#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
SPTBN4	57731	genome.wustl.edu	37	19	41038564	41038564	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr19:41038564G>T	ENST00000352632.3	+	19	4067	c.3981G>T	c.(3979-3981)atG>atT	p.M1327I	SPTBN4_ENST00000392023.1_Missense_Mutation_p.M3I|SPTBN4_ENST00000392025.1_Missense_Mutation_p.M70I|SPTBN4_ENST00000338932.3_Missense_Mutation_p.M1327I|SPTBN4_ENST00000595535.1_Missense_Mutation_p.M1327I|SPTBN4_ENST00000598249.1_Missense_Mutation_p.M1327I			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1327					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGATGCTGATGGCGCGGGATG	0.617																																																	0								ENSG00000160460						71.0	62.0	65.0					19																	41038564		2203	4300	6503	SPTBN4	SO:0001583	missense	0			-	HGNC	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.3981G>T	19.37:g.41038564G>T	ENSP00000263373:p.Met1327Ile	Somatic	0	48	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.M1327I	ENST00000352632.3	37	c.3981	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	G	17.16	3.317865	0.60524	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.58797	0.9;0.9;0.9;0.31	4.86	4.86	0.63082	.	0.134395	0.46145	D	0.000311	T	0.60025	0.2237	N	0.16233	0.39	0.44380	D	0.997283	B;P;P;B;D;D	0.55385	0.057;0.949;0.951;0.111;0.969;0.971	B;P;P;B;D;P	0.70227	0.014;0.465;0.755;0.07;0.968;0.855	T	0.55604	-0.8115	10	0.19147	T	0.46	.	16.9138	0.86146	0.0:0.0:1.0:0.0	.	1327;70;70;3;1327;1327	E9PDB1;Q9H254-3;C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;.;.;SPTN4_HUMAN;.	I	1327;1327;1327;70;3	ENSP00000263373:M1327I;ENSP00000340345:M1327I;ENSP00000375879:M70I;ENSP00000375877:M3I	ENSP00000340345:M1327I	M	+	3	0	SPTBN4	45730404	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.138000	0.50570	2.499000	0.84300	0.561000	0.74099	ATG	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.617	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	protein_coding	OTTHUMT00000462559.2	G		-		41038564	+1	no_errors	ENST00000352632	ensembl	human	known	74_37	missense	SNP	1.000	T
CLCNKA	1187	genome.wustl.edu	37	1	16360323	16360323	+	3'UTR	SNP	G	G	T	rs61772372		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:16360323G>T	ENST00000331433.4	+	0	2253				CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000420078.1_3'UTR|CLCNKA_ENST00000375692.1_3'UTR			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	CTCATCCTGGGTGGGACGATG	0.552																																																	0								ENSG00000186510																																			CLCNKA	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.*170G>T	1.37:g.16360323G>T		Somatic	0	31	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000331433.4	37	NULL	CCDS167.1	1																																																																																			-	-		0.552	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	protein_coding	OTTHUMT00000026326.1	G		rs61772372		16360323	+1	no_errors	ENST00000464764	ensembl	human	known	74_37	rna	SNP	0.000	T
DFNB31	25861	genome.wustl.edu	37	9	117240969	117240969	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr9:117240969T>A	ENST00000362057.3	-	2	869	c.701A>T	c.(700-702)tAc>tTc	p.Y234F	DFNB31_ENST00000374057.3_Missense_Mutation_p.Y234F|DFNB31_ENST00000265134.6_5'UTR	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	234					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CACCCAGGTGTAGATGTGGTT	0.667																																																	0								ENSG00000095397						38.0	36.0	37.0					9																	117240969		2203	4300	6503	DFNB31	SO:0001583	missense	0			-	HGNC	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.701A>T	9.37:g.117240969T>A	ENSP00000354623:p.Tyr234Phe	Somatic	0	61	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	25	13.79	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Y234F	ENST00000362057.3	37	c.701	CCDS6806.1	9	.	.	.	.	.	.	.	.	.	.	T	28.1	4.890673	0.91889	.	.	ENSG00000095397	ENST00000362057;ENST00000374057	T;T	0.16743	2.32;2.32	5.53	5.53	0.82687	PDZ/DHR/GLGF (1);	0.000000	0.85682	D	0.000000	T	0.39517	0.1081	M	0.69823	2.125	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.993;0.995	T	0.17077	-1.0381	10	0.16896	T	0.51	-23.1489	15.6591	0.77169	0.0:0.0:0.0:1.0	.	234;234;234	Q9P202-2;B9EGE6;Q9P202	.;.;WHRN_HUMAN	F	234	ENSP00000354623:Y234F;ENSP00000363170:Y234F	ENSP00000354623:Y234F	Y	-	2	0	DFNB31	116280790	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.630000	0.83225	2.097000	0.63578	0.374000	0.22700	TAC	-	superfamily_PDZ		0.667	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DFNB31	protein_coding	OTTHUMT00000053776.2	T	NM_015404	-		117240969	-1	no_errors	ENST00000362057	ensembl	human	known	74_37	missense	SNP	1.000	A
KCNQ5	56479	genome.wustl.edu	37	6	73904416	73904416	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr6:73904416C>T	ENST00000370398.1	+	14	2187	c.2078C>T	c.(2077-2079)aCg>aTg	p.T693M	KCNQ5_ENST00000342056.2_Missense_Mutation_p.T712M|KCNQ5_ENST00000403813.2_Missense_Mutation_p.T684M|KCNQ5_ENST00000402622.2_Missense_Mutation_p.T703M|KCNQ5_ENST00000355635.3_Missense_Mutation_p.T694M|KCNQ5_ENST00000355194.4_Missense_Mutation_p.T693M|KCNQ5_ENST00000414165.2_Missense_Mutation_p.T583M	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	693					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	TTCATTCTGACGCCAAATGAG	0.502																																					GBM(142;1375 1859 14391 23261 44706)												0								ENSG00000185760						129.0	129.0	129.0					6																	73904416		2203	4300	6503	KCNQ5	SO:0001583	missense	0			-	HGNC	AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.2078C>T	6.37:g.73904416C>T	ENSP00000359425:p.Thr693Met	Somatic	0	17	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	26	18.75	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.T703M	ENST00000370398.1	37	c.2108	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	C	18.00	3.526532	0.64860	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99470	-5.71;-5.72;-5.72;-5.71;-5.73;-5.76;-5.96	5.32	5.32	0.75619	.	0.064303	0.64402	D	0.000008	D	0.99248	0.9738	L	0.54323	1.7	0.30218	N	0.797104	D;D;D;D;D	0.89917	1.0;0.998;0.997;0.999;0.997	D;P;P;P;P	0.74674	0.984;0.862;0.814;0.825;0.683	D	0.98212	1.0473	10	0.66056	D	0.02	-5.9378	18.9881	0.92780	0.0:1.0:0.0:0.0	.	583;703;712;684;693	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	M	712;712;693;693;703;694;684;583	ENSP00000345055:T712M;ENSP00000347326:T693M;ENSP00000359425:T693M;ENSP00000385501:T703M;ENSP00000347853:T694M;ENSP00000384453:T684M;ENSP00000409861:T583M	ENSP00000345055:T712M	T	+	2	0	KCNQ5	73961137	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.454000	0.60068	2.486000	0.83907	0.561000	0.74099	ACG	-	NULL		0.502	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	protein_coding	OTTHUMT00000041198.3	C	NM_019842	-		73904416	+1	no_errors	ENST00000402622	ensembl	human	known	74_37	missense	SNP	1.000	T
PLCB1	23236	genome.wustl.edu	37	20	8665641	8665641	+	Missense_Mutation	SNP	C	C	T	rs368967370		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr20:8665641C>T	ENST00000338037.6	+	10	952	c.925C>T	c.(925-927)Cct>Tct	p.P309S	PLCB1_ENST00000378641.3_Missense_Mutation_p.P309S|PLCB1_ENST00000378637.2_Missense_Mutation_p.P309S	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	309				P -> T (in Ref. 2; AAF86613). {ECO:0000305}.	activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						AGTCGTTTCACCTGAGAAACT	0.418																																																	0								ENSG00000182621	C	SER/PRO,SER/PRO	0,4406		0,0,2203	184.0	175.0	178.0		925,925	4.8	1.0	20		178	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PLCB1	NM_015192.2,NM_182734.1	74,74	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	309/1217,309/1174	8665641	1,13005	2203	4300	6503	PLCB1	SO:0001583	missense	0			-	HGNC	AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.925C>T	20.37:g.8665641C>T	ENSP00000338185:p.Pro309Ser	Somatic	0	58	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	36	35.71	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_PLC-beta,pfam_PLC-beta_C,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,prints_Pinositol_PLipase_C,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.P309S	ENST00000338037.6	37	c.925	CCDS13102.1	20	.	.	.	.	.	.	.	.	.	.	C	10.38	1.335268	0.24253	0.0	1.16E-4	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.21031	2.03;2.03;2.03	5.76	4.81	0.61882	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);EF-hand-like domain (1);	0.099528	0.64402	D	0.000001	T	0.39384	0.1076	L	0.58669	1.825	0.58432	D	0.999999	P;D	0.89917	0.605;1.0	B;D	0.76575	0.387;0.988	T	0.25082	-1.0142	10	0.07482	T	0.82	.	17.1722	0.86833	0.0:0.8737:0.1263:0.0	.	309;309	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	S	309;309;309;229;229	ENSP00000367908:P309S;ENSP00000338185:P309S;ENSP00000367904:P309S	ENSP00000338185:P309S	P	+	1	0	PLCB1	8613641	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	5.959000	0.70339	1.555000	0.49500	-0.182000	0.12963	CCT	-	pirsf_PLC-beta,pfam_PLipase_C_EF-hand-like		0.418	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCB1	protein_coding	OTTHUMT00000077938.3	C		-		8665641	+1	no_errors	ENST00000338037	ensembl	human	known	74_37	missense	SNP	1.000	T
OTOP1	133060	genome.wustl.edu	37	4	4204225	4204229	+	Frame_Shift_Del	DEL	TTGAG	TTGAG	-	rs369956607		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	TTGAG	TTGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr4:4204225_4204229delTTGAG	ENST00000296358.4	-	4	700_704	c.676_680delCTCAA	c.(676-681)ctcaatfs	p.LN226fs		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	226					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L226fs*1(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTTGTGCTCATTGAGTTGGTGCTTT	0.502																																																	1	Deletion - Frameshift(1)	liver(1)						ENSG00000163982																																			OTOP1	SO:0001589	frameshift_variant	0				HGNC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.676_680delCTCAA	4.37:g.4204225_4204229delTTGAG	ENSP00000296358:p.Leu226fs	Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L476	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Otopetrin	p.L226fs	ENST00000296358.4	37	c.680_676	CCDS3372.1	4																																																																																			-	pfam_Otopetrin		0.502	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP1	protein_coding	OTTHUMT00000206661.2	TTGAG	NM_177998			4204229	-1	no_errors	ENST00000296358	ensembl	human	known	74_37	frame_shift_del	DEL	0.998:0.995:0.417:0.986:0.987	-
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
CKAP5	9793	genome.wustl.edu	37	11	46774244	46774244	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr11:46774244G>A	ENST00000529230.1	-	38	5120	c.5074C>T	c.(5074-5076)Ctc>Ttc	p.L1692F	CKAP5_ENST00000354558.3_Missense_Mutation_p.L1632F|CKAP5_ENST00000415402.1_Missense_Mutation_p.L1692F|CKAP5_ENST00000312055.5_Missense_Mutation_p.L1632F|MIR5582_ENST00000579697.1_RNA			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1692					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						CTGTCTTGGAGCAAAACAAGT	0.408																																					Ovarian(4;85 273 2202 4844 13323)												0								ENSG00000175216						93.0	90.0	91.0					11																	46774244		2201	4299	6500	CKAP5	SO:0001583	missense	0			-	HGNC		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.5074C>T	11.37:g.46774244G>A	ENSP00000432768:p.Leu1692Phe	Somatic	0	29	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	10	41.18	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,superfamily_Homing_endonucl,pfscan_HEAT_type_2	p.L1692F	ENST00000529230.1	37	c.5074	CCDS31477.1	11	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631428	0.28978	.	.	ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558	T;T;T;T	0.69040	-0.37;-0.21;-0.36;-0.36	5.24	4.33	0.51752	Armadillo-like helical (1);Armadillo-type fold (1);	0.059179	0.64402	D	0.000001	T	0.66790	0.2825	M	0.80616	2.505	0.52501	D	0.999957	B;B;B	0.32203	0.36;0.008;0.009	B;B;B	0.29176	0.099;0.018;0.008	T	0.69811	-0.5044	10	0.72032	D	0.01	-7.6374	12.1481	0.54034	0.0798:0.0:0.9202:0.0	.	1692;1632;1692	Q14008-3;Q14008-2;Q14008	.;.;CKAP5_HUMAN	F	1692;1692;1632;1632	ENSP00000432768:L1692F;ENSP00000395302:L1692F;ENSP00000310227:L1632F;ENSP00000346566:L1632F	ENSP00000310227:L1632F	L	-	1	0	CKAP5	46730820	1.000000	0.71417	1.000000	0.80357	0.052000	0.14988	7.911000	0.87458	1.218000	0.43458	-0.145000	0.13849	CTC	-	superfamily_ARM-type_fold		0.408	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	protein_coding	OTTHUMT00000390679.1	G	NM_014756	-		46774244	-1	no_errors	ENST00000415402	ensembl	human	known	74_37	missense	SNP	1.000	A
KIAA0513	9764	genome.wustl.edu	37	16	85100984	85100984	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr16:85100984G>T	ENST00000566428.1	+	2	938	c.307G>T	c.(307-309)Gtg>Ttg	p.V103L	KIAA0513_ENST00000538274.1_Missense_Mutation_p.V103L|KIAA0513_ENST00000567328.1_Missense_Mutation_p.V103L|KIAA0513_ENST00000258180.3_Missense_Mutation_p.V103L			O60268	K0513_HUMAN	KIAA0513	103						cytoplasm (GO:0005737)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(9)|pancreas(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.234)		GCGTGGCTACGTGGAGAAGAT	0.622																																																	0								ENSG00000135709						57.0	44.0	48.0					16																	85100984		2198	4297	6495	KIAA0513	SO:0001583	missense	0			-	HGNC	AB011085	CCDS32499.1, CCDS67091.1, CCDS73919.1	16q24.1	2012-11-29			ENSG00000135709	ENSG00000135709			29058	protein-coding gene	gene with protein product		611675				9628581	Standard	XM_005256265		Approved		uc002fiu.3	O60268	OTTHUMG00000176597	ENST00000566428.1:c.307G>T	16.37:g.85100984G>T	ENSP00000457408:p.Val103Leu	Somatic	0	69	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	23	14.81	B4DSS5|D3DUM2|Q8N6G0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SBF2	p.V103L	ENST00000566428.1	37	c.307	CCDS32499.1	16	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726563	0.69074	.	.	ENSG00000135709	ENST00000538274;ENST00000258180	T;T	0.36157	1.27;1.27	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	M	0.75264	2.295	0.58432	D	0.999992	B;B	0.31077	0.174;0.307	B;B	0.31337	0.128;0.06	T	0.49818	-0.8899	10	0.62326	D	0.03	-15.3159	16.5569	0.84487	0.0:0.0:1.0:0.0	.	103;103	B4DSS5;O60268	.;K0513_HUMAN	L	103	ENSP00000446439:V103L;ENSP00000258180:V103L	ENSP00000258180:V103L	V	+	1	0	KIAA0513	83658485	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	8.720000	0.91442	2.304000	0.77564	0.655000	0.94253	GTG	-	NULL		0.622	KIAA0513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0513	protein_coding	OTTHUMT00000432736.1	G	NM_014732	-		85100984	+1	no_errors	ENST00000258180	ensembl	human	known	74_37	missense	SNP	1.000	T
AEBP2	121536	genome.wustl.edu	37	12	19615524	19615524	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr12:19615524G>T	ENST00000398864.3	+	2	778	c.752G>T	c.(751-753)aGc>aTc	p.S251I	AEBP2_ENST00000266508.9_Missense_Mutation_p.S251I|AEBP2_ENST00000360995.4_Missense_Mutation_p.S35I|AEBP2_ENST00000541908.1_Missense_Mutation_p.S22I	NM_001114176.1	NP_001107648.1	Q6ZN18	AEBP2_HUMAN	AE binding protein 2	251	Interaction with RBBP4.|Ser-rich.				chromatin modification (GO:0016568)	ESC/E(Z) complex (GO:0035098)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			ovary(1)	1	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)|Esophageal squamous(101;0.143)					GGACAAGGAAGCACTACTTCT	0.433																																																	0								ENSG00000139154						100.0	93.0	95.0					12																	19615524		1932	4148	6080	AEBP2	SO:0001583	missense	0			-	HGNC		CCDS44841.1, CCDS44842.1, CCDS58215.1	12p12.3	2012-10-02			ENSG00000139154	ENSG00000139154			24051	protein-coding gene	gene with protein product						10329662	Standard	NM_153207		Approved	MGC17922	uc001ref.2	Q6ZN18	OTTHUMG00000168906	ENST00000398864.3:c.752G>T	12.37:g.19615524G>T	ENSP00000381840:p.Ser251Ile	Somatic	0	52	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	Q59FS5|Q6ZN62|Q96BG3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S251I	ENST00000398864.3	37	c.752	CCDS44841.1	12	.	.	.	.	.	.	.	.	.	.	G	15.30	2.792929	0.50102	.	.	ENSG00000139154	ENST00000538425;ENST00000541908;ENST00000398864;ENST00000435841;ENST00000266508;ENST00000360995	D;T;T;T;T	0.88124	-2.34;-0.45;-0.34;-0.52;-0.39	5.55	5.55	0.83447	.	.	.	.	.	T	0.78836	0.4346	N	0.19112	0.55	0.31118	N	0.709216	B	0.22346	0.068	B	0.13407	0.009	T	0.75374	-0.3340	9	0.49607	T	0.09	-6.3575	12.287	0.54797	0.0:0.0:0.7215:0.2784	.	251	Q6ZN18	AEBP2_HUMAN	I	22;22;251;185;251;35	ENSP00000444255:S22I;ENSP00000437983:S22I;ENSP00000381840:S251I;ENSP00000266508:S251I;ENSP00000354267:S35I	ENSP00000266508:S251I	S	+	2	0	AEBP2	19506791	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.671000	0.68095	2.885000	0.99019	0.655000	0.94253	AGC	-	NULL		0.433	AEBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AEBP2	protein_coding	OTTHUMT00000401575.1	G	NM_153207	-		19615524	+1	no_errors	ENST00000398864	ensembl	human	known	74_37	missense	SNP	1.000	T
WDFY2	115825	genome.wustl.edu	37	13	52332390	52332390	+	Missense_Mutation	SNP	C	C	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr13:52332390C>G	ENST00000298125.5	+	11	1307	c.1127C>G	c.(1126-1128)gCa>gGa	p.A376G		NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	376							metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		CATTTCGATGCAACCAGAGGA	0.423																																																	0								ENSG00000139668						165.0	138.0	147.0					13																	52332390		2203	4300	6503	WDFY2	SO:0001583	missense	0			-	HGNC	AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.1127C>G	13.37:g.52332390C>G	ENSP00000298125:p.Ala376Gly	Somatic	0	66	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	24	46.67	B1AL86|Q96CS1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,pfam_Znf_FYVE,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,smart_WD40_repeat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A376G	ENST00000298125.5	37	c.1127	CCDS9429.1	13	.	.	.	.	.	.	.	.	.	.	C	13.30	2.196828	0.38806	.	.	ENSG00000139668	ENST00000298125	T	0.59906	0.23	5.67	4.82	0.62117	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.151942	0.64402	D	0.000015	T	0.44561	0.1299	N	0.19112	0.55	0.51767	D	0.999938	B	0.33000	0.393	B	0.31946	0.138	T	0.47071	-0.9145	10	0.59425	D	0.04	-21.848	15.2368	0.73438	0.1413:0.8587:0.0:0.0	.	376	Q96P53	WDFY2_HUMAN	G	376	ENSP00000298125:A376G	ENSP00000298125:A376G	A	+	2	0	WDFY2	51230391	1.000000	0.71417	0.984000	0.44739	0.970000	0.65996	4.668000	0.61568	1.399000	0.46721	-0.152000	0.13540	GCA	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.423	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY2	protein_coding	OTTHUMT00000045985.3	C	NM_052950	-		52332390	+1	no_errors	ENST00000298125	ensembl	human	known	74_37	missense	SNP	0.993	G
