#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
DOCK2	1794	genome.wustl.edu	37	5	169469044	169469044	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr5:169469044G>A	ENST00000256935.8	+	38	3864	c.3784G>A	c.(3784-3786)Gtc>Atc	p.V1262I	DOCK2_ENST00000520908.1_Missense_Mutation_p.V754I|DOCK2_ENST00000540750.1_Missense_Mutation_p.V323I|DOCK2_ENST00000523351.1_3'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1262	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGCATCACAGGTCATGCAGAC	0.537																																																	0								ENSG00000134516						72.0	60.0	64.0					5																	169469044		2203	4300	6503	DOCK2	SO:0001583	missense	0			-	HGNC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3784G>A	5.37:g.169469044G>A	ENSP00000256935:p.Val1262Ile	Somatic	0	32	0.00		0.6553633802850016	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	9	35.71	Q2M3I0|Q96AK7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.V1262I	ENST00000256935.8	37	c.3784	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	15.99	2.995732	0.54147	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.67171	-0.25;-0.25;4.57	5.18	4.28	0.50868	.	0.068809	0.64402	D	0.000015	T	0.52565	0.1742	N	0.25201	0.72	0.29588	N	0.848612	B;B	0.34372	0.451;0.013	B;B	0.30179	0.112;0.014	T	0.56829	-0.7914	10	0.62326	D	0.03	.	15.6424	0.77016	0.0:0.1379:0.8621:0.0	.	754;1262	E7ERW7;Q92608	.;DOCK2_HUMAN	I	1262;754;323	ENSP00000256935:V1262I;ENSP00000429283:V754I;ENSP00000438827:V323I	ENSP00000256935:V1262I	V	+	1	0	DOCK2	169401622	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	4.170000	0.58229	1.249000	0.43950	0.561000	0.74099	GTC	-	NULL		0.537	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	protein_coding	OTTHUMT00000252828.2	G	NM_004946	-		169469044	+1	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	SNP	1.000	A
NUDT10	170685	genome.wustl.edu	37	X	51075934	51075934	+	Silent	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chrX:51075934C>T	ENST00000376006.3	+	2	337	c.117C>T	c.(115-117)agC>agT	p.S39S	NUDT10_ENST00000356450.2_Silent_p.S39S	NM_153183.2	NP_694853.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 10	0					ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	16	Ovarian(276;0.236)					TGAGTAGCAGCCGGTACCCGG	0.697																																					NSCLC(90;1817 2035 37909 38249)												0								ENSG00000122824						22.0	23.0	22.0					X																	51075934		2201	4298	6499	NUDT10	SO:0001819	synonymous_variant	0			-	HGNC	AF469196	CCDS35278.1	Xp11.22-p11.1	2014-05-20			ENSG00000122824	ENSG00000122824		"""Nudix motif containing"""	17621	protein-coding gene	gene with protein product		300527				12105228	Standard	NM_153183		Approved	DIPP3a, hDIPP3alpha	uc004dph.3	Q8NFP7	OTTHUMG00000021530	ENST00000376006.3:c.117C>T	X.37:g.51075934C>T		Somatic	0	153	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	110	29	78.57	Q8NBN1|Q8NCB9|Q8NG25	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.S39	ENST00000376006.3	37	c.117	CCDS35278.1	X																																																																																			-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like		0.697	NUDT10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NUDT10	protein_coding	OTTHUMT00000056578.1	C	NM_153183	-		51075934	+1	no_errors	ENST00000356450	ensembl	human	known	74_37	silent	SNP	0.980	T
OR2W5	441932	genome.wustl.edu	37	1	247654688	247654688	+	RNA	SNP	G	G	T	rs368780486		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:247654688G>T	ENST00000522351.1	+	0	319							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			GAACCTGGGGGGTCCAGAGAA	0.542																																																	0								ENSG00000203664						86.0	87.0	87.0					1																	247654688		2203	4300	6503	OR2W5			0			-	HGNC			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247654688G>T		Somatic	0	11	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	6	50.00	B9EH85	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000522351.1	37	NULL		1																																																																																			-	-		0.542	OR2W5-002	KNOWN	basic	processed_transcript	OR2W5	pseudogene	OTTHUMT00000375789.1	G	NM_001004698	-		247654688	+1	no_errors	ENST00000522351	ensembl	human	known	74_37	rna	SNP	0.568	T
AC114798.1	0	genome.wustl.edu	37	4	183747503	183747503	+	RNA	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr4:183747503C>T	ENST00000408259.1	+	0	123																											tcaaattttaccagatgtctt	0.388																																																	0								ENSG00000221186																																			AC114798.1			0			-	Clone_based_ensembl_gene																													4.37:g.183747503C>T		Somatic	0	138	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	33	77	30.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000408259.1	37	NULL		4																																																																																			-	-		0.388	AC114798.1-201	NOVEL	basic	miRNA	ENSG00000221186	miRNA		C		-		183747503	+1	no_errors	ENST00000408259	ensembl	human	novel	74_37	rna	SNP	0.000	T
RP1	6101	genome.wustl.edu	37	8	55537285	55537285	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr8:55537285G>T	ENST00000220676.1	+	4	991	c.843G>T	c.(841-843)gaG>gaT	p.E281D		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	281					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TTTCTTCTGAGAAAACACATA	0.313																																					Colon(91;1014 1389 7634 14542 40420)												0								ENSG00000104237						62.0	68.0	66.0					8																	55537285		2203	4297	6500	RP1	SO:0001583	missense	0			-	HGNC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.843G>T	8.37:g.55537285G>T	ENSP00000220676:p.Glu281Asp	Somatic	0	46	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.E281D	ENST00000220676.1	37	c.843	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	G	0.674	-0.800832	0.02841	.	.	ENSG00000104237	ENST00000220676	T	0.22134	1.97	5.19	1.27	0.21489	.	0.524252	0.18691	N	0.133880	T	0.07413	0.0187	N	0.10916	0.065	0.29599	N	0.847791	B	0.02656	0.0	B	0.04013	0.001	T	0.34650	-0.9820	10	0.08599	T	0.76	.	2.8389	0.05523	0.1275:0.2593:0.4262:0.187	.	281	P56715	RP1_HUMAN	D	281	ENSP00000220676:E281D	ENSP00000220676:E281D	E	+	3	2	RP1	55699838	0.891000	0.30450	0.994000	0.49952	0.979000	0.70002	-0.168000	0.09925	-0.043000	0.13513	-0.165000	0.13383	GAG	-	NULL		0.313	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	protein_coding	OTTHUMT00000378532.2	G	NM_006269	-		55537285	+1	no_errors	ENST00000220676	ensembl	human	known	74_37	missense	SNP	0.988	T
MCF2L	23263	genome.wustl.edu	37	13	113732739	113732739	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr13:113732739C>T	ENST00000375608.3	+	15	1871	c.1813C>T	c.(1813-1815)Cgg>Tgg	p.R605W	MCF2L_ENST00000421756.1_Missense_Mutation_p.R579W|MCF2L_ENST00000375604.2_Missense_Mutation_p.R632W|MCF2L_ENST00000397030.1_Missense_Mutation_p.R608W|MCF2L_ENST00000423482.2_Missense_Mutation_p.R573W|MCF2L_ENST00000442652.2_Missense_Mutation_p.R605W|MCF2L_ENST00000375601.3_Missense_Mutation_p.R579W|MCF2L_ENST00000375597.4_Missense_Mutation_p.R573W|MCF2L_ENST00000434480.2_Missense_Mutation_p.R581W|MCF2L_ENST00000535094.2_Missense_Mutation_p.R575W			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	605					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				AGGGCCCTACCGGAGGGCCAA	0.687																																																	0								ENSG00000126217						36.0	39.0	38.0					13																	113732739		2199	4299	6498	MCF2L	SO:0001583	missense	0			-	HGNC	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.1813C>T	13.37:g.113732739C>T	ENSP00000364758:p.Arg605Trp	Somatic	0	43	0.00		0.6553633802850016	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	56	20.00	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_Spectrin_repeat,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.R632W	ENST00000375608.3	37	c.1894		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.82|15.82	2.946502|2.946502	0.53186|0.53186	.|.	.|.	ENSG00000126217|ENSG00000126217	ENST00000397017|ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000423482;ENST00000375597;ENST00000440749	.|T;T;T;T;T;T;T;T;T;T	.|0.37752	.|1.23;1.23;1.18;1.23;1.19;1.25;1.19;1.23;1.19;1.25	4.06|4.06	-1.46|-1.46	0.08800|0.08800	.|.	.|0.232964	.|0.42294	.|D	.|0.000738	T|T	0.52869|0.52869	0.1761|0.1761	M|M	0.76002|0.76002	2.32|2.32	0.26738|0.26738	N|N	0.970443|0.970443	.|D;D;D;D;D;D	.|0.76494	.|0.998;0.998;0.999;0.998;0.999;0.998	.|D;D;D;P;D;D	.|0.69307	.|0.946;0.946;0.963;0.881;0.946;0.918	T|T	0.51996|0.51996	-0.8634|-0.8634	5|10	.|0.72032	.|D	.|0.01	.|.	11.4213|11.4213	0.49982|0.49982	0.4155:0.5845:0.0:0.0|0.4155:0.5845:0.0:0.0	.|.	.|573;575;632;537;573;605	.|E9PDN8;O15068-9;G5E9A1;E2QRA2;O15068-4;O15068	.|.;.;.;.;.;MCF2L_HUMAN	L|W	235|605;605;632;608;575;579;579;581;573;573;416	.|ENSP00000364758:R605W;ENSP00000401422:R605W;ENSP00000364754:R632W;ENSP00000380225:R608W;ENSP00000440374:R575W;ENSP00000397285:R579W;ENSP00000364751:R579W;ENSP00000407722:R581W;ENSP00000405639:R573W;ENSP00000364747:R573W	.|ENSP00000364747:R573W	P|R	+|+	2|1	0|2	MCF2L|MCF2L	112780740|112780740	0.995000|0.995000	0.38212|0.38212	0.987000|0.987000	0.45799|0.45799	0.649000|0.649000	0.38597|0.38597	0.179000|0.179000	0.16840|0.16840	-0.353000|-0.353000	0.08224|0.08224	0.561000|0.561000	0.74099|0.74099	CCG|CGG	-	NULL		0.687	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	protein_coding	OTTHUMT00000045849.4	C		-		113732739	+1	no_errors	ENST00000375604	ensembl	human	known	74_37	missense	SNP	0.997	T
NADK	65220	genome.wustl.edu	37	1	1684501	1684501	+	Splice_Site	SNP	T	T	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:1684501T>A	ENST00000341426.5	-	12	1406		c.e12-2		NADK_ENST00000378625.1_Splice_Site|NADK_ENST00000344463.4_Splice_Site|NADK_ENST00000342348.5_Splice_Site|NADK_ENST00000341991.3_Splice_Site	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase						ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		ATGCTGATGCTGGGACGGGAG	0.637																																																	0								ENSG00000008130						40.0	26.0	31.0					1																	1684501		2200	4298	6498	NADK	SO:0001630	splice_region_variant	0			-	HGNC	BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.1185-2A>T	1.37:g.1684501T>A		Somatic	0	79	0.00		0.6553633802850016	0	100.00	4	WXS	Illumina HiSeq 2500	Phase_IV	tier1	60	14	80.00	A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e13-2	ENST00000341426.5	37	c.1620-2	CCDS30565.1	1	.	.	.	.	.	.	.	.	.	.	t	12.25	1.881740	0.33255	.	.	ENSG00000008130	ENST00000341426;ENST00000341991;ENST00000378625;ENST00000344463;ENST00000342348	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9551	0.58424	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NADK	1674361	1.000000	0.71417	0.972000	0.41901	0.510000	0.34073	7.173000	0.77612	1.752000	0.51891	0.459000	0.35465	.	-	-		0.637	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	NADK	protein_coding	OTTHUMT00000002769.1	T	NM_023018	-	Intron	1684501	-1	no_errors	ENST00000344463	ensembl	human	known	74_37	splice_site	SNP	1.000	A
COL16A1	1307	genome.wustl.edu	37	1	32151243	32151243	+	Silent	SNP	T	T	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:32151243T>C	ENST00000373672.3	-	29	2529	c.2013A>G	c.(2011-2013)aaA>aaG	p.K671K	COL16A1_ENST00000271069.6_Silent_p.K670K|COL16A1_ENST00000373668.3_Silent_p.K671K	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	671	Collagen-like 3.|Triple-helical region 6 (COL6) with 1 imperfection.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		ACCTCACCTGTTTTCCTGGCA	0.642																																					Colon(143;498 1786 21362 25193 36625)												0								ENSG00000084636						85.0	93.0	90.0					1																	32151243		1875	4106	5981	COL16A1	SO:0001819	synonymous_variant	0			-	HGNC	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.2013A>G	1.37:g.32151243T>C		Somatic	0	125	0.00		0.6553633802850016	238	27.44	90	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	67	27.96	Q16593|Q59F89|Q71RG9	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.K670	ENST00000373672.3	37	c.2010	CCDS41297.1	1																																																																																			-	pfam_Collagen		0.642	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	protein_coding	OTTHUMT00000011057.2	T	NM_001856	-		32151243	-1	no_errors	ENST00000271069	ensembl	human	known	74_37	silent	SNP	0.987	C
TEKT2	27285	genome.wustl.edu	37	1	36553137	36553137	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:36553137T>A	ENST00000207457.3	+	8	1080	c.953T>A	c.(952-954)cTa>cAa	p.L318Q	ADPRHL2_ENST00000373178.4_5'Flank	NM_014466.2	NP_055281.2	Q9UIF3	TEKT2_HUMAN	tektin 2 (testicular)	318					cell projection organization (GO:0030030)|inner dynein arm assembly (GO:0036159)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|pancreas(1)|skin(2)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CATACCCGGCTAGAGGCCAGA	0.617																																																	0								ENSG00000092850						43.0	49.0	47.0					1																	36553137		2203	4300	6503	TEKT2	SO:0001583	missense	0			-	HGNC	AB033823	CCDS401.1	1p34.3	2008-02-05			ENSG00000092850	ENSG00000092850			11725	protein-coding gene	gene with protein product		608953				12029069, 11751288	Standard	NM_014466		Approved	TEKTB1	uc001bzr.3	Q9UIF3	OTTHUMG00000007629	ENST00000207457.3:c.953T>A	1.37:g.36553137T>A	ENSP00000207457:p.Leu318Gln	Somatic	0	72	0.00		0.6553633802850016	2	60.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	37	35	51.39	A6NIS6|O60638	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tektin,superfamily_Prefoldin,prints_Tektin	p.L318Q	ENST00000207457.3	37	c.953	CCDS401.1	1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.648015	0.87958	.	.	ENSG00000092850	ENST00000207457	T	0.07908	3.15	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000001	T	0.38719	0.1051	M	0.92367	3.3	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.50906	-0.8772	10	0.62326	D	0.03	.	15.4263	0.75055	0.0:0.0:0.0:1.0	.	318	Q9UIF3	TEKT2_HUMAN	Q	318	ENSP00000207457:L318Q	ENSP00000207457:L318Q	L	+	2	0	TEKT2	36325724	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.780000	0.68956	2.053000	0.61076	0.460000	0.39030	CTA	-	pfam_Tektin,superfamily_Prefoldin,prints_Tektin		0.617	TEKT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT2	protein_coding	OTTHUMT00000020200.1	T	NM_014466	-		36553137	+1	no_errors	ENST00000207457	ensembl	human	known	74_37	missense	SNP	1.000	A
AHNAK	79026	genome.wustl.edu	37	11	62284538	62284571	+	Frame_Shift_Del	DEL	CTGAATGAATTTGAGCGGTGCCGTGGCTTCTTAC	CTGAATGAATTTGAGCGGTGCCGTGGCTTCTTAC	-	rs370820574|rs190527959|rs183445252|rs377736920|rs200104251		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	CTGAATGAATTTGAGCGGTGCCGTGGCTTCTTAC	CTGAATGAATTTGAGCGGTGCCGTGGCTTCTTAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:62284538_62284571delCTGAATGAATTTGAGCGGTGCCGTGGCTTCTTAC	ENST00000378024.4	-	5	17592_17625	c.17318_17351delGTAAGAAGCCACGGCACCGCTCAAATTCATTCAG	c.(17317-17352)agtaagaagccacggcaccgctcaaattcattcagtfs	p.SKKPRHRSNSFS5773fs	AHNAK_ENST00000525875.1_5'UTR|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5773					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.P5776L(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TCTTTCATCACTGAATGAATTTGAGCGGTGCCGTGGCTTCTTACTTTTAAATAA	0.509																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000124942																																			AHNAK	SO:0001589	frameshift_variant	0				HGNC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17318_17351delGTAAGAAGCCACGGCACCGCTCAAATTCATTCAG	11.37:g.62284538_62284571delCTGAATGAATTTGAGCGGTGCCGTGGCTTCTTAC	ENSP00000367263:p.Ser5773fs	Somatic	NA	NA	NA		0.6553633802850016	678	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A1A586	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S5773fs	ENST00000378024.4	37	c.17351_17318	CCDS31584.1	11																																																																																			-	NULL		0.509	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	protein_coding	OTTHUMT00000395572.1	CTGAATGAATTTGAGCGGTGCCGTGGCTTCTTAC	NM_024060			62284571	-1	no_errors	ENST00000378024	ensembl	human	known	74_37	frame_shift_del	DEL	0.998:1.000:1.000:1.000:0.996:0.924:0.938:0.929:0.002:0.000:0.000:0.000:0.970:0.982:0.960:0.999:1.000:1.000:0.995:0.929:0.283:0.192:0.069:0.024:0.956:0.961:1.000:1.000:1.000:0.992:0.992:0.893:0.822:0.918	-
AHNAK	79026	genome.wustl.edu	37	11	62284533	62284534	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:62284533_62284534delCA	ENST00000378024.4	-	5	17629_17630	c.17355_17356delTG	c.(17353-17358)gatgaafs	p.D5785fs	AHNAK_ENST00000525875.1_5'UTR|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5785					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)	p.E5786K(1)		NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AACTCTCTTTCATCACTGAATG	0.51																																																	1	Substitution - Missense(1)	skin(1)						ENSG00000124942																																			AHNAK	SO:0001589	frameshift_variant	0				HGNC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.17355_17356delTG	11.37:g.62284533_62284534delCA	ENSP00000367263:p.Asp5785fs	Somatic	0	37	0.00		0.6553633802850016	690	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	15	37.50	A1A586	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D5785fs	ENST00000378024.4	37	c.17356_17355	CCDS31584.1	11																																																																																			-	NULL		0.510	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	protein_coding	OTTHUMT00000395572.1	CA	NM_024060			62284534	-1	no_errors	ENST00000378024	ensembl	human	known	74_37	frame_shift_del	DEL	0.975:0.440	-
ATAD1	84896	genome.wustl.edu	37	10	89536142	89536142	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr10:89536142G>T	ENST00000308448.7	-	6	1004	c.626C>A	c.(625-627)aCa>aAa	p.T209K	ATAD1_ENST00000328142.3_Missense_Mutation_p.T209K|ATAD1_ENST00000541004.1_Missense_Mutation_p.T209K|ATAD1_ENST00000400215.3_Missense_Mutation_p.T151K	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	209					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		CATCATGGCTGTAGCTTCATG	0.378																																																	0								ENSG00000138138						132.0	133.0	133.0					10																	89536142		2203	4300	6503	ATAD1	SO:0001583	missense	0			-	HGNC	AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.626C>A	10.37:g.89536142G>T	ENSP00000339017:p.Thr209Lys	Somatic	0	105	0.00		0.6553633802850016	5	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	12	20.00	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T209K	ENST00000308448.7	37	c.626	CCDS7386.1	10	.	.	.	.	.	.	.	.	.	.	G	31	5.074503	0.94000	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000400215;ENST00000541004	D;D;D;D	0.92647	-3.08;-3.08;-3.08;-3.08	5.23	5.23	0.72850	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.94594	0.8258	L	0.47716	1.5	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.93583	0.6914	9	.	.	.	-10.9222	19.1787	0.93614	0.0:0.0:1.0:0.0	.	151;209	B4E2J1;Q8NBU5	.;ATAD1_HUMAN	K	209;209;151;209	ENSP00000339017:T209K;ENSP00000339016:T209K;ENSP00000412968:T151K;ENSP00000445500:T209K	.	T	-	2	0	ATAD1	89526122	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.444000	0.97578	2.597000	0.87782	0.563000	0.77884	ACA	-	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.378	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD1	protein_coding	OTTHUMT00000049235.1	G	NM_032810	-		89536142	-1	no_errors	ENST00000308448	ensembl	human	known	74_37	missense	SNP	1.000	T
AP4B1	10717	genome.wustl.edu	37	1	114440214	114440218	+	Intron	DEL	CAAAA	CAAAA	-	rs376491508	byFrequency	TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	CAAAA	CAAAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:114440214_114440218delCAAAA	ENST00000369569.1	-	7	1583				AP4B1-AS1_ENST00000419536.1_RNA|AP4B1_ENST00000369567.1_Intron|AP4B1_ENST00000256658.4_Intron|AP4B1_ENST00000462591.1_5'UTR	NM_001253852.1	NP_001240781.1	Q9Y6B7	AP4B1_HUMAN	adaptor-related protein complex 4, beta 1 subunit						intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|trans-Golgi network (GO:0005802)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|prostate(3)	25	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.1e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		tcaagcaaagcaaaacaaaacaaaa	0.415														66	0.0131789	0.0098	0.0159	5008	,	,		21135	0.004		0.0209	False		,,,				2504	0.0174																0								ENSG00000134262																																			AP4B1	SO:0001627	intron_variant	0				HGNC	AF092094	CCDS865.1	1p13.2	2012-03-30			ENSG00000134262	ENSG00000134262			572	protein-coding gene	gene with protein product	"""beta 4 subunit of AP-4"""	607245	"""spastic paraplegia 47"""	SPG47		10066790	Standard	NM_006594		Approved	BETA-4	uc001eeb.3	Q9Y6B7	OTTHUMG00000011943	ENST00000369569.1:c.1302+243TTTTG>-	1.37:g.114440224_114440228delCAAAA		Somatic	NA	NA	NA		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B7Z4X3|Q59EJ4|Q96CL6	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000369569.1	37	NULL	CCDS865.1	1																																																																																			-	-		0.415	AP4B1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AP4B1	protein_coding	OTTHUMT00000033037.1	CAAAA	NM_006594			114440218	-1	no_errors	ENST00000462591	ensembl	human	known	74_37	rna	DEL	0.003:0.002:0.002:0.002:0.001	-
CD84	8832	genome.wustl.edu	37	1	160535413	160535413	+	Missense_Mutation	SNP	T	T	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:160535413T>C	ENST00000311224.4	-	2	235	c.169A>G	c.(169-171)Aaa>Gaa	p.K57E	CD84_ENST00000368048.3_Missense_Mutation_p.K57E|CD84_ENST00000368054.3_Missense_Mutation_p.K57E|RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000534968.1_Intron|CD84_ENST00000368047.3_5'UTR|CD84_ENST00000368051.3_Missense_Mutation_p.K57E	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	57	Ig-like V-type.				blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			ACAGATGTTTTAGAAGTCCAA	0.423																																																	0								ENSG00000066294						137.0	131.0	133.0					1																	160535413		2203	4300	6503	CD84	SO:0001583	missense	0			-	HGNC	AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.169A>G	1.37:g.160535413T>C	ENSP00000312367:p.Lys57Glu	Somatic	0	54	0.00		0.6553633802850016	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	55	20.29	B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Ig_sub,pfscan_Ig-like_dom	p.K57E	ENST00000311224.4	37	c.169	CCDS53396.1	1	.	.	.	.	.	.	.	.	.	.	T	10.12	1.264223	0.23136	.	.	ENSG00000066294	ENST00000368054;ENST00000368048;ENST00000311224;ENST00000368051;ENST00000360056;ENST00000368047	T;T;T;T;T;T	0.21191	2.02;2.02;2.02;2.02;2.02;2.02	5.11	-8.27	0.01017	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.462330	0.03383	N	0.200696	T	0.02888	0.0086	N	0.16790	0.44	0.09310	N	1	B;B;B;B;B;B	0.06786	0.0;0.001;0.001;0.001;0.001;0.001	B;B;B;B;B;B	0.06405	0.001;0.002;0.002;0.001;0.002;0.001	T	0.21518	-1.0243	10	0.17369	T	0.5	-5.772	8.7416	0.34560	0.0:0.4552:0.3566:0.1882	.	57;57;57;57;57;57	Q9UIB8-5;Q9UIB8-6;Q9UIB8-4;Q9UIB8;Q9UIB8-2;Q9UIB8-3	.;.;.;SLAF5_HUMAN;.;.	E	57	ENSP00000357033:K57E;ENSP00000357027:K57E;ENSP00000312367:K57E;ENSP00000357030:K57E;ENSP00000353163:K57E;ENSP00000357026:K57E	ENSP00000312367:K57E	K	-	1	0	CD84	158802037	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-0.878000	0.04192	-1.259000	0.02468	-1.505000	0.00955	AAA	-	smart_Ig_sub		0.423	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CD84	protein_coding	OTTHUMT00000059092.1	T	NM_003874	-		160535413	-1	no_errors	ENST00000311224	ensembl	human	novel	74_37	missense	SNP	0.000	C
