|NFATC3_ENST00000575270.1_Missense_Mutation_p.P99Q|NFATC3_ENST00000349223.5_Missense_Mutation_p.P99Q	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3	99					cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		AAATATAGCCCATTAGGTGGT	0.403																																																	0								ENSG00000072736						121.0	111.0	114.0					16																	68156082		2198	4300	6498	NFATC3	SO:0001583	missense	0			-	HGNC	L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.296C>A	16.37:g.68156082C>A	ENSP00000300659:p.Pro99Gln	Somatic	0	53	0.00		0.5284069354479217	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	O75211|Q14516|Q99840|Q99841|Q99842	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT,pfscan_RHD,prints_NFAT	p.P99Q	ENST00000346183.3	37	c.296	CCDS10860.1	16	.	.	.	.	.	.	.	.	.	.	C	15.61	2.884528	0.51908	.	.	ENSG00000072736	ENST00000349223;ENST00000346183;ENST00000329524	T;T;T	0.08984	3.03;3.04;3.04	5.71	5.71	0.89125	.	0.165522	0.53938	D	0.000041	T	0.13884	0.0336	L	0.54323	1.7	0.52501	D	0.99995	B;B;B;B	0.23591	0.007;0.088;0.007;0.025	B;B;B;B	0.25759	0.005;0.063;0.007;0.005	T	0.02596	-1.1136	10	0.87932	D	0	-2.5734	20.2785	0.98491	0.0:1.0:0.0:0.0	.	99;99;99;99	Q12968;Q12968-3;B5B2S0;B5B2S2	NFAC3_HUMAN;.;.;.	Q	99	ENSP00000264008:P99Q;ENSP00000300659:P99Q;ENSP00000331324:P99Q	ENSP00000331324:P99Q	P	+	2	0	NFATC3	66713583	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.074000	0.57577	2.869000	0.98440	0.558000	0.71614	CCA	-	NULL		0.403	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFATC3	protein_coding	OTTHUMT00000268890.2	C	NM_004555	-		68156082	+1	no_errors	ENST00000346183	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM230C	26080	genome.wustl.edu	37	22	21663891	21663891	+	lincRNA	SNP	T	T	C	rs482113		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr22:21663891T>C	ENST00000436681.1	-	0	279																											TGGTGTGATGTATGGAGGTGG	0.537																																																	0								ENSG00000206142																																			KB-1183D5.13			0			-	Clone_based_vega_gene																													22.37:g.21663891T>C		Somatic	0	63	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	1	88.89		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			-	-		0.537	KB-1183D5.13-003	KNOWN	basic	lincRNA	FAM230C	lincRNA	OTTHUMT00000320109.1	T		-		21663891	-1	no_errors	ENST00000436681	ensembl	human	known	74_37	rna	SNP	0.411	C
PLD4	122618	genome.wustl.edu	37	14	105394089	105394089	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr14:105394089C>T	ENST00000392593.4	+	3	338	c.170C>T	c.(169-171)cCt>cTt	p.P57L	PLD4_ENST00000540372.1_Missense_Mutation_p.P64L	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	57					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			GTGCCCCGTCCTCCCACCTGG	0.687																																																	0								ENSG00000166428						18.0	23.0	21.0					14																	105394089		2126	4247	6373	PLD4	SO:0001583	missense	0			-	HGNC		CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.170C>T	14.37:g.105394089C>T	ENSP00000376372:p.Pro57Leu	Somatic	0	92	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	59	43.81	Q6UWD2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_D/transphosphatidylase,smart_PLipase_D/transphosphatidylase,pfscan_PLipase_D/transphosphatidylase	p.P57L	ENST00000392593.4	37	c.170	CCDS9995.2	14	.	.	.	.	.	.	.	.	.	.	C	10.86	1.470648	0.26423	.	.	ENSG00000166428	ENST00000540372;ENST00000392593;ENST00000557573	T;T;T	0.26223	1.81;1.83;1.75	3.28	0.44	0.16572	.	1.201940	0.06377	U	0.714593	T	0.15305	0.0369	N	0.19112	0.55	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.31251	-0.9950	10	0.28530	T	0.3	-0.0024	5.3366	0.15961	0.0:0.6065:0.0:0.3935	.	64;57	F5H2B5;Q96BZ4	.;PLD4_HUMAN	L	64;57;55	ENSP00000438677:P64L;ENSP00000376372:P57L;ENSP00000451278:P55L	ENSP00000376372:P57L	P	+	2	0	PLD4	104465134	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.262000	0.18460	0.076000	0.16826	0.511000	0.50034	CCT	-	NULL		0.687	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLD4	protein_coding	OTTHUMT00000291348.2	C	NM_138790	-		105394089	+1	no_errors	ENST00000392593	ensembl	human	known	74_37	missense	SNP	0.000	T
HMGB1P5	10354	genome.wustl.edu	37	3	22424060	22424060	+	RNA	SNP	G	G	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr3:22424060G>A	ENST00000451497.1	+	0	625									high mobility group box 1 pseudogene 5																		TGTAAGATTTGTTTTTAAACT	0.338																																																	0								ENSG00000132967																																			HMGB1P5			0			-	HGNC	AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424060G>A		Somatic	0	51	0.00		0.5284069354479217	100	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	30	51.61		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			-	-		0.338	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	pseudogene	OTTHUMT00000340803.1	G	NG_000897	-		22424060	+1	no_errors	ENST00000451497	ensembl	human	known	74_37	rna	SNP	1.000	A
SLC5A11	115584	genome.wustl.edu	37	16	24921737	24921739	+	In_Frame_Del	DEL	CAG	CAG	-	rs140499762		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:24921737_24921739delCAG	ENST00000347898.3	+	15	2383_2385	c.1761_1763delCAG	c.(1759-1764)gccagc>gcc	p.S592del	SLC5A11_ENST00000569071.1_In_Frame_Del_p.S436del|SLC5A11_ENST00000565769.1_In_Frame_Del_p.S528del|SLC5A11_ENST00000567758.1_In_Frame_Del_p.S557del|SLC5A11_ENST00000568579.1_In_Frame_Del_p.S522del|SLC5A11_ENST00000545376.1_In_Frame_Del_p.S522del|SLC5A11_ENST00000449109.2_In_Frame_Del_p.S436del|SLC5A11_ENST00000539472.1_In_Frame_Del_p.S528del|SLC5A11_ENST00000424767.2_In_Frame_Del_p.S557del	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		TGCCAGAGGCCAGCAGCAGCAGC	0.542																																																	0								ENSG00000158865			0,59,4205		0,0,0,0,59,2073						2.3	0.0		dbSNP_134	91	12,151,8089		0,0,12,0,151,3963	no	codingComplex	SLC5A11	NM_052944.2		0,0,12,0,210,6036	A1A1,A1A2,A1R,A2A2,A2R,RR		1.9753,1.3837,1.7737				12,210,12294				SLC5A11	SO:0001651	inframe_deletion	0				HGNC	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.1761_1763delCAG	16.37:g.24921746_24921748delCAG	ENSP00000289932:p.Ser592del	Somatic	0	87	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.S591in_frame_del	ENST00000347898.3	37	c.1761_1763	CCDS10625.1	16																																																																																			-	NULL		0.542	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A11	protein_coding	OTTHUMT00000214091.3	CAG	NM_052944			24921739	+1	no_errors	ENST00000347898	ensembl	human	known	74_37	in_frame_del	DEL	0.002:0.001:0.001	-
CHML	1122	genome.wustl.edu	37	1	241797739	241797739	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:241797739C>A	ENST00000366553.1	-	1	1493	c.1330G>T	c.(1330-1332)Gaa>Taa	p.E444*	OPN3_ENST00000366554.2_Intron|OPN3_ENST00000331838.5_Intron|OPN3_ENST00000469376.1_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	444					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			GAGCATGTTTCCTCAGAAAGG	0.358																																																	0								ENSG00000203668						104.0	106.0	105.0					1																	241797739		2203	4300	6503	CHML	SO:0001587	stop_gained	0			-	HGNC	X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.1330G>T	1.37:g.241797739C>A	ENSP00000355511:p.Glu444*	Somatic	0	32	0.00		0.5284069354479217	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	B2RAB9|Q17RE0|Q9H1Y4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.E444*	ENST00000366553.1	37	c.1330	CCDS31073.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.332581	0.97480	.	.	ENSG00000203668	ENST00000366553	.	.	.	5.08	2.21	0.28008	.	1.393940	0.04048	U	0.304261	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.684	6.6163	0.22778	0.0:0.7134:0.0:0.2866	.	.	.	.	X	444	.	ENSP00000355511:E444X	E	-	1	0	CHML	239864362	0.998000	0.40836	0.985000	0.45067	0.970000	0.65996	1.010000	0.29898	0.856000	0.35383	0.655000	0.94253	GAA	-	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk		0.358	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	protein_coding	OTTHUMT00000095712.1	C	NM_001821	-		241797739	-1	no_errors	ENST00000366553	ensembl	human	known	74_37	nonsense	SNP	0.992	A
LNPEP	4012	genome.wustl.edu	37	5	96320886	96320886	+	Missense_Mutation	SNP	G	G	T	rs573270904		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:96320886G>T	ENST00000231368.5	+	3	1655	c.963G>T	c.(961-963)agG>agT	p.R321S	LNPEP_ENST00000395770.3_Missense_Mutation_p.R307S	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	321					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		AGATCATAAGGGATGAGCAAT	0.373																																																	0								ENSG00000113441						143.0	138.0	140.0					5																	96320886		2203	4300	6503	LNPEP	SO:0001583	missense	0			-	HGNC	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.963G>T	5.37:g.96320886G>T	ENSP00000231368:p.Arg321Ser	Somatic	0	47	0.00		0.5284069354479217	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.R321S	ENST00000231368.5	37	c.963	CCDS4087.1	5	.	.	.	.	.	.	.	.	.	.	G	17.81	3.479636	0.63849	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.04275	3.66;3.66	5.34	2.41	0.29592	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.046195	0.85682	D	0.000000	T	0.10121	0.0248	L	0.60904	1.88	0.47547	D	0.999451	P	0.47677	0.899	P	0.52031	0.688	T	0.01972	-1.1237	10	0.87932	D	0	.	7.9692	0.30117	0.4849:0.0:0.5151:0.0	.	321	Q9UIQ6	LCAP_HUMAN	S	321;307	ENSP00000231368:R321S;ENSP00000379117:R307S	ENSP00000231368:R321S	R	+	3	2	LNPEP	96346642	0.999000	0.42202	0.959000	0.39883	0.976000	0.68499	0.714000	0.25808	0.264000	0.21851	-0.152000	0.13540	AGG	-	pfam_Peptidase_M1_N		0.373	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNPEP	protein_coding	OTTHUMT00000250624.1	G	NM_005575	-		96320886	+1	no_errors	ENST00000231368	ensembl	human	known	74_37	missense	SNP	0.984	T
NPC1L1	29881	genome.wustl.edu	37	7	44560685	44560685	+	Missense_Mutation	SNP	T	T	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:44560685T>C	ENST00000289547.4	-	13	3041	c.2986A>G	c.(2986-2988)Atc>Gtc	p.I996V	NPC1L1_ENST00000546276.1_Missense_Mutation_p.I950V|NPC1L1_ENST00000381160.3_Missense_Mutation_p.I996V	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	996					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	CCCATCGTGATGCTCATGCAG	0.567																																																	0								ENSG00000015520						135.0	132.0	133.0					7																	44560685		2203	4300	6503	NPC1L1	SO:0001583	missense	0			-	HGNC		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.2986A>G	7.37:g.44560685T>C	ENSP00000289547:p.Ile996Val	Somatic	0	26	0.00		0.5284069354479217	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	22	42.11	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD	p.I996V	ENST00000289547.4	37	c.2986	CCDS5491.1	7	.	.	.	.	.	.	.	.	.	.	T	7.160	0.585583	0.13749	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.93366	-3.1;-3.11;-3.21	4.63	-1.91	0.07641	.	4.895910	0.00757	U	0.001119	D	0.84437	0.5472	N	0.17474	0.49	0.09310	N	1	B;B;B	0.12630	0.002;0.001;0.006	B;B;B	0.14578	0.011;0.002;0.006	T	0.75628	-0.3252	10	0.09590	T	0.72	-2.7223	4.2307	0.10601	0.2795:0.0:0.4035:0.3171	.	950;996;996	B7ZLE6;Q17RV5;D3DVK9	.;.;.	V	996;996;950	ENSP00000289547:I996V;ENSP00000370552:I996V;ENSP00000438033:I950V	ENSP00000289547:I996V	I	-	1	0	NPC1L1	44527210	0.000000	0.05858	0.000000	0.03702	0.373000	0.29922	-2.678000	0.00839	-0.276000	0.09206	-0.672000	0.03802	ATC	-	NULL		0.567	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	protein_coding	OTTHUMT00000251256.1	T	NM_013389	-		44560685	-1	no_errors	ENST00000289547	ensembl	human	known	74_37	missense	SNP	0.000	C
SHCBP1	79801	genome.wustl.edu	37	16	46633815	46633815	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:46633815C>A	ENST00000303383.3	-	9	1539	c.1273G>T	c.(1273-1275)Gac>Tac	p.D425Y		NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	425					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)					breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				CCAGTGCAGTCCACAAAAGTG	0.408																																																	0								ENSG00000171241						101.0	95.0	97.0					16																	46633815		2203	4300	6503	SHCBP1	SO:0001583	missense	0			-	HGNC	AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.1273G>T	16.37:g.46633815C>A	ENSP00000306473:p.Asp425Tyr	Somatic	0	27	0.00		0.5284069354479217	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	Q96N60|Q9BVS0|Q9H6P6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Pectin_lyase_fold/virulence,smart_PbH1	p.D425Y	ENST00000303383.3	37	c.1273	CCDS10720.1	16	.	.	.	.	.	.	.	.	.	.	C	16.43	3.121824	0.56613	.	.	ENSG00000171241	ENST00000303383	T	0.47177	0.85	3.79	3.79	0.43588	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.101764	0.64402	D	0.000003	T	0.59932	0.2230	L	0.44542	1.39	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	T	0.64037	-0.6501	10	0.56958	D	0.05	-21.6653	15.8308	0.78749	0.0:1.0:0.0:0.0	.	425	Q8NEM2	SHCBP_HUMAN	Y	425	ENSP00000306473:D425Y	ENSP00000306473:D425Y	D	-	1	0	SHCBP1	45191316	1.000000	0.71417	0.998000	0.56505	0.273000	0.26683	6.833000	0.75334	1.953000	0.56701	0.563000	0.77884	GAC	-	superfamily_Pectin_lyase_fold/virulence		0.408	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1	protein_coding	OTTHUMT00000255740.1	C	NM_024745	-		46633815	-1	no_errors	ENST00000303383	ensembl	human	known	74_37	missense	SNP	1.000	A
FAM27B	100133121	genome.wustl.edu	37	9	67793683	67793684	+	Intron	INS	-	-	CT			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr9:67793683_67793684insCT	ENST00000377484.3	-	1	215				RP11-12A20.7_ENST00000315762.5_RNA			Q5VT28	FAM27_HUMAN	family with sequence similarity 27, member B																		acacacacacacactcacacac	0.515																																																	0								ENSG00000236233																																			RP11-12A20.7	SO:0001627	intron_variant	0				Clone_based_vega_gene			9q13	2014-05-06			ENSG00000170215	ENSG00000278763			23667	other	unknown							Standard	NR_027422		Approved	bA12A20.3, FAM27A2	uc004aet.4	Q5VT28	OTTHUMG00000188586	ENST00000377484.3:c.78+212->AG	9.37:g.67793683_67793684insCT		Somatic	0	10	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	7	46.15		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000377484.3	37	NULL		9																																																																																			-	-		0.515	FAM27B-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000236233	protein_coding	OTTHUMT00000037106.1	-	NR_027422			67793684	+1	no_errors	ENST00000315762	ensembl	human	known	74_37	rna	INS	0.063:0.065	CT
C19orf38	255809	genome.wustl.edu	37	19	10966998	10966998	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:10966998C>T	ENST00000397820.4	+	3	505	c.398C>T	c.(397-399)gCt>gTt	p.A133V	C19orf38_ENST00000592854.1_Missense_Mutation_p.A133V	NM_001136482.1	NP_001129954.1	A8MVS5	HIDE1_HUMAN	chromosome 19 open reading frame 38	133						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)	2						TTCCTCCTTGCTGGGCTGGTG	0.557																																																	0								ENSG00000214212						115.0	90.0	97.0					19																	10966998		692	1591	2283	C19orf38	SO:0001583	missense	0			-	HGNC		CCDS45970.1	19p13.2	2011-08-02	2008-04-14		ENSG00000214212	ENSG00000214212			34073	protein-coding gene	gene with protein product	"""Highly expressed in immature dendritic cell transcript 1"""						Standard	NM_001136482		Approved	HIDE1	uc010dxm.1	A8MVS5		ENST00000397820.4:c.398C>T	19.37:g.10966998C>T	ENSP00000380920:p.Ala133Val	Somatic	0	29	0.00		0.5284069354479217	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	B2RXI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A133V	ENST00000397820.4	37	c.398	CCDS45970.1	19	.	.	.	.	.	.	.	.	.	.	C	11.01	1.513359	0.27123	.	.	ENSG00000214212	ENST00000397820	.	.	.	5.26	1.75	0.24633	.	0.514825	0.14315	U	0.327408	T	0.24890	0.0604	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.19745	-1.0296	9	0.16420	T	0.52	-5.1548	5.0968	0.14737	0.0:0.5763:0.0:0.4237	.	133	A8MVS5	HIDE1_HUMAN	V	133	.	ENSP00000380920:A133V	A	+	2	0	C19orf38	10827998	0.000000	0.05858	0.006000	0.13384	0.032000	0.12392	-0.595000	0.05727	0.626000	0.30322	0.555000	0.69702	GCT	-	NULL		0.557	C19orf38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf38	protein_coding	OTTHUMT00000452622.1	C	NM_001136482	-		10966998	+1	no_errors	ENST00000397820	ensembl	human	known	74_37	missense	SNP	0.011	T
WWC1	23286	genome.wustl.edu	37	5	167891760	167891760	+	Silent	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:167891760C>A	ENST00000265293.4	+	21	3445	c.2943C>A	c.(2941-2943)tcC>tcA	p.S981S	WWC1_ENST00000522140.1_3'UTR|WWC1_ENST00000521089.1_Silent_p.S987S	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	981	Interaction with PRKCZ.|Interaction with histone H3.				cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		CGCTGCGCTCCGAGCGTCTGA	0.607																																																	0								ENSG00000113645						49.0	49.0	49.0					5																	167891760		2203	4300	6503	WWC1	SO:0001819	synonymous_variant	0			-	HGNC	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2943C>A	5.37:g.167891760C>A		Somatic	0	52	0.00		0.5284069354479217	77	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.S981	ENST00000265293.4	37	c.2943	CCDS4366.1	5																																																																																			-	NULL		0.607	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	protein_coding	OTTHUMT00000252791.2	C	NM_015238	-		167891760	+1	no_errors	ENST00000265293	ensembl	human	known	74_37	silent	SNP	0.002	A
FRS2	10818	genome.wustl.edu	37	12	69967977	69967977	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr12:69967977C>A	ENST00000550389.1	+	7	1015	c.769C>A	c.(769-771)Cct>Act	p.P257T	FRS2_ENST00000299293.2_Missense_Mutation_p.P257T|FRS2_ENST00000397997.2_Missense_Mutation_p.P257T|FRS2_ENST00000549921.1_Missense_Mutation_p.P257T	NM_001278353.1|NM_001278357.1	NP_001265282.1|NP_001265286.1	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	257					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification, embryo (GO:0008595)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation with mouth forming second (GO:0001702)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lens fiber cell development (GO:0070307)|neuroblast proliferation (GO:0007405)|neurotrophin TRK receptor signaling pathway (GO:0048011)|optic placode formation involved in camera-type eye formation (GO:0046619)|organ induction (GO:0001759)|phosphatidylinositol-mediated signaling (GO:0048015)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of apoptotic process (GO:0042981)|regulation of epithelial cell proliferation (GO:0050678)|regulation of ERK1 and ERK2 cascade (GO:0070372)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatase activator activity (GO:0019211)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			AGGGCCAACCCCTGTTCAAAA	0.423																																																	0								ENSG00000166225						72.0	68.0	69.0					12																	69967977		1865	4097	5962	FRS2	SO:0001583	missense	0			-	HGNC	AF036717	CCDS41809.1	12q15	2008-02-05				ENSG00000166225			16971	protein-coding gene	gene with protein product		607743				8761293, 9660748	Standard	NM_001278351		Approved	SNT-1, FRS2alpha, SNT1, FRS2A	uc001suz.3	Q8WU20		ENST00000550389.1:c.769C>A	12.37:g.69967977C>A	ENSP00000447241:p.Pro257Thr	Somatic	0	37	0.00		0.5284069354479217	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	B0LPF2|B2R684|O43558|Q7LDQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.P257T	ENST00000550389.1	37	c.769	CCDS41809.1	12	.	.	.	.	.	.	.	.	.	.	C	14.00	2.406014	0.42715	.	.	ENSG00000166225	ENST00000299293;ENST00000549921;ENST00000550389;ENST00000397997	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	5.9	5.01	0.66863	.	0.145399	0.64402	D	0.000005	T	0.29028	0.0721	L	0.52011	1.625	0.54753	D	0.99998	B	0.30793	0.295	B	0.28011	0.085	T	0.03795	-1.1003	9	.	.	.	-8.5926	14.8457	0.70259	0.0:0.9313:0.0:0.0687	.	257	Q8WU20	FRS2_HUMAN	T	257	ENSP00000299293:P257T;ENSP00000450048:P257T;ENSP00000447241:P257T;ENSP00000381083:P257T	.	P	+	1	0	FRS2	68254244	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.576000	0.82467	1.493000	0.48517	0.650000	0.86243	CCT	-	NULL		0.423	FRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRS2	protein_coding	OTTHUMT00000403760.1	C	NM_006654	-		69967977	+1	no_errors	ENST00000299293	ensembl	human	known	74_37	missense	SNP	1.000	A
PTPRJ	5795	genome.wustl.edu	37	11	48142787	48142787	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:48142787G>T	ENST00000418331.2	+	4	937	c.585G>T	c.(583-585)tgG>tgT	p.W195C	PTPRJ_ENST00000440289.2_Missense_Mutation_p.W195C	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	195	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						ATGAGACTTGGGGAGATCCCA	0.448																																																	0								ENSG00000149177						106.0	101.0	103.0					11																	48142787		2201	4298	6499	PTPRJ	SO:0001583	missense	0			-	HGNC	U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.585G>T	11.37:g.48142787G>T	ENSP00000400010:p.Trp195Cys	Somatic	0	37	0.00		0.5284069354479217	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.W195C	ENST00000418331.2	37	c.585	CCDS7945.1	11	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229380	0.39399	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289;ENST00000534219	T;T;T	0.81163	0.57;0.57;-1.46	5.41	0.0324	0.14175	Fibronectin, type III (3);	.	.	.	.	T	0.79009	0.4374	L	0.36672	1.1	0.09310	N	0.999999	D;D	0.64830	0.967;0.994	P;D	0.63033	0.814;0.91	T	0.65315	-0.6198	9	0.48119	T	0.1	.	3.0956	0.06308	0.2771:0.0:0.4046:0.3183	.	195;195	Q12913;Q6P4H4	PTPRJ_HUMAN;.	C	195;195;195;116	ENSP00000400010:W195C;ENSP00000409733:W195C;ENSP00000432686:W116C	ENSP00000278456:W195C	W	+	3	0	PTPRJ	48099363	0.000000	0.05858	0.000000	0.03702	0.118000	0.20060	-0.446000	0.06837	-0.027000	0.13873	0.591000	0.81541	TGG	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.448	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	protein_coding	OTTHUMT00000390525.1	G		-		48142787	+1	no_errors	ENST00000418331	ensembl	human	known	74_37	missense	SNP	0.001	T
TRA2B	6434	genome.wustl.edu	37	3	185638941	185638941	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr3:185638941C>A	ENST00000453386.2	-	6	948	c.673G>T	c.(673-675)Gga>Tga	p.G225*	TRA2B_ENST00000382191.4_Nonsense_Mutation_p.G125*	NM_004593.2	NP_004584.1	P62995	TRA2B_HUMAN	transformer 2 beta homolog (Drosophila)	225	Linker.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing, via transesterification reactions (GO:0000375)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|kidney(1)|large_intestine(6)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	18						CGATCATATCCTCTGTCATAG	0.418																																																	0								ENSG00000136527						118.0	108.0	112.0					3																	185638941		2203	4300	6503	TRA2B	SO:0001587	stop_gained	0			-	HGNC	AF057159	CCDS33905.1, CCDS58872.1	3q26.2-q27	2014-06-13	2009-02-27	2009-02-27	ENSG00000136527	ENSG00000136527		"""RNA binding motif (RRM) containing"""	10781	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 156"""	602719	"""splicing factor, arginine/serine-rich 10 (transformer 2 homolog, Drosophila)"""	SFRS10		9790768	Standard	NM_004593		Approved	Htra2-beta, PPP1R156	uc003fpv.3	P62995	OTTHUMG00000156641	ENST00000453386.2:c.673G>T	3.37:g.185638941C>A	ENSP00000416959:p.Gly225*	Somatic	0	35	0.00		0.5284069354479217	832	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B4DVK2|D3DNU3|O15449|Q15815|Q64283	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G225*	ENST00000453386.2	37	c.673	CCDS33905.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.266890|5.266890	0.95399|0.95399	.|.	.|.	ENSG00000136527|ENSG00000136527	ENST00000259043;ENST00000414862|ENST00000453386;ENST00000382191	.|.	.|.	.|.	6.07|6.07	5.2|5.2	0.72013|0.72013	.|.	.|0.048051	.|0.85682	.|D	.|0.000000	T|.	0.54870|.	0.1885|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.47849|.	-0.9085|.	4|.	.|0.11485	.|T	.|0.65	-8.6399|-8.6399	16.4581|16.4581	0.84029|0.84029	0.0:0.8685:0.1315:0.0|0.0:0.8685:0.1315:0.0	.|.	.|.	.|.	.|.	D|X	83;44|225;125	.|.	.|ENSP00000371626:G125X	E|G	-|-	3|1	2|0	TRA2B|TRA2B	187121635|187121635	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.864000|0.864000	0.49448|0.49448	7.375000|7.375000	0.79646|0.79646	1.567000|1.567000	0.49668|0.49668	0.655000|0.655000	0.94253|0.94253	GAG|GGA	-	NULL		0.418	TRA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRA2B	protein_coding	OTTHUMT00000344984.1	C	NM_004593	-		185638941	-1	no_errors	ENST00000453386	ensembl	human	known	74_37	nonsense	SNP	1.000	A
OR4M1	441670	genome.wustl.edu	37	14	20249229	20249229	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr14:20249229G>C	ENST00000315957.4	+	1	829	c.748G>C	c.(748-750)Gtg>Ctg	p.V250L		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	250						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TACCATTGTGGTGCTAATGTT	0.448																																																	0								ENSG00000176299						230.0	209.0	216.0					14																	20249229		2203	4297	6500	OR4M1	SO:0001583	missense	0			-	HGNC		CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.748G>C	14.37:g.20249229G>C	ENSP00000319654:p.Val250Leu	Somatic	0	173	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	141	21.23	B9EH18|Q6IFA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V250L	ENST00000315957.4	37	c.748	CCDS32021.1	14	.	.	.	.	.	.	.	.	.	.	.	7.088	0.571506	0.13623	.	.	ENSG00000176299	ENST00000315957	T	0.39787	1.06	4.42	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000411	T	0.21145	0.0509	N	0.04768	-0.165	0.32828	D	0.503717	B	0.25563	0.129	B	0.23852	0.049	T	0.20505	-1.0273	10	0.45353	T	0.12	-12.7343	10.122	0.42627	0.1008:0.0:0.8992:0.0	.	250	Q8NGD0	OR4M1_HUMAN	L	250	ENSP00000319654:V250L	ENSP00000319654:V250L	V	+	1	0	OR4M1	19319069	0.000000	0.05858	1.000000	0.80357	0.990000	0.78478	0.346000	0.19997	2.468000	0.83385	0.506000	0.49869	GTG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.448	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4M1	protein_coding	OTTHUMT00000409770.1	G		-		20249229	+1	no_errors	ENST00000315957	ensembl	human	known	74_37	missense	SNP	0.998	C
CALHM3	119395	genome.wustl.edu	37	10	105236233	105236233	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr10:105236233C>A	ENST00000369783.4	-	2	568	c.361G>T	c.(361-363)Ggg>Tgg	p.G121W		NM_001129742.1	NP_001123214.1	Q86XJ0	CAHM3_HUMAN	calcium homeostasis modulator 3	121					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)	2						AAGCACTTCCCGTCAAGGAGG	0.617																																																	0								ENSG00000183128						43.0	42.0	42.0					10																	105236233		692	1591	2283	CALHM3	SO:0001583	missense	0			-	HGNC	BC043367	CCDS44476.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000183128	ENSG00000183128			23458	protein-coding gene	gene with protein product			"""family with sequence similarity 26, member A"""	FAM26A		18585350	Standard	NM_001129742		Approved	bA225H22.7	uc001kxg.4	Q86XJ0	OTTHUMG00000018989	ENST00000369783.4:c.361G>T	10.37:g.105236233C>A	ENSP00000358798:p.Gly121Trp	Somatic	0	62	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	Q5W090|Q8IXR2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G121W	ENST00000369783.4	37	c.361	CCDS44476.1	10	.	.	.	.	.	.	.	.	.	.	C	28.3	4.912393	0.92178	.	.	ENSG00000183128	ENST00000369783	T	0.37235	1.21	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.65974	0.2743	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70633	-0.4818	10	0.87932	D	0	-5.47	19.3361	0.94319	0.0:1.0:0.0:0.0	.	121	Q86XJ0-2	.	W	121	ENSP00000358798:G121W	ENSP00000358798:G121W	G	-	1	0	CALHM3	105226223	1.000000	0.71417	0.838000	0.33150	0.988000	0.76386	7.298000	0.78815	2.577000	0.86979	0.462000	0.41574	GGG	-	NULL		0.617	CALHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALHM3	protein_coding	OTTHUMT00000050157.1	C	NM_182494	-		105236233	-1	no_errors	ENST00000369783	ensembl	human	known	74_37	missense	SNP	1.000	A
