#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SNORD3B-1	26851	genome.wustl.edu	37	17	18967256	18967256	+	lincRNA	SNP	C	C	G	rs547211012|rs373053962	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:18967256C>G	ENST00000363359.1	+	0	432				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		cgttctctccctctcactccc	0.547													-|||	2	0.000399361	0.0	0.0	5008	,	,		22255	0.0		0.002	False		,,,				2504	0.0																0								ENSG00000262074						40.0	104.0	90.0					17																	18967256		510	1935	2445	SNORD3B-2			0			-	HGNC	AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18967256C>G		Somatic	0	17	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	19	55.81		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			-	-		0.547	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-2	lincRNA		C	NR_003271	-		18967256	-1	no_errors	ENST00000364880	ensembl	human	known	74_37	rna	SNP	0.036	G
MAGEA11	4110	genome.wustl.edu	37	X	148798425	148798425	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chrX:148798425G>A	ENST00000355220.5	+	5	1381	c.1279G>A	c.(1279-1281)Gag>Aag	p.E427K	MAGEA11_ENST00000333104.4_Missense_Mutation_p.E398K	NM_005366.4	NP_005357.2	P43364	MAGAB_HUMAN	melanoma antigen family A, 11	427						cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	9	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGAGGAGGGAGAGGGAGTCTG	0.537																																																	0								ENSG00000185247						92.0	69.0	77.0					X																	148798425		2203	4300	6503	MAGEA11	SO:0001583	missense	0			-	HGNC		CCDS48180.1	Xq28	2009-03-13			ENSG00000185247	ENSG00000185247			6798	protein-coding gene	gene with protein product	"""MAGE-11 antigen"", ""melanoma-associated antigen 11"", ""cancer/testis antigen family 1, member 11"""	300344		MAGE11		8575766	Standard	NM_001011544		Approved	MAGE-11, MAGEA-11, MGC10511, CT1.11	uc004fdq.3	P43364	OTTHUMG00000022633	ENST00000355220.5:c.1279G>A	X.37:g.148798425G>A	ENSP00000347358:p.Glu427Lys	Somatic	0	43	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	30	46.43	Q5ETU4|Q6ZRZ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E427K	ENST00000355220.5	37	c.1279	CCDS48180.1	X	.	.	.	.	.	.	.	.	.	.	N	12.43	1.935024	0.34189	.	.	ENSG00000185247	ENST00000333104;ENST00000355220	T;T	0.03301	3.98;4.02	0.976	0.976	0.19727	.	.	.	.	.	T	0.11793	0.0287	M	0.69823	2.125	0.09310	N	1	D;D	0.71674	0.995;0.998	D;D	0.66979	0.948;0.937	T	0.12218	-1.0556	8	.	.	.	.	4.9662	0.14091	0.0:0.0:1.0:0.0	.	398;427	G5E962;P43364	.;MAGAB_HUMAN	K	398;427	ENSP00000328177:E398K;ENSP00000347358:E427K	.	E	+	1	0	MAGEA11	148575980	0.006000	0.16342	0.015000	0.15790	0.011000	0.07611	2.052000	0.41316	0.761000	0.33130	0.429000	0.28392	GAG	-	NULL		0.537	MAGEA11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEA11	protein_coding	OTTHUMT00000058725.4	G	NM_005366	-		148798425	+1	no_errors	ENST00000355220	ensembl	human	known	74_37	missense	SNP	0.015	A
KIAA1919	91749	genome.wustl.edu	37	6	111587229	111587229	+	Missense_Mutation	SNP	A	A	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr6:111587229A>T	ENST00000368847.4	+	4	817	c.464A>T	c.(463-465)gAg>gTg	p.E155V		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	155					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		AACCACACAGAGTCTGACTTC	0.473																																																	0								ENSG00000173214						100.0	92.0	95.0					6																	111587229		2203	4300	6503	KIAA1919	SO:0001583	missense	0			-	HGNC	BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.464A>T	6.37:g.111587229A>T	ENSP00000357840:p.Glu155Val	Somatic	0	24	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	1	87.50	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.E155V	ENST00000368847.4	37	c.464	CCDS5090.1	6	.	.	.	.	.	.	.	.	.	.	A	5.972	0.363349	0.11296	.	.	ENSG00000173214	ENST00000368847	T	0.46819	0.86	5.85	1.84	0.25277	Major facilitator superfamily domain, general substrate transporter (1);	0.690355	0.15255	N	0.272115	T	0.14527	0.0351	L	0.54323	1.7	0.22034	N	0.999404	P	0.38223	0.623	B	0.34242	0.178	T	0.07616	-1.0763	10	0.19590	T	0.45	-12.8425	1.4056	0.02279	0.4383:0.2808:0.1241:0.1568	.	155	Q5TF39	NAGT1_HUMAN	V	155	ENSP00000357840:E155V	ENSP00000357840:E155V	E	+	2	0	KIAA1919	111693922	0.000000	0.05858	0.120000	0.21714	0.009000	0.06853	-0.066000	0.11598	1.005000	0.39183	0.523000	0.50628	GAG	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.473	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1919	protein_coding	OTTHUMT00000041827.1	A	NM_153369	-		111587229	+1	no_errors	ENST00000368847	ensembl	human	known	74_37	missense	SNP	0.273	T
PVRL3	25945	genome.wustl.edu	37	3	110911220	110911220	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr3:110911220C>T	ENST00000493615.1	+	8	1496	c.1244C>T	c.(1243-1245)aCt>aTt	p.T415I		NM_001243288.1	NP_001230217.1	Q9NQS3	PVRL3_HUMAN	poliovirus receptor-related 3	0					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|fertilization (GO:0009566)|homophilic cell adhesion (GO:0007156)|lens morphogenesis in camera-type eye (GO:0002089)|retina morphogenesis in camera-type eye (GO:0060042)|single organismal cell-cell adhesion (GO:0016337)	apical junction complex (GO:0043296)|cell-cell adherens junction (GO:0005913)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	cell adhesion molecule binding (GO:0050839)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(3)	19						CCTTTGCAGACTCAGTTCAAA	0.403																																																	0								ENSG00000177707																																			PVRL3	SO:0001583	missense	0			-	HGNC	AF282874	CCDS2957.1, CCDS58842.1, CCDS58843.1	3q13	2013-01-29			ENSG00000177707	ENSG00000177707		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17664	protein-coding gene	gene with protein product		607147				11024295	Standard	NM_015480		Approved	nectin-3, PPR3, PVRR3, DKFZP566B0846, CDw113, CD113	uc003dxt.2	Q9NQS3	OTTHUMG00000159239	ENST00000493615.1:c.1244C>T	3.37:g.110911220C>T	ENSP00000420579:p.Thr415Ile	Somatic	0	45	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	23	46.51	E9PFR0|Q6NVZ3|Q8NC05|Q8WVU4|Q9BVA9|Q9Y412	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like_dom	p.T415I	ENST00000493615.1	37	c.1244	CCDS58843.1	3	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643201	0.47153	.	.	ENSG00000177707	ENST00000493615;ENST00000485506	T	0.15952	2.38	5.35	3.42	0.39159	.	.	.	.	.	T	0.15478	0.0373	.	.	.	0.23440	N	0.997672	B	0.32968	0.392	B	0.32624	0.149	T	0.16305	-1.0407	8	0.87932	D	0	.	11.7311	0.51737	0.0:0.6561:0.3439:0.0	.	415	E9PFR0	.	I	415;8	ENSP00000420579:T415I	ENSP00000419829:T8I	T	+	2	0	PVRL3	112393910	0.996000	0.38824	1.000000	0.80357	0.993000	0.82548	0.153000	0.16323	1.597000	0.50072	0.655000	0.94253	ACT	-	NULL		0.403	PVRL3-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	PVRL3	protein_coding	OTTHUMT00000354046.1	C	NM_015480	-		110911220	+1	no_errors	ENST00000493615	ensembl	human	putative	74_37	missense	SNP	1.000	T
SPO11	23626	genome.wustl.edu	37	20	55917803	55917803	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr20:55917803T>A	ENST00000371263.3	+	12	1087	c.978T>A	c.(976-978)gaT>gaA	p.D326E	SPO11_ENST00000371260.4_Missense_Mutation_p.D284E|SPO11_ENST00000345868.4_Missense_Mutation_p.D288E	NM_012444.2	NP_036576.1	Q9Y5K1	SPO11_HUMAN	SPO11 meiotic protein covalently bound to DSB	326					DNA catabolic process, endonucleolytic (GO:0000737)|female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|ovarian follicle development (GO:0001541)|protein localization to chromosome (GO:0034502)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|hydrolase activity (GO:0016787)			autonomic_ganglia(1)|breast(3)|large_intestine(4)|lung(8)|skin(2)	18	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			TACCTAAAGATAGTTTGATTC	0.338								Editing and processing nucleases																																									0								ENSG00000054796						76.0	72.0	73.0					20																	55917803		2203	4299	6502	SPO11	SO:0001583	missense	0			-	HGNC	AF169385	CCDS13456.1, CCDS13457.1	20q13.31	2013-06-05	2013-06-05		ENSG00000054796	ENSG00000054796			11250	protein-coding gene	gene with protein product	"""cancer/testis antigen 35"", ""spermatogenesis associated 43"""	605114	"""SPO11, meiotic protein covalently bound to DSB (S. cerevisiae)-like"", ""SPO11 meiotic protein covalently bound to DSB-like (S. cerevisiae)"", ""SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)"""			10534401	Standard	NM_012444		Approved	CT35, SPATA43, TOPVIA	uc002xye.3	Q9Y5K1	OTTHUMG00000032817	ENST00000371263.3:c.978T>A	20.37:g.55917803T>A	ENSP00000360310:p.Asp326Glu	Somatic	0	13	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	14	53.33	Q5TCI1|Q8N4V0|Q9NQM7|Q9NQM8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Meiosis_Spo11,pfam_Spo11/TopoVI_A_N,superfamily_Spo11/TopoVI_A,prints_Meiotic_Spo11,prints_Spo11/TopoVI_A,prints_TopoVI_A	p.D326E	ENST00000371263.3	37	c.978	CCDS13456.1	20	.	.	.	.	.	.	.	.	.	.	T	10.16	1.273780	0.23221	.	.	ENSG00000054796	ENST00000371263;ENST00000345868;ENST00000371260	T;T;T	0.18016	2.24;2.27;2.27	5.15	1.0	0.19881	.	0.618485	0.18610	N	0.136192	T	0.10294	0.0252	L	0.31578	0.945	0.35562	D	0.804753	B;B	0.15719	0.014;0.005	B;B	0.16722	0.016;0.011	T	0.27123	-1.0083	10	0.20519	T	0.43	-1.0315	6.5409	0.22380	0.0:0.1094:0.1447:0.7459	.	288;326	Q9Y5K1-2;Q9Y5K1	.;SPO11_HUMAN	E	326;288;284	ENSP00000360310:D326E;ENSP00000316034:D288E;ENSP00000360307:D284E	ENSP00000316034:D288E	D	+	3	2	SPO11	55351210	0.989000	0.36119	0.315000	0.25238	0.990000	0.78478	0.140000	0.16056	-0.030000	0.13804	0.482000	0.46254	GAT	-	superfamily_Spo11/TopoVI_A,prints_Meiotic_Spo11		0.338	SPO11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPO11	protein_coding	OTTHUMT00000079836.2	T	NM_012444	-		55917803	+1	no_errors	ENST00000371263	ensembl	human	known	74_37	missense	SNP	0.991	A
PSME4	23198	genome.wustl.edu	37	2	54176323	54176323	+	Missense_Mutation	SNP	T	T	C			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr2:54176323T>C	ENST00000404125.1	-	2	395	c.340A>G	c.(340-342)Agc>Ggc	p.S114G	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	114					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TGCATCATGCTGATTTCCAGT	0.348																																																	0								ENSG00000068878						95.0	94.0	94.0					2																	54176323		2203	4300	6503	PSME4	SO:0001583	missense	0			-	HGNC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.340A>G	2.37:g.54176323T>C	ENSP00000384211:p.Ser114Gly	Somatic	0	26	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	16	57.89	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3437,superfamily_ARM-type_fold	p.S114G	ENST00000404125.1	37	c.340	CCDS33197.2	2	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447936	0.43429	.	.	ENSG00000068878	ENST00000404125	D	0.91686	-2.89	5.1	5.1	0.69264	.	0.000000	0.85682	U	0.000000	D	0.88890	0.6560	M	0.65498	2.005	0.80722	D	1	P	0.40875	0.731	B	0.32211	0.142	D	0.87693	0.2555	10	0.22109	T	0.4	.	15.1872	0.73012	0.0:0.0:0.0:1.0	.	114	Q14997	PSME4_HUMAN	G	114	ENSP00000384211:S114G	ENSP00000374643:S114G	S	-	1	0	PSME4	54029827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.030000	0.59900	0.533000	0.62120	AGC	-	NULL		0.348	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	protein_coding	OTTHUMT00000324163.1	T	XM_040158	-		54176323	-1	no_errors	ENST00000404125	ensembl	human	known	74_37	missense	SNP	1.000	C
CYP2A6	1548	genome.wustl.edu	37	19	41354534	41354534	+	Missense_Mutation	SNP	G	G	T	rs60563539		TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr19:41354534G>T	ENST00000301141.5	-	3	498	c.478C>A	c.(478-480)Ctc>Atc	p.L160I	CTC-490E21.12_ENST00000601627.1_Intron	NM_000762.5	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 6	160			L -> H (in allele CYP2A6*2; unable to catalyze 7-hydroxylation of coumarin; causes switching from coumarin 7- hydroxylation to 3-hydroxylation; dbSNP:rs1801272). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:2322567, ECO:0000269|PubMed:2748347, ECO:0000269|Ref.6}.		coumarin catabolic process (GO:0046226)|coumarin metabolic process (GO:0009804)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)	coumarin 7-hydroxylase activity (GO:0008389)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)	37			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Acetaminophen(DB00316)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amobarbital(DB01351)|Amphetamine(DB00182)|Antipyrine(DB01435)|Arformoterol(DB01274)|Azelastine(DB00972)|Azithromycin(DB00207)|Buprenorphine(DB00921)|Bupropion(DB01156)|Chlorzoxazone(DB00356)|Cinnarizine(DB00568)|Cisapride(DB00604)|Clofibrate(DB00636)|Clomifene(DB00882)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cyclophosphamide(DB00531)|Dapagliflozin(DB06292)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Diethylstilbestrol(DB00255)|Dronabinol(DB00470)|Eletriptan(DB00216)|Ezogabine(DB04953)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Flurazepam(DB00690)|Fomepizole(DB01213)|Formoterol(DB00983)|Halothane(DB01159)|Ifosfamide(DB01181)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Letrozole(DB01006)|Lidocaine(DB00281)|Lorcaserin(DB04871)|Memantine(DB01043)|Menadione(DB00170)|Methimazole(DB00763)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Miconazole(DB01110)|Montelukast(DB00471)|Nevirapine(DB00238)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Norfloxacin(DB01059)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Prednisolone(DB00860)|Progesterone(DB00396)|Propofol(DB00818)|Rifampicin(DB01045)|Rosiglitazone(DB00412)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sulfaphenazole(DB06729)|Tamoxifen(DB00675)|Tranylcypromine(DB00752)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Zidovudine(DB00495)	GTGCCCCGGAGGGCGTCGATG	0.706																																																	0								ENSG00000255974						35.0	39.0	37.0					19																	41354534		2203	4299	6502	CYP2A6	SO:0001583	missense	0			-	HGNC	AF182275	CCDS12568.1	19q13.2	2013-11-11	2003-01-14		ENSG00000255974	ENSG00000255974		"""Cytochrome P450s"""	2610	protein-coding gene	gene with protein product		122720	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 6"""	CYP2A3		7668294, 2748347	Standard	NM_000762		Approved	CPA6, CYP2A	uc002opl.4	P11509	OTTHUMG00000182713	ENST00000301141.5:c.478C>A	19.37:g.41354534G>T	ENSP00000301141:p.Leu160Ile	Somatic	0	66	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	52	11.86	A7YAE5|B2R7F6|P00190|P10890|Q16803|Q4VAT9|Q4VAU0|Q4VAU1|Q9H1Z7|Q9UCU0|Q9UK48	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.L160I	ENST00000301141.5	37	c.478	CCDS12568.1	19	.	.	.	.	.	.	.	.	.	.	-	7.661	0.684983	0.14973	.	.	ENSG00000255974	ENST00000301141	T	0.72282	-0.64	2.95	-5.91	0.02269	.	0.336308	0.29676	U	0.011482	T	0.46814	0.1412	L	0.28649	0.875	0.09310	N	1	B	0.02656	0.0	B	0.25506	0.061	T	0.25187	-1.0139	10	0.49607	T	0.09	.	0.9801	0.01434	0.4696:0.1142:0.2033:0.2128	rs60563539	160	P11509	CP2A6_HUMAN	I	160	ENSP00000301141:L160I	ENSP00000301141:L160I	L	-	1	0	CYP2A6	46046374	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.497000	0.00969	-2.055000	0.00899	-1.602000	0.00811	CTC	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.706	CYP2A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A6	protein_coding	OTTHUMT00000463259.1	G	NM_000762	rs60563539		41354534	-1	no_errors	ENST00000301141	ensembl	human	known	74_37	missense	SNP	0.000	T