MIP	4284	genome.wustl.edu	37	12	56848076	56848076	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr12:56848076T>A	ENST00000257979.4	-	1	350	c.322A>T	c.(322-324)Acc>Tcc	p.T108S	MIP_ENST00000555551.1_Intron	NM_012064.3	NP_036196.1	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	108					canalicular bile acid transport (GO:0015722)|lens development in camera-type eye (GO:0002088)|response to stimulus (GO:0050896)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)|water transport (GO:0006833)	gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intracellular canaliculus (GO:0046691)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|structural constituent of eye lens (GO:0005212)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			kidney(1)|large_intestine(2)|lung(8)|prostate(1)|skin(3)|urinary_tract(1)	16						GCAGGTGGGGTAACGCTATAC	0.592																																																	0								ENSG00000135517						57.0	63.0	61.0					12																	56848076		2203	4300	6503	MIP	SO:0001583	missense	0			-	HGNC		CCDS8919.1	12q13	2012-10-02				ENSG00000135517		"""Ion channels / Aquaporins"""	7103	protein-coding gene	gene with protein product	aquaporin 0	154050				1840563, 7536742	Standard	NM_012064		Approved	MP26, LIM1, AQP0	uc001slh.3	P30301		ENST00000257979.4:c.322A>T	12.37:g.56848076T>A	ENSP00000257979:p.Thr108Ser	Somatic	0	45	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	10	70.59	Q17R41	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	p.T108S	ENST00000257979.4	37	c.322	CCDS8919.1	12	.	.	.	.	.	.	.	.	.	.	T	25.6	4.657783	0.88154	.	.	ENSG00000135517	ENST00000257979	D	0.93247	-3.19	5.18	5.18	0.71444	Aquaporin-like (2);	0.000000	0.85682	D	0.000000	D	0.93449	0.7910	L	0.37561	1.115	0.58432	D	0.999998	P	0.43973	0.823	P	0.56127	0.792	D	0.93212	0.6601	10	0.44086	T	0.13	-23.6709	14.3185	0.66468	0.0:0.0:0.0:1.0	.	108	P30301	MIP_HUMAN	S	108	ENSP00000257979:T108S	ENSP00000257979:T108S	T	-	1	0	MIP	55134343	1.000000	0.71417	0.991000	0.47740	0.970000	0.65996	5.957000	0.70323	2.093000	0.63338	0.459000	0.35465	ACC	-	pfam_MIP,superfamily_Aquaporin-like,tigrfam_MIP		0.592	MIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIP	protein_coding	OTTHUMT00000409620.1	T	NM_012064	-		56848076	-1	no_errors	ENST00000257979	ensembl	human	known	74_37	missense	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	34401431	34401431	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:34401431G>T	ENST00000373381.4	-	4	818	c.642C>A	c.(640-642)caC>caA	p.H214Q		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	174	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGAGCACGGCGTGGCCCTCCA	0.627																																																	0								ENSG00000121904						94.0	86.0	89.0					1																	34401431		2203	4300	6503	CSMD2	SO:0001583	missense	0			-	HGNC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.642C>A	1.37:g.34401431G>T	ENSP00000362479:p.His214Gln	Somatic	0	35	0.00		0.6553633802850016	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.H214Q	ENST00000373381.4	37	c.642		1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.125183	0.37533	.	.	ENSG00000121904	ENST00000373381	T	0.61980	0.06	5.27	-2.42	0.06542	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000001	T	0.61825	0.2378	N	0.21324	0.655	0.80722	D	1	D;D	0.89917	0.96;1.0	P;D	0.97110	0.812;1.0	T	0.58177	-0.7682	10	0.39692	T	0.17	.	13.0233	0.58800	0.5393:0.0:0.4607:0.0	.	174;214	Q7Z408;E7EUA6	CSMD2_HUMAN;.	Q	214	ENSP00000362479:H214Q	ENSP00000241312:H174Q	H	-	3	2	CSMD2	34174018	0.129000	0.22400	0.960000	0.40013	0.699000	0.40488	-0.423000	0.07034	-0.510000	0.06523	-2.303000	0.00259	CAC	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.627	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	protein_coding		G	NM_052896	-		34401431	-1	no_errors	ENST00000373381	ensembl	human	known	74_37	missense	SNP	0.971	T
BLNK	29760	genome.wustl.edu	37	10	97951812	97951812	+	Nonsense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr10:97951812G>A	ENST00000224337.5	-	17	1429	c.1288C>T	c.(1288-1290)Caa>Taa	p.Q430*	BLNK_ENST00000427367.2_Nonsense_Mutation_p.Q395*|BLNK_ENST00000371176.2_Nonsense_Mutation_p.Q407*|BLNK_ENST00000413476.2_Nonsense_Mutation_p.Q378*	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	430	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		GGACTATGTTGATGATTCCTG	0.348																																																	0								ENSG00000095585						206.0	194.0	198.0					10																	97951812		2203	4300	6503	BLNK	SO:0001587	stop_gained	0			-	HGNC	AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.1288C>T	10.37:g.97951812G>A	ENSP00000224337:p.Gln430*	Somatic	0	105	0.00		0.6553633802850016	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	48	22.58	O75498|O75499|Q2MD49	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2	p.Q430*	ENST00000224337.5	37	c.1288	CCDS7446.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.657583	0.96734	.	.	ENSG00000095585	ENST00000224337;ENST00000371176;ENST00000427367;ENST00000413476;ENST00000537049;ENST00000393894	.	.	.	5.13	5.13	0.70059	.	0.133376	0.53938	D	0.000051	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-20.8264	17.72	0.88348	0.0:0.0:1.0:0.0	.	.	.	.	X	430;407;395;378;273;159	.	ENSP00000224337:Q430X	Q	-	1	0	BLNK	97941802	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.175000	0.71949	2.567000	0.86603	0.557000	0.71058	CAA	-	smart_SH2,pfscan_SH2		0.348	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLNK	protein_coding	OTTHUMT00000049593.1	G	NM_013314	-		97951812	-1	no_errors	ENST00000224337	ensembl	human	known	74_37	nonsense	SNP	1.000	A
ZZZ3	26009	genome.wustl.edu	37	1	78031815	78031815	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:78031815C>T	ENST00000370801.3	-	14	2993	c.2518G>A	c.(2518-2520)Gat>Aat	p.D840N	ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Missense_Mutation_p.D346N	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	840					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						GGAGGACAATCCTGGCAATGC	0.398																																																	0								ENSG00000036549						64.0	61.0	62.0					1																	78031815		2203	4300	6503	ZZZ3	SO:0001583	missense	0			-	HGNC	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.2518G>A	1.37:g.78031815C>T	ENSP00000359837:p.Asp840Asn	Somatic	0	109	0.00		0.6553633802850016	37	32.73	18	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	107	15.08	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.D840N	ENST00000370801.3	37	c.2518	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898318	0.72639	.	.	ENSG00000036549	ENST00000370801;ENST00000370798	D;D	0.91180	-2.8;-2.8	5.23	5.23	0.72850	Zinc finger, ZZ-type (4);	0.117136	0.56097	D	0.000035	D	0.92351	0.7573	L	0.42686	1.345	0.80722	D	1	P;D;D	0.89917	0.827;1.0;0.999	P;D;D	0.97110	0.526;1.0;0.964	D	0.90958	0.4810	10	0.37606	T	0.19	.	19.1896	0.93660	0.0:1.0:0.0:0.0	.	346;840;839	Q8IYH5-3;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	N	840;346	ENSP00000359837:D840N;ENSP00000359834:D346N	ENSP00000359834:D346N	D	-	1	0	ZZZ3	77804403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.879000	0.69690	2.606000	0.88127	0.655000	0.94253	GAT	-	pfam_Znf_ZZ,pfscan_Znf_ZZ		0.398	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	protein_coding	OTTHUMT00000026615.1	C	NM_015534	-		78031815	-1	no_errors	ENST00000370801	ensembl	human	known	74_37	missense	SNP	1.000	T
DHRS9	10170	genome.wustl.edu	37	2	169948327	169948327	+	Silent	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr2:169948327C>T	ENST00000327239.4	+	7	2104	c.600C>T	c.(598-600)caC>caT	p.H200H	DHRS9_ENST00000432060.2_Silent_p.H260H|DHRS9_ENST00000428522.1_Silent_p.H200H|DHRS9_ENST00000357546.2_Silent_p.H200H|DHRS9_ENST00000421653.1_Silent_p.H53H|DHRS9_ENST00000412271.1_Silent_p.H200H|DHRS9_ENST00000436483.2_Silent_p.H200H|DHRS9_ENST00000602501.1_Silent_p.H200H	NM_005771.4	NP_005762.2	Q9BPW9	DHRS9_HUMAN	dehydrogenase/reductase (SDR family) member 9	200					9-cis-retinoic acid biosynthetic process (GO:0042904)|androgen metabolic process (GO:0008209)|epithelial cell differentiation (GO:0030855)|progesterone metabolic process (GO:0042448)|retinol metabolic process (GO:0042572)	integral component of endoplasmic reticulum membrane (GO:0030176)	alcohol dehydrogenase (NAD) activity (GO:0004022)|racemase and epimerase activity (GO:0016854)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(1)|endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						TTGGTGTGCACGTCTCATGCA	0.393																																																	0								ENSG00000073737						99.0	97.0	98.0					2																	169948327		2203	4300	6503	DHRS9	SO:0001819	synonymous_variant	0			-	HGNC	AF067174	CCDS2231.1, CCDS74600.1	2q31.1	2011-09-14			ENSG00000073737	ENSG00000073737		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	16888	protein-coding gene	gene with protein product	"""NADP-dependent retinol dehydrogenase/reductase"", ""3-alpha hydroxysteroid dehydrogenase"", ""retinol dehydrogenase homolog"", ""short chain dehydrogenase/reductase family 9C, member 4"""	612131				11304534, 11294878, 19027726	Standard	NM_001142270		Approved	RDHL, 3alpha-HSD, RETSDR8, RDH15, SDR9C4	uc010zde.2	Q9BPW9	OTTHUMG00000132180	ENST00000327239.4:c.600C>T	2.37:g.169948327C>T		Somatic	0	100	0.00		0.6553633802850016	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	27	61.97	B7Z416|D3DPC1|Q5RKX1|Q9NRA9|Q9NRB0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.H260	ENST00000327239.4	37	c.780	CCDS2231.1	2																																																																																			-	prints_Glc/ribitol_DH		0.393	DHRS9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS9	protein_coding	OTTHUMT00000333612.3	C	NM_005771	-		169948327	+1	no_errors	ENST00000432060	ensembl	human	known	74_37	silent	SNP	0.767	T
TBC1D1	23216	genome.wustl.edu	37	4	38134403	38134403	+	Intron	SNP	T	T	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr4:38134403T>A	ENST00000261439.4	+	19	3487				TBC1D1_ENST00000407365.1_Intron|TBC1D1_ENST00000508802.1_Intron	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						AATAAATTTTTATGTCTTTAA	0.264																																																	0								ENSG00000065882																																			TBC1D1	SO:0001627	intron_variant	0			-	HGNC	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.3133-302T>A	4.37:g.38134403T>A		Somatic	0	107	0.00		0.6553633802850016	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	90	38.36	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000261439.4	37	NULL	CCDS33972.1	4																																																																																			-	-		0.264	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	protein_coding	OTTHUMT00000317443.2	T	NM_015173	-		38134403	+1	no_errors	ENST00000405444	ensembl	human	known	74_37	rna	SNP	0.000	A
ARHGAP27	201176	genome.wustl.edu	37	17	43481440	43481440	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr17:43481440C>A	ENST00000428638.1	-	7	1501	c.1502G>T	c.(1501-1503)gGg>gTg	p.G501V	ARHGAP27_ENST00000376922.2_Missense_Mutation_p.G160V|ARHGAP27_ENST00000532038.1_Missense_Mutation_p.G279V|ARHGAP27_ENST00000455881.1_Missense_Mutation_p.G160V|ARHGAP27_ENST00000532891.2_Missense_Mutation_p.G479V|ARHGAP27_ENST00000528384.1_Missense_Mutation_p.G133V|ARHGAP27_ENST00000582826.1_5'Flank|ARHGAP27_ENST00000442348.1_Missense_Mutation_p.G474V			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	501	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					ATGGAGCACCCCTGCCTTGTC	0.592																																																	0								ENSG00000159314						72.0	69.0	70.0					17																	43481440		2203	4300	6503	ARHGAP27	SO:0001583	missense	0			-	HGNC	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.1502G>T	17.37:g.43481440C>A	ENSP00000403323:p.Gly501Val	Somatic	0	29	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	18	30.77	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RhoGAP_dom,pfam_WW_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_dom,smart_WW_dom,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_dom,pfscan_RhoGAP_dom	p.G501V	ENST00000428638.1	37	c.1502		17	.	.	.	.	.	.	.	.	.	.	C	18.28	3.590304	0.66105	.	.	ENSG00000159314	ENST00000532038;ENST00000376922;ENST00000528384;ENST00000532891;ENST00000428638;ENST00000442348;ENST00000455881	D;D;D;D;D;D;D	0.99167	-5.51;-5.51;-5.51;-5.51;-5.51;-5.51;-5.51	5.45	5.45	0.79879	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.99396	0.9787	M	0.90759	3.145	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.98816	1.0745	10	0.87932	D	0	.	16.8198	0.85743	0.0:1.0:0.0:0.0	.	279;474;501	B7Z6T0;F8WBX1;Q6ZUM4	.;.;RHG27_HUMAN	V	279;160;133;479;501;474;160	ENSP00000432762:G279V;ENSP00000366121:G160V;ENSP00000431591:G133V;ENSP00000433942:G479V;ENSP00000403323:G501V;ENSP00000409330:G474V;ENSP00000408235:G160V	ENSP00000366121:G160V	G	-	2	0	ARHGAP27	40837223	0.999000	0.42202	0.989000	0.46669	0.301000	0.27625	5.943000	0.70211	2.837000	0.97791	0.591000	0.81541	GGG	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.592	ARHGAP27-202	KNOWN	basic	protein_coding	ARHGAP27	protein_coding		C	NM_199282	-		43481440	-1	no_errors	ENST00000428638	ensembl	human	known	74_37	missense	SNP	0.998	A
LCP2	3937	genome.wustl.edu	37	5	169689718	169689718	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr5:169689718G>T	ENST00000046794.5	-	13	1462	c.847C>A	c.(847-849)Caa>Aaa	p.Q283K	LCP2_ENST00000521416.1_Missense_Mutation_p.Q78K	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	283					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)		p.Q283*(2)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		GGAGGCTTTTGAATCTTGGGT	0.502																																																	2	Substitution - Nonsense(2)	cervix(2)						ENSG00000043462						87.0	86.0	86.0					5																	169689718		1934	4144	6078	LCP2	SO:0001583	missense	0			-	HGNC		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.847C>A	5.37:g.169689718G>T	ENSP00000046794:p.Gln283Lys	Somatic	0	86	0.00		0.6553633802850016	16	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	45	8.16	A8KA25|Q53XV4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,smart_SH2,pfscan_SH2	p.Q283K	ENST00000046794.5	37	c.847	CCDS47339.1	5	.	.	.	.	.	.	.	.	.	.	G	0.492	-0.874707	0.02550	.	.	ENSG00000043462	ENST00000046794;ENST00000521416;ENST00000520344	T;T	0.44482	0.92;0.95	5.65	4.75	0.60458	.	0.571382	0.18013	N	0.154485	T	0.38374	0.1038	L	0.56769	1.78	0.26800	N	0.96922	B;B;B	0.32717	0.381;0.381;0.258	B;B;B	0.32624	0.103;0.149;0.07	T	0.27434	-1.0074	9	.	.	.	-2.4478	9.7824	0.40656	0.0991:0.0:0.9009:0.0	.	78;283;283	E7ESF6;A8KA25;Q13094	.;.;LCP2_HUMAN	K	283;78;50	ENSP00000046794:Q283K;ENSP00000428871:Q78K	.	Q	-	1	0	LCP2	169622296	0.714000	0.27936	0.264000	0.24511	0.222000	0.24845	3.796000	0.55507	1.320000	0.45209	0.655000	0.94253	CAA	-	NULL		0.502	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP2	protein_coding	OTTHUMT00000371727.1	G	NM_005565	-		169689718	-1	no_errors	ENST00000046794	ensembl	human	known	74_37	missense	SNP	0.811	T
TMEM2	23670	genome.wustl.edu	37	9	74365130	74365130	+	Silent	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr9:74365130G>T	ENST00000377044.4	-	2	699	c.160C>A	c.(160-162)Cga>Aga	p.R54R	TMEM2_ENST00000377066.5_Silent_p.R54R	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	54					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		CGGTCTTCTCGTCTGATGGAG	0.478																																																	0								ENSG00000135048						136.0	128.0	131.0					9																	74365130		2203	4300	6503	TMEM2	SO:0001819	synonymous_variant	0			-	HGNC		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.160C>A	9.37:g.74365130G>T		Somatic	0	108	0.00		0.6553633802850016	9	10.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	72	24.21	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.R54	ENST00000377044.4	37	c.160	CCDS6638.1	9																																																																																			-	NULL		0.478	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM2	protein_coding	OTTHUMT00000052618.2	G	NM_013390	-		74365130	-1	no_errors	ENST00000377044	ensembl	human	known	74_37	silent	SNP	1.000	T
INTS5	80789	genome.wustl.edu	37	11	62416816	62416816	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:62416816C>A	ENST00000330574.2	-	2	788	c.736G>T	c.(736-738)Ggc>Tgc	p.G246C	GANAB_ENST00000356638.3_5'Flank|GANAB_ENST00000540933.1_5'Flank|GANAB_ENST00000346178.4_5'Flank|GANAB_ENST00000534779.1_5'Flank	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	246					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						TCCTTAAGGCCACAGGAGAGA	0.547																																																	0								ENSG00000185085						92.0	87.0	89.0					11																	62416816		2202	4299	6501	INTS5	SO:0001583	missense	0			-	HGNC	AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.736G>T	11.37:g.62416816C>A	ENSP00000327889:p.Gly246Cys	Somatic	0	100	0.00		0.6553633802850016	5	68.75	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	56	42.27	Q8N6W5|Q9C0G5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G246C	ENST00000330574.2	37	c.736	CCDS8027.1	11	.	.	.	.	.	.	.	.	.	.	C	21.3	4.125638	0.77436	.	.	ENSG00000185085	ENST00000330574	.	.	.	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	T	0.77565	0.4149	M	0.72894	2.215	0.58432	D	0.999996	D	0.89917	1.0	D	0.97110	1.0	T	0.80549	-0.1333	9	0.87932	D	0	.	14.8911	0.70609	0.0:1.0:0.0:0.0	.	246	Q6P9B9	INT5_HUMAN	C	246	.	ENSP00000327889:G246C	G	-	1	0	INTS5	62173392	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.208000	0.77907	2.378000	0.81104	0.650000	0.86243	GGC	-	NULL		0.547	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS5	protein_coding	OTTHUMT00000395327.1	C	NM_030628	-		62416816	-1	no_errors	ENST00000330574	ensembl	human	known	74_37	missense	SNP	1.000	A
LRP5	4041	genome.wustl.edu	37	11	68204446	68204446	+	Missense_Mutation	SNP	G	G	T	rs146404570	byFrequency	TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:68204446G>T	ENST00000294304.7	+	19	4196	c.4090G>T	c.(4090-4092)Ggc>Tgc	p.G1364C		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1364	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTGTATCGACGGCTCCGACGA	0.632																																																	0								ENSG00000162337						152.0	112.0	126.0					11																	68204446		2200	4294	6494	LRP5	SO:0001583	missense	0			-	HGNC	AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4090G>T	11.37:g.68204446G>T	ENSP00000294304:p.Gly1364Cys	Somatic	0	38	0.00		0.6553633802850016	24	53.57	30	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	19	58.70	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.G1364C	ENST00000294304.7	37	c.4090	CCDS8181.1	11	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850786	0.71719	.	.	ENSG00000162337	ENST00000294304	D	0.96716	-4.1	4.37	4.37	0.52481	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.121825	0.35708	U	0.003039	D	0.98343	0.9450	H	0.95679	3.705	0.46078	D	0.998852	D;D	0.69078	0.997;0.997	D;D	0.66084	0.941;0.941	D	0.98602	1.0659	10	0.87932	D	0	.	11.1199	0.48284	0.0849:0.0:0.9151:0.0	.	1364;1364	Q9UES7;O75197	.;LRP5_HUMAN	C	1364	ENSP00000294304:G1364C	ENSP00000294304:G1364C	G	+	1	0	LRP5	67961022	0.999000	0.42202	0.966000	0.40874	0.991000	0.79684	3.007000	0.49536	2.453000	0.82957	0.638000	0.83543	GGC	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt		0.632	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5	protein_coding	OTTHUMT00000395088.1	G	NM_002335	-		68204446	+1	no_errors	ENST00000294304	ensembl	human	known	74_37	missense	SNP	0.993	T
LRRC30	339291	genome.wustl.edu	37	18	7231877	7231877	+	Silent	SNP	C	C	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr18:7231877C>A	ENST00000383467.2	+	1	755	c.741C>A	c.(739-741)ctC>ctA	p.L247L		NM_001105581.1	NP_001099051.1	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	247										central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						TCCAGACCCTCCCGAGCGAAC	0.562																																																	0								ENSG00000206422						72.0	76.0	75.0					18																	7231877		2038	4199	6237	LRRC30	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42409.1	18p11.23	2005-01-06				ENSG00000206422			30219	protein-coding gene	gene with protein product							Standard	NM_001105581		Approved		uc010wzk.2	A6NM36		ENST00000383467.2:c.741C>A	18.37:g.7231877C>A		Somatic	0	49	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	33	10.81		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L247	ENST00000383467.2	37	c.741	CCDS42409.1	18																																																																																			-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp		0.562	LRRC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC30	protein_coding	OTTHUMT00000442140.1	C	XM_292678	-		7231877	+1	no_errors	ENST00000383467	ensembl	human	known	74_37	silent	SNP	0.196	A
COPS4	51138	genome.wustl.edu	37	4	83987617	83987617	+	Missense_Mutation	SNP	A	A	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr4:83987617A>T	ENST00000264389.2	+	8	1048	c.913A>T	c.(913-915)Att>Ttt	p.I305F	COPS4_ENST00000511653.1_Missense_Mutation_p.I305F|COPS4_ENST00000503682.1_Missense_Mutation_p.I337F|COPS4_ENST00000509093.1_Missense_Mutation_p.I305F	NM_016129.2	NP_057213.2	Q9BT78	CSN4_HUMAN	COP9 signalosome subunit 4	305	PCI.				cullin deneddylation (GO:0010388)|protein deneddylation (GO:0000338)	cell junction (GO:0030054)|COP9 signalosome (GO:0008180)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(4)|urinary_tract(2)	13		Hepatocellular(203;0.114)				CAGAGCTGTTATTGAACACAA	0.328																																																	0								ENSG00000138663						89.0	94.0	92.0					4																	83987617		2203	4296	6499	COPS4	SO:0001583	missense	0			-	HGNC	AF100757	CCDS3600.1, CCDS58909.1	4q21.22	2013-03-14	2013-03-14		ENSG00000138663	ENSG00000138663			16702	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 4"", ""COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)"""			9707402	Standard	NM_016129		Approved	CSN4	uc003hoa.3	Q9BT78	OTTHUMG00000130298	ENST00000264389.2:c.913A>T	4.37:g.83987617A>T	ENSP00000264389:p.Ile305Phe	Somatic	0	108	0.00		0.6553633802850016	157	15.59	29	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	103	15.57	B3KN88|B3KST5|Q561W7|Q9NW31|Q9Y677	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PCI_dom,smart_PCI_dom	p.I305F	ENST00000264389.2	37	c.913	CCDS3600.1	4	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237480	0.58886	.	.	ENSG00000138663	ENST00000509093;ENST00000264389;ENST00000509317;ENST00000503682;ENST00000511653	T;T;T;T;T	0.34072	1.38;1.38;1.38;1.38;1.38	5.23	5.23	0.72850	Winged helix-turn-helix transcription repressor DNA-binding (1);Proteasome component (PCI) domain (2);	0.000000	0.85682	D	0.000000	T	0.38295	0.1035	L	0.47078	1.49	0.80722	D	1	B;B;B;B	0.24675	0.007;0.044;0.012;0.109	B;B;B;B	0.33568	0.016;0.037;0.011;0.166	T	0.22661	-1.0210	10	0.46703	T	0.11	-11.2314	15.2853	0.73822	1.0:0.0:0.0:0.0	.	305;337;305;305	B3KST5;D6RFN0;D6RAX7;Q9BT78	.;.;.;CSN4_HUMAN	F	305;305;193;337;305	ENSP00000425976:I305F;ENSP00000264389:I305F;ENSP00000425486:I193F;ENSP00000424791:I337F;ENSP00000424655:I305F	ENSP00000264389:I305F	I	+	1	0	COPS4	84206641	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.797000	0.91882	2.201000	0.70794	0.533000	0.62120	ATT	-	pfam_PCI_dom,smart_PCI_dom		0.328	COPS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS4	protein_coding	OTTHUMT00000252643.1	A		-		83987617	+1	no_errors	ENST00000264389	ensembl	human	known	74_37	missense	SNP	1.000	T
COL4A1	1282	genome.wustl.edu	37	13	110828798	110828798	+	Nonsense_Mutation	SNP	C	C	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr13:110828798C>A	ENST00000375820.4	-	36	3152	c.3031G>T	c.(3031-3033)Gga>Tga	p.G1011*		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1011	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCAACAGATCCTTTTGGTCCC	0.483																																																	0								ENSG00000187498						95.0	82.0	86.0					13																	110828798		2203	4300	6503	COL4A1	SO:0001587	stop_gained	0			-	HGNC	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.3031G>T	13.37:g.110828798C>A	ENSP00000364979:p.Gly1011*	Somatic	0	50	0.00		0.6553633802850016	169	0.59	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	48	35.14	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G1011*	ENST00000375820.4	37	c.3031	CCDS9511.1	13	.	.	.	.	.	.	.	.	.	.	C	40	8.181571	0.98693	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	.	.	.	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.2422	0.98381	0.0:1.0:0.0:0.0	.	.	.	.	X	654;1011;660	.	ENSP00000364973:G654X	G	-	1	0	COL4A1	109626799	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	7.175000	0.77632	2.782000	0.95742	0.655000	0.94253	GGA	-	pfam_Collagen		0.483	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	protein_coding	OTTHUMT00000045759.3	C		-		110828798	-1	no_errors	ENST00000375820	ensembl	human	known	74_37	nonsense	SNP	1.000	A
