#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
FLT4	2324	genome.wustl.edu	37	5	180047285	180047285	+	Silent	SNP	C	C	T	rs143907746		TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr5:180047285C>T	ENST00000261937.6	-	17	2508	c.2430G>A	c.(2428-2430)acG>acA	p.T810T	FLT4_ENST00000502649.1_Silent_p.T810T|FLT4_ENST00000424276.2_5'Flank|FLT4_ENST00000393347.3_Silent_p.T810T	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	810					blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACAGGTAGCCCGTCTTGATGT	0.622													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16295	0.0		0.0	False		,,,				2504	0.0				Colon(97;1075 1466 27033 27547 35871)												0								ENSG00000037280	C	,	3,4403	8.1+/-20.4	0,3,2200	74.0	81.0	79.0		2430,2430	-8.3	0.6	5	dbSNP_134	79	0,8598		0,0,4299	no	coding-synonymous,coding-synonymous	FLT4	NM_002020.4,NM_182925.4	,	0,3,6499	TT,TC,CC		0.0,0.0681,0.0231	,	810/1299,810/1364	180047285	3,13001	2203	4299	6502	FLT4	SO:0001819	synonymous_variant	0			GMAF=0.0005	HGNC	X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.2430G>A	5.37:g.180047285C>T		Somatic	0	102	0.00		0.5119144303430573	68	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	48	12.73	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_VEGFR3_rcpt	p.T810	ENST00000261937.6	37	c.2430	CCDS4457.1	5																																																																																			-	superfamily_Kinase-like_dom		0.622	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	protein_coding	OTTHUMT00000253527.4	C		rs143907746		180047285	-1	no_errors	ENST00000261937	ensembl	human	known	74_37	silent	SNP	0.029	T
AGFG2	3268	genome.wustl.edu	37	7	100163513	100163514	+	3'UTR	DEL	TT	TT	-	rs56804763|rs145117814	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr7:100163513_100163514delTT	ENST00000300176.4	+	0	2467_2468				AGFG2_ENST00000474713.1_3'UTR	NM_006076.4	NP_006067.3	O95081	AGFG2_HUMAN	ArfGAP with FG repeats 2						regulation of ARF GTPase activity (GO:0032312)	membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TTGCCTGGTCTTTTTTTTTTTT	0.515																																																	0								ENSG00000106351																																			AGFG2	SO:0001624	3_prime_UTR_variant	0				HGNC	AF015042	CCDS5697.1	7q22.1	2008-09-22	2008-09-22	2008-09-22	ENSG00000106351	ENSG00000106351		"""ADP-ribosylation factor GTPase activating proteins"""	5177	protein-coding gene	gene with protein product		604019	"""HIV-1 Rev binding protein-like"""	HRBL		9799793	Standard	XM_005250306		Approved	RABR	uc003uvf.3	O95081	OTTHUMG00000156029	ENST00000300176.4:c.*900TT>-	7.37:g.100163523_100163524delTT		Somatic	0	25	0.00		0.5119144303430573	50	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	21	12.50	O75429|Q96AB9|Q96GL4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000300176.4	37	NULL	CCDS5697.1	7																																																																																			-	-		0.515	AGFG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGFG2	protein_coding	OTTHUMT00000342769.1	TT	NM_006076			100163514	+1	no_errors	ENST00000474713	ensembl	human	known	74_37	rna	DEL	0.015:0.012	-
RGMA	56963	genome.wustl.edu	37	15	93588269	93588269	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr15:93588269C>T	ENST00000329082.7	-	4	1583	c.1312G>A	c.(1312-1314)Gcc>Acc	p.A438T	RGMA_ENST00000538818.1_Missense_Mutation_p.A329T|RGMA_ENST00000425933.2_Missense_Mutation_p.A422T|RGMA_ENST00000542321.2_Missense_Mutation_p.A422T|RGMA_ENST00000556658.1_Missense_Mutation_p.A329T|RGMA_ENST00000543599.1_Missense_Mutation_p.A422T|RGMA_ENST00000557301.1_Missense_Mutation_p.A446T|RGMA_ENST00000557420.1_3'UTR	NM_020211.2	NP_064596	Q96B86	RGMA_HUMAN	repulsive guidance molecule family member a	438					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|neural tube closure (GO:0001843)|regulation of BMP signaling pathway (GO:0030510)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	9	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			GGGACGAGGGCGCCCAGGAGG	0.687																																																	0								ENSG00000182175						14.0	15.0	15.0					15																	93588269		1916	4090	6006	RGMA	SO:0001583	missense	0			-	HGNC	AL390083	CCDS45357.1, CCDS53973.1, CCDS53974.1	15q26.1	2013-11-06	2013-11-06			ENSG00000182175			30308	protein-coding gene	gene with protein product		607362	"""RGM domain family, member A"""			15975920	Standard	NM_020211		Approved	RGM, RGMa	uc010urc.2	Q96B86		ENST00000329082.7:c.1312G>A	15.37:g.93588269C>T	ENSP00000330005:p.Ala438Thr	Somatic	0	24	0.00		0.5119144303430573	20	45.95	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	12	33.33	B2RTW1|B7Z5S8|F5GXQ7|F5GZU6|G3V518|Q0JV97|Q8NC80|Q9H0E6|Q9NPM3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RGM_N,pfam_RGM_C	p.A438T	ENST00000329082.7	37	c.1312	CCDS45357.1	15	.	.	.	.	.	.	.	.	.	.	C	8.045	0.764648	0.15914	.	.	ENSG00000182175	ENST00000543599;ENST00000425933;ENST00000329082;ENST00000542321;ENST00000538818;ENST00000557301	D;D;D;D;D;D	0.90844	-2.73;-2.73;-2.73;-2.73;-2.36;-2.74	4.57	-4.88	0.03113	.	0.760949	0.12704	N	0.446118	T	0.77896	0.4199	N	0.16478	0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.61637	-0.7022	10	0.20046	T	0.44	-10.5532	9.4623	0.38792	0.0:0.6035:0.1392:0.2573	.	446;438	G3V518;Q96B86	.;RGMA_HUMAN	T	422;422;438;422;329;446	ENSP00000442498:A422T;ENSP00000404442:A422T;ENSP00000330005:A438T;ENSP00000440025:A422T;ENSP00000442546:A329T;ENSP00000452126:A446T	ENSP00000330005:A438T	A	-	1	0	RGMA	91389273	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.103000	0.03329	-1.185000	0.02716	-0.339000	0.08088	GCC	-	NULL		0.687	RGMA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGMA	protein_coding	OTTHUMT00000415091.1	C	NM_020211	-		93588269	-1	no_errors	ENST00000329082	ensembl	human	known	74_37	missense	SNP	0.000	T
TOLLIP	54472	genome.wustl.edu	37	11	1307270	1307270	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr11:1307270G>T	ENST00000317204.6	-	5	695	c.572C>A	c.(571-573)aCa>aAa	p.T191K	TOLLIP_ENST00000527886.1_Missense_Mutation_p.T122K|TOLLIP_ENST00000528719.1_5'Flank|TOLLIP_ENST00000525159.1_Missense_Mutation_p.T130K|TOLLIP_ENST00000263646.7_Missense_Mutation_p.T163K|TOLLIP_ENST00000542915.1_Missense_Mutation_p.T141K|TOLLIP_ENST00000527938.1_Intron	NM_019009.3	NP_061882.2	Q9H0E2	TOLIP_HUMAN	toll interacting protein	191					autophagy (GO:0006914)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|leukocyte activation (GO:0045321)|phosphorylation (GO:0016310)|positive regulation of protein sumoylation (GO:0033235)|protein localization to endosome (GO:0036010)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|interleukin-1 receptor complex (GO:0045323)|interleukin-18 receptor complex (GO:0045092)|nuclear body (GO:0016604)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|signal transducer activity (GO:0004871)|Toll-like receptor binding (GO:0035325)			large_intestine(1)|lung(4)|upper_aerodigestive_tract(1)	6		all_cancers(49;7.62e-05)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00152)|Lung(200;0.09)|LUSC - Lung squamous cell carcinoma(625;0.107)		CTGGTACACTGTTGGCATCAG	0.632																																																	0								ENSG00000078902						128.0	93.0	105.0					11																	1307270		2197	4297	6494	TOLLIP	SO:0001583	missense	0			-	HGNC	AJ242972	CCDS7723.1	11p	2008-02-05			ENSG00000078902	ENSG00000078902			16476	protein-coding gene	gene with protein product		606277				9426216, 10854325	Standard	NM_019009		Approved	IL-1RAcPIP	uc001lte.3	Q9H0E2	OTTHUMG00000133333	ENST00000317204.6:c.572C>A	11.37:g.1307270G>T	ENSP00000314733:p.Thr191Lys	Somatic	0	22	0.00		0.5119144303430573	136	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	11	21.43	B3KXC6|Q9H9E6|Q9UJ69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUE,pfam_C2_dom,superfamily_C2_dom,superfamily_UBA-like,smart_C2_dom,smart_CUE,pfscan_CUE	p.T191K	ENST00000317204.6	37	c.572	CCDS7723.1	11	.	.	.	.	.	.	.	.	.	.	G	15.93	2.977595	0.53720	.	.	ENSG00000078902	ENST00000317204;ENST00000527886;ENST00000525159;ENST00000263646;ENST00000542915;ENST00000382211;ENST00000530541	T;T;T;T;T;T	0.46063	0.94;0.9;0.95;0.91;0.91;0.88	5.08	4.17	0.49024	.	0.054891	0.64402	D	0.000001	T	0.38427	0.1040	M	0.61703	1.905	0.53005	D	0.999965	P;P;B	0.50710	0.938;0.717;0.138	B;B;B	0.42555	0.391;0.202;0.086	T	0.34453	-0.9828	10	0.08179	T	0.78	-39.6395	13.84	0.63432	0.0738:0.0:0.9262:0.0	.	130;141;191	F2Z2Y8;B3KR28;Q9H0E2	.;.;TOLIP_HUMAN	K	191;122;130;163;141;222;141	ENSP00000314733:T191K;ENSP00000434035:T122K;ENSP00000432668:T130K;ENSP00000263646:T163K;ENSP00000437404:T141K;ENSP00000434494:T141K	ENSP00000263646:T163K	T	-	2	0	TOLLIP	1263846	1.000000	0.71417	0.967000	0.41034	0.248000	0.25809	8.583000	0.90794	1.363000	0.46019	0.561000	0.74099	ACA	-	NULL		0.632	TOLLIP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TOLLIP	protein_coding	OTTHUMT00000257162.2	G	NM_019009	-		1307270	-1	no_errors	ENST00000317204	ensembl	human	known	74_37	missense	SNP	0.997	T
CFH	3075	genome.wustl.edu	37	1	196709781	196709781	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:196709781C>T	ENST00000367429.4	+	18	3055	c.2815C>T	c.(2815-2817)Cat>Tat	p.H939Y		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	939	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						TGAGATTTCTCATGGTGTTGT	0.338																																																	0								ENSG00000000971						123.0	120.0	121.0					1																	196709781		2203	4300	6503	CFH	SO:0001583	missense	0			-	HGNC	Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2815C>T	1.37:g.196709781C>T	ENSP00000356399:p.His939Tyr	Somatic	0	64	0.00		0.5119144303430573	181	11.27	23	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	57	9.52	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.H939Y	ENST00000367429.4	37	c.2815	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	.	9.290	1.050348	0.19827	.	.	ENSG00000000971	ENST00000367429	T	0.66638	-0.22	6.16	-12.3	0.00002	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.56217	0.1970	L	0.60904	1.88	0.09310	N	0.999998	B	0.18741	0.03	B	0.14578	0.011	T	0.49679	-0.8914	9	0.52906	T	0.07	.	14.1597	0.65438	0.1794:0.6764:0.0:0.1442	.	939	P08603	CFAH_HUMAN	Y	939	ENSP00000356399:H939Y	ENSP00000356399:H939Y	H	+	1	0	CFH	194976404	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.376000	0.02561	-2.527000	0.00494	-0.840000	0.03056	CAT	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.338	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	protein_coding	OTTHUMT00000086412.2	C	NM_000186	-		196709781	+1	no_errors	ENST00000367429	ensembl	human	known	74_37	missense	SNP	0.000	T
SELPLG	6404	genome.wustl.edu	37	12	109017341	109017341	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr12:109017341G>A	ENST00000550948.1	-	2	967	c.743C>T	c.(742-744)gCc>gTc	p.A248V	SELPLG_ENST00000228463.6_Missense_Mutation_p.A264V|SELPLG_ENST00000388962.3_Missense_Mutation_p.A238V			Q14242	SELPL_HUMAN	selectin P ligand	248	12 X 10 AA tandem repeats.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to interleukin-6 (GO:0071354)|leukocyte adhesive activation (GO:0050902)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|prostate(3)|skin(1)	12						TGCCTCCGTGGCTGTGGGTTG	0.607																																																	0								ENSG00000110876						176.0	147.0	157.0					12																	109017341		2203	4300	6503	SELPLG	SO:0001583	missense	0			-	HGNC		CCDS31895.1, CCDS31895.2, CCDS55881.1	12q24	2014-01-30						"""CD molecules"", ""Endogenous ligands"""	10722	protein-coding gene	gene with protein product		600738				7505206	Standard	NM_003006		Approved	PSGL-1, CD162	uc010sxe.2	Q14242		ENST00000550948.1:c.743C>T	12.37:g.109017341G>A	ENSP00000447752:p.Ala248Val	Somatic	0	97	0.00		0.5119144303430573	142	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	73	16.09	A8K2Y0|B4DQC3|B7Z5C7|J3KMX6|Q12775|Q6GTW7|Q8N7J7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A248V	ENST00000550948.1	37	c.743	CCDS31895.2	12	.	.	.	.	.	.	.	.	.	.	G	12.97	2.095945	0.36952	.	.	ENSG00000110876	ENST00000388962;ENST00000550948;ENST00000228463	T;T;T	0.15017	2.46;2.46;2.46	2.8	-3.7	0.04437	.	1.066990	0.07402	N	0.890940	T	0.09555	0.0235	N	0.14661	0.345	0.09310	N	1	B;B;B	0.16396	0.017;0.017;0.017	B;B;B	0.17433	0.018;0.018;0.013	T	0.38156	-0.9674	10	0.34782	T	0.22	-2.2226	9.428	0.38592	0.5942:0.0:0.4058:0.0	.	264;248;208	B7Z5C7;Q14242;B4DHR9	.;SELPL_HUMAN;.	V	238;248;264	ENSP00000373614:A238V;ENSP00000447752:A248V;ENSP00000228463:A264V	ENSP00000228463:A264V	A	-	2	0	SELPLG	107541470	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.058000	0.11750	-1.017000	0.03367	-0.229000	0.12294	GCC	-	NULL		0.607	SELPLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELPLG	protein_coding	OTTHUMT00000403904.1	G		-		109017341	-1	no_errors	ENST00000550948	ensembl	human	known	74_37	missense	SNP	0.000	A
