#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ZC3H12B	340554	genome.wustl.edu	37	X	64722228	64722228	+	Silent	SNP	T	T	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chrX:64722228T>A	ENST00000338957.4	+	5	1717	c.1650T>A	c.(1648-1650)ggT>ggA	p.G550G	ZC3H12B_ENST00000423889.3_Silent_p.G539G	NM_001010888.3	NP_001010888.3	Q5HYM0	ZC12B_HUMAN	zinc finger CCCH-type containing 12B	550							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CAATGTTAGGTGACTTCTCCA	0.478																																																	0								ENSG00000102053						48.0	45.0	46.0					X																	64722228		1931	4122	6053	ZC3H12B	SO:0001819	synonymous_variant	0			-	HGNC	BX647241	CCDS48131.1, CCDS48131.2	Xq12	2012-07-05	2005-06-14	2005-06-14	ENSG00000102053	ENSG00000102053		"""Zinc fingers, CCCH-type domain containing"""	17407	protein-coding gene	gene with protein product	"""MCP induced protein 2"""	300889	"""chromosome X open reading frame 32"""	CXorf32		18178554	Standard	NM_001010888		Approved	MCPIP2	uc010nko.3	Q5HYM0	OTTHUMG00000021719	ENST00000338957.4:c.1650T>A	X.37:g.64722228T>A		Somatic	0	36	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	23	51.06	B2RTQ3|E9PAJ6|Q5H9C0	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_Zc3h12	p.G550	ENST00000338957.4	37	c.1650	CCDS48131.2	X																																																																																			-	NULL		0.478	ZC3H12B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H12B	protein_coding	OTTHUMT00000378734.2	T	XM_293334	-		64722228	+1	no_errors	ENST00000338957	ensembl	human	known	74_37	silent	SNP	0.745	A
FGA	2243	genome.wustl.edu	37	4	155507241	155507241	+	Missense_Mutation	SNP	T	T	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr4:155507241T>A	ENST00000302053.3	-	5	1418	c.1340A>T	c.(1339-1341)gAg>gTg	p.E447V	FGA_ENST00000403106.3_Missense_Mutation_p.E447V	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	447					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	GGTGACCTTCTCTTTACCAGT	0.453																																					NSCLC(143;340 1922 20892 22370 48145)												0								ENSG00000171560						211.0	221.0	218.0					4																	155507241		2203	4300	6503	FGA	SO:0001583	missense	0			-	HGNC		CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.1340A>T	4.37:g.155507241T>A	ENSP00000306361:p.Glu447Val	Somatic	0	76	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	55	17.91	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Fibrinogen_a/b/g_C_dom,pfam_Fibrinogen_a/b/g_coil_dom,pfam_Fibrinogen_aC,superfamily_Fibrinogen_a/b/g_C_dom,smart_Fibrinogen_a/b/g_C_dom	p.E447V	ENST00000302053.3	37	c.1340	CCDS3787.1	4	.	.	.	.	.	.	.	.	.	.	T	17.74	3.464375	0.63513	.	.	ENSG00000171560	ENST00000302053;ENST00000403106	T;T	0.61274	0.12;0.12	5.46	5.46	0.80206	Fibrinogen alpha C domain (1);	13.422700	0.00166	N	0.000000	T	0.77438	0.4130	M	0.62723	1.935	0.31728	N	0.637445	D;D	0.76494	0.985;0.999	P;D	0.68483	0.859;0.958	T	0.59747	-0.7396	10	0.87932	D	0	.	13.4209	0.60996	0.0:0.0:0.0:1.0	.	447;447	P02671-2;P02671	.;FIBA_HUMAN	V	447	ENSP00000306361:E447V;ENSP00000385981:E447V	ENSP00000306361:E447V	E	-	2	0	FGA	155726691	0.651000	0.27340	0.850000	0.33497	0.661000	0.39034	1.166000	0.31834	2.291000	0.77112	0.533000	0.62120	GAG	-	pfam_Fibrinogen_aC		0.453	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	protein_coding	OTTHUMT00000317593.1	T	NM_000508	-		155507241	-1	no_errors	ENST00000302053	ensembl	human	known	74_37	missense	SNP	0.992	A