PZP	5858	genome.wustl.edu	37	12	9312564	9312564	+	Missense_Mutation	SNP	T	T	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr12:9312564T>C	ENST00000261336.2	-	25	3135	c.3107A>G	c.(3106-3108)gAa>gGa	p.E1036G	PZP_ENST00000381997.2_Missense_Mutation_p.E822G|PZP_ENST00000539983.1_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1036					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GCCATATCGTTCCCCAAAGGT	0.418																																					Melanoma(125;1402 1695 4685 34487 38571)												0								ENSG00000126838						190.0	183.0	185.0					12																	9312564		2203	4300	6503	PZP	SO:0001583	missense	0			-	HGNC	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3107A>G	12.37:g.9312564T>C	ENSP00000261336:p.Glu1036Gly	Somatic	0	97	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	26	29.73	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.E1036G	ENST00000261336.2	37	c.3107	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	T	8.576	0.881142	0.17467	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.35973	1.28;1.28	4.44	4.44	0.53790	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	1.044110	0.07605	U	0.924377	T	0.45316	0.1336	M	0.69358	2.11	0.09310	N	1	P;P	0.45768	0.628;0.866	B;P	0.48873	0.236;0.593	T	0.38067	-0.9678	10	0.54805	T	0.06	.	5.6887	0.17817	0.0:0.0922:0.2975:0.6102	.	822;1036	P20742-2;P20742	.;PZP_HUMAN	G	1036;822	ENSP00000261336:E1036G;ENSP00000371427:E822G	ENSP00000261336:E1036G	E	-	2	0	PZP	9203831	0.000000	0.05858	0.307000	0.25127	0.118000	0.20060	0.199000	0.17237	1.938000	0.56188	0.460000	0.39030	GAA	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase		0.418	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	protein_coding	OTTHUMT00000337624.1	T	NM_002864	-		9312564	-1	no_errors	ENST00000261336	ensembl	human	known	74_37	missense	SNP	0.010	C
PGM1	5236	genome.wustl.edu	37	1	64117302	64117302	+	Intron	SNP	A	A	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:64117302A>C	ENST00000371084.3	+	9	1493				PGM1_ENST00000483707.1_3'UTR|PGM1_ENST00000540265.1_Intron|PGM1_ENST00000371083.4_Intron	NM_002633.2	NP_002624.2	P36871	PGM1_HUMAN	phosphoglucomutase 1						carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20						TGTGATCTGCAGTCAGCCCGT	0.483																																																	0								ENSG00000079739						62.0	60.0	61.0					1																	64117302		2203	4300	6503	PGM1	SO:0001627	intron_variant	0			-	HGNC	BC019920	CCDS625.1, CCDS53323.1, CCDS53324.1	1p22.1	2012-10-02			ENSG00000079739	ENSG00000079739	5.4.2.2		8905	protein-coding gene	gene with protein product		171900				4517931, 1530890	Standard	NM_002633		Approved		uc010ooz.2	P36871	OTTHUMG00000008968	ENST00000371084.3:c.1281-38A>C	1.37:g.64117302A>C		Somatic	0	76	0.00		0.6553633802850016	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	10	82.46	B2R5N9|B4DPV0|Q16105|Q16106|Q5BKZ9|Q6NW22|Q86U74|Q96J40|Q9NTY4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371084.3	37	NULL	CCDS625.1	1																																																																																			-	-		0.483	PGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM1	protein_coding	OTTHUMT00000024868.1	A	NM_002633	-		64117302	+1	no_errors	ENST00000483707	ensembl	human	known	74_37	rna	SNP	0.000	C
DDX60	55601	genome.wustl.edu	37	4	169196590	169196590	+	Missense_Mutation	SNP	C	C	T	rs574811561		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr4:169196590C>T	ENST00000393743.3	-	16	2501	c.2210G>A	c.(2209-2211)cGg>cAg	p.R737Q		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	737					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)	p.R737Q(2)		breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CAGTTGGAACCGAGCTGGCCC	0.393													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15607	0.0		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	endometrium(2)						ENSG00000137628						101.0	98.0	99.0					4																	169196590		2203	4300	6503	DDX60	SO:0001583	missense	0			-	HGNC	AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.2210G>A	4.37:g.169196590C>T	ENSP00000377344:p.Arg737Gln	Somatic	0	104	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	49	30.99	Q6PK35|Q9NVE3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R737Q	ENST00000393743.3	37	c.2210	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717358	0.68844	.	.	ENSG00000137628	ENST00000393743	T	0.18174	2.23	5.37	3.65	0.41850	.	0.102711	0.43110	N	0.000614	T	0.28665	0.0710	L	0.32530	0.975	0.29601	N	0.847719	D	0.89917	1.0	D	0.87578	0.998	T	0.06303	-1.0834	10	0.40728	T	0.16	.	12.3977	0.55395	0.0:0.8661:0.0:0.1339	.	737	Q8IY21	DDX60_HUMAN	Q	737	ENSP00000377344:R737Q	ENSP00000377344:R737Q	R	-	2	0	DDX60	169433165	0.980000	0.34600	0.431000	0.26735	0.718000	0.41266	2.491000	0.45303	0.748000	0.32831	0.563000	0.77884	CGG	-	NULL		0.393	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	protein_coding	OTTHUMT00000364622.1	C	NM_017631	-		169196590	-1	no_errors	ENST00000393743	ensembl	human	known	74_37	missense	SNP	0.978	T
TULP4	56995	genome.wustl.edu	37	6	158915857	158915857	+	Silent	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr6:158915857C>T	ENST00000367097.3	+	11	3206	c.1849C>T	c.(1849-1851)Ctg>Ttg	p.L617L	TULP4_ENST00000367094.2_Silent_p.L617L	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	617					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GGCTGCTTTCCTGCCAACCAA	0.438																																																	0								ENSG00000130338						131.0	118.0	123.0					6																	158915857		2203	4300	6503	TULP4	SO:0001819	synonymous_variant	0			-	HGNC		CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.1849C>T	6.37:g.158915857C>T		Somatic	0	47	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	13	38.10	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L617	ENST00000367097.3	37	c.1849	CCDS34561.1	6																																																																																			-	superfamily_Tubby_C-like		0.438	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	protein_coding	OTTHUMT00000042869.1	C	NM_020245	-		158915857	+1	no_errors	ENST00000367097	ensembl	human	known	74_37	silent	SNP	1.000	T
LEPREL2	10536	genome.wustl.edu	37	12	6943091	6943091	+	RNA	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr12:6943091G>T	ENST00000538102.1	+	0	486				LEPREL2_ENST00000251761.8_RNA|LEPREL2_ENST00000396725.2_RNA|LEPREL2_ENST00000606935.1_RNA			Q8IVL6	P3H3_HUMAN	leprecan-like 2						extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)	endoplasmic reticulum lumen (GO:0005788)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			breast(1)|cervix(1)|endometrium(2)|lung(6)	10					L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	CCTGGCAGATGTCCTTCTCCT	0.637																																																	0								ENSG00000110811						92.0	98.0	96.0					12																	6943091		2017	4181	6198	LEPREL2			0			-	HGNC	U47926	CCDS61027.1	12p13.31	2014-03-25			ENSG00000110811	ENSG00000110811			19318	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 3"""	610342				15063763	Standard	NM_014262		Approved	GRCB, HSU47926, P3H3		Q8IVL6	OTTHUMG00000168516		12.37:g.6943091G>T		Somatic	0	40	0.00		0.6553633802850016	777	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	44	8.33	Q13512|Q15740|Q66K32|Q6NX61|Q7L2T1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Pro_4_hyd_alph	p.V445F	ENST00000538102.1	37	c.1333		12	.	.	.	.	.	.	.	.	.	.	G	2.410	-0.335633	0.05278	.	.	ENSG00000110811	ENST00000396725;ENST00000290510	T;T	0.70749	-0.51;-0.51	4.68	3.76	0.43208	.	0.739273	0.13243	N	0.402705	T	0.56863	0.2014	.	.	.	0.09310	N	1	P	0.38642	0.641	B	0.36030	0.216	T	0.54977	-0.8212	9	0.87932	D	0	-11.7488	5.6462	0.17590	0.0804:0.1932:0.6001:0.1262	.	446	Q8IVL6	P3H3_HUMAN	F	445;261	ENSP00000379951:V445F;ENSP00000290510:V261F	ENSP00000290510:V261F	V	+	1	0	LEPREL2	6813352	0.981000	0.34729	0.995000	0.50966	0.151000	0.21798	1.481000	0.35476	2.435000	0.82474	0.556000	0.70494	GTC	-	NULL		0.637	LEPREL2-006	KNOWN	basic	processed_transcript	LEPREL2	polymorphic_pseudogene	OTTHUMT00000399998.1	G	NM_014262	-		6943091	+1	no_errors	ENST00000396725	ensembl	human	known	74_37	missense	SNP	0.003	T
GZF1	64412	genome.wustl.edu	37	20	23345161	23345161	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr20:23345161G>A	ENST00000338121.5	+	2	218	c.141G>A	c.(139-141)atG>atA	p.M47I	GZF1_ENST00000542987.1_Intron|GZF1_ENST00000377051.2_Missense_Mutation_p.M47I|GZF1_ENST00000544236.1_Intron			Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	47	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				branching involved in ureteric bud morphogenesis (GO:0001658)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)|sequence-specific DNA binding (GO:0043565)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(7)|prostate(1)|urinary_tract(2)	24	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					AAGACTTCATGGCCCACAAGG	0.488																																																	0								ENSG00000125812						84.0	78.0	80.0					20																	23345161		2203	4300	6503	GZF1	SO:0001583	missense	0			-	HGNC	AK025447	CCDS13151.1	20p11.21	2013-01-09	2006-09-19	2006-09-19	ENSG00000125812	ENSG00000125812		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	15808	protein-coding gene	gene with protein product		613842	"""zinc finger protein 336"""	ZNF336		14522971, 16049025	Standard	NM_022482		Approved	dJ322G13.2, ZBTB23	uc002wsz.3	Q9H116	OTTHUMG00000032069	ENST00000338121.5:c.141G>A	20.37:g.23345161G>A	ENSP00000338290:p.Met47Ile	Somatic	0	65	0.00		0.6553633802850016	5	16.67	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	24	53.85	A8K199|B2RBC3|B3KPL4|B4DF58|D3DW39|Q54A22|Q96N08|Q9BQK9|Q9H117|Q9H6W6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.M47I	ENST00000338121.5	37	c.141	CCDS13151.1	20	.	.	.	.	.	.	.	.	.	.	G	5.667	0.307639	0.10733	.	.	ENSG00000125812	ENST00000338121;ENST00000424216;ENST00000377051	T;T	0.66995	-0.24;-0.24	5.33	4.37	0.52481	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.241738	0.35646	N	0.003062	T	0.52240	0.1722	L	0.32530	0.975	0.80722	D	1	B	0.24483	0.104	B	0.21917	0.037	T	0.50890	-0.8774	10	0.38643	T	0.18	.	9.229	0.37425	0.0784:0.1437:0.7779:0.0	.	47	Q9H116	GZF1_HUMAN	I	47	ENSP00000338290:M47I;ENSP00000366250:M47I	ENSP00000338290:M47I	M	+	3	0	GZF1	23293161	1.000000	0.71417	1.000000	0.80357	0.162000	0.22319	0.680000	0.25306	2.517000	0.84864	0.650000	0.86243	ATG	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like		0.488	GZF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GZF1	protein_coding	OTTHUMT00000078333.1	G	NM_022482	-		23345161	+1	no_errors	ENST00000338121	ensembl	human	known	74_37	missense	SNP	0.979	A
EMC2	9694	genome.wustl.edu	37	8	109489027	109489027	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr8:109489027G>T	ENST00000220853.3	+	9	643	c.608G>T	c.(607-609)gGt>gTt	p.G203V	EMC2_ENST00000520294.1_3'UTR	NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	203						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											TATACCCAAGGTGGACTTGAA	0.343																																																	0								ENSG00000104412						110.0	110.0	110.0					8																	109489027		2203	4300	6503	EMC2	SO:0001583	missense	0			-	HGNC	BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.608G>T	8.37:g.109489027G>T	ENSP00000220853:p.Gly203Val	Somatic	0	61	0.00		0.6553633802850016	99	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30	Q8WUE1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G203V	ENST00000220853.3	37	c.608	CCDS6309.1	8	.	.	.	.	.	.	.	.	.	.	G	16.29	3.081779	0.55861	.	.	ENSG00000104412	ENST00000220853	D	0.81908	-1.55	6.06	6.06	0.98353	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.90974	0.7162	M	0.88241	2.94	0.80722	D	1	P	0.51240	0.943	P	0.52823	0.71	D	0.91462	0.5190	10	0.66056	D	0.02	-13.1943	20.6397	0.99537	0.0:0.0:1.0:0.0	.	203	Q15006	TTC35_HUMAN	V	203	ENSP00000220853:G203V	ENSP00000220853:G203V	G	+	2	0	TTC35	109558203	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	9.216000	0.95154	2.880000	0.98712	0.650000	0.86243	GGT	-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.343	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC2	protein_coding	OTTHUMT00000380717.1	G	NM_014673	-		109489027	+1	no_errors	ENST00000220853	ensembl	human	known	74_37	missense	SNP	1.000	T
ZNF277	11179	genome.wustl.edu	37	7	111846832	111846832	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr7:111846832T>A	ENST00000361822.3	+	1	190	c.61T>A	c.(61-63)Tgc>Agc	p.C21S	DOCK4_ENST00000437633.1_5'Flank|ZNF277_ENST00000450657.1_Missense_Mutation_p.C21S|DOCK4_ENST00000428084.1_5'Flank|DOCK4_ENST00000476846.1_5'Flank|ZNF277_ENST00000421043.1_Missense_Mutation_p.C21S	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	21					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						TGATGGGAGCTGCAGCACAGT	0.627																																																	0								ENSG00000198839						41.0	43.0	42.0					7																	111846832		2203	4300	6503	ZNF277	SO:0001583	missense	0			-	HGNC	AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.61T>A	7.37:g.111846832T>A	ENSP00000354501:p.Cys21Ser	Somatic	0	175	0.00		0.6553633802850016	0	100.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	94	22.31	Q75MZ2|Q75MZ3|Q8WY14	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C21S	ENST00000361822.3	37	c.61	CCDS5755.2	7	.	.	.	.	.	.	.	.	.	.	T	7.882	0.730424	0.15507	.	.	ENSG00000198839	ENST00000361822;ENST00000421043;ENST00000425229;ENST00000450657	T;T	0.27720	1.68;1.65	5.25	-0.155	0.13395	.	0.844233	0.10226	N	0.700250	T	0.11281	0.0275	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30851	-0.9964	10	0.18710	T	0.47	1.3763	0.721	0.00941	0.1779:0.3792:0.1543:0.2886	.	21;21	Q9NRM2;G5E9M4	ZN277_HUMAN;.	S	21	ENSP00000354501:C21S;ENSP00000402292:C21S	ENSP00000354501:C21S	C	+	1	0	ZNF277	111634068	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.022000	0.12480	0.084000	0.17077	-1.074000	0.02243	TGC	-	NULL		0.627	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF277	protein_coding	OTTHUMT00000316843.2	T	NM_021994	-		111846832	+1	no_errors	ENST00000361822	ensembl	human	known	74_37	missense	SNP	0.000	A
BID	637	genome.wustl.edu	37	22	18220804	18220804	+	Silent	SNP	G	G	A	rs146712574	byFrequency	TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr22:18220804G>A	ENST00000399774.3	-	5	724	c.555C>T	c.(553-555)taC>taT	p.Y185Y	BID_ENST00000342111.5_3'UTR|BID_ENST00000317361.7_Silent_p.Y231Y|BID_ENST00000399765.1_Silent_p.Y89Y|BID_ENST00000399767.1_Silent_p.Y89Y|BID_ENST00000551952.1_Silent_p.Y185Y|BID_ENST00000473439.1_5'Flank	NM_001196.3|NM_001244569.1	NP_001187.1|NP_001231498.1	P55957	BID_HUMAN	BH3 interacting domain death agonist	185					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|brain development (GO:0007420)|establishment of protein localization to membrane (GO:0090150)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|glial cell apoptotic process (GO:0034349)|intrinsic apoptotic signaling pathway (GO:0097193)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of cell proliferation (GO:0042127)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|release of cytochrome c from mitochondria (GO:0001836)|response to estradiol (GO:0032355)|signal transduction in response to DNA damage (GO:0042770)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial membrane (GO:0032592)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	death receptor binding (GO:0005123)			large_intestine(2)|ovary(1)	3		all_epithelial(15;0.198)		Lung(27;0.0419)		AGCTCCTCACGTAGGTGCGTA	0.552													G|||	4	0.000798722	0.003	0.0	5008	,	,		20123	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000015475	G	,,	7,4399	12.9+/-30.5	0,7,2196	113.0	114.0	114.0		555,693,267	-8.4	0.4	22	dbSNP_134	114	2,8598	2.2+/-6.3	0,2,4298	yes	coding-synonymous,coding-synonymous,coding-synonymous	BID	NM_001196.3,NM_197966.2,NM_197967.2	,,	0,9,6494	AA,AG,GG		0.0233,0.1589,0.0692	,,	185/196,231/242,89/100	18220804	9,12997	2203	4300	6503	BID	SO:0001819	synonymous_variant	0			-	HGNC	AF042083	CCDS13747.1, CCDS13748.1, CCDS13749.1	22q11.2	2014-03-07			ENSG00000015475	ENSG00000015475		"""Endogenous ligands"""	1050	protein-coding gene	gene with protein product		601997				8918887, 9721221	Standard	NM_001244567		Approved		uc002znc.2	P55957	OTTHUMG00000150087	ENST00000399774.3:c.555C>T	22.37:g.18220804G>A		Somatic	0	58	0.00		0.6553633802850016	169	38.77	107	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	30	41.18	Q549M7|Q71T04|Q7Z4M9|Q8IY86	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_BID	p.Y231	ENST00000399774.3	37	c.693	CCDS13748.1	22																																																																																			-	pfam_BID		0.552	BID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BID	protein_coding	OTTHUMT00000316178.1	G	NM_197966	rs146712574		18220804	-1	no_errors	ENST00000317361	ensembl	human	known	74_37	silent	SNP	0.406	A
DSG2	1829	genome.wustl.edu	37	18	29116347	29116347	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr18:29116347A>G	ENST00000261590.8	+	11	1815	c.1606A>G	c.(1606-1608)Aaa>Gaa	p.K536E		NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	536					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			CGTCATTGACAAACCACCTGG	0.418																																																	0								ENSG00000046604						65.0	64.0	64.0					18																	29116347		1904	4140	6044	DSG2	SO:0001583	missense	0			-	HGNC	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.1606A>G	18.37:g.29116347A>G	ENSP00000261590:p.Lys536Glu	Somatic	0	49	0.00		0.6553633802850016	6	53.85	7	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	19	34.48	Q4KKU6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.K536E	ENST00000261590.8	37	c.1606	CCDS42423.1	18	.	.	.	.	.	.	.	.	.	.	A	5.059	0.196644	0.09599	.	.	ENSG00000046604	ENST00000261590	T	0.59906	0.23	5.8	0.358	0.16084	.	0.642460	0.15013	N	0.285447	T	0.20861	0.0502	N	0.01705	-0.755	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.30001	-0.9993	10	0.02654	T	1	.	5.373	0.16150	0.37:0.1773:0.4527:0.0	.	536	Q14126	DSG2_HUMAN	E	536	ENSP00000261590:K536E	ENSP00000261590:K536E	K	+	1	0	DSG2	27370345	0.190000	0.23276	0.016000	0.15963	0.316000	0.28119	0.841000	0.27613	0.057000	0.16193	0.482000	0.46254	AAA	-	superfamily_Cadherin-like		0.418	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG2	protein_coding	OTTHUMT00000447506.1	A	NM_001943	-		29116347	+1	no_errors	ENST00000261590	ensembl	human	known	74_37	missense	SNP	0.011	G
AOC3	8639	genome.wustl.edu	37	17	41007484	41007484	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr17:41007484G>A	ENST00000308423.2	+	3	2070	c.1910G>A	c.(1909-1911)cGg>cAg	p.R637Q	AOC3_ENST00000591562.1_Missense_Mutation_p.R94Q	NM_003734.2	NP_003725.1	Q16853	AOC3_HUMAN	amine oxidase, copper containing 3	637					amine metabolic process (GO:0009308)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cell adhesion (GO:0007155)|inflammatory response (GO:0006954)|response to antibiotic (GO:0046677)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	aliphatic-amine oxidase activity (GO:0052595)|aminoacetone:oxygen oxidoreductase(deaminating) activity (GO:0052594)|calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|phenethylamine:oxygen oxidoreductase (deaminating) activity (GO:0052596)|primary amine oxidase activity (GO:0008131)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|tryptamine:oxygen oxidoreductase (deaminating) activity (GO:0052593)			breast(1)|central_nervous_system(4)|endometrium(4)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|skin(8)	41		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Hydralazine(DB01275)|Phenelzine(DB00780)	GTGACCCAGCGGAAGGAGGAG	0.547																																					NSCLC(3;192 220 10664 11501 16477)												0								ENSG00000131471						53.0	52.0	52.0					17																	41007484		2203	4300	6503	AOC3	SO:0001583	missense	0			-	HGNC	AF067406	CCDS11444.1, CCDS62198.1, CCDS74071.1	17q21	2013-05-08	2013-05-08			ENSG00000131471	1.4.3.21		550	protein-coding gene	gene with protein product	"""vascular adhesion protein 1"""	603735				9653080, 8972912	Standard	NM_003734		Approved	VAP1, HPAO, VAP-1	uc002ibv.4	Q16853		ENST00000308423.2:c.1910G>A	17.37:g.41007484G>A	ENSP00000312326:p.Arg637Gln	Somatic	0	58	0.00		0.6553633802850016	8	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	16	50.00	B2RCI5|K7ESB3|L0L8N9|Q45F94	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.R637Q	ENST00000308423.2	37	c.1910	CCDS11444.1	17	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169719	0.78452	.	.	ENSG00000131471	ENST00000308423	T	0.03663	3.85	4.97	2.98	0.34508	Copper amine oxidase, C-terminal (3);	0.177207	0.48767	N	0.000169	T	0.10465	0.0256	L	0.55213	1.73	0.44523	D	0.99747	D	0.89917	1.0	D	0.63877	0.919	T	0.13495	-1.0507	10	0.27082	T	0.32	.	11.2398	0.48962	0.1485:0.0:0.8515:0.0	.	637	Q16853	AOC3_HUMAN	Q	637	ENSP00000312326:R637Q	ENSP00000312326:R637Q	R	+	2	0	AOC3	38261010	1.000000	0.71417	0.987000	0.45799	0.977000	0.68977	4.115000	0.57865	0.697000	0.31718	0.650000	0.86243	CGG	-	pfam_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_C		0.547	AOC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AOC3	protein_coding	OTTHUMT00000452444.1	G	NM_003734	-		41007484	+1	no_errors	ENST00000308423	ensembl	human	known	74_37	missense	SNP	0.964	A
WDR70	55100	genome.wustl.edu	37	5	37443374	37443374	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr5:37443374C>T	ENST00000265107.4	+	7	742	c.586C>T	c.(586-588)Cgt>Tgt	p.R196C	WDR70_ENST00000504564.1_Missense_Mutation_p.R196C	NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	196							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTCAGGTGCCCGTTTGGTGAC	0.418																																																	0								ENSG00000082068						103.0	89.0	94.0					5																	37443374		2203	4300	6503	WDR70	SO:0001583	missense	0			-	HGNC	BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.586C>T	5.37:g.37443374C>T	ENSP00000265107:p.Arg196Cys	Somatic	0	44	0.00		0.6553633802850016	9	73.53	25	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	22	57.69	Q9H053	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R196C	ENST00000265107.4	37	c.586	CCDS34147.1	5	.	.	.	.	.	.	.	.	.	.	C	27.5	4.834944	0.91036	.	.	ENSG00000082068	ENST00000265107;ENST00000504564	T;T	0.60672	0.17;0.17	4.91	4.91	0.64330	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80076	0.4557	M	0.87547	2.89	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.993	D	0.83986	0.0335	10	0.72032	D	0.01	0.4523	18.4538	0.90713	0.0:1.0:0.0:0.0	.	196;196	D6RIW8;Q9NW82	.;WDR70_HUMAN	C	196	ENSP00000265107:R196C;ENSP00000425841:R196C	ENSP00000265107:R196C	R	+	1	0	WDR70	37479131	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.445000	0.80570	2.437000	0.82529	0.491000	0.48974	CGT	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.418	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR70	protein_coding	OTTHUMT00000368294.1	C	NM_018034	-		37443374	+1	no_errors	ENST00000265107	ensembl	human	known	74_37	missense	SNP	1.000	T
ABCA13	154664	genome.wustl.edu	37	7	48685086	48685086	+	Missense_Mutation	SNP	A	A	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr7:48685086A>T	ENST00000435803.1	+	62	15179	c.15155A>T	c.(15154-15156)cAc>cTc	p.H5052L	ABCA13_ENST00000544596.1_Missense_Mutation_p.H782L	NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	5052					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GACAGTCACCACACACATCAC	0.373																																																	0								ENSG00000179869						62.0	62.0	62.0					7																	48685086		2041	4212	6253	ABCA13	SO:0001583	missense	0			-	HGNC	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.15155A>T	7.37:g.48685086A>T	ENSP00000411096:p.His5052Leu	Somatic	0	56	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	30	9.09	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.H5052L	ENST00000435803.1	37	c.15155	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	A	12.82	2.052476	0.36181	.	.	ENSG00000179869	ENST00000435803;ENST00000411975;ENST00000544596	D;D;D	0.86432	-1.94;-2.12;-2.08	5.43	-0.989	0.10242	.	0.938768	0.08793	N	0.892959	T	0.76456	0.3990	L	0.29908	0.895	0.09310	N	1	B;B;B	0.29432	0.034;0.131;0.244	B;B;B	0.25140	0.025;0.04;0.058	T	0.58165	-0.7684	10	0.16896	T	0.51	.	9.2561	0.37584	0.5672:0.0:0.4328:0.0	.	782;2754;5052	F5H7B7;Q86UQ4-3;Q86UQ4	.;.;ABCAD_HUMAN	L	5052;825;782	ENSP00000411096:H5052L;ENSP00000391042:H825L;ENSP00000442634:H782L	ENSP00000391042:H825L	H	+	2	0	ABCA13	48655632	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	0.016000	0.13377	-0.091000	0.12440	0.533000	0.62120	CAC	-	NULL		0.373	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	protein_coding	OTTHUMT00000341964.2	A	NM_152701	-		48685086	+1	no_errors	ENST00000435803	ensembl	human	known	74_37	missense	SNP	0.000	T