MST1L	11223	genome.wustl.edu	37	1	17085028	17085028	+	RNA	SNP	G	G	A	rs2761534		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:17085028G>A	ENST00000455405.2	-	0	160							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)	p.R483C(1)|p.R452C(1)									AGCTTGGAACGACGCTGATCC	0.607																																																	2	Substitution - Missense(2)	kidney(2)						ENSG00000186715																																			MST1L			0			-	HGNC	U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085028G>A		Somatic	1	127	0.78		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	29	19.44	B7WPB1|Q13209	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000455405.2	37	NULL		1	.	.	.	.	.	.	.	.	.	.	.	9.858	1.195618	0.22037	.	.	ENSG00000186715	ENST00000389184;ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);	.	.	.	.	T	0.40956	0.1138	.	.	.	.	.	.	D;D	0.67145	0.996;0.981	P;P	0.53549	0.729;0.613	T	0.44221	-0.9342	5	0.39692	T	0.17	.	2.6507	0.04998	0.5:0.0:0.5:0.0	rs2761534;rs3882324;rs3981970;rs3982159	483;483	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	C	452;483;483	.	ENSP00000439273:R483C	R	-	1	0	MST1P9	16957615	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.159000	0.16442	-0.000000	0.14550	0.000000	0.15137	CGT	-	-		0.607	MST1L-002	KNOWN	basic	processed_transcript	MST1L	pseudogene	OTTHUMT00000400328.1	G	NM_001271733	rs2761534		17085028	-1	no_errors	ENST00000455405	ensembl	human	known	74_37	rna	SNP	0.155	A
POLD1	5424	genome.wustl.edu	37	19	50909545	50909545	+	Missense_Mutation	SNP	G	G	C			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr19:50909545G>C	ENST00000440232.2	+	11	1402	c.1349G>C	c.(1348-1350)aGc>aCc	p.S450T	POLD1_ENST00000599857.1_Missense_Mutation_p.S450T|POLD1_ENST00000595904.1_Missense_Mutation_p.S450T	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	450					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		AAGGTTGTCAGCATGGTGGGC	0.647								DNA polymerases (catalytic subunits)																																									0								ENSG00000062822						57.0	58.0	57.0					19																	50909545		2203	4300	6503	POLD1	SO:0001583	missense	0			-	HGNC		CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.1349G>C	19.37:g.50909545G>C	ENSP00000406046:p.Ser450Thr	Somatic	0	87	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	56	8.20	Q8NER3|Q96H98	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.S450T	ENST00000440232.2	37	c.1349	CCDS12795.1	19	.	.	.	.	.	.	.	.	.	.	G	13.34	2.207979	0.39003	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.09350	2.99	4.44	4.44	0.53790	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.051041	0.85682	D	0.000000	T	0.03608	0.0103	N	0.01464	-0.85	0.38402	D	0.945682	B;B	0.12013	0.005;0.002	B;B	0.17098	0.017;0.01	T	0.40683	-0.9550	10	0.31617	T	0.26	-50.4231	6.8783	0.24158	0.192:0.0:0.808:0.0	.	450;450	E7EVW0;P28340	.;DPOD1_HUMAN	T	450;451	ENSP00000406046:S450T	ENSP00000366129:S451T	S	+	2	0	POLD1	55601357	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.211000	0.58507	2.482000	0.83794	0.655000	0.94253	AGC	-	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B		0.647	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	POLD1	protein_coding	OTTHUMT00000464732.1	G		-		50909545	+1	no_errors	ENST00000440232	ensembl	human	known	74_37	missense	SNP	1.000	C
LRRC37A6P	387646	genome.wustl.edu	37	10	27536666	27536666	+	lincRNA	SNP	C	C	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr10:27536666C>T	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							TTTTTGCCTACACTTTGAATC	0.433																																																	0								ENSG00000230445																																			LRRC37A6P			0			-	HGNC																													10.37:g.27536666C>T		Somatic	0	38	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	17	50.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			-	-		0.433	RP11-85G18.6-001	KNOWN	basic	lincRNA	LRRC37A6P	lincRNA	OTTHUMT00000436904.1	C		-		27536666	-1	no_errors	ENST00000284414	ensembl	human	known	74_37	rna	SNP	0.000	T
MAP2K4	6416	genome.wustl.edu	37	17	12032516	12032516	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr17:12032516A>G	ENST00000353533.5	+	9	1015	c.952A>G	c.(952-954)Aca>Gca	p.T318A	MAP2K4_ENST00000415385.3_Missense_Mutation_p.T329A	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	318	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TGATCAACTAACACAAGTCGT	0.433			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																			Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|lung(1)|pancreas(1)						ENSG00000065559						93.0	85.0	88.0					17																	12032516		2203	4298	6501	MAP2K4	SO:0001583	missense	0			-	HGNC	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.952A>G	17.37:g.12032516A>G	ENSP00000262445:p.Thr318Ala	Somatic	0	46	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	24	44.19	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.T329A	ENST00000353533.5	37	c.985	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	A	17.10	3.302183	0.60195	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	T;T	0.64803	-0.12;-0.12	5.1	5.1	0.69264	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.42517	0.1206	N	0.10733	0.035	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.001	B;B;B	0.09377	0.002;0.002;0.004	T	0.30909	-0.9962	10	0.35671	T	0.21	.	14.2917	0.66284	1.0:0.0:0.0:0.0	.	190;329;318	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	A	318;329;295;190	ENSP00000262445:T318A;ENSP00000410402:T329A	ENSP00000262445:T318A	T	+	1	0	MAP2K4	11973241	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.073000	0.93992	2.263000	0.75096	0.533000	0.62120	ACA	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.433	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	protein_coding	OTTHUMT00000441226.1	A		-		12032516	+1	no_errors	ENST00000415385	ensembl	human	known	74_37	missense	SNP	1.000	G
FAM166B	730112	genome.wustl.edu	37	9	35563376	35563376	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr9:35563376G>T	ENST00000399742.2	-	2	143	c.73C>A	c.(73-75)Cac>Aac	p.H25N	FAM166B_ENST00000492890.1_Intron	NM_001099951.2|NM_001164310.1	NP_001093421.1|NP_001157782.1	A8MTA8	F166B_HUMAN	family with sequence similarity 166, member B	25										kidney(3)|large_intestine(1)|lung(4)|ovary(1)	9						AGTGGGCAGTGTCCAGTGTAC	0.627																																																	0								ENSG00000215187						23.0	29.0	27.0					9																	35563376		2128	4239	6367	FAM166B	SO:0001583	missense	0			-	HGNC	BC129999	CCDS47963.1, CCDS56572.1	9p13.3	2008-06-10			ENSG00000215187	ENSG00000215187			34242	protein-coding gene	gene with protein product							Standard	NM_001099951		Approved		uc010mkr.3	A8MTA8	OTTHUMG00000019858	ENST00000399742.2:c.73C>A	9.37:g.35563376G>T	ENSP00000382646:p.His25Asn	Somatic	0	17	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	A1L3B2|B7ZBJ0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UPF0573/UPF0605	p.H25N	ENST00000399742.2	37	c.73	CCDS56572.1	9	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512299	0.85389	.	.	ENSG00000215187	ENST00000399742;ENST00000537504	T	0.57273	0.41	5.76	5.76	0.90799	.	0.162163	0.24730	U	0.036078	T	0.71986	0.3405	M	0.76574	2.34	0.43830	D	0.996407	D;D;D;D	0.76494	0.999;0.993;0.999;0.998	D;D;D;D	0.78314	0.977;0.953;0.958;0.991	T	0.71774	-0.4491	9	.	.	.	-20.0009	15.463	0.75373	0.0:0.0:1.0:0.0	.	25;25;25;25	B7ZW33;B7ZW26;A8MTA8;A8MTA8-2	.;.;F166B_HUMAN;.	N	25	ENSP00000382646:H25N	.	H	-	1	0	FAM166B	35553376	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.323000	0.43823	2.720000	0.93068	0.561000	0.74099	CAC	-	pfam_UPF0573/UPF0605		0.627	FAM166B-005	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM166B	protein_coding	OTTHUMT00000336563.1	G	NM_001099951	-		35563376	-1	no_errors	ENST00000447837	ensembl	human	known	74_37	missense	SNP	1.000	T
GARNL3	84253	genome.wustl.edu	37	9	130005414	130005414	+	IGR	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr9:130005414G>A								RALGPS1 (19971 upstream) : GARNL3 (20526 downstream)																							GTGCCTTGTGGGAGTCAGATA	0.522																																																	0								ENSG00000136895						35.0	32.0	33.0					9																	130005414		876	1991	2867	GARNL3	SO:0001628	intergenic_variant	0			-	HGNC																													9.37:g.130005414G>A		Somatic	0	56	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	2	90.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G10E		37	c.29		9	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145828	0.37923	.	.	ENSG00000136895	ENST00000439286;ENST00000444677;ENST00000446764;ENST00000373399	T;T	0.43688	1.94;0.94	4.79	3.88	0.44766	.	.	.	.	.	T	0.44052	0.1275	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.19031	-1.0318	5	.	.	.	.	8.0103	0.30349	0.107:0.0:0.893:0.0	.	.	.	.	E	10	ENSP00000400579:G10E;ENSP00000411160:G10E	.	G	+	2	0	GARNL3	129045235	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	2.716000	0.47219	2.582000	0.87167	0.557000	0.71058	GGG	-	NULL	0	0.522					GARNL3			G		-		130005414	+1	no_errors	ENST00000429629	ensembl	human	known	74_37	missense	SNP	1.000	A
OR4C3	256144	genome.wustl.edu	37	11	48347059	48347059	+	Silent	SNP	T	T	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr11:48347059T>G	ENST00000319856.4	+	1	588	c.567T>G	c.(565-567)ctT>ctG	p.L189L		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						TCCTGGTCCTTTGGTTGCCCT	0.517																																																	0								ENSG00000176547						167.0	153.0	158.0					11																	48347059		2201	4298	6499	OR4C3	SO:0001819	synonymous_variant	0			-	HGNC	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.567T>G	11.37:g.48347059T>G		Somatic	0	112	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	74	17.78	B2RNF2|Q6IFB3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L189	ENST00000319856.4	37	c.567	CCDS31489.1	11																																																																																			-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.517	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C3	protein_coding	OTTHUMT00000390557.1	T	NM_001004702	-		48347059	+1	no_errors	ENST00000319856	ensembl	human	known	74_37	silent	SNP	0.003	G
BMP8B	656	genome.wustl.edu	37	1	40230633	40230633	+	Intron	SNP	T	T	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:40230633T>A	ENST00000372827.3	-	4	1049				BMP8B_ENST00000397360.2_Missense_Mutation_p.M241L	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b						cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AGTTTCCACATCTGAAGCCTG	0.652																																																	0								ENSG00000116985																																			BMP8B	SO:0001627	intron_variant	0			-	HGNC	BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.674-144A>T	1.37:g.40230633T>A		Somatic	0	22	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	8	27.27	E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TGF-b_N	p.M241L	ENST00000372827.3	37	c.721	CCDS444.1	1	.	.	.	.	.	.	.	.	.	.	T	9.146	1.014961	0.19355	.	.	ENSG00000116985	ENST00000397360	T	0.57107	0.42	3.04	0.699	0.18093	.	.	.	.	.	T	0.37461	0.1004	.	.	.	0.80722	P	0.0	B	0.25850	0.136	B	0.24394	0.053	T	0.36578	-0.9742	7	0.52906	T	0.07	.	4.7925	0.13256	0.0:0.2801:0.0:0.7199	.	241	E7EMY8	.	L	241	ENSP00000380518:M241L	ENSP00000380518:M241L	M	-	1	0	BMP8B	40003220	0.014000	0.17966	0.224000	0.23877	0.017000	0.09413	1.013000	0.29937	0.120000	0.18254	-0.376000	0.06991	ATG	-	NULL		0.652	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP8B	protein_coding	OTTHUMT00000025641.1	T	NM_001720	-		40230633	-1	no_errors	ENST00000397360	ensembl	human	known	74_37	missense	SNP	0.658	A
ZCCHC6	79670	genome.wustl.edu	37	9	88937852	88937854	+	In_Frame_Del	DEL	TTT	TTT	-	rs58050565|rs77621374|rs200402481|rs397759922	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	TTT	TTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr9:88937852_88937854delTTT	ENST00000375963.3	-	13	2983_2985	c.2811_2813delAAA	c.(2809-2814)aaaaat>aat	p.K937del	ZCCHC6_ENST00000375961.2_In_Frame_Del_p.K937del|ZCCHC6_ENST00000375960.2_In_Frame_Del_p.K814del|ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000277141.6_In_Frame_Del_p.K226del	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	937				Missing (in Ref. 1; CAI45944/CAH56219). {ECO:0000305}.	RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)	p.N938delN(1)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CACAGGTGAATTTTTTTCTTCAC	0.345														2624	0.523962	0.562	0.4899	5008	,	,		19309	0.4792		0.5417	False		,,,				2504	0.5245																1	Deletion - In frame(1)	large_intestine(1)						ENSG00000083223		,,	2377,1887		665,1047,420					,,	4.1	1.0		dbSNP_129	62	4461,3793		1183,2095,849	no	coding,coding,coding	ZCCHC6	NM_024617.3,NM_001185074.1,NM_001185059.1	,,	1848,3142,1269	A1A1,A1R,RR		45.9535,44.2542,45.3747	,,	,,		6838,5680				ZCCHC6	SO:0001651	inframe_deletion	0				HGNC	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2811_2813delAAA	9.37:g.88937855_88937857delTTT	ENSP00000365130:p.Lys937del	Somatic	0	27	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_U1,smart_Znf_CCHC,pfscan_Znf_CCHC	p.K937in_frame_del	ENST00000375963.3	37	c.2813_2811	CCDS35057.1	9																																																																																			-	NULL		0.345	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	protein_coding	OTTHUMT00000052918.1	TTT	NM_024617			88937854	-1	no_errors	ENST00000375963	ensembl	human	known	74_37	in_frame_del	DEL	0.904:0.484:0.228	-
EHBP1L1	254102	genome.wustl.edu	37	11	65348685	65348685	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr11:65348685C>A	ENST00000309295.4	+	8	972	c.707C>A	c.(706-708)gCc>gAc	p.A236D		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	236						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						TTCTCAGTTGCCAGCCCTTCT	0.637																																																	0								ENSG00000173442						37.0	42.0	40.0					11																	65348685		1966	4137	6103	EHBP1L1	SO:0001583	missense	0			-	HGNC	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.707C>A	11.37:g.65348685C>A	ENSP00000312671:p.Ala236Asp	Somatic	0	15	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	36	17	67.92	Q8TB89|Q9H7M7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.A236D	ENST00000309295.4	37	c.707	CCDS44649.1	11	.	.	.	.	.	.	.	.	.	.	C	12.52	1.962768	0.34659	.	.	ENSG00000173442	ENST00000309295;ENST00000533237	T;T	0.81415	-0.16;-1.49	4.3	2.42	0.29668	.	0.640591	0.12980	N	0.423363	T	0.75451	0.3851	L	0.34521	1.04	0.80722	D	1	D	0.61080	0.989	P	0.50314	0.637	T	0.70197	-0.4938	10	0.54805	T	0.06	.	7.1154	0.25414	0.0:0.7856:0.0:0.2144	.	236	Q8N3D4	EH1L1_HUMAN	D	236	ENSP00000312671:A236D;ENSP00000431996:A236D	ENSP00000312671:A236D	A	+	2	0	EHBP1L1	65105261	0.987000	0.35691	0.992000	0.48379	0.222000	0.24845	0.955000	0.29188	0.395000	0.25257	-0.137000	0.14449	GCC	-	NULL		0.637	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1L1	protein_coding	OTTHUMT00000390145.1	C	XM_170658	-		65348685	+1	no_errors	ENST00000309295	ensembl	human	known	74_37	missense	SNP	0.998	A
MIER3	166968	genome.wustl.edu	37	5	56224818	56224819	+	Intron	INS	-	-	CACACACA	rs371679889|rs3989923|rs58757804|rs372725126|rs146870702		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr5:56224818_56224819insCACACACA	ENST00000381199.3	-	10	840				MIER3_ENST00000409421.1_Intron|MIER3_ENST00000381213.3_Intron|MIER3_ENST00000381226.3_Intron|CTD-2310F14.1_ENST00000606813.1_RNA			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		actctctctctcacacacacac	0.411																																																	0								ENSG00000271828																																			CTD-2310F14.1	SO:0001627	intron_variant	0				Clone_based_vega_gene	BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.830-130->TGTGTGTG	5.37:g.56224819_56224826dupCACACACA		Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000381199.3	37	NULL		5																																																																																			-	-		0.411	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	ENSG00000271828	protein_coding	OTTHUMT00000132523.2	-	NM_152622			56224819	+1	no_errors	ENST00000606813	ensembl	human	known	74_37	rna	INS	0.000:0.000	CACACACA
SLC6A3	6531	genome.wustl.edu	37	5	1432617	1432617	+	Silent	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr5:1432617G>A	ENST00000270349.9	-	4	742	c.615C>T	c.(613-615)aaC>aaT	p.N205N	SLC6A3_ENST00000453492.2_Silent_p.N205N	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	205					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)	p.N205N(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	CAAAAGTGTCGTTGAGGCCCG	0.617																																																	1	Substitution - coding silent(1)	lung(1)						ENSG00000142319						96.0	85.0	88.0					5																	1432617		2203	4300	6503	SLC6A3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.615C>T	5.37:g.1432617G>A		Somatic	0	39	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	34	17.07	A2RUN4|Q14996	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_dopamine	p.N205	ENST00000270349.9	37	c.615	CCDS3863.1	5																																																																																			-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.617	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A3	protein_coding	OTTHUMT00000253650.3	G	NM_001044	-		1432617	-1	no_errors	ENST00000270349	ensembl	human	known	74_37	silent	SNP	0.989	A
EHBP1L1	254102	genome.wustl.edu	37	11	65348684	65348684	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr11:65348684G>A	ENST00000309295.4	+	8	971	c.706G>A	c.(706-708)Gcc>Acc	p.A236T		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	236						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						CTTCTCAGTTGCCAGCCCTTC	0.637																																																	0								ENSG00000173442						36.0	42.0	40.0					11																	65348684		1967	4137	6104	EHBP1L1	SO:0001583	missense	0			-	HGNC	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.706G>A	11.37:g.65348684G>A	ENSP00000312671:p.Ala236Thr	Somatic	0	14	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	18	67.27	Q8TB89|Q9H7M7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.A236T	ENST00000309295.4	37	c.706	CCDS44649.1	11	.	.	.	.	.	.	.	.	.	.	G	11.26	1.585158	0.28268	.	.	ENSG00000173442	ENST00000309295;ENST00000533237	T;T	0.81415	-0.16;-1.49	4.3	0.918	0.19386	.	0.640591	0.12980	N	0.423363	T	0.66086	0.2754	L	0.34521	1.04	0.80722	D	1	P	0.43094	0.799	B	0.35931	0.214	T	0.61187	-0.7113	10	0.56958	D	0.05	.	7.2609	0.26203	0.0:0.3506:0.4693:0.1801	.	236	Q8N3D4	EH1L1_HUMAN	T	236	ENSP00000312671:A236T;ENSP00000431996:A236T	ENSP00000312671:A236T	A	+	1	0	EHBP1L1	65105260	0.979000	0.34478	0.985000	0.45067	0.230000	0.25150	0.577000	0.23758	0.342000	0.23796	0.655000	0.94253	GCC	-	NULL		0.637	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1L1	protein_coding	OTTHUMT00000390145.1	G	XM_170658	-		65348684	+1	no_errors	ENST00000309295	ensembl	human	known	74_37	missense	SNP	0.987	A
RUFY3	22902	genome.wustl.edu	37	4	71588302	71588302	+	Silent	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr4:71588302G>T	ENST00000226328.4	+	1	575	c.12G>T	c.(10-12)ctG>ctT	p.L4L	RUFY3_ENST00000417478.2_Intron|RUFY3_ENST00000381006.3_Silent_p.L4L|RUFY3_ENST00000536664.1_5'Flank	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	4					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			TGTCTGCTCTGACGCCTCCGA	0.502																																																	0								ENSG00000018189						159.0	134.0	143.0					4																	71588302		2203	4300	6503	RUFY3	SO:0001819	synonymous_variant	0			-	HGNC	AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.12G>T	4.37:g.71588302G>T		Somatic	0	54	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Run,superfamily_Prefoldin,smart_Run,pfscan_Run	p.L4	ENST00000226328.4	37	c.12	CCDS3547.1	4																																																																																			-	NULL		0.502	RUFY3-001	KNOWN	basic|CCDS	protein_coding	RUFY3	protein_coding	OTTHUMT00000252161.2	G	NM_014961	-		71588302	+1	no_errors	ENST00000226328	ensembl	human	known	74_37	silent	SNP	1.000	T