ATG2B	55102	genome.wustl.edu	37	14	96784117	96784117	+	Silent	SNP	G	G	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr14:96784117G>A	ENST00000359933.4	-	19	3848	c.2955C>T	c.(2953-2955)ggC>ggT	p.G985G		NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	985					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		AAAGCCCAATGCCATAGGAAA	0.343																																																	0								ENSG00000066739						97.0	93.0	95.0					14																	96784117		1833	4103	5936	ATG2B	SO:0001819	synonymous_variant	0			-	HGNC	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.2955C>T	14.37:g.96784117G>A		Somatic	0	107	0.00		0.5284069354479217	5	50.00	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	41	51.76	Q6ZRE7|Q96DQ3|Q9NW80	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Autophagy-rel_C	p.G985	ENST00000359933.4	37	c.2955	CCDS9944.2	14																																																																																			-	NULL		0.343	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG2B	protein_coding	OTTHUMT00000314037.1	G	NM_018036	-		96784117	-1	no_errors	ENST00000359933	ensembl	human	known	74_37	silent	SNP	0.301	A
KRTAP5-5	439915	genome.wustl.edu	37	11	1651210	1651239	+	In_Frame_Del	DEL	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	-	rs190828070|rs553119014|rs71454096|rs117674201|rs369130959	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:1651210_1651239delGCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	ENST00000399676.2	+	1	178_207	c.140_169delGCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	c.(139-171)ggctgtggctccggctgtgcgggctgtggggga>gga	p.47_57GCGSGCAGCGG>G		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	47				A -> G (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.A53A(1)|p.G54V(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ggctgtgggggctgtggctccggctgtgcgggctgtgggggatgtggctc	0.691																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|kidney(1)						ENSG00000185940																																			KRTAP5-5	SO:0001651	inframe_deletion	0				HGNC	AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.140_169delGCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	11.37:g.1651210_1651239delGCTGTGGCTCCGGCTGTGCGGGCTGTGGGG	ENSP00000382584:p.Gly47_Gly56del	Somatic	NA	NA	NA		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8MWN2	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.GCAGCGGCGS51in_frame_del	ENST00000399676.2	37	c.140_169	CCDS41592.1	11																																																																																			-	NULL		0.691	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	protein_coding	OTTHUMT00000127919.1	GCTGTGGCTCCGGCTGTGCGGGCTGTGGGG				1651239	+1	no_errors	ENST00000399676	ensembl	human	known	74_37	in_frame_del	DEL	0.818:0.967:0.993:0.997:0.997:0.999:1.000:0.998:0.998:0.991:0.983:0.976:1.000:1.000:0.999:0.995:0.061:0.083:0.113:0.325:0.996:0.999:1.000:1.000:0.999:0.994:0.996:0.995:0.546:0.579	-
GIMAP4	55303	genome.wustl.edu	37	7	150267070	150267070	+	Intron	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:150267070C>A	ENST00000255945.2	+	2	233				GIMAP4_ENST00000461940.1_Silent_p.P27P|GIMAP4_ENST00000494750.1_Intron	NM_018326.2	NP_060796.1	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4							cytosol (GO:0005829)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TCAGTGCTCCCCAGACCAGGC	0.602																																																	0								ENSG00000133574						48.0	44.0	45.0					7																	150267070		2203	4300	6503	GIMAP4	SO:0001627	intron_variant	0			-	HGNC	AK001972	CCDS5904.1	7q36.1	2014-04-04			ENSG00000133574	ENSG00000133574		"""GTPases, IMAP"""	21872	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 1"""	608087				15474311, 18701445	Standard	NM_018326		Approved	HIMAP4, FLJ11110, IMAP4, IAN1	uc003whl.3	Q9NUV9	OTTHUMG00000157475	ENST00000255945.2:c.58+23C>A	7.37:g.150267070C>A		Somatic	0	42	0.00		0.5284069354479217	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AIG1,superfamily_P-loop_NTPase	p.P27	ENST00000255945.2	37	c.81	CCDS5904.1	7																																																																																			-	NULL		0.602	GIMAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP4	protein_coding	OTTHUMT00000348927.1	C	NM_018326	-		150267070	+1	no_errors	ENST00000461940	ensembl	human	novel	74_37	silent	SNP	0.000	A
NECAB3	63941	genome.wustl.edu	37	20	32245323	32245357	+	3'UTR	DEL	CAGGGACGGGACCTGCCCTGGGTCGCTCAGCCAGG	CAGGGACGGGACCTGCCCTGGGTCGCTCAGCCAGG	-	rs372251956|rs199749227|rs542227652|rs145687988|rs376186622	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	CAGGGACGGGACCTGCCCTGGGTCGCTCAGCCAGG	CAGGGACGGGACCTGCCCTGGGTCGCTCAGCCAGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr20:32245323_32245357delCAGGGACGGGACCTGCCCTGGGTCGCTCAGCCAGG	ENST00000246190.6	-	0	1524_1558				NECAB3_ENST00000375238.4_3'UTR|RP1-63M2.6_ENST00000607224.1_RNA|NECAB3_ENST00000606525.1_5'UTR	NM_031232.3	NP_112509.3	Q96P71	NECA3_HUMAN	N-terminal EF-hand calcium binding protein 3						protein metabolic process (GO:0019538)|protein secretion (GO:0009306)|regulation of amyloid precursor protein biosynthetic process (GO:0042984)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|Golgi cis cisterna (GO:0000137)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			large_intestine(3)|lung(5)|skin(2)	10						cccacccagacagggacgggacctgccctgggtcgctcagccaggcagggacagc	0.587														363	0.072484	0.1301	0.1758	5008	,	,		24405	0.0387		0.0	False		,,,				2504	0.0307																0								ENSG00000125967																																			NECAB3	SO:0001624	3_prime_UTR_variant	0				HGNC	AB039947	CCDS42866.1, CCDS42867.1	20q11.21	2013-01-10	2007-12-06	2007-12-06	ENSG00000125967	ENSG00000125967		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	15851	protein-coding gene	gene with protein product	"""EF-hand calcium binding protein 3"""	612478	"""amyloid beta (A4) precursor protein-binding, family A, member 2 binding protein"""	SYTIP2, APBA2BP		10833507	Standard	NM_031232		Approved	XB51, dJ63M2.4, NIP1, dJ63M2.5, EFCBP3	uc002wzn.4	Q96P71	OTTHUMG00000032264	ENST00000246190.6:c.*312CCTGGCTGAGCGACCCAGGGCAGGTCCCGTCCCTG>-	20.37:g.32245323_32245357delCAGGGACGGGACCTGCCCTGGGTCGCTCAGCCAGG		Somatic	NA	NA	NA		0.5284069354479217	49	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K780|E1P5N2|Q5JWF5|Q5JWF6|Q5JWF7|Q86VV1|Q9H433|Q9H8G8|Q9HBW7|Q9HCQ9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000246190.6	37	NULL	CCDS42866.1	20																																																																																			-	-		0.587	NECAB3-010	KNOWN	basic|CCDS	protein_coding	NECAB3	protein_coding	OTTHUMT00000078724.2	CAGGGACGGGACCTGCCCTGGGTCGCTCAGCCAGG				32245357	-1	no_errors	ENST00000606525	ensembl	human	known	74_37	rna	DEL	0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.008:0.007:0.013:0.014:0.014:0.018:0.019:0.013:0.010:0.002:0.002:0.001:0.001:0.002:0.002:0.000:0.000:0.000:0.001:0.005:0.003:0.001	-
LRRK2	120892	genome.wustl.edu	37	12	40681216	40681216	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr12:40681216G>T	ENST00000298910.7	+	20	2622	c.2564G>T	c.(2563-2565)gGa>gTa	p.G855V	LRRK2_ENST00000343742.2_Missense_Mutation_p.G855V	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	855					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GTGGAAGAAGGAACAGCCTCA	0.388																																																	0								ENSG00000188906						116.0	111.0	112.0					12																	40681216		2203	4299	6502	LRRK2	SO:0001583	missense	0			-	HGNC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2564G>T	12.37:g.40681216G>T	ENSP00000298910:p.Gly855Val	Somatic	0	52	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.G855V	ENST00000298910.7	37	c.2564	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	3.763	-0.049295	0.07407	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.70749	2.33;-0.51	5.5	2.72	0.32119	.	0.499292	0.21103	N	0.080136	T	0.52322	0.1727	N	0.12746	0.255	0.09310	N	1	P;B	0.39216	0.664;0.011	B;B	0.41860	0.368;0.005	T	0.40869	-0.9540	10	0.26408	T	0.33	.	9.4855	0.38926	0.282:0.0:0.718:0.0	.	855;855	E9PC85;Q5S007	.;LRRK2_HUMAN	V	855	ENSP00000341930:G855V;ENSP00000298910:G855V	ENSP00000298910:G855V	G	+	2	0	LRRK2	38967483	0.086000	0.21541	0.005000	0.12908	0.182000	0.23217	0.836000	0.27545	0.302000	0.22762	0.491000	0.48974	GGA	-	NULL		0.388	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	protein_coding	OTTHUMT00000277179.1	G	XM_058513	-		40681216	+1	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	SNP	0.002	T
UTP20	27340	genome.wustl.edu	37	12	101685626	101685626	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr12:101685626G>T	ENST00000261637.4	+	9	1172	c.998G>T	c.(997-999)gGa>gTa	p.G333V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	333					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GTAAAACATGGAAGTGGGACA	0.383																																																	0								ENSG00000120800						68.0	67.0	67.0					12																	101685626		2203	4300	6503	UTP20	SO:0001583	missense	0			-	HGNC	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.998G>T	12.37:g.101685626G>T	ENSP00000261637:p.Gly333Val	Somatic	0	32	0.00		0.5284069354479217	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q9H3H4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DRIM,superfamily_ARM-type_fold	p.G333V	ENST00000261637.4	37	c.998	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	9.322	1.058410	0.19987	.	.	ENSG00000120800	ENST00000261637	T	0.64260	-0.09	5.81	4.9	0.64082	Armadillo-type fold (1);	0.273174	0.36703	N	0.002458	T	0.55401	0.1918	L	0.47716	1.5	0.49687	D	0.999816	P	0.36222	0.544	B	0.33392	0.163	T	0.56123	-0.8031	10	0.34782	T	0.22	-23.8057	17.1615	0.86804	0.0:0.1753:0.8247:0.0	.	333	O75691	UTP20_HUMAN	V	333	ENSP00000261637:G333V	ENSP00000261637:G333V	G	+	2	0	UTP20	100209757	0.975000	0.34042	0.967000	0.41034	0.048000	0.14542	1.758000	0.38410	2.746000	0.94184	0.655000	0.94253	GGA	-	superfamily_ARM-type_fold		0.383	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	protein_coding	OTTHUMT00000408242.1	G	NM_014503	-		101685626	+1	no_errors	ENST00000261637	ensembl	human	known	74_37	missense	SNP	0.782	T
FAT2	2196	genome.wustl.edu	37	5	150946545	150946545	+	Missense_Mutation	SNP	A	A	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:150946545A>C	ENST00000261800.5	-	1	1960	c.1948T>G	c.(1948-1950)Tca>Gca	p.S650A		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	650	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTGTGGGTGAGGCATAGTTT	0.418																																																	0								ENSG00000086570						98.0	97.0	97.0					5																	150946545		2203	4300	6503	FAT2	SO:0001583	missense	0			-	HGNC	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1948T>G	5.37:g.150946545A>C	ENSP00000261800:p.Ser650Ala	Somatic	0	47	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	15	50.00	O75091|Q9NSR7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S650A	ENST00000261800.5	37	c.1948	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	A	2.941	-0.218967	0.06101	.	.	ENSG00000086570	ENST00000261800	T	0.42131	0.98	5.78	0.584	0.17422	Cadherin (4);Cadherin-like (1);	0.372511	0.22723	N	0.056432	T	0.23806	0.0576	L	0.44542	1.39	0.09310	N	1	B	0.20671	0.047	B	0.25506	0.061	T	0.14727	-1.0462	10	0.08179	T	0.78	.	0.4991	0.00576	0.4287:0.1344:0.1767:0.2602	.	650	Q9NYQ8	FAT2_HUMAN	A	650	ENSP00000261800:S650A	ENSP00000261800:S650A	S	-	1	0	FAT2	150926738	0.001000	0.12720	0.117000	0.21633	0.993000	0.82548	1.227000	0.32576	0.144000	0.18951	0.533000	0.62120	TCA	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.418	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	protein_coding	OTTHUMT00000252434.1	A	NM_001447	-		150946545	-1	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	SNP	0.000	C
RSPH4A	345895	genome.wustl.edu	37	6	116949179	116949179	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr6:116949179C>T	ENST00000229554.5	+	3	1446	c.1309C>T	c.(1309-1311)Cca>Tca	p.P437S	RSPH4A_ENST00000368580.4_Intron|RSPH4A_ENST00000368581.4_Missense_Mutation_p.P437S	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	437					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|radial spoke (GO:0001534)				breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						TTGCAATGAACCAGGAAGACC	0.393									Kartagener syndrome																																								0								ENSG00000111834						79.0	77.0	78.0					6																	116949179		2203	4300	6503	RSPH4A	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	-	HGNC		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834			21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3		19200523	Standard	NM_001010892		Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.1309C>T	6.37:g.116949179C>T	ENSP00000229554:p.Pro437Ser	Somatic	0	74	0.00		0.5284069354479217	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	40	52.94	B4DSI1|Q3KP24|Q5TD95	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Radial_spoke	p.P437S	ENST00000229554.5	37	c.1309	CCDS34521.1	6	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998910	0.74818	.	.	ENSG00000111834	ENST00000368581;ENST00000229554;ENST00000447842	T;T	0.19105	2.17;2.17	5.74	5.74	0.90152	.	0.099483	0.64402	D	0.000001	T	0.38957	0.1060	M	0.80508	2.5	0.58432	D	0.999999	D;D	0.89917	0.998;1.0	D;D	0.79784	0.993;0.987	T	0.17501	-1.0367	10	0.48119	T	0.1	-12.6035	13.064	0.59022	0.0:0.8386:0.1614:0.0	.	437;437	Q5TD94-3;Q5TD94	.;RSH4A_HUMAN	S	437;437;232	ENSP00000357570:P437S;ENSP00000229554:P437S	ENSP00000229554:P437S	P	+	1	0	RSPH4A	117055872	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.709000	0.68384	2.707000	0.92482	0.655000	0.94253	CCA	-	pfam_Radial_spoke		0.393	RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH4A	protein_coding	OTTHUMT00000041960.1	C	NM_001010892	-		116949179	+1	no_errors	ENST00000229554	ensembl	human	known	74_37	missense	SNP	1.000	T
CRISPLD2	83716	genome.wustl.edu	37	16	84900557	84900557	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:84900557C>A	ENST00000262424.5	+	7	988	c.764C>A	c.(763-765)gCt>gAt	p.A255D	CRISPLD2_ENST00000567845.1_Missense_Mutation_p.A254D|CRISPLD2_ENST00000564567.1_Missense_Mutation_p.A255D	NM_031476.3	NP_113664.1	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain containing 2	255					extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|lung development (GO:0030324)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|transport vesicle (GO:0030133)	heparin binding (GO:0008201)			endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)	18						GTGGAAACGGCTCCCATTCCT	0.468																																																	0								ENSG00000103196						126.0	107.0	113.0					16																	84900557		2199	4300	6499	CRISPLD2	SO:0001583	missense	0			-	HGNC	AL136861	CCDS10949.1	16q24.1	2008-02-05	2005-02-16	2005-02-16	ENSG00000103196	ENSG00000103196			25248	protein-coding gene	gene with protein product		612434	"""LCCL domain containing cysteine-rich secretory protein 2"""	LCRISP2		11230166	Standard	NM_031476		Approved	DKFZP434B044	uc010voh.1	Q9H0B8	OTTHUMG00000137644	ENST00000262424.5:c.764C>A	16.37:g.84900557C>A	ENSP00000262424:p.Ala255Asp	Somatic	0	64	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	D3DUM0|Q6P590|Q6UWH0|Q6UXC6|Q96IB1|Q96K61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.A255D	ENST00000262424.5	37	c.764	CCDS10949.1	16	.	.	.	.	.	.	.	.	.	.	C	3.943	-0.013912	0.07681	.	.	ENSG00000103196	ENST00000262424	T	0.63913	-0.07	5.66	2.61	0.31194	.	0.565777	0.19448	N	0.114007	T	0.50120	0.1597	L	0.47716	1.5	0.09310	N	0.999999	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.10450	0.002;0.005;0.004	T	0.33803	-0.9854	10	0.21540	T	0.41	.	8.5757	0.33597	0.0:0.754:0.1364:0.1096	.	255;255;255	Q9H0B8;Q9H0B8-2;Q9H0B8-3	CRLD2_HUMAN;.;.	D	255	ENSP00000262424:A255D	ENSP00000262424:A255D	A	+	2	0	CRISPLD2	83458058	0.065000	0.20965	0.001000	0.08648	0.014000	0.08584	1.323000	0.33701	0.313000	0.23062	0.655000	0.94253	GCT	-	NULL		0.468	CRISPLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD2	protein_coding	OTTHUMT00000269086.2	C	NM_031476	-		84900557	+1	no_errors	ENST00000262424	ensembl	human	known	74_37	missense	SNP	0.004	A
SCN8A	6334	genome.wustl.edu	37	12	52200275	52200275	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr12:52200275G>T	ENST00000354534.6	+	27	5183	c.5005G>T	c.(5005-5007)Ggg>Tgg	p.G1669W	SCN8A_ENST00000545061.1_Missense_Mutation_p.G1628W	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1669					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.G1669W(2)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CTCCATTTTTGGGATGTCCAA	0.458																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000196876						167.0	168.0	168.0					12																	52200275		2203	4300	6503	SCN8A	SO:0001583	missense	0			-	HGNC	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.5005G>T	12.37:g.52200275G>T	ENSP00000346534:p.Gly1669Trp	Somatic	0	53	0.00		0.5284069354479217	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.16	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.G1669W	ENST00000354534.6	37	c.5005	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492557	0.64074	.	.	ENSG00000196876	ENST00000354534;ENST00000545061	D;D	0.97598	-4.45;-4.45	5.32	5.32	0.75619	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99390	0.9785	H	0.99929	4.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97922	1.0315	10	0.87932	D	0	.	19.5787	0.95455	0.0:0.0:1.0:0.0	.	1669	Q9UQD0	SCN8A_HUMAN	W	1669;1628	ENSP00000346534:G1669W;ENSP00000440360:G1628W	ENSP00000346534:G1669W	G	+	1	0	SCN8A	50486542	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.941000	0.99782	0.655000	0.94253	GGG	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel		0.458	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	protein_coding	OTTHUMT00000404372.3	G	NM_014191	-		52200275	+1	no_errors	ENST00000354534	ensembl	human	known	74_37	missense	SNP	1.000	T
FAM46C	54855	genome.wustl.edu	37	1	118165499	118165499	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:118165499G>T	ENST00000369448.3	+	2	256	c.9G>T	c.(7-9)gaG>gaT	p.E3D		NM_017709.3	NP_060179.2	Q5VWP2	FA46C_HUMAN	family with sequence similarity 46, member C	3										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)	15	Lung SC(450;0.225)	all_cancers(81;0.000101)|all_lung(203;3.4e-06)|all_epithelial(167;4.98e-06)|Lung NSC(69;2.33e-05)		Lung(183;0.0576)|LUSC - Lung squamous cell carcinoma(189;0.192)|Colorectal(144;0.247)		AGATGGCAGAGGAGAGCAGCT	0.532			"""Mis, F, O"""		MM					Multiple Myeloma(3;1.13e-06)																														Rec	yes		1	1p12	54855	"""family with sequence similarity 46, member C"""		L	0								ENSG00000183508						74.0	64.0	67.0					1																	118165499		2203	4300	6503	FAM46C	SO:0001583	missense	0			-	HGNC	BC036516	CCDS896.1	1p12	2008-02-05			ENSG00000183508	ENSG00000183508			24712	protein-coding gene	gene with protein product		613952				12477932	Standard	NM_017709		Approved	FLJ20202	uc001ehe.3	Q5VWP2	OTTHUMG00000013703	ENST00000369448.3:c.9G>T	1.37:g.118165499G>T	ENSP00000358458:p.Glu3Asp	Somatic	0	32	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	A3KMG2|Q8NE25|Q9NXK0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1693	p.E3D	ENST00000369448.3	37	c.9	CCDS896.1	1	.	.	.	.	.	.	.	.	.	.	G	8.108	0.778056	0.16120	.	.	ENSG00000183508	ENST00000369448	T	0.22336	1.96	5.75	1.08	0.20341	.	2.220440	0.03381	U	0.200356	T	0.03564	0.0102	N	0.08118	0	0.25966	N	0.982565	B	0.02656	0.0	B	0.01281	0.0	T	0.32877	-0.9890	10	0.31617	T	0.26	3.5476	7.7663	0.28982	0.0818:0.5964:0.2146:0.1072	.	3	Q5VWP2	FA46C_HUMAN	D	3	ENSP00000358458:E3D	ENSP00000358458:E3D	E	+	3	2	FAM46C	117967022	0.999000	0.42202	1.000000	0.80357	0.986000	0.74619	0.427000	0.21379	0.322000	0.23283	0.655000	0.94253	GAG	-	NULL		0.532	FAM46C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM46C	protein_coding	OTTHUMT00000038424.1	G	NM_017709	-		118165499	+1	no_errors	ENST00000369448	ensembl	human	known	74_37	missense	SNP	0.966	T
NOVA2	4858	genome.wustl.edu	37	19	46457065	46457065	+	Silent	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:46457065G>T	ENST00000263257.5	-	3	563	c.369C>A	c.(367-369)acC>acA	p.T123T		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	123					regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		GGTTCATCGTGGTTTGGGGTT	0.522																																																	0								ENSG00000104967						307.0	260.0	276.0					19																	46457065		2203	4300	6503	NOVA2	SO:0001819	synonymous_variant	0			-	HGNC	U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.369C>A	19.37:g.46457065G>T		Somatic	0	64	0.00		0.5284069354479217	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	O43267|Q9UEA1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.T123	ENST00000263257.5	37	c.369	CCDS12679.1	19																																																																																			-	NULL		0.522	NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOVA2	protein_coding	OTTHUMT00000437210.2	G	NM_002516	-		46457065	-1	no_errors	ENST00000263257	ensembl	human	known	74_37	silent	SNP	1.000	T
VWA7	80737	genome.wustl.edu	37	6	31734954	31734954	+	Silent	SNP	G	G	T	rs373994052		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr6:31734954G>T	ENST00000375688.4	-	13	2063	c.1863C>A	c.(1861-1863)ccC>ccA	p.P621P	VWA7_ENST00000447450.1_Silent_p.P621P|VWA7_ENST00000375686.3_Silent_p.P621P|VWA7_ENST00000467576.1_5'UTR|SAPCD1-AS1_ENST00000419679.1_RNA			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	621						extracellular region (GO:0005576)											GCTGAGTCAGGGGGTAGAGGC	0.483																																																	0								ENSG00000204396						25.0	26.0	26.0					6																	31734954		2203	4299	6502	VWA7	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.1863C>A	6.37:g.31734954G>T		Somatic	0	30	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P621	ENST00000375688.4	37	c.1863	CCDS4721.2	6																																																																																			-	NULL		0.483	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VWA7	protein_coding	OTTHUMT00000076233.2	G	NM_025258	-		31734954	-1	no_errors	ENST00000375686	ensembl	human	known	74_37	silent	SNP	0.995	T
SNAI2	6591	genome.wustl.edu	37	8	49832765	49832765	+	Silent	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr8:49832765G>T	ENST00000396822.1	-	3	672	c.315C>A	c.(313-315)ccC>ccA	p.P105P	SNAI2_ENST00000020945.1_Silent_p.P105P			O43623	SNAI2_HUMAN	snail family zinc finger 2	105					canonical Wnt signaling pathway (GO:0060070)|cartilage morphogenesis (GO:0060536)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to ionizing radiation (GO:0071479)|desmosome disassembly (GO:0035921)|embryo development (GO:0009790)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|epithelium development (GO:0060429)|negative regulation of anoikis (GO:2000811)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell-cell adhesion by negative regulation of transcription from RNA polymerase II promoter (GO:1900387)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of stem cell proliferation (GO:2000647)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vitamin D biosynthetic process (GO:0010957)|negative regulation of vitamin D receptor signaling pathway (GO:0070563)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone acetylation (GO:0035066)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of chemokine production (GO:0032642)|regulation of osteoblast differentiation (GO:0045667)|regulation of tight junction assembly (GO:2000810)|sensory perception of sound (GO:0007605)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)	18		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CATCACTAATGGGGCTTTCTG	0.493																																																	0								ENSG00000019549						142.0	137.0	138.0					8																	49832765		2203	4300	6503	SNAI2	SO:0001819	synonymous_variant	0			-	HGNC	U97060	CCDS6146.1	8q11.21	2013-05-23	2013-05-23	2002-02-28	ENSG00000019549	ENSG00000019549		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	11094	protein-coding gene	gene with protein product		602150	"""slug homolog, zinc finger protein (chicken)"", ""snail homolog 2 (Drosophila)"""	SLUG		9337409, 9721220	Standard	NM_003068		Approved	SLUGH1, SNAIL2	uc003xqp.3	O43623	OTTHUMG00000149912	ENST00000396822.1:c.315C>A	8.37:g.49832765G>T		Somatic	0	39	0.00		0.5284069354479217	171	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B2R6P6|Q53FC1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P105	ENST00000396822.1	37	c.315	CCDS6146.1	8																																																																																			-	NULL		0.493	SNAI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI2	protein_coding	OTTHUMT00000313873.2	G	NM_003068	-		49832765	-1	no_errors	ENST00000020945	ensembl	human	known	74_37	silent	SNP	1.000	T
R3HCC1L	27291	genome.wustl.edu	37	10	99967999	99967999	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr10:99967999C>A	ENST00000298999.3	+	5	431	c.128C>A	c.(127-129)cCt>cAt	p.P43H	R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.P43H|R3HCC1L_ENST00000370586.2_Intron	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	43							nucleotide binding (GO:0000166)										TGTGGTTCACCTAACTCTGTG	0.428																																																	0								ENSG00000166024						65.0	69.0	68.0					10																	99967999		2203	4300	6503	R3HCC1L	SO:0001583	missense	0			-	HGNC	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.128C>A	10.37:g.99967999C>A	ENSP00000298999:p.Pro43His	Somatic	0	59	0.00		0.5284069354479217	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P43H	ENST00000298999.3	37	c.128	CCDS31267.1	10	.	.	.	.	.	.	.	.	.	.	C	8.822	0.937876	0.18206	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.08807	3.05;3.05	5.95	2.65	0.31530	.	0.550299	0.17834	N	0.160432	T	0.18341	0.0440	L	0.59436	1.845	0.09310	N	0.999998	D;D	0.76494	0.998;0.999	P;D	0.65874	0.891;0.939	T	0.03453	-1.1035	9	.	.	.	-0.2067	5.928	0.19122	0.1577:0.663:0.0:0.1793	.	43;43	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	H	43	ENSP00000359616:P43H;ENSP00000298999:P43H	.	P	+	2	0	C10orf28	99957989	0.000000	0.05858	0.007000	0.13788	0.076000	0.17211	0.382000	0.20635	0.853000	0.35312	0.650000	0.86243	CCT	-	NULL		0.428	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	R3HCC1L	protein_coding	OTTHUMT00000049764.1	C	NM_014472	-		99967999	+1	no_errors	ENST00000370584	ensembl	human	known	74_37	missense	SNP	0.000	A
APOA4	337	genome.wustl.edu	37	11	116691796	116691796	+	Missense_Mutation	SNP	C	C	A	rs371977184		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:116691796C>A	ENST00000357780.3	-	3	1092	c.978G>T	c.(976-978)agG>agT	p.R326S		NM_000482.3	NP_000473.2	P06727	APOA4_HUMAN	apolipoprotein A-IV	326	13 X 22 AA approximate tandem repeats.				cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron assembly (GO:0034378)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle remodeling (GO:0034375)|hydrogen peroxide catabolic process (GO:0042744)|innate immune response in mucosa (GO:0002227)|leukocyte cell-cell adhesion (GO:0007159)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|multicellular organismal lipid catabolic process (GO:0044240)|negative regulation of plasma lipoprotein particle oxidation (GO:0034445)|phosphatidylcholine metabolic process (GO:0046470)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of triglyceride catabolic process (GO:0010898)|protein-lipid complex assembly (GO:0065005)|regulation of cholesterol transport (GO:0032374)|regulation of intestinal cholesterol absorption (GO:0030300)|removal of superoxide radicals (GO:0019430)|response to lipid hydroperoxide (GO:0006982)|response to stilbenoid (GO:0035634)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	blood microparticle (GO:0072562)|chylomicron (GO:0042627)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|very-low-density lipoprotein particle (GO:0034361)	antioxidant activity (GO:0016209)|cholesterol transporter activity (GO:0017127)|copper ion binding (GO:0005507)|lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)|phosphatidylcholine binding (GO:0031210)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|lung(10)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.62e-05)|all cancers(92;0.000165)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CCAGTTTCTGCCTGAGCTGTT	0.607																																																	0								ENSG00000110244	C	SER/ARG	1,4401	2.1+/-5.4	0,1,2200	69.0	68.0	68.0		978	-0.1	0.7	11		68	0,8584		0,0,4292	no	missense	APOA4	NM_000482.3	110	0,1,6492	AA,AC,CC		0.0,0.0227,0.0077	possibly-damaging	326/397	116691796	1,12985	2201	4292	6493	APOA4	SO:0001583	missense	0			-	HGNC		CCDS31681.1	11q23.3	2013-01-24			ENSG00000110244	ENSG00000110244		"""Apolipoproteins"""	602	protein-coding gene	gene with protein product		107690					Standard	NM_000482		Approved		uc001pps.1	P06727	OTTHUMG00000046110	ENST00000357780.3:c.978G>T	11.37:g.116691796C>A	ENSP00000350425:p.Arg326Ser	Somatic	0	65	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8MSL6|Q14CW8|Q6Q787	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ApoA1_A4_E	p.R326S	ENST00000357780.3	37	c.978	CCDS31681.1	11	.	.	.	.	.	.	.	.	.	.	C	16.04	3.008589	0.54361	2.27E-4	0.0	ENSG00000110244	ENST00000357780	T	0.74209	-0.82	5.39	-0.085	0.13688	Apolipoprotein/apolipophorin (1);	0.345830	0.27172	N	0.020591	T	0.80093	0.4560	M	0.88570	2.965	0.30989	N	0.721575	P	0.52170	0.951	P	0.53809	0.735	T	0.77332	-0.2627	10	0.87932	D	0	-31.3028	5.0257	0.14383	0.0:0.4423:0.2637:0.294	.	326	P06727	APOA4_HUMAN	S	326	ENSP00000350425:R326S	ENSP00000350425:R326S	R	-	3	2	APOA4	116197006	0.005000	0.15991	0.691000	0.30163	0.431000	0.31685	0.382000	0.20635	-0.000000	0.14550	0.557000	0.71058	AGG	-	pfam_ApoA1_A4_E		0.607	APOA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOA4	protein_coding	OTTHUMT00000106279.2	C	NM_000482	-		116691796	-1	no_errors	ENST00000357780	ensembl	human	known	74_37	missense	SNP	0.911	A