BRCA1	672	genome.wustl.edu	37	17	41245740	41245740	+	Nonsense_Mutation	SNP	G	G	T	rs80359886|rs397508909		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr17:41245740G>T	ENST00000357654.3	-	10	1926	c.1808C>A	c.(1807-1809)tCa>tAa	p.S603*	BRCA1_ENST00000493795.1_Nonsense_Mutation_p.S556*|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000346315.3_Nonsense_Mutation_p.S603*|BRCA1_ENST00000354071.3_Nonsense_Mutation_p.S603*|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Nonsense_Mutation_p.S307*|BRCA1_ENST00000491747.2_Intron|BRCA1_ENST00000471181.2_Nonsense_Mutation_p.S603*	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	603					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		AGGTGCTTTTGAATTGTGGAT	0.378			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																													yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0								ENSG00000012048						79.0	82.0	81.0					17																	41245740		2202	4299	6501	BRCA1	SO:0001587	stop_gained	0	Familial Cancer Database		-	HGNC	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.1808C>A	17.37:g.41245740G>T	ENSP00000350283:p.Ser603*	Somatic	0	82	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	44	10.20	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,prints_BRCA1,pfscan_BRCT_dom,pfscan_Znf_RING	p.S603*	ENST00000357654.3	37	c.1808	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	G	19.45	3.829169	0.71258	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000346315;ENST00000309486;ENST00000471181;ENST00000493795;ENST00000470026;ENST00000477152	.	.	.	5.02	4.02	0.46733	.	0.321067	0.22883	N	0.054497	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.9104	5.2128	0.15327	0.1605:0.0:0.6537:0.1859	.	.	.	.	X	603;603;603;603;307;603;556;603;577	.	ENSP00000310938:S307X	S	-	2	0	BRCA1	38499266	0.887000	0.30362	0.985000	0.45067	0.673000	0.39480	2.312000	0.43726	2.618000	0.88619	0.462000	0.41574	TCA	-	pirsf_BRCA1		0.378	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	protein_coding	OTTHUMT00000348798.2	G	NM_007294	-		41245740	-1	no_errors	ENST00000471181	ensembl	human	known	74_37	nonsense	SNP	0.295	T
SPATA5	166378	genome.wustl.edu	37	4	123949450	123949450	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr4:123949450C>T	ENST00000274008.4	+	11	2048	c.1979C>T	c.(1978-1980)cCa>cTa	p.P660L	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	660					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						GGTATTCAGCCACCTAAAGGA	0.433																																																	0								ENSG00000145375						132.0	128.0	129.0					4																	123949450		2203	4300	6503	SPATA5	SO:0001583	missense	0			-	HGNC	AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.1979C>T	4.37:g.123949450C>T	ENSP00000274008:p.Pro660Leu	Somatic	0	89	0.00		0.6553633802850016	9	25.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	44	32.31	C9JT97|Q86XW1|Q8NI20|Q8TDL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,superfamily_Asp_de-COase-like_dom,smart_AAA+_ATPase	p.P660L	ENST00000274008.4	37	c.1979	CCDS3730.1	4	.	.	.	.	.	.	.	.	.	.	C	31	5.090222	0.94149	.	.	ENSG00000145375	ENST00000274008	D	0.95377	-3.69	5.79	5.79	0.91817	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.98153	0.9390	M	0.90198	3.095	0.80722	D	1	D;D	0.89917	1.0;0.972	D;P	0.67725	0.953;0.802	D	0.98611	1.0663	10	0.87932	D	0	-18.5544	20.0308	0.97536	0.0:1.0:0.0:0.0	.	660;660	Q8NB90;Q8NB90-3	SPAT5_HUMAN;.	L	660	ENSP00000274008:P660L	ENSP00000274008:P660L	P	+	2	0	SPATA5	124168900	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.635000	0.67841	2.732000	0.93576	0.585000	0.79938	CCA	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase		0.433	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA5	protein_coding	OTTHUMT00000256714.2	C	NM_145207	-		123949450	+1	no_errors	ENST00000274008	ensembl	human	known	74_37	missense	SNP	1.000	T
AP1M1	8907	genome.wustl.edu	37	19	16339600	16339600	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr19:16339600G>A	ENST00000291439.3	+	9	1357	c.908G>A	c.(907-909)cGg>cAg	p.R303Q	AP1M1_ENST00000444449.2_Missense_Mutation_p.R315Q|AP1M1_ENST00000541844.1_Missense_Mutation_p.R231Q|AP1M1_ENST00000429941.2_Intron|AP1M1_ENST00000590756.1_Missense_Mutation_p.R231Q	NM_032493.3	NP_115882.1	Q9BXS5	AP1M1_HUMAN	adaptor-related protein complex 1, mu 1 subunit	303	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.		R -> Q (in a breast cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|trans-Golgi network membrane (GO:0032588)		p.R303Q(1)		breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|prostate(2)	21						CAGTTCAAGCGGCGGTCAACA	0.622																																																	1	Substitution - Missense(1)	breast(1)						ENSG00000072958						120.0	85.0	97.0					19																	16339600		2203	4300	6503	AP1M1	SO:0001583	missense	0			-	HGNC		CCDS12342.1, CCDS46008.1	19p13.12	2008-05-23							13667	protein-coding gene	gene with protein product		603535				9653655, 17988225	Standard	NM_032493		Approved	AP47, CLAPM2	uc002ndv.2	Q9BXS5		ENST00000291439.3:c.908G>A	19.37:g.16339600G>A	ENSP00000291439:p.Arg303Gln	Somatic	0	82	0.00		0.6553633802850016	111	43.37	85	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	43	41.10	Q4TTY5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.R315Q	ENST00000291439.3	37	c.944	CCDS12342.1	19	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783147	0.90282	.	.	ENSG00000072958	ENST00000444449;ENST00000291439;ENST00000541844	T;T;T	0.20200	2.09;2.09;2.09	3.64	3.64	0.41730	Clathrin adaptor, mu subunit, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.33177	0.0854	M	0.74258	2.255	0.80722	D	1	P;D	0.59767	0.593;0.986	B;P	0.50109	0.15;0.631	T	0.22521	-1.0214	10	0.32370	T	0.25	-32.8258	14.4911	0.67651	0.0:0.0:1.0:0.0	.	315;303	Q4TTY5;Q9BXS5	.;AP1M1_HUMAN	Q	315;303;231	ENSP00000388996:R315Q;ENSP00000291439:R303Q;ENSP00000445682:R231Q	ENSP00000291439:R303Q	R	+	2	0	AP1M1	16200600	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.257000	0.65473	1.871000	0.54225	0.561000	0.74099	CGG	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu		0.622	AP1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1M1	protein_coding	OTTHUMT00000460492.1	G	NM_032493	-		16339600	+1	no_errors	ENST00000444449	ensembl	human	known	74_37	missense	SNP	1.000	A
UGT3A2	167127	genome.wustl.edu	37	5	36039752	36039752	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr5:36039752C>T	ENST00000282507.3	-	5	1003	c.902G>A	c.(901-903)gGc>gAc	p.G301D	UGT3A2_ENST00000513300.1_Missense_Mutation_p.G267D|UGT3A2_ENST00000504954.1_5'Flank|UGT3A2_ENST00000545528.1_5'UTR	NM_174914.3	NP_777574.2	Q3SY77	UD3A2_HUMAN	UDP glycosyltransferase 3 family, polypeptide A2	301					cellular response to genistein (GO:0071412)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)|UDP-glycosyltransferase activity (GO:0008194)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	43	all_lung(31;0.000179)		Lung(74;0.111)|Epithelial(62;0.113)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CACCATGGAGCCCAAGGTCAC	0.458																																																	0								ENSG00000168671						93.0	87.0	89.0					5																	36039752		2203	4300	6503	UGT3A2	SO:0001583	missense	0			-	HGNC		CCDS3914.1, CCDS54842.1	5p13.2	2014-05-20			ENSG00000168671	ENSG00000168671		"""UDP glucuronosyltransferases"""	27266	protein-coding gene	gene with protein product						12975309	Standard	NM_174914		Approved		uc003jjz.2	Q3SY77	OTTHUMG00000131108	ENST00000282507.3:c.902G>A	5.37:g.36039752C>T	ENSP00000282507:p.Gly301Asp	Somatic	0	66	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	68	21.84	B4DUQ7|E9PFK7|Q6UXC4|Q8NBP2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.G301D	ENST00000282507.3	37	c.902	CCDS3914.1	5	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783052	0.49891	.	.	ENSG00000168671	ENST00000282507;ENST00000513300	D;D	0.96104	-3.91;-3.91	3.18	3.18	0.36537	.	0.000000	0.64402	D	0.000001	D	0.98510	0.9503	H	0.98005	4.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98888	1.0772	10	0.87932	D	0	.	14.2717	0.66155	0.0:1.0:0.0:0.0	.	267;301	E9PFK7;Q3SY77	.;UD3A2_HUMAN	D	301;267	ENSP00000282507:G301D;ENSP00000427404:G267D	ENSP00000282507:G301D	G	-	2	0	UGT3A2	36075509	0.998000	0.40836	0.561000	0.28357	0.074000	0.17049	4.163000	0.58183	2.077000	0.62373	0.591000	0.81541	GGC	-	pfam_UDP_glucos_trans		0.458	UGT3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT3A2	protein_coding	OTTHUMT00000253771.2	C	NM_174914	-		36039752	-1	no_errors	ENST00000282507	ensembl	human	known	74_37	missense	SNP	0.999	T
CARD10	29775	genome.wustl.edu	37	22	37906309	37906314	+	In_Frame_Del	DEL	CTCCTT	CTCCTT	-	rs113275238|rs60611523	byFrequency	TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	CTCCTT	CTCCTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr22:37906309_37906314delCTCCTT	ENST00000403299.1	-	5	1030_1035	c.814_819delAAGGAG	c.(814-819)aaggagdel	p.KE272del	CARD10_ENST00000406271.3_5'Flank|CARD10_ENST00000494166.1_5'UTR|CARD10_ENST00000251973.5_In_Frame_Del_p.KE272del			Q9BWT7	CAR10_HUMAN	caspase recruitment domain family, member 10	272					activation of NF-kappaB-inducing kinase activity (GO:0007250)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)	receptor signaling complex scaffold activity (GO:0030159)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	17	Melanoma(58;0.0574)					CATTGTCTGGctccttctccttctcc	0.631														1551	0.309704	0.4743	0.2536	5008	,	,		16347	0.3036		0.2535	False		,,,				2504	0.1912																0								ENSG00000100065																																			CARD10	SO:0001651	inframe_deletion	0				HGNC	AF086324	CCDS13948.1	22q13.1	2008-05-22			ENSG00000100065	ENSG00000100065			16422	protein-coding gene	gene with protein product		607209				11259443, 11356195	Standard	NM_014550		Approved	CARMA3, BIMP1	uc003asu.1	Q9BWT7	OTTHUMG00000150592	ENST00000403299.1:c.814_819delAAGGAG	22.37:g.37906315_37906320delCTCCTT	ENSP00000384570:p.Lys272_Glu273del	Somatic	NA	NA	NA		0.6553633802850016	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q14CQ8|Q5TFG6|Q8NC81|Q9UGR5|Q9UGR6|Q9Y3H0	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	p.KE272in_frame_del	ENST00000403299.1	37	c.819_814	CCDS13948.1	22																																																																																			-	NULL		0.631	CARD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD10	protein_coding	OTTHUMT00000318997.1	CTCCTT	NM_014550			37906314	-1	no_errors	ENST00000251973	ensembl	human	known	74_37	in_frame_del	DEL	0.939:0.949:0.957:0.963:0.966:0.967	-
RASA1	5921	genome.wustl.edu	37	5	86645158	86645158	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr5:86645158G>A	ENST00000274376.6	+	8	1794	c.1230G>A	c.(1228-1230)atG>atA	p.M410I	RASA1_ENST00000512763.1_Missense_Mutation_p.M243I|RASA1_ENST00000506290.1_Missense_Mutation_p.M244I|RASA1_ENST00000456692.2_Missense_Mutation_p.M233I	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	410	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		ATCAGTTTATGATGGGAGGCC	0.338																																																	0								ENSG00000145715						65.0	69.0	68.0					5																	86645158		2201	4299	6500	RASA1	SO:0001583	missense	0			-	HGNC		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1230G>A	5.37:g.86645158G>A	ENSP00000274376:p.Met410Ile	Somatic	0	92	0.00		0.6553633802850016	7	12.50	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	80	24.53	B2R6W3|Q9UDI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH2,smart_SH3_domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_RasGAP,prints_SH2	p.M410I	ENST00000274376.6	37	c.1230	CCDS34200.1	5	.	.	.	.	.	.	.	.	.	.	G	17.42	3.385294	0.61956	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	D;D;D;D	0.86366	-2.11;-2.11;-2.11;-2.11	5.78	5.78	0.91487	SH2 motif (4);	0.000000	0.85682	D	0.000000	T	0.77350	0.4117	N	0.04508	-0.205	0.80722	D	1	B;B;B;B;B	0.15719	0.001;0.001;0.001;0.001;0.014	B;B;B;B;B	0.16722	0.006;0.006;0.006;0.005;0.016	T	0.70831	-0.4765	10	0.45353	T	0.12	.	20.0172	0.97481	0.0:0.0:1.0:0.0	.	244;243;244;233;410	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	I	410;443;233;243;244	ENSP00000274376:M410I;ENSP00000411221:M233I;ENSP00000422008:M243I;ENSP00000420905:M244I	ENSP00000274376:M410I	M	+	3	0	RASA1	86680914	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.841000	0.86834	2.723000	0.93209	0.585000	0.79938	ATG	-	pfam_SH2,smart_SH2,pfscan_SH2		0.338	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASA1	protein_coding	OTTHUMT00000369729.1	G	NM_002890	-		86645158	+1	no_errors	ENST00000274376	ensembl	human	known	74_37	missense	SNP	1.000	A
NOBOX	135935	genome.wustl.edu	37	7	144096231	144096231	+	Silent	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr7:144096231G>A	ENST00000467773.1	-	8	1280	c.1281C>T	c.(1279-1281)ccC>ccT	p.P427P	NOBOX_ENST00000223140.5_Silent_p.P310P|NOBOX_ENST00000483238.1_Silent_p.P395P	NM_001080413.3	NP_001073882.3	O60393	NOBOX_HUMAN	NOBOX oogenesis homeobox	427	Pro-rich.				oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	26	Melanoma(164;0.14)					TGGGTTGGGTGGGGGCCAAAG	0.602																																																	0								ENSG00000106410						14.0	15.0	15.0					7																	144096231		1856	3953	5809	NOBOX	SO:0001819	synonymous_variant	0			-	HGNC			7q35	2011-06-20			ENSG00000106410	ENSG00000106410		"""Homeoboxes / PRD class"""	22448	protein-coding gene	gene with protein product	"""newborn ovary homeobox-encoding gene"""	610934				11804785, 16597639	Standard	NM_001080413		Approved	OG2, Og2x	uc022aoj.1	O60393	OTTHUMG00000158051	ENST00000467773.1:c.1281C>T	7.37:g.144096231G>A		Somatic	0	89	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	43	58.65	A6NCD3|A8MZN5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.P427	ENST00000467773.1	37	c.1281		7																																																																																			-	NULL		0.602	NOBOX-002	KNOWN	basic	protein_coding	NOBOX	protein_coding	OTTHUMT00000350095.1	G	XM_001134420	-		144096231	-1	no_errors	ENST00000467773	ensembl	human	known	74_37	silent	SNP	0.000	A
KBTBD12	166348	genome.wustl.edu	37	3	127642187	127642187	+	Missense_Mutation	SNP	G	G	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr3:127642187G>C	ENST00000405109.1	+	2	750	c.283G>C	c.(283-285)Gag>Cag	p.E95Q	KBTBD12_ENST00000343941.4_5'Flank|KBTBD12_ENST00000407609.3_Intron|KBTBD12_ENST00000405256.1_Missense_Mutation_p.E95Q			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	95	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						TGCAGCTTTGGAGATCAATAA	0.378																																																	0								ENSG00000187715						77.0	72.0	73.0					3																	127642187		1925	4130	6055	KBTBD12	SO:0001583	missense	0			-	HGNC		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.283G>C	3.37:g.127642187G>C	ENSP00000385957:p.Glu95Gln	Somatic	0	44	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	36	18.18	B5MCC6|Q6ZRK1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.E95Q	ENST00000405109.1	37	c.283	CCDS33848.2	3	.	.	.	.	.	.	.	.	.	.	G	9.812	1.183350	0.21870	.	.	ENSG00000187715	ENST00000405109;ENST00000405256	T;T	0.68025	-0.3;-0.3	5.75	4.86	0.63082	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	.	.	.	.	T	0.49474	0.1559	N	0.21282	0.65	0.25685	N	0.985751	B	0.15141	0.012	B	0.13407	0.009	T	0.32798	-0.9893	9	0.16420	T	0.52	.	9.3085	0.37889	0.0774:0.3552:0.5674:0.0	.	95	Q3ZCT8	KBTBC_HUMAN	Q	95	ENSP00000385957:E95Q;ENSP00000385879:E95Q	ENSP00000385957:E95Q	E	+	1	0	KBTBD12	129124877	1.000000	0.71417	0.831000	0.32960	0.782000	0.44232	4.312000	0.59154	1.383000	0.46405	0.460000	0.39030	GAG	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like		0.378	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD12	protein_coding	OTTHUMT00000318682.1	G	NM_207335	-		127642187	+1	no_errors	ENST00000405109	ensembl	human	known	74_37	missense	SNP	0.994	C
SDK2	54549	genome.wustl.edu	37	17	71431719	71431719	+	Silent	SNP	G	G	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr17:71431719G>C	ENST00000392650.3	-	9	1065	c.1065C>G	c.(1063-1065)acC>acG	p.T355T	SDK2_ENST00000388726.3_Silent_p.T355T	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	355	Ig-like C2-type 4.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GCCGGAAGCGGGTCAACTTCT	0.672																																																	0								ENSG00000069188						49.0	34.0	39.0					17																	71431719		2199	4293	6492	SDK2	SO:0001819	synonymous_variant	0			-	HGNC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1065C>G	17.37:g.71431719G>C		Somatic	0	90	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	28	22.22	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T355	ENST00000392650.3	37	c.1065	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	G	8.758	0.922899	0.18056	.	.	ENSG00000069188	ENST00000416616	.	.	.	4.83	1.09	0.20402	.	.	.	.	.	T	0.59183	0.2175	.	.	.	0.39060	D	0.960516	.	.	.	.	.	.	T	0.57791	-0.7750	4	.	.	.	.	11.2959	0.49277	0.0:0.1036:0.5677:0.3287	.	.	.	.	A	260	.	.	P	-	1	0	SDK2	68943314	0.221000	0.23642	0.553000	0.28255	0.965000	0.64279	-0.529000	0.06186	0.407000	0.25591	0.555000	0.69702	CCG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.672	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	protein_coding	OTTHUMT00000327598.2	G	NM_019064	-		71431719	-1	no_errors	ENST00000392650	ensembl	human	known	74_37	silent	SNP	0.054	C
RASA1	5921	genome.wustl.edu	37	5	86645033	86645033	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr5:86645033G>A	ENST00000274376.6	+	8	1669	c.1105G>A	c.(1105-1107)Ggt>Agt	p.G369S	RASA1_ENST00000512763.1_Missense_Mutation_p.G202S|RASA1_ENST00000506290.1_Missense_Mutation_p.G203S|RASA1_ENST00000456692.2_Missense_Mutation_p.G192S	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	369	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		TCTTACAGTTGGTCAAGTCTG	0.313																																																	0								ENSG00000145715						85.0	90.0	88.0					5																	86645033		2203	4300	6503	RASA1	SO:0001583	missense	0			-	HGNC		CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.1105G>A	5.37:g.86645033G>A	ENSP00000274376:p.Gly369Ser	Somatic	0	54	0.00		0.6553633802850016	7	12.50	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	33	19.51	B2R6W3|Q9UDI1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_SH2,smart_SH3_domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_RasGAP,prints_SH2	p.G369S	ENST00000274376.6	37	c.1105	CCDS34200.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.532278	0.96446	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.78	5.78	0.91487	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.89560	0.6750	L	0.52759	1.655	0.80722	D	1	P;P;P;P;D	0.89917	0.823;0.823;0.823;0.891;1.0	P;P;P;P;D	0.97110	0.792;0.792;0.792;0.903;1.0	D	0.89126	0.3506	10	0.56958	D	0.05	.	20.0172	0.97481	0.0:0.0:1.0:0.0	.	203;202;203;192;369	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	S	369;402;192;202;203	ENSP00000274376:G369S;ENSP00000411221:G192S;ENSP00000422008:G202S;ENSP00000420905:G203S	ENSP00000274376:G369S	G	+	1	0	RASA1	86680789	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.832000	0.99423	2.723000	0.93209	0.585000	0.79938	GGT	-	pfam_SH2,smart_SH2,pfscan_SH2		0.313	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASA1	protein_coding	OTTHUMT00000369729.1	G	NM_002890	-		86645033	+1	no_errors	ENST00000274376	ensembl	human	known	74_37	missense	SNP	1.000	A
ATG2A	23130	genome.wustl.edu	37	11	64669435	64669435	+	Splice_Site	SNP	G	G	T	rs528665670		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:64669435G>T	ENST00000377264.3	-	29	4230	c.4118C>A	c.(4117-4119)cCg>cAg	p.P1373Q	ATG2A_ENST00000421419.2_Splice_Site_p.P1375Q	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1373					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						ACCACGCACCGGGATGCCCAG	0.612																																																	0								ENSG00000110046						103.0	89.0	93.0					11																	64669435		2201	4297	6498	ATG2A	SO:0001630	splice_region_variant	0			-	HGNC		CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.4119+1C>A	11.37:g.64669435G>T		Somatic	0	40	0.00		0.6553633802850016	14	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Autophagy-rel_C	p.P1375Q	ENST00000377264.3	37	c.4124	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	G	8.753	0.921832	0.17982	.	.	ENSG00000110046	ENST00000421419;ENST00000377264	T;T	0.38401	1.14;1.14	4.63	1.54	0.23209	.	0.378699	0.26183	N	0.025848	T	0.21347	0.0514	N	0.05078	-0.115	0.38735	D	0.953769	P;D	0.56035	0.956;0.974	P;P	0.54664	0.578;0.758	T	0.20405	-1.0276	10	0.10636	T	0.68	.	4.8154	0.13363	0.1995:0.0:0.6315:0.169	.	1373;1375	Q2TAZ0;Q2TAZ0-3	ATG2A_HUMAN;.	Q	1375;1373	ENSP00000410522:P1375Q;ENSP00000366475:P1373Q	ENSP00000366475:P1373Q	P	-	2	0	ATG2A	64426011	1.000000	0.71417	0.621000	0.29145	0.843000	0.47879	2.178000	0.42519	0.099000	0.17552	0.563000	0.77884	CCG	-	NULL		0.612	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	protein_coding	OTTHUMT00000143224.1	G	NM_015104	-	Missense_Mutation	64669435	-1	no_errors	ENST00000421419	ensembl	human	known	74_37	missense	SNP	1.000	T
MAMLD1	10046	genome.wustl.edu	37	X	149639325	149639327	+	In_Frame_Del	DEL	CAG	CAG	-	rs374739932|rs374561693		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chrX:149639325_149639327delCAG	ENST00000370401.2	+	4	1790_1792	c.1480_1482delCAG	c.(1480-1482)cagdel	p.Q502del	MAMLD1_ENST00000262858.5_In_Frame_Del_p.Q502del|MAMLD1_ENST00000432680.2_In_Frame_Del_p.Q477del|MAMLD1_ENST00000455522.2_5'UTR|MAMLD1_ENST00000426613.2_In_Frame_Del_p.Q477del			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	502	Poly-Gln.				male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.Q469Q(1)|p.Q494Q(1)|p.Q421Q(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					AAGCcagcaacagcagcagcagc	0.532																																																	3	Substitution - coding silent(3)	kidney(3)						ENSG00000013619																																			MAMLD1	SO:0001651	inframe_deletion	0				HGNC	U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1480_1482delCAG	X.37:g.149639334_149639336delCAG	ENSP00000359428:p.Gln502del	Somatic	0	18	0.00		0.6553633802850016	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	6	33.33	B2RCQ4|B4DG93|B9EGA5	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.Q472in_frame_del	ENST00000370401.2	37	c.1405_1407	CCDS14693.2	X																																																																																			-	NULL		0.532	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	protein_coding	OTTHUMT00000060844.2	CAG	NM_005491			149639327	+1	no_errors	ENST00000432680	ensembl	human	known	74_37	in_frame_del	DEL	0.006:0.000:0.000	-
KCNH7	90134	genome.wustl.edu	37	2	163279886	163279886	+	Missense_Mutation	SNP	T	T	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr2:163279886T>C	ENST00000332142.5	-	9	2213	c.2114A>G	c.(2113-2115)cAg>cGg	p.Q705R	KCNH7_ENST00000328032.4_Missense_Mutation_p.Q698R	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	705					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	CCATGCGTGCTGGAAATATTC	0.448																																					GBM(196;1492 2208 17507 24132 45496)												0								ENSG00000184611						248.0	231.0	237.0					2																	163279886		2203	4300	6503	KCNH7	SO:0001583	missense	0			-	HGNC	AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.2114A>G	2.37:g.163279886T>C	ENSP00000331727:p.Gln705Arg	Somatic	0	103	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	92	12.38	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,superfamily_cNMP-bd-like,superfamily_PAS,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.Q705R	ENST00000332142.5	37	c.2114	CCDS2219.1	2	.	.	.	.	.	.	.	.	.	.	T	25.9	4.686658	0.88639	.	.	ENSG00000184611	ENST00000332142;ENST00000328032	D;D	0.96774	-4.12;-4.12	5.82	5.82	0.92795	Cyclic nucleotide-binding-like (1);	0.000000	0.85682	D	0.000000	D	0.97914	0.9314	M	0.77313	2.365	0.80722	D	1	D;B	0.89917	1.0;0.23	D;B	0.91635	0.999;0.168	D	0.98048	1.0386	10	0.44086	T	0.13	.	16.1778	0.81874	0.0:0.0:0.0:1.0	.	698;705	Q9NS40-2;Q9NS40	.;KCNH7_HUMAN	R	705;698	ENSP00000331727:Q705R;ENSP00000333781:Q698R	ENSP00000333781:Q698R	Q	-	2	0	KCNH7	162988132	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.997000	0.88414	2.225000	0.72522	0.459000	0.35465	CAG	-	superfamily_cNMP-bd-like,prints_K_chnl_volt-dep_ERG		0.448	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	protein_coding	OTTHUMT00000255093.1	T	NM_033272	-		163279886	-1	no_errors	ENST00000332142	ensembl	human	known	74_37	missense	SNP	1.000	C
BTN1A1	696	genome.wustl.edu	37	6	26505348	26505348	+	Missense_Mutation	SNP	T	T	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr6:26505348T>C	ENST00000244513.6	+	3	689	c.623T>C	c.(622-624)aTc>aCc	p.I208T		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	208	Ig-like V-type 2.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						TCAGTGATCATCAGAGACACT	0.453																																																	0								ENSG00000124557						111.0	112.0	112.0					6																	26505348		2203	4300	6503	BTN1A1	SO:0001583	missense	0			-	HGNC	U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.623T>C	6.37:g.26505348T>C	ENSP00000244513:p.Ile208Thr	Somatic	0	41	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	28	26.32	Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.I208T	ENST00000244513.6	37	c.623	CCDS4614.1	6	.	.	.	.	.	.	.	.	.	.	T	16.52	3.146987	0.57151	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.10005	2.92	5.52	5.52	0.82312	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.328311	0.26435	N	0.024391	T	0.13884	0.0336	M	0.88450	2.955	0.09310	N	1	P	0.37423	0.594	B	0.43052	0.406	T	0.08166	-1.0735	10	0.87932	D	0	.	12.0074	0.53268	0.0:0.0:0.0:1.0	.	208	Q13410	BT1A1_HUMAN	T	208	ENSP00000244513:I208T	ENSP00000244513:I208T	I	+	2	0	BTN1A1	26613327	0.293000	0.24371	0.010000	0.14722	0.845000	0.48019	4.609000	0.61148	2.085000	0.62840	0.533000	0.62120	ATC	-	pfam_CD80_C2-set,pfscan_Ig-like_dom		0.453	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	protein_coding	OTTHUMT00000043776.1	T	NM_001732	-		26505348	+1	no_errors	ENST00000244513	ensembl	human	known	74_37	missense	SNP	0.013	C