PPP1R21	129285	genome.wustl.edu	37	2	48722864	48722864	+	Missense_Mutation	SNP	G	G	A	rs144544742		TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr2:48722864G>A	ENST00000294952.8	+	16	1803	c.1646G>A	c.(1645-1647)cGc>cAc	p.R549H	PPP1R21_ENST00000449090.2_Intron|PPP1R21_ENST00000281394.4_Missense_Mutation_p.R549H	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	549						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						GCAAACCGCCGCATCCTTCTC	0.423																																																	0								ENSG00000162869	G	HIS/ARG,,HIS/ARG	0,4406		0,0,2203	86.0	88.0	87.0		1646,,1646	5.2	1.0	2	dbSNP_134	87	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron,missense	KLRAQ1	NM_001135629.2,NM_001193475.1,NM_152994.4	29,,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,,probably-damaging	549/781,,549/770	48722864	1,13005	2203	4300	6503	PPP1R21	SO:0001583	missense	0			-	HGNC	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.1646G>A	2.37:g.48722864G>A	ENSP00000294952:p.Arg549His	Somatic	0	33	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	11	59.26	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KLRAQ/TTKRSYEDQ_C,pfam_Unchr_KLRAQ/TTKRSYEDQ_N,superfamily_Ferritin-like_SF	p.R549H	ENST00000294952.8	37	c.1646	CCDS46278.1	2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.292677	0.80914	0.0	1.16E-4	ENSG00000162869	ENST00000281394;ENST00000294952	.	.	.	5.18	5.18	0.71444	.	0.051915	0.85682	D	0.000000	T	0.74566	0.3733	L	0.43923	1.385	0.80722	D	1	D;D;D	0.89917	1.0;0.973;1.0	D;P;D	0.91635	0.999;0.632;0.999	T	0.76372	-0.2983	9	0.66056	D	0.02	-18.7729	19.0379	0.92986	0.0:0.0:1.0:0.0	.	549;549;549	Q6ZMI0;Q6ZMI0-2;Q6ZMI0-3	PPR21_HUMAN;.;.	H	549	.	ENSP00000281394:R549H	R	+	2	0	KLRAQ1	48576368	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.089000	0.76909	2.563000	0.86464	0.591000	0.81541	CGC	-	pfam_KLRAQ/TTKRSYEDQ_C		0.423	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R21	protein_coding	OTTHUMT00000251238.4	G	NM_152994	rs144544742		48722864	+1	no_errors	ENST00000294952	ensembl	human	known	74_37	missense	SNP	1.000	A
OR52W1	120787	genome.wustl.edu	37	11	6221371	6221371	+	Silent	SNP	A	A	G			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr11:6221371A>G	ENST00000311352.2	+	1	996	c.918A>G	c.(916-918)agA>agG	p.R306R	RP11-290F24.6_ENST00000600308.1_lincRNA	NM_001005178.1	NP_001005178.1	Q6IF63	O52W1_HUMAN	olfactory receptor, family 52, subfamily W, member 1	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)	11		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;2.13e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCAGATCAGAGACCGACTCC	0.547																																																	0								ENSG00000175485						121.0	133.0	129.0					11																	6221371		2201	4296	6497	OR52W1	SO:0001819	synonymous_variant	0			-	HGNC	AB065511	CCDS31407.1	11p15.4	2012-08-09		2004-03-10	ENSG00000175485	ENSG00000175485		"""GPCR / Class A : Olfactory receptors"""	15239	protein-coding gene	gene with protein product				OR52W1P			Standard	NM_001005178		Approved		uc010qzz.2	Q6IF63	OTTHUMG00000165378	ENST00000311352.2:c.918A>G	11.37:g.6221371A>G		Somatic	0	44	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	18	53.85	Q8NH78	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.R306	ENST00000311352.2	37	c.918	CCDS31407.1	11																																																																																			-	NULL		0.547	OR52W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52W1	protein_coding	OTTHUMT00000383758.1	A	NM_001005178	-		6221371	+1	no_errors	ENST00000311352	ensembl	human	known	74_37	silent	SNP	0.072	G
ATXN1L	342371	genome.wustl.edu	37	16	71884767	71884768	+	Frame_Shift_Ins	INS	-	-	G			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr16:71884767_71884768insG	ENST00000427980.2	+	3	1417_1418	c.1124_1125insG	c.(1123-1128)gaggggfs	p.EG375fs	ATXN1L_ENST00000569119.1_Intron	NM_001137675.3	NP_001131147.1	P0C7T5	ATX1L_HUMAN	ataxin 1-like	375					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)	4						CATCAGGGTGAGGGGCGAGGGT	0.579																																																	0								ENSG00000224470																																			ATXN1L	SO:0001589	frameshift_variant	0				HGNC		CCDS45523.1	16q22.2	2014-09-04			ENSG00000224470	ENSG00000224470			33279	protein-coding gene	gene with protein product	"""brother of ataxin 1"""	614301				16121196, 17322884, 21475249	Standard	NM_001137675		Approved	BOAT1	uc002fbd.3	P0C7T5	OTTHUMG00000176872	ENST00000427980.2:c.1128dupG	16.37:g.71884771_71884771dupG	ENSP00000415822:p.Glu375fs	Somatic	0	25	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	4	76.47		Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Ataxin-1_HBP1,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.R377fs	ENST00000427980.2	37	c.1124_1125	CCDS45523.1	16																																																																																			-	NULL		0.579	ATXN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1L	protein_coding	OTTHUMT00000434171.1	-	NM_001137675.2			71884768	+1	no_errors	ENST00000427980	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:0.993	G
TRIM3	10612	genome.wustl.edu	37	11	6486813	6486813	+	Missense_Mutation	SNP	A	A	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr11:6486813A>T	ENST00000525074.1	-	2	507	c.113T>A	c.(112-114)cTg>cAg	p.L38Q	TRIM3_ENST00000536344.1_Intron|TRIM3_ENST00000359518.3_Missense_Mutation_p.L38Q|TRIM3_ENST00000345851.3_Missense_Mutation_p.L38Q|TRIM3_ENST00000537602.1_Missense_Mutation_p.L38Q	NM_001248006.1	NP_001234935.1	O75382	TRIM3_HUMAN	tripartite motif containing 3	38					nervous system development (GO:0007399)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|endosome (GO:0005768)	protein C-terminus binding (GO:0008022)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(3)	27		all_lung(207;9.97e-06)|Lung NSC(207;1.74e-05)|Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;9.34e-10)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.133)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAAGGTGTGCAGGCAAGGAAG	0.612																																					Melanoma(6;5 510 1540 25169 29084)												0								ENSG00000110171						212.0	159.0	177.0					11																	6486813		2201	4296	6497	TRIM3	SO:0001583	missense	0			-	HGNC	AF045239	CCDS7764.1, CCDS58115.1	11p15.5	2013-01-09	2011-01-25	2001-11-23	ENSG00000110171	ENSG00000110171		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10064	protein-coding gene	gene with protein product	"""ring finger protein 22"", ""brain expressed ring finger"", ""tripartite motif protein TRIM3"""	605493	"""tripartite motif-containing 3"""	RNF22		10391919	Standard	NM_006458		Approved	HAC1, BERP, RNF97	uc009yfd.3	O75382	OTTHUMG00000133405	ENST00000525074.1:c.113T>A	11.37:g.6486813A>T	ENSP00000433102:p.Leu38Gln	Somatic	0	38	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	19	51.22	B7Z5E6|F5H2Q8|Q4V9L4|Q9C038|Q9C039	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.L38Q	ENST00000525074.1	37	c.113	CCDS7764.1	11	.	.	.	.	.	.	.	.	.	.	A	22.4	4.282866	0.80692	.	.	ENSG00000110171	ENST00000530899;ENST00000525074;ENST00000545029;ENST00000345851;ENST00000336043;ENST00000537602;ENST00000359518;ENST00000528227;ENST00000529529	D;D;D;D;D;D	0.86164	-2.08;-2.08;-2.08;-2.08;-2.08;-2.08	4.76	4.76	0.60689	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.077155	0.53938	D	0.000050	D	0.87265	0.6134	N	0.21194	0.64	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84098	0.0394	10	0.18276	T	0.48	-12.8045	13.2423	0.60004	1.0:0.0:0.0:0.0	.	38	O75382	TRIM3_HUMAN	Q	38	ENSP00000433102:L38Q;ENSP00000340797:L38Q;ENSP00000441091:L38Q;ENSP00000352508:L38Q;ENSP00000433070:L38Q;ENSP00000437283:L38Q	ENSP00000337094:L38Q	L	-	2	0	TRIM3	6443389	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.121000	0.94375	2.004000	0.58718	0.477000	0.44152	CTG	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.612	TRIM3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRIM3	protein_coding	OTTHUMT00000384224.2	A	NM_006458	-		6486813	-1	no_errors	ENST00000345851	ensembl	human	known	74_37	missense	SNP	1.000	T
SLC15A5	729025	genome.wustl.edu	37	12	16392642	16392650	+	In_Frame_Del	DEL	CTCTCTTAG	CTCTCTTAG	-	rs375565160	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	CTCTCTTAG	CTCTCTTAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr12:16392642_16392650delCTCTCTTAG	ENST00000344941.3	-	5	1126_1134	c.1127_1135delCTAAGAGAG	c.(1126-1137)tctaagagagtt>ttt	p.376_379SKRV>F		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	376					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						AATGATCCAACTCTCTTAGAGGGAAACAG	0.397																																																	0								ENSG00000188991																																			SLC15A5	SO:0001651	inframe_deletion	0				HGNC			12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.1127_1135delCTAAGAGAG	12.37:g.16392642_16392650delCTCTCTTAG	ENSP00000340402:p.Ser376_Val379delinsPhe	Somatic	NA	NA	NA		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt	p.SKRV376in_frame_delF	ENST00000344941.3	37	c.1135_1127		12																																																																																			-	pfam_POT_fam,superfamily_MFS_dom_general_subst_transpt		0.397	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	protein_coding	OTTHUMT00000401119.2	CTCTCTTAG	XM_001129090			16392650	-1	no_errors	ENST00000344941	ensembl	human	novel	74_37	in_frame_del	DEL	0.139:0.131:0.134:0.147:0.147:0.137:0.102:0.054:0.068	-
LOC100631378	100631378	genome.wustl.edu	37	19	38321382	38321409	+	lincRNA	DEL	ATAGGCCAAGCATCTTACTGTATCCTTA	ATAGGCCAAGCATCTTACTGTATCCTTA	-	rs192500605|rs72463745	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	ATAGGCCAAGCATCTTACTGTATCCTTA	ATAGGCCAAGCATCTTACTGTATCCTTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr19:38321382_38321409delATAGGCCAAGCATCTTACTGTATCCTTA	ENST00000443870.1	+	0	1192_1219				AC016582.2_ENST00000592640.1_lincRNA																							GGGACCTCCCATAGGCCAAGCATCTTACTGTATCCTTACGGTCTGCTG	0.491														13	0.00259585	0.0008	0.0029	5008	,	,		29989	0.0		0.0099	False		,,,				2504	0.0																0								ENSG00000229481																																			CTD-2554C21.3			0				Clone_based_vega_gene																													19.37:g.38321382_38321409delATAGGCCAAGCATCTTACTGTATCCTTA		Somatic	NA	NA	NA		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000443870.1	37	NULL		19																																																																																			-	-		0.491	CTD-2554C21.3-001	KNOWN	basic	lincRNA	ENSG00000229481	lincRNA	OTTHUMT00000459795.1	ATAGGCCAAGCATCTTACTGTATCCTTA				38321409	+1	no_errors	ENST00000443870	ensembl	human	known	74_37	rna	DEL	0.908:0.956:0.955:0.942:0.994:1.000:1.000:1.000:1.000:1.000:0.996:0.874:0.272:0.255:0.272:0.267:0.257:0.049:0.002:0.000:0.144:0.255:0.332:0.326:0.001:0.000:0.000:0.000	-
IK	3550	genome.wustl.edu	37	5	140038905	140038905	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr5:140038905G>T	ENST00000417647.2	+	13	1321	c.1182G>T	c.(1180-1182)atG>atT	p.M394I		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	394					cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCAGCCCATGGACGTTGACA	0.493																																																	0								ENSG00000113141						120.0	111.0	114.0					5																	140038905		1999	4179	6178	IK	SO:0001583	missense	0			-	HGNC	BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.1182G>T	5.37:g.140038905G>T	ENSP00000396301:p.Met394Ile	Somatic	0	34	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	23	50.00	Q6IPD8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RED_N,pfam_RED_C	p.M394I	ENST00000417647.2	37	c.1182	CCDS47280.1	5	.	.	.	.	.	.	.	.	.	.	G	8.731	0.916694	0.17907	.	.	ENSG00000113141	ENST00000417647	.	.	.	5.47	0.135	0.14775	.	0.516795	0.22752	N	0.056068	T	0.25419	0.0618	N	0.12182	0.205	0.39076	D	0.960819	B	0.02656	0.0	B	0.01281	0.0	T	0.03981	-1.0987	9	0.34782	T	0.22	.	2.1977	0.03915	0.1546:0.1184:0.2512:0.4758	.	394	Q13123	RED_HUMAN	I	394	.	ENSP00000396301:M394I	M	+	3	0	IK	140019089	0.958000	0.32768	0.998000	0.56505	0.945000	0.59286	0.022000	0.13511	0.323000	0.23307	-0.126000	0.14955	ATG	-	NULL		0.493	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	IK	protein_coding	OTTHUMT00000372897.1	G	NM_006083	-		140038905	+1	no_errors	ENST00000417647	ensembl	human	known	74_37	missense	SNP	0.990	T
ANP32BP1	646791	genome.wustl.edu	37	15	75614887	75614887	+	RNA	SNP	G	G	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr15:75614887G>A	ENST00000564205.1	-	0	147									acidic (leucine-rich) nuclear phosphoprotein 32 family, member B pseudogene 1																		TTAACTTTCCGCAGCGGGGGC	0.642																																																	0								ENSG00000259790																																			ANP32BP1			0			-	HGNC			15q24.2	2014-02-12			ENSG00000259790	ENSG00000259790			24267	pseudogene	pseudogene							Standard	NG_022900		Approved				OTTHUMG00000172674		15.37:g.75614887G>A		Somatic	0	42	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	29	38.30		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564205.1	37	NULL		15																																																																																			-	-		0.642	ANP32BP1-002	KNOWN	basic	processed_transcript	ANP32BP1	pseudogene	OTTHUMT00000419801.1	G		-		75614887	-1	no_errors	ENST00000564205	ensembl	human	known	74_37	rna	SNP	0.017	A
DNM1P46	196968	genome.wustl.edu	37	15	100340305	100340305	+	RNA	SNP	T	T	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr15:100340305T>A	ENST00000341853.1	-	0	621					NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										ACGAGTGTCTTCTGGTTCCCA	0.612																																																	0								ENSG00000182397						19.0	22.0	21.0					15																	100340305		1301	3222	4523	DNM1P46			0			-	HGNC	AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100340305T>A		Somatic	0	46	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	37	9.76	Q3ZCN3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			-	-		0.612	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	pseudogene	OTTHUMT00000313543.1	T	NR_003260	-		100340305	-1	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	SNP	0.986	A