KIAA1524	57650	genome.wustl.edu	37	3	108273288	108273288	+	Missense_Mutation	SNP	A	A	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr3:108273288A>T	ENST00000295746.8	-	18	2335	c.2259T>A	c.(2257-2259)gaT>gaA	p.D753E	KIAA1524_ENST00000491772.1_Missense_Mutation_p.D594E	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	753					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TATTCAGAGAATCACATGTGA	0.308																																																	0								ENSG00000163507						75.0	70.0	72.0					3																	108273288		2200	4293	6493	KIAA1524	SO:0001583	missense	0			-	HGNC	AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.2259T>A	3.37:g.108273288A>T	ENSP00000295746:p.Asp753Glu	Somatic	0	57	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	18	35.71	A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.D753E	ENST00000295746.8	37	c.2259	CCDS33812.1	3	.	.	.	.	.	.	.	.	.	.	A	4.835	0.155305	0.09236	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	T;T	0.17854	2.25;2.25	5.15	1.24	0.21308	.	0.390446	0.29172	N	0.012926	T	0.06962	0.0177	N	0.16478	0.41	0.21915	N	0.999472	B	0.06786	0.001	B	0.06405	0.002	T	0.41574	-0.9501	10	0.05721	T	0.95	-5.4114	5.7182	0.17972	0.6272:0.0:0.0746:0.2982	.	753	Q8TCG1	CIP2A_HUMAN	E	594;753	ENSP00000419487:D594E;ENSP00000295746:D753E	ENSP00000295746:D753E	D	-	3	2	KIAA1524	109755978	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	0.828000	0.27435	0.024000	0.15214	0.528000	0.53228	GAT	-	NULL		0.308	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1524	protein_coding	OTTHUMT00000353975.2	A	NM_020890	-		108273288	-1	no_errors	ENST00000295746	ensembl	human	known	74_37	missense	SNP	1.000	T
GTPBP4	23560	genome.wustl.edu	37	10	1053042	1053042	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr10:1053042G>A	ENST00000360803.4	+	10	1169	c.1087G>A	c.(1087-1089)Gct>Act	p.A363T	GTPBP4_ENST00000491635.1_3'UTR|GTPBP4_ENST00000538293.1_Missense_Mutation_p.A247T|GTPBP4_ENST00000545048.1_Missense_Mutation_p.A316T	NM_012341.2	NP_036473.2	Q9BZE4	NOG1_HUMAN	GTP binding protein 4	363					GTP catabolic process (GO:0006184)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of collagen binding (GO:0033342)|negative regulation of DNA replication (GO:0008156)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein stabilization (GO:0050821)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(2)|skin(1)	21		all_epithelial(10;0.107)|Colorectal(49;0.14)	OV - Ovarian serous cystadenocarcinoma(33;0.0814)	Epithelial(11;0.0513)|all cancers(11;0.135)|OV - Ovarian serous cystadenocarcinoma(14;0.173)		ACTGCACCTGGCTATCCCAAC	0.502																																																	0								ENSG00000107937						113.0	94.0	101.0					10																	1053042		2203	4300	6503	GTPBP4	SO:0001583	missense	0			-	HGNC	AK001548	CCDS31132.1	10p15-p14	2007-07-27			ENSG00000107937	ENSG00000107937			21535	protein-coding gene	gene with protein product	"""G protein-binding protein CRFG"", "" GTP-binding protein"""					11316846	Standard	NM_012341		Approved	CRFG, NGB, FLJ10690, FLJ10686, NOG1	uc001ift.3	Q9BZE4	OTTHUMG00000017538	ENST00000360803.4:c.1087G>A	10.37:g.1053042G>A	ENSP00000354040:p.Ala363Thr	Somatic	0	39	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	35	10.26	B3KMC5|B4DY13|B7Z7A3|O95446|Q5T3R8|Q9NVJ8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NOG1_Rossman_fold_dom,pfam_NOG_C,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,pfam_MIRO-like,superfamily_P-loop_NTPase,prints_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.A363T	ENST00000360803.4	37	c.1087	CCDS31132.1	10	.	.	.	.	.	.	.	.	.	.	G	16.90	3.249992	0.59212	.	.	ENSG00000107937	ENST00000360803;ENST00000538293;ENST00000545048	T;T;T	0.37411	1.2;1.21;1.2	5.47	5.47	0.80525	.	0.146210	0.64402	D	0.000008	T	0.45856	0.1363	M	0.82132	2.575	0.80722	D	1	P	0.45768	0.866	B	0.39562	0.303	T	0.56780	-0.7922	10	0.62326	D	0.03	-12.7396	19.7377	0.96214	0.0:0.0:1.0:0.0	.	363	Q9BZE4	NOG1_HUMAN	T	363;247;316	ENSP00000354040:A363T;ENSP00000444277:A247T;ENSP00000445473:A316T	ENSP00000354040:A363T	A	+	1	0	GTPBP4	1043042	1.000000	0.71417	0.063000	0.19743	0.026000	0.11368	9.350000	0.97070	2.733000	0.93635	0.650000	0.86243	GCT	-	NULL		0.502	GTPBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP4	protein_coding	OTTHUMT00000046412.1	G	NM_012341	-		1053042	+1	no_errors	ENST00000360803	ensembl	human	known	74_37	missense	SNP	1.000	A
PILRB	29990	genome.wustl.edu	37	7	99943553	99943553	+	5'UTR	DEL	T	T	-			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr7:99943553delT	ENST00000610247.1	+	0	493				STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|STAG3L5P_ENST00000493499.1_RNA			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGTGAAGGGATTTTTTTTTTT	0.413																																																	0								ENSG00000272752																																			STAG3L5P-PVRIG2P-PILRB	SO:0001623	5_prime_UTR_variant	0				HGNC	AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000610247.1:c.-2004T>-	7.37:g.99943553delT		Somatic	0	18	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	16	15.79	Q69YF9|Q9HBS0	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000610247.1	37	NULL	CCDS43622.1	7																																																																																			-	-		0.413	PILRB-202	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG3L5P-PVRIG2P-PILRB	protein_coding		T	NM_178238			99943553	+1	no_errors	ENST00000310771	ensembl	human	known	74_37	rna	DEL	0.002	-
PTPN23	25930	genome.wustl.edu	37	3	47452009	47452009	+	Silent	SNP	G	G	A	rs150118207	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr3:47452009G>A	ENST00000265562.4	+	20	2798	c.2721G>A	c.(2719-2721)ccG>ccA	p.P907P	PTPN23_ENST00000431726.1_Silent_p.P781P	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	907	His.|Pro-rich.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTCCTCCCCCGCCCTGCTTCC	0.672																																																	0								ENSG00000076201	G		0,4406		0,0,2203	17.0	18.0	18.0		2721	1.5	0.9	3	dbSNP_134	18	3,8587		0,3,4292	no	coding-synonymous	PTPN23	NM_015466.2		0,3,6495	AA,AG,GG		0.0349,0.0,0.0231		907/1637	47452009	3,12993	2203	4295	6498	PTPN23	SO:0001819	synonymous_variant	0			-	HGNC	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.2721G>A	3.37:g.47452009G>A		Somatic	0	9	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	5	50.00	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BRO1_dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_BRO1_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.P907	ENST00000265562.4	37	c.2721	CCDS2754.1	3																																																																																			-	NULL		0.672	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN23	protein_coding	OTTHUMT00000257492.2	G	NM_015466	rs150118207		47452009	+1	no_errors	ENST00000265562	ensembl	human	known	74_37	silent	SNP	0.066	A
USH2A	7399	genome.wustl.edu	37	1	216073476	216073476	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:216073476G>T	ENST00000307340.3	-	40	7921	c.7535C>A	c.(7534-7536)gCc>gAc	p.A2512D	USH2A_ENST00000366943.2_Missense_Mutation_p.A2512D|RP5-1111A8.3_ENST00000414995.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2512	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TCCATTGGAGGCAACCAACCG	0.418										HNSCC(13;0.011)																																							0								ENSG00000042781						145.0	120.0	128.0					1																	216073476		2203	4300	6503	USH2A	SO:0001583	missense	0			-	HGNC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7535C>A	1.37:g.216073476G>T	ENSP00000305941:p.Ala2512Asp	Somatic	0	28	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	20	16.67	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.A2512D	ENST00000307340.3	37	c.7535	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260941	0.80246	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.77098	-1.07;-1.07	6.16	2.97	0.34412	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.44688	D	0.000424	D	0.85017	0.5601	M	0.80616	2.505	0.31949	N	0.609939	D	0.69078	0.997	D	0.63793	0.918	D	0.85283	0.1063	10	0.87932	D	0	.	8.382	0.32477	0.1566:0.1219:0.7215:0.0	.	2512	O75445	USH2A_HUMAN	D	2512	ENSP00000305941:A2512D;ENSP00000355910:A2512D	ENSP00000305941:A2512D	A	-	2	0	USH2A	214140099	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	1.323000	0.33701	0.333000	0.23563	0.650000	0.86243	GCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.418	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	protein_coding	OTTHUMT00000128138.1	G	NM_007123	-		216073476	-1	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	SNP	1.000	T
GRM3	2913	genome.wustl.edu	37	7	86394618	86394618	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr7:86394618G>A	ENST00000361669.2	+	2	1256	c.157G>A	c.(157-159)Gga>Aga	p.G53R	GRM3_ENST00000546348.1_Intron|GRM3_ENST00000394720.2_Missense_Mutation_p.G51R|GRM3_ENST00000439827.1_Missense_Mutation_p.G53R|GRM3_ENST00000536043.1_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	53					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					AAAAGGCACTGGAACTGAAGA	0.408																																					GBM(52;969 1098 3139 52280)												0								ENSG00000198822						127.0	125.0	126.0					7																	86394618		2203	4300	6503	GRM3	SO:0001583	missense	0			-	HGNC		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.157G>A	7.37:g.86394618G>A	ENSP00000355316:p.Gly53Arg	Somatic	0	30	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	17	43.33	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B	p.G53R	ENST00000361669.2	37	c.157	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	G	18.78	3.695939	0.68386	.	.	ENSG00000198822	ENST00000361669;ENST00000439827;ENST00000394720;ENST00000421579;ENST00000441140	D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.77322	0.4113	L	0.45285	1.41	0.80722	D	1	P;P	0.43519	0.615;0.809	B;B	0.40375	0.327;0.317	T	0.74247	-0.3727	10	0.09590	T	0.72	.	17.9854	0.89154	0.0:0.0:1.0:0.0	.	53;53	G5E9K2;Q14832	.;GRM3_HUMAN	R	53;53;51;53;53	ENSP00000355316:G53R;ENSP00000398767:G53R;ENSP00000378209:G51R;ENSP00000390037:G53R;ENSP00000407490:G53R	ENSP00000355316:G53R	G	+	1	0	GRM3	86232554	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.673000	0.83973	2.732000	0.93576	0.655000	0.94253	GGA	-	superfamily_Peripla_BP_I,prints_GPCR_3_mtglu_rcpt_3		0.408	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	protein_coding	OTTHUMT00000253362.2	G		-		86394618	+1	no_errors	ENST00000361669	ensembl	human	known	74_37	missense	SNP	1.000	A
CD33	945	genome.wustl.edu	37	19	51729106	51729106	+	Missense_Mutation	SNP	G	G	T	rs201074739|rs201342074	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr19:51729106G>T	ENST00000262262.4	+	3	487	c.466G>T	c.(466-468)Ggc>Tgc	p.G156C	CD33_ENST00000421133.2_Missense_Mutation_p.G29C|CD33_ENST00000436584.2_Missense_Mutation_p.G29C|CD33_ENST00000391796.3_Missense_Mutation_p.G156C	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	156	Ig-like C2-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)	p.G156C(1)		NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	TCTAGAACCCGGCCACTCCAA	0.607																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000105383						80.0	84.0	82.0					19																	51729106		2203	4297	6500	CD33	SO:0001583	missense	0			-	HGNC	M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.466G>T	19.37:g.51729106G>T	ENSP00000262262:p.Gly156Cys	Somatic	0	18	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	3	85.71	B4E3P8|C9JEN7|F8WAL2|Q8TD24	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom	p.G156C	ENST00000262262.4	37	c.466	CCDS33084.1	19	.	.	.	.	.	.	.	.	.	.	.	13.48	2.250319	0.39797	.	.	ENSG00000105383	ENST00000436584;ENST00000262262;ENST00000421133;ENST00000391796	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	3.08	3.08	0.35506	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.588614	0.13010	U	0.420977	T	0.40815	0.1132	M	0.94021	3.485	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	T	0.18808	-1.0325	10	0.87932	D	0	.	9.7514	0.40478	0.0:0.0:1.0:0.0	.	29;156;156	C9JEN7;F8WAL2;P20138	.;.;CD33_HUMAN	C	29;156;29;156	ENSP00000403331:G29C;ENSP00000262262:G156C;ENSP00000410126:G29C;ENSP00000375673:G156C	ENSP00000262262:G156C	G	+	1	0	CD33	56420918	0.384000	0.25164	0.002000	0.10522	0.001000	0.01503	3.953000	0.56699	1.731000	0.51592	0.462000	0.41574	GGC	-	pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom		0.607	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD33	protein_coding	OTTHUMT00000464199.2	G	NM_001772	-		51729106	+1	no_errors	ENST00000262262	ensembl	human	known	74_37	missense	SNP	0.004	T
CSMD2	114784	genome.wustl.edu	37	1	34383726	34383726	+	Missense_Mutation	SNP	C	C	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:34383726C>G	ENST00000373381.4	-	5	1065	c.889G>C	c.(889-891)Gaa>Caa	p.E297Q		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	257	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCAGTGACTTCCAGAAAGTCG	0.517																																																	0								ENSG00000121904						97.0	84.0	88.0					1																	34383726		2203	4300	6503	CSMD2	SO:0001583	missense	0			-	HGNC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.889G>C	1.37:g.34383726C>G	ENSP00000362479:p.Glu297Gln	Somatic	0	32	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	1	95.00	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.E297Q	ENST00000373381.4	37	c.889		1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667467	0.88348	.	.	ENSG00000121904	ENST00000373381	D	0.94000	-3.33	5.48	5.48	0.80851	CUB (5);	0.000000	0.64402	D	0.000001	D	0.95683	0.8596	M	0.72353	2.195	0.80722	D	1	P;D	0.57571	0.929;0.98	P;P	0.60541	0.794;0.876	D	0.94208	0.7456	10	0.28530	T	0.3	.	18.3364	0.90290	0.0:1.0:0.0:0.0	.	257;297	Q7Z408;E7EUA6	CSMD2_HUMAN;.	Q	297	ENSP00000362479:E297Q	ENSP00000241312:E257Q	E	-	1	0	CSMD2	34156313	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.811000	0.86092	2.591000	0.87537	0.478000	0.44815	GAA	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom		0.517	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	protein_coding		C	NM_052896	-		34383726	-1	no_errors	ENST00000373381	ensembl	human	known	74_37	missense	SNP	1.000	G
PCMTD1	115294	genome.wustl.edu	37	8	52732893	52732894	+	3'UTR	INS	-	-	C	rs138060787		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr8:52732893_52732894insC	ENST00000360540.5	-	0	1497_1498				PCMTD1_ENST00000544451.1_3'UTR|PCMTD1_ENST00000519559.1_5'UTR	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1							cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				CAGTAGGCATTTTTCTTCTTGA	0.302																																																	0								ENSG00000168300																																			PCMTD1	SO:0001624	3_prime_UTR_variant	0				HGNC		CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.*18->G	8.37:g.52732893_52732894insC		Somatic	0	31	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	26	21.21	Q96FK9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000360540.5	37	NULL	CCDS6148.1	8																																																																																			-	-		0.302	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCMTD1	protein_coding	OTTHUMT00000377909.2	-	NM_052937			52732894	-1	no_errors	ENST00000519559	ensembl	human	known	74_37	rna	INS	0.206:0.021	C
MARK1	4139	genome.wustl.edu	37	1	220825491	220825491	+	Splice_Site	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:220825491G>A	ENST00000366917.4	+	15	2001	c.1735G>A	c.(1735-1737)Ggt>Agt	p.G579S	MARK1_ENST00000402574.1_Splice_Site_p.G444S|MARK1_ENST00000366918.4_Splice_Site_p.G557S					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TTACCGGCCTGGGTAATGTGT	0.428																																																	0								ENSG00000116141						115.0	108.0	110.0					1																	220825491		2203	4300	6503	MARK1	SO:0001630	splice_region_variant	0			-	HGNC	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1736+1G>A	1.37:g.220825491G>A		Somatic	0	60	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	47	29.85		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_KA1_dom,superfamily_Kinase-like_dom,superfamily_KA1/Ssp2_C,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.G579S	ENST00000366917.4	37	c.1735	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	9.737	1.163771	0.21538	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.27402	1.67;1.67;1.67	5.74	3.88	0.44766	.	0.543405	0.20470	N	0.091706	T	0.10637	0.0260	N	0.03194	-0.395	0.35344	D	0.786768	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.0;0.001;0.0;0.001	T	0.23190	-1.0195	10	0.02654	T	1	.	7.4892	0.27452	0.3546:0.0:0.6454:0.0	.	579;444;579;557	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	S	444;557;579	ENSP00000386017:G444S;ENSP00000355885:G557S;ENSP00000355884:G579S	ENSP00000355884:G579S	G	+	1	0	MARK1	218892114	0.999000	0.42202	1.000000	0.80357	0.950000	0.60333	1.932000	0.40143	0.892000	0.36259	0.563000	0.77884	GGT	-	NULL		0.428	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	protein_coding	OTTHUMT00000090899.1	G		-	Missense_Mutation	220825491	+1	no_errors	ENST00000366917	ensembl	human	known	74_37	missense	SNP	1.000	A
OTOP1	133060	genome.wustl.edu	37	4	4228274	4228282	+	In_Frame_Del	DEL	CCACAGCAG	CCACAGCAG	-	rs75328065|rs199840382|rs111245977|rs377667898|rs200554408|rs201436152	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	CCACAGCAG	CCACAGCAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr4:4228274_4228282delCCACAGCAG	ENST00000296358.4	-	1	334_342	c.310_318delCTGCTGTGG	c.(310-318)ctgctgtggdel	p.LLW104del		NM_177998.1	NP_819056.1	Q7RTM1	OTOP1_HUMAN	otopetrin 1	104					biomineral tissue development (GO:0031214)|detection of gravity (GO:0009590)|inner ear morphogenesis (GO:0042472)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)		p.L104_W106delLLW(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|liver(4)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ACCACAGCATCCACAGCAGCTGCAGCAGC	0.727																																																	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)						ENSG00000163982																																			OTOP1	SO:0001651	inframe_deletion	0				HGNC	BK000653	CCDS3372.1	4p16.2	2008-02-05			ENSG00000163982	ENSG00000163982			19656	protein-coding gene	gene with protein product		607806				12651873	Standard	NM_177998		Approved		uc003ghp.1	Q7RTM1	OTTHUMG00000090301	ENST00000296358.4:c.310_318delCTGCTGTGG	4.37:g.4228274_4228282delCCACAGCAG	ENSP00000296358:p.Leu104_Trp106del	Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1L476	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Otopetrin	p.LLW104in_frame_del	ENST00000296358.4	37	c.318_310	CCDS3372.1	4																																																																																			-	NULL		0.727	OTOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP1	protein_coding	OTTHUMT00000206661.2	CCACAGCAG	NM_177998			4228282	-1	no_errors	ENST00000296358	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:0.995:0.999:0.998:0.998:1.000:1.000	-