GRM5	2915	genome.wustl.edu	37	11	88300954	88300954	+	Missense_Mutation	SNP	A	A	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:88300954A>C	ENST00000305447.4	-	7	2046	c.1897T>G	c.(1897-1899)Ttc>Gtc	p.F633V	GRM5_ENST00000455756.2_Missense_Mutation_p.F633V|GRM5_ENST00000393297.1_Missense_Mutation_p.F633V|GRM5_ENST00000305432.5_Missense_Mutation_p.F633V|GRM5_ENST00000418177.2_Missense_Mutation_p.F633V	NM_001143831.2	NP_001137303.1	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5	633					activation of MAPKKK activity (GO:0000185)|cognition (GO:0050890)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|learning (GO:0007612)|locomotory behavior (GO:0007626)|negative regulation of locomotion (GO:0040013)|phospholipase C-activating G-protein coupled glutamate receptor signaling pathway (GO:0007206)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(1)|breast(5)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(18)|lung(40)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)|Rufinamide(DB06201)	ATGAGGCAGAAGGTACATAAG	0.478																																																	0								ENSG00000168959						106.0	94.0	98.0					11																	88300954		2201	4299	6500	GRM5	SO:0001583	missense	0			-	HGNC	D28538	CCDS8283.1, CCDS44694.1	11q14.3	2014-06-12			ENSG00000168959	ENSG00000168959		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4597	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 86"""	604102				7908515	Standard	NM_001143831		Approved	MGLUR5, GPRC1E, mGlu5, PPP1R86	uc001pcq.3	P41594	OTTHUMG00000134306	ENST00000305447.4:c.1897T>G	11.37:g.88300954A>C	ENSP00000306138:p.Phe633Val	Somatic	0	58	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	26	48.00	Q6J164	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Metabotropic_Glu_rcpt_Homer-bd,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,prints_GPCR_3_mtglu_rcpt_5,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_1,pfscan_GPCR_3_C	p.F633V	ENST00000305447.4	37	c.1897	CCDS44694.1	11	.	.	.	.	.	.	.	.	.	.	A	22.5	4.300825	0.81136	.	.	ENSG00000168959	ENST00000418177;ENST00000455756;ENST00000305432;ENST00000305447;ENST00000393297	D;D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48;-2.48	5.71	5.71	0.89125	GPCR, family 3, C-terminal (2);	0.087086	0.85682	D	0.000000	D	0.93465	0.7915	M	0.69463	2.115	0.80722	D	1	D;D	0.69078	0.996;0.997	D;D	0.79108	0.986;0.992	D	0.93199	0.6590	9	.	.	.	.	15.9905	0.80202	1.0:0.0:0.0:0.0	.	633;633	P41594-2;P41594	.;GRM5_HUMAN	V	633	ENSP00000402912:F633V;ENSP00000405690:F633V;ENSP00000305905:F633V;ENSP00000306138:F633V;ENSP00000376975:F633V	.	F	-	1	0	GRM5	87940602	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.187000	0.69744	0.533000	0.62120	TTC	-	pfam_GPCR_3_C,pfscan_GPCR_3_C		0.478	GRM5-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM5	protein_coding	OTTHUMT00000259226.1	A	NM_000842	-		88300954	-1	no_errors	ENST00000305447	ensembl	human	known	74_37	missense	SNP	1.000	C
IQCA1	79781	genome.wustl.edu	37	2	237276995	237276995	+	Intron	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr2:237276995G>A	ENST00000409907.3	-	14	1836				IQCA1_ENST00000431676.2_Intron|RP11-785G17.1_ENST00000605740.1_RNA|IQCA1_ENST00000309507.5_Intron	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1								ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						GCGCTGGTCTGAGCTGCATAA	0.428																																																	0								ENSG00000270540						28.0	30.0	29.0					2																	237276995		1032	2124	3156	RP11-785G17.1	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.1562-51C>T	2.37:g.237276995G>A		Somatic	0	40	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	8	70.37	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000409907.3	37	NULL	CCDS46549.1	2																																																																																			-	-		0.428	IQCA1-001	KNOWN	basic|CCDS	protein_coding	ENSG00000270540	protein_coding	OTTHUMT00000329266.1	G	NM_024726	-		237276995	+1	no_errors	ENST00000605740	ensembl	human	known	74_37	rna	SNP	0.000	A
GPR98	84059	genome.wustl.edu	37	5	89990459	89990459	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr5:89990459G>A	ENST00000405460.2	+	33	7982	c.7886G>A	c.(7885-7887)gGa>gAa	p.G2629E		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2629	Calx-beta 18. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTTGTTGGTGGAACAGCTACT	0.483																																																	0								ENSG00000164199						136.0	142.0	140.0					5																	89990459		2023	4168	6191	GPR98	SO:0001583	missense	0			-	HGNC	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.7886G>A	5.37:g.89990459G>A	ENSP00000384582:p.Gly2629Glu	Somatic	0	46	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	34	29.17	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.G2629E	ENST00000405460.2	37	c.7886	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.9|26.9	4.782668|4.782668	0.90282|0.90282	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000509621|ENST00000405460;ENST00000296619	.|T	.|0.44083	.|0.93	5.81|5.81	5.81|5.81	0.92471|0.92471	.|Na-Ca exchanger/integrin-beta4 (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.73257|0.73257	0.3564|0.3564	M|M	0.90198|0.90198	3.095|3.095	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	T|T	0.77859|0.77859	-0.2431|-0.2431	5|10	.|0.72032	.|D	.|0.01	.|.	20.0827|20.0827	0.97786|0.97786	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2629;2629	.|E7ETI5;Q8WXG9	.|.;GPR98_HUMAN	K|E	195|2629	.|ENSP00000384582:G2629E	.|ENSP00000296619:G2629E	E|G	+|+	1|2	0|0	GPR98|GPR98	90026215|90026215	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.923000|0.923000	0.55619|0.55619	9.574000|9.574000	0.98184|0.98184	2.744000|2.744000	0.94065|0.94065	0.655000|0.655000	0.94253|0.94253	GAA|GGA	-	pfam_Calx_beta,smart_Calx_beta		0.483	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	protein_coding	OTTHUMT00000369993.2	G	NM_032119	-		89990459	+1	no_errors	ENST00000405460	ensembl	human	known	74_37	missense	SNP	1.000	A
CSPG4	1464	genome.wustl.edu	37	15	75979836	75979836	+	Missense_Mutation	SNP	C	C	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr15:75979836C>G	ENST00000308508.5	-	3	3662	c.3570G>C	c.(3568-3570)caG>caC	p.Q1190H		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1190	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CCAGCAGGTCCTGCTGGGAGA	0.647																																																	0								ENSG00000173546						55.0	57.0	56.0					15																	75979836		2196	4293	6489	CSPG4	SO:0001583	missense	0			-	HGNC	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3570G>C	15.37:g.75979836C>G	ENSP00000312506:p.Gln1190His	Somatic	0	99	0.00		0.6553633802850016	16	57.89	22	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	38	55.29	D3DW77|Q92675	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.Q1190H	ENST00000308508.5	37	c.3570	CCDS10284.1	15	.	.	.	.	.	.	.	.	.	.	.	9.799	1.180015	0.21787	.	.	ENSG00000173546	ENST00000308508	T	0.20069	2.1	5.07	4.16	0.48862	.	0.516581	0.17606	N	0.168252	T	0.09992	0.0245	N	0.08118	0	0.33952	D	0.644584	B	0.16396	0.017	B	0.06405	0.002	T	0.14896	-1.0456	10	0.29301	T	0.29	.	7.6578	0.28386	0.1623:0.7547:0.0:0.0829	.	1190	Q6UVK1	CSPG4_HUMAN	H	1190	ENSP00000312506:Q1190H	ENSP00000312506:Q1190H	Q	-	3	2	CSPG4	73766891	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	1.860000	0.39428	1.138000	0.42230	0.555000	0.69702	CAG	-	NULL		0.647	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	protein_coding	OTTHUMT00000286472.1	C	NM_001897	-		75979836	-1	no_errors	ENST00000308508	ensembl	human	known	74_37	missense	SNP	1.000	G
BZW2	28969	genome.wustl.edu	37	7	16737659	16737659	+	Intron	SNP	C	C	T	rs377279314		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr7:16737659C>T	ENST00000433922.2	+	10	1147				BZW2_ENST00000452975.2_Intron|BZW2_ENST00000407633.1_Intron|AC073333.8_ENST00000418907.1_RNA|BZW2_ENST00000258761.3_Intron|BZW2_ENST00000405202.1_Intron	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2						cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		TTTTACTCTCCACTTCTGTTC	0.517																																																	0								ENSG00000235837	C	,	0,4406		0,0,2203	70.0	67.0	68.0		,	-3.2	0.0	7		68	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron	BZW2	NM_001159767.1,NM_014038.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	,	16737659	1,13005	2203	4300	6503	AC073333.8	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.970-14C>T	7.37:g.16737659C>T		Somatic	0	35	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	18	30.77	A4D123|Q3B779|Q96JW5|Q9H3F7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000433922.2	37	NULL	CCDS5362.1	7																																																																																			-	-		0.517	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000235837	protein_coding	OTTHUMT00000253256.2	C	NM_014038	-		16737659	-1	no_errors	ENST00000418907	ensembl	human	known	74_37	rna	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7578204	7578204	+	Missense_Mutation	SNP	A	A	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr17:7578204A>C	ENST00000269305.4	-	6	834	c.645T>G	c.(643-645)agT>agG	p.S215R	TP53_ENST00000359597.4_Missense_Mutation_p.S215R|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.S215R|TP53_ENST00000420246.2_Missense_Mutation_p.S215R|TP53_ENST00000445888.2_Missense_Mutation_p.S215R|TP53_ENST00000413465.2_Missense_Mutation_p.S215R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	215	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in sporadic cancers; somatic mutation).|S -> G (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> K (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|S -> N (in sporadic cancers; somatic mutation).|S -> R (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S215R(17)|p.0?(8)|p.?(5)|p.S215S(2)|p.H214fs*5(2)|p.V216fs*32(1)|p.V216fs*33(1)|p.S215fs*27(1)|p.S215del(1)|p.S215fs*29(1)|p.D208_V216delDRNTFRHSV(1)|p.V216fs*6(1)|p.T211_S215delTFRHS(1)|p.S83R(1)|p.D208fs*1(1)|p.S215fs*32(1)|p.S215fs*31(1)|p.S215_V216insX(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.S215_V218>R(1)|p.S215_V218>M(1)|p.S122R(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACCACCACACTATGTCGAA	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Substitution - Missense(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Unknown(5)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(3)|Substitution - coding silent(2)|Insertion - In frame(1)|Complex - frameshift(1)	haematopoietic_and_lymphoid_tissue(9)|biliary_tract(5)|large_intestine(5)|bone(5)|breast(5)|stomach(4)|oesophagus(4)|ovary(4)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(2)|skin(2)|lung(2)|liver(1)|prostate(1)	GRCh37	CD941799	TP53	D		ENSG00000141510						124.0	111.0	116.0					17																	7578204		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.645T>G	17.37:g.7578204A>C	ENSP00000269305:p.Ser215Arg	Somatic	0	66	0.00		0.6553633802850016	1	93.33	14	WXS	Illumina HiSeq 2500	Phase_IV	tier1	45	16	72.58	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.S215R	ENST00000269305.4	37	c.645	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	20.2	3.954051	0.73902	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99855	-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2;-7.2	5.28	-4.05	0.03998	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99806	0.9916	M	0.90705	3.14	0.58432	D	0.999995	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.98563	1.0642	10	0.87932	D	0	-18.3023	12.3136	0.54942	0.7185:0.0:0.2815:0.0	.	176;215;215;122;215;215;215	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	215;215;215;215;215;215;204;122;83;122;83	ENSP00000410739:S215R;ENSP00000352610:S215R;ENSP00000269305:S215R;ENSP00000398846:S215R;ENSP00000391127:S215R;ENSP00000391478:S215R;ENSP00000425104:S83R;ENSP00000423862:S122R	ENSP00000269305:S215R	S	-	3	2	TP53	7518929	0.000000	0.05858	0.557000	0.28306	0.964000	0.63967	-1.515000	0.02252	-0.649000	0.05430	-0.468000	0.05107	AGT	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546	-		7578204	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	0.959	C
PRDM16	63976	genome.wustl.edu	37	1	3328332	3328332	+	Missense_Mutation	SNP	C	C	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:3328332C>A	ENST00000270722.5	+	9	1620	c.1571C>A	c.(1570-1572)cCc>cAc	p.P524H	PRDM16_ENST00000378398.3_Missense_Mutation_p.P525H|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000378391.2_Missense_Mutation_p.P524H|PRDM16_ENST00000442529.2_Missense_Mutation_p.P524H|PRDM16_ENST00000514189.1_Missense_Mutation_p.P525H|PRDM16_ENST00000441472.2_Missense_Mutation_p.P524H|PRDM16_ENST00000511072.1_Missense_Mutation_p.P525H			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	524	Pro-rich.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		TCCTTGTACCCCCGGCCGCCT	0.706			T	EVI1	"""MDS, AML"""																																			Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	0								ENSG00000142611						62.0	80.0	74.0					1																	3328332		1922	4117	6039	PRDM16	SO:0001583	missense	0			-	HGNC	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.1571C>A	1.37:g.3328332C>A	ENSP00000270722:p.Pro524His	Somatic	0	74	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	41	13	75.93	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Znf_BED_prd,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.P524H	ENST00000270722.5	37	c.1571	CCDS41236.2	1	.	.	.	.	.	.	.	.	.	.	C	6.574	0.474225	0.12521	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.06768	3.31;3.38;3.39;3.37;3.37;3.26;3.39;3.34;3.27	5.33	5.33	0.75918	.	0.000000	0.50627	U	0.000109	T	0.21550	0.0519	L	0.42245	1.32	0.51482	D	0.999929	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	P;D;D;D	0.91635	0.888;0.999;0.994;0.98	T	0.04294	-1.0962	10	0.15066	T	0.55	.	19.0652	0.93108	0.0:1.0:0.0:0.0	.	524;524;524;524	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	H	525;525;524;524;524;525;524;340;340;333	ENSP00000426975:P525H;ENSP00000367651:P525H;ENSP00000407968:P524H;ENSP00000405253:P524H;ENSP00000367643:P524H;ENSP00000421400:P525H;ENSP00000270722:P524H;ENSP00000422504:P340H;ENSP00000425796:P333H	ENSP00000270722:P524H	P	+	2	0	PRDM16	3318192	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.793000	0.62474	2.526000	0.85167	0.603000	0.83216	CCC	-	NULL		0.706	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM16	protein_coding	OTTHUMT00000001382.3	C	NM_022114	-		3328332	+1	no_errors	ENST00000270722	ensembl	human	known	74_37	missense	SNP	1.000	A
CDON	50937	genome.wustl.edu	37	11	125867223	125867223	+	Silent	SNP	C	C	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:125867223C>G	ENST00000392693.3	-	12	2368	c.2241G>C	c.(2239-2241)ggG>ggC	p.G747G	CDON_ENST00000531738.1_Silent_p.G124G|CDON_ENST00000263577.7_Silent_p.G747G	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	747	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TTGGAGAACCCCCGTTTGCCC	0.507																																																	0								ENSG00000064309						108.0	84.0	92.0					11																	125867223		2201	4299	6500	CDON	SO:0001819	synonymous_variant	0			-	HGNC	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.2241G>C	11.37:g.125867223C>G		Somatic	0	118	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	44	38.03	O14631	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G747	ENST00000392693.3	37	c.2241	CCDS58192.1	11																																																																																			-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.507	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDON	protein_coding	OTTHUMT00000386749.2	C	NM_016952	-		125867223	-1	no_errors	ENST00000392693	ensembl	human	known	74_37	silent	SNP	0.953	G
FGG	2266	genome.wustl.edu	37	4	155526029	155526029	+	Missense_Mutation	SNP	G	G	A	rs141597421		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr4:155526029G>A	ENST00000336098.3	-	9	1357	c.1319C>T	c.(1318-1320)gCg>gTg	p.A440V	FGG_ENST00000407946.1_Missense_Mutation_p.A448V|FGG_ENST00000404648.3_Intron|FGG_ENST00000405164.1_Intron	NM_021870.2	NP_068656.2	P02679	FIBG_HUMAN	fibrinogen gamma chain	440					blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TTCTGTTTCCGCAGGGTGCTC	0.423																																																	0								ENSG00000171557	A	,VAL/ALA	0,4406		0,0,2203	183.0	177.0	179.0		,1319	-0.6	0.0	4	dbSNP_134	179	1,8599	1.2+/-3.3	0,1,4299	yes	intron,missense	FGG	NM_000509.4,NM_021870.2	,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,benign	,440/454	155526029	1,13005	2203	4300	6503	FGG	SO:0001583	missense	0			-	HGNC		CCDS3788.1, CCDS47153.1	4q28	2014-09-17			ENSG00000171557	ENSG00000171557		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3694	protein-coding gene	gene with protein product		134850	"""fibrinogen, gamma polypeptide"""				Standard	NM_000509		Approved		uc003ioj.3	P02679	OTTHUMG00000150329	ENST00000336098.3:c.1319C>T	4.37:g.155526029G>A	ENSP00000336829:p.Ala440Val	Somatic	0	76	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	75	15.73	A8K057|P04469|P04470|Q53Y18|Q96A14|Q96KJ3|Q9UC62|Q9UC63|Q9UCF3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.A440V	ENST00000336098.3	37	c.1319	CCDS3788.1	4	.	.	.	.	.	.	.	.	.	.	g	0.293	-0.978712	0.02197	0.0	1.16E-4	ENSG00000171557	ENST00000336098;ENST00000407946	T;T	0.57107	0.47;0.42	4.85	-0.6	0.11642	.	0.432575	0.19944	N	0.102572	T	0.19967	0.0480	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.22034	-1.0228	10	0.02654	T	1	.	3.0702	0.06227	0.3715:0.3734:0.1586:0.0966	.	448;440	C9JC84;P02679	.;FIBG_HUMAN	V	440;448	ENSP00000336829:A440V;ENSP00000384552:A448V	ENSP00000336829:A440V	A	-	2	0	FGG	155745479	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.299000	0.08254	-0.411000	0.07530	-1.852000	0.00566	GCG	-	NULL		0.423	FGG-002	KNOWN	basic|CCDS	protein_coding	FGG	protein_coding	OTTHUMT00000317581.1	G	NM_021870	rs141597421		155526029	-1	no_errors	ENST00000336098	ensembl	human	known	74_37	missense	SNP	0.000	A
SHE	126669	genome.wustl.edu	37	1	154474064	154474064	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:154474064G>T	ENST00000304760.2	-	1	525	c.439C>A	c.(439-441)Ctc>Atc	p.L147I	TDRD10_ENST00000368482.4_5'Flank|TDRD10_ENST00000368480.3_5'Flank	NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	147										breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			ACCTTGATGAGCCTGTTGATG	0.642																																																	0								ENSG00000169291						129.0	104.0	112.0					1																	154474064		2203	4300	6503	SHE	SO:0001583	missense	0			-	HGNC	AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.439C>A	1.37:g.154474064G>T	ENSP00000307369:p.Leu147Ile	Somatic	0	28	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	22	29.03	Q8TEQ5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.L147I	ENST00000304760.2	37	c.439	CCDS30877.1	1	.	.	.	.	.	.	.	.	.	.	g	23.5	4.429660	0.83776	.	.	ENSG00000169291	ENST00000304760	T	0.32023	1.47	4.85	4.85	0.62838	.	0.075162	0.56097	D	0.000039	T	0.34135	0.0887	M	0.71581	2.175	0.32967	D	0.521877	D	0.58620	0.983	P	0.51016	0.656	T	0.35226	-0.9797	10	0.72032	D	0.01	-25.5219	15.5094	0.75769	0.0:0.0:1.0:0.0	.	147	Q5VZ18	SHE_HUMAN	I	147	ENSP00000307369:L147I	ENSP00000307369:L147I	L	-	1	0	SHE	152740688	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.765000	0.55272	2.504000	0.84457	0.556000	0.70494	CTC	-	NULL		0.642	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHE	protein_coding	OTTHUMT00000087910.2	G	NM_001010846	-		154474064	-1	no_errors	ENST00000304760	ensembl	human	known	74_37	missense	SNP	1.000	T
MBD3L1	85509	genome.wustl.edu	37	19	8953829	8953829	+	Missense_Mutation	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr19:8953829G>T	ENST00000595891.1	+	3	706	c.475G>T	c.(475-477)Ggg>Tgg	p.G159W	MBD3L1_ENST00000305625.2_Missense_Mutation_p.G159W			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	159					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						GAAACAGGAAGGGAAAGTGAA	0.493																																																	0								ENSG00000170948						44.0	40.0	41.0					19																	8953829		2203	4300	6503	MBD3L1	SO:0001583	missense	0			-	HGNC	AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.475G>T	19.37:g.8953829G>T	ENSP00000471575:p.Gly159Trp	Somatic	0	32	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	18	14.29	B5BUM6|Q2M291	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G159W	ENST00000595891.1	37	c.475	CCDS12209.1	19	.	.	.	.	.	.	.	.	.	.	G	0.208	-1.038667	0.02013	.	.	ENSG00000170948	ENST00000305625	T	0.41400	1.0	3.92	-1.94	0.07571	.	0.686997	0.12234	N	0.487128	T	0.19805	0.0476	N	0.16368	0.405	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.11567	-1.0582	10	0.39692	T	0.17	-11.3074	1.617	0.02705	0.4781:0.1334:0.257:0.1315	.	159	Q8WWY6	MB3L1_HUMAN	W	159	ENSP00000304198:G159W	ENSP00000304198:G159W	G	+	1	0	MBD3L1	8814829	0.000000	0.05858	0.187000	0.23214	0.078000	0.17371	-0.367000	0.07553	-0.949000	0.03663	-3.842000	0.00018	GGG	-	NULL		0.493	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L1	protein_coding	OTTHUMT00000459973.1	G	NM_145208	-		8953829	+1	no_errors	ENST00000305625	ensembl	human	known	74_37	missense	SNP	0.298	T
CENPBD1P1	65996	genome.wustl.edu	37	19	59110563	59110563	+	RNA	SNP	C	C	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr19:59110563C>G	ENST00000596427.1	-	0	159				AC016629.3_ENST00000596029.1_RNA																							ATGCTATCATCAAGTTTCCGC	0.527																																																	0								ENSG00000213753																																			RPL23AP79			0			-	HGNC																													19.37:g.59110563C>G		Somatic	0	16	0.00		0.6553633802850016	32	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	5	61.54		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000596427.1	37	NULL		19																																																																																			-	-		0.527	AC016629.3-001	KNOWN	basic	antisense	RPL23AP79	antisense	OTTHUMT00000466990.1	C		-		59110563	+1	no_errors	ENST00000473164	ensembl	human	known	74_37	rna	SNP	1.000	G
YME1L1	10730	genome.wustl.edu	37	10	27403538	27403538	+	Splice_Site	SNP	T	T	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr10:27403538T>C	ENST00000326799.3	-	19	2240		c.e19-2		YME1L1_ENST00000375972.3_Splice_Site|YME1L1_ENST00000376016.3_Splice_Site	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase						cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						AACTCCAAGCTAAAACCAAAA	0.343																																																	0								ENSG00000136758						80.0	77.0	78.0					10																	27403538		2203	4300	6503	YME1L1	SO:0001630	splice_region_variant	0			-	HGNC	AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.2092-2A>G	10.37:g.27403538T>C		Somatic	0	67	0.00		0.6553633802850016	3	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	38	15.56	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e19-2	ENST00000326799.3	37	c.2092-2	CCDS7152.1	10	.	.	.	.	.	.	.	.	.	.	T	14.94	2.686715	0.48097	.	.	ENSG00000136758	ENST00000376016;ENST00000326799;ENST00000375969;ENST00000375972;ENST00000546122	.	.	.	5.36	5.36	0.76844	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.648	0.77070	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	YME1L1	27443544	1.000000	0.71417	0.998000	0.56505	0.273000	0.26683	8.010000	0.88615	2.137000	0.66172	0.528000	0.53228	.	-	-		0.343	YME1L1-005	KNOWN	basic|CCDS	protein_coding	YME1L1	protein_coding	OTTHUMT00000047306.1	T	NM_139312	-	Intron	27403538	-1	no_errors	ENST00000326799	ensembl	human	known	74_37	splice_site	SNP	1.000	C
ZZZ3	26009	genome.wustl.edu	37	1	78031848	78031848	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:78031848C>T	ENST00000370801.3	-	14	2960	c.2485G>A	c.(2485-2487)Gaa>Aaa	p.E829K	ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Missense_Mutation_p.E335K	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	829					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						TGGATGGGTTCTATGCCACAG	0.383																																																	0								ENSG00000036549						54.0	52.0	53.0					1																	78031848		2203	4300	6503	ZZZ3	SO:0001583	missense	0			-	HGNC	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.2485G>A	1.37:g.78031848C>T	ENSP00000359837:p.Glu829Lys	Somatic	0	113	0.00		0.6553633802850016	39	25.00	13	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	107	14.40	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.E829K	ENST00000370801.3	37	c.2485	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.188424	0.78789	.	.	ENSG00000036549	ENST00000370801;ENST00000370798	D;D	0.91237	-2.81;-2.81	5.23	5.23	0.72850	Zinc finger, ZZ-type (4);	0.000000	0.85682	D	0.000000	D	0.92848	0.7725	L	0.49513	1.565	0.80722	D	1	P;D;D	0.63880	0.72;0.993;0.971	B;D;P	0.66716	0.35;0.946;0.783	D	0.92663	0.6143	10	0.54805	T	0.06	.	19.1896	0.93660	0.0:1.0:0.0:0.0	.	335;829;828	Q8IYH5-3;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	K	829;335	ENSP00000359837:E829K;ENSP00000359834:E335K	ENSP00000359834:E335K	E	-	1	0	ZZZ3	77804436	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.612000	0.82975	2.606000	0.88127	0.655000	0.94253	GAA	-	pfam_Znf_ZZ,pfscan_Znf_ZZ		0.383	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	protein_coding	OTTHUMT00000026615.1	C	NM_015534	-		78031848	-1	no_errors	ENST00000370801	ensembl	human	known	74_37	missense	SNP	1.000	T