DROSHA	29102	genome.wustl.edu	37	5	31424571	31424571	+	Missense_Mutation	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr5:31424571C>T	ENST00000511367.2	-	27	3468	c.3224G>A	c.(3223-3225)cGc>cAc	p.R1075H	DROSHA_ENST00000344624.3_Missense_Mutation_p.R1075H|DROSHA_ENST00000442743.1_Missense_Mutation_p.R1038H|DROSHA_ENST00000513349.1_Missense_Mutation_p.R1038H	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1075	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						CCAGACTTCGCGCAGGTCCTG	0.423																																																	0								ENSG00000113360						105.0	106.0	105.0					5																	31424571		1940	4145	6085	DROSHA	SO:0001583	missense	0			-	HGNC	AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.3224G>A	5.37:g.31424571C>T	ENSP00000425979:p.Arg1075His	Somatic	0	49	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	50	13.79	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RNase_III_dom,pfam_dsRNA-bd_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.R1075H	ENST00000511367.2	37	c.3224	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	C	15.84	2.950818	0.53186	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188	T;T;T;T	0.46819	1.44;1.44;0.86;0.86	5.41	5.41	0.78517	Ribonuclease III (2);	0.056790	0.64402	D	0.000003	T	0.34193	0.0889	N	0.19112	0.55	0.58432	D	0.999999	B;B	0.17852	0.024;0.017	B;B	0.17433	0.008;0.018	T	0.12372	-1.0550	10	0.13470	T	0.59	-16.8708	17.7429	0.88412	0.0:1.0:0.0:0.0	.	1038;1075	E7EMP9;Q9NRR4	.;RNC_HUMAN	H	1075;1075;1038;1038;1000;1031	ENSP00000425979:R1075H;ENSP00000339845:R1075H;ENSP00000409335:R1038H;ENSP00000424161:R1038H	ENSP00000265075:R1000H	R	-	2	0	DROSHA	31460328	1.000000	0.71417	0.966000	0.40874	0.992000	0.81027	4.861000	0.62969	2.691000	0.91804	0.650000	0.86243	CGC	-	superfamily_RNase_III_dom,smart_RNase_III_dom		0.423	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	protein_coding	OTTHUMT00000366561.3	C	NM_013235	-		31424571	-1	no_errors	ENST00000344624	ensembl	human	known	74_37	missense	SNP	1.000	T
KRCC1	51315	genome.wustl.edu	37	2	88327723	88327723	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr2:88327723delA	ENST00000347055.3	-	4	753	c.360delT	c.(358-360)tttfs	p.F120fs		NM_016618.1	NP_057702.1	Q9NPI7	KRCC1_HUMAN	lysine-rich coiled-coil 1	120										cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)	7						CTTGTTGATTAAAGTTCAGGG	0.433																																																	0								ENSG00000172086						110.0	113.0	112.0					2																	88327723		2203	4300	6503	KRCC1	SO:0001589	frameshift_variant	0				HGNC	AF208845	CCDS2000.1	2p11.2	2008-02-05			ENSG00000172086	ENSG00000172086			28039	protein-coding gene	gene with protein product						12477932	Standard	XM_005264360		Approved	FLJ22333	uc002sso.1	Q9NPI7	OTTHUMG00000130315	ENST00000347055.3:c.360delT	2.37:g.88327723delA	ENSP00000340083:p.Phe120fs	Somatic	0	77	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	90	10.89	Q3B7J7	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.F120fs	ENST00000347055.3	37	c.360	CCDS2000.1	2																																																																																			-	NULL		0.433	KRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRCC1	protein_coding	OTTHUMT00000252664.1	A	NM_016618			88327723	-1	no_errors	ENST00000347055	ensembl	human	known	74_37	frame_shift_del	DEL	0.004	-
TUBB8P12	260334	genome.wustl.edu	37	18	49208	49208	+	Missense_Mutation	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr18:49208G>A	ENST00000573909.1	-	2	543	c.11C>T	c.(10-12)cCa>cTa	p.P4L	RP11-683L23.1_ENST00000594555.1_5'Flank|RP11-683L23.1_ENST00000308911.6_Silent_p.A29A																							CGGAGTCGATGGCATGTTCAT	0.677																																																	0								ENSG00000173213																																			RP11-683L23.1	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000573909.1:c.11C>T	18.37:g.49208G>A	ENSP00000459638:p.Pro4Leu	Somatic	0	49	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	35	18.60		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin	p.P4L	ENST00000573909.1	37	c.11		18																																																																																			-	NULL		0.677	RP11-683L23.1-002	PUTATIVE	not_best_in_genome_evidence|basic	protein_coding	ENSG00000173213	protein_coding	OTTHUMT00000439819.1	G		-		49208	-1	no_errors	ENST00000573909	ensembl	human	putative	74_37	missense	SNP	0.997	A