ANAPC1	64682	genome.wustl.edu	37	2	112615924	112615924	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr2:112615924T>A	ENST00000341068.3	-	11	2089	c.1317A>T	c.(1315-1317)caA>caT	p.Q439H		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	439					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						ACAGGAACTTTTGCCCACATA	0.363																																																	0								ENSG00000153107						101.0	94.0	96.0					2																	112615924		2203	4300	6503	ANAPC1	SO:0001583	missense	0			-	HGNC	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1317A>T	2.37:g.112615924T>A	ENSP00000339109:p.Gln439His	Somatic	0	257	0.00		0.5119144303430573	1	80.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	93	22.95	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q439H	ENST00000341068.3	37	c.1317	CCDS2093.1	2	.	.	.	.	.	.	.	.	.	.	t	16.74	3.207984	0.58343	.	.	ENSG00000153107	ENST00000341068	.	.	.	4.99	-9.15	0.00698	.	0.557375	0.12906	U	0.429366	T	0.50548	0.1622	M	0.71206	2.165	0.42024	D	0.990992	P	0.39964	0.697	B	0.38562	0.276	T	0.65117	-0.6246	9	0.66056	D	0.02	-6.2141	14.0952	0.65016	0.075:0.7671:0.0:0.1578	.	439	Q9H1A4	APC1_HUMAN	H	439	.	ENSP00000339109:Q439H	Q	-	3	2	ANAPC1	112332395	0.002000	0.14202	0.651000	0.29564	0.633000	0.38033	-2.177000	0.01261	-1.897000	0.01101	-1.243000	0.01532	CAA	-	NULL		0.363	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	protein_coding	OTTHUMT00000254045.2	T	NM_022662	-		112615924	-1	no_errors	ENST00000341068	ensembl	human	known	74_37	missense	SNP	0.748	A
RB1	5925	genome.wustl.edu	37	13	48947579	48947579	+	Nonsense_Mutation	SNP	T	T	G	rs587778845		TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr13:48947579T>G	ENST00000267163.4	+	12	1304	c.1166T>G	c.(1165-1167)tTa>tGa	p.L389*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	389	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.L389*(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATGATGATTTTAAATTCAGCA	0.289		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	24	Whole gene deletion(15)|Unknown(8)|Substitution - Nonsense(1)	bone(11)|breast(5)|eye(2)|central_nervous_system(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	GRCh37	CM071074	RB1	M		ENSG00000139687						106.0	113.0	111.0					13																	48947579		2202	4289	6491	RB1	SO:0001587	stop_gained	0	Familial Cancer Database		-	HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1166T>G	13.37:g.48947579T>G	ENSP00000267163:p.Leu389*	Somatic	0	38	0.00		0.5119144303430573	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	6	57.14	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.L389*	ENST00000267163.4	37	c.1166	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	T	38	7.183736	0.98121	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.675	0.77311	0.0:0.0:0.0:1.0	.	.	.	.	X	368;389	.	ENSP00000267163:L389X	L	+	2	0	RB1	47845580	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.940000	0.70187	2.110000	0.64415	0.460000	0.39030	TTA	-	pfam_RB_A,superfamily_Cyclin-like		0.289	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	T		-		48947579	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	nonsense	SNP	1.000	G
BMS1P5	399761	genome.wustl.edu	37	10	48944619	48944620	+	RNA	INS	-	-	CTATAAGCATCAGTAC			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr10:48944619_48944620insCTATAAGCATCAGTAC	ENST00000449800.1	-	0	496_497					NR_003611.2				BMS1 pseudogene 5																		AAAGCTGGCATCTATAAGCATC	0.45																																																	0								ENSG00000204164																																			BMS1P5			0				HGNC			10q11.22	2013-05-22	2007-03-20	2007-03-20	ENSG00000204164				23653	pseudogene	pseudogene			"""BMS1L pseudogene 5"""	BMS1LP5			Standard	NR_003611		Approved	bA508M1.1, OTTHUMG00000018157			OTTHUMG00000018157		10.37:g.48944619_48944620insCTATAAGCATCAGTAC		Somatic	NA	NA	NA		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000449800.1	37	NULL		10																																																																																			-	-		0.450	BMS1P5-002	KNOWN	basic	processed_transcript	BMS1P5	pseudogene	OTTHUMT00000047906.1	-				48944620	-1	no_errors	ENST00000449800	ensembl	human	known	74_37	rna	INS	1.000:1.000	CTATAAGCATCAGTAC
SORL1	6653	genome.wustl.edu	37	11	121429444	121429444	+	Silent	SNP	G	G	A	rs370296806		TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr11:121429444G>A	ENST00000260197.7	+	20	2937	c.2808G>A	c.(2806-2808)acG>acA	p.T936T		NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	936					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		TTTACTGGACGGATGCCTACC	0.542																																																	0								ENSG00000137642	A		0,4406		0,0,2203	222.0	181.0	195.0		2808	-11.1	0.0	11		195	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	SORL1	NM_003105.5		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		936/2215	121429444	1,13003	2203	4299	6502	SORL1	SO:0001819	synonymous_variant	0			-	HGNC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.2808G>A	11.37:g.121429444G>A		Somatic	0	54	0.00		0.5119144303430573	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33	B2RNX7|Q92856	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_LDrepeatLR_classA_rpt,pfam_Fibronectin_type3,pfam_LDLR_classB_rpt,superfamily_Fibronectin_type3,superfamily_LDrepeatLR_classA_rpt,smart_VPS10,smart_LDLR_classB_rpt,smart_LDrepeatLR_classA_rpt,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.T936	ENST00000260197.7	37	c.2808	CCDS8436.1	11																																																																																			-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt		0.542	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	protein_coding	OTTHUMT00000387626.2	G	NM_003105	-		121429444	+1	no_errors	ENST00000260197	ensembl	human	known	74_37	silent	SNP	0.005	A
DNAH14	127602	genome.wustl.edu	37	1	225347091	225347091	+	Frame_Shift_Del	DEL	A	A	-			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:225347091delA	ENST00000445597.2	+	22	4068	c.4068delA	c.(4066-4068)ccafs	p.P1356fs	DNAH14_ENST00000439375.2_Frame_Shift_Del_p.P1761fs|DNAH14_ENST00000430092.1_Frame_Shift_Del_p.P1761fs			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	1356					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CTAGTTTGCCAAAATGTCCTC	0.363																																																	0								ENSG00000185842						211.0	175.0	186.0					1																	225347091		692	1591	2283	DNAH14	SO:0001589	frameshift_variant	0				HGNC	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.4068delA	1.37:g.225347091delA	ENSP00000409472:p.Pro1356fs	Somatic	0	67	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	22	8.33	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.K1762fs	ENST00000445597.2	37	c.5283		1																																																																																			-	superfamily_P-loop_NTPase		0.363	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	protein_coding	OTTHUMT00000331217.3	A	XM_059166			225347091	+1	no_errors	ENST00000430092	ensembl	human	known	74_37	frame_shift_del	DEL	0.977	-
YRDC	79693	genome.wustl.edu	37	1	38269624	38269624	+	Silent	SNP	C	C	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:38269624C>A	ENST00000373044.2	-	5	817	c.813G>T	c.(811-813)ctG>ctT	p.L271L		NM_024640.3	NP_078916.3	Q86U90	YRDC_HUMAN	yrdC N(6)-threonylcarbamoyltransferase domain containing	271					negative regulation of transport (GO:0051051)	membrane (GO:0016020)|mitochondrion (GO:0005739)	double-stranded RNA binding (GO:0003725)			lung(2)|upper_aerodigestive_tract(1)	3	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GTGAGGGGAGCAGTCCGTACT	0.547																																																	0								ENSG00000196449						157.0	123.0	135.0					1																	38269624		2203	4300	6503	YRDC	SO:0001819	synonymous_variant	0			-	HGNC		CCDS30675.1	1p34.3	2013-09-12	2013-09-12		ENSG00000196449	ENSG00000196449			28905	protein-coding gene	gene with protein product	"""ischemia/reperfusion inducible protein"""	612276	"""yrdC domain containing (E.coli)"", ""yrdC domain containing (E. coli)"""			12730717	Standard	NM_024640		Approved	FLJ23476, IRIP, SUA5	uc001cca.1	Q86U90	OTTHUMG00000004318	ENST00000373044.2:c.813G>T	1.37:g.38269624C>A		Somatic	0	88	0.00		0.5119144303430573	95	26.36	34	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	41	30.51	Q4W4X8|Q6NVW3|Q7L4E4|Q7Z2I4|Q9H5F8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_YrdC-like_dom,superfamily_DHBP_synth_RibB-like_a/b_dom,pfscan_YrdC-like_dom,tigrfam_YrdC-like_dom	p.L271	ENST00000373044.2	37	c.813	CCDS30675.1	1																																																																																			-	NULL		0.547	YRDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YRDC	protein_coding	OTTHUMT00000012470.1	C	NM_024640	-		38269624	-1	no_errors	ENST00000373044	ensembl	human	known	74_37	silent	SNP	0.132	A
ABHD10	55347	genome.wustl.edu	37	3	111709558	111709558	+	Intron	SNP	G	G	C			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr3:111709558G>C	ENST00000273359.3	+	5	603				ABHD10_ENST00000494817.1_Missense_Mutation_p.R196S|ABHD10_ENST00000534857.1_Intron	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10						glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						ACTCTGGAAGGAAAAactata	0.284																																																	0								ENSG00000144827																																			ABHD10	SO:0001627	intron_variant	0			-	HGNC	AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.577-666G>C	3.37:g.111709558G>C		Somatic	0	58	0.00		0.5119144303430573	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	31	18.42	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_AB_hydrolase_1	p.R196S	ENST00000273359.3	37	c.588	CCDS2963.1	3	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.498890	0.01001	.	.	ENSG00000144827	ENST00000494817	.	.	.	3.43	1.56	0.23342	.	.	.	.	.	T	0.27900	0.0687	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.22277	-1.0221	5	0.38643	T	0.18	.	4.0071	0.09607	0.1255:0.0:0.6417:0.2328	.	.	.	.	S	196	.	ENSP00000418973:R196S	R	+	3	2	ABHD10	113192248	0.000000	0.05858	0.055000	0.19348	0.029000	0.11900	0.134000	0.15932	0.413000	0.25759	-0.259000	0.10710	AGG	-	NULL		0.284	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD10	protein_coding	OTTHUMT00000354326.1	G	NM_018394	-		111709558	+1	no_errors	ENST00000494817	ensembl	human	putative	74_37	missense	SNP	0.103	C
CXADR	1525	genome.wustl.edu	37	21	18937978	18937978	+	Missense_Mutation	SNP	C	C	G	rs142651712	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr21:18937978C>G	ENST00000284878.7	+	7	1814	c.1066C>G	c.(1066-1068)Cca>Gca	p.P356A	CXADR_ENST00000400169.1_Intron|CXADR_ENST00000400166.1_3'UTR|CXADR_ENST00000306618.10_Missense_Mutation_p.P315A	NM_001338.4	NP_001329.1	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	356					actin cytoskeleton reorganization (GO:0031532)|AV node cell to bundle of His cell communication (GO:0086067)|blood coagulation (GO:0007596)|cardiac muscle fiber development (GO:0048739)|cell-cell junction organization (GO:0045216)|defense response to virus (GO:0051607)|epithelial structure maintenance (GO:0010669)|gamma-delta T cell activation (GO:0046629)|germ cell migration (GO:0008354)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|homotypic cell-cell adhesion (GO:0034109)|leukocyte migration (GO:0050900)|mitochondrion organization (GO:0007005)|neutrophil chemotaxis (GO:0030593)|regulation of immune response (GO:0050776)|transepithelial transport (GO:0070633)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|adherens junction (GO:0005912)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|filopodium (GO:0030175)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|cell adhesion molecule binding (GO:0050839)|connexin binding (GO:0071253)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|virus receptor activity (GO:0001618)			endometrium(2)|large_intestine(5)|lung(1)|ovary(1)|prostate(2)	11				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		TGTGATGATTCCAGCACAGAG	0.458																																																	0								ENSG00000154639						58.0	56.0	57.0					21																	18937978		2202	4300	6502	CXADR	SO:0001583	missense	0			-	HGNC	Y07593	CCDS33519.1, CCDS56204.1, CCDS56205.1, CCDS56206.1, CCDS56207.1	21q21.1	2013-01-29			ENSG00000154639	ENSG00000154639		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2559	protein-coding gene	gene with protein product		602621				9036860, 9096397	Standard	NM_001338		Approved	CAR	uc002yki.3	P78310	OTTHUMG00000074508	ENST00000284878.7:c.1066C>G	21.37:g.18937978C>G	ENSP00000284878:p.Pro356Ala	Somatic	0	84	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	30	40.00	B2R8V8|B7WPI3|D3YHP0|O00694|Q8WWT6|Q8WWT7|Q8WWT8|Q9UKV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.P356A	ENST00000284878.7	37	c.1066	CCDS33519.1	21	.	.	.	.	.	.	.	.	.	.	C	22.1	4.237702	0.79800	.	.	ENSG00000154639	ENST00000284878;ENST00000306618	D;D	0.99418	-3.87;-5.87	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.99518	0.9828	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.98681	1.0692	10	0.87932	D	0	.	18.6315	0.91361	0.0:1.0:0.0:0.0	.	356	P78310	CXAR_HUMAN	A	356;315	ENSP00000284878:P356A;ENSP00000303395:P315A	ENSP00000284878:P356A	P	+	1	0	CXADR	17859849	1.000000	0.71417	0.992000	0.48379	0.739000	0.42172	7.195000	0.77798	2.713000	0.92767	0.655000	0.94253	CCA	-	NULL		0.458	CXADR-001	KNOWN	basic|CCDS	protein_coding	CXADR	protein_coding	OTTHUMT00000158209.1	C		-		18937978	+1	no_errors	ENST00000284878	ensembl	human	known	74_37	missense	SNP	1.000	G