COL18A1	80781	genome.wustl.edu	37	21	46909414	46909414	+	Silent	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr21:46909414G>A	ENST00000359759.4	+	18	3204	c.3183G>A	c.(3181-3183)gtG>gtA	p.V1061V	COL18A1_ENST00000400337.2_Silent_p.V646V|COL18A1_ENST00000355480.5_Silent_p.V826V			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1061	Triple-helical region 4 (COL4).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		ATCCTGGCGTGCCTGGGCTGC	0.687																																																	0								ENSG00000182871						16.0	20.0	18.0					21																	46909414		1958	4129	6087	COL18A1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3183G>A	21.37:g.46909414G>A		Somatic	0	71	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	52	34.18	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl_sf,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.V1061	ENST00000359759.4	37	c.3183		21																																																																																			-	pfam_Collagen		0.687	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	protein_coding	OTTHUMT00000206827.1	G		-		46909414	+1	no_errors	ENST00000359759	ensembl	human	known	74_37	silent	SNP	0.000	A
DCHS1	8642	genome.wustl.edu	37	11	6651257	6651257	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr11:6651257C>T	ENST00000299441.3	-	10	5179	c.4768G>A	c.(4768-4770)Ggc>Agc	p.G1590S	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1590	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CGGAAGTGGCCGTCCCCGCCA	0.682																																																	0								ENSG00000166341						23.0	24.0	24.0					11																	6651257		2200	4296	6496	DCHS1	SO:0001583	missense	0			-	HGNC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.4768G>A	11.37:g.6651257C>T	ENSP00000299441:p.Gly1590Ser	Somatic	0	43	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	37	32.73	O15098	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G1590S	ENST00000299441.3	37	c.4768	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	19.84	3.901799	0.72754	.	.	ENSG00000166341	ENST00000299441	T	0.53857	0.6	4.68	3.75	0.43078	Cadherin (4);Cadherin-like (1);	0.166270	0.28606	N	0.014752	T	0.59972	0.2233	L	0.41079	1.255	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.53634	-0.8411	10	0.19147	T	0.46	.	12.2686	0.54693	0.0:0.9165:0.0:0.0835	.	1590	Q96JQ0	PCD16_HUMAN	S	1590	ENSP00000299441:G1590S	ENSP00000299441:G1590S	G	-	1	0	DCHS1	6607833	0.981000	0.34729	0.993000	0.49108	0.502000	0.33828	1.793000	0.38764	1.184000	0.42957	0.407000	0.27541	GGC	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.682	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	protein_coding	OTTHUMT00000257258.1	C	NM_003737	-		6651257	-1	no_errors	ENST00000299441	ensembl	human	known	74_37	missense	SNP	0.997	T
TRIM64B	642446	genome.wustl.edu	37	11	89603886	89603886	+	Missense_Mutation	SNP	C	C	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr11:89603886C>G	ENST00000329862.6	-	6	1252	c.1253G>C	c.(1252-1254)aGt>aCt	p.S418T		NM_001136486.1|NM_001164397.1	NP_001129958.1|NP_001157869.1	A6NI03	TR64B_HUMAN	tripartite motif containing 64B	418	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)	2						ATCAAAAAAACTCACAGATCC	0.418																																																	0								ENSG00000189253						87.0	89.0	88.0					11																	89603886		692	1580	2272	TRIM64B	SO:0001583	missense	0			-	HGNC		CCDS53693.1	11q14.3	2014-04-02	2011-01-25		ENSG00000189253	ENSG00000189253		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	37147	protein-coding gene	gene with protein product			"""tripartite motif-containing 64B"""				Standard	NM_001164397		Approved		uc021qoo.1	A6NI03	OTTHUMG00000167638	ENST00000329862.6:c.1253G>C	11.37:g.89603886C>G	ENSP00000332969:p.Ser418Thr	Somatic	0	244	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	387	9.58		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S418T	ENST00000329862.6	37	c.1253	CCDS53693.1	11	.	.	.	.	.	.	.	.	.	.	.	14.69	2.611282	0.46631	.	.	ENSG00000189253	ENST00000329862	T	0.67523	-0.27	2.2	-0.218	0.13142	.	.	.	.	.	T	0.70631	0.3246	M	0.84948	2.725	0.09310	N	1	.	.	.	.	.	.	T	0.63079	-0.6717	6	.	.	.	.	2.8802	0.05645	0.0:0.5:0.3016:0.1984	.	.	.	.	T	418	ENSP00000332969:S418T	.	S	-	2	0	TRIM64B	89243534	0.011000	0.17503	0.568000	0.28447	0.539000	0.34962	0.332000	0.19751	0.252000	0.21531	0.391000	0.25812	AGT	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.418	TRIM64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM64B	protein_coding	OTTHUMT00000395440.1	C		-		89603886	-1	no_errors	ENST00000329862	ensembl	human	known	74_37	missense	SNP	0.277	G
CD244	51744	genome.wustl.edu	37	1	160832438	160832438	+	Silent	SNP	G	G	C			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:160832438G>C	ENST00000368033.3	-	1	112	c.30C>G	c.(28-30)ctC>ctG	p.L10L	CD244_ENST00000322302.7_Silent_p.L10L|CD244_ENST00000368034.4_Silent_p.L10L|CD244_ENST00000368032.2_Silent_p.L10L			Q9BZW8	CD244_HUMAN	CD244 molecule, natural killer cell receptor 2B4	10					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|large_intestine(3)|lung(12)|ovary(1)|urinary_tract(1)	18	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GGAGCAGGAGGAGTATGAGGG	0.637																																																	0								ENSG00000122223						103.0	70.0	81.0					1																	160832438		2203	4300	6503	CD244	SO:0001819	synonymous_variant	0			-	HGNC	AF105261	CCDS1210.1, CCDS53398.1, CCDS53399.1	1q23.1	2013-01-11	2006-03-29		ENSG00000122223	ENSG00000122223		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18171	protein-coding gene	gene with protein product		605554	"""natural killer cell receptor 2B4"", ""CD244 natural killer cell receptor 2B4"""			3772297, 10458320	Standard	NM_016382		Approved	2B4, NAIL, NKR2B4, Nmrk, SLAMF4	uc009wtq.3	Q9BZW8	OTTHUMG00000028606	ENST00000368033.3:c.30C>G	1.37:g.160832438G>C		Somatic	0	50	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	53	34	60.92	Q5VYI2|Q5VYI6|Q5VYI7|Q96T47|Q9NQD2|Q9NQD3|Q9Y288	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NK_rcpt_2B4_Ig_dom,pfscan_Ig-like_dom	p.L10	ENST00000368033.3	37	c.30	CCDS53399.1	1																																																																																			-	NULL		0.637	CD244-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD244	protein_coding	OTTHUMT00000071469.1	G	NM_016382	-		160832438	-1	no_errors	ENST00000368033	ensembl	human	known	74_37	silent	SNP	0.007	C
PIP	5304	genome.wustl.edu	37	7	142829269	142829269	+	Silent	SNP	C	C	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr7:142829269C>T	ENST00000291009.3	+	1	100	c.60C>T	c.(58-60)tgC>tgT	p.C20C		NM_002652.2	NP_002643.1	P12273	PIP_HUMAN	prolactin-induced protein	20					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of gene expression (GO:0010628)|proteolysis (GO:0006508)|regulation of immune system process (GO:0002682)|retina homeostasis (GO:0001895)	apical plasma membrane (GO:0016324)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	actin binding (GO:0003779)|aspartic-type endopeptidase activity (GO:0004190)|glycoprotein binding (GO:0001948)|IgG binding (GO:0019864)|protein dimerization activity (GO:0046983)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	18	Melanoma(164;0.059)	Ovarian(593;2.82e-05)|Breast(660;0.012)		BRCA - Breast invasive adenocarcinoma(188;0.0026)|LUSC - Lung squamous cell carcinoma(290;0.0733)|Lung(243;0.08)		TGGTTCTCTGCCTGCAGTTGG	0.577																																																	0								ENSG00000159763						186.0	178.0	181.0					7																	142829269		2203	4299	6502	PIP	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34768.1	7q34	2013-09-19			ENSG00000159763	ENSG00000159763			8993	protein-coding gene	gene with protein product	"""prolactin-inducible protein"""	176720				2727805, 1955075	Standard	NM_002652		Approved	GCDFP-15, GCDFP15, GPIP4	uc003wcf.1	P12273	OTTHUMG00000152635	ENST00000291009.3:c.60C>T	7.37:g.142829269C>T		Somatic	0	42	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	18	43.75	A0A963|A0A9C3|A0A9F3|A4D2I1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_SV_autoAg,pirsf_SV_autoAg	p.C20	ENST00000291009.3	37	c.60	CCDS34768.1	7																																																																																			-	pfam_SV_autoAg,pirsf_SV_autoAg		0.577	PIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP	protein_coding	OTTHUMT00000327089.1	C	NM_002652	-		142829269	+1	no_errors	ENST00000291009	ensembl	human	known	74_37	silent	SNP	0.887	T
BHLHA9	727857	genome.wustl.edu	37	17	1174545	1174545	+	Missense_Mutation	SNP	A	A	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr17:1174545A>T	ENST00000391429.1	+	1	693	c.688A>T	c.(688-690)Atg>Ttg	p.M230L		NM_001164405.1	NP_001157877.1	Q7RTU4	BHA09_HUMAN	basic helix-loop-helix family, member a9	230					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)										CGCCCCCGGGATGGGCCATCC	0.736																																																	0								ENSG00000205899						1.0	1.0	1.0					17																	1174545		209	522	731	BHLHA9	SO:0001583	missense	0			-	HGNC		CCDS45560.1	17p13.3	2009-01-12	2009-01-12		ENSG00000205899	ENSG00000205899		"""Basic helix-loop-helix proteins"""	35126	protein-coding gene	gene with protein product		615416				14516699, 18557763	Standard	NM_001164405		Approved	bHLHa9, BHLHF42	uc021tnd.1	Q7RTU4	OTTHUMG00000132192	ENST00000391429.1:c.688A>T	17.37:g.1174545A>T	ENSP00000375248:p.Met230Leu	Somatic	0	29	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	9	47.06	A8MSH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.M230L	ENST00000391429.1	37	c.688	CCDS45560.1	17	.	.	.	.	.	.	.	.	.	.	A	1.760	-0.487093	0.04352	.	.	ENSG00000205899	ENST00000391429	D	0.94457	-3.43	4.4	0.914	0.19360	.	.	.	.	.	T	0.78704	0.4325	N	0.02916	-0.46	0.09310	N	1	.	.	.	.	.	.	T	0.69587	-0.5105	7	0.02654	T	1	-2.8851	0.9258	0.01324	0.2092:0.4176:0.1591:0.2142	.	.	.	.	L	230	ENSP00000375248:M230L	ENSP00000375248:M230L	M	+	1	0	BHLHA9	1121295	0.005000	0.15991	0.508000	0.27688	0.017000	0.09413	-0.189000	0.09629	0.369000	0.24510	0.459000	0.35465	ATG	-	NULL		0.736	BHLHA9-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BHLHA9	protein_coding	OTTHUMT00000255245.1	A	XM_001125971	-		1174545	+1	no_errors	ENST00000391429	ensembl	human	known	74_37	missense	SNP	0.081	T
CROCCP2	84809	genome.wustl.edu	37	1	16952377	16952377	+	lincRNA	SNP	C	C	T	rs9658928	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:16952377C>T	ENST00000412962.1	-	0	892							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											CCCTCCAGGCCCTGCCGTGCC	0.697													.|||	849	0.169529	0.1452	0.0965	5008	,	,		49550	0.2907		0.1392	False		,,,				2504	0.1605																0								ENSG00000215908																																			CROCCP2			0			-	HGNC	AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16952377C>T		Somatic	0	92	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	52	8.77	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			-	-		0.697	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	lincRNA	OTTHUMT00000092784.1	C	NR_026752.1	rs9658928		16952377	-1	no_errors	ENST00000412962	ensembl	human	known	74_37	rna	SNP	1.000	T
ARID1A	8289	genome.wustl.edu	37	1	27097647	27097647	+	Missense_Mutation	SNP	A	A	T	rs372945891		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:27097647A>T	ENST00000324856.7	+	12	3607	c.3236A>T	c.(3235-3237)aAc>aTc	p.N1079I	ARID1A_ENST00000540690.1_5'Flank|ARID1A_ENST00000374152.2_Missense_Mutation_p.N696I|ARID1A_ENST00000457599.2_Missense_Mutation_p.N1079I	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1079	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTTGCAACCAACCTCAATGTG	0.478			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0								ENSG00000117713						76.0	71.0	73.0					1																	27097647		2203	4300	6503	ARID1A	SO:0001583	missense	0			-	HGNC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3236A>T	1.37:g.27097647A>T	ENSP00000320485:p.Asn1079Ile	Somatic	0	46	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	2	94.12	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.N1079I	ENST00000324856.7	37	c.3236	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.106196	0.37145	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	T;T;T	0.63913	-0.07;-0.07;-0.07	5.33	5.33	0.75918	ARID/BRIGHT DNA-binding domain (5);	0.086125	0.85682	D	0.000000	T	0.64046	0.2563	N	0.19112	0.55	0.80722	D	1	D;D;D	0.63046	0.992;0.99;0.992	D;P;D	0.64144	0.922;0.873;0.922	T	0.62562	-0.6828	10	0.28530	T	0.3	-11.6727	15.4606	0.75353	1.0:0.0:0.0:0.0	.	1079;1079;733	O14497;O14497-2;Q4LE49	ARI1A_HUMAN;.;.	I	1079;1079;696	ENSP00000320485:N1079I;ENSP00000387636:N1079I;ENSP00000363267:N696I	ENSP00000320485:N1079I	N	+	2	0	ARID1A	26970234	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.592000	0.67543	2.238000	0.73509	0.533000	0.62120	AAC	-	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd		0.478	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	protein_coding	OTTHUMT00000011437.2	A	NM_139135	-		27097647	+1	no_errors	ENST00000324856	ensembl	human	known	74_37	missense	SNP	1.000	T
ADAMTSL4	54507	genome.wustl.edu	37	1	150524368	150524368	+	Intron	DEL	A	A	-	rs199813152		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:150524368delA	ENST00000271643.4	+	3	152				ADAMTSL4_ENST00000369039.5_Intron|MIR4257_ENST00000581735.1_RNA|RP11-54A4.2_ENST00000442435.2_RNA|ADAMTSL4_ENST00000483335.1_3'UTR|ADAMTSL4_ENST00000369041.5_Intron|ADAMTSL4_ENST00000369038.2_5'Flank	NM_019032.4	NP_061905.2	Q6UY14	ATL4_HUMAN	ADAMTS-like 4						apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)			breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			tctccatctcaaaaaaaaaaa	0.527																																																	0								ENSG00000143382																																			ADAMTSL4	SO:0001627	intron_variant	0				HGNC	BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000271643.4:c.-84-313A>-	1.37:g.150524368delA		Somatic	0	13	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000271643.4	37	NULL	CCDS955.1	1																																																																																			-	-		0.527	ADAMTSL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL4	protein_coding		A	NM_019032			150524368	+1	no_errors	ENST00000483335	ensembl	human	known	74_37	rna	DEL	0.000	-
IL1RAPL1	11141	genome.wustl.edu	37	X	29973451	29973451	+	Silent	SNP	G	G	T	rs35305747	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chrX:29973451G>T	ENST00000378993.1	+	11	2278	c.1605G>T	c.(1603-1605)acG>acT	p.T535T	IL1RAPL1_ENST00000302196.4_Silent_p.T535T	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	535	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						AGCTCCTGACGGTCATTAAAT	0.418													G|||	2	0.000529801	0.0	0.0	3775	,	,		15694	0.0		0.002	False		,,,				2504	0.0																0								ENSG00000169306	G		2,3831		0,2,0,1629,571	59.0	55.0	56.0		1605	-0.9	1.0	X	dbSNP_126	56	10,6718		0,6,4,2422,1868	no	coding-synonymous	IL1RAPL1	NM_014271.3		0,8,4,4051,2439	TT,TG,T,GG,G		0.1486,0.0522,0.1136		535/697	29973451	12,10549	2202	4300	6502	IL1RAPL1	SO:0001819	synonymous_variant	0			GMAF=0	HGNC	AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.1605G>T	X.37:g.29973451G>T		Somatic	0	41	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	35	14.63	A0AVG4|Q9UJ53	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.T535	ENST00000378993.1	37	c.1605	CCDS14218.1	X																																																																																			-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom		0.418	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	protein_coding	OTTHUMT00000056155.1	G	NM_014271	rs35305747		29973451	+1	no_errors	ENST00000302196	ensembl	human	known	74_37	silent	SNP	0.876	T
ECSIT	51295	genome.wustl.edu	37	19	11617100	11617100	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr19:11617100C>T	ENST00000270517.7	-	8	1330	c.1195G>A	c.(1195-1197)Gag>Aag	p.E399K	ECSIT_ENST00000591104.1_3'UTR|ZNF653_ENST00000293771.5_5'Flank|CTC-398G3.6_ENST00000585656.1_5'Flank|ZNF653_ENST00000593191.1_5'Flank|ECSIT_ENST00000588998.1_3'UTR|ECSIT_ENST00000252440.7_3'UTR|ECSIT_ENST00000417981.2_Missense_Mutation_p.E185K|ECSIT_ENST00000591352.1_5'Flank	NM_016581.4	NP_057665.2	Q9BQ95	ECSIT_HUMAN	ECSIT signalling integrator	399					BMP signaling pathway (GO:0030509)|innate immune response (GO:0045087)|mesoderm formation (GO:0001707)|oxidation-reduction process (GO:0055114)|regulation of oxidoreductase activity (GO:0051341)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	oxidoreductase activity, acting on NAD(P)H (GO:0016651)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	11						GTCTGGAGCTCCCGGGTGGAC	0.667																																																	0								ENSG00000130159						25.0	28.0	27.0					19																	11617100		2202	4295	6497	ECSIT	SO:0001583	missense	0			-	HGNC	BC005119	CCDS12262.1, CCDS45979.1, CCDS45980.1, CCDS59353.1	19p13.2	2013-05-24	2013-05-24			ENSG00000130159		"""Mitochondrial respiratory chain complex assembly factors"""	29548	protein-coding gene	gene with protein product	"""signaling intermediate in Toll pathway evolutionarily conserved ortholog (mouse)"""	608388	"""ECSIT homolog (Drosophila)"""			10465784, 22982022	Standard	NM_001142464		Approved	SITPEC	uc002msb.3	Q9BQ95		ENST00000270517.7:c.1195G>A	19.37:g.11617100C>T	ENSP00000270517:p.Glu399Lys	Somatic	0	89	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	112	12.50	E9PAN9|K7EMM0|Q96HQ7|Q9NYI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ECSIT	p.E399K	ENST00000270517.7	37	c.1195	CCDS12262.1	19	.	.	.	.	.	.	.	.	.	.	C	19.10	3.762635	0.69763	.	.	ENSG00000130159	ENST00000270517;ENST00000417981	T;T	0.37058	1.26;1.22	5.4	5.4	0.78164	.	0.221378	0.44688	D	0.000436	T	0.57917	0.2086	M	0.75264	2.295	0.80722	D	1	D;D	0.76494	0.993;0.999	D;D	0.64144	0.91;0.922	T	0.61023	-0.7146	10	0.62326	D	0.03	-34.5689	14.6711	0.68945	0.0:1.0:0.0:0.0	.	185;399	E9PAN9;Q9BQ95	.;ECSIT_HUMAN	K	399;185	ENSP00000270517:E399K;ENSP00000412712:E185K	ENSP00000270517:E399K	E	-	1	0	ECSIT	11478100	0.996000	0.38824	1.000000	0.80357	0.069000	0.16628	3.386000	0.52492	2.543000	0.85770	0.585000	0.79938	GAG	-	NULL		0.667	ECSIT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECSIT	protein_coding	OTTHUMT00000442603.2	C	NM_016581	-		11617100	-1	no_errors	ENST00000270517	ensembl	human	known	74_37	missense	SNP	1.000	T
MYO10	4651	genome.wustl.edu	37	5	16766285	16766285	+	Missense_Mutation	SNP	T	T	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr5:16766285T>G	ENST00000513610.1	-	11	1537	c.1083A>C	c.(1081-1083)ttA>ttC	p.L361F		NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	361	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						CCAGCCCAAGTAACTCCGCAG	0.512																																																	0								ENSG00000145555						107.0	105.0	106.0					5																	16766285		1952	4159	6111	MYO10	SO:0001583	missense	0			-	HGNC	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.1083A>C	5.37:g.16766285T>G	ENSP00000421280:p.Leu361Phe	Somatic	0	26	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	21	22.22	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_Pleckstrin_homology,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_Ras-assoc,superfamily_P-loop_NTPase,superfamily_FERM_central,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology,prints_Myosin_head_motor_dom	p.L361F	ENST00000513610.1	37	c.1083	CCDS54834.1	5	.	.	.	.	.	.	.	.	.	.	T	19.31	3.802915	0.70682	.	.	ENSG00000145555	ENST00000513610;ENST00000513882	T;T	0.81163	-1.46;-1.46	5.05	1.06	0.20224	Myosin head, motor domain (2);	.	.	.	.	D	0.88276	0.6393	M	0.89353	3.025	0.80722	D	1	D	0.54397	0.966	P	0.62885	0.908	D	0.86353	0.1712	9	0.87932	D	0	.	8.7465	0.34589	0.0:0.2878:0.0:0.7122	.	361	Q9HD67	MYO10_HUMAN	F	361;372	ENSP00000421280:L361F;ENSP00000421309:L372F	ENSP00000421280:L361F	L	-	3	2	MYO10	16819285	0.720000	0.27996	0.997000	0.53966	0.963000	0.63663	-0.280000	0.08468	-0.047000	0.13423	0.482000	0.46254	TTA	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom		0.512	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO10	protein_coding	OTTHUMT00000366167.1	T	NM_012334	-		16766285	-1	no_errors	ENST00000513610	ensembl	human	known	74_37	missense	SNP	0.998	G