MYO9A	4649	genome.wustl.edu	37	15	72190133	72190133	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr15:72190133G>C	ENST00000356056.5	-	25	5183	c.4711C>G	c.(4711-4713)Ctt>Gtt	p.L1571V	MYO9A_ENST00000444904.1_Missense_Mutation_p.L1552V|MYO9A_ENST00000563542.1_5'UTR|MYO9A_ENST00000564571.1_Missense_Mutation_p.L1571V|MYO9A_ENST00000566885.1_Missense_Mutation_p.L1191V|MYO9A_ENST00000424560.1_Missense_Mutation_p.L1571V	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	1571	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AGTACATTAAGTTCTCCCTTA	0.463																																																	0								ENSG00000066933						66.0	60.0	62.0					15																	72190133		2199	4297	6496	MYO9A	SO:0001583	missense	0			-	HGNC	AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.4711C>G	15.37:g.72190133G>C	ENSP00000348349:p.Leu1571Val	Somatic	0	45	0.00		0.5284069354479217	7	41.67	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	47	27.69	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.L1571V	ENST00000356056.5	37	c.4711	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.507910	0.00984	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.84070	-1.8;-1.78;-1.79	5.92	0.523	0.17060	.	.	.	.	.	T	0.65354	0.2683	N	0.19112	0.55	0.09310	N	1	B;B;B	0.14012	0.009;0.009;0.0	B;B;B	0.12837	0.008;0.008;0.0	T	0.50136	-0.8863	9	0.30854	T	0.27	.	1.9466	0.03358	0.2783:0.1309:0.4636:0.1272	.	1552;1571;1571	B2RTY4-2;B2RTY4-4;B2RTY4	.;.;MYO9A_HUMAN	V	1571;1571;1552	ENSP00000348349:L1571V;ENSP00000399162:L1571V;ENSP00000398250:L1552V	ENSP00000348349:L1571V	L	-	1	0	MYO9A	69977187	0.177000	0.23109	0.114000	0.21550	0.150000	0.21749	0.526000	0.22971	0.378000	0.24764	0.650000	0.86243	CTT	-	NULL		0.463	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	protein_coding	OTTHUMT00000257308.1	G	NM_006901	-		72190133	-1	no_errors	ENST00000424560	ensembl	human	known	74_37	missense	SNP	0.012	C
CHD2	1106	genome.wustl.edu	37	15	93558113	93558113	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr15:93558113C>A	ENST00000394196.4	+	37	5948	c.4880C>A	c.(4879-4881)cCc>cAc	p.P1627H	CHD2_ENST00000557381.1_Missense_Mutation_p.P1627H	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1627					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TACAATCACCCCAACAAGAGA	0.448																																																	0								ENSG00000173575						148.0	144.0	146.0					15																	93558113		2197	4298	6495	CHD2	SO:0001583	missense	0			-	HGNC	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.4880C>A	15.37:g.93558113C>A	ENSP00000377747:p.Pro1627His	Somatic	0	29	0.00		0.5284069354479217	239	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	C6G482|Q96IP5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P1627H	ENST00000394196.4	37	c.4880	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	C	11.14	1.552287	0.27739	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000557759	D;D;T	0.89746	-2.56;-2.53;0.89	5.8	5.8	0.92144	.	0.000000	0.33650	U	0.004689	D	0.88314	0.6403	N	0.14661	0.345	0.80722	D	1	D;D	0.61697	0.983;0.99	P;P	0.56474	0.635;0.799	D	0.89369	0.3673	10	0.52906	T	0.07	-14.3291	20.0544	0.97645	0.0:1.0:0.0:0.0	.	1627;1627	O14647;O14647-2	CHD2_HUMAN;.	H	1627;1627;152	ENSP00000377747:P1627H;ENSP00000451366:P1627H;ENSP00000451539:P152H	ENSP00000377747:P1627H	P	+	2	0	CHD2	91359117	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	5.299000	0.65716	2.746000	0.94184	0.591000	0.81541	CCC	-	NULL		0.448	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	protein_coding	OTTHUMT00000313528.3	C	NM_001271	-		93558113	+1	no_errors	ENST00000557381	ensembl	human	putative	74_37	missense	SNP	1.000	A
ADAD2	161931	genome.wustl.edu	37	16	84230276	84230276	+	Missense_Mutation	SNP	G	G	A	rs374328634		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:84230276G>A	ENST00000315906.5	+	9	1602	c.1550G>A	c.(1549-1551)cGt>cAt	p.R517H	ADAD2_ENST00000268624.3_Missense_Mutation_p.R599H|RP11-486L19.2_ENST00000536986.1_RNA|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA|RP11-486L19.2_ENST00000569834.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	517	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						CCTCCCTCCCGTCTCTGCAAG	0.612																																																	0								ENSG00000140955	G	HIS/ARG,HIS/ARG	0,4400		0,0,2200	96.0	102.0	100.0		1550,1796	4.2	1.0	16		100	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ADAD2	NM_001145400.1,NM_139174.3	29,29	0,1,6499	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	517/584,599/666	84230276	1,12999	2200	4300	6500	ADAD2	SO:0001583	missense	0			-	HGNC	AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1550G>A	16.37:g.84230276G>A	ENSP00000325153:p.Arg517His	Somatic	0	35	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	18	52.63	B2RCL6|Q8NA94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.R599H	ENST00000315906.5	37	c.1796	CCDS45536.1	16	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500070	0.64298	0.0	1.16E-4	ENSG00000140955	ENST00000315906;ENST00000268624	D;D	0.94723	-3.5;-3.5	5.27	4.25	0.50352	Adenosine deaminase/editase (2);	0.000000	0.64402	D	0.000001	D	0.97387	0.9145	M	0.91872	3.25	0.47183	D	0.999341	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.97499	1.0059	10	0.87932	D	0	-37.8386	11.0193	0.47709	0.0:0.1882:0.8118:0.0	.	517;599	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	H	517;599	ENSP00000325153:R517H;ENSP00000268624:R599H	ENSP00000268624:R599H	R	+	2	0	ADAD2	82787777	1.000000	0.71417	1.000000	0.80357	0.406000	0.30931	3.533000	0.53561	2.440000	0.82611	0.585000	0.79938	CGT	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.612	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD2	protein_coding	OTTHUMT00000433385.1	G	NM_139174	-		84230276	+1	no_errors	ENST00000268624	ensembl	human	known	74_37	missense	SNP	1.000	A
ALMS1P	200420	genome.wustl.edu	37	2	73901980	73901980	+	RNA	SNP	G	G	A	rs200040304	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr2:73901980G>A	ENST00000450720.1	+	0	933					NR_003683.2		Q96L16	ALM1L_HUMAN	Alstrom syndrome 1 pseudogene						endosomal transport (GO:0016197)|regulation of stress fiber assembly (GO:0051492)												CTTCCTGGCTGTCCAGAAGAA	0.478													.|||	32	0.00638978	0.0113	0.0216	5008	,	,		20054	0.0		0.002	False		,,,				2504	0.0																0								ENSG00000163016						216.0	170.0	184.0					2																	73901980		692	1591	2283	ALMS1P			0			-	HGNC	BC014492		2p13.2	2008-01-31	2008-01-31	2008-01-31	ENSG00000163016	ENSG00000163016			29586	pseudogene	pseudogene			"""Alstrom syndrome 1-like"""	ALMS1L		12477932	Standard	NR_003683		Approved		uc010yrl.2	Q96L16	OTTHUMG00000152773		2.37:g.73901980G>A		Somatic	0	90	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	112	8.20		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000450720.1	37	NULL		2																																																																																			-	-		0.478	ALMS1P-002	KNOWN	basic	processed_transcript	ALMS1P	pseudogene	OTTHUMT00000339824.1	G	NR_003683	rs200040304		73901980	+1	no_errors	ENST00000450720	ensembl	human	known	74_37	rna	SNP	0.033	A
FAM182A	284800	genome.wustl.edu	37	20	26061818	26061818	+	RNA	SNP	G	G	C	rs112101451		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr20:26061818G>C	ENST00000376398.2	+	0	838					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						GATTTCTCCTGCTTAGAAATG	0.463																																																	0								ENSG00000125804						12.0	11.0	11.0					20																	26061818		692	1579	2271	FAM182A			0			-	HGNC	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061818G>C		Somatic	0	49	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	42	16.00	A2RRD0|Q8N947	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376398.2	37	NULL		20	.	.	.	.	.	.	.	.	.	.	N	7.694	0.691703	0.15039	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.47322	0.1439	.	.	.	0.30118	N	0.805912	.	.	.	.	.	.	T	0.53092	-0.8487	4	0.87932	D	0	.	.	.	.	.	.	.	.	S	57	.	ENSP00000246000:C57S	C	+	2	0	FAM182A	26009818	1.000000	0.71417	0.427000	0.26684	0.468000	0.32798	0.774000	0.26675	0.451000	0.26802	0.123000	0.15791	TGC	-	-		0.463	FAM182A-001	KNOWN	basic	lincRNA	FAM182A	processed_transcript	OTTHUMT00000078473.2	G		rs112101451		26061818	+1	no_errors	ENST00000376398	ensembl	human	known	74_37	rna	SNP	0.580	C
MAP7D3	79649	genome.wustl.edu	37	X	135313835	135313835	+	Silent	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chrX:135313835C>T	ENST00000316077.9	-	8	1501	c.1281G>A	c.(1279-1281)aaG>aaA	p.K427K	MAP7D3_ENST00000370661.1_Silent_p.K392K|MAP7D3_ENST00000495432.1_5'Flank|MAP7D3_ENST00000370663.5_Silent_p.K409K	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	427					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TCACACTCTCCTTGGGGGCTA	0.592																																																	0								ENSG00000129680						91.0	85.0	87.0					X																	135313835		1933	4115	6048	MAP7D3	SO:0001819	synonymous_variant	0			-	HGNC	AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1281G>A	X.37:g.135313835C>T		Somatic	0	30	0.00		0.5284069354479217	29	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_MAP7	p.K409	ENST00000316077.9	37	c.1227	CCDS44004.1	X																																																																																			-	NULL		0.592	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D3	protein_coding	OTTHUMT00000058487.2	C		-		135313835	-1	no_errors	ENST00000370663	ensembl	human	known	74_37	silent	SNP	0.024	T
ARAP3	64411	genome.wustl.edu	37	5	141036193	141036193	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:141036193C>A	ENST00000239440.4	-	27	3732	c.3667G>T	c.(3667-3669)Gag>Tag	p.E1223*	ARAP3_ENST00000513878.1_Nonsense_Mutation_p.E885*|ARAP3_ENST00000512390.1_5'UTR|ARAP3_ENST00000508305.1_Nonsense_Mutation_p.E1054*	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	1223	PH 3. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						CGTGGGCTCTCACGTCGGATA	0.632																																																	0								ENSG00000120318						25.0	25.0	25.0					5																	141036193		2203	4300	6503	ARAP3	SO:0001587	stop_gained	0			-	HGNC	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.3667G>T	5.37:g.141036193C>A	ENSP00000239440:p.Glu1223*	Somatic	0	51	0.00		0.5284069354479217	67	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	B4DIT1|D3DQE3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ras-assoc,pfam_SAM_2,pfam_SAM_type1,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.E1223*	ENST00000239440.4	37	c.3667	CCDS4266.1	5	.	.	.	.	.	.	.	.	.	.	C	43	10.145493	0.99346	.	.	ENSG00000120318	ENST00000508305;ENST00000239440;ENST00000513878	.	.	.	5.64	5.64	0.86602	.	0.101468	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	19.2624	0.93973	0.0:1.0:0.0:0.0	.	.	.	.	X	1054;1223;885	.	ENSP00000239440:E1223X	E	-	1	0	ARAP3	141016377	0.995000	0.38212	0.998000	0.56505	0.970000	0.65996	3.340000	0.52143	2.662000	0.90505	0.591000	0.81541	GAG	-	pfscan_Pleckstrin_homology		0.632	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARAP3	protein_coding	OTTHUMT00000251805.1	C	NM_022481	-		141036193	-1	no_errors	ENST00000239440	ensembl	human	known	74_37	nonsense	SNP	1.000	A
APBB2	323	genome.wustl.edu	37	4	41016404	41016404	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:41016404C>A	ENST00000295974.8	-	6	660	c.31G>T	c.(31-33)Gtt>Ttt	p.V11F	APBB2_ENST00000508593.1_Missense_Mutation_p.V11F|APBB2_ENST00000506352.1_Missense_Mutation_p.V11F|APBB2_ENST00000513140.1_Missense_Mutation_p.V11F	NM_001166050.1|NM_004307.1	NP_001159522.1|NP_004298.1	Q92870	APBB2_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 2	11					axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|extracellular matrix organization (GO:0030198)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|transcription factor binding (GO:0008134)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|skin(2)|urinary_tract(1)	34						AAGGTGTCAACACCTGAGTCA	0.428																																					Ovarian(3;20 75 16686 49997)												0								ENSG00000163697						64.0	61.0	62.0					4																	41016404		1955	4155	6110	APBB2	SO:0001583	missense	0			-	HGNC	U62325	CCDS43224.1, CCDS54760.1, CCDS54761.1, CCDS54762.1	4p13	2011-10-10	2008-07-31		ENSG00000163697	ENSG00000163697			582	protein-coding gene	gene with protein product	"""Fe65-like"""	602710				8955346, 9585438	Standard	NM_173075		Approved	FE65L, FE65L1, MGC35575	uc003gvn.3	Q92870	OTTHUMG00000160416	ENST00000295974.8:c.31G>T	4.37:g.41016404C>A	ENSP00000295974:p.Val11Phe	Somatic	0	45	0.00		0.5284069354479217	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70	B4DSL4|E9PG87|Q8IUI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,pfam_WW_dom,superfamily_WW_dom,smart_WW_dom,smart_PTB/PI_dom,pfscan_PTB/PI_dom,pfscan_WW_dom	p.V11F	ENST00000295974.8	37	c.31	CCDS54761.1	4	.	.	.	.	.	.	.	.	.	.	C	6.225	0.409705	0.11812	.	.	ENSG00000163697	ENST00000295974;ENST00000316212;ENST00000513140;ENST00000508593;ENST00000506352;ENST00000508707;ENST00000508676	T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84	4.87	4.03	0.46877	.	0.847663	0.10205	N	0.702790	T	0.23210	0.0561	N	0.19112	0.55	0.21355	N	0.999713	B;P;B	0.35192	0.357;0.489;0.303	B;B;B	0.39660	0.161;0.306;0.121	T	0.29610	-1.0006	10	0.87932	D	0	0.0	13.0816	0.59117	0.0:0.9227:0.0:0.0773	.	11;11;11	E9PG87;Q92870-2;Q92870	.;.;APBB2_HUMAN	F	11;10;11;11;11;11;11	ENSP00000295974:V11F;ENSP00000426018:V11F;ENSP00000427211:V11F;ENSP00000421539:V11F;ENSP00000424579:V11F	ENSP00000295974:V11F	V	-	1	0	APBB2	40711161	0.105000	0.21958	0.610000	0.28997	0.007000	0.05969	1.891000	0.39738	1.283000	0.44513	0.561000	0.74099	GTT	-	NULL		0.428	APBB2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	APBB2	protein_coding	OTTHUMT00000360523.3	C	NM_173075	-		41016404	-1	no_errors	ENST00000295974	ensembl	human	known	74_37	missense	SNP	0.253	A
CDC20	991	genome.wustl.edu	37	1	43825929	43825929	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:43825929C>A	ENST00000372462.1	+	5	825	c.622C>A	c.(622-624)Ctg>Atg	p.L208M	CDC20_ENST00000478882.1_3'UTR|CDC20_ENST00000310955.6_Missense_Mutation_p.L208M|RP1-92O14.3_ENST00000424948.1_RNA			Q12834	CDC20_HUMAN	cell division cycle 20	208					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell cycle (GO:0007049)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of dendrite development (GO:0050773)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|spindle (GO:0005819)	enzyme binding (GO:0019899)|protein C-terminus binding (GO:0008022)	p.L208M(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	15	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CAGTGTGTACCTGTGGAGTGC	0.512																																					Esophageal Squamous(137;1154 1759 10362 10401 46925)												1	Substitution - Missense(1)	large_intestine(1)						ENSG00000117399						149.0	141.0	144.0					1																	43825929		2203	4300	6503	CDC20	SO:0001583	missense	0			-	HGNC	U05340	CCDS484.1	1p34.1	2013-01-17	2013-01-17		ENSG00000117399	ENSG00000117399		"""WD repeat domain containing"""	1723	protein-coding gene	gene with protein product		603618	"""CDC20 (cell division cycle 20, S. cerevisiae, homolog)"", ""CDC20 cell division cycle 20 homolog (S. cerevisiae)"", ""cell division cycle 20 homolog (S. cerevisiae)"""			7513050, 9353311	Standard	NM_001255		Approved	p55CDC, CDC20A	uc001cix.3	Q12834	OTTHUMG00000007420	ENST00000372462.1:c.622C>A	1.37:g.43825929C>A	ENSP00000361540:p.Leu208Met	Somatic	0	36	0.00		0.5284069354479217	434	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	B2R6Z6|D3DPJ1|Q5JUY4|Q9BW56|Q9UQI9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L208M	ENST00000372462.1	37	c.622	CCDS484.1	1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293394	0.60086	.	.	ENSG00000117399	ENST00000437896;ENST00000310955;ENST00000372462	T;T	0.35789	1.29;1.29	5.85	-0.684	0.11331	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.57975	0.2090	M	0.84948	2.725	0.54753	D	0.999987	D	0.89917	1.0	D	0.80764	0.994	T	0.62291	-0.6885	10	0.66056	D	0.02	-13.0355	10.8764	0.46913	0.0:0.6233:0.0:0.3767	.	208	Q12834	CDC20_HUMAN	M	184;208;208	ENSP00000308450:L208M;ENSP00000361540:L208M	ENSP00000308450:L208M	L	+	1	2	CDC20	43598516	0.998000	0.40836	0.998000	0.56505	0.987000	0.75469	0.911000	0.28584	0.073000	0.16731	-0.345000	0.07892	CTG	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.512	CDC20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CDC20	protein_coding	OTTHUMT00000019488.1	C	NM_001255	-		43825929	+1	no_errors	ENST00000310955	ensembl	human	known	74_37	missense	SNP	1.000	A
MARS2	92935	genome.wustl.edu	37	2	198571474	198571474	+	Missense_Mutation	SNP	C	C	G			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr2:198571474C>G	ENST00000282276.6	+	1	1388	c.1345C>G	c.(1345-1347)Ctg>Gtg	p.L449V	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	449					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	GGATTATGCTCTGGTGAGCGC	0.552																																																	0								ENSG00000247626						88.0	91.0	90.0					2																	198571474		2203	4300	6503	MARS2	SO:0001583	missense	0			-	HGNC	BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.1345C>G	2.37:g.198571474C>G	ENSP00000282276:p.Leu449Val	Somatic	0	28	0.00		0.5284069354479217	8	52.94	9	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	16	52.94	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Methionyl/Leucyl_tRNA_Synth,pfam_aa-tRNA-synth_Ia,pfam_Cys-tRNA/MSH_ligase,superfamily_tRNAsynth_1a_anticodon-bd,prints_Met-tRNA_synth,tigrfam_Met-tRNA_synth	p.L449V	ENST00000282276.6	37	c.1345	CCDS33358.1	2	.	.	.	.	.	.	.	.	.	.	C	10.89	1.479740	0.26511	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.53857	0.6	5.17	-0.14	0.13456	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.230148	0.42964	D	0.000623	T	0.41419	0.1158	L	0.46157	1.445	0.36490	D	0.868386	P	0.38711	0.643	B	0.38327	0.271	T	0.45425	-0.9262	10	0.72032	D	0.01	-10.7732	7.9483	0.29999	0.0:0.3751:0.0:0.6249	.	449	Q96GW9	SYMM_HUMAN	V	449;376	ENSP00000282276:L449V	ENSP00000282276:L449V	L	+	1	2	MARS2	198279719	0.259000	0.24043	0.940000	0.37924	0.989000	0.77384	0.287000	0.18920	0.058000	0.16222	-0.140000	0.14226	CTG	-	superfamily_tRNAsynth_1a_anticodon-bd,tigrfam_Met-tRNA_synth		0.552	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS2	protein_coding	OTTHUMT00000335477.1	C	NM_138395	-		198571474	+1	no_errors	ENST00000282276	ensembl	human	known	74_37	missense	SNP	0.965	G
ISM1	140862	genome.wustl.edu	37	20	13279761	13279761	+	Silent	SNP	C	C	T	rs572363345		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr20:13279761C>T	ENST00000262487.4	+	6	1056	c.1050C>T	c.(1048-1050)gaC>gaT	p.D350D	TASP1_ENST00000539805.1_Intron	NM_080826.1	NP_543016.1	B1AKI9	ISM1_HUMAN	isthmin 1, angiogenesis inhibitor	350	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.					extracellular region (GO:0005576)				NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(8)|lung(5)|urinary_tract(1)	17						GCTGGAAGGACGCCAGCGGGC	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18261	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000101230						41.0	47.0	45.0					20																	13279761		2144	4237	6381	ISM1	SO:0001819	synonymous_variant	0			-	HGNC	AL133463	CCDS46579.1	20p12.1	2013-05-15	2013-05-15	2008-12-23	ENSG00000101230	ENSG00000101230			16213	protein-coding gene	gene with protein product		615793	"""chromosome 20 open reading frame 82"", ""isthmin 1 homolog (zebrafish)"""	C20orf82			Standard	NM_080826		Approved	bA149I18.1	uc010gce.1	B1AKI9		ENST00000262487.4:c.1050C>T	20.37:g.13279761C>T		Somatic	0	31	0.00		0.5284069354479217	2	50.00	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	16	51.52	Q8WVH9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_AMOP,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_AMOP,pfscan_AMOP,pfscan_Thrombospondin_1_rpt	p.D350	ENST00000262487.4	37	c.1050	CCDS46579.1	20																																																																																			-	pfam_AMOP,smart_AMOP,pfscan_AMOP		0.647	ISM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISM1	protein_coding	OTTHUMT00000078039.2	C		-		13279761	+1	no_errors	ENST00000262487	ensembl	human	known	74_37	silent	SNP	0.980	T
CCDC30	728621	genome.wustl.edu	37	1	43047166	43047166	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:43047166C>A	ENST00000340612.4	+	7	1201	c.1201C>A	c.(1201-1203)Caa>Aaa	p.Q401K	CCDC30_ENST00000342022.4_Missense_Mutation_p.Q401K|CCDC30_ENST00000390640.4_Missense_Mutation_p.Q190K|CCDC30_ENST00000428554.2_Missense_Mutation_p.Q401K|CCDC30_ENST00000507855.1_Missense_Mutation_p.Q190K			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	401						extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						GCAACAATATCAAGAAGAACA	0.368																																																	0								ENSG00000186409						93.0	88.0	90.0					1																	43047166		2203	4300	6503	CCDC30	SO:0001583	missense	0			-	HGNC	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1201C>A	1.37:g.43047166C>A	ENSP00000340378:p.Gln401Lys	Somatic	0	39	0.00		0.5284069354479217	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	Q14F06|Q5VVM5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q401K	ENST00000340612.4	37	c.1201	CCDS30690.1	1	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939213	0.52972	.	.	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.51817	0.69;0.71;0.69;0.69;0.71	5.25	1.07	0.20283	.	0.235442	0.44285	D	0.000466	T	0.52565	0.1742	M	0.68952	2.095	0.31290	N	0.689521	P;P;P	0.51537	0.869;0.562;0.946	P;B;P	0.48840	0.475;0.275;0.592	T	0.61893	-0.6969	10	0.32370	T	0.25	.	16.2484	0.82467	0.0:0.4804:0.5196:0.0	.	401;185;190	Q5VVM6;Q6N081;Q5VVM6-2	CCD30_HUMAN;.;.	K	401;190;401;401;190	ENSP00000397035:Q401K;ENSP00000426711:Q190K;ENSP00000340378:Q401K;ENSP00000339280:Q401K;ENSP00000375051:Q190K	ENSP00000340378:Q401K	Q	+	1	0	CCDC30	42819753	0.421000	0.25465	0.971000	0.41717	0.972000	0.66771	0.319000	0.19522	0.009000	0.14813	0.650000	0.86243	CAA	-	NULL		0.368	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	protein_coding	OTTHUMT00000019524.3	C	NM_025030	-		43047166	+1	no_errors	ENST00000340612	ensembl	human	known	74_37	missense	SNP	0.969	A
ERVMER34-1	100288413	genome.wustl.edu	37	4	53610776	53610776	+	Silent	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:53610776C>T	ENST00000443173.1	-	3	1772	c.912G>A	c.(910-912)ggG>ggA	p.G304G	ERVMER34-1_ENST00000440542.1_Silent_p.G304G|ERVMER34-1_ENST00000454756.2_Intron|ERVMER34-1_ENST00000540758.1_Silent_p.G304G	NM_001242690.1	NP_001229619.1	Q9H9K5	MER34_HUMAN	endogenous retrovirus group MER34, member 1	304						integral component of membrane (GO:0016021)|viral envelope (GO:0019031)				endometrium(3)|kidney(1)	4						ctttgtacaccccattgccgc	0.498																																																	0								ENSG00000226887						86.0	74.0	78.0					4																	53610776		692	1591	2283	ERVMER34-1	SO:0001819	synonymous_variant	0			-	HGNC			4q12	2011-10-20			ENSG00000226887	ENSG00000226887			42970	other	endogenous retrovirus							Standard	NM_024534		Approved		uc003gzs.3	Q9H9K5	OTTHUMG00000150366	ENST00000443173.1:c.912G>A	4.37:g.53610776C>T		Somatic	0	59	0.00		0.5284069354479217	35	40.68	24	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	29	46.30	B3KTB4|Q0P5R3|Q6NWN0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TLV/ENV_coat_polyprotein	p.G304	ENST00000443173.1	37	c.912		4																																																																																			-	NULL		0.498	ERVMER34-1-002	KNOWN	alternative_5_UTR|basic|appris_principal	protein_coding	ERVMER34-1	protein_coding	OTTHUMT00000317860.2	C	NM_024534	-		53610776	-1	no_errors	ENST00000440542	ensembl	human	known	74_37	silent	SNP	0.006	T
PREP	5550	genome.wustl.edu	37	6	105800914	105800914	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr6:105800914C>A	ENST00000369110.3	-	7	948	c.756G>T	c.(754-756)agG>agT	p.R252S		NM_002726.4	NP_002717.3	P48147	PPCE_HUMAN	prolyl endopeptidase	252					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		all_cancers(87;0.000128)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0344)|Lung NSC(302;0.191)|Colorectal(196;0.202)			Oxytocin(DB00107)	CACATCCTTCCCTTATTGATA	0.378																																																	0								ENSG00000085377						160.0	164.0	163.0					6																	105800914		2203	4300	6503	PREP	SO:0001583	missense	0			-	HGNC		CCDS5053.1	6q22	2008-02-05			ENSG00000085377	ENSG00000085377	3.4.21.26		9358	protein-coding gene	gene with protein product		600400				7959018	Standard	NM_002726		Approved		uc003prc.3	P48147	OTTHUMG00000015297	ENST00000369110.3:c.756G>T	6.37:g.105800914C>A	ENSP00000358106:p.Arg252Ser	Somatic	0	43	0.00		0.5284069354479217	175	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	41	8.89	Q8N6D4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Pept_S9A_N,pfam_Peptidase_S9,prints_Peptidase_S9A	p.R252S	ENST00000369110.3	37	c.756	CCDS5053.1	6	.	.	.	.	.	.	.	.	.	.	C	10.95	1.496204	0.26861	.	.	ENSG00000085377	ENST00000369110	T	0.37584	1.19	5.56	1.58	0.23477	Peptidase S9A, oligopeptidase, N-terminal (1);Peptidase S9A/B/C, oligopeptidase, N-terminal beta-propeller (2);	0.084201	0.85682	D	0.000000	T	0.03959	0.0111	N	0.02286	-0.61	0.45250	D	0.998251	B	0.09022	0.002	B	0.06405	0.002	T	0.23404	-1.0189	10	0.14252	T	0.57	-7.5235	5.4531	0.16576	0.0:0.548:0.1424:0.3096	.	252	P48147	PPCE_HUMAN	S	252	ENSP00000358106:R252S	ENSP00000358106:R252S	R	-	3	2	PREP	105907607	0.999000	0.42202	0.998000	0.56505	0.951000	0.60555	0.439000	0.21575	0.820000	0.34516	0.655000	0.94253	AGG	-	pfam_Pept_S9A_N		0.378	PREP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREP	protein_coding	OTTHUMT00000041658.1	C		-		105800914	-1	no_errors	ENST00000369110	ensembl	human	known	74_37	missense	SNP	0.963	A
ELMO1	9844	genome.wustl.edu	37	7	36895294	36895295	+	Frame_Shift_Ins	INS	-	-	G	rs182459066		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:36895294_36895295insG	ENST00000310758.4	-	22	2692_2693	c.2045_2046insC	c.(2044-2046)acgfs	p.T682fs	ELMO1_ENST00000341056.3_Frame_Shift_Ins_p.T384fs|ELMO1_ENST00000396045.3_Frame_Shift_Ins_p.T202fs|ELMO1_ENST00000396040.2_Frame_Shift_Ins_p.T202fs|ELMO1_ENST00000442504.1_Frame_Shift_Ins_p.T682fs|ELMO1_ENST00000448602.1_Frame_Shift_Ins_p.T682fs	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	682					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GGTCATTCCGCGTCAGGTCGCT	0.574																																																	0								ENSG00000155849																																			ELMO1	SO:0001589	frameshift_variant	0				HGNC	AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.2046dupC	7.37:g.36895295_36895295dupG	ENSP00000312185:p.Thr682fs	Somatic	0	37	0.00		0.5284069354479217	78	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	18	48.57	A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.R683fs	ENST00000310758.4	37	c.2046_2045	CCDS5449.1	7																																																																																			-	NULL		0.574	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	protein_coding	OTTHUMT00000219830.4	-	NM_130442			36895295	-1	no_errors	ENST00000310758	ensembl	human	known	74_37	frame_shift_ins	INS	0.017:0.999	G