NUGGC	389643	genome.wustl.edu	37	8	27927797	27927797	+	Silent	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr8:27927797G>A	ENST00000413272.2	-	3	262	c.120C>T	c.(118-120)ccC>ccT	p.P40P	NUGGC_ENST00000341513.6_Silent_p.P40P	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	40					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										GCTCCATGGAGGGAAATGCTC	0.393																																																	0								ENSG00000189233						66.0	66.0	66.0					8																	27927797		1859	4096	5955	NUGGC	SO:0001819	synonymous_variant	0			-	HGNC	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.120C>T	8.37:g.27927797G>A		Somatic	0	36	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	13	40.91	Q6ZP73	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase	p.P40	ENST00000413272.2	37	c.120	CCDS47833.1	8																																																																																			-	NULL		0.393	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUGGC	protein_coding	OTTHUMT00000342494.1	G	NM_001010906	-		27927797	-1	no_errors	ENST00000341513	ensembl	human	known	74_37	silent	SNP	0.987	A
PCID2	55795	genome.wustl.edu	37	13	113840342	113840349	+	Intron	DEL	AAAAACAA	AAAAACAA	-	rs398099200|rs75123051|rs776902|rs59772073|rs140778047	byFrequency	TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	AAAAACAA	AAAAACAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr13:113840342_113840349delAAAAACAA	ENST00000337344.4	-	8	544				PCID2_ENST00000375459.1_Intron|PCID2_ENST00000246505.5_Intron|PCID2_ENST00000375477.1_Intron|PCID2_ENST00000375457.2_Intron|PCID2_ENST00000493650.1_5'UTR|PCID2_ENST00000375479.2_Intron	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2						negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			ctcaaaaaacaaaaacaaaaaaagaaaa	0.442														2966	0.592252	0.5605	0.6354	5008	,	,		20154	0.4544		0.7942	False		,,,				2504	0.5389																0								ENSG00000126226																																			PCID2	SO:0001627	intron_variant	0				HGNC	AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.468-468TTGTTTTT>-	13.37:g.113840342_113840349delAAAAACAA		Somatic	NA	NA	NA		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000337344.4	37	NULL	CCDS9532.2	13																																																																																			-	-		0.442	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	PCID2	protein_coding	OTTHUMT00000045897.1	AAAAACAA	NM_018386			113840349	-1	no_errors	ENST00000493650	ensembl	human	known	74_37	rna	DEL	0.107:0.100:0.088:0.070:0.063:0.051:0.034:0.028	-
GOLGA8S	653061	genome.wustl.edu	37	15	23609668	23609668	+	Intron	SNP	C	C	T	rs565120055		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr15:23609668C>T	ENST00000562295.1	+	17	1448				RN7SL536P_ENST00000491146.2_RNA|AC100756.1_ENST00000459602.1_RNA					golgin A8 family, member S																		CCTGTCCTCCCGCAGGAAAAT	0.622													.|||	1	0.000199681	0.0	0.0	5008	,	,		11774	0.001		0.0	False		,,,				2504	0.0																0								ENSG00000238737																																			AC100756.