CCDC168	643677	genome.wustl.edu	37	13	103386924	103386924	+	Frame_Shift_Del	DEL	T	T	-	rs61389599		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr13:103386924delT	ENST00000322527.2	-	1	2235	c.2236delA	c.(2236-2238)atafs	p.I747fs		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	747																	ATATCGATTATTTTTTTTTGG	0.398																																																	0								ENSG00000175820						276.0	197.0	221.0					13																	103386924		692	1591	2283	CCDC168	SO:0001589	frameshift_variant	0				HGNC		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.2236delA	13.37:g.103386924delT	ENSP00000320232:p.Ile747fs	Somatic	0	47	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	19	13.64	Q8N800	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.I746fs	ENST00000322527.2	37	c.2236		13																																																																																			-	NULL		0.398	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	protein_coding		T	NM_001146197			103386924	-1	no_errors	ENST00000322527	ensembl	human	known	74_37	frame_shift_del	DEL	0.005	-
KDR	3791	genome.wustl.edu	37	4	55981139	55981139	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr4:55981139A>G	ENST00000263923.4	-	5	855	c.560T>C	c.(559-561)aTt>aCt	p.I187T		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	187	Ig-like C2-type 2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTAGCTGGGAATAGTAAAGCC	0.373			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																														Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	0								ENSG00000128052						75.0	75.0	75.0					4																	55981139		2203	4300	6503	KDR	SO:0001583	missense	0			-	HGNC	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.560T>C	4.37:g.55981139A>G	ENSP00000263923:p.Ile187Thr	Somatic	0	38	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	18	43.75	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_dom,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR2_rcpt	p.I187T	ENST00000263923.4	37	c.560	CCDS3497.1	4	.	.	.	.	.	.	.	.	.	.	A	21.9	4.220347	0.79464	.	.	ENSG00000128052	ENST00000263923	T	0.10763	2.84	5.9	5.9	0.94986	Tyrosine-protein kinase, vascular endothelial growth factor receptor (VEGFR), N-terminal (1);Immunoglobulin-like fold (1);	0.311123	0.35903	N	0.002920	T	0.32071	0.0817	M	0.73598	2.24	0.42954	D	0.994387	D;P	0.56968	0.978;0.653	P;B	0.61533	0.89;0.432	T	0.03773	-1.1005	10	0.87932	D	0	.	16.315	0.82915	1.0:0.0:0.0:0.0	.	187;187	P35968-2;P35968	.;VGFR2_HUMAN	T	187	ENSP00000263923:I187T	ENSP00000263923:I187T	I	-	2	0	KDR	55675896	1.000000	0.71417	0.540000	0.28089	0.969000	0.65631	8.558000	0.90704	2.250000	0.74265	0.533000	0.62120	ATT	-	smart_Ig_sub,prints_VEGFR2_rcpt		0.373	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDR	protein_coding	OTTHUMT00000250645.1	A		-		55981139	-1	no_errors	ENST00000263923	ensembl	human	known	74_37	missense	SNP	0.901	G
NPAS3	64067	genome.wustl.edu	37	14	33525132	33525132	+	Silent	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr14:33525132G>T	ENST00000356141.4	+	2	72	c.72G>T	c.(70-72)ctG>ctT	p.L24L	NPAS3_ENST00000548645.1_Intron|NPAS3_ENST00000551492.1_Silent_p.L31L|NPAS3_ENST00000341321.4_Silent_p.L24L|NPAS3_ENST00000357798.5_Intron|NPAS3_ENST00000346562.2_Intron			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	24					locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		AGCATCCTCTGCCCAACCAAT	0.403																																																	0								ENSG00000151322						133.0	112.0	118.0					14																	33525132		692	1591	2283	NPAS3	SO:0001819	synonymous_variant	0			-	HGNC	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.72G>T	14.37:g.33525132G>T		Somatic	0	72	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	23	11.54	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PAS_fold_3,pfam_PAS_fold,superfamily_PAS,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pfscan_PAS,pfscan_bHLH_dom	p.L24	ENST00000356141.4	37	c.72	CCDS53891.1	14																																																																																			-	NULL		0.403	NPAS3-004	KNOWN	basic|CCDS	protein_coding	NPAS3	protein_coding	OTTHUMT00000276645.1	G		-		33525132	+1	no_errors	ENST00000356141	ensembl	human	known	74_37	silent	SNP	1.000	T
UGT1A6	54578	genome.wustl.edu	37	2	234663608	234663608	+	Intron	SNP	A	A	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr2:234663608A>T	ENST00000305139.6	+	2	1000				UGT1A6_ENST00000373424.1_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A3_ENST00000482026.1_Intron|AC114812.5_ENST00000450901.1_RNA|UGT1A4_ENST00000373409.3_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A6_ENST00000480628.1_3'UTR	NM_001072.3	NP_001063.2	P19224	UD16_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A6						cellular glucuronidation (GO:0052695)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;5.86e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000384)|Lung(119;0.00306)|LUSC - Lung squamous cell carcinoma(224;0.00702)	Acetaminophen(DB00316)|Deferiprone(DB08826)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Propofol(DB00818)|Valproic Acid(DB00313)	GCCGCCAAAGAACTCCCTGAA	0.632																																																	0								ENSG00000178836																																			AC114812.5	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	M84130	CCDS2507.1, CCDS2508.1	2q37	2010-03-05	2005-07-20		ENSG00000167165	ENSG00000167165		"""UDP glucuronosyltransferases"""	12538	other	complex locus constituent		606431	"""UDP glycosyltransferase 1 family, polypeptide A6"""			9295054, 1339448	Standard	NM_001072		Approved	HLUGP, GNT1, UGT1F		P19224	OTTHUMG00000059122	ENST00000305139.6:c.862-12072A>T	2.37:g.234663608A>T		Somatic	0	50	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	25	37.50	A6NKK6|B8K289|Q96TE7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000305139.6	37	NULL	CCDS2507.1	2																																																																																			-	-		0.632	UGT1A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100286922	protein_coding	OTTHUMT00000130988.1	A	NM_205862	-		234663608	-1	no_errors	ENST00000450901	ensembl	human	known	74_37	rna	SNP	1.000	T
ESPNP	284729	genome.wustl.edu	37	1	17023376	17023376	+	RNA	SNP	C	C	T	rs613579	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:17023376C>T	ENST00000492551.1	-	0	1571					NR_026567.1				espin pseudogene																		CCAGTAGCTCCGAGTTGTCGC	0.617													c|||	1978	0.394968	0.2474	0.415	5008	,	,		39011	0.497		0.4264	False		,,,				2504	0.4427																0								ENSG00000268869																																			ESPNP			0			-	HGNC	AL035288		1p36.13	2013-05-22			ENSG00000268869	ENSG00000268869			23285	pseudogene	pseudogene						15286153	Standard	NR_026567		Approved		uc001azn.1		OTTHUMG00000000803		1.37:g.17023376C>T		Somatic	1	119	0.83		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	53	10.17		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000492551.1	37	NULL		1																																																																																			-	-		0.617	ESPNP-002	KNOWN	basic	processed_transcript	ESPNP	pseudogene	OTTHUMT00000326311.1	C		rs613579		17023376	-1	no_errors	ENST00000492551	ensembl	human	known	74_37	rna	SNP	0.527	T
LAMB1	3912	genome.wustl.edu	37	7	107575793	107575805	+	Intron	DEL	TTTTTTTTTTTTT	TTTTTTTTTTTTT	-	rs200599445|rs560552126|rs375320552|rs532164356|rs551910860|rs369537571|rs199891469|rs201843656|rs201373619|rs537372267|rs372331129|rs2701027	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	TTTTTTTTTTTTT	TTTTTTTTTTTTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr7:107575793_107575805delTTTTTTTTTTTTT	ENST00000222399.6	-	27	4419				LAMB1_ENST00000474380.1_Intron|LAMB1_ENST00000393561.1_Intron	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						tttttctttgttttttttttttttttttttttt	0.408																																																	0								ENSG00000091136																																			LAMB1	SO:0001627	intron_variant	0				HGNC	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4188+54AAAAAAAAAAAAA>-	7.37:g.107575793_107575805delTTTTTTTTTTTTT		Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q14D91	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000222399.6	37	NULL	CCDS5750.1	7																																																																																			-	-		0.408	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	protein_coding	OTTHUMT00000314584.1	TTTTTTTTTTTTT	NM_002291			107575805	-1	no_errors	ENST00000491196	ensembl	human	putative	74_37	rna	DEL	0.022:0.021:0.019:0.017:0.014:0.011:0.008:0.004:0.003:0.001:0.001:0.000:0.000	-
XKR5	389610	genome.wustl.edu	37	8	6668560	6668573	+	RNA	DEL	CAGCCCTGTTTCTT	CAGCCCTGTTTCTT	-	rs72403823|rs368831209|rs375599997	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	CAGCCCTGTTTCTT	CAGCCCTGTTTCTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr8:6668560_6668573delCAGCCCTGTTTCTT	ENST00000518724.1	-	0	2358_2371							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		caaaatcatccagccctgtttcttcatttttcag	0.463														778	0.155351	0.3018	0.1614	5008	,	,		23176	0.1389		0.0477	False		,,,				2504	0.0808																0								ENSG00000186530																																			XKR5			0				HGNC	AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		8.37:g.6668560_6668573delCAGCCCTGTTTCTT		Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q5GH74	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000518724.1	37	NULL		8																																																																																			-	-		0.463	XKR5-001	KNOWN	basic	processed_transcript	XKR5	processed_transcript	OTTHUMT00000331969.2	CAGCCCTGTTTCTT	NM_207411			6668573	-1	no_errors	ENST00000405979	ensembl	human	known	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001	-
FLJ35934	400579	genome.wustl.edu	37	17	18314913	18314913	+	lincRNA	SNP	T	T	C	rs62074237	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr17:18314913T>C	ENST00000577684.1	+	0	441																											cccaccctcttctcctctccc	0.547																																																	0								ENSG00000220161																																			RP1-37N7.3			0			-	Clone_based_vega_gene																													17.37:g.18314913T>C		Somatic	1	102	0.97		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	100	8.26		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000577684.1	37	NULL		17	.	.	.	.	.	.	.	.	.	.	.	4.220	0.039756	0.08148	.	.	ENSG00000220161	ENST00000407600	.	.	.	.	.	.	.	.	.	.	.	T	0.37461	0.1004	.	.	.	.	.	.	.	.	.	.	.	.	T	0.47262	-0.9131	3	0.87932	D	0	.	3.2759	0.06898	0.0:0.3314:0.0:0.6686	rs62074237	.	.	.	P	22	.	ENSP00000385341:S22P	S	+	1	0	AL353997.1	18255638	0.801000	0.28930	0.101000	0.21167	0.101000	0.19017	0.227000	0.17795	0.131000	0.18576	0.130000	0.15844	TCT	-	-		0.547	RP1-37N7.3-001	KNOWN	basic	lincRNA	FLJ35934	lincRNA	OTTHUMT00000447480.1	T		rs62074237		18314913	+1	no_errors	ENST00000577684	ensembl	human	known	74_37	rna	SNP	0.351	C
PCNT	5116	genome.wustl.edu	37	21	47864659	47864659	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr21:47864659G>A	ENST00000359568.5	+	46	9999	c.9892G>A	c.(9892-9894)Gat>Aat	p.D3298N	PCNT_ENST00000480896.1_3'UTR	NM_006031.5	NP_006022.3	O95613	PCNT_HUMAN	pericentrin	3298					brain morphogenesis (GO:0048854)|cerebellar cortex morphogenesis (GO:0021696)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural precursor cell proliferation (GO:0061351)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of intracellular protein transport (GO:0090316)|spindle organization (GO:0007051)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|microtubule (GO:0005874)|motile cilium (GO:0031514)|pericentriolar material (GO:0000242)				NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(15)|liver(2)|lung(41)|ovary(5)|pancreas(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	104	Breast(49;0.112)					TGCTTCTCAAGATCCAGAACA	0.398																																																	0								ENSG00000160299						110.0	107.0	108.0					21																	47864659		2203	4300	6503	PCNT	SO:0001583	missense	0			-	HGNC	AB007862	CCDS33592.1	21q22.3	2014-02-20	2008-01-30	2005-11-03	ENSG00000160299	ENSG00000160299			16068	protein-coding gene	gene with protein product	"""kendrin"", ""Seckel syndrome 4"""	605925	"""pericentrin 2 (kendrin)"""	PCNT2		8812505, 9455477	Standard	NM_006031		Approved	KEN, KIAA0402, PCN, PCNTB, SCKL4	uc002zji.4	O95613	OTTHUMG00000090665	ENST00000359568.5:c.9892G>A	21.37:g.47864659G>A	ENSP00000352572:p.Asp3298Asn	Somatic	0	50	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	O43152|Q7Z7C9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PACT_domain	p.D3298N	ENST00000359568.5	37	c.9892	CCDS33592.1	21	.	.	.	.	.	.	.	.	.	.	G	35	5.535159	0.96460	.	.	ENSG00000160299	ENST00000359568	T	0.04502	3.61	5.92	5.92	0.95590	.	0.000000	0.35067	N	0.003480	T	0.23171	0.0560	M	0.72894	2.215	0.48696	D	0.999697	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.00017	-1.2377	10	0.87932	D	0	.	19.3095	0.94179	0.0:0.0:1.0:0.0	.	3101;3298	O95613-2;O95613	.;PCNT_HUMAN	N	3298	ENSP00000352572:D3298N	ENSP00000352572:D3298N	D	+	1	0	PCNT	46689087	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.479000	0.90431	2.804000	0.96469	0.655000	0.94253	GAT	-	NULL		0.398	PCNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNT	protein_coding	OTTHUMT00000207336.1	G	NM_006031	-		47864659	+1	no_errors	ENST00000359568	ensembl	human	known	74_37	missense	SNP	1.000	A
RP11-439I14.2	0	genome.wustl.edu	37	16	64770704	64770705	+	lincRNA	INS	-	-	CCAGTGATGGTCACCT	rs200421189|rs71143515|rs377231404|rs145408521|rs140029302	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr16:64770704_64770705insCCAGTGATGGTCACCT	ENST00000564293.1	+	0	453_454																											TGTCACCACTGCCACCTTGTTC	0.371														3288	0.65655	0.8434	0.5144	5008	,	,		21531	0.6052		0.5537	False		,,,				2504	0.6636																0								ENSG00000259859																																			RP11-439I14.2			0				Clone_based_vega_gene																													16.37:g.64770704_64770705insCCAGTGATGGTCACCT		Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000564293.1	37	NULL		16																																																																																			-	-		0.371	RP11-439I14.2-001	KNOWN	basic	lincRNA	ENSG00000259859	lincRNA	OTTHUMT00000422725.1	-				64770705	+1	no_errors	ENST00000564293	ensembl	human	known	74_37	rna	INS	0.009:0.006	CCAGTGATGGTCACCT
EFHC2	80258	genome.wustl.edu	37	X	44008133	44008133	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chrX:44008133C>A	ENST00000420999.1	-	15	2241	c.2158G>T	c.(2158-2160)Gat>Tat	p.D720Y	EFHC2_ENST00000343571.3_5'UTR	NM_025184.3	NP_079460.2	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	720							calcium ion binding (GO:0005509)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	29						AGCCAAACATCTTCACATCTC	0.368																																																	0								ENSG00000183690						78.0	63.0	68.0					X																	44008133		1859	4078	5937	EFHC2	SO:0001583	missense	0			-	HGNC	AK026254	CCDS55405.1	Xp11	2014-01-31			ENSG00000183690	ENSG00000183690		"""EF-hand domain containing"""	26233	protein-coding gene	gene with protein product		300817	"""mental retardation, X-linked 74"""	MRX74		17221867	Standard	NM_025184		Approved	FLJ22843	uc004dgb.4	Q5JST6	OTTHUMG00000021393	ENST00000420999.1:c.2158G>T	X.37:g.44008133C>A	ENSP00000404232:p.Asp720Tyr	Somatic	0	65	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	31	27	53.45	Q5JST8|Q68DK4|Q8NEI0|Q9H653	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1126,smart_Uncharacterised_DM10,pfscan_EF_hand_dom	p.D720Y	ENST00000420999.1	37	c.2158	CCDS55405.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.62|13.62	2.292683|2.292683	0.40594|0.40594	.|.	.|.	ENSG00000183690|ENSG00000183690	ENST00000343571;ENST00000333807;ENST00000420999|ENST00000441230	T;T|.	0.68479|.	-0.31;-0.33|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.217475|.	0.36854|.	N|.	0.002378|.	T|T	0.70090|0.70090	0.3184|0.3184	L|L	0.57536|0.57536	1.79|1.79	0.47778|0.47778	D|D	0.999518|0.999518	D|.	0.89917|.	1.0|.	D|.	0.68192|.	0.956|.	T|T	0.68538|0.68538	-0.5382|-0.5382	10|5	0.59425|.	D|.	0.04|.	-15.7608|-15.7608	15.34|15.34	0.74287|0.74287	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	720|.	Q5JST6|.	EFHC2_HUMAN|.	Y|I	133;720;748|700	ENSP00000333823:D720Y;ENSP00000404232:D748Y|.	ENSP00000333823:D720Y|.	D|R	-|-	1|2	0|0	EFHC2|EFHC2	43893077|43893077	1.000000|1.000000	0.71417|0.71417	0.986000|0.986000	0.45419|0.45419	0.110000|0.110000	0.19582|0.19582	2.796000|2.796000	0.47869|0.47869	2.268000|2.268000	0.75426|0.75426	0.506000|0.506000	0.49869|0.49869	GAT|AGA	-	NULL		0.368	EFHC2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	EFHC2	protein_coding	OTTHUMT00000056312.2	C	NM_025184	-		44008133	-1	no_errors	ENST00000420999	ensembl	human	known	74_37	missense	SNP	1.000	A
KRTAP19-5	337972	genome.wustl.edu	37	21	31874391	31874391	+	Silent	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr21:31874391G>A	ENST00000334151.2	-	1	44	c.18C>T	c.(16-18)aaC>aaT	p.N6N		NM_181611.1	NP_853642.1	Q3LI72	KR195_HUMAN	keratin associated protein 19-5	6						intermediate filament (GO:0005882)				endometrium(1)|large_intestine(5)|lung(4)|pancreas(1)|prostate(1)	12						CTCCATAGTAGTTGCCGTAGT	0.552																																																	0								ENSG00000186977						126.0	102.0	110.0					21																	31874391		2203	4300	6503	KRTAP19-5	SO:0001819	synonymous_variant	0			-	HGNC	AP001708	CCDS13597.1	21q22.1	2006-03-13			ENSG00000186977	ENSG00000186977		"""Keratin associated proteins"""	18940	protein-coding gene	gene with protein product						12359730	Standard	NM_181611		Approved	KAP19.5	uc011ada.2	Q3LI72	OTTHUMG00000057774	ENST00000334151.2:c.18C>T	21.37:g.31874391G>A		Somatic	0	126	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	46	50.54	A4IF22	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_KRTAP_type6/8/16/19/20	p.N6	ENST00000334151.2	37	c.18	CCDS13597.1	21																																																																																			-	pfam_KRTAP_type6/8/16/19/20		0.552	KRTAP19-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP19-5	protein_coding	OTTHUMT00000128226.2	G		-		31874391	-1	no_errors	ENST00000334151	ensembl	human	known	74_37	silent	SNP	0.353	A
LINC00686	140865	genome.wustl.edu	37	20	61326439	61326440	+	lincRNA	INS	-	-	CTGCACCTGCACCTGCAC	rs386816062|rs138220488|rs145607453		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr20:61326439_61326440insCTGCACCTGCACCTGCAC	ENST00000435412.1	-	0	267_268									long intergenic non-protein coding RNA 686																		CCGTCTGCCGTctgcacctgca	0.624																																																	0								ENSG00000237687																																			LINC00686			0				HGNC	D80415		20q13.33	2012-10-24	2012-10-24	2012-10-24	ENSG00000237687	ENSG00000237687		"""Long non-coding RNAs"""	16221	non-coding RNA	RNA, long non-coding			"""chromosome 20 open reading frame 90"""	C20orf90			Standard			Approved	bA93B14.2			OTTHUMG00000032927		20.37:g.61326439_61326440insCTGCACCTGCACCTGCAC		Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000435412.1	37	NULL		20																																																																																			-	-		0.624	LINC00686-001	KNOWN	basic	lincRNA	LINC00686	lincRNA	OTTHUMT00000080056.1	-				61326440	-1	no_errors	ENST00000435412	ensembl	human	known	74_37	rna	INS	0.017:0.023	CTGCACCTGCACCTGCAC