TP53	7157	genome.wustl.edu	37	17	7577568	7577568	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:7577568C>T	ENST00000269305.4	-	7	902	c.713G>A	c.(712-714)tGt>tAt	p.C238Y	TP53_ENST00000445888.2_Missense_Mutation_p.C238Y|TP53_ENST00000359597.4_Missense_Mutation_p.C238Y|TP53_ENST00000455263.2_Missense_Mutation_p.C238Y|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.C238Y|TP53_ENST00000420246.2_Missense_Mutation_p.C238Y	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	238	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> H (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C238Y(65)|p.C238F(46)|p.C238S(9)|p.0?(8)|p.?(5)|p.C145F(5)|p.C145Y(5)|p.M237_N239delMCN(4)|p.C238fs*21(1)|p.M237fs*1(1)|p.M144_N146delMCN(1)|p.C238del(1)|p.Y236_M243delYMCNSSCM(1)|p.V225fs*23(1)|p.H233fs*6(1)|p.C238_M246delCNSSCMGGM(1)|p.H233_C242del10(1)|p.N239_C242del(1)|p.C145S(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGAACTGTTACACATGTAGTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	158	Substitution - Missense(131)|Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Deletion - Frameshift(4)	breast(22)|ovary(17)|large_intestine(14)|haematopoietic_and_lymphoid_tissue(13)|endometrium(13)|lung(12)|upper_aerodigestive_tract(9)|pancreas(8)|soft_tissue(7)|urinary_tract(7)|oesophagus(7)|biliary_tract(6)|central_nervous_system(6)|liver(5)|bone(5)|stomach(4)|skin(2)|meninges(1)	GRCh37	CM034930	TP53	M		ENSG00000141510						132.0	103.0	113.0					17																	7577568		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.713G>A	17.37:g.7577568C>T	ENSP00000269305:p.Cys238Tyr	Somatic	0	53	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	0	100.00	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C238Y	ENST00000269305.4	37	c.713	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327056	0.81690	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99964	-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96;-9.96	4.09	4.09	0.47781	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99972	0.9991	M	0.92970	3.365	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.95847	0.8871	10	0.87932	D	0	-18.536	14.6088	0.68501	0.0:1.0:0.0:0.0	.	238;238;145;238;238;238	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	Y	238;238;238;238;238;238;227;145;106;145	ENSP00000410739:C238Y;ENSP00000352610:C238Y;ENSP00000269305:C238Y;ENSP00000398846:C238Y;ENSP00000391127:C238Y;ENSP00000391478:C238Y;ENSP00000425104:C106Y;ENSP00000423862:C145Y	ENSP00000269305:C238Y	C	-	2	0	TP53	7518293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.556000	0.82233	2.564000	0.86499	0.462000	0.41574	TGT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	C	NM_000546	-		7577568	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	1.000	T
DNAH17	8632	genome.wustl.edu	37	17	76503585	76503585	+	Silent	SNP	G	G	A	rs12943086	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:76503585G>A	ENST00000585328.1	-	28	4654	c.4530C>T	c.(4528-4530)ctC>ctT	p.L1510L	DNAH17_ENST00000389840.5_Silent_p.L1509L	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1509	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AGTCCCCCGGGAGCTGGGTGC	0.597																																																	0								ENSG00000187775						45.0	50.0	48.0					17																	76503585		2076	4241	6317	DNAH17	SO:0001819	synonymous_variant	0			-	HGNC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.4530C>T	17.37:g.76503585G>A		Somatic	0	40	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	15	51.61	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.L1509	ENST00000585328.1	37	c.4527		17																																																																																			-	pfam_Dynein_heavy_dom-2		0.597	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	protein_coding	OTTHUMT00000318962.2	G	NM_173628	-		76503585	-1	no_errors	ENST00000389840	ensembl	human	known	74_37	silent	SNP	0.970	A
LOC150776	150776	genome.wustl.edu	37	2	132278713	132278713	+	RNA	SNP	T	T	C	rs200714420	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr2:132278713T>C	ENST00000438378.2	+	0	3352					NR_026922.1																						AGATGGGTGCTGGTCCTCAGG	0.577													t|||	1647	0.328874	0.1346	0.4193	5008	,	,		17117	0.6597		0.2177	False		,,,				2504	0.3006																0								ENSG00000152117																																			AC093838.4			0			-	Clone_based_vega_gene																													2.37:g.132278713T>C		Somatic	0	11	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	9	35.71		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000438378.2	37	NULL		2																																																																																			-	-		0.577	AC093838.4-001	KNOWN	basic	processed_transcript	LOC150776	pseudogene	OTTHUMT00000331819.7	T		rs200714420		132278713	+1	no_errors	ENST00000438378	ensembl	human	known	74_37	rna	SNP	0.001	C
PRR5	55615	genome.wustl.edu	37	22	45110527	45110527	+	Missense_Mutation	SNP	T	T	G			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr22:45110527T>G	ENST00000336985.6	+	2	468	c.191T>G	c.(190-192)cTc>cGc	p.L64R	ARHGAP8_ENST00000389773.5_Missense_Mutation_p.L55R|PRR5_ENST00000006251.7_Missense_Mutation_p.L55R|PRR5_ENST00000403581.1_Missense_Mutation_p.L87R|PRR5-ARHGAP8_ENST00000352766.7_Missense_Mutation_p.L64R|ARHGAP8_ENST00000517296.3_Missense_Mutation_p.L64R|PRR5-ARHGAP8_ENST00000361473.5_Missense_Mutation_p.L64R|PRR5_ENST00000477331.1_3'UTR	NM_181333.3	NP_851850.1	P85299	PRR5_HUMAN	proline rich 5 (renal)	64	Interaction with RICTOR.				cell cycle (GO:0007049)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)	TORC2 complex (GO:0031932)				central_nervous_system(1)|endometrium(2)|lung(6)|prostate(1)|skin(1)	11		all_neural(38;0.00409)|Ovarian(80;0.024)|Glioma(61;0.0647)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)		GACCAGGAGCTCTTCAGCCTC	0.647																																																	0								ENSG00000241484						81.0	77.0	78.0					22																	45110527		2203	4300	6503	ARHGAP8	SO:0001583	missense	0			-	HGNC	AF177331	CCDS14058.1, CCDS14059.1, CCDS56232.1, CCDS74875.1	22q13.3	2011-02-10			ENSG00000186654	ENSG00000186654			31682	protein-coding gene	gene with protein product	"""protein observed with Rictor-1"""	609406				15718101, 17599906	Standard	NM_001017528		Approved	PP610, FLJ20185k, Protor-1		P85299	OTTHUMG00000150460	ENST00000336985.6:c.191T>G	22.37:g.45110527T>G	ENSP00000337464:p.Leu64Arg	Somatic	0	21	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	0	100.00	B1AHF6|B1AHG5|B3KP73|O75983|O95695|Q5BIW2|Q5EAJ8|Q5EAJ9|Q5XKJ6|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_HbrB,pfam_CRAL-TRIO_dom,superfamily_Rho_GTPase_activation_prot,superfamily_CRAL-TRIO_dom,smart_RhoGAP_dom,pfscan_CRAL-TRIO_dom,pfscan_RhoGAP_dom	p.L64R	ENST00000336985.6	37	c.191	CCDS14058.1	22	.	.	.	.	.	.	.	.	.	.	T	17.57	3.423569	0.62733	.	.	ENSG00000186654;ENSG00000186654;ENSG00000186654;ENSG00000186654;ENSG00000186654;ENSG00000186654;ENSG00000248405;ENSG00000248405;ENSG00000241484;ENSG00000241484	ENST00000432186;ENST00000006251;ENST00000403581;ENST00000336985;ENST00000403696;ENST00000457960;ENST00000361473;ENST00000352766;ENST00000517296;ENST00000389773	T;T;T;T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;1.46;-1.17;0.43;-1.17;-1.17;0.46	3.9	3.9	0.45041	.	0.000000	0.29722	N	0.011368	D	0.85427	0.5694	M	0.66939	2.045	0.28046	N	0.933544	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.91635	0.979;0.972;0.999;0.965	T	0.79184	-0.1908	10	0.87932	D	0	.	12.02	0.53337	0.0:0.0:0.0:1.0	.	87;64;64;64	B1AHF6;B1AHC4;B1AHC3;P85299	.;.;.;PRR5_HUMAN	R	55;55;87;64;64;55;64;64;64;55	ENSP00000400925:L55R;ENSP00000006251:L55R;ENSP00000384848:L87R;ENSP00000337464:L64R;ENSP00000384746:L64R;ENSP00000410215:L55R;ENSP00000354732:L64R;ENSP00000262731:L64R;ENSP00000429240:L64R;ENSP00000374423:L55R	ENSP00000262731:L64R	L	+	2	0	PRR5;PRR5-ARHGAP8;ARHGAP8	43489191	1.000000	0.71417	0.998000	0.56505	0.620000	0.37586	4.764000	0.62264	1.782000	0.52362	0.533000	0.62120	CTC	-	pfam_HbrB		0.647	PRR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP8	protein_coding	OTTHUMT00000318200.2	T	NM_001017528	-		45110527	+1	no_errors	ENST00000517296	ensembl	human	known	74_37	missense	SNP	1.000	G
ADCY1	107	genome.wustl.edu	37	7	45688271	45688271	+	Missense_Mutation	SNP	G	G	T	rs373262043		TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:45688271G>T	ENST00000297323.7	+	5	1045	c.1023G>T	c.(1021-1023)gaG>gaT	p.E341D	ADCY1_ENST00000432715.1_Missense_Mutation_p.E116D	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	341					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	CCCTGAAGGAGAACCACTGTC	0.602																																																	0								ENSG00000164742						91.0	78.0	83.0					7																	45688271		2203	4300	6503	ADCY1	SO:0001583	missense	0			-	HGNC	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.1023G>T	7.37:g.45688271G>T	ENSP00000297323:p.Glu341Asp	Somatic	0	34	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	22	31.25	A4D2L8|Q75MI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.E341D	ENST00000297323.7	37	c.1023	CCDS34631.1	7	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021953	0.35701	.	.	ENSG00000164742	ENST00000432715;ENST00000297323;ENST00000545300	D;D	0.81821	-1.54;-1.54	3.91	-0.411	0.12370	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	T	0.66446	0.2790	L	0.33668	1.02	0.49483	D	0.999792	B;B	0.09022	0.002;0.001	B;B	0.17433	0.006;0.018	T	0.54050	-0.8351	10	0.49607	T	0.09	.	6.8396	0.23955	0.6463:0.0:0.3537:0.0	.	341;116	Q08828;C9J1J0	ADCY1_HUMAN;.	D	116;341;341	ENSP00000392721:E116D;ENSP00000297323:E341D	ENSP00000297323:E341D	E	+	3	2	ADCY1	45654796	1.000000	0.71417	0.998000	0.56505	0.978000	0.69477	2.077000	0.41557	0.022000	0.15160	0.561000	0.74099	GAG	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase		0.602	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY1	protein_coding	OTTHUMT00000340055.2	G	NM_021116	-		45688271	+1	no_errors	ENST00000297323	ensembl	human	known	74_37	missense	SNP	0.995	T
NPAP1	23742	genome.wustl.edu	37	15	24924311	24924311	+	Silent	SNP	C	C	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr15:24924311C>T	ENST00000329468.2	+	1	3771	c.3297C>T	c.(3295-3297)tgC>tgT	p.C1099C		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	1099					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											AGAATTCATGCAGTGGTATGG	0.507																																																	0								ENSG00000185823						140.0	125.0	130.0					15																	24924311		2203	4300	6503	NPAP1	SO:0001819	synonymous_variant	0			-	HGNC	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.3297C>T	15.37:g.24924311C>T		Somatic	0	40	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	46	16.36		Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.C1099	ENST00000329468.2	37	c.3297	CCDS10015.1	15																																																																																			-	NULL		0.507	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	protein_coding	OTTHUMT00000251253.1	C	NM_018958	-		24924311	+1	no_errors	ENST00000329468	ensembl	human	known	74_37	silent	SNP	0.000	T
N4BP2L2	10443	genome.wustl.edu	37	13	33016602	33016602	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr13:33016602C>A	ENST00000504114.1	-	6	2118	c.2027G>T	c.(2026-2028)cGt>cTt	p.R676L	N4BP2L2_ENST00000380121.3_5'UTR|N4BP2L2_ENST00000399396.3_Missense_Mutation_p.R691L|N4BP2L2_ENST00000357505.6_Missense_Mutation_p.R676L|N4BP2L2_ENST00000446957.2_Missense_Mutation_p.R594L			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	0					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)	p.R691P(1)		kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		CTCAAGGGAACGGTAGTCAGT	0.398																																																	1	Substitution - Missense(1)	kidney(1)						ENSG00000244754						64.0	64.0	64.0					13																	33016602		1898	4148	6046	N4BP2L2	SO:0001583	missense	0			-	HGNC	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000504114.1:c.2027G>T	13.37:g.33016602C>A	ENSP00000427477:p.Arg676Leu	Somatic	0	42	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.16	A3KME8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase	p.R691L	ENST00000504114.1	37	c.2072		13	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976927	0.34848	.	.	ENSG00000139617;ENSG00000139617;ENSG00000244754;ENSG00000244754;ENSG00000244754;ENSG00000244754	ENST00000380121;ENST00000503296;ENST00000504114;ENST00000357505;ENST00000399396;ENST00000446957	D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14	5.34	-10.2	0.00374	.	1.817370	0.02661	N	0.107523	T	0.68897	0.3051	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.17268	0.0;0.021;0.0;0.0;0.0	B;B;B;B;B	0.22601	0.0;0.04;0.0;0.0;0.0	T	0.60722	-0.7207	10	0.87932	D	0	5.4106	2.2566	0.04057	0.1997:0.3347:0.3048:0.1609	.	676;691;574;594;574	B4DPY1;Q92802-3;Q96KV2;Q92802-2;Q9Y3H6	.;.;.;.;.	L	574;603;676;676;691;594	ENSP00000427477:R676L;ENSP00000350104:R676L;ENSP00000382328:R691L;ENSP00000394239:R594L	ENSP00000350104:R676L	R	-	2	0	N4BP2L2;RP11-298P3.4	31914602	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.321000	0.08018	-2.212000	0.00736	-0.324000	0.08512	CGT	-	NULL		0.398	N4BP2L2-004	PUTATIVE	basic	protein_coding	N4BP2L2	protein_coding	OTTHUMT00000361380.1	C	NM_014887	-		33016602	-1	no_errors	ENST00000399396	ensembl	human	known	74_37	missense	SNP	0.000	A
PPM1E	22843	genome.wustl.edu	37	17	56833457	56833457	+	Silent	SNP	G	G	C	rs3834568|rs201186780|rs74256772	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:56833457G>C	ENST00000308249.2	+	1	228	c.99G>C	c.(97-99)ccG>ccC	p.P33P		NM_014906.4	NP_055721.3	Q96MI6	PPM1M_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1E	0	PP2C-like.				protein dephosphorylation (GO:0006470)	nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)|manganese ion binding (GO:0030145)			biliary_tract(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)	33	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			agccggagccggaacccgaac	0.672																																																	0								ENSG00000175175						14.0	20.0	18.0					17																	56833457		2188	4284	6472	PPM1E	SO:0001819	synonymous_variant	0			-	HGNC	AB028995	CCDS11613.1	17q24.2	2012-04-17	2010-03-05		ENSG00000175175	ENSG00000175175		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19322	protein-coding gene	gene with protein product	"""partner of PIX 1"", ""nuclear calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1E (PP2C domain containing)"""			11864573, 10470851	Standard	NR_048561		Approved	POPX1, KIAA1072, PP2CH, CaMKP-N	uc002iwx.4	Q8WY54		ENST00000308249.2:c.99G>C	17.37:g.56833457G>C		Somatic	0	19	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	30	16.67	Q8N8J9|Q96DB8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.P33	ENST00000308249.2	37	c.99	CCDS11613.1	17																																																																																			-	NULL		0.672	PPM1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1E	protein_coding	OTTHUMT00000445458.1	G	NM_014906	rs74256772		56833457	+1	no_errors	ENST00000308249	ensembl	human	known	74_37	silent	SNP	0.984	C