PRELP	5549	genome.wustl.edu	37	1	203455946	203455946	+	Missense_Mutation	SNP	G	G	T	rs202213609		TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:203455946G>T	ENST00000343110.2	+	3	1213	c.1086G>T	c.(1084-1086)ttG>ttT	p.L362F		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	362					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			GAAACTACTTGAAGCCGCCCA	0.607																																																	0								ENSG00000188783						94.0	75.0	81.0					1																	203455946		2203	4300	6503	PRELP	SO:0001583	missense	0			-	HGNC	BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.1086G>T	1.37:g.203455946G>T	ENSP00000343924:p.Leu362Phe	Somatic	0	35	0.00		0.5119144303430573	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	12	25.00	Q6FG38	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.L362F	ENST00000343110.2	37	c.1086	CCDS1438.1	1	.	.	.	.	.	.	.	.	.	.	G	19.15	3.771805	0.69992	.	.	ENSG00000188783	ENST00000343110	T	0.05786	3.39	5.46	3.48	0.39840	.	0.283230	0.28760	N	0.014234	T	0.15739	0.0379	L	0.55481	1.735	0.49213	D	0.999763	D	0.63880	0.993	D	0.63283	0.913	T	0.00544	-1.1679	10	0.62326	D	0.03	-28.1293	9.4206	0.38548	0.0795:0.1447:0.7758:0.0	.	362	P51888	PRELP_HUMAN	F	362	ENSP00000343924:L362F	ENSP00000343924:L362F	L	+	3	2	PRELP	201722569	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	0.918000	0.28678	1.302000	0.44855	0.561000	0.74099	TTG	-	NULL		0.607	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRELP	protein_coding	OTTHUMT00000087474.1	G	NM_002725	-		203455946	+1	no_errors	ENST00000343110	ensembl	human	known	74_37	missense	SNP	0.998	T
CLDN24	100132463	genome.wustl.edu	37	4	184243470	184243470	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr4:184243470T>A	ENST00000541814.1	-	1	109	c.110A>T	c.(109-111)aAc>aTc	p.N37I	CLDN22_ENST00000323319.5_5'Flank	NM_001185149.1	NP_001172078.1	A6NM45	CLD24_HUMAN	claudin 24	37						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)	4						TAAGTCCAGGTTGAGGTTCTT	0.423																																																	0								ENSG00000185758																																			CLDN24	SO:0001583	missense	0			-	HGNC		CCDS54824.1	4q35.1	2012-07-05			ENSG00000185758	ENSG00000185758			37200	protein-coding gene	gene with protein product			"""claudin 21"""	CLDN21		12736707	Standard	NM_001185149		Approved		uc021xva.1	A6NM45	OTTHUMG00000160628	ENST00000541814.1:c.110A>T	4.37:g.184243470T>A	ENSP00000438400:p.Asn37Ile	Somatic	0	94	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	52	17.46	F5H040	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin	p.N37I	ENST00000541814.1	37	c.110	CCDS54824.1	4	.	.	.	.	.	.	.	.	.	.	T	17.24	3.339846	0.60963	.	.	ENSG00000185758	ENST00000541814;ENST00000514470	D;D	0.89196	-2.48;-2.48	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.94056	0.8095	M	0.86028	2.79	0.41553	D	0.988588	.	.	.	.	.	.	D	0.95058	0.8193	8	0.72032	D	0.01	.	15.1849	0.72993	0.0:0.0:0.0:1.0	.	.	.	.	I	37;29	ENSP00000438400:N37I;ENSP00000422519:N29I	ENSP00000422519:N29I	N	-	2	0	CLDN24	184480464	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.756000	0.47549	2.181000	0.69327	0.460000	0.39030	AAC	-	pfam_PMP22/EMP/MP20/Claudin		0.423	CLDN24-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN24	protein_coding		T	XM_001714660	-		184243470	-1	no_errors	ENST00000541814	ensembl	human	known	74_37	missense	SNP	0.986	A
HOOK1	51361	genome.wustl.edu	37	1	60333955	60333955	+	Missense_Mutation	SNP	G	G	C			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:60333955G>C	ENST00000371208.3	+	20	2136	c.1879G>C	c.(1879-1881)Gca>Cca	p.A627P	HOOK1_ENST00000465876.1_3'UTR|HOOK1_ENST00000395561.2_Missense_Mutation_p.A585P	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	627					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					GTTAAATCCAGCATCAGCTGA	0.279																																																	0								ENSG00000134709						51.0	58.0	56.0					1																	60333955		2203	4299	6502	HOOK1	SO:0001583	missense	0			-	HGNC	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1879G>C	1.37:g.60333955G>C	ENSP00000360252:p.Ala627Pro	Somatic	0	126	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	58	30.59	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Hook-related_fam,superfamily_Prefoldin	p.A627P	ENST00000371208.3	37	c.1879	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	G	18.81	3.703884	0.68501	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.24151	1.87;1.87	5.99	5.99	0.97316	.	0.046583	0.85682	D	0.000000	T	0.26738	0.0654	L	0.39898	1.24	0.80722	D	1	B	0.18013	0.025	B	0.20384	0.029	T	0.02698	-1.1122	10	0.27785	T	0.31	.	20.4777	0.99188	0.0:0.0:1.0:0.0	.	627	Q9UJC3	HOOK1_HUMAN	P	627;585	ENSP00000360252:A627P;ENSP00000378928:A585P	ENSP00000360252:A627P	A	+	1	0	HOOK1	60106543	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.017000	0.76399	2.840000	0.97914	0.655000	0.94253	GCA	-	pfam_Hook-related_fam		0.279	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	protein_coding	OTTHUMT00000024934.1	G	NM_015888	-		60333955	+1	no_errors	ENST00000371208	ensembl	human	known	74_37	missense	SNP	1.000	C
SLC4A3	6508	genome.wustl.edu	37	2	220496799	220496801	+	In_Frame_Del	DEL	GAA	GAA	-	rs557843124	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr2:220496799_220496801delGAA	ENST00000358055.3	+	7	1433_1435	c.921_923delGAA	c.(919-924)aggaag>agg	p.K313del	SLC4A3_ENST00000497589.1_3'UTR|SLC4A3_ENST00000373760.2_In_Frame_Del_p.K313del|SLC4A3_ENST00000317151.3_In_Frame_Del_p.K313del|SLC4A3_ENST00000373762.3_In_Frame_Del_p.K340del|SLC4A3_ENST00000273063.6_In_Frame_Del_p.K340del			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	313	Poly-Lys.				bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCTTCGCAGGAAGAAGAAGAAG	0.65														5	0.000998403	0.0	0.0058	5008	,	,		20005	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000114923		,	46,4208		1,44,2082					,	3.4	1.0			35	90,8146		2,86,4030	no	coding,coding	SLC4A3	NM_201574.2,NM_005070.3	,	3,130,6112	A1A1,A1R,RR		1.0928,1.0813,1.0889	,	,		136,12354				SLC4A3	SO:0001651	inframe_deletion	0				HGNC		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.921_923delGAA	2.37:g.220496808_220496810delGAA	ENSP00000350756:p.Lys313del	Somatic	0	74	0.00		0.5119144303430573	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	36	10.00	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_HCO3_transpt_C,pfam_Band3_cytoplasmic_dom,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange_3,prints_Anion_exchange,tigrfam_HCO3_transpt_euk	p.K338in_frame_del	ENST00000358055.3	37	c.1002_1004	CCDS2445.1	2																																																																																			-	NULL		0.650	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC4A3	protein_coding	OTTHUMT00000316472.1	GAA	NM_005070			220496801	+1	no_errors	ENST00000273063	ensembl	human	known	74_37	in_frame_del	DEL	0.999:1.000:1.000	-
RP11-764K9.1	0	genome.wustl.edu	37	9	68400510	68400510	+	lincRNA	SNP	C	C	A	rs367810189	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr9:68400510C>A	ENST00000417843.2	-	0	1309																											tatagaggaacgccacacttt	0.478																																																	0								ENSG00000225411																																			RP11-764K9.1			0			-	Clone_based_vega_gene																													9.37:g.68400510C>A		Somatic	0	14	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			-	-		0.478	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	lincRNA	OTTHUMT00000129817.2	C		-		68400510	-1	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	SNP	0.060	A
USP30	84749	genome.wustl.edu	37	12	109490426	109490427	+	5'UTR	INS	-	-	CGGCGG	rs71079516|rs3217401|rs140371213	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr12:109490426_109490427insCGGCGG	ENST00000257548.5	+	0	36_37				USP30_ENST00000392784.2_Intron|USP30-AS1_ENST00000478808.2_RNA	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30						mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						ATCCCTCGGTCcggcggcggcg	0.728														2378	0.47484	0.177	0.6398	5008	,	,		14910	0.6944		0.5199	False		,,,				2504	0.4877																0								ENSG00000256262																																			USP30-AS1	SO:0001623	5_prime_UTR_variant	0				HGNC	BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.-57->CGGCGG	12.37:g.109490427_109490432dupCGGCGG		Somatic	NA	NA	NA		0.5119144303430573	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8WTU7|Q96JX4|Q9BSS3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000257548.5	37	NULL	CCDS9123.2	12																																																																																			-	-		0.728	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP30-AS1	protein_coding	OTTHUMT00000257733.2	-	NM_032663			109490427	-1	no_errors	ENST00000478808	ensembl	human	known	74_37	rna	INS	0.000:0.000	CGGCGG
MYCBP2	23077	genome.wustl.edu	37	13	77695586	77695586	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr13:77695586G>T	ENST00000544440.2	-	55	7965	c.7948C>A	c.(7948-7950)Cct>Act	p.P2650T	MYCBP2_ENST00000360084.5_Missense_Mutation_p.P113T|MYCBP2_ENST00000357337.6_Missense_Mutation_p.P2650T|MYCBP2_ENST00000407578.2_Missense_Mutation_p.P2688T|MYCBP2_ENST00000482517.1_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ACTGAGAAAGGGCTTGGAGGA	0.393																																																	0								ENSG00000005810						88.0	88.0	88.0					13																	77695586		2203	4300	6503	MYCBP2	SO:0001583	missense	0			-	HGNC	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.7948C>A	13.37:g.77695586G>T	ENSP00000444596:p.Pro2650Thr	Somatic	0	46	0.00		0.5119144303430573	9	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	26	13.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.P2688T	ENST00000544440.2	37	c.8062		13	.	.	.	.	.	.	.	.	.	.	G	19.28	3.798179	0.70567	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440;ENST00000360084	T;T;T;T	0.46063	1.65;1.65;1.65;0.88	5.6	5.6	0.85130	.	0.107089	0.64402	D	0.000003	T	0.53126	0.1777	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.83275	0.996;0.987	T	0.44406	-0.9330	10	0.26408	T	0.33	.	19.6223	0.95663	0.0:0.0:1.0:0.0	.	2650;2650	O75592-2;O75592	.;MYCB2_HUMAN	T	2650;2688;2650;113	ENSP00000349892:P2650T;ENSP00000384288:P2688T;ENSP00000444596:P2650T;ENSP00000353197:P113T	ENSP00000349892:P2650T	P	-	1	0	MYCBP2	76593587	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.455000	0.97625	2.616000	0.88540	0.655000	0.94253	CCT	-	superfamily_ARM-type_fold		0.393	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	protein_coding	OTTHUMT00000045326.1	G	NM_015057	-		77695586	-1	no_errors	ENST00000407578	ensembl	human	known	74_37	missense	SNP	1.000	T
CXADR	1525	genome.wustl.edu	37	21	18937853	18937853	+	Missense_Mutation	SNP	C	C	G			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr21:18937853C>G	ENST00000284878.7	+	7	1689	c.941C>G	c.(940-942)tCc>tGc	p.S314C	CXADR_ENST00000400169.1_Missense_Mutation_p.S314C|CXADR_ENST00000400166.1_Missense_Mutation_p.P227A|CXADR_ENST00000400165.1_Missense_Mutation_p.P175A|CXADR_ENST00000306618.10_Missense_Mutation_p.S273C	NM_001338.4	NP_001329.1	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	314					actin cytoskeleton reorganization (GO:0031532)|AV node cell to bundle of His cell communication (GO:0086067)|blood coagulation (GO:0007596)|cardiac muscle fiber development (GO:0048739)|cell-cell junction organization (GO:0045216)|defense response to virus (GO:0051607)|epithelial structure maintenance (GO:0010669)|gamma-delta T cell activation (GO:0046629)|germ cell migration (GO:0008354)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|homotypic cell-cell adhesion (GO:0034109)|leukocyte migration (GO:0050900)|mitochondrion organization (GO:0007005)|neutrophil chemotaxis (GO:0030593)|regulation of immune response (GO:0050776)|transepithelial transport (GO:0070633)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|adherens junction (GO:0005912)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|filopodium (GO:0030175)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|cell adhesion molecule binding (GO:0050839)|connexin binding (GO:0071253)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|virus receptor activity (GO:0001618)			endometrium(2)|large_intestine(5)|lung(1)|ovary(1)|prostate(2)	11				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		GAAGGATATTCCAAGACTCAG	0.507																																																	0								ENSG00000154639						78.0	71.0	73.0					21																	18937853		2203	4300	6503	CXADR	SO:0001583	missense	0			-	HGNC	Y07593	CCDS33519.1, CCDS56204.1, CCDS56205.1, CCDS56206.1, CCDS56207.1	21q21.1	2013-01-29			ENSG00000154639	ENSG00000154639		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2559	protein-coding gene	gene with protein product		602621				9036860, 9096397	Standard	NM_001338		Approved	CAR	uc002yki.3	P78310	OTTHUMG00000074508	ENST00000284878.7:c.941C>G	21.37:g.18937853C>G	ENSP00000284878:p.Ser314Cys	Somatic	0	89	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	40	28.57	B2R8V8|B7WPI3|D3YHP0|O00694|Q8WWT6|Q8WWT7|Q8WWT8|Q9UKV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	p.S314C	ENST00000284878.7	37	c.941	CCDS33519.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.11|19.11	3.763055|3.763055	0.69763|0.69763	.|.	.|.	ENSG00000154639|ENSG00000154639	ENST00000400166;ENST00000400165|ENST00000284878;ENST00000400169;ENST00000306618	D;D|T;T;D	0.94828|0.87887	-2.89;-3.53|-1.12;-1.17;-2.31	5.3|5.3	5.3|5.3	0.74995|0.74995	.|.	.|0.371962	.|0.27677	.|N	.|0.018320	D|D	0.93569|0.93569	0.7947|0.7947	.|.	.|.	.|.	0.46222|0.46222	D|D	0.998937|0.998937	B;B|D;D	0.26744|0.89917	0.158;0.158|1.0;0.999	B;B|D;P	0.20184|0.70487	0.028;0.028|0.969;0.907	D|D	0.93772|0.93772	0.7076|0.7076	8|9	0.54805|0.59425	T|D	0.06|0.04	.|.	18.3313|18.3313	0.90270|0.90270	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	175;227|314;314	P78310-4;P78310-5|B7WPI3;P78310	.;.|.;CXAR_HUMAN	A|C	227;175|314;314;273	ENSP00000383030:P227A;ENSP00000383029:P175A|ENSP00000284878:S314C;ENSP00000383033:S314C;ENSP00000303395:S273C	ENSP00000383029:P175A|ENSP00000284878:S314C	P|S	+|+	1|2	0|0	CXADR|CXADR	17859724|17859724	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.866000|0.866000	0.49608|0.49608	3.513000|3.513000	0.53414|0.53414	2.644000|2.644000	0.89710|0.89710	0.561000|0.561000	0.74099|0.74099	CCA|TCC	-	NULL		0.507	CXADR-001	KNOWN	basic|CCDS	protein_coding	CXADR	protein_coding	OTTHUMT00000158209.1	C		-		18937853	+1	no_errors	ENST00000284878	ensembl	human	known	74_37	missense	SNP	1.000	G