ZAN	7455	genome.wustl.edu	37	7	100382410	100382410	+	RNA	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:100382410C>A	ENST00000348028.3	+	0	6952				ZAN_ENST00000546292.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000427578.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AAGTGTGTCCCCAGAAGTCAG	0.602																																																	0								ENSG00000146839						61.0	61.0	61.0					7																	100382410		2151	4278	6429	ZAN			0			-	HGNC	U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100382410C>A		Somatic	0	38	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.P2262H	ENST00000348028.3	37	c.6785		7	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576502	0.65878	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	D;D;D;D	0.91843	-2.92;-2.92;-2.92;-2.92	4.24	3.28	0.37604	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	0.812582	0.10097	N	0.716474	D	0.93946	0.8062	.	.	.	0.25831	N	0.984169	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.70487	0.948;0.948;0.969	D	0.84290	0.0499	9	0.31617	T	0.26	.	7.0239	0.24930	0.0:0.8507:0.0:0.1493	.	736;2262;2263	F5GX59;F5H0T8;Q9Y493	.;.;ZAN_HUMAN	H	2262;2262;2262;736	ENSP00000445943:P2262H;ENSP00000445091:P2262H;ENSP00000444427:P2262H;ENSP00000441117:P736H	ENSP00000445091:P2262H	P	+	2	0	ZAN	100220346	0.000000	0.05858	0.998000	0.56505	0.979000	0.70002	0.532000	0.23067	1.022000	0.39626	0.591000	0.81541	CCC	-	pfam_TIL_dom,superfamily_TIL_dom		0.602	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	polymorphic_pseudogene	OTTHUMT00000347214.1	C	NM_003386	-		100382410	+1	no_errors	ENST00000546292	ensembl	human	known	74_37	missense	SNP	1.000	A
SVIL	6840	genome.wustl.edu	37	10	29777607	29777607	+	Missense_Mutation	SNP	C	C	A	rs146000151		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr10:29777607C>A	ENST00000355867.4	-	23	5023	c.4271G>T	c.(4270-4272)cGg>cTg	p.R1424L	SVIL_ENST00000538146.1_Missense_Mutation_p.R216L|SVIL_ENST00000375400.3_Missense_Mutation_p.R998L|SVIL_ENST00000535393.1_Missense_Mutation_p.R338L|SVIL_ENST00000375398.2_Missense_Mutation_p.R1424L|PTCHD3P1_ENST00000413405.1_RNA	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1424	Interaction with NEB.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GTTGACGCTCCGCAGGCTGAC	0.512																																																	0								ENSG00000197321						66.0	53.0	58.0					10																	29777607		2203	4298	6501	SVIL	SO:0001583	missense	0			-	HGNC	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.4271G>T	10.37:g.29777607C>A	ENSP00000348128:p.Arg1424Leu	Somatic	0	51	0.00		0.5284069354479217	23	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.R1424L	ENST00000355867.4	37	c.4271	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	C	34	5.370963	0.95923	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393;ENST00000535994;ENST00000538146	T;T;T;T;D	0.86297	2.27;2.22;2.22;2.27;-2.1	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.93229	0.7843	M	0.76574	2.34	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.79784	0.985;0.993;0.99;0.983	D	0.93897	0.7185	10	0.87932	D	0	-25.111	18.3624	0.90379	0.0:1.0:0.0:0.0	.	338;216;998;1424	F5H2Q5;F5GXV0;O95425-2;O95425	.;.;.;SVIL_HUMAN	L	998;1424;1424;338;378;216	ENSP00000364549:R998L;ENSP00000364547:R1424L;ENSP00000348128:R1424L;ENSP00000445472:R338L;ENSP00000440343:R216L	ENSP00000348128:R1424L	R	-	2	0	SVIL	29817613	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.556000	0.82233	2.577000	0.86979	0.485000	0.47835	CGG	-	NULL		0.512	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	protein_coding	OTTHUMT00000047395.1	C		-		29777607	-1	no_errors	ENST00000355867	ensembl	human	known	74_37	missense	SNP	1.000	A
LIG1	3978	genome.wustl.edu	37	19	48647158	48647158	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:48647158C>A	ENST00000263274.7	-	10	1258	c.839G>T	c.(838-840)tGc>tTc	p.C280F	LIG1_ENST00000536218.1_Missense_Mutation_p.C212F|CTC-453G23.4_ENST00000594589.1_RNA|LIG1_ENST00000427526.2_Missense_Mutation_p.C249F	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	280					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	CGGTTTCCAGCAGGCATCTTC	0.547								Nucleotide excision repair (NER)																																									0								ENSG00000105486						133.0	137.0	136.0					19																	48647158		2203	4300	6503	LIG1	SO:0001583	missense	0			-	HGNC		CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.839G>T	19.37:g.48647158C>A	ENSP00000263274:p.Cys280Phe	Somatic	0	109	0.00		0.5284069354479217	37	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B2RAI8|Q2TB12|Q32P23	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_DNA_ligase_ATP-dep_C,superfamily_DNA_ligase_ATP-dep_N,superfamily_NA-bd_OB-fold,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.C280F	ENST00000263274.7	37	c.839	CCDS12711.1	19	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727540	0.69074	.	.	ENSG00000105486	ENST00000263274;ENST00000544761;ENST00000427526;ENST00000536218;ENST00000542460	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	4.88	4.88	0.63580	DNA ligase, ATP-dependent, N-terminal (2);	0.098790	0.64402	D	0.000001	T	0.20536	0.0494	M	0.66939	2.045	0.58432	D	0.999999	P;P;P	0.45396	0.553;0.661;0.857	B;B;B	0.36418	0.049;0.224;0.175	T	0.10567	-1.0624	10	0.09843	T	0.71	-26.3242	16.3342	0.83052	0.0:1.0:0.0:0.0	.	249;212;280	B4DTU4;F5GZ28;P18858	.;.;DNLI1_HUMAN	F	280;311;249;212;248	ENSP00000263274:C280F;ENSP00000442841:C249F;ENSP00000441531:C212F;ENSP00000445928:C248F	ENSP00000263274:C280F	C	-	2	0	LIG1	53338970	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.774000	0.68906	2.630000	0.89119	0.655000	0.94253	TGC	-	superfamily_DNA_ligase_ATP-dep_N		0.547	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG1	protein_coding	OTTHUMT00000465575.1	C	NM_000234	-		48647158	-1	no_errors	ENST00000263274	ensembl	human	known	74_37	missense	SNP	1.000	A
CASZ1	54897	genome.wustl.edu	37	1	10725140	10725140	+	Splice_Site	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:10725140C>A	ENST00000377022.3	-	5	822	c.505G>T	c.(505-507)Gga>Tga	p.G169*	CASZ1_ENST00000344008.5_Splice_Site_p.G169*|CASZ1_ENST00000478728.2_5'UTR	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	169					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		AGGCACCCACCTGAAGCCTGC	0.677																																																	0								ENSG00000130940						27.0	25.0	26.0					1																	10725140		2203	4299	6502	CASZ1	SO:0001630	splice_region_variant	0			-	HGNC	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.505+1G>T	1.37:g.10725140C>A		Somatic	0	29	0.00		0.5284069354479217	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G169*	ENST00000377022.3	37	c.505	CCDS41246.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.636306	0.96693	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	3.9	3.9	0.45041	.	0.063982	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.6697	9.7154	0.40272	0.0:0.8965:0.0:0.1035	.	.	.	.	X	169	.	.	G	-	1	0	CASZ1	10647727	1.000000	0.71417	0.999000	0.59377	0.473000	0.32948	2.457000	0.45005	2.191000	0.70037	0.511000	0.50034	GGA	-	NULL		0.677	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	protein_coding	OTTHUMT00000005673.2	C	NM_017766	-	Nonsense_Mutation	10725140	-1	no_errors	ENST00000377022	ensembl	human	known	74_37	nonsense	SNP	1.000	A
SAMD9L	219285	genome.wustl.edu	37	7	92762287	92762287	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:92762287G>T	ENST00000318238.4	-	5	4214	c.2998C>A	c.(2998-3000)Ctg>Atg	p.L1000M	SAMD9L_ENST00000437805.1_Missense_Mutation_p.L1000M|SAMD9L_ENST00000411955.1_Missense_Mutation_p.L1000M	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	1000					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CTTCTTTCCAGTTCTTTTAGA	0.338																																																	0								ENSG00000177409						70.0	70.0	70.0					7																	92762287		2202	4299	6501	SAMD9L	SO:0001583	missense	0			-	HGNC	AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.2998C>A	7.37:g.92762287G>T	ENSP00000326247:p.Leu1000Met	Somatic	0	31	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	22	12.00	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_SAM/pointed,superfamily_P-loop_NTPase,pfscan_SAM	p.L1000M	ENST00000318238.4	37	c.2998	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	G	11.00	1.511417	0.27036	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.44482	0.92;0.92;0.92	5.22	2.24	0.28232	.	0.094004	0.43416	D	0.000577	T	0.55321	0.1913	M	0.69823	2.125	0.28166	N	0.928796	D	0.89917	1.0	D	0.70935	0.971	T	0.47129	-0.9141	10	0.72032	D	0.01	-4.9835	5.3298	0.15926	0.5056:0.0:0.4944:0.0	.	1000	Q8IVG5	SAM9L_HUMAN	M	1000	ENSP00000326247:L1000M;ENSP00000405760:L1000M;ENSP00000408796:L1000M	ENSP00000326247:L1000M	L	-	1	2	SAMD9L	92600223	0.011000	0.17503	0.998000	0.56505	0.116000	0.19942	0.051000	0.14141	0.784000	0.33661	0.467000	0.42956	CTG	-	NULL		0.338	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	protein_coding	OTTHUMT00000341730.1	G	NM_152703	-		92762287	-1	no_errors	ENST00000318238	ensembl	human	known	74_37	missense	SNP	0.997	T
CPXM2	119587	genome.wustl.edu	37	10	125671068	125671068	+	Intron	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr10:125671068C>A	ENST00000368854.3	-	2	174				AC068058.1_ENST00000408510.1_RNA|RP11-285A18.2_ENST00000435782.1_RNA			Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		actttcgcaccaacctaatag	0.438																																																	0								ENSG00000221437																																			AC068058.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000368854.3:c.2474+27924G>T	10.37:g.125671068C>A		Somatic	0	40	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B4E3Q2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368854.3	37	NULL		10																																																																																			-	-		0.438	CPXM2-001	KNOWN	basic	processed_transcript	ENSG00000221437	protein_coding	OTTHUMT00000050852.2	C	NM_198148	-		125671068	-1	no_errors	ENST00000408510	ensembl	human	novel	74_37	rna	SNP	0.001	A
ZNF354A	6940	genome.wustl.edu	37	5	178140027	178140027	+	Silent	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:178140027G>T	ENST00000335815.2	-	5	1049	c.852C>A	c.(850-852)tcC>tcA	p.S284S		NM_005649.2	NP_005640.2	O60765	Z354A_HUMAN	zinc finger protein 354A	284					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(7)|lung(3)|ovary(2)|skin(2)|stomach(2)	19	all_cancers(89;0.000536)|Renal(175;0.000159)|all_epithelial(37;0.000221)|Lung NSC(126;0.00308)|all_lung(126;0.00536)	all_cancers(40;0.0452)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.185)		GTTTATAAAGGGATGTACTGA	0.378																																																	0								ENSG00000169131						78.0	81.0	80.0					5																	178140027		2203	4300	6503	ZNF354A	SO:0001819	synonymous_variant	0			-	HGNC	AF116030	CCDS4438.1	5q35.3	2013-01-08		2001-11-23	ENSG00000169131	ENSG00000169131		"""Zinc fingers, C2H2-type"", ""-"""	11628	protein-coding gene	gene with protein product		602444		TCF17		9465904	Standard	NM_005649		Approved	KID-1, EZNF, HKL1, KID1	uc003mjj.3	O60765	OTTHUMG00000130895	ENST00000335815.2:c.852C>A	5.37:g.178140027G>T		Somatic	0	65	0.00		0.5284069354479217	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	Q9UNJ8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S284	ENST00000335815.2	37	c.852	CCDS4438.1	5																																																																																			-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZNF354A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354A	protein_coding	OTTHUMT00000253481.1	G	NM_005649	-		178140027	-1	no_errors	ENST00000335815	ensembl	human	known	74_37	silent	SNP	0.062	T
ANGEL2	90806	genome.wustl.edu	37	1	213168389	213168389	+	Missense_Mutation	SNP	C	C	A	rs532245447		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:213168389C>A	ENST00000366962.3	-	9	1783	c.1629G>T	c.(1627-1629)gaG>gaT	p.E543D	ANGEL2_ENST00000544555.1_Missense_Mutation_p.E374D|ANGEL2_ENST00000473303.1_5'UTR|ANGEL2_ENST00000535388.1_3'UTR|ANGEL2_ENST00000360506.2_Missense_Mutation_p.E374D|ANGEL2_ENST00000540642.1_Missense_Mutation_p.E417D	NM_144567.3	NP_653168.2	Q5VTE6	ANGE2_HUMAN	angel homolog 2 (Drosophila)	543										central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(1)	24				OV - Ovarian serous cystadenocarcinoma(81;0.00446)|all cancers(67;0.0169)|Epithelial(68;0.0921)|GBM - Glioblastoma multiforme(131;0.185)		AGAGTCAGAGCTCAAGTCTGA	0.328																																																	0								ENSG00000174606						101.0	100.0	101.0					1																	213168389		2203	4300	6503	ANGEL2	SO:0001583	missense	0			-	HGNC	AL079275	CCDS1512.1, CCDS73027.1	1q32.3	2014-06-17			ENSG00000174606	ENSG00000174606			30534	protein-coding gene	gene with protein product						11943475	Standard	XM_005273344		Approved	KIAA0759L, FLJ12793, Ccr4d	uc001hjz.3	Q5VTE6	OTTHUMG00000036927	ENST00000366962.3:c.1629G>T	1.37:g.213168389C>A	ENSP00000355929:p.Glu543Asp	Somatic	0	44	0.00		0.5284069354479217	11	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	B7Z2U4|D3DTA3|Q86X13|Q8NHH3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.E543D	ENST00000366962.3	37	c.1629	CCDS1512.1	1	.	.	.	.	.	.	.	.	.	.	C	11.79	1.742304	0.30865	.	.	ENSG00000174606	ENST00000366962;ENST00000360506;ENST00000544555;ENST00000540642	D;T;T;D	0.95238	-3.65;0.93;0.93;-3.65	5.89	-4.84	0.03151	Endonuclease/exonuclease/phosphatase (1);	0.497263	0.23395	N	0.048655	D	0.85349	0.5676	N	0.20685	0.6	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.12156	0.007;0.005	T	0.61397	-0.7071	10	0.34782	T	0.22	-3.8739	8.8243	0.35045	0.0:0.4359:0.0931:0.4711	.	417;543	F5H476;Q5VTE6	.;ANGE2_HUMAN	D	543;374;374;417	ENSP00000355929:E543D;ENSP00000353696:E374D;ENSP00000443193:E374D;ENSP00000446124:E417D	ENSP00000353696:E374D	E	-	3	2	ANGEL2	211235012	0.000000	0.05858	0.723000	0.30687	0.758000	0.43043	-1.218000	0.02976	-0.996000	0.03455	-1.028000	0.02416	GAG	-	superfamily_Endo/exonuclease/phosphatase		0.328	ANGEL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL2	protein_coding	OTTHUMT00000089693.1	C	NM_144567	-		213168389	-1	no_errors	ENST00000366962	ensembl	human	known	74_37	missense	SNP	0.912	A
MYEOV	26579	genome.wustl.edu	37	11	69062890	69062890	+	Silent	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:69062890C>A	ENST00000308946.3	+	2	519	c.69C>A	c.(67-69)ctC>ctA	p.L23L	MYEOV_ENST00000535407.1_5'UTR|MYEOV_ENST00000441339.2_Silent_p.L23L	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	23										endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		gctgttgcctctgcctggaac	0.592																																																	0								ENSG00000172927						229.0	159.0	183.0					11																	69062890		2200	4294	6494	MYEOV	SO:0001819	synonymous_variant	0			-	HGNC	AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.69C>A	11.37:g.69062890C>A		Somatic	0	34	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q9UGN6|Q9UGN7	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L23	ENST00000308946.3	37	c.69	CCDS8190.1	11																																																																																			-	NULL		0.592	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	MYEOV	protein_coding	OTTHUMT00000396548.1	C		-		69062890	+1	no_errors	ENST00000308946	ensembl	human	known	74_37	silent	SNP	0.004	A
RGAG1	57529	genome.wustl.edu	37	X	109695164	109695164	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chrX:109695164C>A	ENST00000465301.2	+	3	1565	c.1319C>A	c.(1318-1320)tCa>tAa	p.S440*	RGAG1_ENST00000540313.1_Nonsense_Mutation_p.S440*	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	440										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ATGACCACCTCACTGATGACA	0.502																																																	0								ENSG00000243978						155.0	146.0	149.0					X																	109695164		2203	4300	6503	RGAG1	SO:0001587	stop_gained	0			-	HGNC	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1319C>A	X.37:g.109695164C>A	ENSP00000419786:p.Ser440*	Somatic	0	41	0.00		0.5284069354479217	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	Q9P2M8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S440*	ENST00000465301.2	37	c.1319	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	C	37	6.140714	0.97320	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	.	.	.	3.97	3.09	0.35607	.	0.256644	0.20685	N	0.087574	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-5.8505	10.0145	0.42006	0.2032:0.7968:0.0:0.0	.	.	.	.	X	440	.	.	S	+	2	0	RGAG1	109581820	0.985000	0.35326	0.019000	0.16419	0.543000	0.35085	1.588000	0.36633	0.997000	0.38969	0.544000	0.68410	TCA	-	NULL		0.502	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	protein_coding	OTTHUMT00000057906.2	C	NM_020769	-		109695164	+1	no_errors	ENST00000465301	ensembl	human	known	74_37	nonsense	SNP	0.053	A
DNMT1	1786	genome.wustl.edu	37	19	10287970	10287970	+	Silent	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:10287970C>T	ENST00000340748.4	-	5	754	c.519G>A	c.(517-519)aaG>aaA	p.K173K	DNMT1_ENST00000359526.4_Silent_p.K189K|DNMT1_ENST00000540357.1_Silent_p.K173K			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	173	Interaction with DNMT3B.|Interaction with PCNA.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	ATACTGACCCCTTTGCAAAAT	0.463																																																	0								ENSG00000130816						145.0	128.0	134.0					19																	10287970		2203	4300	6503	DNMT1	SO:0001819	synonymous_variant	0			-	HGNC	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.519G>A	19.37:g.10287970C>T		Somatic	0	82	0.00		0.5284069354479217	150	33.63	76	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	81	28.32	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_DNA_C5-MeTrfase_1_euk,pfam_C5_MeTfrase,pfam_BAH_dom,pfam_Cytosine_MeTrfase1_RFD,pfam_DMAP1-bd,pfam_Znf_CXXC,smart_BAH_dom,prints_C5_MeTfrase,pfscan_BAH_dom,pfscan_Znf_CXXC	p.K189	ENST00000340748.4	37	c.567	CCDS12228.1	19																																																																																			-	pirsf_DNA_C5-MeTrfase_1_euk		0.463	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	DNMT1	protein_coding	OTTHUMT00000451166.1	C	NM_001379	-		10287970	-1	no_errors	ENST00000359526	ensembl	human	known	74_37	silent	SNP	0.692	T
AKAP9	10142	genome.wustl.edu	37	7	91732034	91732034	+	Silent	SNP	C	C	A	rs376311830		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:91732034C>A	ENST00000359028.2	+	46	11461	c.11236C>A	c.(11236-11238)Cgg>Agg	p.R3746R	AKAP9_ENST00000356239.3_Silent_p.R3742R|AKAP9_ENST00000358100.2_Silent_p.R3692R			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3746					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CCTGCTTGCCCGGATGGGGGG	0.532			T	BRAF	papillary thyroid																																			Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0								ENSG00000127914						108.0	115.0	113.0					7																	91732034		2203	4300	6503	AKAP9	SO:0001819	synonymous_variant	0			-	HGNC	AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.11236C>A	7.37:g.91732034C>A		Somatic	0	51	0.00		0.5284069354479217	58	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB	p.R3746	ENST00000359028.2	37	c.11236		7																																																																																			-	pfam_PACT_domain		0.532	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	protein_coding		C	NM_005751	-		91732034	+1	no_errors	ENST00000359028	ensembl	human	known	74_37	silent	SNP	1.000	A
IFNLR1	163702	genome.wustl.edu	37	1	24484288	24484288	+	Missense_Mutation	SNP	T	T	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:24484288T>A	ENST00000327535.1	-	7	907	c.895A>T	c.(895-897)Acc>Tcc	p.T299S	IFNLR1_ENST00000374421.3_Missense_Mutation_p.T270S|IFNLR1_ENST00000327575.2_3'UTR	NM_170743.3|NM_173064.2	NP_734464.1|NP_775087.1	Q8IU57	INLR1_HUMAN	interferon, lambda receptor 1	299					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mucosal immune response (GO:0002385)|negative regulation of cell proliferation (GO:0008285)|regulation of defense response to virus by host (GO:0050691)|response to type III interferon (GO:0034342)	integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)											ACCCCTCTGGTCAGTTCCTTT	0.562																																																	0								ENSG00000185436						112.0	118.0	116.0					1																	24484288		2203	4300	6503	IFNLR1	SO:0001583	missense	0			-	HGNC	AY129153	CCDS248.1, CCDS249.1, CCDS250.1	1p36.11	2012-11-27	2012-11-26	2012-11-26	ENSG00000185436	ENSG00000185436		"""Interferons"""	18584	protein-coding gene	gene with protein product	"""interferon lambda receptor 1"""	607404	"""interleukin 28 receptor, alpha"", ""interleukin 28 receptor, alpha (interferon, lambda receptor)"""	IL28RA			Standard	NM_173064		Approved	CRF2/12, IFNLR, IL-28R1	uc001bis.3	Q8IU57	OTTHUMG00000003036	ENST00000327535.1:c.895A>T	1.37:g.24484288T>A	ENSP00000327824:p.Thr299Ser	Somatic	0	55	0.00		0.5284069354479217	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	33	40.00	Q5VTX5|Q5VTX7|Q5VTX8|Q6ZML8|Q8IV66|Q8IZI7|Q8IZI8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Fibronectin_type3	p.T299S	ENST00000327535.1	37	c.895	CCDS248.1	1	.	.	.	.	.	.	.	.	.	.	T	6.881	0.531998	0.13127	.	.	ENSG00000185436	ENST00000327535;ENST00000374421	.	.	.	5.38	-1.86	0.07760	.	0.946429	0.08947	N	0.870671	T	0.30479	0.0766	L	0.59436	1.845	0.09310	N	0.999995	B;B	0.26195	0.144;0.094	B;B	0.23275	0.036;0.045	T	0.30592	-0.9973	9	0.12430	T	0.62	-2.0418	4.6022	0.12359	0.0:0.2575:0.3013:0.4412	.	299;270	Q8IU57;Q8IU57-2	I28RA_HUMAN;.	S	299;270	.	ENSP00000327824:T299S	T	-	1	0	IL28RA	24356875	0.000000	0.05858	0.010000	0.14722	0.090000	0.18270	-0.161000	0.10026	-0.150000	0.11195	-0.242000	0.12053	ACC	-	NULL		0.562	IFNLR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFNLR1	protein_coding	OTTHUMT00000008402.1	T	NM_170743	-		24484288	-1	no_errors	ENST00000327535	ensembl	human	known	74_37	missense	SNP	0.104	A
PPP1R3F	89801	genome.wustl.edu	37	X	49130125	49130125	+	Intron	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chrX:49130125G>T	ENST00000055335.6	+	1	1020				PPP1R3F_ENST00000495799.1_Intron|LL0XNC01-7P3.1_ENST00000602455.1_lincRNA|PPP1R3F_ENST00000438316.1_Intron|PPP1R3F_ENST00000466508.1_Intron	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F						regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					TTGAAGACTAGCCACCCTTTG	0.478																																																	0								ENSG00000270012																																			LL0XNC01-7P3.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene		CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1004+2789G>T	X.37:g.49130125G>T		Somatic	0	17	0.00		0.5284069354479217	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	10	41.18	A2VDJ8|B3KPW2|E9PCM3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000055335.6	37	NULL	CCDS35254.1	X																																																																																			-	-		0.478	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000270012	protein_coding	OTTHUMT00000060819.2	G	NM_033215	-		49130125	+1	no_errors	ENST00000602455	ensembl	human	known	74_37	rna	SNP	0.891	T
TCF7L2	6934	genome.wustl.edu	37	10	114925316	114925317	+	Frame_Shift_Ins	INS	-	-	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr10:114925316_114925317insA	ENST00000355995.4	+	15	1952_1953	c.1445_1446insA	c.(1444-1449)agaaaafs	p.RK482fs	TCF7L2_ENST00000542695.1_Frame_Shift_Ins_p.RK198fs|TCF7L2_ENST00000466338.1_3'UTR|TCF7L2_ENST00000538897.1_Frame_Shift_Ins_p.E458fs|TCF7L2_ENST00000545257.1_Frame_Shift_Ins_p.RK482fs|TCF7L2_ENST00000369397.4_Frame_Shift_Ins_p.RK459fs|TCF7L2_ENST00000369389.1_Frame_Shift_Ins_p.E152fs|TCF7L2_ENST00000543371.1_Frame_Shift_Ins_p.RK465fs|TCF7L2_ENST00000536810.1_Frame_Shift_Ins_p.RK465fs|TCF7L2_ENST00000352065.5_3'UTR|TCF7L2_ENST00000355717.4_Frame_Shift_Ins_p.E465fs|TCF7L2_ENST00000369386.1_3'UTR			Q9NQB0	TF7L2_HUMAN	transcription factor 7-like 2 (T-cell specific, HMG-box)	482	Promoter-specific activation domain.				blood vessel development (GO:0001568)|bone mineralization (GO:0030282)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|catenin import into nucleus (GO:0035411)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cellular response to starvation (GO:0009267)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|generation of neurons (GO:0048699)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen metabolic process (GO:0005977)|insulin metabolic process (GO:1901142)|maintenance of DNA repeat elements (GO:0043570)|multicellular organism growth (GO:0035264)|myoblast fate commitment (GO:0048625)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of organ growth (GO:0046621)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neural tube development (GO:0021915)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte development (GO:0014003)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of insulin secretion (GO:0032024)|positive regulation of protein binding (GO:0032092)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|post-embryonic development (GO:0009791)|regulation of hormone metabolic process (GO:0032350)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of myelination (GO:0031641)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of skeletal muscle tissue development (GO:0048641)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|secretory granule localization (GO:0032252)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	beta-catenin-TCF7L2 complex (GO:0070369)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|gamma-catenin binding (GO:0045295)|nuclear hormone receptor binding (GO:0035257)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		VTI1A/TCF7L2(8)	central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(24)|liver(2)|lung(8)|ovary(1)|skin(1)	41		Breast(234;0.058)|Colorectal(252;0.0615)		Epithelial(162;0.00554)|all cancers(201;0.02)		GTTTCTAGGAGAAAAAAAAAGT	0.52			T	VTI1A	colorectal																																			Dom	yes		10	10q25.3	6934	transcription factor 7-like 2		E	0								ENSG00000148737																																			TCF7L2	SO:0001589	frameshift_variant	0				HGNC	X62871	CCDS7576.1, CCDS53578.1, CCDS55729.1, CCDS73196.1, CCDS73197.1, CCDS73198.1	10q25.3	2006-11-24			ENSG00000148737	ENSG00000148737			11641	protein-coding gene	gene with protein product		602228		TCF4		1741298	Standard	NM_001146283		Approved	TCF-4	uc001lae.4	Q9NQB0	OTTHUMG00000019070	ENST00000355995.4:c.1454dupA	10.37:g.114925325_114925325dupA	ENSP00000348274:p.Arg482fs	Somatic	0	39	0.00		0.5284069354479217	33	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	17	10.53	B4DRJ8|B9X074|C6ZRJ8|C6ZRK0|E2GH14|E2GH19|E2GH20|E2GH24|E2GH25|E9PFH9|F8W742|F8W7T5|O00185|Q9NQB1|Q9NQB2|Q9NQB3|Q9NQB4|Q9NQB5|Q9NQB6|Q9NQB7|Q9ULC2	Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_CTNNB1-bd_N,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.K486fs	ENST00000355995.4	37	c.1445_1446		10																																																																																			-	NULL		0.520	TCF7L2-203	KNOWN	basic	protein_coding	TCF7L2	protein_coding		-	NM_030756			114925317	+1	no_errors	ENST00000355995	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
FAM182A	284800	genome.wustl.edu	37	20	26061803	26061803	+	RNA	SNP	C	C	A	rs78281752	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr20:26061803C>A	ENST00000376398.2	+	0	823					NR_026713.1		Q5T1J6	F182A_HUMAN	family with sequence similarity 182, member A											breast(1)|endometrium(2)|kidney(1)	4						ATTTCAGTTTCTTTTGATTTC	0.443																																																	0								ENSG00000125804						13.0	11.0	12.0					20																	26061803		692	1589	2281	FAM182A			0			-	HGNC	AL391119		20p11	2013-03-18	2008-08-05	2008-08-05	ENSG00000125804	ENSG00000125804			16222	other	unknown			"""chromosome 20 open reading frame 91"""	C20orf91			Standard	NR_026713		Approved	bB329D4.1, C20orf91A	uc010gdq.3	Q5T1J6	OTTHUMG00000032144		20.37:g.26061803C>A		Somatic	0	47	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	39	17.02	A2RRD0|Q8N947	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000376398.2	37	NULL		20	.	.	.	.	.	.	.	.	.	.	N	9.534	1.111620	0.20714	.	.	ENSG00000125804	ENST00000376398;ENST00000246000	.	.	.	0.368	0.368	0.16146	.	.	.	.	.	T	0.55847	0.1946	.	.	.	0.33448	D	0.583239	.	.	.	.	.	.	T	0.67142	-0.5745	4	0.87932	D	0	.	.	.	.	.	.	.	.	Y	52	.	ENSP00000246000:S52Y	S	+	2	0	FAM182A	26009803	0.964000	0.33143	0.497000	0.27552	0.480000	0.33159	0.675000	0.25232	0.451000	0.26802	0.123000	0.15791	TCT	-	-		0.443	FAM182A-001	KNOWN	basic	lincRNA	FAM182A	processed_transcript	OTTHUMT00000078473.2	C		rs78281752		26061803	+1	no_errors	ENST00000376398	ensembl	human	known	74_37	rna	SNP	0.644	A