DLGAP1	9229	genome.wustl.edu	37	18	3729210	3729210	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr18:3729210C>T	ENST00000315677.3	-	7	2111	c.1516G>A	c.(1516-1518)Gac>Aac	p.D506N	DLGAP1_ENST00000478161.1_5'UTR|DLGAP1_ENST00000584874.1_Missense_Mutation_p.D506N|DLGAP1_ENST00000581699.1_Missense_Mutation_p.D212N|DLGAP1_ENST00000400145.2_Missense_Mutation_p.D204N|DLGAP1_ENST00000515196.2_Missense_Mutation_p.D506N|DLGAP1_ENST00000539435.1_Missense_Mutation_p.D204N|DLGAP1_ENST00000400155.1_Missense_Mutation_p.D212N|DLGAP1_ENST00000581527.1_Missense_Mutation_p.D506N|DLGAP1_ENST00000400149.3_Missense_Mutation_p.D214N|DLGAP1_ENST00000400147.2_Missense_Mutation_p.D204N|DLGAP1_ENST00000534970.1_Missense_Mutation_p.D218N|DLGAP1_ENST00000400150.3_Missense_Mutation_p.D212N	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	506					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				ACGCACTCGTCGTCCTGGGAG	0.687																																																	0								ENSG00000170579						54.0	41.0	46.0					18																	3729210		2203	4299	6502	DLGAP1	SO:0001583	missense	0			-	HGNC	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.1516G>A	18.37:g.3729210C>T	ENSP00000316377:p.Asp506Asn	Somatic	0	43	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	38	51.90	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GKAP	p.D506N	ENST00000315677.3	37	c.1516	CCDS11836.1	18	.	.	.	.	.	.	.	.	.	.	C	18.74	3.689378	0.68271	.	.	ENSG00000170579	ENST00000315677;ENST00000400147;ENST00000400150;ENST00000400149;ENST00000400155;ENST00000534970;ENST00000539435;ENST00000400145;ENST00000515196	T;D;D;D;D;D;D;T;T	0.87966	2.32;-2.32;-2.32;-2.32;-2.32;-2.32;-2.32;1.59;2.32	5.9	5.9	0.94986	.	0.105150	0.64402	D	0.000004	D	0.91673	0.7368	M	0.75615	2.305	0.58432	D	0.999993	D;D;P;D;P;D;P;P;D	0.59767	0.957;0.976;0.944;0.957;0.944;0.986;0.876;0.944;0.967	B;P;P;B;B;P;B;P;P	0.53313	0.284;0.51;0.533;0.284;0.428;0.704;0.381;0.533;0.723	D	0.92046	0.5644	10	0.87932	D	0	-33.1494	20.2821	0.98520	0.0:1.0:0.0:0.0	.	506;218;192;212;204;506;204;506;204	B7Z9Y4;B7Z2H2;B7Z2J5;A8MWN8;B7Z2I2;Q6IS01;O14490-3;O14490;O14490-2	.;.;.;.;.;.;.;DLGP1_HUMAN;.	N	506;204;212;214;212;218;204;204;506	ENSP00000316377:D506N;ENSP00000383011:D204N;ENSP00000383014:D212N;ENSP00000383013:D214N;ENSP00000383019:D212N;ENSP00000437817:D218N;ENSP00000446312:D204N;ENSP00000383010:D204N;ENSP00000445973:D506N	ENSP00000316377:D506N	D	-	1	0	DLGAP1	3719210	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.083000	0.71326	2.786000	0.95864	0.563000	0.77884	GAC	-	NULL		0.687	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	protein_coding	OTTHUMT00000254394.4	C		-		3729210	-1	no_errors	ENST00000315677	ensembl	human	known	74_37	missense	SNP	1.000	T
AL162430.1	0	genome.wustl.edu	37	1	51656628	51656629	+	RNA	INS	-	-	A	rs191510247|rs200336691	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr1:51656628_51656629insA	ENST00000408565.1	+	0	74_75				AL162430.2_ENST00000459498.1_RNA														p.0?(2)									aacctggtctcaaaaaaaacaa	0.465													|||unknown(LONG_INSERTION)	19	0.00379393	0.0098	0.0014	5008	,	,		14847	0.003		0.002	False		,,,				2504	0.0																2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)						ENSG00000221492																																			AL162430.1			0				Clone_based_ensembl_gene																													1.37:g.51656636_51656636dupA		Somatic	0	30	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	16	46.67		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408565.1	37	NULL		1																																																																																			-	-		0.465	AL162430.1-201	NOVEL	basic	miRNA	ENSG00000221492	miRNA		-				51656629	+1	no_errors	ENST00000408565	ensembl	human	novel	74_37	rna	INS	0.273:0.275	A
PTX4	390667	genome.wustl.edu	37	16	1537837	1537837	+	Silent	SNP	C	C	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr16:1537837C>A	ENST00000447419.2	-	2	301	c.276G>T	c.(274-276)cgG>cgT	p.R92R	PTX4_ENST00000440447.2_Silent_p.R92R|PTX4_ENST00000293922.1_Silent_p.R87R			Q96A99	PTX4_HUMAN	pentraxin 4, long	92			R -> W (in dbSNP:rs2745101).			extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						AGGCCTGTGACCGGTTGACTG	0.652																																																	0								ENSG00000251692						74.0	77.0	76.0					16																	1537837		2199	4296	6495	PTX4	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.276G>T	16.37:g.1537837C>A		Somatic	0	50	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	80	31.03		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Pentaxin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.R92	ENST00000447419.2	37	c.276		16																																																																																			-	NULL		0.652	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PTX4	protein_coding	OTTHUMT00000432526.1	C	NM_001013658	-		1537837	-1	no_errors	ENST00000447419	ensembl	human	known	74_37	silent	SNP	0.028	A
ABCA13	154664	genome.wustl.edu	37	7	48335445	48335445	+	Missense_Mutation	SNP	A	A	C	rs193205599		TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:48335445A>C	ENST00000435803.1	+	21	9128	c.9104A>C	c.(9103-9105)cAg>cCg	p.Q3035P		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3035					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GAGACGGTGCAGCAGCACTTG	0.478																																																	0								ENSG00000179869						154.0	159.0	157.0					7																	48335445		1940	4132	6072	ABCA13	SO:0001583	missense	0			-	HGNC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.9104A>C	7.37:g.48335445A>C	ENSP00000411096:p.Gln3035Pro	Somatic	0	41	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	26	45.83	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Q3035P	ENST00000435803.1	37	c.9104	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	A	11.17	1.558727	0.27827	.	.	ENSG00000179869	ENST00000435803	D	0.86956	-2.19	5.49	-3.71	0.04424	.	0.436908	0.19324	N	0.117049	T	0.72558	0.3475	L	0.34521	1.04	0.09310	N	0.999999	B;B	0.11235	0.004;0.002	B;B	0.11329	0.006;0.003	T	0.57883	-0.7734	10	0.56958	D	0.05	.	0.4874	0.00558	0.3563:0.2556:0.1404:0.2477	.	737;3035	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	P	3035	ENSP00000411096:Q3035P	ENSP00000411096:Q3035P	Q	+	2	0	ABCA13	48305991	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	0.206000	0.17375	-0.961000	0.03609	0.533000	0.62120	CAG	-	NULL		0.478	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	protein_coding	OTTHUMT00000341964.2	A	NM_152701	-		48335445	+1	no_errors	ENST00000435803	ensembl	human	known	74_37	missense	SNP	0.000	C
FTCD	10841	genome.wustl.edu	37	21	47558841	47558841	+	Intron	SNP	C	C	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr21:47558841C>T	ENST00000291670.5	-	11	1304				FTCD_ENST00000397743.1_Intron|FTCD_ENST00000359679.2_Intron|FTCD_ENST00000355384.2_Intron|FTCD_ENST00000498355.2_Intron|FTCD_ENST00000397746.3_Intron|FTCD_ENST00000397748.1_Intron	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase						cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	TTGCTTCCTGCCATAAAGAGA	0.627																																																	0								ENSG00000160282						56.0	61.0	59.0					21																	47558841		2203	4299	6502	FTCD	SO:0001627	intron_variant	0			-	HGNC	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.1261-4G>A	21.37:g.47558841C>T		Somatic	0	46	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	54	10.00	B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000291670.5	37	NULL	CCDS13731.1	21																																																																																			-	-		0.627	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	protein_coding	OTTHUMT00000206962.1	C	NM_006657	-		47558841	-1	no_errors	ENST00000488577	ensembl	human	known	74_37	rna	SNP	0.549	T
EP400	57634	genome.wustl.edu	37	12	132547087	132547087	+	Silent	SNP	G	G	A	rs12366766	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr12:132547087G>A	ENST00000333577.4	+	48	8392	c.8283G>A	c.(8281-8283)caG>caA	p.Q2761Q	EP400_ENST00000332482.4_Silent_p.Q2688Q|EP400_ENST00000330386.6_Silent_p.Q2644Q|EP400_ENST00000389562.2_Silent_p.Q2724Q|EP400_ENST00000389561.2_Silent_p.Q2725Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2761	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2724Q(16)|p.Q2725Q(1)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcagcagcaacaacagc	0.562													G|||	37	0.00738818	0.0038	0.0072	5008	,	,		15585	0.002		0.0149	False		,,,				2504	0.0102																17	Substitution - coding silent(17)	prostate(4)|kidney(4)|central_nervous_system(3)|lung(3)|endometrium(2)|urinary_tract(1)						ENSG00000183495						28.0	31.0	30.0					12																	132547087		2199	4282	6481	EP400	SO:0001819	synonymous_variant	0			-	HGNC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8283G>A	12.37:g.132547087G>A		Somatic	0	26	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	28	17.65	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2761	ENST00000333577.4	37	c.8283		12																																																																																			-	NULL		0.562	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	protein_coding		G	NM_015409	rs12366766		132547087	+1	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	SNP	1.000	A
NELFB	25920	genome.wustl.edu	37	9	140150511	140150511	+	Frame_Shift_Del	DEL	G	G	-			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr9:140150511delG	ENST00000343053.4	+	2	592	c.255delG	c.(253-255)aagfs	p.K85fs		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	85					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CGGAGGGGAAGGCTGAGGAAA	0.622																																																	0								ENSG00000188986						56.0	58.0	58.0					9																	140150511		2203	4299	6502	NELFB	SO:0001589	frameshift_variant	0				HGNC	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.255delG	9.37:g.140150511delG	ENSP00000339495:p.Lys85fs	Somatic	0	21	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	14	46.15	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_COBRA1	p.A86fs	ENST00000343053.4	37	c.255	CCDS7040.1	9																																																																																			-	NULL		0.622	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELFB	protein_coding	OTTHUMT00000254710.1	G	NM_015456			140150511	+1	no_errors	ENST00000343053	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
LINC01330	646168	genome.wustl.edu	37	3	167630632	167630632	+	lincRNA	SNP	A	A	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr3:167630632A>T	ENST00000481578.1	+	0	431																											TCCCAAGGAAAAGAGTTCTTG	0.363																																																	0								ENSG00000244227																																			RP11-298O21.5			0			-	Clone_based_vega_gene																													3.37:g.167630632A>T		Somatic	0	77	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	68	45.16		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			-	-		0.363	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	lincRNA	OTTHUMT00000351188.1	A		-		167630632	+1	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	SNP	0.937	T
FAM83B	222584	genome.wustl.edu	37	6	54805246	54805246	+	Missense_Mutation	SNP	C	C	T	rs373419492		TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr6:54805246C>T	ENST00000306858.7	+	5	1593	c.1477C>T	c.(1477-1479)Cgt>Tgt	p.R493C	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	493										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					GTCATTCCTACGTAACTGGAG	0.408																																																	0								ENSG00000168143	C	CYS/ARG	0,4406		0,0,2203	93.0	93.0	93.0		1477	5.6	1.0	6		93	1,8599	1.2+/-3.3	0,1,4299	no	missense	FAM83B	NM_001010872.1	180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	493/1012	54805246	1,13005	2203	4300	6503	FAM83B	SO:0001583	missense	0			-	HGNC	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1477C>T	6.37:g.54805246C>T	ENSP00000304078:p.Arg493Cys	Somatic	0	28	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	3	87.50	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1669	p.R493C	ENST00000306858.7	37	c.1477	CCDS34479.1	6	.	.	.	.	.	.	.	.	.	.	C	22.2	4.264202	0.80358	0.0	1.16E-4	ENSG00000168143	ENST00000306858	T	0.35421	1.31	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.43897	0.1268	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.44081	-0.9351	10	0.87932	D	0	-18.1053	19.8898	0.96926	0.0:1.0:0.0:0.0	.	493	Q5T0W9	FA83B_HUMAN	C	493	ENSP00000304078:R493C	ENSP00000304078:R493C	R	+	1	0	FAM83B	54913205	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	4.365000	0.59486	2.775000	0.95449	0.655000	0.94253	CGT	-	NULL		0.408	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	protein_coding	OTTHUMT00000040994.1	C	XM_294139	-		54805246	+1	no_errors	ENST00000306858	ensembl	human	known	74_37	missense	SNP	1.000	T
PRRT3	285368	genome.wustl.edu	37	3	9990873	9990873	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr3:9990873C>A	ENST00000412055.1	-	2	1056	c.927G>T	c.(925-927)caG>caT	p.Q309H	PRRT3-AS1_ENST00000431558.1_RNA|PRRT3_ENST00000411976.2_Missense_Mutation_p.Q309H	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	309	Pro-rich.					integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						GAAGGTCAGCCTGCTTGGGCG	0.642																																																	0								ENSG00000163704						66.0	75.0	72.0					3																	9990873		1951	4143	6094	PRRT3	SO:0001583	missense	0			-	HGNC	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.927G>T	3.37:g.9990873C>A	ENSP00000392511:p.Gln309His	Somatic	0	11	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	12	53.85	Q49AD0|Q6UXY6|Q8NBC9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q309H	ENST00000412055.1	37	c.927	CCDS43049.1	3	.	.	.	.	.	.	.	.	.	.	C	15.11	2.737495	0.49045	.	.	ENSG00000163704	ENST00000412055;ENST00000411976	T;T	0.22743	2.28;1.94	3.41	2.5	0.30297	.	0.463064	0.16228	N	0.223737	T	0.21022	0.0506	L	0.32530	0.975	0.09310	N	1	P;P	0.47677	0.899;0.681	P;B	0.50490	0.642;0.371	T	0.05289	-1.0894	9	.	.	.	-0.9681	7.8927	0.29688	0.2461:0.7539:0.0:0.0	.	309;309	Q5FWE3-3;Q5FWE3	.;PRRT3_HUMAN	H	309	ENSP00000392511:Q309H;ENSP00000404512:Q309H	.	Q	-	3	2	PRRT3	9965873	0.003000	0.15002	0.006000	0.13384	0.084000	0.17831	0.864000	0.27926	0.982000	0.38575	0.655000	0.94253	CAG	-	NULL		0.642	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT3	protein_coding	OTTHUMT00000339322.1	C	NM_207351	-		9990873	-1	no_errors	ENST00000295984	ensembl	human	known	74_37	missense	SNP	0.010	A