FCGR2B	2213	genome.wustl.edu	37	1	161643269	161643269	+	Intron	SNP	C	C	T	rs2045571	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:161643269C>T	ENST00000358671.5	+	4	727				FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000236937.9_Intron|FCGR2B_ENST00000403078.3_Intron|RP11-25K21.1_ENST00000453111.1_RNA|FCGR2B_ENST00000367961.4_Intron|FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000428605.2_Missense_Mutation_p.T221M	NM_001002275.2|NM_004001.4	NP_001002275.1|NP_003992.3	P31994	FCG2B_HUMAN	Fc fragment of IgG, low affinity IIb, receptor (CD32)						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)						all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Antithymocyte globulin(DB00098)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGACTAAGGACGGCAGCGAAG	0.532			T	?	ALL																																			Dom	yes		1	1q23	2213	"""Fc fragment of IgG, low affinity IIb, receptor for (CD32)"""		L	0								ENSG00000072694	T	,,,,	461,1289		44,373,458	22.0	18.0	19.0		,,,,	-4.0	0.0	1	dbSNP_94	19	422,3548		15,392,1578	no	intron,intron,intron,intron,intron	FCGR2B	NM_001002273.2,NM_001002274.2,NM_001002275.2,NM_001190828.1,NM_004001.4	,,,,	59,765,2036	TT,TC,CC		10.6297,26.3429,15.4371	,,,,	,,,,	161643269	883,4837	875	1985	2860	FCGR2B	SO:0001627	intron_variant	0			-	HGNC	BC031992	CCDS30924.1, CCDS30925.1, CCDS53414.1	1q23	2013-01-11	2005-02-02		ENSG00000072694	ENSG00000072694		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3618	protein-coding gene	gene with protein product		604590	"""Fc fragment of IgG, low affinity IIb, receptor for (CD32)"""	FCG2, FCGR2		2139735	Standard	NM_004001		Approved	CD32, CD32B	uc001gaz.2	P31994	OTTHUMG00000034470	ENST00000358671.5:c.646+250C>T	1.37:g.161643269C>T		Somatic	0	88	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	112	8.94	A6H8N3|O95649|Q53X85|Q5VXA9|Q8NIA1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T221M	ENST00000358671.5	37	c.662	CCDS30924.1	1	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.450145	0.01080	0.263429	0.106297	ENSG00000072694	ENST00000428605	T	0.02301	4.35	1.97	-3.95	0.04118	.	.	.	.	.	T	0.00496	0.0016	.	.	.	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.45440	-0.9261	7	0.62326	D	0.03	.	2.0013	0.03467	0.1309:0.2757:0.1301:0.4633	rs2045571;rs41290386;rs52799663;rs61548046;rs2045571	221	P31995-4	.	M	221	ENSP00000404329:T221M	ENSP00000404329:T221M	T	+	2	0	FCGR2B	159909893	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.971000	0.00322	-2.881000	0.00319	-4.289000	0.00008	ACG	-	NULL		0.532	FCGR2B-002	KNOWN	basic|CCDS	protein_coding	FCGR2B	protein_coding	OTTHUMT00000083337.4	C	NM_004001	rs2045571		161643269	+1	no_errors	ENST00000428605	ensembl	human	known	74_37	missense	SNP	0.000	T
HARS2	23438	genome.wustl.edu	37	5	140073605	140073605	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr5:140073605C>A	ENST00000230771.3	+	3	492	c.269C>A	c.(268-270)gCa>gAa	p.A90E	HARS_ENST00000438307.2_5'Flank|HARS_ENST00000457527.2_5'Flank|HARS2_ENST00000448069.2_Intron|HARS2_ENST00000432671.2_Intron|HARS_ENST00000448240.1_5'Flank|HARS_ENST00000431330.2_5'Flank|HARS_ENST00000504156.1_5'Flank|HARS2_ENST00000502303.1_3'UTR|HARS2_ENST00000508522.1_Missense_Mutation_p.A65E|HARS_ENST00000307633.3_5'Flank|HARS2_ENST00000435019.2_Intron|HARS2_ENST00000437649.2_Missense_Mutation_p.A90E|HARS_ENST00000415192.2_5'Flank	NM_012208.2	NP_036340.1	P49590	SYHM_HUMAN	histidyl-tRNA synthetase 2, mitochondrial	90					gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|large_intestine(5)|lung(10)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTCATGGAGCAAAGGGGATG	0.473																																																	0								ENSG00000112855						139.0	140.0	140.0					5																	140073605		2203	4300	6503	HARS2	SO:0001583	missense	0			-	HGNC	U18937	CCDS4238.1, CCDS64267.1	5q31.3	2012-07-20	2012-07-20	2007-02-23	ENSG00000112855	ENSG00000112855	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4817	protein-coding gene	gene with protein product	"""histidine tRNA ligase 2, mitochondrial (putative)"""	600783	"""histidyl-tRNA synthetase-like"""	HARSL		7755634, 21464306	Standard	NM_012208		Approved	HO3, HARSR	uc003lgx.3	P49590	OTTHUMG00000129500	ENST00000230771.3:c.269C>A	5.37:g.140073605C>A	ENSP00000230771:p.Ala90Glu	Somatic	0	71	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	56	13.85	B4DDY8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,superfamily_Anticodon-bd,pirsf_HisRS/HisZ,pfscan_aa-tRNA-synth_II,tigrfam_His-tRNA-ligase	p.A90E	ENST00000230771.3	37	c.269	CCDS4238.1	5	.	.	.	.	.	.	.	.	.	.	c	27.5	4.836201	0.91117	.	.	ENSG00000112855	ENST00000230771;ENST00000509299;ENST00000503873;ENST00000437649;ENST00000508522	T;T;T;T;T	0.66638	1.0;1.39;1.39;-0.22;1.0	6.17	5.3	0.74995	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.88217	0.6377	H	0.96748	3.875	0.80722	D	1	D;D;D;D	0.76494	0.993;0.999;0.999;0.999	P;D;D;D	0.77557	0.782;0.99;0.99;0.99	D	0.92139	0.5719	10	0.59425	D	0.04	-8.1182	17.7532	0.88441	0.0:0.8778:0.1222:0.0	.	90;65;90;90	E9PG66;B4DDY8;B2R7G6;P49590	.;.;.;SYHM_HUMAN	E	90;96;96;90;65	ENSP00000230771:A90E;ENSP00000425695:A96E;ENSP00000424516:A96E;ENSP00000411708:A90E;ENSP00000423616:A65E	ENSP00000230771:A90E	A	+	2	0	HARS2	140053789	1.000000	0.71417	0.951000	0.38953	0.885000	0.51271	5.689000	0.68234	1.616000	0.50265	0.655000	0.94253	GCA	-	pfam_aa-tRNA-synt_IIb_cons-dom,pirsf_HisRS/HisZ,pfscan_aa-tRNA-synth_II,tigrfam_His-tRNA-ligase		0.473	HARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HARS2	protein_coding	OTTHUMT00000251670.2	C	NM_012208	-		140073605	+1	no_errors	ENST00000230771	ensembl	human	known	74_37	missense	SNP	1.000	A
SRRM1	10250	genome.wustl.edu	37	1	24969812	24969812	+	5'UTR	SNP	G	G	C			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:24969812G>C	ENST00000323848.9	+	0	310				SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000447431.2_5'UTR|SRRM1_ENST00000374389.4_5'UTR	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CGAGCGAGGCGGCAAGATGGA	0.697																																					Ovarian(68;897 1494 3282 17478)												0								ENSG00000133226						19.0	24.0	22.0					1																	24969812		2203	4299	6502	SRRM1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.-6G>C	1.37:g.24969812G>C		Somatic	0	52	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	6	76.00	O60585|Q5VVN4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000323848.9	37	NULL	CCDS255.1	1																																																																																			-	-		0.697	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	protein_coding	OTTHUMT00000009292.2	G	NM_005839	-		24969812	+1	no_errors	ENST00000466910	ensembl	human	known	74_37	rna	SNP	0.994	C
ZNF773	374928	genome.wustl.edu	37	19	58017753	58017753	+	Missense_Mutation	SNP	C	C	A	rs201340833|rs61731281|rs386811330	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr19:58017753C>A	ENST00000282292.4	+	4	430	c.290C>A	c.(289-291)gCa>gAa	p.A97E	ZNF773_ENST00000598770.1_Missense_Mutation_p.A96E|ZNF773_ENST00000599847.1_Intron|ZNF773_ENST00000593916.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	97					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		AAGGCTGAGGCAGCTGCTGAG	0.488													A|||	859	0.171526	0.2716	0.1484	5008	,	,		22832	0.1002		0.2018	False		,,,				2504	0.0951																0								ENSG00000152439						84.0	87.0	86.0					19																	58017753		2203	4300	6503	ZNF773	SO:0001583	missense	0			-	HGNC	BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.290C>A	19.37:g.58017753C>A	ENSP00000282292:p.Ala97Glu	Somatic	0	46	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	25	10.71	Q96DL8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A97E	ENST00000282292.4	37	c.290	CCDS33134.1	19	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.856327	0.00558	.	.	ENSG00000152439	ENST00000282292	T	0.05649	3.41	1.25	1.25	0.21368	.	.	.	.	.	T	0.02929	0.0087	N	0.05280	-0.08	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46789	-0.9166	9	0.28530	T	0.3	.	5.476	0.16695	0.7127:0.2873:0.0:0.0	rs61731281	96;97	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	E	97	ENSP00000282292:A97E	ENSP00000282292:A97E	A	+	2	0	ZNF773	62709565	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.333000	0.19768	0.000000	0.14550	-0.824000	0.03097	GCA	-	NULL		0.488	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	protein_coding	OTTHUMT00000466475.1	C	NM_198542	rs61731281		58017753	+1	no_errors	ENST00000282292	ensembl	human	known	74_37	missense	SNP	0.008	A
CYP11B2	1585	genome.wustl.edu	37	8	143994865	143994865	+	Silent	SNP	T	T	C			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr8:143994865T>C	ENST00000323110.2	-	6	959	c.957A>G	c.(955-957)acA>acG	p.T319T		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	319					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	AGGGAAACGCTGTCTACAGAA	0.632									Familial Hyperaldosteronism type I																																								0								ENSG00000179142						67.0	62.0	63.0					8																	143994865		2203	4300	6503	CYP11B2	SO:0001819	synonymous_variant	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	-	HGNC	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.957A>G	8.37:g.143994865T>C		Somatic	0	60	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	33	38.89	B0ZBE4|Q16726	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.T319	ENST00000323110.2	37	c.957	CCDS6393.1	8																																																																																			-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450		0.632	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	protein_coding	OTTHUMT00000359904.1	T		-		143994865	-1	no_errors	ENST00000323110	ensembl	human	known	74_37	silent	SNP	0.000	C
RP11-402P6.11	0	genome.wustl.edu	37	X	70979260	70979261	+	lincRNA	DEL	GC	GC	-	rs199772875		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	GC	GC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chrX:70979260_70979261delGC	ENST00000439926.1	-	0	440				BX276092.1_ENST00000408757.1_RNA																							gtgcacatgtgcgcgcgcgcgc	0.564																																																	0								ENSG00000221684																																			BX276092.1			0				Clone_based_ensembl_gene																													X.37:g.70979270_70979271delGC		Somatic	0	27	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	19	20.83		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000439926.1	37	NULL		X																																																																																			-	-		0.564	RP11-402P6.11-001	KNOWN	basic	lincRNA	ENSG00000221684	lincRNA	OTTHUMT00000057168.1	GC				70979261	-1	no_errors	ENST00000408757	ensembl	human	novel	74_37	rna	DEL	0.000:0.000	-
FREM1	158326	genome.wustl.edu	37	9	14842509	14842509	+	Missense_Mutation	SNP	A	A	C			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr9:14842509A>C	ENST00000380880.3	-	9	2326	c.1543T>G	c.(1543-1545)Ttg>Gtg	p.L515V	FREM1_ENST00000422223.2_Missense_Mutation_p.L515V|FREM1_ENST00000380881.4_Missense_Mutation_p.L516V			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	515					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TCTTTGGGCAAGACGTTGATG	0.507																																																	0								ENSG00000164946						145.0	145.0	145.0					9																	14842509		2038	4193	6231	FREM1	SO:0001583	missense	0			-	HGNC	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1543T>G	9.37:g.14842509A>C	ENSP00000370262:p.Leu515Val	Somatic	0	36	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	25	32.43	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.L516V	ENST00000380880.3	37	c.1546	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	A	18.36	3.607230	0.66558	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.27256	1.68;1.68;1.68	5.93	2.33	0.28932	.	0.096026	0.52532	D	0.000073	T	0.32793	0.0841	L	0.44542	1.39	0.45762	D	0.998656	D	0.89917	1.0	D	0.91635	0.999	T	0.25676	-1.0125	10	0.11794	T	0.64	-9.8604	6.267	0.20932	0.4781:0.0:0.5219:0.0	.	515	Q5H8C1	FREM1_HUMAN	V	516;515;515	ENSP00000370263:L516V;ENSP00000412940:L515V;ENSP00000370262:L515V	ENSP00000370257:L518V	L	-	1	2	FREM1	14832509	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.165000	0.50778	0.506000	0.28125	-0.274000	0.10170	TTG	-	NULL		0.507	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	protein_coding	OTTHUMT00000339474.2	A	NM_144966	-		14842509	-1	no_errors	ENST00000380881	ensembl	human	known	74_37	missense	SNP	1.000	C
ECSIT	51295	genome.wustl.edu	37	19	11623977	11623977	+	Missense_Mutation	SNP	T	T	C	rs202141211		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr19:11623977T>C	ENST00000270517.7	-	4	767	c.632A>G	c.(631-633)aAc>aGc	p.N211S	ECSIT_ENST00000591104.1_Missense_Mutation_p.N211S|ECSIT_ENST00000588998.1_Intron|ECSIT_ENST00000252440.7_Missense_Mutation_p.N211S|ECSIT_ENST00000417981.2_Intron|ECSIT_ENST00000591352.1_Intron|RN7SL833P_ENST00000498758.2_RNA|ECSIT_ENST00000592312.1_Missense_Mutation_p.N95S	NM_016581.4	NP_057665.2	Q9BQ95	ECSIT_HUMAN	ECSIT signalling integrator	211					BMP signaling pathway (GO:0030509)|innate immune response (GO:0045087)|mesoderm formation (GO:0001707)|oxidation-reduction process (GO:0055114)|regulation of oxidoreductase activity (GO:0051341)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	oxidoreductase activity, acting on NAD(P)H (GO:0016651)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	11						TGGGAAGGGGTTGACGTTCAT	0.592																																																	0								ENSG00000130159						97.0	75.0	83.0					19																	11623977		2203	4300	6503	ECSIT	SO:0001583	missense	0			-	HGNC	BC005119	CCDS12262.1, CCDS45979.1, CCDS45980.1, CCDS59353.1	19p13.2	2013-05-24	2013-05-24			ENSG00000130159		"""Mitochondrial respiratory chain complex assembly factors"""	29548	protein-coding gene	gene with protein product	"""signaling intermediate in Toll pathway evolutionarily conserved ortholog (mouse)"""	608388	"""ECSIT homolog (Drosophila)"""			10465784, 22982022	Standard	NM_001142464		Approved	SITPEC	uc002msb.3	Q9BQ95		ENST00000270517.7:c.632A>G	19.37:g.11623977T>C	ENSP00000270517:p.Asn211Ser	Somatic	0	29	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	66	11.84	E9PAN9|K7EMM0|Q96HQ7|Q9NYI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ECSIT	p.N211S	ENST00000270517.7	37	c.632	CCDS12262.1	19	.	.	.	.	.	.	.	.	.	.	t	19.51	3.841023	0.71488	.	.	ENSG00000130159	ENST00000270517;ENST00000252440	T;T	0.78003	-1.14;-1.14	4.94	4.94	0.65067	.	0.000000	0.85682	D	0.000000	T	0.81800	0.4899	L	0.45228	1.405	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	T	0.77341	-0.2624	10	0.13853	T	0.58	-38.722	13.8989	0.63790	0.0:0.0:0.0:1.0	.	211;211	Q9BQ95-2;Q9BQ95	.;ECSIT_HUMAN	S	211	ENSP00000270517:N211S;ENSP00000252440:N211S	ENSP00000252440:N211S	N	-	2	0	ECSIT	11484977	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.168000	0.77570	1.986000	0.57962	0.520000	0.50463	AAC	-	pfam_ECSIT		0.592	ECSIT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECSIT	protein_coding	OTTHUMT00000442603.2	T	NM_016581	rs202141211		11623977	-1	no_errors	ENST00000270517	ensembl	human	known	74_37	missense	SNP	1.000	C
KANSL1	284058	genome.wustl.edu	37	17	44116420	44116420	+	Nonsense_Mutation	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr17:44116420G>A	ENST00000262419.6	-	9	2835	c.2365C>T	c.(2365-2367)Cga>Tga	p.R789*	KANSL1_ENST00000393476.3_Intron|KANSL1_ENST00000575318.1_Intron|KANSL1_ENST00000572904.1_Nonsense_Mutation_p.R789*|KANSL1_ENST00000432791.1_Nonsense_Mutation_p.R789*|KANSL1_ENST00000574590.1_Nonsense_Mutation_p.R789*	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	789					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											GAATGGTCTCGCAATCTCATT	0.587																																																	0								ENSG00000120071						237.0	197.0	211.0					17																	44116420		2203	4300	6503	KANSL1	SO:0001587	stop_gained	0			-	HGNC	BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2365C>T	17.37:g.44116420G>A	ENSP00000262419:p.Arg789*	Somatic	0	73	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	35	47.76	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R789*	ENST00000262419.6	37	c.2365	CCDS11503.1	17	.	.	.	.	.	.	.	.	.	.	G	41	9.054168	0.99050	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	.	.	.	6.17	6.17	0.99709	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.2476	17.6123	0.88058	0.0:0.0:1.0:0.0	.	.	.	.	X	789	.	ENSP00000262419:R789X	R	-	1	2	KIAA1267	41472267	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.260000	0.51523	2.941000	0.99782	0.655000	0.94253	CGA	-	NULL		0.587	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KANSL1	protein_coding	OTTHUMT00000440274.1	G	NM_015443	-		44116420	-1	no_errors	ENST00000262419	ensembl	human	known	74_37	nonsense	SNP	1.000	A
C14orf39	317761	genome.wustl.edu	37	14	60950421	60950421	+	Missense_Mutation	SNP	T	T	C			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr14:60950421T>C	ENST00000321731.3	-	4	380	c.221A>G	c.(220-222)gAc>gGc	p.D74G		NM_174978.2	NP_777638	Q8N1H7	S6OS1_HUMAN	chromosome 14 open reading frame 39	74					multicellular organismal development (GO:0007275)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(108;0.0448)		TCTACAGTTGTCTTTAATCTC	0.294																																																	0								ENSG00000179008						136.0	121.0	126.0					14																	60950421		2199	4297	6496	C14orf39	SO:0001583	missense	0			-	HGNC	AK098187	CCDS9746.1	14q23.1	2012-11-05	2012-11-05	2012-11-05	ENSG00000179008	ENSG00000179008			19849	protein-coding gene	gene with protein product							Standard	NM_174978		Approved	SIX6OS1	uc001xez.4	Q8N1H7	OTTHUMG00000140332	ENST00000321731.3:c.221A>G	14.37:g.60950421T>C	ENSP00000324920:p.Asp74Gly	Somatic	0	62	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	6	81.25	Q08AQ4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.D74G	ENST00000321731.3	37	c.221	CCDS9746.1	14	.	.	.	.	.	.	.	.	.	.	T	10.50	1.367937	0.24771	.	.	ENSG00000179008	ENST00000321731;ENST00000555476;ENST00000556799	T;T	0.54071	1.63;0.59	5.28	4.13	0.48395	.	0.274136	0.31020	N	0.008415	T	0.41236	0.1150	L	0.40543	1.245	0.34605	D	0.716935	B	0.10296	0.003	B	0.09377	0.004	T	0.47749	-0.9093	10	0.48119	T	0.1	-3.5976	8.2621	0.31790	0.0:0.0909:0.0:0.9091	.	74	Q8N1H7	S6OS1_HUMAN	G	74;45;74	ENSP00000324920:D74G;ENSP00000451665:D45G	ENSP00000324920:D74G	D	-	2	0	C14orf39	60020174	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	2.329000	0.43876	0.932000	0.37266	-0.274000	0.10170	GAC	-	NULL		0.294	C14orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf39	protein_coding	OTTHUMT00000276948.1	T	NM_174978	-		60950421	-1	no_errors	ENST00000321731	ensembl	human	known	74_37	missense	SNP	0.996	C