CAPN11	11131	genome.wustl.edu	37	6	44147741	44147741	+	Missense_Mutation	SNP	A	A	G			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr6:44147741A>G	ENST00000398776.1	+	14	1519	c.1481A>G	c.(1480-1482)cAg>cGg	p.Q494R	CAPN11_ENST00000542245.1_Missense_Mutation_p.Q494R	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	494	Domain III.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ACGAAGTATCAGGACCACGGC	0.507																																																	0								ENSG00000137225						131.0	130.0	130.0					6																	44147741		1987	4172	6159	CAPN11	SO:0001583	missense	0			-	HGNC	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.1481A>G	6.37:g.44147741A>G	ENSP00000381758:p.Gln494Arg	Somatic	0	38	0.00		0.5284069354479217	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.Q494R	ENST00000398776.1	37	c.1481	CCDS47436.1	6	.	.	.	.	.	.	.	.	.	.	A	1.454	-0.564361	0.03939	.	.	ENSG00000137225	ENST00000398776;ENST00000542245	D;D	0.87491	-2.26;-2.26	4.97	-4.08	0.03963	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	0.501878	0.17032	N	0.189661	T	0.51363	0.1670	N	0.16201	0.385	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.12156	0.007;0.007	T	0.53394	-0.8445	10	0.19590	T	0.45	.	9.1282	0.36828	0.2584:0.5928:0.1488:0.0	.	148;494	B4DT90;Q9UMQ6	.;CAN11_HUMAN	R	494	ENSP00000381758:Q494R;ENSP00000441078:Q494R	ENSP00000381758:Q494R	Q	+	2	0	CAPN11	44255719	0.023000	0.18921	0.034000	0.17996	0.021000	0.10359	0.559000	0.23485	-0.411000	0.07530	0.496000	0.49642	CAG	-	pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Calpain_III		0.507	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAPN11	protein_coding	OTTHUMT00000040714.3	A		-		44147741	+1	no_errors	ENST00000398776	ensembl	human	known	74_37	missense	SNP	0.006	G
XCR1	2829	genome.wustl.edu	37	3	46063291	46063291	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr3:46063291C>T	ENST00000309285.3	-	2	505	c.149G>A	c.(148-150)aGc>aAc	p.S50N	XCR1_ENST00000542109.1_Missense_Mutation_p.S50N	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	50					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CAGGACCAGGCTGTTGCCCAC	0.577																																																	0								ENSG00000173578						121.0	114.0	117.0					3																	46063291		2203	4300	6503	XCR1	SO:0001583	missense	0			-	HGNC		CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.149G>A	3.37:g.46063291C>T	ENSP00000310405:p.Ser50Asn	Somatic	0	53	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_XCR1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Brdyknn_rcpt	p.S50N	ENST00000309285.3	37	c.149	CCDS2736.1	3	.	.	.	.	.	.	.	.	.	.	C	14.56	2.572843	0.45798	.	.	ENSG00000173578	ENST00000309285;ENST00000542109	T;T	0.39056	1.1;1.1	5.24	4.37	0.52481	GPCR, rhodopsin-like superfamily (1);	0.292976	0.38605	N	0.001625	T	0.47021	0.1423	M	0.84326	2.69	0.26488	N	0.974996	B	0.23128	0.08	B	0.25614	0.062	T	0.50541	-0.8816	10	0.66056	D	0.02	.	10.401	0.44229	0.0:0.7793:0.1442:0.0765	.	50	P46094	XCR1_HUMAN	N	50	ENSP00000310405:S50N;ENSP00000438119:S50N	ENSP00000310405:S50N	S	-	2	0	XCR1	46038295	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	1.232000	0.32636	1.209000	0.43321	0.650000	0.86243	AGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.577	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XCR1	protein_coding	OTTHUMT00000257322.2	C		-		46063291	-1	no_errors	ENST00000309285	ensembl	human	known	74_37	missense	SNP	1.000	T
MPPED2	744	genome.wustl.edu	37	11	30410479	30410479	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:30410479G>T	ENST00000448418.2	-	7	1151	c.791C>A	c.(790-792)gCa>gAa	p.A264E		NM_001145399.1	NP_001138871.1	Q15777	MPPD2_HUMAN	metallophosphoesterase domain containing 2	0					nervous system development (GO:0007399)		hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(15)|skin(2)|upper_aerodigestive_tract(2)	33						tgtcctcagtgcctTGGAGAT	0.403																																																	0								ENSG00000066382						107.0	87.0	93.0					11																	30410479		1565	3577	5142	MPPED2	SO:0001583	missense	0			-	HGNC	U57911	CCDS7870.1, CCDS44560.1	11p13	2008-07-18	2005-10-10	2005-10-10	ENSG00000066382	ENSG00000066382			1180	protein-coding gene	gene with protein product		600911	"""chromosome 11 open reading frame 8"""	C11orf8		8666403, 9266672	Standard	NM_001584		Approved	239FB, D11S302E, Hs.46638, FAM1B, dJ873F21.1, dJ1024C24.1	uc001msr.3	Q15777	OTTHUMG00000166159	ENST00000448418.2:c.791C>A	11.37:g.30410479G>T	ENSP00000388258:p.Ala264Glu	Somatic	0	37	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	D3DQZ5|E9PB10|Q59GE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PEstase_dom	p.A264E	ENST00000448418.2	37	c.791	CCDS44560.1	11	.	.	.	.	.	.	.	.	.	.	G	9.181	1.023595	0.19433	.	.	ENSG00000066382	ENST00000448418	T	0.46063	0.88	3.15	-6.05	0.02172	.	.	.	.	.	T	0.19127	0.0459	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15780	-1.0425	9	0.35671	T	0.21	.	1.1571	0.01798	0.1886:0.15:0.3641:0.2973	.	264	E9PB10	.	E	264	ENSP00000388258:A264E	ENSP00000388258:A264E	A	-	2	0	MPPED2	30367055	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.878000	0.04192	-1.389000	0.02090	0.655000	0.94253	GCA	-	NULL		0.403	MPPED2-001	KNOWN	basic|CCDS	protein_coding	MPPED2	protein_coding	OTTHUMT00000388154.1	G	NM_001584	-		30410479	-1	no_errors	ENST00000448418	ensembl	human	known	74_37	missense	SNP	0.000	T
UHMK1	127933	genome.wustl.edu	37	1	162492294	162492294	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:162492294C>A	ENST00000489294.1	+	8	1372	c.1214C>A	c.(1213-1215)cCg>cAg	p.P405Q	UHMK1_ENST00000538489.1_3'UTR|UHMK1_ENST00000545294.1_Missense_Mutation_p.P331Q|UHMK1_ENST00000282169.8_3'UTR	NM_175866.4	NP_787062.1	Q8TAS1	UHMK1_HUMAN	U2AF homology motif (UHM) kinase 1	405	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176, ECO:0000305}.				cell cycle arrest (GO:0007050)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of translational initiation (GO:0045948)|protein autophosphorylation (GO:0046777)|regulation of protein export from nucleus (GO:0046825)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|neuronal ribonucleoprotein granule (GO:0071598)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)|transferase activity (GO:0016740)	p.P405L(1)		endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	11	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			ACATTCTACCCGCTGAGTGCC	0.423																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000152332						158.0	156.0	156.0					1																	162492294		2203	4300	6503	UHMK1	SO:0001583	missense	0			-	HGNC	BC026046	CCDS1239.1, CCDS53423.1, CCDS53424.1	1q23.1	2013-02-12			ENSG00000152332	ENSG00000152332		"""RNA binding motif (RRM) containing"""	19683	protein-coding gene	gene with protein product		608849				12093740, 12782393	Standard	NM_175866		Approved	KIS, Kist	uc001gcc.2	Q8TAS1	OTTHUMG00000031373	ENST00000489294.1:c.1214C>A	1.37:g.162492294C>A	ENSP00000420270:p.Pro405Gln	Somatic	0	45	0.00		0.5284069354479217	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K8K4|G3V1M1|Q96C22	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RRM_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Prot_kinase_dom	p.P405Q	ENST00000489294.1	37	c.1214	CCDS1239.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283911	0.80803	.	.	ENSG00000152332	ENST00000545294;ENST00000489294	T;T	0.76839	-0.19;-1.05	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.87700	0.6243	M	0.85859	2.78	.	.	.	D;D	0.89917	0.999;1.0	D;D	0.91635	0.993;0.999	D	0.88860	0.3325	9	0.87932	D	0	-6.8932	15.9723	0.80031	0.0:1.0:0.0:0.0	.	405;331	Q8TAS1;G3V1M1	UHMK1_HUMAN;.	Q	331;405	ENSP00000441226:P331Q;ENSP00000420270:P405Q	ENSP00000420270:P405Q	P	+	2	0	UHMK1	160758918	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.856000	0.75450	2.788000	0.95919	0.650000	0.86243	CCG	-	NULL		0.423	UHMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHMK1	protein_coding	OTTHUMT00000076788.1	C	NM_175866	-		162492294	+1	no_errors	ENST00000489294	ensembl	human	known	74_37	missense	SNP	1.000	A
UNC79	57578	genome.wustl.edu	37	14	94083507	94083507	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr14:94083507C>A	ENST00000393151.2	+	28	4081	c.4081C>A	c.(4081-4083)Ccc>Acc	p.P1361T	UNC79_ENST00000555664.1_Missense_Mutation_p.P1361T|UNC79_ENST00000553484.1_Missense_Mutation_p.P1383T|UNC79_ENST00000256339.4_Missense_Mutation_p.P1184T			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1361					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ACACCTTCTCCCCTTAGTGGT	0.418																																																	0								ENSG00000133958						113.0	110.0	111.0					14																	94083507		2203	4300	6503	UNC79	SO:0001583	missense	0			-	HGNC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4081C>A	14.37:g.94083507C>A	ENSP00000376858:p.Pro1361Thr	Somatic	0	29	0.00		0.5284069354479217	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,superfamily_ARM-type_fold	p.P1383T	ENST00000393151.2	37	c.4147		14	.	.	.	.	.	.	.	.	.	.	C	22.3	4.273844	0.80580	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.20200	2.12;2.09;2.12;2.12	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.43612	0.1255	L	0.47190	1.495	0.54753	D	0.99998	D	0.89917	1.0	D	0.83275	0.996	T	0.18398	-1.0338	10	0.72032	D	0.01	-20.0382	19.8778	0.96885	0.0:1.0:0.0:0.0	.	1383	C9JQL1	.	T	1184;1361;1383;1361;1383	ENSP00000256339:P1184T;ENSP00000450868:P1361T;ENSP00000451360:P1383T;ENSP00000376858:P1361T	ENSP00000256339:P1184T	P	+	1	0	KIAA1409	93153260	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.554000	0.82212	2.710000	0.92621	0.585000	0.79938	CCC	-	superfamily_ARM-type_fold		0.418	UNC79-006	KNOWN	basic	protein_coding	UNC79	protein_coding	OTTHUMT00000412766.1	C	XM_028395	-		94083507	+1	no_errors	ENST00000553484	ensembl	human	known	74_37	missense	SNP	1.000	A
DDX23	9416	genome.wustl.edu	37	12	49227209	49227209	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr12:49227209C>A	ENST00000308025.3	-	13	1733	c.1654G>T	c.(1654-1656)Gat>Tat	p.D552Y		NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	552	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						ATCATCCTATCTGCCTCATCC	0.542																																																	0								ENSG00000174243						126.0	112.0	117.0					12																	49227209		2203	4300	6503	DDX23	SO:0001583	missense	0			-	HGNC	AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.1654G>T	12.37:g.49227209C>A	ENSP00000310723:p.Asp552Tyr	Somatic	0	72	0.00		0.5284069354479217	289	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.51	B2R600|B4DH15|O43188	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D552Y	ENST00000308025.3	37	c.1654	CCDS8770.1	12	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883159	0.91740	.	.	ENSG00000174243	ENST00000308025	T	0.07908	3.15	5.93	5.93	0.95920	RNA helicase, ATP-dependent, DEAD-box, conserved site (1);DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.50292	0.1607	H	0.98701	4.305	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70749	-0.4787	10	0.87932	D	0	-19.1466	19.1152	0.93336	0.0:1.0:0.0:0.0	.	552	Q9BUQ8	DDX23_HUMAN	Y	552	ENSP00000310723:D552Y	ENSP00000310723:D552Y	D	-	1	0	DDX23	47513476	1.000000	0.71417	0.993000	0.49108	0.996000	0.88848	7.746000	0.85057	2.815000	0.96918	0.561000	0.74099	GAT	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.542	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX23	protein_coding	OTTHUMT00000408897.2	C	NM_004818	-		49227209	-1	no_errors	ENST00000308025	ensembl	human	known	74_37	missense	SNP	1.000	A
ZNF317	57693	genome.wustl.edu	37	19	9271774	9271774	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:9271774G>T	ENST00000247956.6	+	7	1758	c.1453G>T	c.(1453-1455)Gac>Tac	p.D485Y	ZNF317_ENST00000360385.3_Missense_Mutation_p.D453Y	NM_020933.4	NP_065984.3	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	485					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	27						AGTCTTCGGTGACTATTTATC	0.542																																																	0								ENSG00000130803						53.0	48.0	50.0					19																	9271774		2203	4300	6503	ZNF317	SO:0001583	missense	0			-	HGNC	AF275255	CCDS12210.1, CCDS54213.1	19p13	2013-01-08				ENSG00000130803		"""Zinc fingers, C2H2-type"", ""-"""	13507	protein-coding gene	gene with protein product		613864				10997877, 11688974	Standard	NM_020933		Approved		uc002mku.3	Q96PQ6		ENST00000247956.6:c.1453G>T	19.37:g.9271774G>T	ENSP00000247956:p.Asp485Tyr	Somatic	0	31	0.00		0.5284069354479217	44	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q6DCA9|Q96PM0|Q96PM1|Q96PT2|Q9HCI4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D485Y	ENST00000247956.6	37	c.1453	CCDS12210.1	19	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.037167	0.00406	.	.	ENSG00000130803	ENST00000247956;ENST00000360385	T;T	0.55052	0.54;0.54	2.59	2.59	0.31030	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43747	D	0.000529	T	0.37999	0.1024	N	0.02403	-0.565	0.09310	N	1	B;D	0.89917	0.225;1.0	B;D	0.91635	0.031;0.999	T	0.37220	-0.9715	10	0.06757	T	0.87	-31.7878	8.7914	0.34852	0.0:0.0:1.0:0.0	.	453;485	Q96PQ6-2;Q96PQ6	.;ZN317_HUMAN	Y	485;453	ENSP00000247956:D485Y;ENSP00000353554:D453Y	ENSP00000247956:D485Y	D	+	1	0	ZNF317	9132774	0.000000	0.05858	0.005000	0.12908	0.115000	0.19883	-0.427000	0.06999	1.771000	0.52183	0.491000	0.48974	GAC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.542	ZNF317-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF317	protein_coding	OTTHUMT00000448995.1	G	NM_020933	-		9271774	+1	no_errors	ENST00000247956	ensembl	human	known	74_37	missense	SNP	0.000	T
ABLIM3	22885	genome.wustl.edu	37	5	148596517	148596517	+	Intron	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:148596517C>A	ENST00000506113.1	+	7	1151				AC012613.2_ENST00000523176.1_RNA|ABLIM3_ENST00000504238.1_Intron|ABLIM3_ENST00000309868.7_Intron|ABLIM3_ENST00000326685.7_Intron|ABLIM3_ENST00000508983.1_Intron|RP11-331K21.1_ENST00000522685.1_RNA|RP11-331K21.1_ENST00000512647.2_RNA|ABLIM3_ENST00000356541.3_Intron			O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3						actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|cilium assembly (GO:0042384)|lamellipodium assembly (GO:0030032)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTCATTTCCATAGGCAGGA	0.498																																																	0								ENSG00000253406						74.0	66.0	69.0					5																	148596517		2203	4300	6503	AC012613.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AB020650	CCDS4294.1	5q33.1	2008-02-05			ENSG00000173210	ENSG00000173210			29132	protein-coding gene	gene with protein product		611305					Standard	XM_005268392		Approved	KIAA0843	uc003lpy.2	O94929	OTTHUMG00000129932	ENST00000506113.1:c.670-5C>A	5.37:g.148596517C>A		Somatic	0	37	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	A8K121|Q19VH3|Q658S1|Q68CI5|Q9BV32	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000506113.1	37	NULL	CCDS4294.1	5																																																																																			-	-		0.498	ABLIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC101927031	protein_coding	OTTHUMT00000373435.1	C	NM_014945	-		148596517	-1	no_errors	ENST00000523176	ensembl	human	known	74_37	rna	SNP	0.001	A
C12orf76	400073	genome.wustl.edu	37	12	110488793	110488793	+	Intron	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr12:110488793G>T	ENST00000309050.5	-	4	664				C12orf76_ENST00000546627.1_5'Flank|C12orf76_ENST00000549724.1_5'Flank|C12orf76_ENST00000551185.2_5'Flank|C12orf76_ENST00000546651.2_5'Flank|C12orf76_ENST00000547573.1_5'Flank|C12orf76_ENST00000548191.1_Silent_p.T106T|C12orf76_ENST00000548936.1_Intron	NM_207435.1	NP_997318.1	Q8N812	CL076_HUMAN	chromosome 12 open reading frame 76											endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6						AACACTACCAGGTGTTCACCT	0.468																																																	0								ENSG00000174456																																			C12orf76	SO:0001627	intron_variant	0			-	HGNC	BC041968	CCDS9141.1	12q24.11	2012-08-16			ENSG00000174456	ENSG00000174456			33790	protein-coding gene	gene with protein product							Standard	NM_207435		Approved	FLJ40142	uc001tqe.2	Q8N812	OTTHUMG00000169315	ENST00000309050.5:c.299+6200C>A	12.37:g.110488793G>T		Somatic	0	44	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	42	8.70		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_P2X_purnocptor	p.T106	ENST00000309050.5	37	c.318	CCDS9141.1	12																																																																																			-	NULL		0.468	C12orf76-001	KNOWN	basic|CCDS	protein_coding	C12orf76	protein_coding	OTTHUMT00000403439.2	G	NM_207435	-		110488793	-1	no_errors	ENST00000548191	ensembl	human	putative	74_37	silent	SNP	0.010	T
MGAM2	93432	genome.wustl.edu	37	7	141875547	141875547	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr7:141875547G>T	ENST00000477922.3	+	32	3837	c.3783G>T	c.(3781-3783)atG>atT	p.M1261I																	endometrium(1)|lung(5)	6						TTGAGCAAATGAAGAAAAATG	0.393																																																	0								ENSG00000257743																																			RP11-1220K2.2	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000477922.3:c.3783G>T	7.37:g.141875547G>T	ENSP00000420449:p.Met1261Ile	Somatic	0	54	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,superfamily_P_trefoil,smart_P_trefoil	p.M1261I	ENST00000477922.3	37	c.3783		7	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486125	0.26686	.	.	ENSG00000257743	ENST00000477922;ENST00000550494	.	.	.	4.31	4.31	0.51392	.	0.083582	0.51477	D	0.000095	T	0.52338	0.1728	.	.	.	.	.	.	.	.	.	.	.	.	T	0.61855	-0.6977	5	0.32370	T	0.25	.	10.3863	0.44143	0.097:0.0:0.903:0.0	.	.	.	.	I	1229;188	.	ENSP00000367474:M188I	M	+	3	0	RP11-1220K2.2	141522016	1.000000	0.71417	0.930000	0.37139	0.977000	0.68977	2.099000	0.41767	2.366000	0.80165	0.557000	0.71058	ATG	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF		0.393	RP11-1220K2.2-003	PUTATIVE	not_best_in_genome_evidence|basic|appris_principal|exp_conf	protein_coding	ENSG00000257743	protein_coding	OTTHUMT00000351325.3	G		-		141875547	+1	no_errors	ENST00000477922	ensembl	human	putative	74_37	missense	SNP	1.000	T
ACAP1	9744	genome.wustl.edu	37	17	7253505	7253505	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr17:7253505G>T	ENST00000158762.3	+	20	2227	c.2021G>T	c.(2020-2022)aGg>aTg	p.R674M	ACAP1_ENST00000570504.1_5'Flank|KCTD11_ENST00000333751.3_5'Flank|ACAP1_ENST00000571471.1_5'Flank|ACAP1_ENST00000575415.1_5'Flank|RP11-542C16.1_ENST00000572417.1_RNA|ACAP1_ENST00000574499.1_5'Flank	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	674	Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						TCTGAAGGCAGGGACCCTCTG	0.647																																																	0								ENSG00000072818						80.0	82.0	81.0					17																	7253505		2203	4300	6503	ACAP1	SO:0001583	missense	0			-	HGNC	D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.2021G>T	17.37:g.7253505G>T	ENSP00000158762:p.Arg674Met	Somatic	0	76	0.00		0.5284069354479217	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q53XN9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_Pleckstrin_homology,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_ArfGAP,prints_ArfGAP	p.R674M	ENST00000158762.3	37	c.2021	CCDS11101.1	17	.	.	.	.	.	.	.	.	.	.	G	17.27	3.346873	0.61183	.	.	ENSG00000072818	ENST00000158762	T	0.35048	1.33	5.26	-0.543	0.11851	Ankyrin repeat-containing domain (3);	0.341358	0.34959	N	0.003554	T	0.22627	0.0546	L	0.29908	0.895	0.80722	D	1	P	0.36789	0.57	B	0.36885	0.235	T	0.03166	-1.1065	10	0.52906	T	0.07	.	8.0061	0.30325	0.6096:0.0:0.3904:0.0	.	674	Q15027	ACAP1_HUMAN	M	674	ENSP00000158762:R674M	ENSP00000158762:R674M	R	+	2	0	ACAP1	7194229	1.000000	0.71417	0.970000	0.41538	0.967000	0.64934	3.168000	0.50801	0.067000	0.16545	0.448000	0.29417	AGG	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.647	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAP1	protein_coding	OTTHUMT00000220049.4	G	NM_014716	-		7253505	+1	no_errors	ENST00000158762	ensembl	human	known	74_37	missense	SNP	0.953	T
ZNF766	90321	genome.wustl.edu	37	19	52785127	52785127	+	Intron	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:52785127G>T	ENST00000439461.1	+	2	61				ZNF766_ENST00000593612.1_Intron|ZNF766_ENST00000359102.4_Intron|ZNF766_ENST00000599581.1_Intron|MIR643_ENST00000385267.1_RNA|ZNF766_ENST00000600821.1_Intron|CTD-2525I3.5_ENST00000594865.1_RNA	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		TGCTAGCTCAGGTAGATATTG	0.333																																																	0								ENSG00000208002						34.0	29.0	31.0					19																	52785127		1566	3582	5148	MIR643	SO:0001627	intron_variant	0			-	HGNC	AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.19-237G>T	19.37:g.52785127G>T		Somatic	0	40	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B2RNE0|Q7Z326	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439461.1	37	NULL	CCDS46163.1	19																																																																																			-	-		0.333	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR643	protein_coding	OTTHUMT00000462764.1	G	NM_001010851	-		52785127	+1	no_errors	ENST00000385267	ensembl	human	known	74_37	rna	SNP	0.001	T
XIST	7503	genome.wustl.edu	37	X	73070785	73070785	+	lincRNA	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chrX:73070785C>A	ENST00000429829.1	-	0	1803					NR_001564.2				X inactive specific transcript (non-protein coding)																		CCTGGTGTACCGCCCACTGGG	0.532																																																	0								ENSG00000229807						38.0	35.0	36.0					X																	73070785		876	1991	2867	XIST			0			-	HGNC	M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73070785C>A		Somatic	0	41	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			-	-		0.532	XIST-001	KNOWN	basic	lincRNA	XIST	lincRNA	OTTHUMT00000057239.1	C	NR_001564	-		73070785	-1	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	SNP	0.001	A
OR5B12	390191	genome.wustl.edu	37	11	58206903	58206903	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:58206903G>T	ENST00000302572.2	-	1	743	c.722C>A	c.(721-723)tCc>tAc	p.S241Y		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AGTAAGGTGGGAAGCACAAGT	0.428																																																	0								ENSG00000172362						78.0	76.0	77.0					11																	58206903		2201	4295	6496	OR5B12	SO:0001583	missense	0			-	HGNC	AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.722C>A	11.37:g.58206903G>T	ENSP00000306657:p.Ser241Tyr	Somatic	0	50	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B2RNL2|Q6IEV5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.S241Y	ENST00000302572.2	37	c.722	CCDS31551.1	11	.	.	.	.	.	.	.	.	.	.	G	18.34	3.601540	0.66445	.	.	ENSG00000172362	ENST00000302572	T	0.39406	1.08	4.3	4.3	0.51218	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000203	T	0.77691	0.4168	H	0.98629	4.285	0.40428	D	0.979919	D	0.76494	0.999	D	0.73380	0.98	D	0.87693	0.2555	10	0.87932	D	0	5.1583	16.2624	0.82553	0.0:0.0:1.0:0.0	.	241	Q96R08	OR5BC_HUMAN	Y	241	ENSP00000306657:S241Y	ENSP00000306657:S241Y	S	-	2	0	OR5B12	57963479	0.980000	0.34600	1.000000	0.80357	0.639000	0.38242	4.483000	0.60264	2.383000	0.81215	0.462000	0.41574	TCC	-	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM		0.428	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B12	protein_coding	OTTHUMT00000394987.1	G	NM_001004733	-		58206903	-1	no_errors	ENST00000302572	ensembl	human	known	74_37	missense	SNP	1.000	T
TRIML2	205860	genome.wustl.edu	37	4	189012788	189012788	+	Silent	SNP	A	A	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:189012788A>T	ENST00000512729.1	-	7	1277	c.903T>A	c.(901-903)acT>acA	p.T301T	TRIML2_ENST00000326754.3_Silent_p.T326T	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	301	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		AGACCCAGAGAGTCCACTCGG	0.562																																																	0								ENSG00000179046						135.0	150.0	145.0					4																	189012788		2203	4300	6503	TRIML2	SO:0001819	synonymous_variant	0			-	HGNC	AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.903T>A	4.37:g.189012788A>T		Somatic	0	43	0.00		0.5284069354479217	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	18	47.06	B7Z6J6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.T301	ENST00000512729.1	37	c.903	CCDS3850.1	4																																																																																			-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.562	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	protein_coding	OTTHUMT00000359733.1	A	NM_173553	-		189012788	-1	no_errors	ENST00000512729	ensembl	human	known	74_37	silent	SNP	0.000	T
ADAMTS12	81792	genome.wustl.edu	37	5	33561192	33561192	+	Missense_Mutation	SNP	G	G	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:33561192G>C	ENST00000504830.1	-	20	4400	c.4065C>G	c.(4063-4065)gaC>gaG	p.D1355E	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.D1270E	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1355	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TTTTTGCAGGGTCAGGTCTCT	0.567										HNSCC(64;0.19)																																							0								ENSG00000151388						131.0	118.0	122.0					5																	33561192		2203	4300	6503	ADAMTS12	SO:0001583	missense	0			-	HGNC	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4065C>G	5.37:g.33561192G>C	ENSP00000422554:p.Asp1355Glu	Somatic	0	77	0.00		0.5284069354479217	4	33.33	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	29	56.06	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.D1355E	ENST00000504830.1	37	c.4065	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	G	7.890	0.732197	0.15507	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.59638	0.25;0.25	5.4	3.56	0.40772	.	0.239932	0.43416	N	0.000563	T	0.26376	0.0644	N	0.05487	-0.04	0.80722	D	1	B;B	0.25048	0.096;0.117	B;B	0.22601	0.024;0.04	T	0.19095	-1.0316	10	0.02654	T	1	.	4.0046	0.09595	0.169:0.0:0.4784:0.3526	.	1270;1355	P58397-3;P58397	.;ATS12_HUMAN	E	1355;1270	ENSP00000422554:D1355E;ENSP00000344847:D1270E	ENSP00000344847:D1270E	D	-	3	2	ADAMTS12	33596949	0.978000	0.34361	0.999000	0.59377	0.559000	0.35586	0.137000	0.15995	0.604000	0.29930	-0.188000	0.12872	GAC	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.567	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	protein_coding	OTTHUMT00000367164.2	G	NM_030955	-		33561192	-1	no_errors	ENST00000504830	ensembl	human	known	74_37	missense	SNP	0.998	C
KCTD14	65987	genome.wustl.edu	37	11	77727734	77727734	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:77727734C>A	ENST00000353172.5	-	2	717	c.673G>T	c.(673-675)Ggg>Tgg	p.G225W	RP11-7I15.3_ENST00000533697.1_RNA|KCTD14_ENST00000533144.1_Missense_Mutation_p.G195W	NM_001203260.1|NM_001203262.1|NM_001282406.1|NM_023930.3	NP_001190189.1|NP_001190191.1|NP_001269335.1|NP_076419.2	Q9BQ13	KCD14_HUMAN	potassium channel tetramerization domain containing 14	225					protein homooligomerization (GO:0051260)					endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	15	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1e-24)			ACCTTGTACCCCTGGGCCTTA	0.473																																					NSCLC(86;414 1416 18100 32729 49271)|Esophageal Squamous(156;1132 1858 11406 36132 46748)												0								ENSG00000151364						156.0	139.0	145.0					11																	77727734		2200	4292	6492	KCTD14	SO:0001583	missense	0			-	HGNC	BC001062	CCDS8255.2, CCDS60908.1	11q13.4	2013-06-20	2013-06-20		ENSG00000151364	ENSG00000151364			23295	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 14"""			12477932	Standard	NM_023930		Approved	MGC2376	uc001oyw.4	Q9BQ13	OTTHUMG00000150224	ENST00000353172.5:c.673G>T	11.37:g.77727734C>A	ENSP00000316482:p.Gly225Trp	Somatic	0	25	0.00		0.5284069354479217	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	17	15.00	B2R9R8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.G225W	ENST00000353172.5	37	c.673	CCDS8255.2	11	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194276	0.78902	.	.	ENSG00000151364	ENST00000353172;ENST00000533144	T;T	0.73047	-0.71;-0.61	4.49	4.49	0.54785	.	1.191180	0.06106	N	0.666204	D	0.86814	0.6023	M	0.80746	2.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79748	-0.1673	10	0.87932	D	0	.	16.3772	0.83410	0.0:1.0:0.0:0.0	.	225	Q9BQ13	KCD14_HUMAN	W	225;195	ENSP00000316482:G225W;ENSP00000431155:G195W	ENSP00000316482:G225W	G	-	1	0	KCTD14	77405382	1.000000	0.71417	0.991000	0.47740	0.843000	0.47879	6.978000	0.76147	2.344000	0.79699	0.650000	0.86243	GGG	-	NULL		0.473	KCTD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD14	protein_coding	OTTHUMT00000316888.1	C	NM_023930	-		77727734	-1	no_errors	ENST00000353172	ensembl	human	known	74_37	missense	SNP	1.000	A