C1orf87	127795	genome.wustl.edu	37	1	60499211	60499211	+	Missense_Mutation	SNP	G	G	C			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr1:60499211G>C	ENST00000371201.3	-	7	1073	c.966C>G	c.(964-966)gaC>gaG	p.D322E	C1orf87_ENST00000450089.2_Intron	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87	322							calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GATTGAGATTGTCTATGTTGA	0.448																																					NSCLC(75;811 1386 4923 13371 51772)												0								ENSG00000162598						218.0	197.0	204.0					1																	60499211		2203	4300	6503	C1orf87	SO:0001583	missense	0			-	HGNC	AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.966C>G	1.37:g.60499211G>C	ENSP00000360244:p.Asp322Glu	Somatic	0	70	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	60	14.29	Q6ZU07|Q8IVS0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D322E	ENST00000371201.3	37	c.966	CCDS614.1	1	.	.	.	.	.	.	.	.	.	.	G	0.054	-1.240830	0.01493	.	.	ENSG00000162598	ENST00000371201	T	0.38560	1.13	5.11	-4.86	0.03132	EF-hand-like domain (1);	0.367187	0.23380	N	0.048814	T	0.11153	0.0272	N	0.02539	-0.55	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.33240	-0.9876	10	0.07030	T	0.85	-3.7198	7.0061	0.24838	0.0:0.1803:0.3964:0.4233	.	322	Q8N0U7	CA087_HUMAN	E	322	ENSP00000360244:D322E	ENSP00000360244:D322E	D	-	3	2	C1orf87	60271799	0.017000	0.18338	0.000000	0.03702	0.793000	0.44817	-0.168000	0.09925	-0.764000	0.04651	-2.093000	0.00369	GAC	-	NULL		0.448	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf87	protein_coding	OTTHUMT00000024943.1	G	NM_152377	-		60499211	-1	no_errors	ENST00000371201	ensembl	human	known	74_37	missense	SNP	0.000	C
GAS8	2622	genome.wustl.edu	37	16	90095596	90095596	+	Intron	SNP	A	A	G	rs55742939	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr16:90095596A>G	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.I52T	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		ggggcaggctatggggcagcc	0.662													a|||	2317	0.46266	0.3767	0.4611	5008	,	,		15261	0.63		0.3757	False		,,,				2504	0.4969																0								ENSG00000221819						20.0	22.0	22.0					16																	90095596		2196	4299	6495	C16orf3	SO:0001627	intron_variant	0			-	HGNC	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1466A>G	16.37:g.90095596A>G		Somatic	0	42	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I52T	ENST00000268699.4	37	c.155	CCDS10992.1	16	.	.	.	.	.	.	.	.	.	.	a	0.042	-1.279284	0.01410	.	.	ENSG00000221819	ENST00000408886	T	0.51817	0.69	.	.	.	.	.	.	.	.	T	0.17280	0.0415	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14531	-1.0469	6	.	.	.	.	.	.	.	rs55742939	60	O95177	CP003_HUMAN	T	52	ENSP00000386218:I52T	.	I	-	2	0	C16orf3	88623097	0.006000	0.16342	0.000000	0.03702	0.009000	0.06853	-1.935000	0.01550	-2.550000	0.00480	-1.973000	0.00462	ATA	-	NULL		0.662	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf3	protein_coding	OTTHUMT00000272877.2	A		rs55742939		90095596	-1	no_errors	ENST00000408886	ensembl	human	known	74_37	missense	SNP	0.000	G
FTCD	10841	genome.wustl.edu	37	21	47558805	47558805	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr21:47558805C>A	ENST00000291670.5	-	11	1336	c.1293G>T	c.(1291-1293)gaG>gaT	p.E431D	FTCD_ENST00000397743.1_Intron|FTCD_ENST00000359679.2_Missense_Mutation_p.E431D|FTCD_ENST00000355384.2_Intron|FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000397746.3_Missense_Mutation_p.E431D|FTCD_ENST00000397748.1_Missense_Mutation_p.E431D	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	431	Cyclodeaminase/cyclohydrolase. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	TGTCCTTTTCCTCAGGTGTGT	0.642																																																	0								ENSG00000160282						75.0	84.0	81.0					21																	47558805		2203	4300	6503	FTCD	SO:0001583	missense	0			-	HGNC	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.1293G>T	21.37:g.47558805C>A	ENSP00000291670:p.Glu431Asp	Somatic	0	41	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	50	9.09	B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Formiminotransferase_N,pfam_Formiminotransferase_C,pfam_Cyclodeamin/CycHdrlase,superfamily_FormiminoTrfase_N/C_subdom,superfamily_Cyclodeamin/CycHdrlase,tigrfam_Formiminotransferase_cat	p.E431D	ENST00000291670.5	37	c.1293	CCDS13731.1	21	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252186	0.39797	.	.	ENSG00000160282	ENST00000291670;ENST00000397748;ENST00000359679;ENST00000397746	T;T;T;T	0.56941	0.43;0.43;0.43;0.43	3.79	1.89	0.25635	Cyclodeaminase/cyclohydrolase (2);	0.119766	0.56097	D	0.000039	T	0.44540	0.1298	L	0.60904	1.88	0.80722	D	1	B;B	0.16166	0.016;0.007	B;B	0.15484	0.013;0.013	T	0.32322	-0.9911	10	0.46703	T	0.11	.	7.8629	0.29520	0.0:0.8032:0.0:0.1968	.	431;431	O95954-2;O95954	.;FTCD_HUMAN	D	431	ENSP00000291670:E431D;ENSP00000380856:E431D;ENSP00000352707:E431D;ENSP00000380854:E431D	ENSP00000291670:E431D	E	-	3	2	FTCD	46383233	0.980000	0.34600	0.889000	0.34880	0.869000	0.49853	0.031000	0.13710	0.318000	0.23185	0.563000	0.77884	GAG	-	pfam_Cyclodeamin/CycHdrlase,superfamily_Cyclodeamin/CycHdrlase		0.642	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FTCD	protein_coding	OTTHUMT00000206962.1	C	NM_006657	-		47558805	-1	no_errors	ENST00000359679	ensembl	human	known	74_37	missense	SNP	1.000	A
KLHL41	10324	genome.wustl.edu	37	2	170371121	170371121	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr2:170371121C>A	ENST00000284669.1	+	2	1225	c.1148C>A	c.(1147-1149)cCt>cAt	p.P383H	RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.P321H|KLHL41_ENST00000463400.1_3'UTR|BBS5_ENST00000554017.1_Missense_Mutation_p.P321H	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	383					myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											GGACTTCCACCTCTGCCTTCA	0.433																																																	0								ENSG00000239474						98.0	96.0	97.0					2																	170371121		2203	4300	6503	KLHL41	SO:0001583	missense	0			-	HGNC	AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.1148C>A	2.37:g.170371121C>A	ENSP00000284669:p.Pro383His	Somatic	0	27	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	15	59.46	Q53R42	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.P383H	ENST00000284669.1	37	c.1148	CCDS2234.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.135069	0.94517	.	.	ENSG00000163093;ENSG00000251569;ENSG00000239474	ENST00000554017;ENST00000513963;ENST00000284669	T;T;T	0.69926	-0.44;-0.44;-0.44	6.02	6.02	0.97574	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.81269	0.4787	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	0.991;1.0	P;D	0.74023	0.72;0.982	T	0.80525	-0.1344	10	0.62326	D	0.03	.	20.5373	0.99239	0.0:1.0:0.0:0.0	.	321;383	E9PBE3;O60662	.;KBTBA_HUMAN	H	321;321;383	ENSP00000452313:P321H;ENSP00000424363:P321H;ENSP00000284669:P383H	ENSP00000284669:P383H	P	+	2	0	BBS5;RP11-724O16.1;KBTBD10	170079367	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.750000	0.85110	2.857000	0.98124	0.650000	0.86243	CCT	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.433	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL41	protein_coding	OTTHUMT00000255263.1	C	NM_006063	-		170371121	+1	no_errors	ENST00000284669	ensembl	human	known	74_37	missense	SNP	1.000	A
SPATA31D1	389763	genome.wustl.edu	37	9	84606723	84606723	+	Nonsense_Mutation	SNP	C	C	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr9:84606723C>A	ENST00000344803.2	+	4	1385	c.1338C>A	c.(1336-1338)taC>taA	p.Y446*		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	446					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGCCAAACTACCAACTAAATT	0.413																																																	0								ENSG00000214929						92.0	84.0	86.0					9																	84606723		1901	4111	6012	SPATA31D1	SO:0001587	stop_gained	0			-	HGNC		CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.1338C>A	9.37:g.84606723C>A	ENSP00000341988:p.Tyr446*	Somatic	0	47	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	55	37.50		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Y446*	ENST00000344803.2	37	c.1338	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	16.65	3.181661	0.57800	.	.	ENSG00000214929	ENST00000344803	.	.	.	2.74	-1.5	0.08691	.	1.699700	0.03286	N	0.186977	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	2.7248	3.2835	0.06924	0.0:0.372:0.2144:0.4136	.	.	.	.	X	446	.	ENSP00000341988:Y446X	Y	+	3	2	FAM75D1	83796543	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.007000	0.13174	-0.339000	0.08401	-0.311000	0.09066	TAC	-	NULL		0.413	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	protein_coding	OTTHUMT00000402325.1	C	NM_001001670	-		84606723	+1	no_errors	ENST00000344803	ensembl	human	known	74_37	nonsense	SNP	0.000	A
LINC01446	401337	genome.wustl.edu	37	7	53879544	53879544	+	lincRNA	SNP	G	G	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:53879544G>T	ENST00000380970.2	-	0	80					NR_038371.1																						cagcaggagaggaagcaaccg	0.637																																																	0								ENSG00000205628																																			GS1-179L18.1			0			-	Clone_based_vega_gene																													7.37:g.53879544G>T		Somatic	0	11	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	9	50.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000380970.2	37	NULL		7																																																																																			-	-		0.637	GS1-179L18.1-001	KNOWN	basic	lincRNA	FLJ45974	lincRNA	OTTHUMT00000342819.1	G		-		53879544	-1	no_errors	ENST00000380970	ensembl	human	known	74_37	rna	SNP	0.103	T
KRT32	3882	genome.wustl.edu	37	17	39619137	39619137	+	Silent	SNP	G	G	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:39619137G>T	ENST00000225899.3	-	6	1265	c.1162C>A	c.(1162-1164)Cgg>Agg	p.R388R		NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	388	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				CCCTCCAGCCGGGCCCGGACG	0.637																																																	0								ENSG00000108759						76.0	76.0	76.0					17																	39619137		2203	4300	6503	KRT32	SO:0001819	synonymous_variant	0			-	HGNC	X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.1162C>A	17.37:g.39619137G>T		Somatic	0	39	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	21	55.32		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.R388	ENST00000225899.3	37	c.1162	CCDS11393.1	17																																																																																			-	pfam_IF		0.637	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT32	protein_coding	OTTHUMT00000257293.1	G	NM_002278	-		39619137	-1	no_errors	ENST00000225899	ensembl	human	known	74_37	silent	SNP	0.999	T
CTTN	2017	genome.wustl.edu	37	11	70269070	70269070	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr11:70269070A>G	ENST00000301843.8	+	12	1132	c.926A>G	c.(925-927)aAg>aGg	p.K309R	CTTN_ENST00000538675.1_5'UTR|CTTN_ENST00000346329.3_Missense_Mutation_p.K272R|CTTN_ENST00000376561.3_Missense_Mutation_p.K272R	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	309					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		TTCGGCGGGAAGTATGGGGTG	0.567																																																	0								ENSG00000085733						179.0	151.0	160.0					11																	70269070		2200	4294	6494	CTTN	SO:0001583	missense	0			-	HGNC	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.926A>G	11.37:g.70269070A>G	ENSP00000301843:p.Lys309Arg	Somatic	0	99	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	40	48.72	Q8N707|Q96H99	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hs1_Cortactin,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_Hs1_Cortactin,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.K309R	ENST00000301843.8	37	c.926	CCDS41680.1	11	.	.	.	.	.	.	.	.	.	.	A	16.66	3.185225	0.57909	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561	T;T;T	0.36520	1.33;1.38;1.25	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	T	0.41465	0.1160	M	0.63843	1.955	0.80722	D	1	P;B;B	0.34639	0.461;0.027;0.309	B;B;B	0.39904	0.198;0.075;0.313	T	0.24977	-1.0145	10	0.29301	T	0.29	-29.2198	15.0683	0.72014	1.0:0.0:0.0:0.0	.	272;309;272	Q96H99;Q14247;Q8N707	.;SRC8_HUMAN;.	R	272;309;272	ENSP00000317189:K272R;ENSP00000301843:K309R;ENSP00000365745:K272R	ENSP00000301843:K309R	K	+	2	0	CTTN	69946718	1.000000	0.71417	0.083000	0.20561	0.847000	0.48162	6.638000	0.74309	1.966000	0.57179	0.533000	0.62120	AAG	-	pfam_Hs1_Cortactin,pfscan_Hs1_Cortactin		0.567	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTN	protein_coding	OTTHUMT00000259233.2	A	NM_138565	-		70269070	+1	no_errors	ENST00000301843	ensembl	human	known	74_37	missense	SNP	0.997	G
ALOX15B	247	genome.wustl.edu	37	17	7945777	7945777	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr17:7945777G>T	ENST00000380183.4	+	4	679	c.540G>T	c.(538-540)aaG>aaT	p.K180N	ALOX15B_ENST00000572022.1_Missense_Mutation_p.K180N|ALOX15B_ENST00000380173.2_Missense_Mutation_p.K180N|ALOX15B_ENST00000573359.1_Missense_Mutation_p.K180N	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	180	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						CCACAGCCAAGAATGCCAACT	0.552																																																	0								ENSG00000179593						123.0	106.0	111.0					17																	7945777		2203	4300	6503	ALOX15B	SO:0001583	missense	0			-	HGNC	U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.540G>T	17.37:g.7945777G>T	ENSP00000369530:p.Lys180Asn	Somatic	0	17	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	1	90.00	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C	p.K180N	ENST00000380183.4	37	c.540	CCDS11128.1	17	.	.	.	.	.	.	.	.	.	.	G	20.7	4.032244	0.75504	.	.	ENSG00000179593	ENST00000380173;ENST00000339694;ENST00000380183	D;D	0.92397	-3.03;-3.03	4.39	3.4	0.38934	Lipoxygenase, C-terminal (2);	0.235941	0.43416	D	0.000563	D	0.96337	0.8805	H	0.95224	3.64	0.34432	D	0.698676	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.81914	0.988;0.995;0.995;0.988	D	0.96758	0.9559	10	0.87932	D	0	-34.4467	6.1622	0.20370	0.2034:0.0:0.7965:0.0	.	180;180;180;180	B4DNW8;O15296-2;O15296-4;O15296	.;.;.;LX15B_HUMAN	N	180	ENSP00000369520:K180N;ENSP00000369530:K180N	ENSP00000344337:K180N	K	+	3	2	ALOX15B	7886502	1.000000	0.71417	0.389000	0.26208	0.408000	0.30992	3.011000	0.49567	2.135000	0.66039	0.561000	0.74099	AAG	-	superfamily_LipOase_C		0.552	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15B	protein_coding	OTTHUMT00000226985.2	G		-		7945777	+1	no_errors	ENST00000380183	ensembl	human	known	74_37	missense	SNP	0.878	T