SERPINB10	5273	genome.wustl.edu	37	18	61587038	61587038	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr18:61587038T>A	ENST00000238508.3	+	5	448	c.389T>A	c.(388-390)aTg>aAg	p.M130K		NM_005024.1	NP_005015.1	P48595	SPB10_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 10	130					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(3)|stomach(2)	24		Esophageal squamous(42;0.131)				TTAGAAGACATGAAAACATAT	0.333																																																	0								ENSG00000242550						68.0	82.0	77.0					18																	61587038		2203	4299	6502	SERPINB10	SO:0001583	missense	0			-	HGNC	U35459	CCDS11990.1	18q21.3	2014-02-18	2005-08-18		ENSG00000242550	ENSG00000242550		"""Serine (or cysteine) peptidase inhibitors"""	8942	protein-coding gene	gene with protein product	"""protease inhibitor 10 (ovalbumin type, bomapin)"""	602058	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 10"""	PI10		9268635, 10871600, 24172014	Standard	NM_005024		Approved	bomapin		P48595	OTTHUMG00000060594	ENST00000238508.3:c.389T>A	18.37:g.61587038T>A	ENSP00000238508:p.Met130Lys	Somatic	0	31	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	25	21.88	Q4VAX4|Q4VAX7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.M130K	ENST00000238508.3	37	c.389	CCDS11990.1	18	.	.	.	.	.	.	.	.	.	.	T	14.65	2.598421	0.46318	.	.	ENSG00000242550	ENST00000238508	D	0.84516	-1.86	5.33	5.33	0.75918	Serpin domain (3);	0.521548	0.22335	N	0.061417	D	0.86703	0.5996	M	0.86268	2.805	0.27479	N	0.95262	B	0.30937	0.301	B	0.33254	0.16	T	0.83336	-0.0010	10	0.87932	D	0	.	11.6961	0.51544	0.0:0.0:0.0:1.0	.	130	P48595	SPB10_HUMAN	K	130	ENSP00000238508:M130K	ENSP00000238508:M130K	M	+	2	0	SERPINB10	59738018	0.189000	0.23263	0.966000	0.40874	0.812000	0.45895	1.166000	0.31834	2.023000	0.59567	0.533000	0.62120	ATG	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.333	SERPINB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB10	protein_coding	OTTHUMT00000134012.3	T	NM_005024	-		61587038	+1	no_errors	ENST00000238508	ensembl	human	known	74_37	missense	SNP	0.999	A
HOXC5	3222	genome.wustl.edu	37	12	54426956	54426956	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr12:54426956C>A	ENST00000312492.2	+	1	320	c.50C>A	c.(49-51)cCt>cAt	p.P17H	HOXC4_ENST00000303406.4_Intron|RP11-834C11.14_ENST00000512206.1_RNA|RP11-834C11.12_ENST00000513209.1_Intron|MIR615_ENST00000384839.1_RNA	NM_018953.2	NP_061826.1	Q00444	HXC5_HUMAN	homeobox C5	17					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(2)|urinary_tract(1)	12						CCCAATATCCCTGCCTATAAC	0.488											OREG0021884	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000172789						69.0	70.0	70.0					12																	54426956		2203	4300	6503	HOXC5	SO:0001583	missense	0			-	HGNC		CCDS8872.1	12q13.13	2011-06-20	2005-12-22		ENSG00000172789	ENSG00000172789		"""Homeoboxes / ANTP class : HOXL subclass"""	5127	protein-coding gene	gene with protein product		142973	"""homeo box C5"""	HOX3D, HOX3		1973146, 1358459	Standard	NM_018953		Approved		uc001sew.3	Q00444	OTTHUMG00000160028	ENST00000312492.2:c.50C>A	12.37:g.54426956C>A	ENSP00000309336:p.Pro17His	Somatic	0	49	0.00	1000	0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	33	42.11		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.P17H	ENST00000312492.2	37	c.50	CCDS8872.1	12	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673614	0.47781	.	.	ENSG00000172789	ENST00000312492	D	0.91686	-2.89	5.27	5.27	0.74061	.	0.000000	0.48286	D	0.000184	D	0.94301	0.8169	L	0.49640	1.575	0.80722	D	1	D	0.76494	0.999	P	0.62813	0.907	D	0.94659	0.7846	10	0.87932	D	0	.	17.8382	0.88707	0.0:1.0:0.0:0.0	.	17	Q00444	HXC5_HUMAN	H	17	ENSP00000309336:P17H	ENSP00000309336:P17H	P	+	2	0	HOXC5	52713223	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.410000	0.59774	2.735000	0.93741	0.655000	0.94253	CCT	-	NULL		0.488	HOXC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC5	protein_coding	OTTHUMT00000358947.1	C		-		54426956	+1	no_errors	ENST00000312492	ensembl	human	known	74_37	missense	SNP	1.000	A
ABCD3	5825	genome.wustl.edu	37	1	94984053	94984055	+	3'UTR	DEL	AAA	AAA	-	rs144257807	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	AAA	AAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:94984053_94984055delAAA	ENST00000370214.4	+	0	3372_3374				ABCD3_ENST00000394233.2_3'UTR|ABCD3_ENST00000484213.1_3'UTR	NM_002858.3	NP_002849.1	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D (ALD), member 3						ATP catabolic process (GO:0006200)|fatty acid beta-oxidation (GO:0006635)|peroxisome organization (GO:0007031)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(2)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		TGTTCAGattaaaaaaaaaaaaa	0.286																																																	0								ENSG00000117528																																			ABCD3	SO:0001624	3_prime_UTR_variant	0				HGNC	M81182	CCDS749.1, CCDS44175.1	1p21.3	2012-05-16			ENSG00000117528	ENSG00000117528		"""ATP binding cassette transporters / subfamily D"""	67	protein-coding gene	gene with protein product		170995		PXMP1		1301993, 8449508	Standard	NM_002858		Approved	PMP70, ZWS2	uc001dqn.4	P28288	OTTHUMG00000010717	ENST00000370214.4:c.*1370AAA>-	1.37:g.94984062_94984064delAAA		Somatic	0	44	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	D3DT46|Q15271|Q6NUN5|Q96DA3|Q9H529	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370214.4	37	NULL	CCDS749.1	1																																																																																			-	-		0.286	ABCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD3	protein_coding	OTTHUMT00000029597.1	AAA	NM_002858			94984055	+1	no_errors	ENST00000484213	ensembl	human	known	74_37	rna	DEL	0.959:0.972:0.991	-
CLASRP	11129	genome.wustl.edu	37	19	45561081	45561081	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr19:45561081G>A	ENST00000221455.3	+	7	636	c.538G>A	c.(538-540)Gaa>Aaa	p.E180K	CLASRP_ENST00000391953.4_Missense_Mutation_p.E118K|CLASRP_ENST00000544944.2_Missense_Mutation_p.E180K	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	180					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						GAAGGCGGCAGAAAAGCCAGA	0.612																																																	0								ENSG00000104859						169.0	124.0	139.0					19																	45561081		2203	4300	6503	CLASRP	SO:0001583	missense	0			-	HGNC	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.538G>A	19.37:g.45561081G>A	ENSP00000221455:p.Glu180Lys	Somatic	0	35	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	6	71.43	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SWAP_N_domain	p.E180K	ENST00000221455.3	37	c.538	CCDS12652.2	19	.	.	.	.	.	.	.	.	.	.	G	11.99	1.804921	0.31961	.	.	ENSG00000104859	ENST00000221455;ENST00000391952;ENST00000391953;ENST00000544944	T;T;T;T	0.46819	1.45;1.45;0.86;1.44	4.95	4.95	0.65309	.	0.000000	0.36591	U	0.002505	T	0.32704	0.0838	N	0.16478	0.41	0.45930	D	0.998767	B;B;B	0.20988	0.05;0.014;0.021	B;B;B	0.23419	0.046;0.008;0.005	T	0.09885	-1.0654	10	0.16896	T	0.51	-15.7021	15.7382	0.77863	0.0:0.0:1.0:0.0	.	118;180;180	F8WAG9;F5H0Q6;Q8N2M8	.;.;CLASR_HUMAN	K	180;180;118;180	ENSP00000221455:E180K;ENSP00000375814:E180K;ENSP00000375815:E118K;ENSP00000438702:E180K	ENSP00000221455:E180K	E	+	1	0	CLASRP	50252921	1.000000	0.71417	0.949000	0.38748	0.353000	0.29299	6.980000	0.76160	2.580000	0.87095	0.557000	0.71058	GAA	-	NULL		0.612	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLASRP	protein_coding	OTTHUMT00000316749.1	G	NM_007056	-		45561081	+1	no_errors	ENST00000221455	ensembl	human	known	74_37	missense	SNP	0.983	A
EPHA3	2042	genome.wustl.edu	37	3	89478261	89478261	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr3:89478261C>A	ENST00000336596.2	+	12	2305	c.2080C>A	c.(2080-2082)Cca>Aca	p.P694T	EPHA3_ENST00000494014.1_Missense_Mutation_p.P694T	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	694	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TCTAGGTAAGCCAGTTATGAT	0.299										TSP Lung(6;0.00050)																																							0								ENSG00000044524						96.0	101.0	99.0					3																	89478261		2203	4300	6503	EPHA3	SO:0001583	missense	0			-	HGNC	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2080C>A	3.37:g.89478261C>A	ENSP00000337451:p.Pro694Thr	Somatic	0	49	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	19	32.14	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.P694T	ENST00000336596.2	37	c.2080	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438627	0.83885	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	D;D	0.83914	-1.78;-1.78	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91848	0.7420	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.91037	0.4868	9	.	.	.	.	20.1554	0.98111	0.0:1.0:0.0:0.0	.	694	P29320	EPHA3_HUMAN	T	694	ENSP00000337451:P694T;ENSP00000419190:P694T	.	P	+	1	0	EPHA3	89560951	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.776000	0.85560	2.838000	0.97847	0.591000	0.81541	CCA	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.299	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	protein_coding	OTTHUMT00000352995.1	C	NM_005233	-		89478261	+1	no_errors	ENST00000336596	ensembl	human	known	74_37	missense	SNP	1.000	A
FRYL	285527	genome.wustl.edu	37	4	48551622	48551622	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr4:48551622T>A	ENST00000503238.1	-	36	4651	c.4652A>T	c.(4651-4653)tAt>tTt	p.Y1551F	FRYL_ENST00000537810.1_Missense_Mutation_p.Y1551F|FRYL_ENST00000358350.4_Missense_Mutation_p.Y1551F|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000507873.2_5'UTR			O94915	FRYL_HUMAN	FRY-like	1551					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CCAATTAGAATAAAGTGGCAT	0.433																																																	0								ENSG00000075539						120.0	115.0	117.0					4																	48551622		1933	4127	6060	FRYL	SO:0001583	missense	0			-	HGNC	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.4652A>T	4.37:g.48551622T>A	ENSP00000426064:p.Tyr1551Phe	Somatic	0	35	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	22	24.14	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.Y1551F	ENST00000503238.1	37	c.4652	CCDS43227.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.24|15.24	2.775966|2.775966	0.49786|0.49786	.|.	.|.	ENSG00000075539|ENSG00000075539	ENST00000514617|ENST00000503238;ENST00000358350;ENST00000537810	T|T;T;T	0.32988|0.23950	1.43|1.88;1.88;1.88	5.56|5.56	5.56|5.56	0.83823|0.83823	.|Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.27454|0.27454	0.0674|0.0674	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.14012	.|0.002;0.009;0.009	.|B;B;B	.|0.23419	.|0.004;0.016;0.046	T|T	0.07616|0.07616	-1.0763|-1.0763	6|10	.|0.18276	.|T	.|0.48	.|.	10.8929|10.8929	0.47006|0.47006	0.1402:0.0:0.0:0.8598|0.1402:0.0:0.0:0.8598	.|.	.|382;1551;1551	.|Q6ZR29;O94915;F5GX82	.|.;FRYL_HUMAN;.	F|F	421|1551	ENSP00000425344:L421F|ENSP00000426064:Y1551F;ENSP00000351113:Y1551F;ENSP00000441114:Y1551F	.|ENSP00000351113:Y1551F	L|Y	-|-	3|2	2|0	FRYL|FRYL	48246379|48246379	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.804000|5.804000	0.69135|0.69135	2.108000|2.108000	0.64289|0.64289	0.533000|0.533000	0.62120|0.62120	TTA|TAT	-	superfamily_ARM-type_fold		0.433	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	protein_coding	OTTHUMT00000369265.2	T		-		48551622	-1	no_errors	ENST00000358350	ensembl	human	known	74_37	missense	SNP	1.000	A
PTCHD3	374308	genome.wustl.edu	37	10	27702287	27702287	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr10:27702287G>T	ENST00000438700.3	-	1	1010	c.893C>A	c.(892-894)aCc>aAc	p.T298N		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	298					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						GAAGAAGCCGGTCAGGTAGAG	0.602																																																	0								ENSG00000182077						58.0	62.0	61.0					10																	27702287		2203	4300	6503	PTCHD3	SO:0001583	missense	0			-	HGNC	AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.893C>A	10.37:g.27702287G>T	ENSP00000417658:p.Thr298Asn	Somatic	0	66	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	33	44.07	I3L499|Q6ZU28	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Patched,pfscan_SSD	p.T298N	ENST00000438700.3	37	c.893	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	G	6.329	0.428807	0.11987	.	.	ENSG00000182077	ENST00000438700	D	0.85258	-1.96	3.98	-0.511	0.11970	.	0.662147	0.14294	N	0.328709	T	0.74168	0.3681	N	0.22421	0.69	0.09310	N	1	P	0.35011	0.48	B	0.40329	0.326	T	0.63998	-0.6510	10	0.41790	T	0.15	-1.636	5.6034	0.17367	0.0923:0.5381:0.2508:0.1188	.	298	Q3KNS1	PTHD3_HUMAN	N	298	ENSP00000417658:T298N	ENSP00000417658:T298N	T	-	2	0	PTCHD3	27742293	0.710000	0.27896	0.001000	0.08648	0.225000	0.24961	1.104000	0.31074	0.100000	0.17581	-0.304000	0.09214	ACC	-	pfam_Patched		0.602	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	protein_coding	OTTHUMT00000047325.3	G	XM_370541	-		27702287	-1	no_errors	ENST00000438700	ensembl	human	known	74_37	missense	SNP	0.255	T
CX3CR1	1524	genome.wustl.edu	37	3	39307683	39307683	+	Silent	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr3:39307683G>T	ENST00000541347.1	-	2	557	c.318C>A	c.(316-318)acC>acA	p.T106T	CX3CR1_ENST00000358309.3_Silent_p.T138T|CX3CR1_ENST00000542107.1_Silent_p.T106T|CX3CR1_ENST00000399220.2_Silent_p.T106T	NM_001171171.1	NP_001164642.1	P49238	CX3C1_HUMAN	chemokine (C-X3-C motif) receptor 1	106					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cerebral cortex cell migration (GO:0021795)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|macrophage chemotaxis (GO:0048246)|microglial cell activation involved in immune response (GO:0002282)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of angiogenesis (GO:0045766)|response to wounding (GO:0009611)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|neuronal cell body membrane (GO:0032809)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-X3-C chemokine receptor activity (GO:0016495)|chemokine receptor activity (GO:0004950)			endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|prostate(1)|skin(1)|urinary_tract(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0557)|Kidney(284;0.0699)		AGAAGAAGGCGGTAGTGAATT	0.473																																																	0								ENSG00000168329						155.0	149.0	151.0					3																	39307683		1961	4152	6113	CX3CR1	SO:0001819	synonymous_variant	0			-	HGNC	BC028078	CCDS43069.1, CCDS54571.1	3p21.3	2012-08-08	2002-08-22		ENSG00000168329	ENSG00000168329		"""GPCR / Class A : Chemokine receptors : C-X-3-C motif"""	2558	protein-coding gene	gene with protein product		601470	"""chemokine (C-X3-C) receptor 1"""	GPR13, CMKBRL1		9726990, 7646814	Standard	NM_001171171		Approved	CMKDR1, V28, CCRL1	uc021wwc.1	P49238	OTTHUMG00000156249	ENST00000541347.1:c.318C>A	3.37:g.39307683G>T		Somatic	0	25	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	12	40.00	A0N0N6|B2R5Z4|J3KP17	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CX3CR1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Duffy_chemokine_rcpt,prints_Chemokine_CXCR4	p.T138	ENST00000541347.1	37	c.414	CCDS43069.1	3																																																																																			-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_rcpt		0.473	CX3CR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CX3CR1	protein_coding	OTTHUMT00000343613.1	G	NM_001337	-		39307683	-1	no_errors	ENST00000358309	ensembl	human	known	74_37	silent	SNP	0.000	T
COL5A3	50509	genome.wustl.edu	37	19	10092765	10092765	+	Silent	SNP	T	T	A	rs138236471	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr19:10092765T>A	ENST00000264828.3	-	32	2521	c.2436A>T	c.(2434-2436)ggA>ggT	p.G812G		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	812	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTCCTATGGGTCCCAGGGGAC	0.532																																																	0								ENSG00000080573	T		0,4406		0,0,2203	127.0	112.0	117.0		2436	-2.8	0.0	19	dbSNP_134	117	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous	COL5A3	NM_015719.3		0,6,6497	AA,AT,TT		0.0698,0.0,0.0461		812/1746	10092765	6,13000	2203	4300	6503	COL5A3	SO:0001819	synonymous_variant	0			-	HGNC	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2436A>T	19.37:g.10092765T>A		Somatic	0	46	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	49	10.91	Q9NZQ6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.G812	ENST00000264828.3	37	c.2436	CCDS12222.1	19																																																																																			-	NULL		0.532	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	protein_coding	OTTHUMT00000315788.1	T	NM_015719	rs138236471		10092765	-1	no_errors	ENST00000264828	ensembl	human	known	74_37	silent	SNP	0.013	A
GRM3	2913	genome.wustl.edu	37	7	86394619	86394619	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr7:86394619G>T	ENST00000361669.2	+	2	1257	c.158G>T	c.(157-159)gGa>gTa	p.G53V	GRM3_ENST00000546348.1_Intron|GRM3_ENST00000394720.2_Missense_Mutation_p.G51V|GRM3_ENST00000439827.1_Missense_Mutation_p.G53V|GRM3_ENST00000536043.1_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	53					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					AAAGGCACTGGAACTGAAGAA	0.408																																					GBM(52;969 1098 3139 52280)												0								ENSG00000198822						128.0	126.0	127.0					7																	86394619		2203	4300	6503	GRM3	SO:0001583	missense	0			-	HGNC		CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.158G>T	7.37:g.86394619G>T	ENSP00000355316:p.Gly53Val	Somatic	0	29	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	17	43.33	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B	p.G53V	ENST00000361669.2	37	c.158	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	G	24.0	4.485484	0.84854	.	.	ENSG00000198822	ENST00000361669;ENST00000439827;ENST00000394720;ENST00000421579;ENST00000441140	D;D;D;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	D	0.83880	0.5350	L	0.52905	1.665	0.80722	D	1	P;B	0.48998	0.918;0.376	P;B	0.47744	0.556;0.166	T	0.82969	-0.0193	10	0.36615	T	0.2	.	17.9854	0.89154	0.0:0.0:1.0:0.0	.	53;53	G5E9K2;Q14832	.;GRM3_HUMAN	V	53;53;51;53;53	ENSP00000355316:G53V;ENSP00000398767:G53V;ENSP00000378209:G51V;ENSP00000390037:G53V;ENSP00000407490:G53V	ENSP00000355316:G53V	G	+	2	0	GRM3	86232555	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.358000	0.73055	2.732000	0.93576	0.655000	0.94253	GGA	-	superfamily_Peripla_BP_I,prints_GPCR_3_mtglu_rcpt_3		0.408	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	protein_coding	OTTHUMT00000253362.2	G		-		86394619	+1	no_errors	ENST00000361669	ensembl	human	known	74_37	missense	SNP	1.000	T
PSME4	23198	genome.wustl.edu	37	2	54152727	54152727	+	Silent	SNP	C	C	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr2:54152727C>T	ENST00000404125.1	-	14	1813	c.1758G>A	c.(1756-1758)ctG>ctA	p.L586L	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	586					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			ACGTAGAAGACAGACCTAATT	0.353																																																	0								ENSG00000068878						173.0	152.0	159.0					2																	54152727		2203	4300	6503	PSME4	SO:0001819	synonymous_variant	0			-	HGNC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.1758G>A	2.37:g.54152727C>T		Somatic	0	86	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	31	45.61	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3437,superfamily_ARM-type_fold	p.L586	ENST00000404125.1	37	c.1758	CCDS33197.2	2																																																																																			-	superfamily_ARM-type_fold		0.353	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME4	protein_coding	OTTHUMT00000324163.1	C	XM_040158	-		54152727	-1	no_errors	ENST00000404125	ensembl	human	known	74_37	silent	SNP	0.958	T