NPHS1	4868	genome.wustl.edu	37	19	36322588	36322588	+	Silent	SNP	G	G	A	rs370276697	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr19:36322588G>A	ENST00000378910.5	-	24	3242	c.3243C>T	c.(3241-3243)gtC>gtT	p.V1081V	NPHS1_ENST00000353632.6_Intron	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	1081					cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GGACCCCCCCGACACAGGAGG	0.652													G|||	2	0.000399361	0.0015	0.0	5008	,	,		14274	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000161270	G		3,4403		0,3,2200	20.0	22.0	21.0		3243	-10.2	0.0	19		21	0,8600		0,0,4300	no	coding-synonymous	NPHS1	NM_004646.3		0,3,6500	AA,AG,GG		0.0,0.0681,0.0231		1081/1242	36322588	3,13003	2203	4300	6503	NPHS1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.3243C>T	19.37:g.36322588G>A		Somatic	0	54	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	33	23.26	A6NDH2|C3RX61	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V1081	ENST00000378910.5	37	c.3243	CCDS32996.1	19																																																																																			-	NULL		0.652	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	protein_coding	OTTHUMT00000452553.1	G		-		36322588	-1	no_errors	ENST00000378910	ensembl	human	known	74_37	silent	SNP	0.000	A
PIKFYVE	200576	genome.wustl.edu	37	2	209141504	209141504	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr2:209141504C>T	ENST00000264380.4	+	4	549	c.391C>T	c.(391-393)Ctc>Ttc	p.L131F	PIKFYVE_ENST00000407449.1_Missense_Mutation_p.L131F|PIKFYVE_ENST00000308862.6_Intron|PIKFYVE_ENST00000392202.3_Intron	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	131					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GCTTCGAAGCCTCAGCACAGT	0.443																																																	0								ENSG00000115020						81.0	80.0	80.0					2																	209141504		2203	4300	6503	PIKFYVE	SO:0001583	missense	0			-	HGNC	AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.391C>T	2.37:g.209141504C>T	ENSP00000264380:p.Leu131Phe	Somatic	0	71	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	21	25.00	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_GroEL-like_apical_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.L131F	ENST00000264380.4	37	c.391	CCDS2382.1	2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155167	0.78114	.	.	ENSG00000115020	ENST00000264380;ENST00000407449;ENST00000422495;ENST00000452564	T;T;T;T	0.68765	1.32;-0.35;-0.3;1.49	5.83	5.83	0.93111	.	0.000000	0.64402	D	0.000001	T	0.68072	0.2961	N	0.19112	0.55	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.995	D;D;D	0.78314	0.991;0.991;0.969	T	0.63594	-0.6602	10	0.22109	T	0.4	-12.2264	13.3259	0.60459	0.0:0.9279:0.0:0.0721	.	131;131;131	Q9Y2I7;E9PDH4;Q08AR7	FYV1_HUMAN;.;.	F	131;131;143;131	ENSP00000264380:L131F;ENSP00000384356:L131F;ENSP00000414477:L143F;ENSP00000405736:L131F	ENSP00000264380:L131F	L	+	1	0	PIKFYVE	208849749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.105000	0.57797	2.762000	0.94881	0.655000	0.94253	CTC	-	NULL		0.443	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	protein_coding	OTTHUMT00000256477.2	C	NM_015040	-		209141504	+1	no_errors	ENST00000264380	ensembl	human	known	74_37	missense	SNP	1.000	T
XPO1	7514	genome.wustl.edu	37	2	61726902	61726902	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr2:61726902A>G	ENST00000401558.2	-	7	1263	c.536T>C	c.(535-537)tTt>tCt	p.F179S	XPO1_ENST00000406957.1_Missense_Mutation_p.F179S|XPO1_ENST00000404992.2_Missense_Mutation_p.F179S	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	179	Necessary for HTLV-1 Rex-mediated mRNA export.				gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AGAGAAATCAAATACTTCTTC	0.328			Mis		CLL																																		-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0								ENSG00000082898						73.0	76.0	75.0					2																	61726902		2203	4300	6503	XPO1	SO:0001583	missense	0			-	HGNC	Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.536T>C	2.37:g.61726902A>G	ENSP00000384863:p.Phe179Ser	Somatic	0	63	0.00		0.5119144303430573	29	58.57	41	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	20	41.18	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CRM1_C_dom,pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F179S	ENST00000401558.2	37	c.536	CCDS33205.1	2	.	.	.	.	.	.	.	.	.	.	A	27.0	4.795393	0.90453	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957;ENST00000451765	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.95	4.8	0.61643	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82967	0.5152	M	0.93978	3.48	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.85616	0.1261	10	0.56958	D	0.05	-20.207	12.0134	0.53301	0.9327:0.0:0.0673:0.0	.	179	O14980	XPO1_HUMAN	S	179	ENSP00000384863:F179S;ENSP00000385942:F179S;ENSP00000385559:F179S;ENSP00000413853:F179S	ENSP00000384863:F179S	F	-	2	0	XPO1	61580406	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.324000	0.96373	1.073000	0.40885	0.533000	0.62120	TTT	-	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold		0.328	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	protein_coding	OTTHUMT00000325872.3	A	NM_003400	-		61726902	-1	no_errors	ENST00000401558	ensembl	human	known	74_37	missense	SNP	1.000	G
IRS1	3667	genome.wustl.edu	37	2	227662246	227662246	+	Silent	SNP	G	G	A	rs529655323		TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr2:227662246G>A	ENST00000305123.5	-	1	2229	c.1209C>T	c.(1207-1209)acC>acT	p.T403T	RP11-395N3.2_ENST00000607970.1_lincRNA|IRS1_ENST00000498335.1_5'Flank	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	403	Ser-rich.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.T403T(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GACAATCCGAGGTGGAGCCAT	0.637											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0014	5008	,	,		16128	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	kidney(1)						ENSG00000169047						64.0	68.0	67.0					2																	227662246		2203	4300	6503	IRS1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1209C>T	2.37:g.227662246G>A		Somatic	0	69	0.00	2321	0.5119144303430573	10	41.18	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	33	13.16		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.T403	ENST00000305123.5	37	c.1209	CCDS2463.1	2																																																																																			-	NULL		0.637	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	protein_coding	OTTHUMT00000256886.3	G	NM_005544	-		227662246	-1	no_errors	ENST00000305123	ensembl	human	known	74_37	silent	SNP	0.797	A
PFKL	5211	genome.wustl.edu	37	21	45732052	45732052	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr21:45732052C>T	ENST00000349048.4	+	4	357	c.302C>T	c.(301-303)gCg>gTg	p.A101V	PFKL_ENST00000403390.1_Missense_Mutation_p.A148V|PFKL_ENST00000496824.1_3'UTR	NM_002626.4	NP_002617.3	P17858	PFKAL_HUMAN	phosphofructokinase, liver	101	N-terminal catalytic PFK domain 1.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose 6-phosphate metabolic process (GO:0006002)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|negative regulation of insulin secretion (GO:0046676)|protein homotetramerization (GO:0051289)|protein oligomerization (GO:0051259)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	6-phosphofructokinase complex (GO:0005945)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	6-phosphofructokinase activity (GO:0003872)|ATP binding (GO:0005524)|fructose binding (GO:0070061)|fructose-6-phosphate binding (GO:0070095)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	23				Colorectal(79;0.0811)		CGCCGGGCAGCGGCCTACAAC	0.642																																																	0								ENSG00000141959						29.0	24.0	26.0					21																	45732052		2193	4294	6487	PFKL	SO:0001583	missense	0			-	HGNC		CCDS33582.1	21q22.3	1992-12-17			ENSG00000141959	ENSG00000141959	2.7.1.11		8876	protein-coding gene	gene with protein product		171860					Standard	NR_024108		Approved		uc002zel.3	P17858	OTTHUMG00000086910	ENST00000349048.4:c.302C>T	21.37:g.45732052C>T	ENSP00000269848:p.Ala101Val	Somatic	0	63	0.00		0.5119144303430573	195	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q96A64|Q96IH4|Q9BR91	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,prints_Phosphofructokinase,tigrfam_6-phosphofructokinase_euk	p.A148V	ENST00000349048.4	37	c.443	CCDS33582.1	21	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095854	0.76870	.	.	ENSG00000141959	ENST00000349048;ENST00000381188;ENST00000403390	T;T	0.80304	-1.36;-1.36	4.3	4.3	0.51218	Phosphofructokinase domain (2);	0.000000	0.85682	D	0.000000	D	0.88280	0.6394	M	0.75615	2.305	0.80722	D	1	D;D	0.76494	0.999;0.995	D;B	0.64776	0.929;0.446	D	0.90212	0.4265	10	0.87932	D	0	-25.5253	15.9247	0.79606	0.0:1.0:0.0:0.0	.	101;148	P17858;P17858-2	K6PL_HUMAN;.	V	101;151;148	ENSP00000269848:A101V;ENSP00000384038:A148V	ENSP00000269848:A101V	A	+	2	0	PFKL	44556480	1.000000	0.71417	0.206000	0.23566	0.373000	0.29922	5.727000	0.68523	2.111000	0.64477	0.467000	0.42956	GCG	-	pfam_Phosphofructokinase_dom,superfamily_Phosphofructokinase_dom,pirsf_6-phosphofructokinase_euk,tigrfam_6-phosphofructokinase_euk		0.642	PFKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKL	protein_coding	OTTHUMT00000195805.1	C		-		45732052	+1	no_errors	ENST00000403390	ensembl	human	known	74_37	missense	SNP	0.996	T
NES	10763	genome.wustl.edu	37	1	156642804	156642804	+	Frame_Shift_Del	DEL	G	G	-	rs372020167		TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:156642804delG	ENST00000368223.3	-	4	1308	c.1176delC	c.(1174-1176)cccfs	p.P392fs		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	392	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCTGAGGTGTGGGGGGGATGG	0.597																																																	0								ENSG00000132688						74.0	93.0	86.0					1																	156642804		2203	4299	6502	NES	SO:0001589	frameshift_variant	0				HGNC	X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.1176delC	1.37:g.156642804delG	ENSP00000357206:p.Pro392fs	Somatic	0	34	0.00		0.5119144303430573	268	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	O00552|Q3LIF5|Q5SYZ6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_IF	p.T393fs	ENST00000368223.3	37	c.1176	CCDS1151.1	1																																																																																			-	NULL		0.597	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	protein_coding	OTTHUMT00000082844.2	G	NM_006617			156642804	-1	no_errors	ENST00000368223	ensembl	human	known	74_37	frame_shift_del	DEL	0.087	-