NLRC3	197358	genome.wustl.edu	37	16	3614642	3614642	+	RNA	SNP	A	A	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr16:3614642A>T	ENST00000301749.7	-	0	701				NLRC3_ENST00000419350.2_RNA|NLRC3_ENST00000324659.8_RNA|NLRC3_ENST00000448023.2_RNA|NLRC3_ENST00000603507.1_RNA|NLRC3_ENST00000359128.5_RNA	NM_178844.2	NP_849172.2	Q7RTR2	NLRC3_HUMAN	NLR family, CARD domain containing 3						I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of protein ubiquitination (GO:0031396)|response to lipopolysaccharide (GO:0032496)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|liver(1)|lung(16)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CCTCAGCTGCAGGTCCGTCAG	0.721																																																	0								ENSG00000167984						15.0	19.0	18.0					16																	3614642		1993	4087	6080	NLRC3			0			-	HGNC	BK001112	CCDS73817.1	16p13.3	2014-03-25			ENSG00000167984	ENSG00000167984		"""Nucleotide-binding domain and leucine rich repeat containing"""	29889	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 3"", ""NOD-like receptor C3"""	615648				15705585, 12766759	Standard	NM_178844		Approved	CLR16.2, FLJ00348, NOD3	uc010btn.3	Q7RTR2	OTTHUMG00000177561		16.37:g.3614642A>T		Somatic	0	29	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	68	9.33	Q5EY36|Q8NF48|Q8NI01|Q8NI02|Q8TEL3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase	p.L146Q	ENST00000301749.7	37	c.437		16	.	.	.	.	.	.	.	.	.	.	A	10.85	1.467901	0.26335	.	.	ENSG00000167984	ENST00000419350;ENST00000301749;ENST00000359128;ENST00000448023	T;T;T	0.70516	-0.45;-0.49;-0.47	4.9	4.9	0.64082	.	0.169554	0.39615	N	0.001304	T	0.73164	0.3552	.	.	.	0.24306	N	0.995102	D	0.89917	1.0	D	0.69307	0.963	T	0.62006	-0.6945	9	0.14656	T	0.56	.	7.3059	0.26447	0.9006:0.0:0.0994:0.0	.	146	C9JLH9	.	Q	99;99;99;146	ENSP00000301749:L99Q;ENSP00000352039:L99Q;ENSP00000414415:L146Q	ENSP00000301749:L99Q	L	-	2	0	NLRC3	3554643	1.000000	0.71417	0.997000	0.53966	0.924000	0.55760	7.147000	0.77382	1.832000	0.53329	0.533000	0.62120	CTG	-	superfamily_P-loop_NTPase		0.721	NLRC3-201	KNOWN	basic|appris_principal	protein_coding	NLRC3	polymorphic_pseudogene		A	NM_178844	-		3614642	-1	no_errors	ENST00000448023	ensembl	human	known	74_37	missense	SNP	1.000	T
KCP	375616	genome.wustl.edu	37	7	128547390	128547390	+	RNA	SNP	G	G	A	rs560712849	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:128547390G>A	ENST00000476647.2	-	0	379				AC025594.1_ENST00000408474.1_RNA			Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						CTGTGCAGGCGTCAGGCTCCC	0.701													G|||	5	0.000998403	0.0023	0.0	5008	,	,		16773	0.0		0.001	False		,,,				2504	0.001																0								ENSG00000135253						23.0	28.0	27.0					7																	128547390		692	1591	2283	KCP			0			-	HGNC	AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128547390G>A		Somatic	0	16	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	11	45.00	Q8NBE0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000476647.2	37	NULL		7																																																																																			-	-		0.701	KCP-006	KNOWN	basic	processed_transcript	KCP	processed_transcript	OTTHUMT00000403051.1	G	NM_199349	-		128547390	-1	no_errors	ENST00000297801	ensembl	human	known	74_37	rna	SNP	0.180	A
AP3D1	8943	genome.wustl.edu	37	19	2117232	2117232	+	Silent	SNP	T	T	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr19:2117232T>A	ENST00000345016.5	-	16	2079	c.1848A>T	c.(1846-1848)ccA>ccT	p.P616P	AP3D1_ENST00000356926.4_Silent_p.P525P|AP3D1_ENST00000350812.6_Silent_p.P447P|AP3D1_ENST00000355272.6_Silent_p.P616P	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	616					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTCGGGGACTGGAACCTTCT	0.637																																																	0								ENSG00000065000						40.0	46.0	44.0					19																	2117232		2007	4164	6171	AP3D1	SO:0001819	synonymous_variant	0			-	HGNC	U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.1848A>T	19.37:g.2117232T>A		Somatic	0	36	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	5	72.22	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.P616	ENST00000345016.5	37	c.1848	CCDS42459.1	19																																																																																			-	superfamily_ARM-type_fold,pirsf_AP3_complex_dsu		0.637	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	protein_coding	OTTHUMT00000450912.1	T		-		2117232	-1	no_errors	ENST00000355272	ensembl	human	known	74_37	silent	SNP	0.403	A
NDUFV2	4729	genome.wustl.edu	37	18	9122591	9122591	+	Silent	SNP	T	T	C	rs76552443	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr18:9122591T>C	ENST00000318388.6	+	5	495	c.381T>C	c.(379-381)gtT>gtC	p.V127V	RP11-21J18.1_ENST00000579126.1_RNA|RP11-143J12.2_ENST00000582375.1_RNA|NDUFV2_ENST00000465096.1_3'UTR|RP11-143J12.2_ENST00000583081.1_RNA|NDUFV2_ENST00000400033.1_Silent_p.V130V	NM_021074.4	NP_066552.2	P19404	NDUV2_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa	127					cardiac muscle tissue development (GO:0048738)|cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|nervous system development (GO:0007399)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)	p.V127V(1)		breast(1)|lung(4)|ovary(1)|stomach(1)	7						GAAAGCCAGTTGGAAAGTATC	0.383																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000178127						121.0	109.0	113.0					18																	9122591		2203	4300	6503	NDUFV2	SO:0001819	synonymous_variant	0			-	HGNC	X84421	CCDS11842.1	18p11.22	2011-07-04	2002-08-29		ENSG00000178127	ENSG00000178127	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7717	protein-coding gene	gene with protein product	"""complex I 24kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 2, mitochondrial"""	600532	"""NADH dehydrogenase (ubiquinone) flavoprotein 2 (24kD)"""			9763677, 7607668	Standard	NM_021074		Approved	CI-24k	uc002knu.3	P19404	OTTHUMG00000131593	ENST00000318388.6:c.381T>C	18.37:g.9122591T>C		Somatic	0	50	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	60	11.76	Q9BV41	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NuoE_like,superfamily_Thioredoxin-like_fold,tigrfam_NuoE_like	p.V127	ENST00000318388.6	37	c.381	CCDS11842.1	18																																																																																			-	pfam_NuoE_like,superfamily_Thioredoxin-like_fold,tigrfam_NuoE_like		0.383	NDUFV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFV2	protein_coding	OTTHUMT00000254475.2	T	NM_021074	rs76552443		9122591	+1	no_errors	ENST00000318388	ensembl	human	known	74_37	silent	SNP	1.000	C
AKNAD1	254268	genome.wustl.edu	37	1	109394814	109394816	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	TTC	TTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr1:109394814_109394816delTTC	ENST00000370001.3	-	2	739_741	c.471_473delGAA	c.(469-474)aagaat>aat	p.K157del	AKNAD1_ENST00000357393.4_Intron|AKNAD1_ENST00000369995.3_In_Frame_Del_p.K157del|AKNAD1_ENST00000369994.1_In_Frame_Del_p.K157del	NM_152763.4	NP_689976.2	Q5T1N1	AKND1_HUMAN	AKNA domain containing 1	157						cytoplasm (GO:0005737)				breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|prostate(6)|skin(3)|stomach(2)	32						TGGCCAAGAATTCTTATTATAAC	0.419																																																	0								ENSG00000162641																																			AKNAD1	SO:0001651	inframe_deletion	0				HGNC	AK095517	CCDS791.2	1p13.3	2009-10-29	2009-10-29	2009-10-29	ENSG00000162641	ENSG00000162641			28398	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 62"""	C1orf62			Standard	NM_152763		Approved	MGC26989	uc001dwa.4	Q5T1N1	OTTHUMG00000011231	ENST00000370001.3:c.471_473delGAA	1.37:g.109394814_109394816delTTC	ENSP00000359018:p.Lys157del	Somatic	0	8	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	B9EK62|Q5T1N0|Q8N990|Q8NCN9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_TF_AT-hook	p.K157in_frame_del	ENST00000370001.3	37	c.473_471	CCDS791.2	1																																																																																			-	NULL		0.419	AKNAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AKNAD1	protein_coding	OTTHUMT00000030923.2	TTC	NM_152763			109394816	-1	no_errors	ENST00000370001	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.009:0.013	-
ASPG	374569	genome.wustl.edu	37	14	104565266	104565266	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr14:104565266T>A	ENST00000551177.1	+	6	682	c.590T>A	c.(589-591)tTc>tAc	p.F197Y	ASPG_ENST00000546892.2_Missense_Mutation_p.F197Y|ASPG_ENST00000455920.2_Missense_Mutation_p.F197Y	NM_001080464.2	NP_001073933.2	Q86U10	LPP60_HUMAN	asparaginase	197	Asparaginase.|Asparaginase/glutaminase. {ECO:0000255|PROSITE-ProRule:PRU01068}.				asparagine metabolic process (GO:0006528)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)		1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|asparaginase activity (GO:0004067)|lysophospholipase activity (GO:0004622)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	11						TTCGCAGCTTTCTGCTCCCCG	0.622																																																	0								ENSG00000166183						33.0	40.0	37.0					14																	104565266		2028	4193	6221	ASPG	SO:0001583	missense	0			-	HGNC		CCDS45170.1, CCDS45170.2	14q32.33	2014-03-14	2014-03-14	2008-11-06	ENSG00000166183	ENSG00000166183	3.1.1.5, 3.5.1.1	"""Ankyrin repeat domain containing"""	20123	protein-coding gene	gene with protein product	"""60-kDa-lysophospholipase"""		"""chromosome 14 open reading frame 76"", ""asparaginase homolog (S. cerevisiae)"""	C14orf76			Standard	NM_001080464		Approved		uc001yoq.2	Q86U10		ENST00000551177.1:c.590T>A	14.37:g.104565266T>A	ENSP00000450040:p.Phe197Tyr	Somatic	0	56	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	39	50.00	B9EGQ2|Q8IV80	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Asparaginase/glutaminase,pfam_Ankyrin_rpt,superfamily_Asparaginase/glutaminase,superfamily_Ankyrin_rpt-contain_dom,smart_Asparaginase/glutaminase,smart_Ankyrin_rpt,prints_Asparaginase/glutaminase,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_AsnASEI	p.F197Y	ENST00000551177.1	37	c.590	CCDS45170.2	14	.	.	.	.	.	.	.	.	.	.	T	17.22	3.334718	0.60853	.	.	ENSG00000166183	ENST00000551177;ENST00000299234;ENST00000546892;ENST00000455920	T;T;T	0.61274	0.12;0.12;0.12	3.97	3.97	0.46021	.	0.061336	0.64402	U	0.000003	T	0.77935	0.4205	M	0.88450	2.955	0.47009	D	0.999281	D;D;D;D	0.89917	0.993;1.0;1.0;1.0	P;D;D;D	0.85130	0.854;0.984;0.984;0.997	T	0.82012	-0.0668	10	0.87932	D	0	-12.7333	11.8467	0.52389	0.0:0.0:0.0:1.0	.	197;197;197;225	G3V1Y8;Q86U10;Q86U10-3;E5RFC2	.;LPP60_HUMAN;.;.	Y	197;225;197;197	ENSP00000450040:F197Y;ENSP00000448911:F197Y;ENSP00000389003:F197Y	ENSP00000299234:F225Y	F	+	2	0	ASPG	103635019	1.000000	0.71417	0.993000	0.49108	0.429000	0.31625	2.573000	0.46007	1.431000	0.47355	0.402000	0.26972	TTC	-	pfam_Asparaginase/glutaminase,superfamily_Asparaginase/glutaminase,smart_Asparaginase/glutaminase,tigrfam_AsnASEI		0.622	ASPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPG	protein_coding	OTTHUMT00000407005.1	T	NM_001080464	-		104565266	+1	no_errors	ENST00000455920	ensembl	human	known	74_37	missense	SNP	1.000	A
DCHS2	54798	genome.wustl.edu	37	4	155253963	155253963	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr4:155253963A>G	ENST00000357232.4	-	9	1899	c.1900T>C	c.(1900-1902)Ttt>Ctt	p.F634L	DCHS2_ENST00000339452.1_Missense_Mutation_p.F1133L|DCHS2_ENST00000507542.1_5'Flank	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	634	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CGGATTCCAAACATAGCAGAG	0.517																																																	0								ENSG00000197410						50.0	52.0	51.0					4																	155253963		2203	4300	6503	DCHS2	SO:0001583	missense	0			-	HGNC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1900T>C	4.37:g.155253963A>G	ENSP00000349768:p.Phe634Leu	Somatic	0	33	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	19	44.12	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F634L	ENST00000357232.4	37	c.1900	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	A	34	5.355189	0.95854	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	T;T	0.70749	-0.42;-0.51	5.06	5.06	0.68205	Cadherin (3);Cadherin-like (1);	0.000000	0.64402	D	0.000006	D	0.85762	0.5772	M	0.86740	2.835	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.994	D	0.88462	0.3056	10	0.72032	D	0.01	.	15.1162	0.72404	1.0:0.0:0.0:0.0	.	1133;634	E9PC11;Q6V1P9	.;PCD23_HUMAN	L	634;1133;1133	ENSP00000349768:F634L;ENSP00000345062:F1133L	ENSP00000345062:F1133L	F	-	1	0	DCHS2	155473413	1.000000	0.71417	0.412000	0.26496	0.199000	0.23934	8.260000	0.89857	2.019000	0.59389	0.533000	0.62120	TTT	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.517	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	protein_coding	OTTHUMT00000365281.2	A	NM_001142552	-		155253963	-1	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	SNP	0.998	G
POM121	9883	genome.wustl.edu	37	7	72412427	72412427	+	Missense_Mutation	SNP	G	G	A	rs201876140		TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:72412427G>A	ENST00000434423.2	+	11	1895	c.1895G>A	c.(1894-1896)aGc>aAc	p.S632N	POM121_ENST00000395270.1_Missense_Mutation_p.S367N|POM121_ENST00000358357.3_Missense_Mutation_p.S367N|POM121_ENST00000257622.4_Missense_Mutation_p.S367N|POM121_ENST00000446813.1_Missense_Mutation_p.S367N			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	632	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)		p.S367N(2)		NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				AAGACACCCAGCCTCCTACCC	0.547																																																	2	Substitution - Missense(2)	NS(1)|skin(1)						ENSG00000196313						3.0	3.0	3.0					7																	72412427		1270	2943	4213	POM121	SO:0001583	missense	0			-	HGNC	AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.1895G>A	7.37:g.72412427G>A	ENSP00000405562:p.Ser632Asn	Somatic	0	29	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.28	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S632N	ENST00000434423.2	37	c.1895		7	.	.	.	.	.	.	.	.	.	.	G	7.496	0.651738	0.14516	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.08102	3.13;3.17;3.13;3.17;3.39	2.7	2.7	0.31948	.	0.155531	0.31257	N	0.007975	T	0.09862	0.0242	L	0.58969	1.84	0.43263	D	0.995207	P;P	0.36535	0.557;0.554	B;B	0.35971	0.215;0.157	T	0.12066	-1.0562	10	0.49607	T	0.09	.	10.9555	0.47356	0.0:0.0:1.0:0.0	.	367;632	A8MXF9;Q96HA1	.;P121A_HUMAN	N	367;367;367;367;632	ENSP00000393020:S367N;ENSP00000257622:S367N;ENSP00000378687:S367N;ENSP00000351124:S367N;ENSP00000405562:S632N	ENSP00000257622:S367N	S	+	2	0	POM121	72050363	0.502000	0.26107	0.893000	0.35052	0.018000	0.09664	1.430000	0.34914	1.503000	0.48686	0.173000	0.16961	AGC	-	NULL		0.547	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	protein_coding	OTTHUMT00000347344.1	G		rs201876140		72412427	+1	no_errors	ENST00000434423	ensembl	human	known	74_37	missense	SNP	0.985	A
CDHR3	222256	genome.wustl.edu	37	7	105671282	105671282	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:105671282T>A	ENST00000317716.9	+	18	2429	c.2349T>A	c.(2347-2349)gaT>gaA	p.D783E	CDHR3_ENST00000478080.1_Missense_Mutation_p.D695E|CDHR3_ENST00000542731.1_Missense_Mutation_p.D783E|CDHR3_ENST00000343407.5_3'UTR|CDHR3_ENST00000470188.1_3'UTR	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	783					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						AAGCCATAGATCCAGGTAATT	0.408																																																	0								ENSG00000128536						122.0	116.0	118.0					7																	105671282		1919	4133	6052	CDHR3	SO:0001583	missense	0			-	HGNC	AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2349T>A	7.37:g.105671282T>A	ENSP00000325954:p.Asp783Glu	Somatic	0	60	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	47	40.51	Q8TCI7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D783E	ENST00000317716.9	37	c.2349	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	T	15.69	2.909126	0.52439	.	.	ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080	T;T;T	0.61627	0.09;0.12;0.09	5.48	3.45	0.39498	.	0.000000	0.64402	D	0.000001	T	0.69984	0.3172	M	0.70275	2.135	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.66606	-0.5881	10	0.42905	T	0.14	-16.5655	7.5169	0.27606	0.0:0.7101:0.0:0.2899	.	770;783	B3KYA0;Q6ZTQ4	.;CDHR3_HUMAN	E	783;783;695	ENSP00000439766:D783E;ENSP00000325954:D783E;ENSP00000417771:D695E	ENSP00000325954:D783E	D	+	3	2	CDHR3	105458518	0.997000	0.39634	0.983000	0.44433	0.368000	0.29767	0.276000	0.18716	0.511000	0.28236	0.459000	0.35465	GAT	-	NULL		0.408	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	protein_coding	OTTHUMT00000349025.2	T	NM_152750	-		105671282	+1	no_errors	ENST00000317716	ensembl	human	known	74_37	missense	SNP	1.000	A