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene			15q11.2	2013-01-17			ENSG00000261739	ENSG00000261739			44409	other	unknown							Standard	NR_038843		Approved		uc021sfv.2		OTTHUMG00000176415	ENST00000562295.1:c.1449-5C>T	15.37:g.23609668C>T		Somatic	0	147	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	95	295	24.30		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000562295.1	37	NULL		15																																																																																			-	-		0.622	GOLGA8S-001	NOVEL	basic|appris_principal	protein_coding	ENSG00000238737	protein_coding	OTTHUMT00000431934.1	C	NR_038843	-		23609668	+1	no_errors	ENST00000459602	ensembl	human	novel	74_37	rna	SNP	0.015	T
TTC39C	125488	genome.wustl.edu	37	18	21660677	21660677	+	Missense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr18:21660677G>T	ENST00000317571.3	+	5	825	c.589G>T	c.(589-591)Gca>Tca	p.A197S	RP11-403A21.3_ENST00000578443.1_RNA|TTC39C_ENST00000578150.1_3'UTR|TTC39C_ENST00000304621.6_Missense_Mutation_p.A136S	NM_001135993.1	NP_001129465.1	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C	197										breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	19						TTCTGATGCTGCAAATGATAA	0.433																																																	0								ENSG00000168234						140.0	134.0	136.0					18																	21660677		2203	4300	6503	TTC39C	SO:0001583	missense	0			-	HGNC	AK091080	CCDS32804.1, CCDS45839.1, CCDS58616.1	18q11.2	2014-02-07	2008-06-23	2008-06-23	ENSG00000168234	ENSG00000168234		"""Tetratricopeptide (TTC) repeat domain containing"""	26595	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 17"""	C18orf17		14702039	Standard	NM_153211		Approved	FLJ33761, HsT2697	uc002kuw.3	Q8N584	OTTHUMG00000179403	ENST00000317571.3:c.589G>T	18.37:g.21660677G>T	ENSP00000323645:p.Ala197Ser	Somatic	0	65	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	28	12.50	B7WP63|J3QRR1|Q0VAJ2|Q8N284	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_OMP_IML2_mit/TPR_39,pfam_Cohesin_loading_factor	p.A197S	ENST00000317571.3	37	c.589	CCDS45839.1	18	.	.	.	.	.	.	.	.	.	.	g	14.97	2.695725	0.48202	.	.	ENSG00000168234	ENST00000304621;ENST00000317571	T;T	0.42513	0.97;0.97	5.92	5.05	0.67936	.	0.048208	0.85682	D	0.000000	T	0.29652	0.0740	N	0.22421	0.69	0.80722	D	1	B	0.14438	0.01	B	0.14023	0.01	T	0.08249	-1.0731	10	0.10902	T	0.67	-3.7805	16.4662	0.84079	0.0:0.0:0.8676:0.1324	.	197	Q8N584	TT39C_HUMAN	S	136;197	ENSP00000306598:A136S;ENSP00000323645:A197S	ENSP00000306598:A136S	A	+	1	0	TTC39C	19914675	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.555000	0.67301	1.491000	0.48482	0.552000	0.68991	GCA	-	pfam_OMP_IML2_mit/TPR_39		0.433	TTC39C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC39C	protein_coding	OTTHUMT00000446107.1	G	NM_153211	-		21660677	+1	no_errors	ENST00000317571	ensembl	human	known	74_37	missense	SNP	1.000	T
CATSPER1	117144	genome.wustl.edu	37	11	65789005	65789005	+	Silent	SNP	C	C	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr11:65789005C>A	ENST00000312106.5	-	4	1790	c.1653G>T	c.(1651-1653)ctG>ctT	p.L551L		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	551					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						TCAGGGCCCGCAGGCTCTTGA	0.622																																																	0								ENSG00000175294						58.0	63.0	61.0					11																	65789005		2201	4296	6497	CATSPER1	SO:0001819	synonymous_variant	0			-	HGNC	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1653G>T	11.37:g.65789005C>A		Somatic	0	68	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	32	47.54	Q96P76	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_PKD1_2_channel	p.L551	ENST00000312106.5	37	c.1653	CCDS8127.1	11																																																																																			-	pfam_Ion_trans_dom		0.622	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPER1	protein_coding	OTTHUMT00000391055.1	C	NM_053054	-		65789005	-1	no_errors	ENST00000312106	ensembl	human	known	74_37	silent	SNP	0.535	A