TMPRSS15	5651	genome.wustl.edu	37	21	19647612	19647612	+	Silent	SNP	G	G	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr21:19647612G>A	ENST00000284885.3	-	24	2839	c.2806C>T	c.(2806-2808)Cta>Tta	p.L936L		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	936	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						TCATTTGATAGAAGAGGAACA	0.403																																																	0								ENSG00000154646						158.0	143.0	148.0					21																	19647612		2203	4300	6503	TMPRSS15	SO:0001819	synonymous_variant	0			-	HGNC		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2806C>T	21.37:g.19647612G>A		Somatic	0	63	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	19	32.14	Q2NKL7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S1,pfam_CUB_dom,pfam_MAM_dom,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_SRCR,superfamily_Trypsin-like_Pept_dom,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA_dom,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.L936	ENST00000284885.3	37	c.2806	CCDS13571.1	21																																																																																			-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1		0.403	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	protein_coding	OTTHUMT00000158231.2	G	NM_002772	-		19647612	-1	no_errors	ENST00000284885	ensembl	human	known	74_37	silent	SNP	0.191	A
AR	367	genome.wustl.edu	37	X	66765161	66765161	+	Missense_Mutation	SNP	A	A	T	rs200185441		TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chrX:66765161A>T	ENST00000374690.3	+	1	697	c.173A>T	c.(172-174)cAg>cTg	p.Q58L	AR_ENST00000396044.3_Missense_Mutation_p.Q58L|AR_ENST00000513847.1_3'UTR|AR_ENST00000504326.1_Missense_Mutation_p.Q58L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	58	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q58L(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTGCTGCTgcagcagcagcag	0.667									Androgen Insensitivity Syndrome																																								2	Substitution - Missense(2)	lung(1)|endometrium(1)	GRCh37	CM033749	AR	M	rs5902610	ENSG00000169083						8.0	11.0	10.0					X																	66765161		2116	4153	6269	AR	SO:0001583	missense	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	-	HGNC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.173A>T	X.37:g.66765161A>T	ENSP00000363822:p.Gln58Leu	Somatic	0	68	0.00		0.5119144303430573	4	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	43	8.51	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.Q58L	ENST00000374690.3	37	c.173	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	a	11.20	1.568808	0.28003	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.69040	-0.37;-0.37;-0.37	.	.	.	.	0.157519	0.30235	N	0.010084	T	0.46541	0.1398	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.34313	0.448;0.448	B;B	0.36534	0.227;0.227	T	0.39800	-0.9596	8	0.62326	D	0.03	.	.	.	.	.	58;58	E7EVX6;D3YPQ2	.;.	L	58	ENSP00000363822:Q58L;ENSP00000421155:Q58L;ENSP00000379359:Q58L	ENSP00000363822:Q58L	Q	+	2	0	AR	66681886	0.997000	0.39634	0.872000	0.34217	0.495000	0.33615	1.386000	0.34419	0.000000	0.14550	0.000000	0.15137	CAG	-	pfam_Andrgn_rcpt		0.667	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	protein_coding	OTTHUMT00000057007.1	A	NM_000044	rs200185441		66765161	+1	no_errors	ENST00000374690	ensembl	human	known	74_37	missense	SNP	0.920	T
ZNF160	90338	genome.wustl.edu	37	19	53576670	53576670	+	Intron	SNP	T	T	G			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr19:53576670T>G	ENST00000429604.1	-	6	687				ZNF160_ENST00000601421.1_Intron|ZNF160_ENST00000418871.1_Intron|ZNF160_ENST00000599056.1_Intron|ZNF160_ENST00000355147.5_Silent_p.R122R	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160						hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		CCGAGGGACCTCGACAGGCGG	0.532																																																	0								ENSG00000170949						53.0	50.0	51.0					19																	53576670		876	1991	2867	ZNF160	SO:0001627	intron_variant	0			-	HGNC	X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.271+722A>C	19.37:g.53576670T>G		Somatic	0	77	0.00		0.5119144303430573	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	62	15.07	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.R122	ENST00000429604.1	37	c.364	CCDS12859.1	19																																																																																			-	NULL		0.532	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF160	protein_coding	OTTHUMT00000463994.2	T	NM_033288	-		53576670	-1	no_errors	ENST00000355147	ensembl	human	putative	74_37	silent	SNP	0.000	G
UGT8	7368	genome.wustl.edu	37	4	115585186	115585186	+	Silent	SNP	T	T	C			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr4:115585186T>C	ENST00000310836.6	+	3	1380	c.858T>C	c.(856-858)caT>caC	p.H286H	UGT8_ENST00000394511.3_Silent_p.H286H	NM_001128174.1	NP_001121646	Q16880	CGT_HUMAN	UDP glycosyltransferase 8	286					axon cargo transport (GO:0008088)|central nervous system development (GO:0007417)|cytoskeleton organization (GO:0007010)|galactosylceramide biosynthetic process (GO:0006682)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to paranode region of axon (GO:0002175)	integral component of membrane (GO:0016021)	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity (GO:0003851)|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity (GO:0008489)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		CTAATGAACATGGCTTTGTCT	0.398																																																	0								ENSG00000174607						184.0	168.0	174.0					4																	115585186		2203	4300	6503	UGT8	SO:0001819	synonymous_variant	0			-	HGNC	AK127970	CCDS3705.1	4q26	2013-02-21	2008-07-31	2005-07-20	ENSG00000174607	ENSG00000174607	2.4.1.45	"""UDP glucuronosyltransferases"""	12555	protein-coding gene	gene with protein product	"""2-hydroxyacylsphingosine 1-beta-galactosyltransferase"""	601291	"""UDP-galactose ceramide galactosyltransferase"""	CGT		8661025	Standard	NM_003360		Approved		uc003ibs.2	Q16880	OTTHUMG00000132915	ENST00000310836.6:c.858T>C	4.37:g.115585186T>C		Somatic	0	71	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	27	32.50	B3KXU7|O00196	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.H286	ENST00000310836.6	37	c.858	CCDS3705.1	4																																																																																			-	pfam_UDP_glucos_trans		0.398	UGT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT8	protein_coding	OTTHUMT00000256426.2	T	NM_003360	-		115585186	+1	no_errors	ENST00000310836	ensembl	human	known	74_37	silent	SNP	0.978	C
TBCE	6905	genome.wustl.edu	37	1	235577820	235577820	+	Silent	SNP	G	G	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:235577820G>A	ENST00000366601.3	+	4	434	c.258G>A	c.(256-258)aaG>aaA	p.K86K	TBCE_ENST00000406207.1_Silent_p.K86K|TBCE_ENST00000543662.1_Silent_p.K86K|TBCE_ENST00000472011.1_3'UTR			Q15813	TBCE_HUMAN	tubulin folding cofactor E	86					'de novo' posttranslational protein folding (GO:0051084)|adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|microtubule cytoskeleton organization (GO:0000226)|muscle atrophy (GO:0014889)|peripheral nervous system neuron axonogenesis (GO:0048936)|post-chaperonin tubulin folding pathway (GO:0007023)|post-embryonic development (GO:0009791)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	chaperone binding (GO:0051087)			NS(1)|endometrium(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	14	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			CTGCAATTAAGAACCGCTATG	0.393																																																	0								ENSG00000116957						111.0	113.0	112.0					1																	235577820		2203	4300	6503	TBCE	SO:0001819	synonymous_variant	0			-	HGNC	U61232	CCDS1605.1, CCDS73052.1	1q42.3	2014-02-04	2006-11-21		ENSG00000116957	ENSG00000116957			11582	protein-coding gene	gene with protein product		604934	"""tubulin-specific chaperone e"", ""Kenny-Caffey syndrome"", ""hypoparathyroidism, growth and mental retardation, and dysmorphism"""	KCS, HRD		8706133, 9806825, 12389028	Standard	NM_001079515		Approved	KCS1, pac2	uc001hxa.1	Q15813	OTTHUMG00000039987	ENST00000366601.3:c.258G>A	1.37:g.235577820G>A		Somatic	0	70	0.00		0.5119144303430573	63	7.35	5	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	56	9.68	A8K8C2|B7Z3P1	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_CAP-Gly_domain,pfam_Ribosomal_S21e,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.K86	ENST00000366601.3	37	c.258	CCDS1605.1	1																																																																																			-	superfamily_CAP-Gly_domain		0.393	TBCE-001	KNOWN	basic|CCDS	protein_coding	TBCE	protein_coding	OTTHUMT00000096458.3	G	NM_003193	-		235577820	+1	no_errors	ENST00000543662	ensembl	human	known	74_37	silent	SNP	0.994	A
KIAA1407	57577	genome.wustl.edu	37	3	113697719	113697719	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr3:113697719G>T	ENST00000295878.3	-	15	2592	c.2446C>A	c.(2446-2448)Cag>Aag	p.Q816K	KIAA1407_ENST00000545063.1_3'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	816										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						AGCCAGCTCTGGATGACTCTC	0.423																																																	0								ENSG00000163617						197.0	193.0	194.0					3																	113697719		2203	4300	6503	KIAA1407	SO:0001583	missense	0			-	HGNC	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.2446C>A	3.37:g.113697719G>T	ENSP00000295878:p.Gln816Lys	Somatic	0	61	0.00		0.5119144303430573	10	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B4DYL1|Q9P2E0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Q816K	ENST00000295878.3	37	c.2446	CCDS2977.1	3	.	.	.	.	.	.	.	.	.	.	G	4.147	0.025686	0.08054	.	.	ENSG00000163617	ENST00000295878	T	0.29397	1.57	5.38	-5.88	0.02290	.	0.839450	0.10954	N	0.615785	T	0.08582	0.0213	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.18713	-1.0328	10	0.36615	T	0.2	.	0.0161	0.00002	0.2886:0.1939:0.2243:0.2931	.	816	Q8NCU4	K1407_HUMAN	K	816	ENSP00000295878:Q816K	ENSP00000295878:Q816K	Q	-	1	0	KIAA1407	115180409	0.000000	0.05858	0.000000	0.03702	0.331000	0.28603	-0.465000	0.06680	-0.796000	0.04456	-1.098000	0.02139	CAG	-	NULL		0.423	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	protein_coding	OTTHUMT00000354724.2	G	NM_020817	-		113697719	-1	no_errors	ENST00000295878	ensembl	human	known	74_37	missense	SNP	0.000	T
MROH2B	133558	genome.wustl.edu	37	5	41017989	41017989	+	Silent	SNP	C	C	T	rs371233888		TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr5:41017989C>T	ENST00000399564.4	-	28	3297	c.2847G>A	c.(2845-2847)gcG>gcA	p.A949A	MROH2B_ENST00000506092.2_Silent_p.A504A	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	949																	AGCTAGCAGCCGCCTGACGGA	0.468																																																	0								ENSG00000171495	C		0,3806		0,0,1903	35.0	36.0	36.0		2847	-9.1	0.3	5		36	2,8246		0,2,4122	no	coding-synonymous	HEATR7B2	NM_173489.4		0,2,6025	TT,TC,CC		0.0242,0.0,0.0166		949/1586	41017989	2,12052	1903	4124	6027	MROH2B	SO:0001819	synonymous_variant	0			-	HGNC		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2847G>A	5.37:g.41017989C>T		Somatic	0	65	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	50	21.54	Q68DM1|Q7Z4U4|Q8N7X3	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.A949	ENST00000399564.4	37	c.2847	CCDS47202.1	5																																																																																			-	superfamily_ARM-type_fold		0.468	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	protein_coding	OTTHUMT00000367558.2	C	NM_173489	-		41017989	-1	no_errors	ENST00000399564	ensembl	human	known	74_37	silent	SNP	0.371	T
RALGPS2	55103	genome.wustl.edu	37	1	178854229	178854229	+	Missense_Mutation	SNP	C	C	G			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:178854229C>G	ENST00000367635.3	+	12	1261	c.923C>G	c.(922-924)tCt>tGt	p.S308C	RALGPS2_ENST00000367634.2_Missense_Mutation_p.S308C|RALGPS2_ENST00000477383.1_3'UTR	NM_152663.3	NP_689876.2	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	308					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						GTAGGAGCGTCTCCACAGAGT	0.428																																																	0								ENSG00000116191						65.0	67.0	66.0					1																	178854229		2203	4300	6503	RALGPS2	SO:0001583	missense	0			-	HGNC	AK098470	CCDS1325.1, CCDS65733.1	1q24	2013-01-11			ENSG00000116191	ENSG00000116191		"""Pleckstrin homology (PH) domain containing"""	30279	protein-coding gene	gene with protein product						10747847, 12102558	Standard	NM_152663		Approved	KIAA0351, FLJ10244, FLJ25604	uc001glz.3	Q86X27	OTTHUMG00000035076	ENST00000367635.3:c.923C>G	1.37:g.178854229C>G	ENSP00000356607:p.Ser308Cys	Somatic	0	82	0.00		0.5119144303430573	14	17.65	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	76	10.59	B7Z7B1|Q5T5Z1|Q5VZ67|Q9NW78	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.S308C	ENST00000367635.3	37	c.923	CCDS1325.1	1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402692	0.62288	.	.	ENSG00000116191	ENST00000367635;ENST00000367634;ENST00000324778	T;T;T	0.44083	0.93;0.93;0.93	5.62	5.62	0.85841	.	0.731376	0.13484	N	0.384425	T	0.61788	0.2375	M	0.63843	1.955	0.80722	D	1	B;D	0.64830	0.064;0.994	B;P	0.58928	0.016;0.848	T	0.61387	-0.7073	10	0.66056	D	0.02	.	19.2628	0.93974	0.0:1.0:0.0:0.0	.	308;308	B7Z7B1;Q86X27	.;RGPS2_HUMAN	C	308;308;273	ENSP00000356607:S308C;ENSP00000356606:S308C;ENSP00000313613:S273C	ENSP00000313613:S273C	S	+	2	0	RALGPS2	177120852	1.000000	0.71417	0.980000	0.43619	0.249000	0.25844	7.128000	0.77217	2.659000	0.90383	0.585000	0.79938	TCT	-	NULL		0.428	RALGPS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS2	protein_coding	OTTHUMT00000084926.2	C	NM_152663	-		178854229	+1	no_errors	ENST00000367635	ensembl	human	known	74_37	missense	SNP	1.000	G