ABCC8	6833	genome.wustl.edu	37	11	17449476	17449476	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:17449476T>A	ENST00000389817.3	-	15	2122	c.2054A>T	c.(2053-2055)tAc>tTc	p.Y685F	ABCC8_ENST00000302539.4_Missense_Mutation_p.Y685F|ABCC8_ENST00000528202.1_5'Flank			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	685	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CCACGTGAAGTAGCCTCCCAT	0.582																																																	0								ENSG00000006071						160.0	124.0	136.0					11																	17449476		2200	4293	6493	ABCC8	SO:0001583	missense	0			-	HGNC	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.2054A>T	11.37:g.17449476T>A	ENSP00000374467:p.Tyr685Phe	Somatic	0	61	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	34	10.53	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.Y685F	ENST00000389817.3	37	c.2054	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	T	7.874	0.728685	0.15507	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	D;D	0.90324	-2.65;-2.65	4.77	3.63	0.41609	ABC transporter-like (1);	0.122857	0.56097	N	0.000021	T	0.80154	0.4571	N	0.20445	0.575	0.27389	N	0.955204	B	0.02656	0.0	B	0.01281	0.0	T	0.62034	-0.6939	10	0.10377	T	0.69	.	9.4154	0.38519	0.821:0.0:0.0:0.179	.	685	Q09428	ABCC8_HUMAN	F	685;685;689	ENSP00000374467:Y685F;ENSP00000303960:Y685F	ENSP00000303960:Y685F	Y	-	2	0	ABCC8	17406052	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	2.655000	0.46707	0.829000	0.34733	0.459000	0.35465	TAC	-	superfamily_P-loop_NTPase,pfscan_ABC_transporter-like		0.582	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	protein_coding	OTTHUMT00000389093.1	T	NM_000352	-		17449476	-1	no_errors	ENST00000302539	ensembl	human	known	74_37	missense	SNP	1.000	A
SSH3	54961	genome.wustl.edu	37	11	67075346	67075346	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:67075346C>T	ENST00000308127.4	+	8	999	c.821C>T	c.(820-822)gCg>gTg	p.A274V	SSH3_ENST00000532181.1_3'UTR|SSH3_ENST00000308298.7_Missense_Mutation_p.A274V|SSH3_ENST00000376757.5_Missense_Mutation_p.A274V	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	274					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			ATGGAGCAGGCGATCCGTGCT	0.617																																																	0								ENSG00000172830						88.0	85.0	86.0					11																	67075346		2200	4295	6495	SSH3	SO:0001583	missense	0			-	HGNC	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.821C>T	11.37:g.67075346C>T	ENSP00000312081:p.Ala274Val	Somatic	0	52	0.00		0.6553633802850016	21	4.35	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	47	26.56	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.A274V	ENST00000308127.4	37	c.821	CCDS8157.1	11	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969552	0.34754	.	.	ENSG00000172830	ENST00000308127;ENST00000308298;ENST00000376757;ENST00000527821	T;T;T;T	0.28255	3.84;1.62;3.86;2.36	4.5	2.46	0.29980	DEK, C-terminal (1);	0.453451	0.20282	N	0.095438	T	0.10809	0.0264	N	0.12182	0.205	0.30879	N	0.731657	P;B	0.43477	0.808;0.009	B;B	0.36504	0.226;0.013	T	0.05305	-1.0893	10	0.11794	T	0.64	-22.2414	3.0869	0.06280	0.0:0.5033:0.2435:0.2532	.	128;274	Q8TE77-3;Q8TE77	.;SSH3_HUMAN	V	274;274;274;26	ENSP00000312081:A274V;ENSP00000310055:A274V;ENSP00000365948:A274V;ENSP00000433902:A26V	ENSP00000312081:A274V	A	+	2	0	SSH3	66831922	0.000000	0.05858	0.989000	0.46669	0.940000	0.58332	0.106000	0.15354	2.241000	0.73720	0.462000	0.41574	GCG	-	pfam_DEK_C		0.617	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH3	protein_coding	OTTHUMT00000393167.1	C	NM_018276	-		67075346	+1	no_errors	ENST00000308127	ensembl	human	known	74_37	missense	SNP	0.969	T
VPS13A	23230	genome.wustl.edu	37	9	79999548	79999550	+	Intron	DEL	TGA	TGA	-	rs142234061|rs373635958		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	TGA	TGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr9:79999548_79999550delTGA	ENST00000360280.3	+	68	9449				VPS13A_ENST00000376636.3_Intron|VPS13A_ENST00000357409.5_In_Frame_Del_p.D3089del	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)						cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GTAGCAGTAGtgatgatgatgat	0.33																																																	0								ENSG00000197969																																			VPS13A	SO:0001627	intron_variant	0				HGNC	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.9189+2545TGA>-	9.37:g.79999557_79999559delTGA		Somatic	0	20	0.00		0.6553633802850016	18	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	26	10.34	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_VPSAP_dom,pfam_Autophagy-rel_C	p.D3083in_frame_del	ENST00000360280.3	37	c.9237_9239	CCDS6655.1	9																																																																																			-	NULL		0.330	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	protein_coding	OTTHUMT00000052753.2	TGA	NM_015186			79999550	+1	no_errors	ENST00000357409	ensembl	human	known	74_37	in_frame_del	DEL	0.999:0.998:0.997	-
KIF1A	547	genome.wustl.edu	37	2	241700664	241700664	+	Missense_Mutation	SNP	G	G	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr2:241700664G>C	ENST00000320389.7	-	23	2378	c.2220C>G	c.(2218-2220)agC>agG	p.S740R	KIF1A_ENST00000498729.2_Missense_Mutation_p.S749R	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	740					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		TCAGCTCCACGCTGATGGCAT	0.587																																																	0								ENSG00000130294						156.0	171.0	166.0					2																	241700664		2121	4236	6357	KIF1A	SO:0001583	missense	0			-	HGNC	AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.2220C>G	2.37:g.241700664G>C	ENSP00000322791:p.Ser740Arg	Somatic	0	20	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	6	76.92	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S749R	ENST00000320389.7	37	c.2247	CCDS46561.1	2	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548094	0.65311	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.79940	-1.32;-1.32;-1.32	5.06	-2.51	0.06365	.	0.099960	0.64402	U	0.000002	D	0.88599	0.6480	M	0.90483	3.12	0.58432	D	0.999999	D;P;P	0.62365	0.991;0.874;0.585	D;P;B	0.66196	0.942;0.601;0.282	D	0.88501	0.3082	10	0.52906	T	0.07	.	13.1319	0.59387	0.7039:0.0:0.2961:0.0	.	749;749;740	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	R	740;749;749;749	ENSP00000322791:S740R;ENSP00000438388:S749R;ENSP00000384231:S749R	ENSP00000322791:S740R	S	-	3	2	KIF1A	241349337	0.002000	0.14202	0.994000	0.49952	0.991000	0.79684	-1.176000	0.03099	-0.235000	0.09767	-0.207000	0.12724	AGC	-	NULL		0.587	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	protein_coding	OTTHUMT00000324536.3	G	NM_138483	-		241700664	-1	no_errors	ENST00000498729	ensembl	human	known	74_37	missense	SNP	0.996	C
SYNM	23336	genome.wustl.edu	37	15	99670639	99670639	+	Silent	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr15:99670639C>T	ENST00000560674.1	+	4	1685	c.1216C>T	c.(1216-1218)Ctg>Ttg	p.L406L	SYNM_ENST00000328642.7_Silent_p.L691L|SYNM_ENST00000561323.1_3'UTR|SYNM_ENST00000336292.6_Silent_p.L691L|RP11-6O2.4_ENST00000566974.1_RNA			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	692	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						GGAGTCTAAACTGACTGAGGA	0.448																																					Pancreas(125;1071 1762 21750 40003 40381)												0								ENSG00000182253						84.0	83.0	83.0					15																	99670639		1977	4155	6132	SYNM	SO:0001819	synonymous_variant	0			-	HGNC	AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.1216C>T	15.37:g.99670639C>T		Somatic	0	28	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	3	70.00	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_IF	p.L691	ENST00000560674.1	37	c.2071		15																																																																																			-	NULL		0.448	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	SYNM	protein_coding	OTTHUMT00000415698.2	C	NM_145728	-		99670639	+1	no_errors	ENST00000336292	ensembl	human	known	74_37	silent	SNP	0.502	T
BTBD18	643376	genome.wustl.edu	37	11	57518618	57518618	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:57518618G>A	ENST00000436147.3	-	1	230	c.43C>T	c.(43-45)Cgg>Tgg	p.R15W	BTBD18_ENST00000422652.1_Missense_Mutation_p.R15W|TMX2-CTNND1_ENST00000528395.1_Intron|CTNND1_ENST00000524630.1_5'Flank|CTNND1_ENST00000529919.1_5'Flank|CTNND1_ENST00000399039.4_5'Flank|RP11-691N7.6_ENST00000531074.1_Intron			B2RXH4	BTBDI_HUMAN	BTB (POZ) domain containing 18	15										endometrium(3)|kidney(1)	4						CTGAGGAACCGGGGGTTCCTG	0.488																																																	0								ENSG00000233436						68.0	78.0	75.0					11																	57518618		692	1591	2283	BTBD18	SO:0001583	missense	0			-	HGNC		CCDS44603.1	11q12.1	2013-01-08			ENSG00000233436	ENSG00000233436		"""BTB/POZ domain containing"""	37214	protein-coding gene	gene with protein product							Standard	NM_001145101		Approved		uc010rjy.2	B2RXH4	OTTHUMG00000167203	ENST00000436147.3:c.43C>T	11.37:g.57518618G>A	ENSP00000397020:p.Arg15Trp	Somatic	0	32	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	39	9.30		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.R15W	ENST00000436147.3	37	c.43	CCDS44603.1	11	.	.	.	.	.	.	.	.	.	.	G	18.90	3.721104	0.68959	.	.	ENSG00000233436	ENST00000422652;ENST00000436147;ENST00000527995	T;T;T	0.22539	1.95;1.95;1.95	5.19	3.06	0.35304	BTB/POZ fold (1);	.	.	.	.	T	0.26231	0.0640	N	0.08118	0	0.25520	N	0.987374	D	0.89917	1.0	D	0.87578	0.998	T	0.27226	-1.0080	9	0.62326	D	0.03	.	12.935	0.58309	0.0:0.0:0.6953:0.3047	.	15	B2RXH4	BTBDI_HUMAN	W	15	ENSP00000394472:R15W;ENSP00000397020:R15W;ENSP00000432341:R15W	ENSP00000394472:R15W	R	-	1	2	BTBD18	57275194	0.998000	0.40836	0.891000	0.34965	0.986000	0.74619	1.297000	0.33400	1.159000	0.42565	0.655000	0.94253	CGG	-	superfamily_BTB/POZ_fold		0.488	BTBD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD18	protein_coding	OTTHUMT00000393718.2	G	NM_001145101	-		57518618	-1	no_errors	ENST00000422652	ensembl	human	known	74_37	missense	SNP	0.951	A
RAI1	10743	genome.wustl.edu	37	17	17697102	17697102	+	Frame_Shift_Del	DEL	G	G	-	rs398124422|rs34083643|rs398124421|rs587780431		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr17:17697102delG	ENST00000353383.1	+	3	1309	c.840delG	c.(838-840)cagfs	p.Q291fs	RAI1_ENST00000261641.6_Frame_Shift_Del_p.Q291fs	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	291	Gln-rich.|Poly-Gln.				circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)	p.Q280fs*84(1)		breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		ACcagcagcagcagcagcagc	0.627																																																	1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)						ENSG00000108557						20.0	25.0	23.0					17																	17697102		2038	4033	6071	RAI1	SO:0001589	frameshift_variant	0				HGNC	AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.840delG	17.37:g.17697102delG	ENSP00000323074:p.Gln291fs	Somatic	0	48	0.00		0.6553633802850016	7	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	63	18.18	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	smart_Znf_PHD	p.Q280fs	ENST00000353383.1	37	c.840	CCDS11188.1	17																																																																																			-	NULL		0.627	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	protein_coding	OTTHUMT00000131775.1	G	NM_030665			17697102	+1	no_errors	ENST00000353383	ensembl	human	known	74_37	frame_shift_del	DEL	0.993	-
FAM174A	345757	genome.wustl.edu	37	5	99871501	99871501	+	Silent	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr5:99871501C>T	ENST00000312637.4	+	1	493	c.267C>T	c.(265-267)gcC>gcT	p.A89A	CTD-2001C12.1_ENST00000499025.1_lincRNA	NM_198507.1	NP_940909.1	Q8TBP5	F174A_HUMAN	family with sequence similarity 174, member A	89						integral component of membrane (GO:0016021)				breast(2)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ACCCTGTGGCCGGGCTTGAGA	0.721																																																	0								ENSG00000174132						13.0	16.0	15.0					5																	99871501		2193	4291	6484	FAM174A	SO:0001819	synonymous_variant	0			-	HGNC	AY359108	CCDS4090.1	5q21.1	2008-06-19	2008-06-19	2008-06-19	ENSG00000174132	ENSG00000174132			24943	protein-coding gene	gene with protein product			"""transmembrane protein 157"""	TMEM157		12975309	Standard	NM_198507		Approved	UNQ1912	uc003knj.1	Q8TBP5	OTTHUMG00000128726	ENST00000312637.4:c.267C>T	5.37:g.99871501C>T		Somatic	0	38	0.00		0.6553633802850016	43	20.00	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	38	13.64	A8K0H4	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF1180	p.A89	ENST00000312637.4	37	c.267	CCDS4090.1	5																																																																																			-	pfam_DUF1180		0.721	FAM174A-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FAM174A	protein_coding	OTTHUMT00000250631.2	C	NM_198507	-		99871501	+1	no_errors	ENST00000312637	ensembl	human	known	74_37	silent	SNP	0.220	T
CHRFAM7A	89832	genome.wustl.edu	37	15	30650474	30650474	+	IGR	SNP	C	C	T	rs370532030		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr15:30650474C>T	ENST00000397827.3	-	0	2794				Y_RNA_ENST00000459414.1_RNA|RP11-382B18.4_ENST00000602453.1_lincRNA	NM_148911.1	NP_683709.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion							integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		agtttgagaacacacagatac	0.368																																																	0								ENSG00000270173																																			RP11-382B18.4	SO:0001628	intergenic_variant	0			-	Clone_based_vega_gene	AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645		15.37:g.30650474C>T		Somatic	0	12	0.00		0.6553633802850016	2	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	5	54.55	A8KAB9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000397827.3	37	NULL	CCDS42008.1	15																																																																																			-	-		0.368	CHRFAM7A-201	KNOWN	basic|CCDS	protein_coding	ENSG00000270173	protein_coding		C	NM_148911	-		30650474	-1	no_errors	ENST00000602453	ensembl	human	known	74_37	rna	SNP	0.012	T
DAZL	1618	genome.wustl.edu	37	3	16638396	16638396	+	Splice_Site	SNP	C	C	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr3:16638396C>A	ENST00000399444.2	-	6	652	c.359G>T	c.(358-360)tGt>tTt	p.C120F	DAZL_ENST00000250863.8_Splice_Site_p.C140F	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	120	Homodimerization. {ECO:0000250}.				female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)		RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						ATGATAAGCACCTTTTTGAAA	0.338																																																	0								ENSG00000092345						130.0	124.0	126.0					3																	16638396		2046	4233	6279	DAZL	SO:0001630	splice_region_variant	0			-	HGNC	BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.359-1G>T	3.37:g.16638396C>A		Somatic	0	231	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	114	143	44.36	O15396|Q5HYB4|Q92909	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.C120F	ENST00000399444.2	37	c.359	CCDS43059.1	3	.	.	.	.	.	.	.	.	.	.	C	15.45	2.838424	0.51057	.	.	ENSG00000092345	ENST00000250863;ENST00000399444;ENST00000454457	T;T;T	0.34472	1.36;1.86;1.36	4.54	4.54	0.55810	.	0.057881	0.64402	D	0.000001	T	0.53883	0.1824	M	0.75264	2.295	0.46981	D	0.999273	D;D	0.59357	0.985;0.985	P;P	0.58780	0.786;0.845	T	0.56396	-0.7986	10	0.62326	D	0.03	.	13.0961	0.59192	0.0:1.0:0.0:0.0	.	120;140	Q92904;Q5HYB4	DAZL_HUMAN;.	F	140;120;158	ENSP00000250863:C140F;ENSP00000382373:C120F;ENSP00000398109:C158F	ENSP00000250863:C140F	C	-	2	0	DAZL	16613400	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.512000	0.45485	2.813000	0.96785	0.609000	0.83330	TGT	-	NULL		0.338	DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAZL	protein_coding	OTTHUMT00000347261.2	C	NM_001351	-	Missense_Mutation	16638396	-1	no_errors	ENST00000399444	ensembl	human	known	74_37	missense	SNP	1.000	A
PKHD1L1	93035	genome.wustl.edu	37	8	110516561	110516561	+	Missense_Mutation	SNP	A	A	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr8:110516561A>C	ENST00000378402.5	+	68	10938	c.10834A>C	c.(10834-10836)Aca>Cca	p.T3612P		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3612					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTTAGGTTCAACATTTGTTGG	0.294										HNSCC(38;0.096)																																							0								ENSG00000205038						73.0	71.0	72.0					8																	110516561		1816	4056	5872	PKHD1L1	SO:0001583	missense	0			-	HGNC	AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10834A>C	8.37:g.110516561A>C	ENSP00000367655:p.Thr3612Pro	Somatic	0	66	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	24	33.33	Q567P2|Q9UF27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.T3612P	ENST00000378402.5	37	c.10834	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	A	18.25	3.582970	0.65992	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.88431	-2.38;-2.15	5.71	5.71	0.89125	.	0.240153	0.33253	N	0.005113	D	0.90913	0.7144	M	0.81341	2.54	0.28232	N	0.92605	P	0.38395	0.629	B	0.43331	0.416	D	0.87964	0.2732	10	0.59425	D	0.04	.	13.9301	0.63989	1.0:0.0:0.0:0.0	.	3612	Q86WI1	PKHL1_HUMAN	P	3612;540	ENSP00000367655:T3612P;ENSP00000437376:T540P	ENSP00000367655:T3612P	T	+	1	0	PKHD1L1	110585737	0.998000	0.40836	0.999000	0.59377	0.964000	0.63967	4.720000	0.61944	2.171000	0.68590	0.533000	0.62120	ACA	-	NULL		0.294	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	protein_coding	OTTHUMT00000381017.1	A	NM_177531	-		110516561	+1	no_errors	ENST00000378402	ensembl	human	known	74_37	missense	SNP	0.996	C
GPAA1	8733	genome.wustl.edu	37	8	145139735	145139735	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr8:145139735A>G	ENST00000355091.4	+	8	1242	c.1121A>G	c.(1120-1122)tAc>tGc	p.Y374C	GPAA1_ENST00000361036.6_Missense_Mutation_p.Y314C	NM_003801.3	NP_003792.1	O43292	GPAA1_HUMAN	glycosylphosphatidylinositol anchor attachment 1	374					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein complex assembly (GO:0006461)|protein retention in ER lumen (GO:0006621)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|membrane (GO:0016020)	tubulin binding (GO:0015631)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(2)	19	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.02e-40)|all cancers(56;2.11e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ATCGGCCTCTACATGCCCGCT	0.597																																																	0								ENSG00000197858						108.0	118.0	115.0					8																	145139735		2008	4175	6183	GPAA1	SO:0001583	missense	0			-	HGNC	AB006969	CCDS43776.1	8q24.3	2012-12-10	2012-12-10		ENSG00000197858	ENSG00000197858			4446	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	603048	"""anchor attachment protein 1 (Gaa1p, yeast) homolog"", ""GPAA1P anchor attachment protein 1 homolog (yeast)"", ""glycosylphosphatidylinositol anchor attachment protein 1 homolog (yeast)"""			9828142	Standard	NM_003801		Approved	GAA1, hGAA1	uc003zax.3	O43292	OTTHUMG00000165438	ENST00000355091.4:c.1121A>G	8.37:g.145139735A>G	ENSP00000347206:p.Tyr374Cys	Somatic	0	30	0.00		0.6553633802850016	275	22.91	82	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	26	23.53	Q9NSS0|Q9UQ31	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Gaa1,pirsf_GPI_prot_transamidse_cplx_GAA1	p.Y374C	ENST00000355091.4	37	c.1121	CCDS43776.1	8	.	.	.	.	.	.	.	.	.	.	A	21.2	4.118330	0.77323	.	.	ENSG00000197858	ENST00000355091;ENST00000361036	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.84288	0.5439	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.87551	0.2465	9	0.87932	D	0	-20.695	13.408	0.60924	1.0:0.0:0.0:0.0	.	374;314	O43292;O43292-2	GPAA1_HUMAN;.	C	374;314	.	ENSP00000347206:Y374C	Y	+	2	0	GPAA1	145211723	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.356000	0.90085	2.046000	0.60703	0.533000	0.62120	TAC	-	pfam_Gaa1,pirsf_GPI_prot_transamidse_cplx_GAA1		0.597	GPAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAA1	protein_coding	OTTHUMT00000384070.1	A	NM_003801	-		145139735	+1	no_errors	ENST00000355091	ensembl	human	known	74_37	missense	SNP	1.000	G
ZZZ3	26009	genome.wustl.edu	37	1	78031803	78031803	+	Missense_Mutation	SNP	C	C	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:78031803C>G	ENST00000370801.3	-	14	3005	c.2530G>C	c.(2530-2532)Gaa>Caa	p.E844Q	ZZZ3_ENST00000476275.1_5'UTR|ZZZ3_ENST00000370798.1_Missense_Mutation_p.E350Q	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	844					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						AAAGACATTTCTGGAGGACAA	0.393																																																	0								ENSG00000036549						63.0	60.0	61.0					1																	78031803		2203	4300	6503	ZZZ3	SO:0001583	missense	0			-	HGNC	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.2530G>C	1.37:g.78031803C>G	ENSP00000359837:p.Glu844Gln	Somatic	0	101	0.00		0.6553633802850016	30	36.17	17	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	97	15.52	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.E844Q	ENST00000370801.3	37	c.2530	CCDS677.1	1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897293	0.33535	.	.	ENSG00000036549	ENST00000370801;ENST00000370798	D;D	0.90324	-2.65;-2.65	5.23	5.23	0.72850	Zinc finger, ZZ-type (4);	0.117822	0.56097	D	0.000023	T	0.75576	0.3868	N	0.12961	0.28	0.49051	D	0.999749	B;B;B	0.31153	0.004;0.31;0.069	B;B;B	0.28553	0.006;0.091;0.031	T	0.77550	-0.2546	10	0.42905	T	0.14	.	14.7606	0.69604	0.0:0.8559:0.1441:0.0	.	350;844;843	Q8IYH5-3;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	Q	844;350	ENSP00000359837:E844Q;ENSP00000359834:E350Q	ENSP00000359834:E350Q	E	-	1	0	ZZZ3	77804391	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.811000	0.69187	2.606000	0.88127	0.655000	0.94253	GAA	-	pfam_Znf_ZZ,pfscan_Znf_ZZ		0.393	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	protein_coding	OTTHUMT00000026615.1	C	NM_015534	-		78031803	-1	no_errors	ENST00000370801	ensembl	human	known	74_37	missense	SNP	1.000	G
SLC26A9	115019	genome.wustl.edu	37	1	205892290	205892290	+	Missense_Mutation	SNP	T	T	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:205892290T>G	ENST00000367135.3	-	16	1806	c.1693A>C	c.(1693-1695)Aag>Cag	p.K565Q	SLC26A9_ENST00000340781.4_Missense_Mutation_p.K565Q|SLC26A9_ENST00000367134.2_Missense_Mutation_p.K565Q	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	565	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			TATTTTTGCTTGGCTAGTAAT	0.507																																																	0								ENSG00000174502						177.0	158.0	164.0					1																	205892290		2203	4300	6503	SLC26A9	SO:0001583	missense	0			-	HGNC	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.1693A>C	1.37:g.205892290T>G	ENSP00000356103:p.Lys565Gln	Somatic	0	51	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	10	60.00	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.K565Q	ENST00000367135.3	37	c.1693	CCDS30990.1	1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.055742	0.75960	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.93426	-3.22;-3.17;-3.22	5.49	5.49	0.81192	Sulphate transporter/antisigma-factor antagonist STAS (3);	0.122556	0.53938	D	0.000056	D	0.95185	0.8439	M	0.70275	2.135	0.38984	D	0.959002	P;D	0.61080	0.896;0.989	P;P	0.57371	0.602;0.819	D	0.95573	0.8640	10	0.48119	T	0.1	.	14.4373	0.67290	0.0:0.0:0.0:1.0	.	565;565	Q7LBE3;B1AVM8	S26A9_HUMAN;.	Q	565	ENSP00000341682:K565Q;ENSP00000356103:K565Q;ENSP00000356102:K565Q	ENSP00000341682:K565Q	K	-	1	0	SLC26A9	204158913	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.657000	0.54474	2.076000	0.62316	0.533000	0.62120	AAG	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt		0.507	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A9	protein_coding	OTTHUMT00000087742.1	T	NM_052934	-		205892290	-1	no_errors	ENST00000340781	ensembl	human	known	74_37	missense	SNP	1.000	G