LRRTM2	26045	genome.wustl.edu	37	5	138209312	138209313	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr5:138209312_138209313delCA	ENST00000274711.6	-	2	1315_1316	c.937_938delTG	c.(937-939)tggfs	p.W313fs	LRRTM2_ENST00000521094.2_Intron|CTNNA1_ENST00000540387.1_5'Flank|LRRTM2_ENST00000523537.1_5'Flank|CTNNA1_ENST00000302763.7_Intron|CTNNA1_ENST00000520400.1_Intron|LRRTM2_ENST00000518785.1_3'UTR|CTNNA1_ENST00000355078.5_Intron|CTNNA1_ENST00000518825.1_Intron	NM_015564.2	NP_056379.1	O43300	LRRT2_HUMAN	leucine rich repeat transmembrane neuronal 2	313	LRRCT.				long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|synapse organization (GO:0050808)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|urinary_tract(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GCTGCATTCCCACAGATTGCCA	0.505																																																	0								ENSG00000146006																																			LRRTM2	SO:0001589	frameshift_variant	0				HGNC	AB007876	CCDS47272.1	5q31	2008-02-05				ENSG00000146006			19409	protein-coding gene	gene with protein product		610868				12676565	Standard	NM_015564		Approved	KIAA0416	uc011cyz.1	O43300		ENST00000274711.6:c.937_938delTG	5.37:g.138209314_138209315delCA	ENSP00000274711:p.Trp313fs	Somatic	0	15	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	11	35.29	A0AVL3|A8K4U9|B7ZLN8|Q7L770	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.W313fs	ENST00000274711.6	37	c.938_937	CCDS47272.1	5																																																																																			-	NULL		0.505	LRRTM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM2	protein_coding	OTTHUMT00000374043.2	CA				138209313	-1	no_errors	ENST00000274711	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000	-
TEX15	56154	genome.wustl.edu	37	8	30701742	30701742	+	Missense_Mutation	SNP	C	C	A	rs140965662	byFrequency	TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr8:30701742C>A	ENST00000256246.2	-	1	4866	c.4792G>T	c.(4792-4794)Gtg>Ttg	p.V1598L		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	1598					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		AAATCACTCACGTATGACGCA	0.403																																																	0								ENSG00000133863						106.0	103.0	104.0					8																	30701742		2203	4300	6503	TEX15	SO:0001583	missense	0			-	HGNC	AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.4792G>T	8.37:g.30701742C>A	ENSP00000256246:p.Val1598Leu	Somatic	0	28	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	14	46.15		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.V1598L	ENST00000256246.2	37	c.4792	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	C	7.839	0.721433	0.15372	.	.	ENSG00000133863	ENST00000256246	T	0.09445	2.98	5.44	-10.9	0.00192	.	1.883160	0.02099	N	0.053783	T	0.05823	0.0152	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.32534	-0.9903	10	0.87932	D	0	.	8.2373	0.31634	0.1075:0.5757:0.1097:0.207	.	1598	Q9BXT5	TEX15_HUMAN	L	1598	ENSP00000256246:V1598L	ENSP00000256246:V1598L	V	-	1	0	TEX15	30821284	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.106000	0.01338	-2.276000	0.00678	-1.273000	0.01405	GTG	-	NULL		0.403	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	protein_coding	OTTHUMT00000376193.1	C		-		30701742	-1	no_errors	ENST00000256246	ensembl	human	known	74_37	missense	SNP	0.000	A