MORC2	22880	genome.wustl.edu	37	22	31321609	31321609	+	3'UTR	SNP	C	C	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr22:31321609C>T	ENST00000397641.3	-	0	4688				MORC2-AS1_ENST00000441558.1_RNA|MORC2-AS1_ENST00000609557.1_RNA|MORC2-AS1_ENST00000432624.2_RNA|MORC2-AS1_ENST00000422995.2_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2							cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						AGTCACAGTCCTTGTGCCTTC	0.493																																																	0								ENSG00000235989						108.0	105.0	106.0					22																	31321609		692	1591	2283	MORC2-AS1	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.*1181G>A	22.37:g.31321609C>T		Somatic	0	64	0.00		0.5119144303430573	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B2RNB1|Q9UF28|Q9Y6V2	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397641.3	37	NULL		22																																																																																			-	-		0.493	MORC2-001	KNOWN	basic|appris_principal	protein_coding	MORC2-AS1	protein_coding	OTTHUMT00000321710.2	C	NM_014941	-		31321609	+1	no_errors	ENST00000422995	ensembl	human	known	74_37	rna	SNP	0.010	T
CTBP1	1487	genome.wustl.edu	37	4	1231728	1231728	+	Intron	SNP	G	G	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr4:1231728G>A	ENST00000290921.6	-	2	377				CTBP1_ENST00000515690.1_Intron|CTBP1_ENST00000382952.3_Intron|CTBP1_ENST00000510568.1_Silent_p.A135A	NM_001328.2	NP_001319.1	Q13363	CTBP1_HUMAN	C-terminal binding protein 1						Golgi organization (GO:0007030)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone deacetylation (GO:0031065)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of transcription by chromatin organization (GO:0034401)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(23;0.00818)	Colorectal(103;0.2)		CTCCTGATGGGGCACAGGGAA	0.612																																																	0								ENSG00000159692																																			CTBP1	SO:0001627	intron_variant	0			-	HGNC	U37408	CCDS3348.1, CCDS43203.1	4p16	2008-02-05			ENSG00000159692	ENSG00000159692			2494	protein-coding gene	gene with protein product	"""brefeldin A-ribosylated substrate"""	602618				9479502	Standard	XM_005272261		Approved	BARS	uc003gcv.1	Q13363	OTTHUMG00000089259	ENST00000290921.6:c.195+242C>T	4.37:g.1231728G>A		Somatic	1	106	0.93		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	66	19.28	Q4W5N3|Q7Z2Q5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.A135	ENST00000290921.6	37	c.405	CCDS3348.1	4																																																																																			-	NULL		0.612	CTBP1-001	KNOWN	basic|CCDS	protein_coding	CTBP1	protein_coding	OTTHUMT00000202938.1	G	NM_001328	-		1231728	-1	no_errors	ENST00000510568	ensembl	human	putative	74_37	silent	SNP	0.001	A
THSD7B	80731	genome.wustl.edu	37	2	137814609	137814609	+	Silent	SNP	G	G	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr2:137814609G>T	ENST00000409968.1	+	3	937	c.759G>T	c.(757-759)ctG>ctT	p.L253L	THSD7B_ENST00000543459.1_Silent_p.L112L|THSD7B_ENST00000272643.3_Silent_p.L253L|THSD7B_ENST00000413152.2_Silent_p.L222L			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	253						integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		AATGCAGACTGCCTCATCTTA	0.413																																																	0								ENSG00000144229						145.0	142.0	143.0					2																	137814609		1876	4118	5994	THSD7B	SO:0001819	synonymous_variant	0			-	HGNC			2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.759G>T	2.37:g.137814609G>T		Somatic	0	75	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	29	25.00		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.L253	ENST00000409968.1	37	c.759		2																																																																																			-	NULL		0.413	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	protein_coding	OTTHUMT00000331769.2	G	XM_046570.9	-		137814609	+1	no_errors	ENST00000272643	ensembl	human	known	74_37	silent	SNP	0.998	T
SHC4	399694	genome.wustl.edu	37	15	49127052	49127052	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr15:49127052T>A	ENST00000332408.4	-	11	2079	c.1651A>T	c.(1651-1653)Agt>Tgt	p.S551C	SHC4_ENST00000537958.1_Missense_Mutation_p.S265C|SHC4_ENST00000396535.3_Missense_Mutation_p.S308C	NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	551	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		GATGTTGCACTCTCTCGAACC	0.517																																																	0								ENSG00000185634						166.0	135.0	146.0					15																	49127052		2197	4295	6492	SHC4	SO:0001583	missense	0			-	HGNC	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.1651A>T	15.37:g.49127052T>A	ENSP00000329668:p.Ser551Cys	Somatic	0	71	0.00		0.5119144303430573	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	17	32.00	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PTB/PI_dom,pfam_SH2,smart_PTB/PI_dom,smart_SH2,pfscan_PTB/PI_dom,pfscan_SH2,prints_PID_Shc-like,prints_SH2	p.S551C	ENST00000332408.4	37	c.1651	CCDS10130.1	15	.	.	.	.	.	.	.	.	.	.	T	21.1	4.094389	0.76870	.	.	ENSG00000185634	ENST00000332408;ENST00000396535;ENST00000537958	D;D;D	0.95035	-3.59;-3.59;-3.59	4.92	4.92	0.64577	SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.97766	0.9267	M	0.92833	3.35	0.48975	D	0.999734	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98855	1.0760	10	0.87932	D	0	-0.0279	14.7222	0.69314	0.0:0.0:0.0:1.0	.	308;551	Q6S5L8-2;Q6S5L8	.;SHC4_HUMAN	C	551;308;265	ENSP00000329668:S551C;ENSP00000379786:S308C;ENSP00000443300:S265C	ENSP00000329668:S551C	S	-	1	0	SHC4	46914344	0.991000	0.36638	1.000000	0.80357	0.990000	0.78478	2.198000	0.42705	2.068000	0.61886	0.482000	0.46254	AGT	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2		0.517	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHC4	protein_coding	OTTHUMT00000254371.1	T	NM_203349	-		49127052	-1	no_errors	ENST00000332408	ensembl	human	known	74_37	missense	SNP	0.998	A
C8A	731	genome.wustl.edu	37	1	57378074	57378074	+	Splice_Site	SNP	A	A	G			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:57378074A>G	ENST00000361249.3	+	10	1476		c.e10-1			NM_000562.2	NP_000553.1	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide						complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	43						CTGTGCCCACAGATGCAGCCT	0.612																																																	0								ENSG00000157131						32.0	34.0	33.0					1																	57378074		2203	4299	6502	C8A	SO:0001630	splice_region_variant	0			-	HGNC	M16974	CCDS606.1	1p32.2	2014-09-17			ENSG00000157131	ENSG00000157131		"""Complement system"""	1352	protein-coding gene	gene with protein product		120950					Standard	NM_000562		Approved		uc001cyo.2	P07357	OTTHUMG00000008306	ENST00000361249.3:c.1381-1A>G	1.37:g.57378074A>G		Somatic	0	53	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	50	19.35	A2RUI4|A2RUI5|Q13668|Q9H130	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e10-2	ENST00000361249.3	37	c.1381-2	CCDS606.1	1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.310129	0.40895	.	.	ENSG00000157131	ENST00000361249	.	.	.	5.55	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0621	0.42282	0.9239:0.0:0.0761:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C8A	57150662	1.000000	0.71417	0.118000	0.21660	0.040000	0.13550	6.381000	0.73163	0.941000	0.37499	0.533000	0.62120	.	-	-		0.612	C8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8A	protein_coding	OTTHUMT00000022890.1	A	NM_000562	-	Intron	57378074	+1	no_errors	ENST00000361249	ensembl	human	known	74_37	splice_site	SNP	0.910	G
LINC00052	145978	genome.wustl.edu	37	15	88121685	88121685	+	lincRNA	SNP	C	C	T	rs544654009	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr15:88121685C>T	ENST00000560153.1	+	0	554				RP11-648K4.2_ENST00000560439.1_lincRNA	NR_026869.1		Q96N35	TMM83_HUMAN	long intergenic non-protein coding RNA 52							integral component of membrane (GO:0016021)											TCTGCTCCATCTGTTCATCCC	0.478													C|||	2	0.000399361	0.0	0.0	5008	,	,		20786	0.0		0.0	False		,,,				2504	0.002																0								ENSG00000259527																																			LINC00052			0			-	HGNC	AK056023		15q25.3	2012-10-12	2011-08-10	2011-08-10		ENSG00000259527		"""Long non-coding RNAs"""	26455	non-coding RNA	RNA, long non-coding			"""transmembrane protein 83"", ""non-protein coding RNA 52"""	TMEM83, NCRNA00052			Standard	NR_026869		Approved	FLJ31461	uc002bmc.1	Q96N35			15.37:g.88121685C>T		Somatic	0	59	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	26	21.21		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000560153.1	37	NULL		15																																																																																			-	-		0.478	LINC00052-002	KNOWN	basic	lincRNA	LINC00052	lincRNA	OTTHUMT00000416151.1	C	XR_017978	-		88121685	+1	no_errors	ENST00000560153	ensembl	human	known	74_37	rna	SNP	0.002	T
LPHN2	23266	genome.wustl.edu	37	1	82402483	82402483	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:82402483A>G	ENST00000370728.1	+	7	1004	c.359A>G	c.(358-360)tAc>tGc	p.Y120C	LPHN2_ENST00000370713.1_Missense_Mutation_p.Y120C|LPHN2_ENST00000370715.1_Missense_Mutation_p.Y120C|LPHN2_ENST00000469377.2_3'UTR|LPHN2_ENST00000370727.1_Missense_Mutation_p.Y120C|LPHN2_ENST00000319517.6_Missense_Mutation_p.Y120C|LPHN2_ENST00000370730.1_Missense_Mutation_p.Y120C|LPHN2_ENST00000370721.1_Missense_Mutation_p.Y120C|LPHN2_ENST00000359929.3_Missense_Mutation_p.Y120C|LPHN2_ENST00000335786.5_Missense_Mutation_p.Y120C|LPHN2_ENST00000394879.1_Missense_Mutation_p.Y120C|LPHN2_ENST00000271029.4_Missense_Mutation_p.Y120C|LPHN2_ENST00000370725.1_Missense_Mutation_p.Y120C|LPHN2_ENST00000370723.1_Missense_Mutation_p.Y120C|LPHN2_ENST00000370717.2_Missense_Mutation_p.Y120C			O95490	LPHN2_HUMAN	latrophilin 2	120	SUEL-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00260}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		CCTGGAACATACAAATACCTT	0.368																																																	0								ENSG00000117114						212.0	198.0	203.0					1																	82402483		2203	4300	6503	LPHN2	SO:0001583	missense	0			-	HGNC	AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.359A>G	1.37:g.82402483A>G	ENSP00000359763:p.Tyr120Cys	Somatic	0	66	0.00		0.5119144303430573	20	35.48	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	44	16.98	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.Y120C	ENST00000370728.1	37	c.359		1	.	.	.	.	.	.	.	.	.	.	A	19.15	3.770993	0.69992	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14;2.14	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.49287	0.1548	M	0.91663	3.23	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.987;1.0;0.992;0.999	T	0.62296	-0.6884	10	0.87932	D	0	.	16.3245	0.82970	1.0:0.0:0.0:0.0	.	120;120;120;120	O95490-3;O95490-4;O95490-2;B3KVU1	.;.;.;.	C	120	ENSP00000359756:Y120C;ENSP00000359763:Y120C;ENSP00000359765:Y120C;ENSP00000359762:Y120C;ENSP00000359760:Y120C;ENSP00000359758:Y120C;ENSP00000353006:Y120C;ENSP00000359750:Y120C;ENSP00000359748:Y120C;ENSP00000322270:Y120C;ENSP00000359752:Y120C;ENSP00000378344:Y120C;ENSP00000271029:Y120C;ENSP00000337306:Y120C	ENSP00000271029:Y120C	Y	+	2	0	LPHN2	82175071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.310000	0.96267	2.254000	0.74563	0.460000	0.39030	TAC	-	pfam_Lectin_gal-bd_dom,pfscan_Lectin_gal-bd_dom		0.368	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	protein_coding	OTTHUMT00000027188.1	A	NM_012302	-		82402483	+1	no_errors	ENST00000370717	ensembl	human	known	74_37	missense	SNP	1.000	G
SLC25A3	5250	genome.wustl.edu	37	12	98987855	98987855	+	Silent	SNP	C	C	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr12:98987855C>T	ENST00000228318.3	+	2	219	c.99C>T	c.(97-99)tcC>tcT	p.S33S	SLC25A3_ENST00000551917.1_Silent_p.S33S|SLC25A3_ENST00000548847.1_Silent_p.S33S|SLC25A3_ENST00000551265.1_Silent_p.S33S|SLC25A3_ENST00000552981.1_Silent_p.S33S|SLC25A3_ENST00000401722.3_Silent_p.S33S|SLC25A3_ENST00000549338.1_Silent_p.S33S|SLC25A3_ENST00000547534.1_Silent_p.S33S|SLC25A3_ENST00000188376.5_Silent_p.S33S	NM_005888.3	NP_005879.1	Q00325	MPCP_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3	33					generation of precursor metabolites and energy (GO:0006091)|phosphate ion transmembrane transport (GO:0035435)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	phosphate ion carrier activity (GO:0015320)|protein complex binding (GO:0032403)|symporter activity (GO:0015293)			breast(1)|endometrium(2)|large_intestine(4)|lung(8)|prostate(1)	16		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		GCAGCAGCTCCCCAGGGCCCA	0.677																																																	0								ENSG00000075415						19.0	19.0	19.0					12																	98987855		2203	4297	6500	SLC25A3	SO:0001819	synonymous_variant	0			-	HGNC		CCDS9065.1, CCDS9066.1	12q23.1	2013-05-22			ENSG00000075415	ENSG00000075415		"""Solute carriers"""	10989	protein-coding gene	gene with protein product		600370		PHC		8168843	Standard	NM_213611		Approved		uc001tfo.3	Q00325	OTTHUMG00000170212	ENST00000228318.3:c.99C>T	12.37:g.98987855C>T		Somatic	0	100	0.00		0.5119144303430573	384	11.70	51	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	40	16.67	B3KS34|Q7Z7N7|Q96A03	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.S33	ENST00000228318.3	37	c.99	CCDS9066.1	12																																																																																			-	NULL		0.677	SLC25A3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A3	protein_coding	OTTHUMT00000407989.1	C	NM_005888	-		98987855	+1	no_errors	ENST00000228318	ensembl	human	known	74_37	silent	SNP	0.002	T