ODF1	4956	genome.wustl.edu	37	8	103573011	103573037	+	In_Frame_Del	DEL	TGCAACCCCTGCAGCCCCTGCAACCCG	TGCAACCCCTGCAGCCCCTGCAACCCG	-	rs143802899|rs111689913|rs568456031|rs372688769|rs369192995|rs377699584|rs62523271|rs62523272|rs62523273|rs386728348|rs58232162|rs386728346|rs150771034	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	TGCAACCCCTGCAGCCCCTGCAACCCG	TGCAACCCCTGCAGCCCCTGCAACCCG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr8:103573011_103573037delTGCAACCCCTGCAGCCCCTGCAACCCG	ENST00000285402.3	+	2	808_834	c.652_678delTGCAACCCCTGCAGCCCCTGCAACCCG	c.(652-678)tgcaacccctgcagcccctgcaacccgdel	p.CNPCSPCNP218del	ODF1_ENST00000518835.1_In_Frame_Del_p.CNPCSPCNP11del	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	218	C-X-P repeat region.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)		p.C218_P226delCNPCSPCNP(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			ctgcagcccctgcaacccctgcagcccctgcaacccgtgcagcccAT	0.542														1567	0.312899	0.2731	0.4193	5008	,	,		21683	0.3244		0.2614	False		,,,				2504	0.3323																1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000155087																																			ODF1	SO:0001651	inframe_deletion	0				HGNC	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.652_678delTGCAACCCCTGCAGCCCCTGCAACCCG	8.37:g.103573011_103573037delTGCAACCCCTGCAGCCCCTGCAACCCG	ENSP00000285402:p.Cys218_Pro226del	Somatic	NA	NA	NA		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q3SX72	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom	p.NPCSPCNPC219in_frame_del	ENST00000285402.3	37	c.652_678	CCDS6293.1	8																																																																																			-	NULL		0.542	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODF1	protein_coding	OTTHUMT00000379884.1	TGCAACCCCTGCAGCCCCTGCAACCCG				103573037	+1	no_errors	ENST00000285402	ensembl	human	known	74_37	in_frame_del	DEL	0.995:0.998:0.993:0.606:0.498:0.829:0.957:0.993:0.985:0.985:0.958:0.001:0.001:0.001:0.728:0.987:0.994:0.989:0.990:0.972:0.003:0.001:0.000:0.002:0.891:0.887:0.486	-
SGK223	157285	genome.wustl.edu	37	8	8176387	8176388	+	In_Frame_Ins	INS	-	-	GGGGCG	rs143409664|rs369009941|rs71217287		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr8:8176387_8176388insGGGGCG	ENST00000520004.1	-	6	3761_3762	c.3497_3498insCGCCCC	c.(3496-3498)ccg>ccCGCCCCg	p.1166_1166P>PAP	SGK223_ENST00000330777.4_In_Frame_Ins_p.1166_1166P>PAP			Q86YV5	SG223_HUMAN		1170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										gggcgggagccggggcgggggc	0.782																																					GBM(34;731 755 10259 33573 33867)												0								ENSG00000182319			1183,1443		406,371,536						-9.8	0.0		dbSNP_134	4	2724,3170		936,852,1159	no	coding	SGK223	NM_001080826.1		1342,1223,1695	A1A1,A1R,RR		46.2165,45.0495,45.8568				3907,4613				SGK223	SO:0001652	inframe_insertion	0				Uniprot_gn																												ENST00000520004.1:c.3492_3497dupCGCCCC	8.37:g.8176388_8176393dupGGGGCG	ENSP00000428054:p.AlaPro1170dup	Somatic	NA	NA	NA		0.5284069354479217	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8N3N5	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.1170in_frame_insPA	ENST00000520004.1	37	c.3498_3497	CCDS43706.1	8																																																																																			-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom		0.782	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	protein_coding	OTTHUMT00000374864.1	-				8176388	-1	no_errors	ENST00000330777	ensembl	human	known	74_37	in_frame_ins	INS	0.000:0.034	GGGGCG
ZNF555	148254	genome.wustl.edu	37	19	2852664	2852664	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:2852664G>T	ENST00000334241.4	+	4	739	c.601G>T	c.(601-603)Gtg>Ttg	p.V201L	ZNF555_ENST00000591539.1_Missense_Mutation_p.V200L|AC006130.3_ENST00000589365.1_RNA	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	201					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGACCCTATGTGTGTAAATT	0.463																																																	0								ENSG00000186300						139.0	119.0	126.0					19																	2852664		2203	4300	6503	ZNF555	SO:0001583	missense	0			-	HGNC	AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.601G>T	19.37:g.2852664G>T	ENSP00000334853:p.Val201Leu	Somatic	0	28	0.00		0.5284069354479217	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V201L	ENST00000334241.4	37	c.601	CCDS12096.1	19	.	.	.	.	.	.	.	.	.	.	G	11.35	1.613311	0.28712	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.27890	1.64	3.4	0.0812	0.14424	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18923	0.0454	L	0.28556	0.865	0.09310	N	1	B;B	0.18013	0.025;0.011	B;B	0.19666	0.026;0.016	T	0.29488	-1.0010	9	0.72032	D	0.01	.	2.5508	0.04748	0.3835:0.0:0.3974:0.2191	.	201;200	Q8NEP9;A8KA89	ZN555_HUMAN;.	L	201;200	ENSP00000334853:V201L	ENSP00000334853:V201L	V	+	1	0	ZNF555	2803664	0.000000	0.05858	0.000000	0.03702	0.981000	0.71138	-0.810000	0.04505	0.264000	0.21851	0.561000	0.74099	GTG	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.463	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF555	protein_coding	OTTHUMT00000451637.3	G	NM_152791	-		2852664	+1	no_errors	ENST00000334241	ensembl	human	known	74_37	missense	SNP	0.000	T
STAC2	342667	genome.wustl.edu	37	17	37373336	37373336	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr17:37373336C>T	ENST00000333461.5	-	3	857	c.488G>A	c.(487-489)gGc>gAc	p.G163D		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	163					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						CACCGTCTTGCCTGGGCATTG	0.567																																																	0								ENSG00000141750						62.0	56.0	58.0					17																	37373336		2203	4300	6503	STAC2	SO:0001583	missense	0			-	HGNC	AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.488G>A	17.37:g.37373336C>T	ENSP00000327509:p.Gly163Asp	Somatic	0	19	0.00		0.5284069354479217	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	Q32MA3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_2,pfam_SH3_domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_SH3_domain,prints_p67phox	p.G163D	ENST00000333461.5	37	c.488	CCDS11335.1	17	.	.	.	.	.	.	.	.	.	.	c	23.8	4.454185	0.84209	.	.	ENSG00000141750	ENST00000333461	D	0.83506	-1.73	5.18	4.19	0.49359	.	0.115599	0.64402	D	0.000020	D	0.89410	0.6707	M	0.89030	3	0.46396	D	0.99902	D	0.55800	0.973	P	0.53035	0.716	D	0.91027	0.4861	10	0.87932	D	0	0.2709	13.5752	0.61870	0.173:0.827:0.0:0.0	.	163	Q6ZMT1	STAC2_HUMAN	D	163	ENSP00000327509:G163D	ENSP00000327509:G163D	G	-	2	0	STAC2	34626862	1.000000	0.71417	0.977000	0.42913	0.919000	0.55068	5.069000	0.64370	1.108000	0.41662	0.491000	0.48974	GGC	-	NULL		0.567	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC2	protein_coding	OTTHUMT00000444533.2	C	NM_198993	-		37373336	-1	no_errors	ENST00000333461	ensembl	human	known	74_37	missense	SNP	1.000	T
GRIN2A	2903	genome.wustl.edu	37	16	9923461	9923461	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:9923461C>A	ENST00000396573.2	-	10	2135	c.1826G>T	c.(1825-1827)tGg>tTg	p.W609L	GRIN2A_ENST00000396575.2_Missense_Mutation_p.W609L|GRIN2A_ENST00000404927.2_Missense_Mutation_p.W609L|GRIN2A_ENST00000562109.1_Missense_Mutation_p.W609L|GRIN2A_ENST00000535259.1_Missense_Mutation_p.W452L|GRIN2A_ENST00000330684.3_Missense_Mutation_p.W609L	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	609					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CACCAGGCCCCAAAGAAGCCA	0.453																																																	0								ENSG00000183454						71.0	66.0	68.0					16																	9923461		2197	4300	6497	GRIN2A	SO:0001583	missense	0			-	HGNC		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1826G>T	16.37:g.9923461C>A	ENSP00000379818:p.Trp609Leu	Somatic	0	60	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	O00669|Q17RZ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.W609L	ENST00000396573.2	37	c.1826	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	C	27.7	4.853885	0.91355	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.27	5.27	0.74061	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.60919	0.2306	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.97110	0.998;1.0;0.995	T	0.58239	-0.7671	9	.	.	.	.	17.9016	0.88906	0.0:1.0:0.0:0.0	.	452;609;609	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	L	609;609;452;609;609	ENSP00000379818:W609L;ENSP00000385872:W609L;ENSP00000441572:W452L;ENSP00000332549:W609L;ENSP00000379820:W609L	.	W	-	2	0	GRIN2A	9830962	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.681000	0.84073	2.465000	0.83290	0.655000	0.94253	TGG	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,prints_NMDA_rcpt		0.453	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	protein_coding	OTTHUMT00000251930.3	C		-		9923461	-1	no_errors	ENST00000330684	ensembl	human	known	74_37	missense	SNP	1.000	A
SNORA11	677799	genome.wustl.edu	37	14	70270922	70270922	+	RNA	DEL	T	T	-	rs566317626		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr14:70270922delT	ENST00000408133.1	-	0	126									small nucleolar RNA, H/ACA box 11																		ATGGATTCTCTTTTTTTTTTT	0.353																																																	0								ENSG00000221060																																			SNORA11			0				RFAM	AM055729		Xp11.21	2013-09-05			ENSG00000221716	ENSG00000221716		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32599	non-coding RNA	RNA, small nucleolar	"""small nucleolar RNA, H/ACA box 11A"""	300662				16361266, 16381836	Standard	NR_002953		Approved	U107, SNORA11A	uc021ptl.1				14.37:g.70270922delT		Somatic	0	12	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	8	20.00		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408133.1	37	NULL		14																																																																																			-	-		0.353	SNORA11.1-201	NOVEL	basic	snoRNA	ENSG00000221060	snoRNA		T	NR_002953			70270922	-1	no_errors	ENST00000408133	ensembl	human	novel	74_37	rna	DEL	0.003	-
TCAIM	285343	genome.wustl.edu	37	3	44442725	44442725	+	Silent	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr3:44442725C>A	ENST00000342649.4	+	10	1576	c.1149C>A	c.(1147-1149)ctC>ctA	p.L383L	TCAIM_ENST00000417237.1_Silent_p.L383L	NM_001282913.1|NM_173826.3	NP_001269842.1|NP_776187.2	Q8N3R3	TCAIM_HUMAN	T cell activation inhibitor, mitochondrial	383						mitochondrion (GO:0005739)											TGCATGAACTCGGGCATTTTA	0.408																																																	0								ENSG00000179152						144.0	137.0	140.0					3																	44442725		2203	4300	6503	TCAIM	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2712.1, CCDS43076.1	3p21.33-p21.32	2012-08-22	2012-08-22	2012-08-22	ENSG00000179152	ENSG00000179152			25241	protein-coding gene	gene with protein product	"""tolerance associated gene-1"""		"""chromosome 3 open reading frame 23"""	C3orf23		12477932	Standard	NM_001029840		Approved	DKFZp313N0621, TOAG-1	uc003cnd.4	Q8N3R3	OTTHUMG00000133049	ENST00000342649.4:c.1149C>A	3.37:g.44442725C>A		Somatic	0	40	0.00		0.5284069354479217	25	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	A8K9P1|Q0P5T9|Q495R1|Q495R3|Q4G0M4|Q6GMU8	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L383	ENST00000342649.4	37	c.1149	CCDS2712.1	3																																																																																			-	NULL		0.408	TCAIM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCAIM	protein_coding	OTTHUMT00000256655.2	C	NM_173826	-		44442725	+1	no_errors	ENST00000342649	ensembl	human	known	74_37	silent	SNP	0.316	A
NEFL	4747	genome.wustl.edu	37	8	24810424	24810426	+	RNA	DEL	CTT	CTT	-	rs570816238		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr8:24810424_24810426delCTT	ENST00000221169.5	-	0	2124_2126							P07196	NFL_HUMAN	neurofilament, light polypeptide						anterograde axon cargo transport (GO:0008089)|axon transport of mitochondrion (GO:0019896)|cell death (GO:0008219)|intermediate filament organization (GO:0045109)|locomotion (GO:0040011)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron apoptotic process (GO:0043524)|neurofilament bundle assembly (GO:0033693)|neuromuscular process controlling balance (GO:0050885)|neuron projection morphogenesis (GO:0048812)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of axonogenesis (GO:0050772)|protein polymerization (GO:0051258)|regulation of axon diameter (GO:0031133)|response to corticosterone (GO:0051412)|response to peptide hormone (GO:0043434)|response to toxic substance (GO:0009636)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|neurofilament (GO:0005883)	identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|protein C-terminus binding (GO:0008022)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)	21		Ovarian(32;0.00965)|Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		ccttcacctccttcttcttcttc	0.414																																																	0								ENSG00000104725																																			NEFL			0				HGNC		CCDS75712.1	8p21.2	2014-09-17	2008-09-19		ENSG00000104725	ENSG00000277586		"""Intermediate filaments type IV"""	7739	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 110"""	162280	"""neurofilament, light polypeptide 68kDa"""			17620486, 3145240	Standard	NM_006158		Approved	NFL, CMT1F, CMT2E, NF68, PPP1R110	uc003xee.4	P07196	OTTHUMG00000134284		8.37:g.24810433_24810435delCTT		Somatic	0	30	0.00		0.5284069354479217	108	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	32	13.51	B9ZVN2|Q16154|Q8IU72	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000221169.5	37	NULL		8																																																																																			-	-		0.414	NEFL-001	KNOWN	sequence_error|basic	processed_transcript	NEFL	processed_transcript	OTTHUMT00000258943.4	CTT	NM_006158			24810426	-1	no_errors	ENST00000221169	ensembl	human	known	74_37	rna	DEL	1.000:1.000:1.000	-
PSG8	440533	genome.wustl.edu	37	19	43257095	43257096	+	IGR	INS	-	-	GGTTGAGATGGTTGAGA	rs377417293	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:43257095_43257096insGGTTGAGATGGTTGAGA	ENST00000306511.4	-	0	1441				PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000404209.4_3'UTR|PSG8_ENST00000401467.2_3'UTR|PSG8_ENST00000406636.3_3'UTR	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8							extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GAGATGTTATGTAAAAGTTTGG	0.416														372	0.0742812	0.093	0.1023	5008	,	,		21813	0.0198		0.0656	False		,,,				2504	0.0941																0								ENSG00000124467																																			PSG8	SO:0001628	intergenic_variant	0				HGNC	M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118		19.37:g.43257095_43257096insGGTTGAGATGGTTGAGA		Somatic	NA	NA	NA		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000306511.4	37	NULL	CCDS33037.1	19																																																																																			-	-		0.416	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	protein_coding	OTTHUMT00000464526.1	-				43257096	-1	no_errors	ENST00000600709	ensembl	human	known	74_37	rna	INS	0.099:0.098	GGTTGAGATGGTTGAGA
REL	5966	genome.wustl.edu	37	2	61153076	61153076	+	3'UTR	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr2:61153076C>A	ENST00000295025.8	+	0	5586				RP11-373L24.1_ENST00000589496.2_RNA	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog						cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			TCTGCTACCTCTGTGTGTAGA	0.323			A		Hodgkin Lymphoma																																			Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	0								ENSG00000267520																																			RP11-373L24.1	SO:0001624	3_prime_UTR_variant	0			-	Clone_based_vega_gene	M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.*3406C>A	2.37:g.61153076C>A		Somatic	0	46	0.00		0.5284069354479217	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	40	11.11	Q17RU2|Q2PNZ7|Q6LDY0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000295025.8	37	NULL	CCDS1864.1	2																																																																																			-	-		0.323	REL-001	KNOWN	basic|CCDS	protein_coding	ENSG00000267520	protein_coding	OTTHUMT00000251576.3	C	NM_002908	-		61153076	+1	no_errors	ENST00000589496	ensembl	human	known	74_37	rna	SNP	0.413	A
SMYD4	114826	genome.wustl.edu	37	17	1686764	1686764	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr17:1686764G>T	ENST00000305513.7	-	9	2194	c.2027C>A	c.(2026-2028)gCt>gAt	p.A676D		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	676							metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						CCGCTGAACAGCTCGCTCTGT	0.602																																																	0								ENSG00000186532						17.0	18.0	18.0					17																	1686764		2203	4300	6503	SMYD4	SO:0001583	missense	0			-	HGNC	AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.2027C>A	17.37:g.1686764G>T	ENSP00000304360:p.Ala676Asp	Somatic	0	90	0.00		0.5284069354479217	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.A676D	ENST00000305513.7	37	c.2027	CCDS11013.1	17	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451826	0.84209	.	.	ENSG00000186532	ENST00000305513	D	0.89617	-2.54	5.75	5.75	0.90469	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.94716	0.8295	M	0.83483	2.645	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.94948	0.8097	10	0.72032	D	0.01	-17.057	17.113	0.86681	0.0:0.0:1.0:0.0	.	676	Q8IYR2	SMYD4_HUMAN	D	676	ENSP00000304360:A676D	ENSP00000304360:A676D	A	-	2	0	SMYD4	1633514	1.000000	0.71417	0.730000	0.30809	0.005000	0.04900	6.462000	0.73526	2.724000	0.93272	0.555000	0.69702	GCT	-	NULL		0.602	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	protein_coding	OTTHUMT00000207108.4	G	XM_056082	-		1686764	-1	no_errors	ENST00000305513	ensembl	human	known	74_37	missense	SNP	0.973	T
UPF2	26019	genome.wustl.edu	37	10	12070987	12070987	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr10:12070987G>T	ENST00000356352.2	-	2	1375	c.902C>A	c.(901-903)tCc>tAc	p.S301Y	UPF2_ENST00000357604.5_Missense_Mutation_p.S301Y|UPF2_ENST00000397053.2_Missense_Mutation_p.S301Y			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	301	MIF4G 1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				ATGAGTGTGGGACTCCCGATC	0.378																																																	0								ENSG00000151461						82.0	79.0	80.0					10																	12070987		2203	4300	6503	UPF2	SO:0001583	missense	0			-	HGNC	AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.902C>A	10.37:g.12070987G>T	ENSP00000348708:p.Ser301Tyr	Somatic	0	43	0.00		0.5284069354479217	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.S301Y	ENST00000356352.2	37	c.902	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147489	0.57151	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000379172;ENST00000397053;ENST00000313977	T;T;T	0.25085	1.82;1.82;1.82	6.17	6.17	0.99709	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.057690	0.64402	D	0.000001	T	0.31796	0.0808	N	0.24115	0.695	0.58432	D	0.999999	D;P	0.54207	0.965;0.954	P;P	0.51135	0.66;0.478	T	0.01561	-1.1324	10	0.62326	D	0.03	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	271;301	Q9HAU5-2;Q9HAU5	.;RENT2_HUMAN	Y	301;301;271;301;271	ENSP00000348708:S301Y;ENSP00000350221:S301Y;ENSP00000380244:S301Y	ENSP00000313617:S271Y	S	-	2	0	UPF2	12110993	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.945000	0.87732	2.941000	0.99782	0.655000	0.94253	TCC	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3		0.378	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	protein_coding	OTTHUMT00000046783.1	G		-		12070987	-1	no_errors	ENST00000356352	ensembl	human	known	74_37	missense	SNP	1.000	T
R3HCC1L	27291	genome.wustl.edu	37	10	99967894	99967894	+	Missense_Mutation	SNP	G	G	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr10:99967894G>A	ENST00000298999.3	+	5	326	c.23G>A	c.(22-24)tGc>tAc	p.C8Y	R3HCC1L_ENST00000314594.5_5'UTR|R3HCC1L_ENST00000370584.3_Missense_Mutation_p.C8Y|R3HCC1L_ENST00000370586.2_Intron	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	8	EJC-binding motif; may mediate interaction with the EJC.						nucleotide binding (GO:0000166)										TCAGAGAGATGCAGAGTTAGA	0.408																																																	0								ENSG00000166024						37.0	34.0	35.0					10																	99967894		2203	4300	6503	R3HCC1L	SO:0001583	missense	0			-	HGNC	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.23G>A	10.37:g.99967894G>A	ENSP00000298999:p.Cys8Tyr	Somatic	0	45	0.00		0.5284069354479217	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C8Y	ENST00000298999.3	37	c.23	CCDS31267.1	10	.	.	.	.	.	.	.	.	.	.	G	16.62	3.175218	0.57692	.	.	ENSG00000166024	ENST00000370584;ENST00000538495;ENST00000298999	T;T	0.09350	2.99;2.99	6.11	4.25	0.50352	.	0.182539	0.39759	N	0.001269	T	0.27349	0.0671	M	0.71581	2.175	0.80722	D	1	D;D	0.63880	0.986;0.993	P;D	0.63113	0.858;0.911	T	0.01018	-1.1479	10	0.87932	D	0	-1.1385	10.2404	0.43308	0.0:0.1471:0.6998:0.1531	.	8;8	Q7Z5L2;Q7Z5L2-2	GIDRP_HUMAN;.	Y	8	ENSP00000359616:C8Y;ENSP00000298999:C8Y	ENSP00000298999:C8Y	C	+	2	0	C10orf28	99957884	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	3.814000	0.55643	0.901000	0.36495	-0.169000	0.13324	TGC	-	NULL		0.408	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	R3HCC1L	protein_coding	OTTHUMT00000049764.1	G	NM_014472	-		99967894	+1	no_errors	ENST00000370584	ensembl	human	known	74_37	missense	SNP	1.000	A
PDLIM3	27295	genome.wustl.edu	37	4	186435435	186435435	+	Silent	SNP	C	C	A	rs138670107	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:186435435C>A	ENST00000284770.5	-	4	460	c.387G>T	c.(385-387)ccG>ccT	p.P129P	PDLIM3_ENST00000284771.6_Intron|PDLIM3_ENST00000284767.5_3'UTR	NM_014476.5	NP_055291.2	Q53GG5	PDLI3_HUMAN	PDZ and LIM domain 3	129					actin filament organization (GO:0007015)|heart development (GO:0007507)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	structural constituent of muscle (GO:0008307)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(1)|lung(5)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		all_lung(41;1.03e-13)|Lung NSC(41;2.49e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00826)|Renal(120;0.00988)|Prostate(90;0.00996)|Colorectal(36;0.0161)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.4e-10)|BRCA - Breast invasive adenocarcinoma(30;8.64e-05)|GBM - Glioblastoma multiforme(59;0.000167)|STAD - Stomach adenocarcinoma(60;0.000828)|LUSC - Lung squamous cell carcinoma(40;0.00984)|COAD - Colon adenocarcinoma(29;0.0115)|READ - Rectum adenocarcinoma(43;0.171)		TGCTTCGGCCCGGGATCACGA	0.453																																																	0								ENSG00000154553						102.0	97.0	99.0					4																	186435435		2203	4300	6503	PDLIM3	SO:0001819	synonymous_variant	0			-	HGNC	AF002280	CCDS3844.1, CCDS47172.1, CCDS75218.1, CCDS75219.1	4q35	2014-09-17			ENSG00000154553	ENSG00000154553			20767	protein-coding gene	gene with protein product		605889				10063829, 8828038	Standard	NM_014476		Approved	ALP	uc003ixw.4	Q53GG5	OTTHUMG00000160412	ENST00000284770.5:c.387G>T	4.37:g.186435435C>A		Somatic	0	45	0.00		0.5284069354479217	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	B2R866|O43590|O60439|O60440|Q8N6Y6|Q9BVP4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,pfam_Znf_LIM,superfamily_PDZ,smart_PDZ,smart_ZASP,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.P129	ENST00000284770.5	37	c.387	CCDS3844.1	4																																																																																			-	NULL		0.453	PDLIM3-001	KNOWN	basic|CCDS	protein_coding	PDLIM3	protein_coding	OTTHUMT00000360499.2	C	NM_014476	-		186435435	-1	no_errors	ENST00000284770	ensembl	human	known	74_37	silent	SNP	1.000	A
LENG8	114823	genome.wustl.edu	37	19	54967914	54967914	+	Silent	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:54967914C>A	ENST00000326764.5	+	11	2024	c.1545C>A	c.(1543-1545)cgC>cgA	p.R515R	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	478										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		GGGCAGCCCGCTTCCAGCACG	0.677																																																	0								ENSG00000167615						24.0	27.0	26.0					19																	54967914		2200	4296	6496	LENG8	SO:0001819	synonymous_variant	0			-	HGNC	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.1545C>A	19.37:g.54967914C>A		Somatic	0	51	0.00		0.5284069354479217	101	50.97	105	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	25	52.83	B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.R515	ENST00000326764.5	37	c.1545	CCDS12894.1	19																																																																																			-	NULL		0.677	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG8	protein_coding	OTTHUMT00000140523.2	C	NM_052925	-		54967914	+1	no_errors	ENST00000326764	ensembl	human	known	74_37	silent	SNP	1.000	A
SNORA11	677799	genome.wustl.edu	37	14	70270921	70270922	+	RNA	INS	-	-	T	rs566317626|rs200703304		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr14:70270921_70270922insT	ENST00000408133.1	-	0	126_127									small nucleolar RNA, H/ACA box 11																		CATGGATTCTCTTTTTTTTTTT	0.351																																																	0								ENSG00000221060																																			SNORA11			0				RFAM	AM055729		Xp11.21	2013-09-05			ENSG00000221716	ENSG00000221716		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32599	non-coding RNA	RNA, small nucleolar	"""small nucleolar RNA, H/ACA box 11A"""	300662				16361266, 16381836	Standard	NR_002953		Approved	U107, SNORA11A	uc021ptl.1				14.37:g.70270932_70270932dupT		Somatic	0	12	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	7	30.00		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408133.1	37	NULL		14																																																																																			-	-		0.351	SNORA11.1-201	NOVEL	basic	snoRNA	ENSG00000221060	snoRNA		-	NR_002953			70270922	-1	no_errors	ENST00000408133	ensembl	human	novel	74_37	rna	INS	0.001:0.003	T
NCAPG	64151	genome.wustl.edu	37	4	17814000	17814000	+	Nonsense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:17814000G>T	ENST00000251496.2	+	2	444	c.268G>T	c.(268-270)Gag>Tag	p.E90*	DCAF16_ENST00000382247.1_5'Flank|DCAF16_ENST00000507768.1_5'Flank|DCAF16_ENST00000536863.1_5'Flank	NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	90	Poly-Glu.				mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		TGATGAGGAAGAGGAAGATGG	0.368																																																	0								ENSG00000109805						95.0	95.0	95.0					4																	17814000		2203	4300	6503	NCAPG	SO:0001587	stop_gained	0			-	HGNC	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.268G>T	4.37:g.17814000G>T	ENSP00000251496:p.Glu90*	Somatic	0	56	0.00		0.5284069354479217	36	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	53	8.62	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.E90*	ENST00000251496.2	37	c.268	CCDS3424.1	4	.	.	.	.	.	.	.	.	.	.	G	27.2	4.805557	0.90623	.	.	ENSG00000109805	ENST00000251496	.	.	.	5.28	5.28	0.74379	.	0.184835	0.45867	D	0.000321	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-5.4881	18.9302	0.92561	0.0:0.0:1.0:0.0	.	.	.	.	X	90	.	ENSP00000251496:E90X	E	+	1	0	NCAPG	17423098	1.000000	0.71417	0.519000	0.27824	0.255000	0.26057	9.280000	0.95786	2.469000	0.83416	0.655000	0.94253	GAG	-	superfamily_ARM-type_fold		0.368	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPG	protein_coding	OTTHUMT00000250375.1	G	NM_022346	-		17814000	+1	no_errors	ENST00000251496	ensembl	human	known	74_37	nonsense	SNP	1.000	T