CDH9	1007	genome.wustl.edu	37	5	26988306	26988306	+	Silent	SNP	A	A	C			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr5:26988306A>C	ENST00000231021.4	-	2	307	c.135T>G	c.(133-135)ggT>ggG	p.G45G		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	45					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GTAGCATTTTACCGTCATCTT	0.408																																					Melanoma(8;187 585 15745 40864 52829)												0								ENSG00000113100						135.0	129.0	131.0					5																	26988306		2203	4300	6503	CDH9	SO:0001819	synonymous_variant	0			-	HGNC	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.135T>G	5.37:g.26988306A>C		Somatic	0	33	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	39	27	59.09	Q3B7I5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G45	ENST00000231021.4	37	c.135	CCDS3893.1	5																																																																																			-	NULL		0.408	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	protein_coding	OTTHUMT00000207352.1	A	NM_016279	-		26988306	-1	no_errors	ENST00000231021	ensembl	human	known	74_37	silent	SNP	0.000	C
BCORL1	63035	genome.wustl.edu	37	X	129147377	129147377	+	Missense_Mutation	SNP	C	C	T	rs267606346		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chrX:129147377C>T	ENST00000218147.7	+	4	826	c.629C>T	c.(628-630)tCg>tTg	p.S210L	BCORL1_ENST00000303743.5_Missense_Mutation_p.S210L|BCORL1_ENST00000359304.2_Missense_Mutation_p.S210L|BCORL1_ENST00000540052.1_Missense_Mutation_p.S210L			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	210	Pro-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GCTCCCGGTTCGGCCTCTGTG	0.617													C|||	1	0.000264901	0.0	0.0	3775	,	,		12943	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000085185						137.0	124.0	128.0					X																	129147377		2203	4300	6503	BCORL1	SO:0001583	missense	0			-	HGNC	AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.629C>T	X.37:g.129147377C>T	ENSP00000218147:p.Ser210Leu	Somatic	0	24	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	15	48.28	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S210L	ENST00000218147.7	37	c.629	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	C	11.77	1.736708	0.30774	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052	T;T;T;T	0.48201	0.84;1.21;0.82;0.84	4.72	4.72	0.59763	.	0.290929	0.18770	N	0.131657	T	0.27063	0.0663	N	0.08118	0	0.23243	N	0.998058	B;B	0.31581	0.322;0.329	B;B	0.23018	0.043;0.019	T	0.06698	-1.0812	9	.	.	.	-3.162	16.544	0.84409	0.0:1.0:0.0:0.0	.	210;210	Q5H9F3-2;Q5H9F3	.;BCORL_HUMAN	L	210	ENSP00000218147:S210L;ENSP00000307541:S210L;ENSP00000352253:S210L;ENSP00000437775:S210L	.	S	+	2	0	BCORL1	128975058	0.562000	0.26586	0.172000	0.22920	0.117000	0.20001	3.109000	0.50345	1.917000	0.55516	0.436000	0.28706	TCG	-	NULL		0.617	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	protein_coding	OTTHUMT00000058223.1	C	NM_021946	-		129147377	+1	no_errors	ENST00000303743	ensembl	human	known	74_37	missense	SNP	0.476	T
FUT1	2523	genome.wustl.edu	37	19	49253749	49253749	+	Missense_Mutation	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr19:49253749C>T	ENST00000310160.3	-	4	1764	c.790G>A	c.(790-792)Ggc>Agc	p.G264S	FUT1_ENST00000601931.1_5'Flank	NM_000148.3	NP_000139.1	P19526	FUT1_HUMAN	fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, H blood group)	264					carbohydrate metabolic process (GO:0005975)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(3)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	17		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000135)|all cancers(93;0.000354)|Epithelial(262;0.0191)|GBM - Glioblastoma multiforme(486;0.0222)		CACTCCATGCCGTTGCTGGTG	0.617																																																	0								ENSG00000174951						129.0	109.0	