NAP1L4	4676	genome.wustl.edu	37	11	2991127	2991127	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr11:2991127G>T	ENST00000380542.4	-	7	580	c.440C>A	c.(439-441)gCa>gAa	p.A147E	NAP1L4_ENST00000526115.1_Missense_Mutation_p.A147E	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4	147					nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		CGTTGCCGCTGCTTTTTCTGT	0.418																																																	0								ENSG00000205531						129.0	116.0	120.0					11																	2991127		1904	4120	6024	NAP1L4	SO:0001583	missense	0			-	HGNC	AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.440C>A	11.37:g.2991127G>T	ENSP00000369915:p.Ala147Glu	Somatic	0	52	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	65	8.45	B2R6J4|F5HFY4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.A147E	ENST00000380542.4	37	c.440	CCDS41599.1	11	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.132882	0.00338	.	.	ENSG00000205531	ENST00000399624;ENST00000380542;ENST00000526115;ENST00000448187;ENST00000399614;ENST00000430811;ENST00000529361	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	4.35	1.85	0.25348	.	0.188895	0.47455	N	0.000228	T	0.09379	0.0231	N	0.00149	-1.99	0.20563	N	0.999888	B;B	0.02656	0.0;0.0	B;B	0.09377	0.0;0.004	T	0.41680	-0.9495	10	0.02654	T	1	-15.8905	13.634	0.62213	0.0:0.0:0.5508:0.4492	.	147;147	F5HFY4;Q99733	.;NP1L4_HUMAN	E	147;147;147;159;116;147;159	ENSP00000369915:A147E;ENSP00000436397:A147E;ENSP00000387783:A159E;ENSP00000382523:A116E;ENSP00000405912:A147E	ENSP00000369915:A147E	A	-	2	0	NAP1L4	2947703	0.952000	0.32445	0.003000	0.11579	0.023000	0.10783	0.651000	0.24873	-0.084000	0.12595	-0.525000	0.04345	GCA	-	pfam_NAP_family		0.418	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L4	protein_coding	OTTHUMT00000030273.3	G	NM_005969	-		2991127	-1	no_errors	ENST00000380542	ensembl	human	known	74_37	missense	SNP	0.855	T
FAM21C	253725	genome.wustl.edu	37	10	46261226	46261226	+	Missense_Mutation	SNP	G	G	C			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr10:46261226G>C	ENST00000336378.4	+	19	1955	c.1837G>C	c.(1837-1839)Gca>Cca	p.A613P	FAM21C_ENST00000540872.1_Missense_Mutation_p.A613P|FAM21C_ENST00000537517.1_Missense_Mutation_p.A589P|FAM21C_ENST00000374362.2_Missense_Mutation_p.A613P|FAM21C_ENST00000359860.4_Missense_Mutation_p.A557P	NM_015262.2	NP_056077.2	Q9Y4E1	FA21C_HUMAN	family with sequence similarity 21, member C	613					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome (GO:0005768)|plasma membrane (GO:0005886)|WASH complex (GO:0071203)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						CAAAAAGAAAGCATCTGCCCT	0.443																																																	0								ENSG00000172661						45.0	48.0	47.0					10																	46261226		1601	3692	5293	FAM21C	SO:0001583	missense	0			-	HGNC		CCDS44374.1, CCDS44374.2, CCDS53528.1, CCDS53529.1	10q11.22	2014-05-09			ENSG00000172661	ENSG00000172661			23414	protein-coding gene	gene with protein product		613631				20498093	Standard	NM_015262		Approved	Em:AC012044.3, KIAA0592	uc001jcu.3	Q9Y4E1	OTTHUMG00000018089	ENST00000336378.4:c.1837G>C	10.37:g.46261226G>C	ENSP00000337541:p.Ala613Pro	Somatic	0	101	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	87	34.59	B4DZQ6|B9EK53|F5H0J6|F5H871|Q5SQU4|Q5SQU5|Q7L521|Q9UG79	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A613P	ENST00000336378.4	37	c.1837		10	.	.	.	.	.	.	.	.	.	.	G	9.622	1.134015	0.21123	.	.	ENSG00000172661	ENST00000336378;ENST00000540872;ENST00000537517;ENST00000374362;ENST00000399588;ENST00000359860;ENST00000436993	.	.	.	3.18	1.17	0.20885	.	0.458056	0.20782	N	0.085772	T	0.27866	0.0686	L	0.40543	1.245	0.21762	N	0.999556	B;B;B;B	0.21753	0.001;0.003;0.008;0.06	B;B;B;B	0.21917	0.004;0.008;0.021;0.037	T	0.17077	-1.0381	9	0.21540	T	0.41	-0.1326	5.9884	0.19446	0.264:0.0:0.736:0.0	.	589;613;613;558	F5H871;Q9Y4E1-4;Q9Y4E1;Q9Y4E1-3	.;.;FA21C_HUMAN;.	P	613;613;589;613;613;557;525	.	ENSP00000337541:A613P	A	+	1	0	FAM21C	45581232	0.797000	0.28877	0.807000	0.32361	0.872000	0.50106	0.884000	0.28214	0.171000	0.19730	-0.450000	0.05554	GCA	-	NULL		0.443	FAM21C-201	KNOWN	basic|appris_candidate	protein_coding	FAM21C	protein_coding		G		-		46261226	+1	no_errors	ENST00000374362	ensembl	human	known	74_37	missense	SNP	0.964	C
PLCG1	5335	genome.wustl.edu	37	20	39792474	39792474	+	Splice_Site	SNP	G	G	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr20:39792474G>T	ENST00000373271.1	+	10	1415		c.e10+1		PLCG1_ENST00000244007.3_Splice_Site|PLCG1_ENST00000373272.2_Splice_Site	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1						activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				CGCACAACACGTGAGTGTGGC	0.582																																																	0								ENSG00000124181						117.0	109.0	111.0					20																	39792474		2203	4300	6503	PLCG1	SO:0001630	splice_region_variant	0			-	HGNC	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.1010+1G>T	20.37:g.39792474G>T		Somatic	0	53	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	46	43.90	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e10+1	ENST00000373271.1	37	c.1010+1	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358305	0.82243	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8016	0.96509	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLCG1	39225888	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.869000	0.99810	2.677000	0.91161	0.655000	0.94253	.	-	-		0.582	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	protein_coding	OTTHUMT00000080514.3	G	NM_182811	-	Intron	39792474	+1	no_errors	ENST00000244007	ensembl	human	known	74_37	splice_site	SNP	1.000	T
KIF6	221458	genome.wustl.edu	37	6	39545869	39545869	+	Nonsense_Mutation	SNP	G	G	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr6:39545869G>A	ENST00000287152.7	-	10	1238	c.1144C>T	c.(1144-1146)Cag>Tag	p.Q382*	KIF6_ENST00000373216.3_Nonsense_Mutation_p.Q382*|KIF6_ENST00000373215.3_Nonsense_Mutation_p.Q382*|KIF6_ENST00000373213.4_Nonsense_Mutation_p.Q221*|KIF6_ENST00000538893.1_Nonsense_Mutation_p.Q382*	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	382					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TCTGTCCTCTGCTCCCCAGTG	0.423																																																	0								ENSG00000164627						160.0	147.0	151.0					6																	39545869		2203	4300	6503	KIF6	SO:0001587	stop_gained	0			-	HGNC	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1144C>T	6.37:g.39545869G>A	ENSP00000287152:p.Gln382*	Somatic	0	37	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	6	75.00	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q382*	ENST00000287152.7	37	c.1144	CCDS4844.1	6	.	.	.	.	.	.	.	.	.	.	G	37	6.219670	0.97385	.	.	ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215;ENST00000538893	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	19.2089	0.93746	0.0:0.0:1.0:0.0	.	.	.	.	X	382;382;221;382;382	.	ENSP00000287152:Q382X	Q	-	1	0	KIF6	39653847	1.000000	0.71417	0.950000	0.38849	0.386000	0.30323	4.350000	0.59392	2.643000	0.89663	0.655000	0.94253	CAG	-	superfamily_P-loop_NTPase		0.423	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	protein_coding	OTTHUMT00000040455.2	G	NM_145027	-		39545869	-1	no_errors	ENST00000287152	ensembl	human	known	74_37	nonsense	SNP	1.000	A
EP400	57634	genome.wustl.edu	37	12	132547093	132547093	+	Silent	SNP	A	A	G	rs10902490|rs528214697	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr12:132547093A>G	ENST00000333577.4	+	48	8398	c.8289A>G	c.(8287-8289)caA>caG	p.Q2763Q	EP400_ENST00000332482.4_Silent_p.Q2690Q|EP400_ENST00000330386.6_Silent_p.Q2646Q|EP400_ENST00000389562.2_Silent_p.Q2726Q|EP400_ENST00000389561.2_Silent_p.Q2727Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2763	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q2726Q(9)		NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcagcaacaacagcagcagc	0.567																																																	9	Substitution - coding silent(9)	lung(3)|kidney(2)|endometrium(2)|central_nervous_system(2)						ENSG00000183495						25.0	29.0	28.0					12																	132547093		2173	4217	6390	EP400	SO:0001819	synonymous_variant	0			-	HGNC	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8289A>G	12.37:g.132547093A>G		Somatic	0	25	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	27	22.86	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2763	ENST00000333577.4	37	c.8289		12																																																																																			-	NULL		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	protein_coding		A	NM_015409	rs28513925		132547093	+1	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	SNP	0.900	G
PREX1	57580	genome.wustl.edu	37	20	47317304	47317304	+	Missense_Mutation	SNP	T	T	G			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr20:47317304T>G	ENST00000371941.3	-	7	926	c.904A>C	c.(904-906)Aag>Cag	p.K302Q	PREX1_ENST00000396220.1_Missense_Mutation_p.K302Q	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	302	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GATTTCCGCTTGCAGTAGACG	0.577																																																	0								ENSG00000124126						138.0	131.0	133.0					20																	47317304		2203	4300	6503	PREX1	SO:0001583	missense	0			-	HGNC	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.904A>C	20.37:g.47317304T>G	ENSP00000361009:p.Lys302Gln	Somatic	0	39	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	21	51.16	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K302Q	ENST00000371941.3	37	c.904	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	T	25.3	4.628662	0.87560	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	D;D	0.91577	-2.87;-2.87	5.11	5.11	0.69529	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.56097	U	0.000024	D	0.95881	0.8659	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96698	0.9516	10	0.87932	D	0	.	15.1983	0.73112	0.0:0.0:0.0:1.0	.	302	Q8TCU6	PREX1_HUMAN	Q	302	ENSP00000361009:K302Q;ENSP00000379522:K302Q	ENSP00000361009:K302Q	K	-	1	0	PREX1	46750711	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.988000	0.88194	2.043000	0.60533	0.374000	0.22700	AAG	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.577	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	protein_coding	OTTHUMT00000079623.1	T	NM_020820	-		47317304	-1	no_errors	ENST00000371941	ensembl	human	known	74_37	missense	SNP	1.000	G
DCAF6	55827	genome.wustl.edu	37	1	167960442	167960442	+	Splice_Site	SNP	G	G	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr1:167960442G>A	ENST00000312263.6	+	6	757	c.553G>A	c.(553-555)Gat>Aat	p.D185N	DCAF6_ENST00000432587.2_Splice_Site_p.D154N|DCAF6_ENST00000470919.1_3'UTR|DCAF6_ENST00000367840.3_Splice_Site_p.D185N|DCAF6_ENST00000367843.3_Splice_Site_p.D185N	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	185					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						TGTTTTGTAGGATATTTTAAT	0.328																																																	0								ENSG00000143164						111.0	104.0	106.0					1																	167960442		2203	4300	6503	DCAF6	SO:0001630	splice_region_variant	0			-	HGNC	AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.553-1G>A	1.37:g.167960442G>A		Somatic	0	44	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	24	45.45	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_IQ_motif_EF-hand-BS,pfscan_WD40_repeat_dom	p.D185N	ENST00000312263.6	37	c.553	CCDS30933.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.100932	0.94245	.	.	ENSG00000143164	ENST00000367843;ENST00000432587;ENST00000312263;ENST00000367840	D;T;D;D	0.81821	-1.54;0.21;-1.54;-1.54	5.86	5.86	0.93980	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.047695	0.85682	D	0.000000	D	0.84826	0.5558	L	0.46741	1.465	0.49213	D	0.999762	D;D;D;D	0.76494	0.997;0.99;0.995;0.999	D;P;D;D	0.81914	0.989;0.877;0.941;0.995	T	0.81805	-0.0764	8	.	.	.	.	20.1854	0.98212	0.0:0.0:1.0:0.0	.	154;185;185;185	B4DNB8;Q58WW2-3;Q58WW2;Q58WW2-2	.;.;DCAF6_HUMAN;.	N	185;154;185;185	ENSP00000356817:D185N;ENSP00000396238:D154N;ENSP00000311949:D185N;ENSP00000356814:D185N	.	D	+	1	0	DCAF6	166227066	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.291000	0.96070	2.772000	0.95346	0.585000	0.79938	GAT	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.328	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCAF6	protein_coding	OTTHUMT00000083661.2	G	NM_018442	-	Missense_Mutation	167960442	+1	no_errors	ENST00000367840	ensembl	human	known	74_37	missense	SNP	1.000	A
EXPH5	23086	genome.wustl.edu	37	11	108381630	108381630	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr11:108381630G>A	ENST00000265843.4	-	6	4714	c.4604C>T	c.(4603-4605)tCt>tTt	p.S1535F	EXPH5_ENST00000524840.1_5'Flank|EXPH5_ENST00000428840.1_Missense_Mutation_p.S1459F|EXPH5_ENST00000525344.1_Missense_Mutation_p.S1528F|EXPH5_ENST00000443411.1_Missense_Mutation_p.S1347F	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1535					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TCTTGGTTCAGACTGCAGACT	0.453																																																	0								ENSG00000110723						66.0	62.0	63.0					11																	108381630		2201	4298	6499	EXPH5	SO:0001583	missense	0			-	HGNC		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.4604C>T	11.37:g.108381630G>A	ENSP00000265843:p.Ser1535Phe	Somatic	0	35	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	20	56.52	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ	p.S1535F	ENST00000265843.4	37	c.4604	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	G	11.18	1.563464	0.27915	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000526312	T;T;T;T;T	0.03580	4.11;4.03;3.88;4.11;3.95	5.72	2.57	0.30868	.	0.773536	0.11691	N	0.538883	T	0.05593	0.0147	M	0.62723	1.935	0.09310	N	1	B	0.24368	0.102	B	0.24155	0.051	T	0.28776	-1.0033	10	0.46703	T	0.11	-1.2408	7.613	0.28142	0.242:0.1346:0.6234:0.0	.	1535	Q8NEV8	EXPH5_HUMAN	F	1535;1459;1347;1528;1459	ENSP00000265843:S1535F;ENSP00000391966:S1459F;ENSP00000411390:S1347F;ENSP00000432546:S1528F;ENSP00000432683:S1459F	ENSP00000265843:S1535F	S	-	2	0	EXPH5	107886840	0.040000	0.19996	0.045000	0.18777	0.113000	0.19764	0.722000	0.25925	0.742000	0.32697	0.561000	0.74099	TCT	-	NULL		0.453	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	protein_coding	OTTHUMT00000390279.1	G	NM_015065	-		108381630	-1	no_errors	ENST00000265843	ensembl	human	known	74_37	missense	SNP	0.000	A