PLA2G2A	5320	genome.wustl.edu	37	1	20305466	20305467	+	Intron	INS	-	-	CACGCACACACA	rs3061293|rs376364585|rs562663581|rs71857665|rs58884069|rs531707871	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:20305466_20305467insCACGCACACACA	ENST00000375111.3	-	3	166				PLA2G2A_ENST00000400520.3_Intron|PLA2G2A_ENST00000496748.1_Intron	NM_000300.3|NM_001161727.1	NP_000291.1|NP_001155199.1	P14555	PA2GA_HUMAN	phospholipase A2, group IIA (platelets, synovial fluid)						defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of epithelial cell proliferation (GO:0050680)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidic acid metabolic process (GO:0046473)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|small molecule metabolic process (GO:0044281)|somatic stem cell maintenance (GO:0035019)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|phospholipase A2 activity (GO:0004623)|phospholipid binding (GO:0005543)			central_nervous_system(1)|lung(6)|prostate(1)|stomach(1)	9		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000138)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.00032)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Diclofenac(DB00586)|Ginkgo biloba(DB01381)|Indomethacin(DB00328)|Suramin(DB04786)	CTCCAGCAATGcacacacacac	0.554														572	0.114217	0.0083	0.1311	5008	,	,		19112	0.2113		0.1103	False		,,,				2504	0.1493																0								ENSG00000188257																																			PLA2G2A	SO:0001627	intron_variant	0				HGNC	BC005919	CCDS201.1	1p35	2008-09-19			ENSG00000188257	ENSG00000188257	3.1.1.4		9031	protein-coding gene	gene with protein product		172411		PLA2B, PLA2L		8838795	Standard	NM_000300		Approved		uc010odb.2	P14555	OTTHUMG00000002699	ENST00000375111.3:c.106-94->TGTGTGTGCGTG	1.37:g.20305466_20305467insCACGCACACACA		Somatic	NA	NA	NA		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A8K5I7|Q6DN24|Q6IBD9|Q9UCD2	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000375111.3	37	NULL	CCDS201.1	1																																																																																			-	-		0.554	PLA2G2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2A	protein_coding	OTTHUMT00000007675.1	-	NM_000300			20305467	-1	no_errors	ENST00000461140	ensembl	human	known	74_37	rna	INS	0.000:0.006	CACGCACACACA
DVL2	1856	genome.wustl.edu	37	17	7131008	7131008	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr17:7131008C>A	ENST00000005340.5	-	11	1479	c.1197G>T	c.(1195-1197)atG>atT	p.M399I	DVL2_ENST00000575458.1_Missense_Mutation_p.M393I|DVL2_ENST00000574642.1_5'Flank	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	399					canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						TAATGGTGCTCATGGAGGAGG	0.602																																																	0								ENSG00000004975						65.0	64.0	64.0					17																	7131008		2203	4300	6503	DVL2	SO:0001583	missense	0			-	HGNC	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.1197G>T	17.37:g.7131008C>A	ENSP00000005340:p.Met399Ile	Somatic	0	57	0.00		0.5284069354479217	88	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	D3DTN3|Q53XM0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dishevelled_C-dom,pfam_DIX,pfam_Dishevelled_protein_dom,pfam_PDZ,pfam_DEP_dom,superfamily_PDZ,smart_DIX,smart_PDZ,smart_DEP_dom,pfscan_DEP_dom,pfscan_DIX,pfscan_PDZ,prints_Dishevelled_2,prints_Dishevelled_fam	p.M399I	ENST00000005340.5	37	c.1197	CCDS11091.1	17	.	.	.	.	.	.	.	.	.	.	C	12.12	1.841440	0.32513	.	.	ENSG00000004975	ENST00000005340	T	0.03951	3.75	4.65	4.65	0.58169	.	0.060098	0.64402	D	0.000002	T	0.09730	0.0239	M	0.82323	2.585	0.42291	D	0.992137	B;B	0.31241	0.315;0.035	B;B	0.29942	0.109;0.008	T	0.09164	-1.0687	10	0.22706	T	0.39	-17.5283	15.0392	0.71774	0.0:1.0:0.0:0.0	.	393;399	B4DLQ0;O14641	.;DVL2_HUMAN	I	399	ENSP00000005340:M399I	ENSP00000005340:M399I	M	-	3	0	DVL2	7071732	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.277000	0.58939	2.412000	0.81896	0.563000	0.77884	ATG	-	NULL		0.602	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DVL2	protein_coding	OTTHUMT00000219999.2	C	NM_004422	-		7131008	-1	no_errors	ENST00000005340	ensembl	human	known	74_37	missense	SNP	1.000	A
AKAP11	11215	genome.wustl.edu	37	13	42891697	42891697	+	Missense_Mutation	SNP	C	C	T	rs529206918		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr13:42891697C>T	ENST00000025301.2	+	12	5613	c.5438C>T	c.(5437-5439)aCg>aTg	p.T1813M		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1813					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		CTGCTAATTACGAATATTGAC	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		19758	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000023516						125.0	115.0	119.0					13																	42891697		2203	4300	6503	AKAP11	SO:0001583	missense	0			-	HGNC	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.5438C>T	13.37:g.42891697C>T	ENSP00000025301:p.Thr1813Met	Somatic	0	47	0.00		0.5284069354479217	20	9.09	2	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	46	13.21	O75124|Q9NUK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.T1813M	ENST00000025301.2	37	c.5438	CCDS9383.1	13	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495713	0.26774	.	.	ENSG00000023516	ENST00000025301	T	0.14022	2.54	5.79	2.67	0.31697	.	0.540943	0.18111	N	0.151344	T	0.06508	0.0167	L	0.27053	0.805	0.09310	N	1	P	0.38167	0.621	B	0.24006	0.05	T	0.30909	-0.9962	10	0.44086	T	0.13	.	4.7101	0.12868	0.0:0.4758:0.164:0.3601	.	1813	Q9UKA4	AKA11_HUMAN	M	1813	ENSP00000025301:T1813M	ENSP00000025301:T1813M	T	+	2	0	AKAP11	41789697	0.001000	0.12720	0.015000	0.15790	0.989000	0.77384	0.562000	0.23531	0.769000	0.33313	0.557000	0.71058	ACG	-	NULL		0.378	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP11	protein_coding	OTTHUMT00000044700.2	C	NM_016248	-		42891697	+1	no_errors	ENST00000025301	ensembl	human	known	74_37	missense	SNP	0.000	T
GLS2	27165	genome.wustl.edu	37	12	56868879	56868879	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr12:56868879C>A	ENST00000311966.4	-	10	1223	c.945G>T	c.(943-945)aaG>aaT	p.K315N	GLS2_ENST00000476991.1_5'UTR	NM_013267.2	NP_037399.2	Q9UI32	GLSL_HUMAN	glutaminase 2 (liver, mitochondrial)	315					cellular amino acid biosynthetic process (GO:0008652)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate secretion (GO:0014047)|glutamine metabolic process (GO:0006541)|neurotransmitter secretion (GO:0007269)|reactive oxygen species metabolic process (GO:0072593)|regulation of apoptotic process (GO:0042981)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	13					L-Glutamine(DB00130)	CCCCTGTTTCCTTCTCTGACT	0.473																																																	0								ENSG00000135423						143.0	151.0	148.0					12																	56868879		2203	4300	6503	GLS2	SO:0001583	missense	0			-	HGNC		CCDS8921.1, CCDS73482.1	12q13	2013-01-10			ENSG00000135423	ENSG00000135423		"""Ankyrin repeat domain containing"""	29570	protein-coding gene	gene with protein product		606365				11130979, 10620514	Standard	NM_013267		Approved	GA, GLS, LGA, hLGA	uc001slj.3	Q9UI32	OTTHUMG00000140379	ENST00000311966.4:c.945G>T	12.37:g.56868879C>A	ENSP00000310447:p.Lys315Asn	Somatic	0	30	0.00		0.5284069354479217	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	38	9.52	B7Z8Q9|Q8IX91|Q9NYY2|Q9UI31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glutaminase,pfam_Ankyrin_rpt,superfamily_Beta-lactam/transpept-like,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_Glutaminase	p.K315N	ENST00000311966.4	37	c.945	CCDS8921.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.90|18.90	3.720699|3.720699	0.68959|0.68959	.|.	.|.	ENSG00000135423|ENSG00000135423	ENST00000311966|ENST00000461077	T|.	0.43294|.	0.95|.	5.03|5.03	4.12|4.12	0.48240|0.48240	Beta-lactamase/transpeptidase-like (1);|.	0.099070|.	0.64402|.	D|.	0.000002|.	T|T	0.68622|0.68622	0.3021|0.3021	M|M	0.81942|0.81942	2.565|2.565	0.80722|0.80722	D|D	1|1	P|.	0.48764|.	0.915|.	P|.	0.58266|.	0.836|.	T|T	0.71988|0.71988	-0.4426|-0.4426	10|6	0.66056|0.87932	D|D	0.02|0	-19.3872|-19.3872	7.3719|7.3719	0.26806|0.26806	0.0:0.7632:0.0:0.2368|0.0:0.7632:0.0:0.2368	.|.	315|.	Q9UI32|.	GLSL_HUMAN|.	N|M	315|171	ENSP00000310447:K315N|.	ENSP00000310447:K315N|ENSP00000417244:R171M	K|R	-|-	3|2	2|0	GLS2|GLS2	55155146|55155146	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.347000|1.347000	0.33975|0.33975	2.499000|2.499000	0.84300|0.84300	0.655000|0.655000	0.94253|0.94253	AAG|AGG	-	pfam_Glutaminase,superfamily_Beta-lactam/transpept-like,tigrfam_Glutaminase		0.473	GLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLS2	protein_coding	OTTHUMT00000277113.1	C	NM_013267	-		56868879	-1	no_errors	ENST00000311966	ensembl	human	known	74_37	missense	SNP	1.000	A
SULT1B1	27284	genome.wustl.edu	37	4	70620481	70620481	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:70620481G>T	ENST00000310613.3	-	3	481	c.184C>A	c.(184-186)Cta>Ata	p.L62I		NM_014465.3	NP_055280.2	O43704	ST1B1_HUMAN	sulfotransferase family, cytosolic, 1B, member 1	62					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|cellular biogenic amine metabolic process (GO:0006576)|epithelial cell differentiation (GO:0030855)|flavonoid metabolic process (GO:0009812)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|thyroid hormone metabolic process (GO:0042403)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|sulfotransferase activity (GO:0008146)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(14)|prostate(1)|upper_aerodigestive_tract(1)	24						CCATCATTTAGAATCATGTCT	0.338																																																	0								ENSG00000173597						99.0	106.0	104.0					4																	70620481		2203	4294	6497	SULT1B1	SO:0001583	missense	0			-	HGNC	D89479	CCDS3530.1	4q13.3	2008-02-05			ENSG00000173597	ENSG00000173597		"""Sulfotransferases, cytosolic"""	17845	protein-coding gene	gene with protein product		608436				11688987, 9443824	Standard	NM_014465		Approved	ST1B2	uc003hen.3	O43704	OTTHUMG00000129407	ENST00000310613.3:c.184C>A	4.37:g.70620481G>T	ENSP00000308770:p.Leu62Ile	Somatic	0	57	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	O15497|Q96FI1|Q9UK34	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.L62I	ENST00000310613.3	37	c.184	CCDS3530.1	4	.	.	.	.	.	.	.	.	.	.	G	8.214	0.801053	0.16397	.	.	ENSG00000173597	ENST00000310613;ENST00000510821;ENST00000512870	T;T;T	0.01887	4.58;4.58;4.58	5.13	0.469	0.16741	Sulfotransferase domain (1);	0.188056	0.25839	N	0.027971	T	0.03783	0.0107	M	0.62723	1.935	0.23943	N	0.996398	B	0.24132	0.098	B	0.34452	0.183	T	0.32851	-0.9891	10	0.41790	T	0.15	.	8.7888	0.34837	0.4002:0.0:0.5998:0.0	.	62	O43704	ST1B1_HUMAN	I	62;62;43	ENSP00000308770:L62I;ENSP00000425464:L62I;ENSP00000427536:L43I	ENSP00000308770:L62I	L	-	1	2	SULT1B1	70655070	0.364000	0.24997	0.031000	0.17742	0.158000	0.22134	0.287000	0.18920	-0.159000	0.11021	-0.237000	0.12165	CTA	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.338	SULT1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1B1	protein_coding	OTTHUMT00000251563.2	G	NM_014465	-		70620481	-1	no_errors	ENST00000310613	ensembl	human	known	74_37	missense	SNP	0.455	T
SRPR	6734	genome.wustl.edu	37	11	126134139	126134139	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:126134139G>T	ENST00000332118.6	-	13	1889	c.1735C>A	c.(1735-1737)Cct>Act	p.P579T	SRPR_ENST00000532259.1_Missense_Mutation_p.P551T	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	579					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		ATGAGCCGAGGTGTCTGAGCC	0.448																																																	0								ENSG00000182934						142.0	142.0	142.0					11																	126134139		2201	4299	6500	SRPR	SO:0001583	missense	0			-	HGNC	BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.1735C>A	11.37:g.126134139G>T	ENSP00000328023:p.Pro579Thr	Somatic	0	45	0.00		0.5284069354479217	164	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sig_recog_particle_rcpt_asu_N,pfam_SRP54_GTPase_dom,pfam_ArgK,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,pfam_Signal_recog_particl_SRP54_hlx,superfamily_Longin-like_dom,superfamily_P-loop_NTPase,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_SRP54_GTPase_dom	p.P579T	ENST00000332118.6	37	c.1735	CCDS31717.1	11	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270181	0.80469	.	.	ENSG00000182934	ENST00000332118;ENST00000532259	.	.	.	5.46	5.46	0.80206	Signal recognition particle, SRP54 subunit, GTPase (2);	0.000000	0.85682	D	0.000000	T	0.70272	0.3205	L	0.52759	1.655	0.80722	D	1	P;P	0.42649	0.616;0.786	P;P	0.52031	0.574;0.688	T	0.66288	-0.5961	9	0.38643	T	0.18	-14.2206	19.5125	0.95148	0.0:0.0:1.0:0.0	.	551;579	E9PJS4;P08240	.;SRPR_HUMAN	T	579;551	.	ENSP00000328023:P579T	P	-	1	0	SRPR	125639349	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.411000	0.97342	2.840000	0.97914	0.655000	0.94253	CCT	-	pfam_SRP54_GTPase_dom,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,superfamily_P-loop_NTPase,smart_SRP54_GTPase_dom		0.448	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPR	protein_coding	OTTHUMT00000386425.2	G	NM_003139	-		126134139	-1	no_errors	ENST00000332118	ensembl	human	known	74_37	missense	SNP	1.000	T
TSHZ1	10194	genome.wustl.edu	37	18	72998202	72998202	+	Silent	SNP	C	C	T	rs573970992		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr18:72998202C>T	ENST00000580243.1	+	2	1188	c.840C>T	c.(838-840)tcC>tcT	p.S280S	TSHZ1_ENST00000322038.5_Silent_p.S235S			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	280					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		ACAAGGACTCCGAGAAGACCA	0.587																																																	0								ENSG00000179981						111.0	89.0	96.0					18																	72998202		2203	4300	6503	TSHZ1	SO:0001819	synonymous_variant	0			-	HGNC	AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.840C>T	18.37:g.72998202C>T		Somatic	0	42	0.00		0.5284069354479217	29	48.21	27	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	27	55.00	O60534|Q4LE29|Q53EU4	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Znf_C2H2	p.S280	ENST00000580243.1	37	c.840		18																																																																																			-	NULL		0.587	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	protein_coding	OTTHUMT00000444913.1	C	NM_005786	-		72998202	+1	no_errors	ENST00000580243	ensembl	human	known	74_37	silent	SNP	0.999	T
RCSD1	92241	genome.wustl.edu	37	1	167599678	167599678	+	Intron	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:167599678C>A	ENST00000367854.3	+	1	337				RP3-455J7.4_ENST00000451992.2_RNA|RCSD1_ENST00000537350.1_Intron|RCSD1_ENST00000472038.1_Intron	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1						cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					TAAAGGACCCCGGAGGGAGAC	0.726																																																	0								ENSG00000241666						22.0	19.0	20.0					1																	167599678		2187	4278	6465	RP3-455J7.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.6+12C>A	1.37:g.167599678C>A		Somatic	0	54	0.00		0.5284069354479217	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000367854.3	37	NULL	CCDS1263.1	1																																																																																			-	-		0.726	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000241666	protein_coding	OTTHUMT00000085451.1	C	NM_052862	-		167599678	-1	no_errors	ENST00000451992	ensembl	human	known	74_37	rna	SNP	0.000	A
CACNA1B	774	genome.wustl.edu	37	9	141010020	141010020	+	Missense_Mutation	SNP	T	T	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr9:141010020T>C	ENST00000371372.1	+	42	5811	c.5666T>C	c.(5665-5667)cTg>cCg	p.L1889P	CACNA1B_ENST00000371357.1_Missense_Mutation_p.L1888P|CACNA1B_ENST00000277549.5_Missense_Mutation_p.L1083P|CACNA1B_ENST00000371355.4_Missense_Mutation_p.L1890P|CACNA1B_ENST00000277551.2_Missense_Mutation_p.L1889P|CACNA1B_ENST00000371363.1_Missense_Mutation_p.L1887P	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1889					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTGTGTCCCTGTTCCACCCT	0.592																																																	0								ENSG00000148408						144.0	143.0	144.0					9																	141010020		2010	4171	6181	CACNA1B	SO:0001583	missense	0			-	HGNC	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5666T>C	9.37:g.141010020T>C	ENSP00000360423:p.Leu1889Pro	Somatic	0	47	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	B1AQK5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_hand_dom,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.L1890P	ENST00000371372.1	37	c.5669	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	T	16.18	3.050451	0.55218	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.97553	-4.16;-4.17;-4.43;-4.19;-4.17;-4.15	4.73	4.73	0.59995	.	5.340800	0.02364	U	0.077180	D	0.96169	0.8751	L	0.60455	1.87	0.80722	D	1	B;B	0.28998	0.028;0.23	B;B	0.24006	0.032;0.05	T	0.79505	-0.1776	10	0.30078	T	0.28	.	14.6773	0.68989	0.0:0.0:0.0:1.0	.	1888;1887	B1AQK7;B1AQK6	.;.	P	1889;1889;1083;1887;1888;1890	ENSP00000360423:L1889P;ENSP00000277551:L1889P;ENSP00000277549:L1083P;ENSP00000360414:L1887P;ENSP00000360408:L1888P;ENSP00000360406:L1890P	ENSP00000277549:L1083P	L	+	2	0	CACNA1B	140129841	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.927000	0.63440	2.101000	0.63845	0.533000	0.62120	CTG	-	NULL		0.592	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	protein_coding	OTTHUMT00000055380.1	T	NM_000718	-		141010020	+1	no_errors	ENST00000371355	ensembl	human	known	74_37	missense	SNP	1.000	C
ZNF83	55769	genome.wustl.edu	37	19	53121989	53121989	+	Intron	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:53121989C>A	ENST00000597597.1	-	2	2021				ZNF83_ENST00000301096.3_Intron|ZNF83_ENST00000598536.1_Intron|ZNF83_ENST00000541777.2_5'Flank|ZNF83_ENST00000544146.1_Intron|ZNF83_ENST00000597161.1_Intron|ZNF83_ENST00000545872.1_Intron|ZNF83_ENST00000594682.2_Intron|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000536937.1_Intron|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000596930.1_Intron			P51522	ZNF83_HUMAN	zinc finger protein 83						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		CTGGAACCCCCACTGAGCTAT	0.453																																																	0								ENSG00000167766																																			ZNF83	SO:0001627	intron_variant	0			-	HGNC	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.233-3939G>T	19.37:g.53121989C>A		Somatic	0	32	0.00		0.5284069354479217	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	A8MT75|Q3ZCX0|Q6PI08	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000597597.1	37	NULL	CCDS12854.1	19																																																																																			-	-		0.453	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	protein_coding	OTTHUMT00000463700.1	C	NM_018300	-		53121989	-1	no_errors	ENST00000596440	ensembl	human	known	74_37	rna	SNP	0.001	A
MCM9	254394	genome.wustl.edu	37	6	119136406	119136406	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr6:119136406C>A	ENST00000316316.6	-	13	3299	c.3013G>T	c.(3013-3015)Gag>Tag	p.E1005*		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	1005					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		ATCACCTTCTCTCTTGGTCCG	0.502																																																	0								ENSG00000111877																																			MCM9	SO:0001587	stop_gained	0			-	HGNC	BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.3013G>T	6.37:g.119136406C>A	ENSP00000314505:p.Glu1005*	Somatic	0	50	0.00		0.5284069354479217	35	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,prints_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase	p.E1005*	ENST00000316316.6	37	c.3013	CCDS56447.1	6	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588444	0.86851	.	.	ENSG00000111877	ENST00000316316;ENST00000243218	.	.	.	5.35	5.35	0.76521	.	0.333227	0.28510	U	0.015088	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	14.616	0.68549	0.0:0.8545:0.1455:0.0	.	.	.	.	X	1005;624	.	ENSP00000243218:E624X	E	-	1	0	MCM9	119243109	0.950000	0.32346	0.580000	0.28601	0.009000	0.06853	1.171000	0.31896	2.894000	0.99253	0.655000	0.94253	GAG	-	NULL		0.502	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	protein_coding	OTTHUMT00000042005.4	C	NM_153255	-		119136406	-1	no_errors	ENST00000316316	ensembl	human	known	74_37	nonsense	SNP	0.988	A
VTCN1	79679	genome.wustl.edu	37	1	117699367	117699367	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr1:117699367C>A	ENST00000369458.3	-	3	352	c.274G>T	c.(274-276)Gag>Tag	p.E92*	VTCN1_ENST00000359008.4_Nonsense_Mutation_p.E95*|VTCN1_ENST00000539893.1_5'UTR|VTCN1_ENST00000463461.1_5'UTR|VTCN1_ENST00000328189.3_Intron	NM_024626.3	NP_078902.2			V-set domain containing T cell activation inhibitor 1											large_intestine(7)|lung(4)|upper_aerodigestive_tract(1)	12	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		TCATCCTGCTCCGACAGCTCA	0.463																																																	0								ENSG00000134258						120.0	109.0	113.0					1																	117699367		2203	4300	6503	VTCN1	SO:0001587	stop_gained	0			-	HGNC	BX648021	CCDS894.1, CCDS58019.1, CCDS58020.1	1p12	2013-01-29			ENSG00000134258	ENSG00000134258		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28873	protein-coding gene	gene with protein product	"""B7 family member, H4"", ""B7 superfamily member 1"""	608162				12818165, 12818166	Standard	NM_024626		Approved	B7-H4, FLJ22418, B7S1, B7X, B7H4	uc001ehb.3	Q7Z7D3	OTTHUMG00000012118	ENST00000369458.3:c.274G>T	1.37:g.117699367C>A	ENSP00000358470:p.Glu92*	Somatic	0	34	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.E95*	ENST00000369458.3	37	c.283	CCDS894.1	1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996333	0.74818	.	.	ENSG00000134258	ENST00000369458;ENST00000359008	.	.	.	5.93	3.95	0.45737	.	0.943176	0.08924	N	0.874001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-15.3026	14.235	0.65919	0.0:0.6402:0.3598:0.0	.	.	.	.	X	92;95	.	ENSP00000351899:E95X	E	-	1	0	VTCN1	117500890	0.001000	0.12720	0.951000	0.38953	0.856000	0.48823	0.520000	0.22878	0.712000	0.32039	0.637000	0.83480	GAG	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom		0.463	VTCN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	VTCN1	protein_coding	OTTHUMT00000033500.2	C	NM_024626	-		117699367	-1	no_errors	ENST00000359008	ensembl	human	known	74_37	nonsense	SNP	0.936	A
ZNF577	84765	genome.wustl.edu	37	19	52383628	52383628	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:52383628delT	ENST00000301399.5	-	4	373	c.8delA	c.(7-9)aatfs	p.N3fs	ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000412216.1_Frame_Shift_Del_p.N3fs|ZNF577_ENST00000420592.1_Frame_Shift_Del_p.N3fs|ZNF577_ENST00000451628.2_Frame_Shift_Del_p.N3fs	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	3					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		aatcgtggcatttttcatgtg	0.418																																																	0								ENSG00000161551						193.0	177.0	183.0					19																	52383628		2203	4300	6503	ZNF577	SO:0001589	frameshift_variant	0				HGNC	AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.8delA	19.37:g.52383628delT	ENSP00000301399:p.Asn3fs	Somatic	0	17	0.00		0.5284069354479217	6	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	A8K0B4|A8K6Z7|C9JFB9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N3fs	ENST00000301399.5	37	c.8	CCDS12842.2	19																																																																																			-	NULL		0.418	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF577	protein_coding	OTTHUMT00000347243.1	T	NM_032679			52383628	-1	no_errors	ENST00000301399	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
WDFY3	23001	genome.wustl.edu	37	4	85642697	85642697	+	Silent	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:85642697G>T	ENST00000295888.4	-	47	7877	c.7470C>A	c.(7468-7470)tcC>tcA	p.S2490S	WDFY3_ENST00000322366.6_Silent_p.S2473S	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2490	Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		GTGCAGATCGGGAGCGTTTTA	0.488																																																	0								ENSG00000163625						105.0	96.0	99.0					4																	85642697		2203	4300	6503	WDFY3	SO:0001819	synonymous_variant	0			-	HGNC	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.7470C>A	4.37:g.85642697G>T		Somatic	0	47	0.00		0.5284069354479217	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S2490	ENST00000295888.4	37	c.7470	CCDS3609.1	4																																																																																			-	NULL		0.488	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	protein_coding	OTTHUMT00000252811.2	G	NM_014991	-		85642697	-1	no_errors	ENST00000295888	ensembl	human	known	74_37	silent	SNP	0.973	T
DOK3	79930	genome.wustl.edu	37	5	176930503	176930503	+	IGR	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr5:176930503C>A	ENST00000357198.4	-	0	1729				RP11-1334A24.6_ENST00000506025.1_RNA|DOK3_ENST00000312943.6_Intron|DOK3_ENST00000377112.4_Intron	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3						Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			CTCGGGCCTCCGGGTCTCCAG	0.612																																																	0								ENSG00000248996																																			RP11-1334A24.6	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850		5.37:g.176930503C>A		Somatic	0	32	0.00		0.5284069354479217	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000357198.4	37	NULL	CCDS4426.1	5																																																																																			-	-		0.612	DOK3-001	KNOWN	basic|CCDS	protein_coding	ENSG00000248996	protein_coding	OTTHUMT00000253420.4	C	NM_024872	-		176930503	+1	no_errors	ENST00000506025	ensembl	human	known	74_37	rna	SNP	0.000	A
NDST3	9348	genome.wustl.edu	37	4	119154221	119154221	+	Missense_Mutation	SNP	C	C	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr4:119154221C>T	ENST00000296499.5	+	9	2277	c.1874C>T	c.(1873-1875)tCc>tTc	p.S625F	NDST3_ENST00000433996.2_Missense_Mutation_p.S544F	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	625	Heparan sulfate N-sulfotransferase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						CTTAGTAACTCCCCCAGCCCA	0.363																																																	0								ENSG00000164100						161.0	159.0	160.0					4																	119154221		2203	4300	6503	NDST3	SO:0001583	missense	0			-	HGNC	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.1874C>T	4.37:g.119154221C>T	ENSP00000296499:p.Ser625Phe	Somatic	0	108	0.00		0.5284069354479217	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	60	39.39	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.S625F	ENST00000296499.5	37	c.1874	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	C	8.384	0.838135	0.16891	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.55052	0.54;0.54	5.64	5.64	0.86602	Sulfotransferase domain (1);	0.057217	0.64402	D	0.000001	T	0.23532	0.0569	N	0.01431	-0.87	0.32449	N	0.545642	B;B	0.15719	0.014;0.0	B;B	0.14578	0.011;0.004	T	0.21690	-1.0238	10	0.09338	T	0.73	.	12.9795	0.58555	0.0:0.926:0.0:0.074	.	544;625	B4DI67;O95803	.;NDST3_HUMAN	F	625;544	ENSP00000296499:S625F;ENSP00000396625:S544F	ENSP00000296499:S625F	S	+	2	0	NDST3	119373669	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.344000	0.44010	2.645000	0.89757	0.637000	0.83480	TCC	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase		0.363	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	protein_coding	OTTHUMT00000256517.4	C	NM_004784	-		119154221	+1	no_errors	ENST00000296499	ensembl	human	known	74_37	missense	SNP	1.000	T
TUT1	64852	genome.wustl.edu	37	11	62348654	62348654	+	Missense_Mutation	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr11:62348654G>T	ENST00000476907.1	-	4	1305	c.614C>A	c.(613-615)tCt>tAt	p.S205Y	TUT1_ENST00000308436.7_Missense_Mutation_p.S243Y|MIR3654_ENST00000496634.2_Missense_Mutation_p.S205Y			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	205					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						ATTTATGGAAGAGCCAAAAGG	0.527																																																	0								ENSG00000149016						107.0	99.0	102.0					11																	62348654		2202	4299	6501	TUT1	SO:0001583	missense	0			-	HGNC	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.614C>A	11.37:g.62348654G>T	ENSP00000419607:p.Ser205Tyr	Somatic	0	23	0.00		0.5284069354479217	128	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PAP_assoc,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S243Y	ENST00000476907.1	37	c.728		11	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763314	0.69763	.	.	ENSG00000149016	ENST00000308436;ENST00000476907;ENST00000494385	D;D;D	0.85955	-2.05;-2.05;-2.05	5.5	5.5	0.81552	.	0.110306	0.64402	D	0.000005	D	0.92609	0.7652	M	0.81614	2.55	0.42729	D	0.993702	D	0.89917	1.0	D	0.91635	0.999	D	0.93508	0.6850	10	0.87932	D	0	-16.7575	16.9396	0.86213	0.0:0.0:1.0:0.0	.	243	F5H0R1	.	Y	243;205;119	ENSP00000308000:S243Y;ENSP00000419607:S205Y;ENSP00000420739:S119Y	ENSP00000441670:S205Y	S	-	2	0	TUT1	62105230	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.978000	0.93450	2.576000	0.86940	0.555000	0.69702	TCT	-	NULL		0.527	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	TUT1	protein_coding	OTTHUMT00000351319.2	G	NM_022830	-		62348654	-1	no_errors	ENST00000308436	ensembl	human	known	74_37	missense	SNP	1.000	T