CREB3L4	148327	genome.wustl.edu	37	1	153946560	153946560	+	3'UTR	SNP	G	G	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:153946560G>T	ENST00000368607.3	+	0	1473				CREB3L4_ENST00000368600.3_3'UTR|CREB3L4_ENST00000468845.1_3'UTR|CREB3L4_ENST00000271889.4_3'UTR|CREB3L4_ENST00000368603.1_3'UTR|CREB3L4_ENST00000405694.3_3'UTR|JTB_ENST00000471173.1_5'Flank	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4						response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AGACCTTCCTGGCCCACTTCC	0.552																																																	0								ENSG00000143578						54.0	44.0	48.0					1																	153946560		2203	4300	6503	CREB3L4	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.*19G>T	1.37:g.153946560G>T		Somatic	0	33	0.00		0.5119144303430573	61	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	D3DV62|Q5T4L0|Q86YW6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368607.3	37	NULL	CCDS1056.1	1																																																																																			-	-		0.552	CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CREB3L4	protein_coding	OTTHUMT00000090291.1	G	NM_130898	-		153946560	+1	no_errors	ENST00000468845	ensembl	human	known	74_37	rna	SNP	0.005	T
LYNX1	66004	genome.wustl.edu	37	8	143846101	143846101	+	Nonsense_Mutation	SNP	G	G	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr8:143846101G>T	ENST00000335822.5	-	5	945	c.318C>A	c.(316-318)tgC>tgA	p.C106*	LYNX1_ENST00000523332.1_Intron|RP11-706C16.7_ENST00000523657.1_RNA|LYNX1_ENST00000317543.7_Nonsense_Mutation_p.C72*	NM_023946.2	NP_076435.1	Q9BZG9	LYNX1_HUMAN	Ly6/neurotoxin 1	106	UPAR/Ly6.					anchored component of membrane (GO:0031225)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|lung(2)|skin(1)	4	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GGATATCGGGGCAGCCTATGT	0.627																																																	0								ENSG00000180155						95.0	92.0	93.0					8																	143846101		2203	4300	6503	LYNX1	SO:0001587	stop_gained	0			-	HGNC	AF321824	CCDS6389.1, CCDS34951.1, CCDS34952.1	8q24.3	2008-03-12			ENSG00000180155	ENSG00000180155			29604	protein-coding gene	gene with protein product		606110				12573258, 10402197	Standard	NM_023946		Approved	SLURP2	uc003yxd.1	Q9BZG9	OTTHUMG00000164694	ENST00000335822.5:c.318C>A	8.37:g.143846101G>T	ENSP00000337950:p.Cys106*	Somatic	0	147	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	68	28.42	D3DWI7|G3XAC2|Q86SR0	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_LY6_UPAR	p.C106*	ENST00000335822.5	37	c.318	CCDS34951.1	8	.	.	.	.	.	.	.	.	.	.	G	34	5.407309	0.96051	.	.	ENSG00000180155	ENST00000317543;ENST00000335822	.	.	.	3.18	-0.295	0.12828	.	0.159383	0.43260	D	0.000592	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.0198	5.834	0.18597	0.4676:0.0:0.5324:0.0	.	.	.	.	X	72;106	.	ENSP00000319846:C72X	C	-	3	2	LYNX1	143843103	0.993000	0.37304	0.920000	0.36463	0.117000	0.20001	0.132000	0.15891	-0.058000	0.13177	-0.481000	0.04817	TGC	-	pfam_LY6_UPAR		0.627	LYNX1-001	KNOWN	basic|CCDS	protein_coding	LYNX1	protein_coding	OTTHUMT00000379786.3	G	NM_177476	-		143846101	-1	no_errors	ENST00000335822	ensembl	human	known	74_37	nonsense	SNP	0.923	T
ANTXRLP1	100996567	genome.wustl.edu	37	10	47640774	47640792	+	RNA	DEL	AAGCTGAGTGTTGGGAGAG	AAGCTGAGTGTTGGGAGAG	-	rs144049238|rs139997534|rs59150445|rs59784451	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	AAGCTGAGTGTTGGGAGAG	AAGCTGAGTGTTGGGAGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr10:47640774_47640792delAAGCTGAGTGTTGGGAGAG	ENST00000454837.1	-	0	17_35					NR_103827.1				anthrax toxin receptor-like pseudogene 1																		ATtgggagaaaagctgagtgttgggagagaagctgaggc	0.493														2692	0.53754	0.5303	0.6484	5008	,	,		21433	0.2996		0.6461	False		,,,				2504	0.6022																0								ENSG00000243536																																			ANTXRLP1			0				HGNC			10q11.22	2014-05-06			ENSG00000243536	ENSG00000263482			45004	pseudogene	pseudogene							Standard	NR_103827		Approved				OTTHUMG00000188317		10.37:g.47640774_47640792delAAGCTGAGTGTTGGGAGAG		Somatic	NA	NA	NA		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000454837.1	37	NULL		10																																																																																			-	-		0.493	ANTXRLP1-001	KNOWN	basic	processed_transcript	ANTXRLP1	pseudogene	OTTHUMT00000047859.2	AAGCTGAGTGTTGGGAGAG				47640792	-1	no_errors	ENST00000454837	ensembl	human	known	74_37	rna	DEL	0.069:0.070:0.070:0.070:0.068:0.065:0.062:0.057:0.052:0.046:0.038:0.038:0.038:0.036:0.034:0.031:0.027:0.022:0.016	-
ZNF43	7594	genome.wustl.edu	37	19	22002025	22002026	+	Splice_Site	INS	-	-	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr19:22002025_22002026insA	ENST00000354959.4	-	2	173		c.e2-2		ZNF43_ENST00000595461.1_Splice_Site|ZNF43_ENST00000598381.1_Splice_Site|ZNF43_ENST00000594012.1_Splice_Site|ZNF43_ENST00000598288.1_Splice_Site	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		CAATGGTCCCTAAAAAAAACAA	0.386																																																	1	Unknown(1)	ovary(1)						ENSG00000198521																																			ZNF43	SO:0001630	splice_region_variant	0				HGNC	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.4-2->T	19.37:g.22002033_22002033dupA		Somatic	0	70	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Splice_Site	INS	NA	NA	NA	NA	NA	NA	-	e2-2	ENST00000354959.4	37	c.4-3_4-2	CCDS12413.2	19																																																																																			-	-		0.386	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	protein_coding	OTTHUMT00000250380.2	-	NM_003423		Intron	22002026	-1	no_errors	ENST00000354959	ensembl	human	known	74_37	splice_site_ins	INS	0.896:0.834	A
MS4A14	84689	genome.wustl.edu	37	11	60165446	60165446	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr11:60165446C>A	ENST00000300187.6	+	2	537	c.260C>A	c.(259-261)gCa>gAa	p.A87E	MS4A14_ENST00000531783.1_Missense_Mutation_p.A87E|MS4A14_ENST00000395001.1_5'UTR|MS4A14_ENST00000531787.1_Intron|MS4A14_ENST00000395005.2_Missense_Mutation_p.A87E	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	87						integral component of membrane (GO:0016021)		p.A87E(1)		autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						TTCTGGGGAGCACTTATTGTG	0.393																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000166928						112.0	114.0	113.0					11																	60165446		2203	4300	6503	MS4A14	SO:0001583	missense	0			-	HGNC	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.260C>A	11.37:g.60165446C>A	ENSP00000300187:p.Ala87Glu	Somatic	0	41	0.00		0.5119144303430573	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	4	80.95	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CD20-like	p.A87E	ENST00000300187.6	37	c.260	CCDS31569.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.03|15.03	2.713250|2.713250	0.48517|0.48517	.|.	.|.	ENSG00000166928|ENSG00000166928	ENST00000300187;ENST00000395005;ENST00000526375;ENST00000531783|ENST00000534688	T;T;T;T|.	0.34859|.	4.06;1.34;4.06;4.06|.	5.03|5.03	4.05|4.05	0.47172|0.47172	.|.	0.508880|.	0.18162|.	N|.	0.149739|.	T|T	0.76962|0.76962	0.4061|0.4061	M|M	0.87547|0.87547	2.89|2.89	0.52099|0.52099	D|D	0.99994|0.99994	D;D|.	0.76494|.	0.998;0.999|.	D;D|.	0.72982|.	0.964;0.979|.	T|T	0.78904|0.78904	-0.2020|-0.2020	10|5	0.87932|.	D|.	0|.	-10.245|-10.245	10.8753|10.8753	0.46906|0.46906	0.0:0.8098:0.1902:0.0|0.0:0.8098:0.1902:0.0	.|.	87;87|.	Q96JA4-2;Q96JA4|.	.;M4A14_HUMAN|.	E|N	87|46	ENSP00000300187:A87E;ENSP00000378453:A87E;ENSP00000435764:A87E;ENSP00000433761:A87E|.	ENSP00000300187:A87E|.	A|H	+|+	2|1	0|0	MS4A14|MS4A14	59922022|59922022	0.816000|0.816000	0.29132|0.29132	0.664000|0.664000	0.29753|0.29753	0.343000|0.343000	0.28985|0.28985	1.166000|1.166000	0.31834|0.31834	2.768000|2.768000	0.95171|0.95171	0.655000|0.655000	0.94253|0.94253	GCA|CAC	-	pfam_CD20-like		0.393	MS4A14-002	KNOWN	basic|CCDS	protein_coding	MS4A14	protein_coding	OTTHUMT00000395383.2	C		-		60165446	+1	no_errors	ENST00000300187	ensembl	human	known	74_37	missense	SNP	0.652	A
TOPAZ1	375337	genome.wustl.edu	37	3	44303960	44303960	+	Missense_Mutation	SNP	A	A	C			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr3:44303960A>C	ENST00000309765.4	+	5	3173	c.3005A>C	c.(3004-3006)tAt>tCt	p.Y1002S		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	1002						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										GAAAATATTTATGAAGTTTGC	0.274																																																	0								ENSG00000173769						35.0	31.0	32.0					3																	44303960		692	1556	2248	TOPAZ1	SO:0001583	missense	0			-	HGNC	AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.3005A>C	3.37:g.44303960A>C	ENSP00000310303:p.Tyr1002Ser	Somatic	0	76	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	21	38.24		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.Y1002S	ENST00000309765.4	37	c.3005	CCDS46809.1	3	.	.	.	.	.	.	.	.	.	.	A	3.140	-0.176604	0.06380	.	.	ENSG00000173769	ENST00000309765	T	0.14391	2.51	5.6	0.263	0.15602	.	.	.	.	.	T	0.04318	0.0119	N	0.03608	-0.345	0.09310	N	1	B	0.16396	0.017	B	0.12837	0.008	T	0.43909	-0.9362	9	0.15499	T	0.54	-0.0462	2.3148	0.04196	0.4765:0.2896:0.0805:0.1535	.	1002	Q8N9V7	CC077_HUMAN	S	1002	ENSP00000310303:Y1002S	ENSP00000310303:Y1002S	Y	+	2	0	C3orf77	44278964	0.059000	0.20769	0.023000	0.16930	0.467000	0.32768	0.209000	0.17435	-0.111000	0.12001	-0.323000	0.08544	TAT	-	NULL		0.274	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPAZ1	protein_coding	OTTHUMT00000343247.1	A	NM_001145030	-		44303960	+1	no_errors	ENST00000309765	ensembl	human	known	74_37	missense	SNP	0.040	C
CACNA1H	8912	genome.wustl.edu	37	16	1257370	1257370	+	Silent	SNP	C	C	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr16:1257370C>T	ENST00000348261.5	+	14	3251	c.3003C>T	c.(3001-3003)ttC>ttT	p.F1001F	CACNA1H_ENST00000358590.4_Silent_p.F1001F|RP11-616M22.3_ENST00000564700.1_RNA|CACNA1H_ENST00000565831.1_Silent_p.F1001F	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1001					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	TCATGACCTTCGGCAACTATG	0.647																																																	0								ENSG00000196557						46.0	46.0	46.0					16																	1257370		2049	4186	6235	CACNA1H	SO:0001819	synonymous_variant	0			-	HGNC	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.3003C>T	16.37:g.1257370C>T		Somatic	0	24	0.00		0.5119144303430573	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.F1001	ENST00000348261.5	37	c.3003	CCDS45375.1	16																																																																																			-	pfam_Ion_trans_dom		0.647	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	protein_coding	OTTHUMT00000421601.1	C	NM_001005407	-		1257370	+1	no_errors	ENST00000348261	ensembl	human	known	74_37	silent	SNP	0.997	T
HSD17B11	51170	genome.wustl.edu	37	4	88312252	88312252	+	5'UTR	DEL	T	T	-	rs111862929|rs60037506|rs368478743	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr4:88312252delT	ENST00000358290.4	-	0	286				HSD17B11_ENST00000507286.1_5'UTR	NM_016245.3	NP_057329.2	Q8NBQ5	DHB11_HUMAN	hydroxysteroid (17-beta) dehydrogenase 11						androgen catabolic process (GO:0006710)|steroid biosynthetic process (GO:0006694)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|lipid particle (GO:0005811)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|steroid dehydrogenase activity (GO:0016229)			cervix(1)|endometrium(4)|kidney(2)|lung(2)|ovary(2)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000339)		GTTTGGTGTGTTTTTTTTTTT	0.463													|||unknown(HR)	1911	0.381589	0.5038	0.304	5008	,	,		17304	0.374		0.3141	False		,,,				2504	0.3487																0								ENSG00000198189						16.0	22.0	20.0					4																	88312252		2130	4279	6409	HSD17B11	SO:0001623	5_prime_UTR_variant	0				HGNC	AF126780	CCDS3619.1	4q22.1	2011-09-20	2006-11-22	2006-11-22	ENSG00000198189	ENSG00000198189	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	22960	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 2"", ""short chain dehydrogenase/reductase family 16C, member 2"""	612831	"""dehydrogenase/reductase (SDR family) member 8"""	DHRS8		11165019, 12697717, 19027726	Standard	XM_006714232		Approved	RetSDR2, 17-BETA-HSD11, 17-BETA-HSDXI, PAN1B, SDR16C2	uc003hqp.2	Q8NBQ5	OTTHUMG00000130594	ENST00000358290.4:c.-30A>-	4.37:g.88312252delT		Somatic	0	52	0.00		0.5119144303430573	77	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	46	9.80	Q96HF6|Q9UKU4	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000358290.4	37	NULL	CCDS3619.1	4																																																																																			-	-		0.463	HSD17B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B11	protein_coding	OTTHUMT00000253041.1	T	NM_016245			88312252	-1	no_errors	ENST00000508413	ensembl	human	known	74_37	rna	DEL	0.000	-