SMCHD1	23347	genome.wustl.edu	37	18	2656092	2656092	+	Silent	SNP	C	C	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr18:2656092C>T	ENST00000320876.6	+	1	356	c.18C>T	c.(16-18)ggC>ggT	p.G6G	CBX3P2_ENST00000579647.1_RNA|SMCHD1_ENST00000261598.8_Silent_p.G6G	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	6					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						CGGCGGACGGCGGCGGGCCTG	0.692																																																	0								ENSG00000101596						5.0	9.0	8.0					18																	2656092		1717	3892	5609	SMCHD1	SO:0001819	synonymous_variant	0			-	HGNC	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.18C>T	18.37:g.2656092C>T		Somatic	0	34	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	17	47.37	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_HATPase_ATP-bd,smart_SMC_hinge	p.G6	ENST00000320876.6	37	c.18	CCDS45822.1	18																																																																																			-	NULL		0.692	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	protein_coding	OTTHUMT00000441082.2	C		-		2656092	+1	no_errors	ENST00000320876	ensembl	human	known	74_37	silent	SNP	0.917	T
GAS8	2622	genome.wustl.edu	37	16	90095597	90095597	+	Intron	SNP	T	T	C	rs61118444|rs71137702	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr16:90095597T>C	ENST00000268699.4	+	2	212				GAS8_ENST00000540721.1_Intron|GAS8_ENST00000536122.1_Intron|C16orf3_ENST00000408886.2_Missense_Mutation_p.I52V	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8						cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		gggcaggctatggggcagcct	0.662													t|||	2317	0.46266	0.3767	0.4611	5008	,	,		15322	0.63		0.3757	False		,,,				2504	0.4969																0								ENSG00000221819						20.0	23.0	22.0					16																	90095597		2197	4299	6496	C16orf3	SO:0001627	intron_variant	0			-	HGNC	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.90+1467T>C	16.37:g.90095597T>C		Somatic	0	42	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.I52V	ENST00000268699.4	37	c.154	CCDS10992.1	16	.	.	.	.	.	.	.	.	.	.	t	0.096	-1.158920	0.01686	.	.	ENSG00000221819	ENST00000408886	T	0.47177	0.85	.	.	.	.	.	.	.	.	T	0.17408	0.0418	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.14117	-1.0484	5	.	.	.	.	.	.	.	rs61118444;rs62640378	60	O95177	CP003_HUMAN	V	52	ENSP00000386218:I52V	.	I	-	1	0	C16orf3	88623098	0.005000	0.15991	0.000000	0.03702	0.009000	0.06853	-2.049000	0.01405	-2.579000	0.00463	-1.976000	0.00459	ATA	-	NULL		0.662	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf3	protein_coding	OTTHUMT00000272877.2	T		rs61118444		90095597	-1	no_errors	ENST00000408886	ensembl	human	known	74_37	missense	SNP	0.000	C
ANO6	196527	genome.wustl.edu	37	12	45822936	45822936	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr12:45822936G>T	ENST00000320560.8	+	20	2777	c.2575G>T	c.(2575-2577)Gta>Tta	p.V859L	ANO6_ENST00000423947.3_Missense_Mutation_p.V880L|ANO6_ENST00000435642.1_Intron|ANO6_ENST00000425752.2_Intron|ANO6_ENST00000441606.2_Missense_Mutation_p.V841L	NM_001025356.2	NP_001020527.2	Q4KMQ2	ANO6_HUMAN	anoctamin 6	859					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						AATTCCCGATGTATCAAAACG	0.388																																																	0								ENSG00000177119						81.0	74.0	76.0					12																	45822936		2203	4300	6503	ANO6	SO:0001583	missense	0			-	HGNC	AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000320560.8:c.2575G>T	12.37:g.45822936G>T	ENSP00000320087:p.Val859Leu	Somatic	0	19	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	5	50.00	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Anoctamin	p.V859L	ENST00000320560.8	37	c.2575	CCDS31782.1	12	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169989	0.78452	.	.	ENSG00000177119	ENST00000423947;ENST00000320560;ENST00000441606	T;T;T	0.64438	-0.1;-0.1;-0.1	5.45	4.55	0.56014	.	0.064498	0.64402	D	0.000009	T	0.73148	0.3550	L	0.56199	1.76	0.80722	D	1	D;P;P	0.76494	0.999;0.774;0.939	D;P;P	0.73380	0.98;0.627;0.73	T	0.70651	-0.4813	10	0.41790	T	0.15	.	14.4517	0.67389	0.0718:0.0:0.9282:0.0	.	841;880;859	E9PB30;B9EGG0;Q4KMQ2	.;.;ANO6_HUMAN	L	880;859;841	ENSP00000409126:V880L;ENSP00000320087:V859L;ENSP00000413137:V841L	ENSP00000320087:V859L	V	+	1	0	ANO6	44109203	1.000000	0.71417	0.615000	0.29064	0.974000	0.67602	6.570000	0.73996	2.941000	0.99782	0.655000	0.94253	GTA	-	pfam_Anoctamin		0.388	ANO6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANO6	protein_coding	OTTHUMT00000404822.1	G	XM_113743	-		45822936	+1	no_errors	ENST00000320560	ensembl	human	known	74_37	missense	SNP	0.999	T
SEPT14	346288	genome.wustl.edu	37	7	55910726	55910726	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr7:55910726G>T	ENST00000388975.3	-	5	583	c.467C>A	c.(466-468)tCt>tAt	p.S156Y	SEPT14_ENST00000477628.1_5'Flank	NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	156	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GTGGACGCGAGAATCATGGTA	0.393																																																	0								ENSG00000154997						101.0	92.0	95.0					7																	55910726		1901	4129	6030	SEPT14	SO:0001583	missense	0			-	HGNC	AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.467C>A	7.37:g.55910726G>T	ENSP00000373627:p.Ser156Tyr	Somatic	0	37	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	10	50.00	A6NCC2|B4DXD6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.S156Y	ENST00000388975.3	37	c.467	CCDS5519.2	7	.	.	.	.	.	.	.	.	.	.	g	14.22	2.469775	0.43839	.	.	ENSG00000154997	ENST00000388975	T	0.53640	0.61	4.33	4.33	0.51752	.	0.258545	0.25397	N	0.030965	T	0.68751	0.3035	M	0.79614	2.46	0.44711	D	0.997703	D	0.71674	0.998	D	0.76071	0.987	T	0.73956	-0.3819	10	0.87932	D	0	.	15.1266	0.72486	0.0:0.0:1.0:0.0	.	156	Q6ZU15	SEP14_HUMAN	Y	156	ENSP00000373627:S156Y	ENSP00000373627:S156Y	S	-	2	0	SEPT14	55878220	0.998000	0.40836	0.015000	0.15790	0.024000	0.10985	6.206000	0.72154	2.318000	0.78349	0.655000	0.94253	TCT	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin		0.393	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT14	protein_coding	OTTHUMT00000251489.2	G	NM_207366	-		55910726	-1	no_errors	ENST00000388975	ensembl	human	known	74_37	missense	SNP	0.994	T
FMN2	56776	genome.wustl.edu	37	1	240255569	240255571	+	In_Frame_Del	DEL	GGC	GGC	-	rs71929261|rs140531536	byFrequency	TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	GGC	GGC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr1:240255569_240255571delGGC	ENST00000319653.9	+	1	390_392	c.160_162delGGC	c.(160-162)ggcdel	p.G59del		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	59					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)	p.G197delG(1)		NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GGGGGGAgggggcggcggcggcg	0.665														3539	0.706669	0.7821	0.7507	5008	,	,		10143	0.4514		0.7893	False		,,,				2504	0.7515																1	Deletion - In frame(1)	prostate(1)						ENSG00000155816																																			FMN2	SO:0001651	inframe_deletion	0				HGNC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.160_162delGGC	1.37:g.240255578_240255580delGGC	ENSP00000318884:p.Gly59del	Somatic	0	11	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	11	31.25	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_FH2_Formin,pfam_Formin_homology_1,smart_FH2_Formin,pfscan_DEP_dom	p.G57in_frame_del	ENST00000319653.9	37	c.160_162	CCDS31069.2	1																																																																																			-	NULL		0.665	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	protein_coding	OTTHUMT00000096217.2	GGC	XM_371352			240255571	+1	no_errors	ENST00000319653	ensembl	human	known	74_37	in_frame_del	DEL	0.957:0.122:0.017	-
HUWE1	10075	genome.wustl.edu	37	X	53620560	53620560	+	Splice_Site	SNP	T	T	C			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chrX:53620560T>C	ENST00000342160.3	-	31	3962	c.3505A>G	c.(3505-3507)Act>Gct	p.T1169A	HUWE1_ENST00000218328.8_Splice_Site_p.T1169A|HUWE1_ENST00000262854.6_Splice_Site_p.T1169A			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	1169					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAGTTGAAAGTTCTAAATTCA	0.433																																																	0								ENSG00000086758						45.0	39.0	41.0					X																	53620560		2203	4300	6503	HUWE1	SO:0001630	splice_region_variant	0			-	HGNC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.3504-1A>G	X.37:g.53620560T>C		Somatic	0	27	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	16	40.74	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.T1169A	ENST00000342160.3	37	c.3505	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.86|12.86	2.064867|2.064867	0.36470|0.36470	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854;ENST00000218328	.|T;T;T	.|0.48201	.|1.07;1.07;0.82	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.34164|0.34164	0.0888|0.0888	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999997|0.999997	.|B	.|0.33212	.|0.402	.|B	.|0.30105	.|0.111	T|T	0.13522|0.13522	-1.0506|-1.0506	5|10	.|0.17832	.|T	.|0.49	.|.	13.8006|13.8006	0.63196|0.63196	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1169	.|Q7Z6Z7	.|HUWE1_HUMAN	S|A	202|1169	.|ENSP00000340648:T1169A;ENSP00000262854:T1169A;ENSP00000218328:T1169A	.|ENSP00000218328:T1169A	N|T	-|-	2|1	0|0	HUWE1|HUWE1	53637285|53637285	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	7.760000|7.760000	0.85248|0.85248	1.904000|1.904000	0.55121|0.55121	0.356000|0.356000	0.21956|0.21956	AAC|ACT	-	NULL		0.433	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	protein_coding	OTTHUMT00000056766.1	T	XM_497119	-	Missense_Mutation	53620560	-1	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	SNP	1.000	C
HMGCS1	3157	genome.wustl.edu	37	5	43293070	43293070	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr5:43293070C>A	ENST00000325110.6	-	9	1395	c.1189G>T	c.(1189-1191)Gct>Tct	p.A397S	HMGCS1_ENST00000433297.2_Missense_Mutation_p.A397S|CTD-2636A23.2_ENST00000569313.1_RNA	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	397					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						TTATCAAGAGCAGACCCTAAA	0.343																																																	0								ENSG00000112972						54.0	57.0	56.0					5																	43293070		2203	4300	6503	HMGCS1	SO:0001583	missense	0			-	HGNC		CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.1189G>T	5.37:g.43293070C>A	ENSP00000322706:p.Ala397Ser	Somatic	0	16	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	5	70.59	B2RDL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_HMG_CoA_synt_C,pfam_HMG_CoA_synth_N,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk	p.A397S	ENST00000325110.6	37	c.1189	CCDS34154.1	5	.	.	.	.	.	.	.	.	.	.	C	4.104	0.017447	0.07959	.	.	ENSG00000112972	ENST00000325110;ENST00000433297;ENST00000545275	T;T	0.76578	-1.03;-1.03	5.73	2.78	0.32641	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like (1);	0.325659	0.35936	N	0.002885	T	0.48943	0.1528	N	0.03209	-0.39	0.50467	D	0.999873	B	0.02656	0.0	B	0.04013	0.001	T	0.35301	-0.9794	10	0.07482	T	0.82	-11.2346	8.7069	0.34360	0.459:0.4708:0.0:0.0702	.	397	Q01581	HMCS1_HUMAN	S	397;397;386	ENSP00000322706:A397S;ENSP00000399402:A397S	ENSP00000322706:A397S	A	-	1	0	HMGCS1	43328827	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	1.588000	0.36633	0.738000	0.32606	-0.136000	0.14681	GCT	-	pfam_HMG_CoA_synt_C,superfamily_Thiolase-like,tigrfam_HMG_CoA_synthase_euk		0.343	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCS1	protein_coding	OTTHUMT00000368022.1	C		-		43293070	-1	no_errors	ENST00000325110	ensembl	human	known	74_37	missense	SNP	1.000	A
WDR78	79819	genome.wustl.edu	37	1	67301325	67301325	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr1:67301325G>A	ENST00000371026.3	-	11	1772	c.1717C>T	c.(1717-1719)Cca>Tca	p.P573S	WDR78_ENST00000431318.1_Missense_Mutation_p.P319S	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	573					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						TCCAGAACTGGAACATTACTG	0.348																																																	0								ENSG00000152763						99.0	95.0	96.0					1																	67301325		2203	4300	6503	WDR78	SO:0001583	missense	0			-	HGNC	BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.1717C>T	1.37:g.67301325G>A	ENSP00000360065:p.Pro573Ser	Somatic	0	32	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	12	33.33	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P573S	ENST00000371026.3	37	c.1717	CCDS635.1	1	.	.	.	.	.	.	.	.	.	.	G	4.022	0.001479	0.07819	.	.	ENSG00000152763	ENST00000371026;ENST00000431318;ENST00000464352	D;D;D	0.91068	-2.78;-2.78;-2.78	5.35	3.43	0.39272	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.213333	0.48286	D	0.000182	T	0.77363	0.4119	L	0.52759	1.655	0.25790	N	0.98462	B;B	0.22080	0.039;0.064	B;B	0.29942	0.109;0.051	T	0.68769	-0.5321	10	0.45353	T	0.12	-12.9788	3.9675	0.09437	0.1338:0.2532:0.4961:0.1169	.	319;573	Q5VTH9-3;Q5VTH9	.;WDR78_HUMAN	S	573;319;339	ENSP00000360065:P573S;ENSP00000393182:P319S;ENSP00000433682:P339S	ENSP00000360065:P573S	P	-	1	0	WDR78	67073913	0.987000	0.35691	0.870000	0.34147	0.134000	0.20937	1.979000	0.40608	1.230000	0.43646	0.644000	0.83932	CCA	-	superfamily_WD40_repeat_dom		0.348	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR78	protein_coding	OTTHUMT00000025404.1	G	NM_024763	-		67301325	-1	no_errors	ENST00000371026	ensembl	human	known	74_37	missense	SNP	0.425	A
SRC	6714	genome.wustl.edu	37	20	36032316	36032316	+	3'UTR	SNP	C	C	T			TCGA-K1-A3PN-02A-11D-A228-09	TCGA-K1-A3PN-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	d7eadeb5-54d2-4f18-9821-21d272ee52b5	b24e4a7b-236b-4dbe-9b7a-6c8427f8e423	g.chr20:36032316C>T	ENST00000373578.2	+	0	2494				SRC_ENST00000373558.2_3'UTR|SRC_ENST00000358208.4_3'UTR|SRC_ENST00000477066.1_3'UTR|SRC_ENST00000373567.2_3'UTR|SRC_ENST00000360723.4_3'UTR|SRC_ENST00000445403.1_3'UTR	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	CCGCTGCTTCCAGGCTGGGCA	0.657																																																	0								ENSG00000197122																																			SRC	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.*534C>T	20.37:g.36032316C>T		Somatic	0	31	0.00		0.6610313755001588	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	36	32.08	E1P5V4|Q76P87|Q86VB9|Q9H5A8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373578.2	37	NULL	CCDS13294.1	20																																																																																			-	-		0.657	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SRC	protein_coding	OTTHUMT00000268142.1	C	NM_005417	-		36032316	+1	no_errors	ENST00000477066	ensembl	human	known	74_37	rna	SNP	0.007	T