BCAS3	54828	genome.wustl.edu	37	17	59104259	59104260	+	Frame_Shift_Ins	INS	-	-	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr17:59104259_59104260insA	ENST00000390652.5	+	17	1701_1702	c.1670_1671insA	c.(1669-1674)ataaaafs	p.IK557fs	BCAS3_ENST00000407086.3_Intron|BCAS3_ENST00000585744.1_Frame_Shift_Ins_p.IK328fs|BCAS3_ENST00000588874.1_Intron|BCAS3_ENST00000588462.1_Frame_Shift_Ins_p.IK557fs|BCAS3_ENST00000408905.3_Intron|BCAS3_ENST00000589222.1_Intron	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TGTTTTTCCATAAAAGCCCCAT	0.386																																																	0								ENSG00000141376																																			BCAS3	SO:0001589	frameshift_variant	0				HGNC	AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.1674dupA	17.37:g.59104263_59104263dupA	ENSP00000375067:p.Ile557fs	Somatic	0	110	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	34	33.33		Frame_Shift_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_BCAS3,pfam_WD40_repeat	p.A559fs	ENST00000390652.5	37	c.1670_1671	CCDS45749.1	17																																																																																			-	pfam_BCAS3		0.386	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	protein_coding	OTTHUMT00000449578.1	-	NM_017679			59104260	+1	no_errors	ENST00000390652	ensembl	human	known	74_37	frame_shift_ins	INS	1.000:1.000	A
DGKG	1608	genome.wustl.edu	37	3	185867916	185867916	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr3:185867916A>G	ENST00000265022.3	-	25	2878	c.2339T>C	c.(2338-2340)tTc>tCc	p.F780S	DGKG_ENST00000544847.1_Missense_Mutation_p.F721S|DGKG_ENST00000447054.1_Intron|DGKG_ENST00000382164.4_Missense_Mutation_p.F741S|DGKG_ENST00000344484.4_Missense_Mutation_p.F755S	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	780					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CAACGAGAAGAAGCTGCTCTT	0.438																																																	0								ENSG00000058866						82.0	71.0	75.0					3																	185867916		2203	4300	6503	DGKG	SO:0001583	missense	0			-	HGNC	AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.2339T>C	3.37:g.185867916A>G	ENSP00000265022:p.Phe780Ser	Somatic	0	44	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	33	29.79	B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.F780S	ENST00000265022.3	37	c.2339	CCDS3274.1	3	.	.	.	.	.	.	.	.	.	.	A	16.97	3.268553	0.59540	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000382164;ENST00000544847	D;D;D;D	0.84589	-1.71;-1.69;-1.87;-1.54	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.89076	0.6612	L	0.45352	1.415	0.54753	D	0.999987	D;D;D;D	0.69078	0.997;0.997;0.997;0.995	D;D;D;D	0.78314	0.991;0.991;0.991;0.979	D	0.88801	0.3285	10	0.46703	T	0.11	.	14.1509	0.65384	1.0:0.0:0.0:0.0	.	721;755;741;780	F5GX27;P49619-2;P49619-3;P49619	.;.;.;DGKG_HUMAN	S	780;755;741;721	ENSP00000265022:F780S;ENSP00000339777:F755S;ENSP00000371599:F741S;ENSP00000440507:F721S	ENSP00000265022:F780S	F	-	2	0	DGKG	187350610	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.079000	0.71291	2.330000	0.79161	0.528000	0.53228	TTC	-	NULL		0.438	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	protein_coding	OTTHUMT00000344800.3	A		-		185867916	-1	no_errors	ENST00000265022	ensembl	human	known	74_37	missense	SNP	1.000	G
CHRNA4	1137	genome.wustl.edu	37	20	61982044	61982044	+	Missense_Mutation	SNP	C	C	T	rs78695425	byFrequency	TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr20:61982044C>T	ENST00000370263.4	-	5	940	c.719G>A	c.(718-720)cGg>cAg	p.R240Q	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	240					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	CGGCAGCCGCCGGATGACGAA	0.607																																																	0								ENSG00000101204						210.0	162.0	178.0					20																	61982044		2203	4299	6502	CHRNA4	SO:0001583	missense	0			-	HGNC		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.719G>A	20.37:g.61982044C>T	ENSP00000359285:p.Arg240Gln	Somatic	0	27	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	17	37.04	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R240Q	ENST00000370263.4	37	c.719	CCDS13517.1	20	.	.	.	.	.	.	.	.	.	.	C	33	5.214450	0.95104	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.79033	-1.23	4.91	4.91	0.64330	Neurotransmitter-gated ion-channel ligand-binding (3);	0.052668	0.64402	N	0.000001	D	0.87289	0.6140	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.87578	0.998;0.802	D	0.88888	0.3344	10	0.87932	D	0	.	18.0833	0.89449	0.0:1.0:0.0:0.0	.	169;240	Q4VAQ5;P43681	.;ACHA4_HUMAN	Q	146;240;169	ENSP00000359285:R240Q	ENSP00000359280:R146Q	R	-	2	0	CHRNA4	61452488	1.000000	0.71417	0.998000	0.56505	0.903000	0.53119	5.913000	0.69957	2.240000	0.73641	0.655000	0.94253	CGG	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel		0.607	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA4	protein_coding	OTTHUMT00000080508.3	C		rs78695425		61982044	-1	no_errors	ENST00000370263	ensembl	human	known	74_37	missense	SNP	1.000	T
XPO4	64328	genome.wustl.edu	37	13	21476857	21476857	+	Frame_Shift_Del	DEL	C	C	-	rs372982570		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr13:21476857delC	ENST00000255305.6	-	1	92	c.21delG	c.(19-21)gggfs	p.G7fs	XPO4_ENST00000490513.1_5'UTR|XPO4_ENST00000400602.2_Frame_Shift_Del_p.G7fs			Q9C0E2	XPO4_HUMAN	exportin 4	7					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		CTTCTGGGGGCCCCAGCGCCG	0.711																																																	0								ENSG00000132953			1,3563		0,1,1781	15.0	20.0	18.0			3.3	1.0	13		6	1,7829		0,1,3914	no	frameshift	XPO4	NM_022459.4		0,2,5695	A1A1,A1R,RR		0.0128,0.0281,0.0176			21476857	2,11392	1856	4093	5949	XPO4	SO:0001589	frameshift_variant	0				HGNC	AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.21delG	13.37:g.21476857delC	ENSP00000255305:p.Gly7fs	Somatic	0	27	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	12	14.29	Q5VUZ5|Q8N3V6|Q9H934	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_ARM-type_fold	p.P9fs	ENST00000255305.6	37	c.21	CCDS41872.1	13																																																																																			-	superfamily_ARM-type_fold		0.711	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	protein_coding	OTTHUMT00000044096.1	C	NM_022459			21476857	-1	no_errors	ENST00000255305	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
RBMS1	5937	genome.wustl.edu	37	2	161130978	161130982	+	3'UTR	DEL	TTTTC	TTTTC	-	rs201326280|rs200119683	byFrequency	TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	TTTTC	TTTTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr2:161130978_161130982delTTTTC	ENST00000348849.3	-	0	1952_1956				RBMS1_ENST00000409075.1_3'UTR|ITGB6_ENST00000485635.1_5'Flank|RBMS1_ENST00000409289.2_3'UTR|RBMS1_ENST00000474820.1_5'UTR	NM_002897.4|NM_016836.3	NP_002888.1|NP_058520.1	P29558	RBMS1_HUMAN	RNA binding motif, single stranded interacting protein 1						DNA replication (GO:0006260)|RNA processing (GO:0006396)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)		PLA2R1/RBMS1(2)								ttctttttttttttctttttctttt	0.288																																																	0								ENSG00000153250																																			RBMS1	SO:0001624	3_prime_UTR_variant	0				HGNC	D28482	CCDS2213.1	2q24.2	2013-02-12			ENSG00000153250	ENSG00000153250		"""RNA binding motif (RRM) containing"""	9907	protein-coding gene	gene with protein product	"""suppressor of cdc 2 (cdc13) with RNA binding motif 2"", ""c-myc gene single strand binding protein 2"""	602310	"""chromosome 2 open reading frame 12"""	C2orf12		8041632, 8134115, 7838710	Standard	NM_016836		Approved	SCR2, MSSP-1, MSSP-2, MSSP-3, YC1, HCC-4, DKFZp564H0764	uc002ubo.3	P29558	OTTHUMG00000132031	ENST00000348849.3:c.*305GAAAA>-	2.37:g.161130978_161130982delTTTTC		Somatic	NA	NA	NA		0.6553633802850016	88	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q14869|Q15433|Q53P46|Q53QX8|Q53RG6|Q8WV20	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000348849.3	37	NULL	CCDS2213.1	2																																																																																			-	-		0.288	RBMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMS1	protein_coding	OTTHUMT00000255043.4	TTTTC	NM_016836			161130982	-1	no_errors	ENST00000474820	ensembl	human	known	74_37	rna	DEL	0.008:0.121:0.138:0.129:0.057	-
LOXHD1	125336	genome.wustl.edu	37	18	44069031	44069031	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr18:44069031A>G	ENST00000398722.4	-	31	5118	c.5119T>C	c.(5119-5121)Tgt>Cgt	p.C1707R	LOXHD1_ENST00000582408.1_Missense_Mutation_p.C812R|LOXHD1_ENST00000300591.6_Missense_Mutation_p.C874R|LOXHD1_ENST00000398686.4_Missense_Mutation_p.C224R|LOXHD1_ENST00000398705.2_Missense_Mutation_p.C224R|LOXHD1_ENST00000441893.2_Missense_Mutation_p.C856R|LOXHD1_ENST00000579038.1_Missense_Mutation_p.C778R|LOXHD1_ENST00000536736.1_Missense_Mutation_p.C1923R|LOXHD1_ENST00000441551.2_Missense_Mutation_p.C1779R			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1707	PLAT 12. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						CAGCAGTCACACTGGAAGTGG	0.547																																																	0								ENSG00000167210						101.0	91.0	94.0					18																	44069031		692	1591	2283	LOXHD1	SO:0001583	missense	0			-	HGNC	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.5119T>C	18.37:g.44069031A>G	ENSP00000381707:p.Cys1707Arg	Somatic	0	71	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	36	12.20	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.C1923R	ENST00000398722.4	37	c.5767		18	.	.	.	.	.	.	.	.	.	.	A	14.50	2.554869	0.45487	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000398705;ENST00000536736;ENST00000441893;ENST00000398686	T;T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49;-0.49	5.58	5.58	0.84498	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	.	.	.	.	D	0.89636	0.6772	H	0.97707	4.06	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.87578	0.998;0.997;0.998	D	0.93098	0.6506	9	0.87932	D	0	.	14.7389	0.69437	1.0:0.0:0.0:0.0	.	1923;856;1707	F5GZB4;F8WA52;Q8IVV2	.;.;LOXH1_HUMAN	R	874;1707;224;1923;856;224	ENSP00000300591:C874R;ENSP00000381707:C1707R;ENSP00000381692:C224R;ENSP00000444586:C1923R;ENSP00000409062:C856R;ENSP00000381676:C224R	ENSP00000300591:C874R	C	-	1	0	LOXHD1	42323029	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	8.904000	0.92590	2.111000	0.64477	0.533000	0.62120	TGT	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom		0.547	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	protein_coding		A	NM_144612	-		44069031	-1	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	SNP	1.000	G
TMEM229A	730130	genome.wustl.edu	37	7	123672457	123672462	+	In_Frame_Del	DEL	GCTGCT	GCTGCT	-	rs71163719|rs374529977|rs566327350|rs72310362	byFrequency	TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	GCTGCT	GCTGCT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr7:123672457_123672462delGCTGCT	ENST00000455783.1	-	1	1061_1066	c.596_601delAGCAGC	c.(595-603)cagcagcgg>cgg	p.QQ199del	RP5-921G16.1_ENST00000484322.1_RNA	NM_001136002.1	NP_001129474.1	B2RXF0	T229A_HUMAN	transmembrane protein 229A	199						host cell nucleus (GO:0042025)|integral component of membrane (GO:0016021)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)	6						GCGCCCCTCCgctgctgctgctgctg	0.757														714	0.142572	0.3026	0.0908	5008	,	,		13703	0.002		0.1282	False		,,,				2504	0.1227																0								ENSG00000234224			16,422,143,1041		8,0,0,0,177,9,59,56,22,480						-4.0	0.0			3	5,438,299,2868		1,0,0,3,176,3,83,104,88,1347	no	codingComplex	TMEM229A	NM_001136002.1		9,0,0,3,353,12,142,160,110,1827	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		20.554,35.82,25.2867				21,860,442,3909				TMEM229A	SO:0001651	inframe_deletion	0				HGNC	BC157828	CCDS47694.1	7q31.32	2009-09-22			ENSG00000234224	ENSG00000234224			37279	protein-coding gene	gene with protein product							Standard	NM_001136002		Approved		uc011kob.2	B2RXF0	OTTHUMG00000154762	ENST00000455783.1:c.596_601delAGCAGC	7.37:g.123672463_123672468delGCTGCT	ENSP00000395244:p.Gln199_Gln200del	Somatic	NA	NA	NA		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A4D0X6	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.QQ199in_frame_del	ENST00000455783.1	37	c.601_596	CCDS47694.1	7																																																																																			-	NULL		0.757	TMEM229A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM229A	protein_coding	OTTHUMT00000336960.3	GCTGCT	NM_001136002			123672462	-1	no_errors	ENST00000455783	ensembl	human	known	74_37	in_frame_del	DEL	0.000:0.000:0.001:0.388:0.445:0.475	-
TGM3	7053	genome.wustl.edu	37	20	2298099	2298099	+	Silent	SNP	A	A	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr20:2298099A>G	ENST00000381458.5	+	7	1014	c.951A>G	c.(949-951)ggA>ggG	p.G317G	TGM3_ENST00000463090.1_3'UTR	NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	317					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	ACCCCATGGGAAACCCCCTGG	0.512																																																	0								ENSG00000125780						218.0	203.0	208.0					20																	2298099		2203	4300	6503	TGM3	SO:0001819	synonymous_variant	0			-	HGNC	L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.951A>G	20.37:g.2298099A>G		Somatic	0	75	0.00		0.6553633802850016	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	47	11.32	A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.G317	ENST00000381458.5	37	c.951	CCDS33435.1	20																																																																																			-	pfam_Transglutaminase-like,smart_Transglutaminase-like		0.512	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM3	protein_coding	OTTHUMT00000077579.2	A	NM_003245	-		2298099	+1	no_errors	ENST00000381458	ensembl	human	known	74_37	silent	SNP	0.088	G
ZZZ3	26009	genome.wustl.edu	37	1	78030187	78030187	+	3'UTR	SNP	C	C	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr1:78030187C>G	ENST00000370801.3	-	0	4325				ZZZ3_ENST00000476275.1_5'Flank	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3						chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						AACAAGCATTCTATAATATAA	0.294																																																	0								ENSG00000036549																																			ZZZ3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.*1138G>C	1.37:g.78030187C>G		Somatic	0	55	0.00		0.6553633802850016	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	37	24.49	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000370801.3	37	NULL	CCDS677.1	1																																																																																			-	-		0.294	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZZ3	protein_coding	OTTHUMT00000026615.1	C	NM_015534	-		78030187	-1	no_errors	ENST00000481346	ensembl	human	known	74_37	rna	SNP	1.000	G
ANKRD26P1	124149	genome.wustl.edu	37	16	46513321	46513321	+	RNA	SNP	G	G	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr16:46513321G>T	ENST00000571006.1	-	0	1350							Q6NSI1	AR26L_HUMAN	ankyrin repeat domain 26 pseudogene 1																		CACTGCTTCTGTAAGATCAGC	0.313																																																	0								ENSG00000261239																																			ANKRD26P1			0			-	HGNC	BC070117		16q11.2	2014-03-18	2009-06-12		ENSG00000261239	ENSG00000261239			32955	pseudogene	pseudogene							Standard	NR_026556		Approved	FLJ43980	uc002eeb.3	Q6NSI1	OTTHUMG00000175593		16.37:g.46513321G>T		Somatic	0	31	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	20	13.04		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000571006.1	37	NULL		16																																																																																			-	-		0.313	ANKRD26P1-007	KNOWN	basic	processed_transcript	ANKRD26P1	pseudogene	OTTHUMT00000437932.1	G	NR_026556	-		46513321	-1	no_errors	ENST00000566201	ensembl	human	known	74_37	rna	SNP	0.761	T
KLC3	147700	genome.wustl.edu	37	19	45851923	45851923	+	Missense_Mutation	SNP	G	G	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr19:45851923G>A	ENST00000391946.2	+	6	901	c.799G>A	c.(799-801)Gaa>Aaa	p.E267K	KLC3_ENST00000585434.1_Missense_Mutation_p.E266K|KLC3_ENST00000470402.1_Missense_Mutation_p.E281K	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	267					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CAAGTACAAAGAAGCCACAGA	0.657																																																	0								ENSG00000104892						24.0	31.0	29.0					19																	45851923		1948	4131	6079	KLC3	SO:0001583	missense	0			-	HGNC	AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.799G>A	19.37:g.45851923G>A	ENSP00000375810:p.Glu267Lys	Somatic	0	81	0.00		0.6553633802850016	3	50.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	74	28.85	A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Kinesin_light	p.E281K	ENST00000391946.2	37	c.841	CCDS12660.2	19	.	.	.	.	.	.	.	.	.	.	G	26.1	4.704327	0.88924	.	.	ENSG00000104892	ENST00000391946;ENST00000470402	T;T	0.76578	-1.03;-1.03	3.05	3.05	0.35203	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.066735	0.56097	D	0.000026	D	0.82559	0.5063	L	0.58302	1.8	0.80722	D	1	P;P;D	0.53745	0.953;0.953;0.962	P;P;P	0.60345	0.742;0.799;0.873	D	0.84664	0.0708	10	0.87932	D	0	-9.5214	12.345	0.55116	0.0:0.0:1.0:0.0	.	266;281;267	Q6P597-2;Q6P597-3;Q6P597	.;.;KLC3_HUMAN	K	267;281	ENSP00000375810:E267K;ENSP00000436019:E281K	ENSP00000375810:E267K	E	+	1	0	KLC3	50543763	1.000000	0.71417	0.998000	0.56505	0.918000	0.54935	9.419000	0.97397	2.026000	0.59711	0.491000	0.48974	GAA	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.657	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLC3	protein_coding	OTTHUMT00000289776.1	G	NM_145275	-		45851923	+1	no_errors	ENST00000470402	ensembl	human	known	74_37	missense	SNP	1.000	A
WDR36	134430	genome.wustl.edu	37	5	110438084	110438084	+	Missense_Mutation	SNP	A	A	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr5:110438084A>G	ENST00000513710.2	+	6	755	c.751A>G	c.(751-753)Aca>Gca	p.T251A	WDR36_ENST00000506538.2_Missense_Mutation_p.T251A|WDR36_ENST00000505303.1_Missense_Mutation_p.T195A			Q8NI36	WDR36_HUMAN	WD repeat domain 36	251					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		AGTTGGAGTGACAGCTCTTCA	0.308																																																	0								ENSG00000134987						68.0	72.0	71.0					5																	110438084		2202	4298	6500	WDR36	SO:0001583	missense	0			-	HGNC	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.751A>G	5.37:g.110438084A>G	ENSP00000424628:p.Thr251Ala	Somatic	0	140	0.00		0.6553633802850016	1	50.00	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	89	24.58	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T251A	ENST00000513710.2	37	c.751	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	A	26.3	4.725803	0.89298	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303;ENST00000504122	T;T;T;T	0.39229	1.37;1.37;3.1;1.09	5.5	5.5	0.81552	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.046276	0.85682	D	0.000000	T	0.65575	0.2704	M	0.86178	2.8	0.80722	D	1	D	0.59767	0.986	P	0.60286	0.872	T	0.72669	-0.4223	10	0.87932	D	0	-19.0506	15.6163	0.76769	1.0:0.0:0.0:0.0	.	251	Q8NI36	WDR36_HUMAN	A	251;251;195;122	ENSP00000423067:T251A;ENSP00000424628:T251A;ENSP00000422158:T195A;ENSP00000426509:T122A	ENSP00000426509:T122A	T	+	1	0	WDR36	110465983	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.601000	0.74136	2.077000	0.62373	0.528000	0.53228	ACA	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.308	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	protein_coding	OTTHUMT00000373504.3	A	NM_139281	-		110438084	+1	no_errors	ENST00000506538	ensembl	human	known	74_37	missense	SNP	1.000	G
MICALCL	84953	genome.wustl.edu	37	11	12315442	12315442	+	Frame_Shift_Del	DEL	A	A	-			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:12315442delA	ENST00000256186.2	+	3	755	c.464delA	c.(463-465)gaafs	p.E155fs		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	155					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		GAAGACCGGGAAAAAGGGAGT	0.572																																																	0								ENSG00000133808						60.0	68.0	65.0					11																	12315442		1949	4131	6080	MICALCL	SO:0001589	frameshift_variant	0				HGNC	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.464delA	11.37:g.12315442delA	ENSP00000256186:p.Glu155fs	Somatic	0	36	0.00		0.6553633802850016	1	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	31	8.82	Q7RTP7|Q96JU6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_DUF3585,smart_ProQ/FinO	p.S158fs	ENST00000256186.2	37	c.464	CCDS41620.1	11																																																																																			-	NULL		0.572	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALCL	protein_coding	OTTHUMT00000386164.1	A	NM_032867			12315442	+1	no_errors	ENST00000256186	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
MYRIP	25924	genome.wustl.edu	37	3	40231809	40231809	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr3:40231809C>T	ENST00000302541.6	+	10	1862	c.1520C>T	c.(1519-1521)aCc>aTc	p.T507I	MYRIP_ENST00000444716.1_Missense_Mutation_p.T507I|MYRIP_ENST00000396217.3_Missense_Mutation_p.T418I|MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000425621.1_Missense_Mutation_p.T507I|MYRIP_ENST00000539167.1_Missense_Mutation_p.T320I	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	507	Actin-binding.|Myosin-binding.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		AGCAGGGAGACCTCGGACAGC	0.637																																																	0								ENSG00000170011						61.0	68.0	66.0					3																	40231809		2203	4300	6503	MYRIP	SO:0001583	missense	0			-	HGNC	AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.1520C>T	3.37:g.40231809C>T	ENSP00000301972:p.Thr507Ile	Somatic	0	24	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	23	46.51	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Myrip/Melanophilin,superfamily_Znf_FYVE_PHD,pfscan_Znf_FYVE-typ	p.T507I	ENST00000302541.6	37	c.1520	CCDS2689.1	3	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435314	0.62955	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621;ENST00000396217;ENST00000539167	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	5.94	3.94	0.45596	Myelin-associated oligodendrocytic basic protein (MOBP) (1);	0.395909	0.25408	N	0.030894	T	0.32436	0.0829	L	0.40543	1.245	0.28958	N	0.890017	D;D;D	0.62365	0.991;0.958;0.984	P;P;P	0.59424	0.857;0.663;0.825	T	0.07102	-1.0790	9	.	.	.	.	7.7165	0.28708	0.3082:0.5591:0.1328:0.0	.	418;507;507	Q32M42;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	I	507;507;507;418;320	ENSP00000398665:T507I;ENSP00000301972:T507I;ENSP00000389323:T507I;ENSP00000379519:T418I;ENSP00000438297:T320I	.	T	+	2	0	MYRIP	40206813	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	2.647000	0.46639	1.482000	0.48325	0.655000	0.94253	ACC	-	pfam_Myrip/Melanophilin		0.637	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	protein_coding	OTTHUMT00000254181.2	C	NM_015460	-		40231809	+1	no_errors	ENST00000302541	ensembl	human	known	74_37	missense	SNP	1.000	T
JPH2	57158	genome.wustl.edu	37	20	42789014	42789014	+	Missense_Mutation	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr20:42789014C>T	ENST00000372980.3	-	2	1285	c.413G>A	c.(412-414)cGc>cAc	p.R138H		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	138	Gly-rich.				calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GTAGCCATGGCGCATGCCGTT	0.711																																																	0								ENSG00000149596						22.0	12.0	15.0					20																	42789014		2086	4080	6166	JPH2	SO:0001583	missense	0			-	HGNC	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.413G>A	20.37:g.42789014C>T	ENSP00000362071:p.Arg138His	Somatic	0	76	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	32	63.64	E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.R138H	ENST00000372980.3	37	c.413	CCDS13325.1	20	.	.	.	.	.	.	.	.	.	.	c	21.3	4.133132	0.77662	.	.	ENSG00000149596	ENST00000372980	T	0.60040	0.22	3.34	3.34	0.38264	.	0.000000	0.85682	U	0.000000	T	0.73032	0.3535	M	0.66439	2.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77981	-0.2383	10	0.87932	D	0	.	14.8586	0.70362	0.0:1.0:0.0:0.0	.	138	Q9BR39	JPH2_HUMAN	H	138	ENSP00000362071:R138H	ENSP00000362071:R138H	R	-	2	0	JPH2	42222428	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	7.241000	0.78201	1.700000	0.51204	0.306000	0.20318	CGC	-	pfam_MORN,smart_MORN,pirsf_Junctophilin		0.711	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	protein_coding	OTTHUMT00000080307.1	C		-		42789014	-1	no_errors	ENST00000372980	ensembl	human	known	74_37	missense	SNP	1.000	T