ARHGAP35	2909	genome.wustl.edu	37	19	47424701	47424701	+	Silent	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:47424701C>A	ENST00000404338.3	+	1	2769	c.2769C>A	c.(2767-2769)ccC>ccA	p.P923P		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	923					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										CAAGCATCCCCTGTAGCCAAC	0.433																																																	0								ENSG00000160007						120.0	118.0	119.0					19																	47424701		1910	4135	6045	ARHGAP35	SO:0001819	synonymous_variant	0			-	HGNC	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.2769C>A	19.37:g.47424701C>A		Somatic	0	48	0.00		0.5284069354479217	50	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	A7E2A4|Q14452|Q9C0E1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P923	ENST00000404338.3	37	c.2769	CCDS46127.1	19																																																																																			-	NULL		0.433	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	protein_coding	OTTHUMT00000466652.1	C	NM_004491	-		47424701	+1	no_errors	ENST00000404338	ensembl	human	known	74_37	silent	SNP	1.000	A
PLCG2	5336	genome.wustl.edu	37	16	81995798	81995809	+	lincRNA	DEL	GAATTGTATTTG	GAATTGTATTTG	-	rs375195217|rs201826443|rs200794987|rs201622146|rs199902581|rs146553414|rs113030180|rs200824503	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	GAATTGTATTTG	GAATTGTATTTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:81995798_81995809delGAATTGTATTTG	ENST00000564138.1	+	0	2275_2286																											ACTAAGTGATGAATTGTATTTGGAAGCAAAAA	0.439														3385	0.675919	0.382	0.696	5008	,	,		18266	0.7817		0.7893	False		,,,				2504	0.8333																0								ENSG00000260682																																			7SK			0				RFAM																													16.37:g.81995798_81995809delGAATTGTATTTG		Somatic	NA	NA	NA		0.5284069354479217	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564138.1	37	NULL		16																																																																																			-	-		0.439	7SK.4-001	KNOWN	basic	lincRNA	ENSG00000260682	lincRNA	OTTHUMT00000432476.1	GAATTGTATTTG				81995809	+1	no_errors	ENST00000363673	ensembl	human	known	74_37	rna	DEL	0.001:0.000:0.000:0.001:0.000:0.000:0.002:0.002:0.000:0.000:0.001:0.001	-
SYNGR4	23546	genome.wustl.edu	37	19	48869112	48869112	+	Frame_Shift_Del	DEL	A	A	-			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:48869112delA	ENST00000344846.2	+	2	263	c.13delA	c.(13-15)aaafs	p.K5fs	TMEM143_ENST00000436660.2_5'Flank|TMEM143_ENST00000377431.2_5'Flank|TMEM143_ENST00000541566.1_5'Flank|TMEM143_ENST00000435956.3_5'Flank|TMEM143_ENST00000598012.1_5'Flank|TMEM143_ENST00000293261.3_5'Flank	NM_012451.3	NP_036583.2	O95473	SNG4_HUMAN	synaptogyrin 4	5						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)|skin(1)	10		all_epithelial(76;5.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|Prostate(7;0.0143)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		GCACATCCCCAAAAGCCTCCA	0.657																																																	0								ENSG00000105467						94.0	93.0	94.0					19																	48869112		2203	4300	6503	SYNGR4	SO:0001589	frameshift_variant	0				HGNC	AJ011733	CCDS12717.1	19q13.3	2008-07-04				ENSG00000105467			11502	protein-coding gene	gene with protein product		608373					Standard	NM_012451		Approved		uc002piz.3	O95473		ENST00000344846.2:c.13delA	19.37:g.48869112delA	ENSP00000344041:p.Lys5fs	Somatic	0	40	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	10	16.67	Q3KP58	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Marvel,pirsf_Synaptogyrin	p.S6fs	ENST00000344846.2	37	c.13	CCDS12717.1	19																																																																																			-	pirsf_Synaptogyrin		0.657	SYNGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNGR4	protein_coding	OTTHUMT00000465704.1	A				48869112	+1	no_errors	ENST00000344846	ensembl	human	known	74_37	frame_shift_del	DEL	0.005	-
DST	667	genome.wustl.edu	37	6	56438560	56438560	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr6:56438560C>A	ENST00000361203.3	-	47	12527	c.12520G>T	c.(12520-12522)Gga>Tga	p.G4174*	DST_ENST00000370788.2_Nonsense_Mutation_p.G2088*|DST_ENST00000370754.5_Nonsense_Mutation_p.G4354*|DST_ENST00000244364.6_Nonsense_Mutation_p.G1762*|DST_ENST00000446842.2_Nonsense_Mutation_p.G3850*|DST_ENST00000312431.6_Nonsense_Mutation_p.G4174*|DST_ENST00000370769.4_Nonsense_Mutation_p.G4176*|DST_ENST00000421834.2_Nonsense_Mutation_p.G2088*			Q03001	DYST_HUMAN	dystonin	4174					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TCCACATTTCCCATCCAGTCC	0.393																																																	0								ENSG00000151914						138.0	140.0	140.0					6																	56438560		1933	4137	6070	DST	SO:0001587	stop_gained	0			-	HGNC	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.12520G>T	6.37:g.56438560C>A	ENSP00000354508:p.Gly4174*	Somatic	0	44	0.00		0.5284069354479217	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.G4354*	ENST00000361203.3	37	c.13060		6	.	.	.	.	.	.	.	.	.	.	C	53	20.891442	0.99935	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203	.	.	.	5.95	5.95	0.96441	.	0.549745	0.16406	N	0.215810	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	9.4454	0.38695	0.1438:0.785:0.0:0.0712	.	.	.	.	X	1762;4354;4176;2088;3850;4174;2088;4174	.	ENSP00000244364:G1762X	G	-	1	0	DST	56546519	0.998000	0.40836	0.971000	0.41717	0.982000	0.71751	3.643000	0.54374	2.821000	0.97095	0.650000	0.86243	GGA	-	superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin		0.393	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	protein_coding	OTTHUMT00000041021.3	C	NM_001723	-		56438560	-1	no_errors	ENST00000370754	ensembl	human	known	74_37	nonsense	SNP	0.995	A
PTGDS	5730	genome.wustl.edu	37	9	139873774	139873774	+	Intron	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr9:139873774C>A	ENST00000371625.3	+	3	405				PTGDS_ENST00000460340.1_3'UTR|PTGDS_ENST00000224167.2_Silent_p.P118P|RP11-229P13.19_ENST00000413913.2_RNA	NM_000954.5	NP_000945.3	P41222	PTGDS_HUMAN	prostaglandin D2 synthase 21kDa (brain)						arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|rough endoplasmic reticulum (GO:0005791)	fatty acid binding (GO:0005504)|prostaglandin-D synthase activity (GO:0004667)|retinoid binding (GO:0005501)|transporter activity (GO:0005215)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TCCACCGGCCCCCTGGGCCCA	0.711																																																	0								ENSG00000107317						20.0	26.0	24.0					9																	139873774		2201	4295	6496	PTGDS	SO:0001627	intron_variant	0			-	HGNC	AA621632	CCDS7019.1	9q34.2-q34.3	2011-11-15	2002-08-29		ENSG00000107317	ENSG00000107317	5.3.99.2	"""Lipocalins"""	9592	protein-coding gene	gene with protein product	"""lipocalin-type prostaglandin D synthase"""	176803	"""prostaglandin D2 synthase (21kD, brain)"""			1902577	Standard	NM_000954		Approved	PGDS, L-PGDS	uc004cke.3	P41222	OTTHUMG00000020957	ENST00000371625.3:c.331+23C>A	9.37:g.139873774C>A		Somatic	0	73	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B2R727|Q5SQ10|Q7M4P3|Q9UC22|Q9UCC9|Q9UCD9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_PstgldnD_synth	p.P118	ENST00000371625.3	37	c.354	CCDS7019.1	9																																																																																			-	superfamily_Calycin-like		0.711	PTGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDS	protein_coding	OTTHUMT00000055188.1	C	NM_000954	-		139873774	+1	no_errors	ENST00000224167	ensembl	human	known	74_37	silent	SNP	0.000	A
ITGB7	3695	genome.wustl.edu	37	12	53589909	53589909	+	Silent	SNP	G	G	A	rs372436147		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr12:53589909G>A	ENST00000267082.5	-	7	1122	c.891C>T	c.(889-891)gaC>gaT	p.D297D	ITGB7_ENST00000422257.3_Silent_p.D297D|ITGB7_ENST00000338737.4_Silent_p.D297D|ITGB7_ENST00000550743.2_Silent_p.D297D	NM_000889.1	NP_000880.1	P26010	ITB7_HUMAN	integrin, beta 7	297	VWFA.				cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte tethering or rolling (GO:0050901)|multicellular organismal development (GO:0007275)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alpha4-beta7 complex (GO:0034669)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			NS(2)|breast(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						CCAACTTCCCGTCCCCAGCTG	0.552													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20336	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000139626	G		1,4405	2.1+/-5.4	0,1,2202	104.0	93.0	97.0		891	-2.3	1.0	12		97	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ITGB7	NM_000889.1		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		297/799	53589909	2,13004	2203	4300	6503	ITGB7	SO:0001819	synonymous_variant	0			-	HGNC		CCDS8849.1	12q13.1	2010-03-23				ENSG00000139626		"""Integrins"""	6162	protein-coding gene	gene with protein product		147559				2040616	Standard	XM_005268851		Approved		uc001scc.3	P26010		ENST00000267082.5:c.891C>T	12.37:g.53589909G>A		Somatic	0	51	0.00		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	24	57.14	Q9UCP7|Q9UCS7	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_EGF_extracell,superfamily_Plexin-like_fold,superfamily_Integrin_bsu_tail,smart_Plexin-like_fold,smart_Integrin_bsu_N,prints_Integrin_bsu	p.D297	ENST00000267082.5	37	c.891	CCDS8849.1	12																																																																																			-	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,smart_Integrin_bsu_N,prints_Integrin_bsu		0.552	ITGB7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB7	protein_coding	OTTHUMT00000405821.2	G		-		53589909	-1	no_errors	ENST00000267082	ensembl	human	known	74_37	silent	SNP	0.990	A
DCLRE1C	64421	genome.wustl.edu	37	10	14951075	14951075	+	Nonsense_Mutation	SNP	C	C	A	rs368636876		TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr10:14951075C>A	ENST00000378278.2	-	14	1448	c.1411G>T	c.(1411-1413)Gga>Tga	p.G471*	DCLRE1C_ENST00000378249.1_Nonsense_Mutation_p.G356*|DCLRE1C_ENST00000357717.2_Nonsense_Mutation_p.G356*|DCLRE1C_ENST00000453695.2_Nonsense_Mutation_p.G351*|DCLRE1C_ENST00000378255.1_Nonsense_Mutation_p.G351*|DCLRE1C_ENST00000378242.1_Nonsense_Mutation_p.G124*|DCLRE1C_ENST00000378258.1_Nonsense_Mutation_p.G351*|DCLRE1C_ENST00000492201.1_5'UTR|DCLRE1C_ENST00000378289.4_Intron|DCLRE1C_ENST00000396817.2_Nonsense_Mutation_p.G351*|DCLRE1C_ENST00000378246.2_Nonsense_Mutation_p.G356*|DCLRE1C_ENST00000378254.1_Nonsense_Mutation_p.G351*			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	471					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						CCCAGATCTCCTTGCAGTGAA	0.428								Non-homologous end-joining																																									0								ENSG00000152457						103.0	91.0	95.0					10																	14951075		2203	4300	6503	DCLRE1C	SO:0001587	stop_gained	0			-	HGNC	BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.1411G>T	10.37:g.14951075C>A	ENSP00000367527:p.Gly471*	Somatic	0	32	0.00		0.5284069354479217	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DRMBL	p.G471*	ENST00000378278.2	37	c.1411	CCDS31149.1	10	.	.	.	.	.	.	.	.	.	.	C	39	7.640485	0.98406	.	.	ENSG00000152457	ENST00000453695;ENST00000378246;ENST00000357717;ENST00000378249;ENST00000396817;ENST00000378255;ENST00000378254;ENST00000378278;ENST00000378258;ENST00000378242	.	.	.	5.54	2.68	0.31781	.	0.860169	0.10922	N	0.619341	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	10.2886	0.43581	0.0:0.6735:0.0:0.3265	.	.	.	.	X	351;356;356;356;351;351;351;471;351;124	.	ENSP00000350349:G356X	G	-	1	0	DCLRE1C	14991081	0.000000	0.05858	0.001000	0.08648	0.282000	0.26991	0.308000	0.19314	0.701000	0.31803	0.655000	0.94253	GGA	-	NULL		0.428	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	protein_coding	OTTHUMT00000046934.1	C	NM_022487	-		14951075	-1	no_errors	ENST00000378278	ensembl	human	known	74_37	nonsense	SNP	0.000	A
RASEF	158158	genome.wustl.edu	37	9	85630776	85630776	+	Missense_Mutation	SNP	G	G	T	rs148666621	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr9:85630776G>T	ENST00000376447.3	-	4	969	c.709C>A	c.(709-711)Cgt>Agt	p.R237S		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	237					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						TCATACTGACGTCTGAGGTCA	0.413																																																	0								ENSG00000165105						260.0	242.0	248.0					9																	85630776		2203	4300	6503	RASEF	SO:0001583	missense	0			-	HGNC	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.709C>A	9.37:g.85630776G>T	ENSP00000365630:p.Arg237Ser	Somatic	0	36	0.00		0.5284069354479217	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81	A6NC29|Q96N04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_Vinculin/catenin,smart_EF_hand_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,pfscan_EF_hand_dom,tigrfam_Small_GTP-bd_dom	p.R237S	ENST00000376447.3	37	c.709	CCDS6662.1	9	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752998	0.89753	.	.	ENSG00000165105	ENST00000376447	T	0.61510	0.1	6.16	5.27	0.74061	.	0.052049	0.85682	D	0.000000	T	0.70894	0.3276	M	0.69823	2.125	0.80722	D	1	D	0.60575	0.988	P	0.56788	0.806	T	0.74853	-0.3523	10	0.62326	D	0.03	.	15.7724	0.78180	0.065:0.0:0.935:0.0	.	237	Q8IZ41	RASEF_HUMAN	S	237	ENSP00000365630:R237S	ENSP00000365630:R237S	R	-	1	0	RASEF	84820596	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	2.098000	0.41757	1.623000	0.50342	0.650000	0.86243	CGT	-	superfamily_Vinculin/catenin		0.413	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASEF	protein_coding	OTTHUMT00000052825.1	G	NM_152573	-		85630776	-1	no_errors	ENST00000376447	ensembl	human	known	74_37	missense	SNP	1.000	T
TM9SF3	56889	genome.wustl.edu	37	10	98303896	98303896	+	Silent	SNP	G	G	T			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr10:98303896G>T	ENST00000371142.4	-	9	1338	c.1122C>A	c.(1120-1122)gcC>gcA	p.A374A	TM9SF3_ENST00000490192.1_5'UTR	NM_020123.3	NP_064508.3	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3	374						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)	15		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		TGATGAAGAAGGCAGTGCCAC	0.368																																																	0								ENSG00000077147						104.0	92.0	96.0					10																	98303896		2203	4300	6503	TM9SF3	SO:0001819	synonymous_variant	0			-	HGNC	AF160213, AF269150	CCDS7450.1	10q24.2	2006-04-12			ENSG00000077147	ENSG00000077147			21529	protein-coding gene	gene with protein product						11530251, 11595169	Standard	NM_020123		Approved	SMBP	uc001kmm.4	Q9HD45	OTTHUMG00000018834	ENST00000371142.4:c.1122C>A	10.37:g.98303896G>T		Somatic	0	62	0.00		0.5284069354479217	86	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04	Q5TB57|Q6UWE7|Q9NWL8|Q9P0G9|Q9UHW8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_EMP70	p.A374	ENST00000371142.4	37	c.1122	CCDS7450.1	10																																																																																			-	pfam_EMP70		0.368	TM9SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF3	protein_coding	OTTHUMT00000049610.2	G	NM_020123	-		98303896	-1	no_errors	ENST00000371142	ensembl	human	known	74_37	silent	SNP	0.999	T
CSPG4P5	114817	genome.wustl.edu	37	15	84957480	84957499	+	RNA	DEL	GGCCCCACATCCATTGAGAA	GGCCCCACATCCATTGAGAA	-	rs554759799|rs529134831|rs548880213	byFrequency	TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	GGCCCCACATCCATTGAGAA	GGCCCCACATCCATTGAGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr15:84957480_84957499delGGCCCCACATCCATTGAGAA	ENST00000558801.1	-	0	7230_7249									DNM1 pseudogene 51																		TGTGTGCACTGGCCCCACATCCATTGAGAAGGCCCCACAT	0.586														762	0.152157	0.146	0.3256	5008	,	,		24353	0.1339		0.1481	False		,,,				2504	0.0603																0								ENSG00000235370																																			DNM1P51			0				HGNC			15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84957480_84957499delGGCCCCACATCCATTGAGAA		Somatic	NA	NA	NA		0.5284069354479217	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000558801.1	37	NULL		15																																																																																			-	-		0.586	DNM1P51-001	KNOWN	basic	processed_transcript	DNM1P51	pseudogene	OTTHUMT00000471721.1	GGCCCCACATCCATTGAGAA				84957499	-1	no_errors	ENST00000558801	ensembl	human	known	74_37	rna	DEL	0.404:0.401:0.398:0.395:0.392:0.390:0.387:0.385:0.382:0.380:0.378:0.376:0.374:0.372:0.370:0.368:0.366:0.365:0.363:0.362	-
FGD1	2245	genome.wustl.edu	37	X	54495293	54495293	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chrX:54495293delT	ENST00000375135.3	-	5	1851	c.1118delA	c.(1117-1119)aagfs	p.K373fs		NM_004463.2	NP_004454.2	P98174	FGD1_HUMAN	FYVE, RhoGEF and PH domain containing 1	373	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GTGAAACACCTTTTGCTGCAC	0.517																																																	0								ENSG00000102302						103.0	72.0	83.0					X																	54495293		2203	4300	6503	FGD1	SO:0001589	frameshift_variant	0				HGNC	U11690	CCDS14359.1	Xp11.21	2013-01-10	2008-08-01		ENSG00000102302	ENSG00000102302		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3663	protein-coding gene	gene with protein product		300546	"""faciogenital dysplasia (Aarskog-Scott syndrome)"""	FGDY			Standard	NM_004463		Approved	ZFYVE3	uc004dtg.3	P98174	OTTHUMG00000021627	ENST00000375135.3:c.1118delA	X.37:g.54495293delT	ENSP00000364277:p.Lys373fs	Somatic	0	51	0.00		0.5284069354479217	247	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	30	11.76	Q5H999|Q8N4D9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.K373fs	ENST00000375135.3	37	c.1118	CCDS14359.1	X																																																																																			-	superfamily_DH-domain,pfscan_DH-domain		0.517	FGD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD1	protein_coding	OTTHUMT00000056801.1	T	NM_004463			54495293	-1	no_errors	ENST00000375135	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
PCDH20	64881	genome.wustl.edu	37	13	61985538	61985538	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr13:61985538C>A	ENST00000409186.1	-	5	4799	c.2694G>T	c.(2692-2694)ttG>ttT	p.L898F	PCDH20_ENST00000409204.4_Missense_Mutation_p.L898F			Q8N6Y1	PCD20_HUMAN	protocadherin 20	898					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TGATGGAACCCAAGCTTATTA	0.433																																																	0								ENSG00000197991						95.0	81.0	86.0					13																	61985538		2203	4300	6503	PCDH20	SO:0001583	missense	0			-	HGNC	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2694G>T	13.37:g.61985538C>A	ENSP00000386653:p.Leu898Phe	Somatic	0	40	0.00		0.5284069354479217	13	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L898F	ENST00000409186.1	37	c.2694	CCDS9442.2	13	.	.	.	.	.	.	.	.	.	.	C	22.5	4.300403	0.81136	.	.	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.58940	0.3;0.3	6.07	6.07	0.98685	.	0.000000	0.52532	D	0.000077	T	0.67832	0.2935	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.64595	0.927	T	0.65212	-0.6223	10	0.46703	T	0.11	.	20.6593	0.99626	0.0:1.0:0.0:0.0	.	898	A8K1K9	.	F	898;898;644	ENSP00000387250:L898F;ENSP00000386653:L898F	ENSP00000351500:L644F	L	-	3	2	PCDH20	60883539	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.735000	0.55044	2.885000	0.99019	0.655000	0.94253	TTG	-	NULL		0.433	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCDH20	protein_coding	OTTHUMT00000333054.2	C	NM_022843	-		61985538	-1	no_errors	ENST00000409186	ensembl	human	known	74_37	missense	SNP	1.000	A
TCF4	6925	genome.wustl.edu	37	18	52937080	52937080	+	Missense_Mutation	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr18:52937080C>A	ENST00000356073.4	-	11	1515	c.904G>T	c.(904-906)Ggg>Tgg	p.G302W	TCF4_ENST00000566286.1_Missense_Mutation_p.G300W|TCF4_ENST00000537856.3_Missense_Mutation_p.G172W|TCF4_ENST00000537578.1_Missense_Mutation_p.G278W|TCF4_ENST00000543082.1_Missense_Mutation_p.G260W|TCF4_ENST00000457482.3_Missense_Mutation_p.G142W|TCF4_ENST00000540999.1_Missense_Mutation_p.G278W|TCF4_ENST00000544241.2_Missense_Mutation_p.G231W|TCF4_ENST00000568740.1_Missense_Mutation_p.G277W|TCF4_ENST00000570287.2_Missense_Mutation_p.G142W|TCF4_ENST00000570177.2_Missense_Mutation_p.G172W|TCF4_ENST00000566279.1_Missense_Mutation_p.G242W|TCF4_ENST00000564228.1_Missense_Mutation_p.G231W|TCF4_ENST00000564403.2_Missense_Mutation_p.G308W|TCF4_ENST00000398339.1_Missense_Mutation_p.G404W|TCF4_ENST00000354452.3_Missense_Mutation_p.G302W|TCF4_ENST00000564999.1_Missense_Mutation_p.G302W|TCF4_ENST00000561992.1_Missense_Mutation_p.G172W|TCF4_ENST00000561831.3_Missense_Mutation_p.G142W|TCF4_ENST00000565018.2_Missense_Mutation_p.G302W|TCF4_ENST00000563760.1_5'UTR|TCF4_ENST00000568673.1_Missense_Mutation_p.G278W|TCF4_ENST00000567880.1_Missense_Mutation_p.G242W	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	302					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CTGTCTGTCCCGTTGGCAGGA	0.453																																																	0								ENSG00000196628						150.0	123.0	132.0					18																	52937080		2203	4300	6503	TCF4	SO:0001583	missense	0			-	HGNC	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.904G>T	18.37:g.52937080C>A	ENSP00000348374:p.Gly302Trp	Somatic	0	65	0.00		0.5284069354479217	98	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	57	8.06	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G404W	ENST00000356073.4	37	c.1210	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150870	0.78001	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T;T	0.52754	0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.72301	0.3443	M	0.81497	2.545	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	0.998;0.998;0.999;0.999;1.0;0.999;0.998;0.998;0.986;0.991	T	0.75013	-0.3467	10	0.87932	D	0	-9.0284	18.8159	0.92076	0.0:1.0:0.0:0.0	.	278;302;278;142;404;302;260;231;142;300	B7Z5M6;G0LNT9;B7Z6Y1;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;.;ITF2_HUMAN;.;.;.;.	W	302;142;302;260;278;278;231;172;404	ENSP00000346440:G302W;ENSP00000409447:G142W;ENSP00000348374:G302W;ENSP00000439656:G260W;ENSP00000445202:G278W;ENSP00000440731:G278W;ENSP00000441562:G231W;ENSP00000439827:G172W;ENSP00000381382:G404W	ENSP00000346440:G302W	G	-	1	0	TCF4	51088078	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.422000	0.66453	2.734000	0.93682	0.460000	0.39030	GGG	-	NULL		0.453	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	protein_coding	OTTHUMT00000256014.1	C	NM_003199	-		52937080	-1	no_errors	ENST00000398339	ensembl	human	known	74_37	missense	SNP	1.000	A
SRCAP	10847	genome.wustl.edu	37	16	30734385	30734385	+	Silent	SNP	C	C	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr16:30734385C>A	ENST00000262518.4	+	24	4379	c.3994C>A	c.(3994-3996)Cgg>Agg	p.R1332R	SRCAP_ENST00000344771.4_Silent_p.R1174R|SRCAP_ENST00000395059.2_Silent_p.R1270R	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1332	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.R1332R(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCCAGCACCCCGGCCTCCGAG	0.602																																																	1	Substitution - coding silent(1)	urinary_tract(1)						ENSG00000080603						76.0	79.0	78.0					16																	30734385		2197	4300	6497	SRCAP	SO:0001819	synonymous_variant	0			-	HGNC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.3994C>A	16.37:g.30734385C>A		Somatic	0	80	0.00		0.5284069354479217	36	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	B0JZA6|O15026|Q7Z744|Q9Y5L9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.R1332	ENST00000262518.4	37	c.3994	CCDS10689.2	16																																																																																			-	NULL		0.602	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	protein_coding	OTTHUMT00000255523.1	C	NM_006662	-		30734385	+1	no_errors	ENST00000262518	ensembl	human	known	74_37	silent	SNP	0.989	A
BCL2L12	83596	genome.wustl.edu	37	19	50169166	50169166	+	Missense_Mutation	SNP	T	T	A			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr19:50169166T>A	ENST00000246785.3	+	1	344	c.86T>A	c.(85-87)aTt>aAt	p.I29N	IRF3_ENST00000600911.1_5'Flank|IRF3_ENST00000377139.3_5'Flank|IRF3_ENST00000598808.1_5'Flank|IRF3_ENST00000442265.2_5'Flank|IRF3_ENST00000599144.1_5'Flank|IRF3_ENST00000600022.1_5'Flank|IRF3_ENST00000597198.1_5'Flank|IRF3_ENST00000596822.1_5'Flank|IRF3_ENST00000309877.7_5'Flank|IRF3_ENST00000601291.1_5'Flank|BCL2L12_ENST00000246784.3_Missense_Mutation_p.I29N|IRF3_ENST00000599223.1_5'Flank|BCL2L12_ENST00000441864.2_Missense_Mutation_p.I29N|IRF3_ENST00000593922.1_5'Flank|IRF3_ENST00000377135.4_5'Flank|IRF3_ENST00000596765.1_5'Flank	NM_001040668.1|NM_138639.1	NP_001035758.1|NP_619580.1	Q9HB09	B2L12_HUMAN	BCL2-like 12 (proline rich)	29					inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	8		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.000681)|GBM - Glioblastoma multiforme(134;0.0214)		CACATGCAAATTGAGCGTGCA	0.602																																																	0								ENSG00000126453						37.0	39.0	39.0					19																	50169166		2203	4300	6503	BCL2L12	SO:0001583	missense	0			-	HGNC	AF289220	CCDS12776.1, CCDS46144.1, CCDS74424.1, CCDS74423.1	19q13.3	2014-03-07				ENSG00000126453			13787	protein-coding gene	gene with protein product		610837					Standard	NM_001040668		Approved		uc002ppa.3	Q9HB09		ENST00000246785.3:c.86T>A	19.37:g.50169166T>A	ENSP00000246785:p.Ile29Asn	Somatic	0	54	0.00		0.5284069354479217	2	33.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	61	40.78	Q3SY11|Q3SY13|Q96I96|Q9HB08	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I29N	ENST00000246785.3	37	c.86	CCDS12776.1	19	.	.	.	.	.	.	.	.	.	.	T	16.56	3.158751	0.57368	.	.	ENSG00000126453	ENST00000246785;ENST00000441864;ENST00000246784	T;T;T	0.56776	0.62;0.62;0.44	3.62	3.62	0.41486	.	0.459704	0.16205	U	0.224767	T	0.37705	0.1013	N	0.08118	0	0.29706	N	0.839742	P;P	0.47677	0.899;0.899	P;P	0.47705	0.555;0.555	T	0.31447	-0.9943	10	0.87932	D	0	0.1035	8.8927	0.35444	0.0:0.0:0.0:1.0	.	29;29	Q3SY13;Q9HB09	.;B2L12_HUMAN	N	29	ENSP00000246785:I29N;ENSP00000393803:I29N;ENSP00000246784:I29N	ENSP00000246784:I29N	I	+	2	0	BCL2L12	54860978	0.980000	0.34600	0.877000	0.34402	0.435000	0.31806	1.996000	0.40776	1.898000	0.54952	0.383000	0.25322	ATT	-	NULL		0.602	BCL2L12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L12	protein_coding	OTTHUMT00000465770.1	T	NM_052842	-		50169166	+1	no_errors	ENST00000246785	ensembl	human	known	74_37	missense	SNP	0.888	A
ECE2	9718	genome.wustl.edu	37	3	184009139	184009139	+	Missense_Mutation	SNP	A	A	C			TCGA-JV-A75J-01A-11D-A32I-09	TCGA-JV-A75J-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	9003f7a7-91de-4a5f-b63b-e2c6da70f128	dfb9bea3-cc77-42ff-b489-c40d0c923396	g.chr3:184009139A>C	ENST00000402825.3	+	18	2387	c.2387A>C	c.(2386-2388)aAa>aCa	p.K796T	ECE2_ENST00000404464.3_Missense_Mutation_p.K678T|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000359140.4_Missense_Mutation_p.K649T|ECE2_ENST00000357474.5_Missense_Mutation_p.K724T	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	796	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGGCTTACAAAGCATGGCTG	0.627																																																	0								ENSG00000145194						75.0	76.0	75.0					3																	184009139		2203	4300	6503	ECE2	SO:0001583	missense	0			-	HGNC	AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.2387A>C	3.37:g.184009139A>C	ENSP00000384223:p.Lys796Thr	Somatic	0	54	0.00		0.5284069354479217	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	22	48.84	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.K796T	ENST00000402825.3	37	c.2387	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	A	6.030	0.373840	0.11409	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81	5.19	2.75	0.32379	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.406947	0.26609	N	0.023431	D	0.89608	0.6764	M	0.70275	2.135	0.25362	N	0.98878	B;B;B;B;B	0.26602	0.154;0.011;0.001;0.001;0.0	B;B;B;B;B	0.38020	0.263;0.029;0.003;0.003;0.005	T	0.82291	-0.0530	10	0.52906	T	0.07	-1.8311	6.3379	0.21306	0.7556:0.1595:0.0848:0.0	.	398;678;724;649;796	B4DHU4;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;ECE2_HUMAN	T	796;649;678;724;670	ENSP00000384223:K796T;ENSP00000352052:K649T;ENSP00000385846:K678T;ENSP00000350066:K724T;ENSP00000398444:K670T	ENSP00000350066:K724T	K	+	2	0	ECE2	185491833	0.005000	0.15991	0.603000	0.28903	0.429000	0.31625	1.864000	0.39469	0.289000	0.22422	0.459000	0.35465	AAA	-	pfam_Peptidase_M13_C		0.627	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	protein_coding	OTTHUMT00000318874.3	A	NM_014693	-		184009139	+1	no_errors	ENST00000402825	ensembl	human	known	74_37	missense	SNP	0.106	C