ADAMTS18	170692	genome.wustl.edu	37	16	77469910	77469929	+	5'Flank	DEL	TGTGTGTGTGTGTGTGTGTG	TGTGTGTGTGTGTGTGTGTG	-	rs151208084|rs201776017|rs150986433|rs553776012|rs374132862|rs142079273	byFrequency	TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	TGTGTGTGTGTGTGTGTGTG	TGTGTGTGTGTGTGTGTGTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr16:77469910_77469929delTGTGTGTGTGTGTGTGTGTG	ENST00000282849.5	-	0	0				AC025284.1_ENST00000401312.1_RNA|RP11-449J10.1_ENST00000564358.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18						eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TGGGATAAGAtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg	0.386																																																	0								ENSG00000216131																																			AC025284.1	SO:0001631	upstream_gene_variant	0				Clone_based_ensembl_gene	AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619		16.37:g.77469910_77469929delTGTGTGTGTGTGTGTGTGTG	Exception_encountered	Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q6P4R5|Q6ZWJ9	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000282849.5	37	NULL	CCDS10926.1	16																																																																																			-	-		0.386	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216131	protein_coding	OTTHUMT00000269037.1	TGTGTGTGTGTGTGTGTGTG				77469929	-1	no_errors	ENST00000401312	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.000:0.000:0.001:0.000:0.000:0.000:0.000:0.000:0.001:0.002:0.004:0.004:0.006:0.006:0.005	-
LOC100128714	100128714	genome.wustl.edu	37	15	26260644	26260644	+	lincRNA	SNP	C	C	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr15:26260644C>T	ENST00000383019.2	+	0	371					NR_040082.1																						TCTGCGTTCTCCTGCCTGGCG	0.587																																																	0								ENSG00000206187																																			RP11-1084I9.1			0			-	Clone_based_vega_gene																													15.37:g.26260644C>T		Somatic	0	40	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	21	48.78		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000383019.2	37	NULL		15																																																																																			-	-		0.587	RP11-1084I9.1-001	KNOWN	basic	lincRNA	LOC100128714	lincRNA	OTTHUMT00000414884.1	C		-		26260644	+1	no_errors	ENST00000383019	ensembl	human	known	74_37	rna	SNP	0.000	T
KCNT2	343450	genome.wustl.edu	37	1	196250098	196250098	+	Silent	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr1:196250098G>A	ENST00000294725.9	-	25	3717	c.2802C>T	c.(2800-2802)gaC>gaT	p.D934D	KCNT2_ENST00000609185.1_Silent_p.D860D|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000367431.4_Silent_p.D860D|KCNT2_ENST00000367433.5_Silent_p.D910D			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	934					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TGATCCATAAGTCATCTGCAG	0.333																																																	0								ENSG00000162687						89.0	88.0	88.0					1																	196250098		2202	4300	6502	KCNT2	SO:0001819	synonymous_variant	0			-	HGNC	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2802C>T	1.37:g.196250098G>A		Somatic	0	50	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	23	56.60	Q3SY59|Q5VTN1|Q6ZMT3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.D934	ENST00000294725.9	37	c.2802	CCDS1384.1	1																																																																																			-	NULL		0.333	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	protein_coding	OTTHUMT00000086418.2	G	NM_198503	-		196250098	-1	no_errors	ENST00000294725	ensembl	human	known	74_37	silent	SNP	1.000	A
TXNDC11	51061	genome.wustl.edu	37	16	11785500	11785500	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr16:11785500C>T	ENST00000356957.3	-	9	1734	c.1627G>A	c.(1627-1629)Gtg>Atg	p.V543M	TXNDC11_ENST00000283033.5_Missense_Mutation_p.V516M|TXNDC11_ENST00000570917.1_5'Flank			Q6PKC3	TXD11_HUMAN	thioredoxin domain containing 11	543					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						AAGCCTGACACACCCCTGCTT	0.463																																																	0								ENSG00000153066						123.0	113.0	116.0					16																	11785500		2197	4300	6497	TXNDC11	SO:0001583	missense	0			-	HGNC	BC013727	CCDS32387.1	16p13.13	2008-09-29				ENSG00000153066			28030	protein-coding gene	gene with protein product	"""EF-hand binding protein 1"""					8619474, 9110174	Standard	XM_005255346		Approved	EFP1	uc002dbg.1	Q6PKC3		ENST00000356957.3:c.1627G>A	16.37:g.11785500C>T	ENSP00000349439:p.Val543Met	Somatic	0	44	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	O95887|Q6PJA6|Q8N2Q4|Q96K45|Q96K53	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.V543M	ENST00000356957.3	37	c.1627		16	.	.	.	.	.	.	.	.	.	.	C	1.633	-0.518595	0.04171	.	.	ENSG00000153066	ENST00000356957;ENST00000283033	T;T	0.23348	1.91;1.91	5.81	-1.74	0.08056	.	1.812070	0.02345	N	0.075268	T	0.13713	0.0332	N	0.16478	0.41	0.09310	N	1	B;B	0.18610	0.013;0.029	B;B	0.13407	0.006;0.009	T	0.14364	-1.0475	10	0.31617	T	0.26	-12.5369	1.0782	0.01637	0.4178:0.2326:0.0995:0.25	.	543;516	Q6PKC3;Q6PKC3-2	TXD11_HUMAN;.	M	543;516	ENSP00000349439:V543M;ENSP00000283033:V516M	ENSP00000283033:V516M	V	-	1	0	TXNDC11	11693001	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.219000	0.09228	-0.125000	0.11703	-0.136000	0.14681	GTG	-	NULL		0.463	TXNDC11-002	KNOWN	basic|appris_candidate_longest	protein_coding	TXNDC11	protein_coding	OTTHUMT00000437057.1	C	NM_015914	-		11785500	-1	no_errors	ENST00000356957	ensembl	human	known	74_37	missense	SNP	0.000	T
ARL4D	379	genome.wustl.edu	37	17	41477526	41477526	+	Silent	SNP	A	A	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr17:41477526A>G	ENST00000320033.4	+	2	633	c.426A>G	c.(424-426)gcA>gcG	p.A142A		NM_001661.3	NP_001652.2	P49703	ARL4D_HUMAN	ADP-ribosylation factor-like 4D	142					GTP catabolic process (GO:0006184)|protein secretion (GO:0009306)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.155)		AGCCCGGGGCACTGAGCGCTG	0.657																																																	0								ENSG00000175906						20.0	21.0	21.0					17																	41477526		2201	4299	6500	ARL4D	SO:0001819	synonymous_variant	0			-	HGNC	AB060692	CCDS11463.1	17q21.31	2014-05-09	2005-11-03	2005-11-03	ENSG00000175906	ENSG00000175906		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	656	protein-coding gene	gene with protein product		600732	"""ADP-ribosylation factor 4-like"""	ARF4L		7590735	Standard	NM_001661		Approved		uc002idt.3	P49703		ENST00000320033.4:c.426A>G	17.37:g.41477526A>G		Somatic	0	17	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	15	40.00	B2RC59|D3DX43	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_MIRO-like,pfam_SRP_receptor_beta_su,pfam_EF_GTP-bd_dom,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.A142	ENST00000320033.4	37	c.426	CCDS11463.1	17																																																																																			-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom		0.657	ARL4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL4D	protein_coding	OTTHUMT00000453481.2	A	NM_001661	-		41477526	+1	no_errors	ENST00000320033	ensembl	human	known	74_37	silent	SNP	0.207	G
GRIN3A	116443	genome.wustl.edu	37	9	104356954	104356954	+	Intron	SNP	C	C	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr9:104356954C>G	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Missense_Mutation_p.V87L	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	TCGCCCTTGACGCTGAACTGG	0.542																																																	0								ENSG00000188386						119.0	114.0	116.0					9																	104356954		2203	4300	6503	PPP3R2	SO:0001627	intron_variant	0			-	HGNC		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15312G>C	9.37:g.104356954C>G		Somatic	0	51	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	33	32.65	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_hand_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,prints_Recoverin	p.V87L	ENST00000361820.3	37	c.259	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	C	8.309	0.821677	0.16678	.	.	ENSG00000188386	ENST00000374806;ENST00000541976	T	0.28895	1.59	3.97	3.97	0.46021	EF-hand-like domain (1);	0.000000	0.37857	N	0.001909	T	0.29749	0.0743	L	0.51422	1.61	0.44899	D	0.997917	B	0.02656	0.0	B	0.06405	0.002	T	0.15752	-1.0426	10	0.59425	D	0.04	-38.3665	14.3488	0.66685	0.0:1.0:0.0:0.0	.	84	Q96LZ3	CANB2_HUMAN	L	87	ENSP00000363939:V87L	ENSP00000363939:V87L	V	-	1	0	PPP3R2	103396775	1.000000	0.71417	0.936000	0.37596	0.348000	0.29142	3.688000	0.54699	2.507000	0.84556	0.563000	0.77884	GTC	-	pfscan_EF_hand_dom		0.542	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP3R2	protein_coding	OTTHUMT00000053453.1	C		-		104356954	-1	no_errors	ENST00000374806	ensembl	human	known	74_37	missense	SNP	1.000	G
AREL1	9870	genome.wustl.edu	37	14	75131588	75131588	+	Frame_Shift_Del	DEL	A	A	-			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr14:75131588delA	ENST00000356357.4	-	18	2659	c.2144delT	c.(2143-2145)ttcfs	p.F715fs	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	715	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										ATGGGCTTTGAAGTCAGACAC	0.428																																																	0								ENSG00000119682						96.0	94.0	95.0					14																	75131588		1984	4161	6145	AREL1	SO:0001589	frameshift_variant	0				HGNC	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.2144delT	14.37:g.75131588delA	ENSP00000348714:p.Phe715fs	Somatic	0	49	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	16	11.11	B4E2C7|Q7LDY1|Q8IYY9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HECT,pfam_Filamin/ABP280_repeat-like,superfamily_HECT,superfamily_Ig_E-set,smart_HECT,pfscan_Filamin/ABP280_repeat-like,pfscan_HECT	p.F715fs	ENST00000356357.4	37	c.2144	CCDS41971.1	14																																																																																			-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.428	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AREL1	protein_coding	OTTHUMT00000335517.2	A	NM_014821			75131588	-1	no_errors	ENST00000356357	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SRI	6717	genome.wustl.edu	37	7	87840220	87840220	+	Silent	SNP	G	G	T	rs368954008		TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr7:87840220G>T	ENST00000265729.2	-	4	278	c.226C>A	c.(226-228)Cgg>Agg	p.R76R	SRI_ENST00000490437.1_Silent_p.R33R|SRI_ENST00000431660.1_Silent_p.R61R|SRI_ENST00000419179.1_Silent_p.R76R|SRI_ENST00000394641.3_Silent_p.R61R	NM_003130.3	NP_003121.1	P30626	SORCN_HUMAN	sorcin	76	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				action potential (GO:0001508)|calcium ion transport (GO:0006816)|cytoplasmic sequestering of transcription factor (GO:0042994)|heart development (GO:0007507)|intracellular sequestering of iron ion (GO:0006880)|muscle organ development (GO:0007517)|negative regulation of heart rate (GO:0010459)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|proteolysis (GO:0006508)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart contraction (GO:0008016)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of relaxation of muscle (GO:1901077)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of striated muscle contraction (GO:0006942)|signal transduction (GO:0007165)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|Z disc (GO:0030018)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|ion channel binding (GO:0044325)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|receptor binding (GO:0005102)	p.R76W(1)		large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	5	Esophageal squamous(14;0.00202)					ACCATAAGCCGGCAAGTCTCC	0.284																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000075142						51.0	52.0	52.0					7																	87840220		2203	4295	6498	SRI	SO:0001819	synonymous_variant	0			-	HGNC	M32886	CCDS5612.1, CCDS47638.1, CCDS59063.1	7q21.1	2014-09-17			ENSG00000075142	ENSG00000075142		"""EF-hand domain containing"""	11292	protein-coding gene	gene with protein product		182520				2901906	Standard	NM_001256891		Approved		uc003ujq.2	P30626	OTTHUMG00000157267	ENST00000265729.2:c.226C>A	7.37:g.87840220G>T		Somatic	0	57	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	A8MTH6|B4DKK2|D6W5Q0	Silent	SNP	NA	NA	NA	NA	NA	NA	smart_EF_hand_dom,pfscan_EF_hand_dom	p.R76	ENST00000265729.2	37	c.226	CCDS5612.1	7																																																																																			-	smart_EF_hand_dom		0.284	SRI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRI	protein_coding	OTTHUMT00000253680.1	G	NM_003130	-		87840220	-1	no_errors	ENST00000265729	ensembl	human	known	74_37	silent	SNP	1.000	T
NAP1L3	4675	genome.wustl.edu	37	X	92928275	92928275	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chrX:92928275G>A	ENST00000373079.3	-	1	292	c.29C>T	c.(28-30)tCg>tTg	p.S10L	FAM133A_ENST00000332647.4_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.S3L|FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000355813.5_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	10					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						GACAGGTTCCGAGACCATTTT	0.522																																																	0								ENSG00000186310						52.0	48.0	50.0					X																	92928275		2203	4300	6503	NAP1L3	SO:0001583	missense	0			-	HGNC		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.29C>T	X.37:g.92928275G>A	ENSP00000362171:p.Ser10Leu	Somatic	0	77	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	30	53.85	B2RCM0|O60788	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NAP_family	p.S10L	ENST00000373079.3	37	c.29	CCDS14465.1	X	.	.	.	.	.	.	.	.	.	.	G	4.602	0.111917	0.08831	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.33438	1.41	3.65	-0.35	0.12606	.	1.573920	0.04398	N	0.363684	T	0.16041	0.0386	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.17440	-1.0369	10	0.17832	T	0.49	.	3.6254	0.08111	0.4797:0.0:0.3389:0.1814	.	10	Q99457	NP1L3_HUMAN	L	10;3	ENSP00000362171:S10L	ENSP00000362171:S10L	S	-	2	0	NAP1L3	92814931	0.094000	0.21725	0.188000	0.23233	0.187000	0.23431	-0.361000	0.07612	-0.209000	0.10156	-0.395000	0.06472	TCG	-	NULL		0.522	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L3	protein_coding	OTTHUMT00000057449.1	G	NM_004538	-		92928275	-1	no_errors	ENST00000373079	ensembl	human	known	74_37	missense	SNP	0.049	A
PTTG1	9232	genome.wustl.edu	37	5	159854773	159854773	+	Missense_Mutation	SNP	T	T	G			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr5:159854773T>G	ENST00000393964.1	+	4	825	c.422T>G	c.(421-423)tTg>tGg	p.L141W	PTTG1_ENST00000352433.5_Missense_Mutation_p.L141W|PTTG1_ENST00000519287.1_3'UTR|PTTG1_ENST00000520452.1_Missense_Mutation_p.L141W	NM_001282382.1	NP_001269311.1	O95997	PTTG1_HUMAN	pituitary tumor-transforming 1	141					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|DNA repair (GO:0006281)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of endopeptidase activity (GO:0010951)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(4)	6	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.00219)|Epithelial(171;0.00348)|all cancers(165;0.0104)		CACCTCCCCTTGAGTGGAGTG	0.527																																																	0								ENSG00000164611						102.0	95.0	97.0					5																	159854773		2203	4300	6503	PTTG1	SO:0001583	missense	0			-	HGNC	AF062649	CCDS4353.1	5q35.1	2014-08-04			ENSG00000164611	ENSG00000164611			9690	protein-coding gene	gene with protein product	"""ESP1-associated protein 1"", ""tumor-transforming protein 1"""	604147		TUTR1		9811450, 9892021	Standard	NM_004219		Approved	PTTG, HPTTG, EAP1, securin	uc003lyj.3	O95997	OTTHUMG00000130328	ENST00000393964.1:c.422T>G	5.37:g.159854773T>G	ENSP00000377536:p.Leu141Trp	Somatic	0	64	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	12	40.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Securin_separation_inhibitor	p.L141W	ENST00000393964.1	37	c.422	CCDS4353.1	5	.	.	.	.	.	.	.	.	.	.	T	22.7	4.323287	0.81580	.	.	ENSG00000164611	ENST00000352433;ENST00000520452;ENST00000393964	T;T;T	0.54279	0.58;0.58;0.58	5.68	5.68	0.88126	.	0.000000	0.64402	D	0.000001	T	0.73202	0.3557	M	0.83603	2.65	0.46678	D	0.999157	D	0.89917	1.0	D	0.97110	1.0	T	0.76408	-0.2970	9	.	.	.	-9.8304	12.3307	0.55038	0.0:0.0:0.0:1.0	.	141	O95997	PTTG1_HUMAN	W	141	ENSP00000344936:L141W;ENSP00000430642:L141W;ENSP00000377536:L141W	.	L	+	2	0	PTTG1	159787351	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.328000	0.59253	2.160000	0.67779	0.533000	0.62120	TTG	-	pfam_Securin_separation_inhibitor		0.527	PTTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTTG1	protein_coding	OTTHUMT00000252677.1	T	NM_004219	-		159854773	+1	no_errors	ENST00000352433	ensembl	human	known	74_37	missense	SNP	1.000	G
IGDCC4	57722	genome.wustl.edu	37	15	65674297	65674297	+	3'UTR	SNP	C	C	T			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr15:65674297C>T	ENST00000352385.2	-	0	6012				IGDCC4_ENST00000558048.1_5'UTR	NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TAAATTGTCTCATTTGCAGCT	0.328																																																	0								ENSG00000103742																																			IGDCC4	SO:0001624	3_prime_UTR_variant	0			-	HGNC		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.*2050G>A	15.37:g.65674297C>T		Somatic	0	22	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	14	39.13	Q9HCE4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000352385.2	37	NULL	CCDS10206.1	15																																																																																			-	-		0.328	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	protein_coding	OTTHUMT00000256825.2	C	NM_020962	-		65674297	-1	no_errors	ENST00000558048	ensembl	human	known	74_37	rna	SNP	1.000	T
MALAT1	378938	genome.wustl.edu	37	11	65269611	65269612	+	lincRNA	INS	-	-	TTTCC			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr11:65269611_65269612insTTTCC	ENST00000534336.1	+	0	4379_4380					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		ACTGTATCTGTTTTCCTTCAAA	0.411																																																	0								ENSG00000251562																																			MALAT1			0				HGNC	AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65269612_65269616dupTTTCC		Somatic	NA	NA	NA		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			-	-		0.411	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	lincRNA	OTTHUMT00000389143.1	-	NR_002819			65269612	+1	no_errors	ENST00000534336	ensembl	human	known	74_37	rna	INS	0.000:0.000	TTTCC
NAV2	89797	genome.wustl.edu	37	11	20070457	20070457	+	Silent	SNP	C	C	A			TCGA-K1-A42X-01A-11D-A24N-09	TCGA-K1-A42X-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	347468ce-6cf1-46ba-8d49-c9627f57b1b1	8bee70d0-af1d-40fb-9152-522822710a6e	g.chr11:20070457C>A	ENST00000396087.3	+	16	4254	c.4155C>A	c.(4153-4155)ctC>ctA	p.L1385L	NAV2_ENST00000360655.4_Silent_p.L1298L|NAV2_ENST00000349880.4_Silent_p.L1362L|NAV2_ENST00000533917.1_Silent_p.L448L|NAV2_ENST00000311043.8_Silent_p.L448L|NAV2-AS2_ENST00000533767.1_RNA|NAV2_ENST00000540292.1_Silent_p.L1316L|NAV2_ENST00000527559.2_Silent_p.L1314L|NAV2_ENST00000396085.1_Silent_p.L1362L	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	1385	Ser-rich.				glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						ATGTGGACCTCAACCAGTCTC	0.617																																																	0								ENSG00000166833						109.0	94.0	99.0					11																	20070457		2203	4300	6503	NAV2	SO:0001819	synonymous_variant	0			-	HGNC	AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.4155C>A	11.37:g.20070457C>A		Somatic	0	56	0.00		0.7095170189562674	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	26	53.57	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.L1385	ENST00000396087.3	37	c.4155	CCDS58126.1	11																																																																																			-	NULL		0.617	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	protein_coding	OTTHUMT00000324112.1	C	NM_145117	-		20070457	+1	no_errors	ENST00000396087	ensembl	human	known	74_37	silent	SNP	0.999	A