CDK12	51755	genome.wustl.edu	37	17	37628001	37628001	+	Missense_Mutation	SNP	A	A	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr17:37628001A>T	ENST00000447079.4	+	2	1949	c.1916A>T	c.(1915-1917)gAt>gTt	p.D639V	CDK12_ENST00000430627.2_Missense_Mutation_p.D639V	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	639				D -> G (in Ref. 1; AAF36401). {ECO:0000305}.	mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						TTACCTGGAGATGATGACATG	0.418			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																														Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0								ENSG00000167258						99.0	95.0	96.0					17																	37628001		2203	4300	6503	CDK12	SO:0001583	missense	0			-	HGNC	AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.1916A>T	17.37:g.37628001A>T	ENSP00000398880:p.Asp639Val	Somatic	0	72	0.00		0.5119144303430573	29	9.38	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.D639V	ENST00000447079.4	37	c.1916	CCDS11337.1	17	.	.	.	.	.	.	.	.	.	.	A	13.94	2.387979	0.42308	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.69806	-0.43;-0.43	5.64	5.64	0.86602	.	0.391272	0.21938	N	0.066925	T	0.65533	0.2700	L	0.43923	1.385	0.80722	D	1	B;B;B	0.25441	0.077;0.077;0.126	B;B;B	0.34873	0.093;0.093;0.191	T	0.65294	-0.6203	10	0.66056	D	0.02	-2.6368	15.8566	0.78983	1.0:0.0:0.0:0.0	.	638;639;639	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	V	639	ENSP00000407720:D639V;ENSP00000398880:D639V	ENSP00000407720:D639V	D	+	2	0	CDK12	34881527	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.387000	0.73191	2.149000	0.67028	0.533000	0.62120	GAT	-	NULL		0.418	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK12	protein_coding	OTTHUMT00000256941.4	A	NM_016507	-		37628001	+1	no_errors	ENST00000447079	ensembl	human	known	74_37	missense	SNP	1.000	T
UNC13C	440279	genome.wustl.edu	37	15	54914551	54914551	+	Nonsense_Mutation	SNP	C	C	T			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr15:54914551C>T	ENST00000260323.11	+	30	6133	c.6133C>T	c.(6133-6135)Cag>Tag	p.Q2045*	UNC13C_ENST00000539562.2_5'UTR|UNC13C_ENST00000545554.1_Nonsense_Mutation_p.Q2045*|UNC13C_ENST00000537900.1_Nonsense_Mutation_p.Q2043*	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	2045					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGCCGTGGGTCAGATATCTGT	0.423																																																	0								ENSG00000137766						117.0	119.0	118.0					15																	54914551		1970	4162	6132	UNC13C	SO:0001587	stop_gained	0			-	HGNC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.6133C>T	15.37:g.54914551C>T	ENSP00000260323:p.Gln2045*	Somatic	0	27	0.00		0.5119144303430573	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09	Q0P613|Q8ND48|Q96NP3	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.Q2045*	ENST00000260323.11	37	c.6133	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	C	45	11.941422	0.99620	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	.	.	.	4.85	4.85	0.62838	.	0.063410	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	12.5997	0.56491	0.0:0.7168:0.2832:0.0	.	.	.	.	X	2045;2045;2043	.	ENSP00000260323:Q2045X	Q	+	1	0	UNC13C	52701843	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	6.948000	0.75965	2.390000	0.81377	0.585000	0.79938	CAG	-	superfamily_C2_dom		0.423	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	protein_coding	OTTHUMT00000419028.3	C	NM_173166	-		54914551	+1	no_errors	ENST00000260323	ensembl	human	known	74_37	nonsense	SNP	1.000	T
P2RY11	5032	genome.wustl.edu	37	19	10224654	10224654	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr19:10224654G>A	ENST00000321826.4	+	2	549	c.365G>A	c.(364-366)tGc>tAc	p.C122Y	PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.C542Y|PPAN-P2RY11_ENST00000428358.1_3'UTR|PPAN_ENST00000556468.1_Missense_Mutation_p.C542Y	NM_002566.4	NP_002557.2	Q96G91	P2Y11_HUMAN	purinergic receptor P2Y, G-protein coupled, 11	122					activation of adenylate cyclase activity (GO:0007190)|adenosine receptor signaling pathway (GO:0001973)|calcium-mediated signaling (GO:0019722)|cellular response to ATP (GO:0071318)|defense response (GO:0006952)|G-protein coupled receptor signaling pathway (GO:0007186)|neuronal signal transduction (GO:0023041)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP-activated nucleotide receptor activity (GO:0045031)|G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|neurotransmitter receptor activity (GO:0030594)|receptor activity (GO:0004872)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)	16			OV - Ovarian serous cystadenocarcinoma(20;3.53e-09)|Epithelial(33;4.91e-06)|all cancers(31;1.1e-05)			TTCATCACCTGCATCAGCCTC	0.667											OREG0025230	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000243207						81.0	71.0	74.0					19																	10224654		2203	4300	6503	PPAN-P2RY11	SO:0001583	missense	0			-	HGNC	AF030335	CCDS12226.1	19p13.2	2012-08-08			ENSG00000244165	ENSG00000244165		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8540	protein-coding gene	gene with protein product		602697				9405388	Standard	NM_002566		Approved	P2Y11		Q96G91	OTTHUMG00000150166	ENST00000321826.4:c.365G>A	19.37:g.10224654G>A	ENSP00000323872:p.Cys122Tyr	Somatic	0	20	0.00	663	0.5119144303430573	20	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	14	17.65	B2R8X9|O43190|Q9BYU4|Q9H170	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Brix,pfam_GPCR_Rhodpsn,superfamily_Anticodon-bd,smart_Brix,prints_GPCR_Rhodpsn,pfscan_Brix,pfscan_GPCR_Rhodpsn_7TM	p.C542Y	ENST00000321826.4	37	c.1625	CCDS12226.1	19	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850796	0.71719	.	.	ENSG00000243207;ENSG00000130810;ENSG00000244165	ENST00000393796;ENST00000556468;ENST00000321826	T;T;T	0.38240	1.15;1.15;1.15	4.62	2.42	0.29668	GPCR, rhodopsin-like superfamily (1);	0.147555	0.42964	U	0.000630	T	0.62913	0.2467	M	0.91038	3.17	0.40230	D	0.977835	D	0.89917	1.0	D	0.81914	0.995	T	0.66972	-0.5788	10	0.87932	D	0	-9.6129	8.8602	0.35253	0.0851:0.1509:0.764:0.0	.	122	Q96G91	P2Y11_HUMAN	Y	542;542;122	ENSP00000377385:C542Y;ENSP00000450710:C542Y;ENSP00000323872:C122Y	ENSP00000323872:C122Y	C	+	2	0	PPAN;P2RY11;PPAN-P2RY11	10085654	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	2.917000	0.48821	0.542000	0.28846	-0.258000	0.10820	TGC	-	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.667	P2RY11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAN-P2RY11	protein_coding	OTTHUMT00000316664.2	G	NM_002566	-		10224654	+1	no_errors	ENST00000393796	ensembl	human	known	74_37	missense	SNP	1.000	A
SCN4B	6330	genome.wustl.edu	37	11	118004511	118004511	+	3'UTR	SNP	A	A	G			TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr11:118004511A>G	ENST00000324727.4	-	0	4064				SCN4B_ENST00000423160.2_5'UTR	NM_001142349.1|NM_174934.3	NP_001135821.1|NP_777594.1	Q8IWT1	SCN4B_HUMAN	sodium channel, voltage-gated, type IV, beta subunit						AV node cell to bundle of His cell communication (GO:0086067)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|voltage-gated sodium channel complex (GO:0001518)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.33e-05)|Epithelial(105;0.00126)	Valproic Acid(DB00313)|Zonisamide(DB00909)	GCTGTCTGTGACACTGAGATG	0.512																																																	0								ENSG00000177098																																			SCN4B	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AY149967	CCDS8389.1, CCDS44744.1	11q23.3	2014-09-17	2012-02-28		ENSG00000177098	ENSG00000177098		"""Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10592	protein-coding gene	gene with protein product		608256	"""sodium channel, voltage-gated, type IV, beta"""				Standard	NM_174934		Approved	LQT10	uc001pse.3	Q8IWT1	OTTHUMG00000166994	ENST00000324727.4:c.*3231T>C	11.37:g.118004511A>G		Somatic	0	35	0.00		0.5119144303430573	51	1.92	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	6	40.00	E9PPT5|Q6PIG5	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000324727.4	37	NULL	CCDS8389.1	11																																																																																			-	-		0.512	SCN4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN4B	protein_coding	OTTHUMT00000392326.1	A		-		118004511	-1	no_errors	ENST00000423160	ensembl	human	known	74_37	rna	SNP	0.004	G
SLC25A3	5250	genome.wustl.edu	37	12	98989563	98989563	+	Intron	SNP	C	C	A	rs1063501		TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr12:98989563C>A	ENST00000228318.3	+	3	402				SLC25A3_ENST00000551917.1_Intron|SLC25A3_ENST00000548847.1_Silent_p.V72V|SLC25A3_ENST00000552981.1_Silent_p.V72V|SLC25A3_ENST00000401722.3_Silent_p.V72V|SLC25A3_ENST00000549338.1_Silent_p.V72V|SLC25A3_ENST00000547534.1_Silent_p.V72V|SLC25A3_ENST00000188376.5_Silent_p.V72V	NM_005888.3	NP_005879.1	Q00325	MPCP_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3						generation of precursor metabolites and energy (GO:0006091)|phosphate ion transmembrane transport (GO:0035435)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	phosphate ion carrier activity (GO:0015320)|protein complex binding (GO:0032403)|symporter activity (GO:0015293)			breast(1)|endometrium(2)|large_intestine(4)|lung(8)|prostate(1)	16		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		TTGGTGGGGTCTTAAGTTGTG	0.418																																																	0								ENSG00000075415						212.0	201.0	205.0					12																	98989563		2203	4300	6503	SLC25A3	SO:0001627	intron_variant	0			-	HGNC		CCDS9065.1, CCDS9066.1	12q23.1	2013-05-22			ENSG00000075415	ENSG00000075415		"""Solute carriers"""	10989	protein-coding gene	gene with protein product		600370		PHC		8168843	Standard	NM_213611		Approved		uc001tfo.3	Q00325	OTTHUMG00000170212	ENST00000228318.3:c.282+228C>A	12.37:g.98989563C>A		Somatic	0	72	0.00		0.5119144303430573	631	12.21	88	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	42	12.50	B3KS34|Q7Z7N7|Q96A03	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.V72	ENST00000228318.3	37	c.216	CCDS9066.1	12																																																																																			-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier		0.418	SLC25A3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A3	protein_coding	OTTHUMT00000407989.1	C	NM_005888	rs1063501		98989563	+1	no_errors	ENST00000188376	ensembl	human	known	74_37	silent	SNP	1.000	A
FBXO2	26232	genome.wustl.edu	37	1	11710779	11710780	+	In_Frame_Ins	INS	-	-	GCG	rs148874459|rs571719627|rs538764329	byFrequency	TCGA-K1-A6RU-01A-11D-A32I-09	TCGA-K1-A6RU-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4e02a96d-ef23-4b00-8641-d581b76ddd9b	03aec406-2c3f-495c-9c57-e8a624ff3317	g.chr1:11710779_11710780insGCG	ENST00000354287.4	-	2	475_476	c.134_135insCGC	c.(133-135)gcg>gcCGCg	p.45_45A>AA	FBXO2_ENST00000475961.1_5'Flank	NM_012168.5	NP_036300.2	Q9UK22	FBX2_HUMAN	F-box protein 2	45	F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.			Missing (in Ref. 1; AAF01822). {ECO:0000305}.	cellular protein modification process (GO:0006464)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of protein ubiquitination (GO:0031396)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|SCF ubiquitin ligase complex (GO:0019005)	beta-amyloid binding (GO:0001540)|carbohydrate binding (GO:0030246)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(1)|lung(4)	6	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		CGTCCAGGTACGCGGCGGCGGc	0.757																																																	0								ENSG00000116661																																			FBXO2	SO:0001652	inframe_insertion	0				HGNC	AF174594	CCDS130.1	1p36.21	2010-04-21	2004-06-15		ENSG00000116661	ENSG00000116661		"""F-boxes /  ""other"""""	13581	protein-coding gene	gene with protein product		607112	"""F-box only protein 2"", ""organ of Corti protein 1"""	OCP1		10531035, 10531037	Standard	NM_012168		Approved	FBX2, Nfb42, Fbs1, Fbg1	uc001asj.3	Q9UK22	OTTHUMG00000002072	ENST00000354287.4:c.132_134dupCGC	1.37:g.11710786_11710788dupGCG	ENSP00000346240:p.Ala45dup	Somatic	0	14	0.00		0.5119144303430573	28	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	10	23.08	B2R7K7|Q5TGY0|Q6FGJ7|Q8TB29|Q9UKC6	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_F-box-assoc_dom,pfam_F-box_dom,superfamily_Galactose-bd-like,superfamily_F-box_dom,pfscan_F-box_dom,pfscan_F-box-assoc_dom	p.46in_frame_insA	ENST00000354287.4	37	c.135_134	CCDS130.1	1																																																																																			-	superfamily_F-box_dom,pfscan_F-box_dom		0.757	FBXO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO2	protein_coding	OTTHUMT00000005764.1	-	NM_012168			11710780	-1	no_errors	ENST00000354287	ensembl	human	known	74_37	in_frame_ins	INS	0.915:0.821	GCG