CDK5RAP3	80279	genome.wustl.edu	37	17	46058946	46058946	+	3'UTR	SNP	C	C	T			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr17:46058946C>T	ENST00000338399.4	+	0	1705				CDK5RAP3_ENST00000536708.2_3'UTR|RP11-6N17.10_ENST00000578239.1_RNA|CDK5RAP3_ENST00000578663.1_3'UTR	NM_176096.1	NP_788276.1	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3						brain development (GO:0007420)|protein ufmylation (GO:0071569)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of neuron differentiation (GO:0045664)	membrane (GO:0016020)	protein kinase binding (GO:0019901)			NS(1)|central_nervous_system(2)|cervix(3)|endometrium(3)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	18						TTTTGGGGCCCTTCAAGGCAA	0.532																																																	0								ENSG00000108465																																			CDK5RAP3	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF110322	CCDS42356.1, CCDS62232.1	17q21.2	2008-07-18				ENSG00000108465			18673	protein-coding gene	gene with protein product	"""ischemic heart CDK5 activator-binding protein C53"", ""LXXLL/leucine-zipper-containing ARFbinding protein"""	608202				10721722	Standard	NM_176096		Approved	MST016, FLJ13660, C53, IC53, HSF-27, OK/SW-cl.114, LZAP	uc010wlc.3	Q96JB5		ENST00000338399.4:c.*78C>T	17.37:g.46058946C>T		Somatic	0	50	0.00		0.6553633802850016	67	45.60	57	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	34	26.09	B7Z6N4|D3DTU1|D3DTU2|F5H3I5|Q53FA2|Q9H3F8|Q9H8G0|Q9HBR9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000338399.4	37	NULL	CCDS42356.1	17																																																																																			-	-		0.532	CDK5RAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK5RAP3	protein_coding	OTTHUMT00000442913.1	C	NM_176096	-		46058946	+1	no_errors	ENST00000578663	ensembl	human	known	74_37	rna	SNP	0.000	T
CCKBR	887	genome.wustl.edu	37	11	6292222	6292222	+	Intron	SNP	G	G	A	rs200830731		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:6292222G>A	ENST00000334619.2	+	5	1004				CCKBR_ENST00000532715.1_Intron|CCKBR_ENST00000525462.1_Missense_Mutation_p.A334T|CCKBR_ENST00000532396.1_Intron	NM_176875.3	NP_795344.1	P32239	GASR_HUMAN	cholecystokinin B receptor						cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cholecystokinin signaling pathway (GO:0038188)|digestion (GO:0007586)|digestive tract development (GO:0048565)|feeding behavior (GO:0007631)|gastric acid secretion (GO:0001696)|gland development (GO:0048732)|metabolic process (GO:0008152)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|sensory perception (GO:0007600)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase regulator activity (GO:0046935)|cholecystokinin receptor activity (GO:0004951)|gastrin receptor activity (GO:0015054)|phosphatidylinositol phospholipase C activity (GO:0004435)|type B gastrin/cholecystokinin receptor binding (GO:0031741)			NS(2)|breast(2)|endometrium(4)|kidney(13)|large_intestine(10)|lung(22)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.139)	Pentagastrin(DB00183)	TTCTCTGACCGCCCACCCTTT	0.627																																																	0								ENSG00000110148						34.0	36.0	35.0					11																	6292222		2201	4296	6497	CCKBR	SO:0001627	intron_variant	0			-	HGNC	D13305	CCDS7761.1	11p15.4	2012-08-10			ENSG00000110148	ENSG00000110148		"""GPCR / Class A : Cholecystokinin receptors"""	1571	protein-coding gene	gene with protein product		118445				1280419	Standard	NM_176875		Approved		uc001mcp.3	P32239	OTTHUMG00000133380	ENST00000334619.2:c.812-19G>A	11.37:g.6292222G>A		Somatic	0	44	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	14	44.00	A8K7P9|O75824|Q16144|Q92492|Q96LC6|Q9NYK7|Q9UBV1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Gastrin_rcpt,prints_Cholcskin_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.A334T	ENST00000334619.2	37	c.1000	CCDS7761.1	11	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.900108	0.00517	.	.	ENSG00000110148	ENST00000525462	T	0.57907	0.37	4.69	-3.84	0.04256	.	.	.	.	.	T	0.25865	0.0630	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.16571	-1.0398	7	.	.	.	.	1.4907	0.02456	0.2903:0.3348:0.2488:0.1261	.	334	P32239-2	.	T	334	ENSP00000435534:A334T	.	A	+	1	0	CCKBR	6248798	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-2.894000	0.00707	-0.391000	0.07763	0.655000	0.94253	GCC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.627	CCKBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCKBR	protein_coding	OTTHUMT00000257230.2	G	NM_176875	rs200830731		6292222	+1	no_errors	ENST00000525462	ensembl	human	known	74_37	missense	SNP	0.000	A
AKR1CL1	340811	genome.wustl.edu	37	10	5199959	5199959	+	5'UTR	SNP	C	C	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr10:5199959C>G	ENST00000465430.1	-	0	105							Q5T2L2	AKCL1_HUMAN	aldo-keto reductase family 1, member C-like 1							cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6						CAATGGATTTCAAGATCGGCT	0.572																																					Ovarian(129;1623 1737 25446 28757 47467)												0								ENSG00000196326																																			AKR1CL1	SO:0001623	5_prime_UTR_variant	0			-	HGNC			10p15.2	2014-05-06			ENSG00000196326	ENSG00000264006			23469	protein-coding gene	gene with protein product						15164054	Standard	NR_027916		Approved		uc009xhz.2	Q5T2L2	OTTHUMG00000184213	ENST00000465430.1:c.-1422G>C	10.37:g.5199959C>G		Somatic	0	83	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	69	14.81	A6NF66|Q6ZN81	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.L69F	ENST00000465430.1	37	c.207		10	.	.	.	.	.	.	.	.	.	.	T	13.25	2.180699	0.38511	.	.	ENSG00000196326	ENST00000473890	T	0.29142	1.58	3.37	-3.03	0.05429	.	0.000000	0.41823	U	0.000815	T	0.25005	0.0607	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.24012	-1.0172	7	0.87932	D	0	.	3.9903	0.09533	0.2917:0.4955:0.1143:0.0985	.	.	.	.	F	69	ENSP00000417959:L69F	ENSP00000417959:L69F	L	-	3	2	AKR1CL1	5189959	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-3.545000	0.00435	-1.260000	0.02465	-1.603000	0.00810	TTG	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr		0.572	AKR1CL1-003	KNOWN	basic	processed_transcript	AKR1CL1	protein_coding	OTTHUMT00000356488.1	C	NR_027916	-		5199959	-1	no_errors	ENST00000473890	ensembl	human	novel	74_37	missense	SNP	0.000	G
SORBS1	10580	genome.wustl.edu	37	10	97131754	97131754	+	Missense_Mutation	SNP	C	C	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr10:97131754C>G	ENST00000361941.3	-	18	1816	c.1790G>C	c.(1789-1791)aGa>aCa	p.R597T	SORBS1_ENST00000371245.3_Missense_Mutation_p.R482T|SORBS1_ENST00000354106.3_Missense_Mutation_p.R567T|SORBS1_ENST00000306402.6_Intron|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000353505.5_Missense_Mutation_p.R482T|SORBS1_ENST00000393949.1_Missense_Mutation_p.R567T|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000371246.2_Missense_Mutation_p.R619T|SORBS1_ENST00000347291.4_Intron|SORBS1_ENST00000277982.5_Missense_Mutation_p.R619T|SORBS1_ENST00000371247.2_Missense_Mutation_p.R597T|SORBS1_ENST00000474353.2_Intron|SORBS1_ENST00000371227.4_Missense_Mutation_p.R551T|SORBS1_ENST00000607232.1_Intron	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1									p.R482T(1)|p.R597T(1)		NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TCTATCCTCTCTAGGAAGGAT	0.453																																																	2	Substitution - Missense(2)	lung(2)						ENSG00000095637						114.0	99.0	104.0					10																	97131754		2203	4300	6503	SORBS1	SO:0001583	missense	0			-	HGNC	AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.1790G>C	10.37:g.97131754C>G	ENSP00000355136:p.Arg597Thr	Somatic	0	42	0.00		0.6553633802850016	0	100.00	3	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	15	46.43		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.R597T	ENST00000361941.3	37	c.1790	CCDS31255.1	10	.	.	.	.	.	.	.	.	.	.	C	19.74	3.884333	0.72410	.	.	ENSG00000095637	ENST00000371245;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000361941;ENST00000277982;ENST00000354106	T;T;T;T;T;T;T;T;T	0.55234	0.53;3.09;3.06;3.42;2.96;0.53;3.09;3.42;2.96	5.69	5.69	0.88448	.	0.000000	0.42821	D	0.000644	T	0.58566	0.2131	N	0.19112	0.55	0.80722	D	1	D;D;D;D;P	0.76494	0.996;0.996;0.999;0.994;0.908	D;D;D;D;B	0.78314	0.99;0.944;0.991;0.919;0.436	T	0.61997	-0.6947	10	0.62326	D	0.03	-12.5268	14.6193	0.68572	0.1457:0.8543:0.0:0.0	.	551;482;597;619;567	Q9BX66-11;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-5	.;.;SRBS1_HUMAN;.;.	T	482;597;551;619;567;482;597;619;567	ENSP00000360291:R482T;ENSP00000360293:R597T;ENSP00000360271:R551T;ENSP00000360292:R619T;ENSP00000377521:R567T;ENSP00000343998:R482T;ENSP00000355136:R597T;ENSP00000277982:R619T;ENSP00000277984:R567T	ENSP00000277982:R619T	R	-	2	0	SORBS1	97121744	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.035000	0.49759	2.691000	0.91804	0.561000	0.74099	AGA	-	NULL		0.453	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	protein_coding	OTTHUMT00000049517.1	C		-		97131754	-1	no_errors	ENST00000361941	ensembl	human	known	74_37	missense	SNP	1.000	G
BLNK	29760	genome.wustl.edu	37	10	97951794	97951794	+	Missense_Mutation	SNP	G	G	C			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr10:97951794G>C	ENST00000224337.5	-	17	1447	c.1306C>G	c.(1306-1308)Ctt>Gtt	p.L436V	BLNK_ENST00000427367.2_Missense_Mutation_p.L401V|BLNK_ENST00000371176.2_Missense_Mutation_p.L413V|BLNK_ENST00000413476.2_Missense_Mutation_p.L384V	NM_013314.3	NP_037446.1	Q8WV28	BLNK_HUMAN	B-cell linker	436	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(2)|stomach(1)	14		Colorectal(252;0.083)		Epithelial(162;7.89e-08)|all cancers(201;2.27e-06)		CTGTCAATAAGAACCAAAGGA	0.343																																																	0								ENSG00000095585						234.0	222.0	226.0					10																	97951794		2203	4300	6503	BLNK	SO:0001583	missense	0			-	HGNC	AF068180	CCDS7446.1, CCDS44464.1, CCDS58091.1, CCDS73171.1	10q23.2-q23.33	2014-09-17			ENSG00000095585	ENSG00000095585		"""SH2 domain containing"""	14211	protein-coding gene	gene with protein product	"""B-cell adapter containing a SH2 domain protein"", ""B-cell activation"", ""Src homology [SH2] domain-containing leukocyte protein of 65 kD"", ""B cell adaptor containing SH2 domain"""	604515				9697839, 10583958	Standard	NM_013314		Approved	SLP65, Ly57, SLP-65, BLNK-s, BASH, bca	uc001kls.4	Q8WV28	OTTHUMG00000018827	ENST00000224337.5:c.1306C>G	10.37:g.97951794G>C	ENSP00000224337:p.Leu436Val	Somatic	0	102	0.00		0.6553633802850016	15	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	49	23.44	O75498|O75499|Q2MD49	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SH2,smart_SH2,pfscan_SH2	p.L436V	ENST00000224337.5	37	c.1306	CCDS7446.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.2|22.2	4.261879|4.261879	0.80358|0.80358	.|.	.|.	ENSG00000095585|ENSG00000095585	ENST00000393889|ENST00000224337;ENST00000371176;ENST00000427367;ENST00000413476;ENST00000537049;ENST00000393894	.|T;T;T;T	.|0.65916	.|-0.18;-0.18;-0.18;-0.18	5.13|5.13	5.13|5.13	0.70059|0.70059	.|SH2 motif (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80742|0.80742	0.4681|0.4681	M|M	0.81179|0.81179	2.53|2.53	0.58432|0.58432	D|D	0.999994|0.999994	.|D;D;D;D;D;D	.|0.89917	.|0.996;1.0;0.999;0.999;0.995;0.992	.|D;D;D;D;D;D	.|0.91635	.|0.994;0.999;0.998;0.993;0.992;0.996	D|D	0.83416|0.83416	0.0030|0.0030	6|10	0.87932|0.87932	D|D	0|0	-21.1215|-21.1215	17.72|17.72	0.88348|0.88348	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|361;384;413;279;413;436	.|Q2MD54;Q2MD49;Q8WV28-2;Q2MD59;Q2MD52;Q8WV28	.|.;.;.;.;.;BLNK_HUMAN	L|V	161|436;413;401;384;279;165	.|ENSP00000224337:L436V;ENSP00000360218:L413V;ENSP00000391924:L401V;ENSP00000397487:L384V	ENSP00000377467:F161L|ENSP00000224337:L436V	F|L	-|-	3|1	2|0	BLNK|BLNK	97941784|97941784	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	6.240000|6.240000	0.72363|0.72363	2.567000|2.567000	0.86603|0.86603	0.557000|0.557000	0.71058|0.71058	TTC|CTT	-	pfscan_SH2		0.343	BLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLNK	protein_coding	OTTHUMT00000049593.1	G	NM_013314	-		97951794	-1	no_errors	ENST00000224337	ensembl	human	known	74_37	missense	SNP	1.000	C
ANKRD18A	253650	genome.wustl.edu	37	9	38596278	38596278	+	Missense_Mutation	SNP	C	C	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr9:38596278C>G	ENST00000399703.5	-	9	1433	c.1059G>C	c.(1057-1059)aaG>aaC	p.K353N		NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A	353										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						GAATATATTTCTTTTCCTTTC	0.313																																																	0								ENSG00000180071						42.0	30.0	34.0					9																	38596278		692	1588	2280	ANKRD18A	SO:0001583	missense	0			-	HGNC	AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.1059G>C	9.37:g.38596278C>G	ENSP00000382610:p.Lys353Asn	Somatic	0	49	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	40	37.50	A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K353N	ENST00000399703.5	37	c.1059	CCDS55311.1	9	.	.	.	.	.	.	.	.	.	.	C	3.292	-0.144719	0.06627	.	.	ENSG00000180071	ENST00000399703	T	0.15017	2.46	1.47	-0.806	0.10875	.	.	.	.	.	T	0.08626	0.0214	L	0.28740	0.885	0.48901	D	0.999723	B	0.19817	0.039	B	0.10450	0.005	T	0.30909	-0.9962	9	0.30078	T	0.28	.	0.7184	0.00936	0.2363:0.3589:0.2339:0.1709	.	353	Q8IVF6	AN18A_HUMAN	N	353	ENSP00000382610:K353N	ENSP00000382610:K353N	K	-	3	2	ANKRD18A	38586278	0.017000	0.18338	0.120000	0.21714	0.006000	0.05464	-1.608000	0.02068	-0.213000	0.10094	-0.879000	0.02964	AAG	-	NULL		0.313	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD18A	protein_coding	OTTHUMT00000052506.3	C		-		38596278	-1	no_errors	ENST00000399703	ensembl	human	known	74_37	missense	SNP	0.809	G
AGAP3	116988	genome.wustl.edu	37	7	150784064	150784064	+	Missense_Mutation	SNP	T	T	A			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr7:150784064T>A	ENST00000397238.2	+	1	236	c.236T>A	c.(235-237)gTg>gAg	p.V79E	AGAP3_ENST00000463381.1_Intron|AGAP3_ENST00000479901.1_Missense_Mutation_p.V79E|AGAP3_ENST00000473312.1_Missense_Mutation_p.V79E	NM_031946.4	NP_114152.3	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	43					cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						TTCGAGTCCGTGCATCCCAAT	0.667																																																	0								ENSG00000133612						31.0	36.0	34.0					7																	150784064		2183	4298	6481	AGAP3	SO:0001583	missense	0			-	HGNC	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000397238.2:c.236T>A	7.37:g.150784064T>A	ENSP00000380413:p.Val79Glu	Somatic	0	38	0.00		0.6553633802850016	38	22.45	11	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	11	26.67	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Pleckstrin_homology,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.V79E	ENST00000397238.2	37	c.236	CCDS43681.1	7	.	.	.	.	.	.	.	.	.	.	T	19.65	3.867847	0.72065	.	.	ENSG00000133612	ENST00000473312;ENST00000479901;ENST00000397238;ENST00000335355	D;D;T	0.92495	-2.91;-3.05;-1.25	2.42	1.21	0.21127	.	0.000000	0.44097	U	0.000495	D	0.94301	0.8169	M	0.82056	2.57	0.80722	D	1	D;D;D	0.89917	0.999;0.995;1.0	D;P;D	0.70227	0.959;0.882;0.968	D	0.91774	0.5430	10	0.87932	D	0	.	5.5351	0.17007	0.0:0.1535:0.0:0.8465	.	79;79;79	C9J975;Q96P47-4;E9PAL8	.;.;.	E	79;79;79;43	ENSP00000418921:V79E;ENSP00000418125:V79E;ENSP00000380413:V79E	ENSP00000334157:V43E	V	+	2	0	AGAP3	150414997	1.000000	0.71417	0.759000	0.31340	0.883000	0.51084	6.971000	0.76105	0.173000	0.19788	0.155000	0.16302	GTG	-	NULL		0.667	AGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP3	protein_coding	OTTHUMT00000351908.3	T	NM_031946	-		150784064	+1	no_errors	ENST00000397238	ensembl	human	known	74_37	missense	SNP	1.000	A
DPP6	1804	genome.wustl.edu	37	7	154667715	154667715	+	Silent	SNP	C	C	T	rs372493523		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr7:154667715C>T	ENST00000377770.3	+	20	2124	c.1983C>T	c.(1981-1983)gaC>gaT	p.D661D	DPP6_ENST00000332007.3_Silent_p.D599D|DPP6_ENST00000404039.1_Silent_p.D597D|DPP6_ENST00000427557.1_Silent_p.D554D			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	661					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TAAAGTGTGACGGCCGTGGCA	0.657																																					NSCLC(125;1384 1783 2490 7422 34254)												0								ENSG00000130226	C	,,	0,4116		0,0,2058	27.0	34.0	31.0		1437,1356,1356	-3.8	1.0	7		31	1,8373		0,1,4186	no	coding-synonymous,coding-synonymous,coding-synonymous	DPP6	NM_001039350.1,NM_001936.3,NM_130797.2	,,	0,1,6244	TT,TC,CC		0.0119,0.0,0.0080	,,	479/684,452/657,452/657	154667715	1,12489	2058	4187	6245	DPP6	SO:0001819	synonymous_variant	0			-	HGNC	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1983C>T	7.37:g.154667715C>T		Somatic	0	125	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	75	19.35		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_PD40	p.D661	ENST00000377770.3	37	c.1983		7																																																																																			-	pfam_Peptidase_S9		0.657	DPP6-003	KNOWN	basic|appris_principal	protein_coding	DPP6	protein_coding	OTTHUMT00000322932.1	C	NM_130797	-		154667715	+1	no_errors	ENST00000377770	ensembl	human	known	74_37	silent	SNP	0.989	T
TH	7054	genome.wustl.edu	37	11	2189744	2189744	+	Missense_Mutation	SNP	A	A	C	rs113018526		TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:2189744A>C	ENST00000381178.1	-	4	575	c.557T>G	c.(556-558)gTg>gGg	p.V186G	TH_ENST00000381175.1_Missense_Mutation_p.V182G|TH_ENST00000352909.3_Missense_Mutation_p.V155G|TH_ENST00000333684.5_Missense_Mutation_p.V159G	NM_199292.2	NP_954986.2	P07101	TY3H_HUMAN	tyrosine hydroxylase	186					anatomical structure morphogenesis (GO:0009653)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to manganese ion (GO:0071287)|cellular response to nicotine (GO:0071316)|cerebral cortex development (GO:0021987)|circadian sleep/wake cycle (GO:0042745)|dopamine biosynthetic process (GO:0042416)|dopamine biosynthetic process from tyrosine (GO:0006585)|eating behavior (GO:0042755)|embryonic camera-type eye morphogenesis (GO:0048596)|epinephrine biosynthetic process (GO:0042418)|eye photoreceptor cell development (GO:0042462)|fatty acid metabolic process (GO:0006631)|glycoside metabolic process (GO:0016137)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|isoquinoline alkaloid metabolic process (GO:0033076)|learning (GO:0007612)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|memory (GO:0007613)|multicellular organismal aging (GO:0010259)|neurotransmitter biosynthetic process (GO:0042136)|norepinephrine biosynthetic process (GO:0042421)|organ morphogenesis (GO:0009887)|phthalate metabolic process (GO:0018963)|phytoalexin metabolic process (GO:0052314)|pigmentation (GO:0043473)|regulation of heart contraction (GO:0008016)|response to activity (GO:0014823)|response to amphetamine (GO:0001975)|response to corticosterone (GO:0051412)|response to electrical stimulus (GO:0051602)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to ether (GO:0045472)|response to herbicide (GO:0009635)|response to hypoxia (GO:0001666)|response to light stimulus (GO:0009416)|response to lipopolysaccharide (GO:0032496)|response to nutrient levels (GO:0031667)|response to peptide hormone (GO:0043434)|response to pyrethroid (GO:0046684)|response to salt stress (GO:0009651)|response to water deprivation (GO:0009414)|response to zinc ion (GO:0010043)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|sphingolipid metabolic process (GO:0006665)|synaptic transmission, dopaminergic (GO:0001963)|synaptic vesicle amine transport (GO:0015842)|terpene metabolic process (GO:0042214)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|melanosome membrane (GO:0033162)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perikaryon (GO:0043204)|smooth endoplasmic reticulum (GO:0005790)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	amino acid binding (GO:0016597)|dopamine binding (GO:0035240)|enzyme binding (GO:0019899)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|oxygen binding (GO:0019825)|tetrahydrobiopterin binding (GO:0034617)|tyrosine 3-monooxygenase activity (GO:0004511)			NS(1)|endometrium(1)|large_intestine(1)|lung(7)|skin(1)	11		all_epithelial(84;1.46e-23)|Lung NSC(207;4.44e-11)|all_lung(207;1.11e-09)|Ovarian(85;1.78e-06)|Breast(177;1.78e-05)|Medulloblastoma(188;0.0208)|all_neural(188;0.0416)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;8.45e-09)|Lung(200;0.000152)|LUSC - Lung squamous cell carcinoma(625;0.00154)	L-Phenylalanine(DB00120)|L-Tyrosine(DB00135)|Metyrosine(DB00765)|Tetrahydrobiopterin(DB00360)	GGGGCTGCGCACGTCCTCTGA	0.701																																																	0								ENSG00000180176						15.0	17.0	16.0					11																	2189744		2186	4268	6454	TH	SO:0001583	missense	0			-	HGNC	X05290	CCDS7730.1, CCDS7731.1, CCDS31338.1	11p15.5	2013-06-03			ENSG00000180176	ENSG00000180176	1.14.16.2		11782	protein-coding gene	gene with protein product	"""tyrosine 3-monooxygenase"""	191290					Standard	NM_199292		Approved	DYT5b	uc001lvq.3	P07101	OTTHUMG00000009559	ENST00000381178.1:c.557T>G	11.37:g.2189744A>C	ENSP00000370571:p.Val186Gly	Somatic	0	40	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	7	66.67	B7ZL70|B7ZL73|Q0PWM2|Q0PWM3|Q15585|Q15588|Q15589|Q2M3B4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Aromatic-AA_hydroxylase_C,pfam_Tyrosine_hydroxylase_CS,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Tyr_3_mOase	p.V186G	ENST00000381178.1	37	c.557	CCDS7731.1	11	.	.	.	.	.	.	.	.	.	.	A	19.49	3.837303	0.71373	.	.	ENSG00000180176	ENST00000381178;ENST00000381175;ENST00000352909;ENST00000333684	D;D;D;D	0.98666	-5.06;-5.06;-5.06;-5.06	3.14	3.14	0.36123	Aromatic amino acid hydroxylase, C-terminal (1);	0.000000	0.85682	U	0.000000	D	0.98798	0.9595	M	0.77313	2.365	0.80722	D	1	B;D;D;D;D;D	0.76494	0.113;0.984;0.984;0.999;0.984;0.991	B;P;P;D;P;D	0.80764	0.068;0.5;0.5;0.994;0.889;0.948	D	0.99019	1.0817	10	0.66056	D	0.02	-24.4282	11.0179	0.47701	1.0:0.0:0.0:0.0	.	159;159;155;155;186;182	B7ZL73;Q0PWM2;Q0PWM3;P07101-3;P07101;P07101-2	.;.;.;.;TY3H_HUMAN;.	G	186;182;155;159	ENSP00000370571:V186G;ENSP00000370567:V182G;ENSP00000325951:V155G;ENSP00000328814:V159G	ENSP00000328814:V159G	V	-	2	0	TH	2146320	0.993000	0.37304	0.057000	0.19452	0.201000	0.24016	4.350000	0.59392	1.437000	0.47472	0.402000	0.26972	GTG	-	pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Tyr_3_mOase		0.701	TH-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TH	protein_coding	OTTHUMT00000026597.1	A	NM_000360	-		2189744	-1	no_errors	ENST00000381178	ensembl	human	known	74_37	missense	SNP	0.999	C
ZNF234	10780	genome.wustl.edu	37	19	44661690	44661691	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr19:44661690_44661691delAG	ENST00000426739.2	+	6	1779_1780	c.1521_1522delAG	c.(1519-1524)acagggfs	p.G508fs	ZNF234_ENST00000592437.1_Frame_Shift_Del_p.G508fs	NM_006630.2	NP_006621.1	Q14588	ZN234_HUMAN	zinc finger protein 234	508					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)	23		Prostate(69;0.0435)				GGATCCACACAGGGGAGAAACC	0.446																																																	0								ENSG00000263002		,	1,4113		0,1,2056					,	3.0	0.9			76	1,8193		0,1,4096	no	frameshift,frameshift	ZNF234	NM_006630.2,NM_001144824.1	,	0,2,6152	A1A1,A1R,RR		0.0122,0.0243,0.0162	,	,		2,12306				ZNF234	SO:0001589	frameshift_variant	0				HGNC	X78927	CCDS46101.1	19q13	2013-01-08				ENSG00000263002		"""Zinc fingers, C2H2-type"", ""-"""	13027	protein-coding gene	gene with protein product		604750		ZNF269		7865130	Standard	NM_006630		Approved	HZF4	uc002oyl.4	Q14588		ENST00000426739.2:c.1521_1522delAG	19.37:g.44661690_44661691delAG	ENSP00000400878:p.Gly508fs	Somatic	0	83	0.00		0.6553633802850016	11	8.33	1	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	83	29.06	A8K1C8|Q96IR4|Q9NS45|Q9NYT7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K510fs	ENST00000426739.2	37	c.1521_1522	CCDS46101.1	19																																																																																			-	pfscan_Znf_C2H2		0.446	ZNF234-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF234	protein_coding	OTTHUMT00000460586.2	AG				44661691	+1	no_errors	ENST00000426739	ensembl	human	known	74_37	frame_shift_del	DEL	0.360:0.998	-
DAGLA	747	genome.wustl.edu	37	11	61508747	61508747	+	Silent	SNP	C	C	G			TCGA-K1-A6RV-01A-11D-A32I-09	TCGA-K1-A6RV-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fde49939-fe43-4058-b143-4997914ebfe9	f92cf376-b51a-4720-bd93-faed5da32efb	g.chr11:61508747C>G	ENST00000257215.5	+	19	2213	c.2097C>G	c.(2095-2097)ctC>ctG	p.L699L		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	699					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		AGCAGCCACTCCCCACGGGGC	0.652																																																	0								ENSG00000134780						50.0	46.0	48.0					11																	61508747		2202	4299	6501	DAGLA	SO:0001819	synonymous_variant	0			-	HGNC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2097C>G	11.37:g.61508747C>G		Somatic	0	41	0.00		0.6553633802850016	0	0.00	0	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	58	33.33	A7E233|Q6WQJ0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipase_3	p.L699	ENST00000257215.5	37	c.2097	CCDS31578.1	11																																																																																			-	NULL		0.652	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAGLA	protein_coding	OTTHUMT00000398516.1	C	NM_006133	-		61508747	+1	no_errors	ENST00000257215	ensembl	human	known	74_37	silent	SNP	1.000	G