116.0					19																	49253749		2203	4300	6503	FUT1	SO:0001583	missense	0			-	HGNC		CCDS12733.1	19q13.33	2014-07-19	2006-01-19		ENSG00000174951	ENSG00000174951	2.4.1.69	"""Blood group antigens"", ""Fucosyltransferases"""	4012	protein-coding gene	gene with protein product		211100	"""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase, Bombay phenotype included)"", ""fucosyltransferase 1 (galactoside 2-alpha-L-fucosyltransferase)"""	H, HSC			Standard	NM_000148		Approved		uc002pkk.3	P19526		ENST00000310160.3:c.790G>A	19.37:g.49253749C>T	ENSP00000312021:p.Gly264Ser	Somatic	0	87	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	34	56	37.78	O14505|O14506|O14507	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glyco_trans_11	p.G264S	ENST00000310160.3	37	c.790	CCDS12733.1	19	.	.	.	.	.	.	.	.	.	.	C	16.21	3.059519	0.55325	.	.	ENSG00000174951	ENST00000310160;ENST00000539428	D	0.96830	-4.14	4.46	2.28	0.28536	.	0.233454	0.30193	N	0.010181	D	0.97046	0.9035	M	0.71036	2.16	0.35246	D	0.778223	D	0.89917	1.0	D	0.97110	1.0	D	0.97139	0.9823	10	0.72032	D	0.01	-2.4381	7.4126	0.27025	0.1661:0.743:0.0:0.0909	.	264	P19526	FUT1_HUMAN	S	264;254	ENSP00000312021:G264S	ENSP00000312021:G264S	G	-	1	0	FUT1	53945561	0.987000	0.35691	0.962000	0.40283	0.170000	0.22686	3.053000	0.49901	0.613000	0.30089	0.557000	0.71058	GGC	-	pfam_Glyco_trans_11		0.617	FUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT1	protein_coding	OTTHUMT00000466194.1	C	NM_000148	-		49253749	-1	no_errors	ENST00000310160	ensembl	human	known	74_37	missense	SNP	0.988	T
NCOA7	135112	genome.wustl.edu	37	6	126136412	126136412	+	Intron	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr6:126136412G>A	ENST00000368357.3	+	3	288				NCOA7_ENST00000487635.1_3'UTR|NCOA7_ENST00000229634.9_Intron|NCOA7_ENST00000392477.2_Intron|NCOA7-AS1_ENST00000429007.1_RNA	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		TAAGTTTACAGTTGCTTTGTT	0.313																																																	0								ENSG00000111912																																			NCOA7	SO:0001627	intron_variant	0			-	HGNC	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.-64-25G>A	6.37:g.126136412G>A		Somatic	0	47	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	31	39.22	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000368357.3	37	NULL	CCDS5132.1	6																																																																																			-	-		0.313	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA7	protein_coding	OTTHUMT00000042083.4	G	XM_059748	-		126136412	+1	no_errors	ENST00000487635	ensembl	human	known	74_37	rna	SNP	0.005	A
TFR2	7036	genome.wustl.edu	37	7	100226977	100226977	+	Missense_Mutation	SNP	C	C	G			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr7:100226977C>G	ENST00000462107.1	-	11	1576	c.1289G>C	c.(1288-1290)gGg>gCg	p.G430A	TFR2_ENST00000544242.1_5'UTR|TFR2_ENST00000431692.1_Silent_p.R344R|TFR2_ENST00000223051.3_Missense_Mutation_p.G430A			Q9UP52	TFR2_HUMAN	transferrin receptor 2	430					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	CCTCTGGGCCCCGATGACAAC	0.607																																																	0								ENSG00000106327						87.0	75.0	79.0					7																	100226977		2203	4300	6503	TFR2	SO:0001583	missense	0			-	HGNC	AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.1289G>C	7.37:g.100226977C>G	ENSP00000420525:p.Gly430Ala	Somatic	0	60	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	24	69.62	A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.G430A	ENST00000462107.1	37	c.1289	CCDS34707.1	7	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470621	0.84533	.	.	ENSG00000106327	ENST00000223051;ENST00000462107	T;T	0.54479	0.57;0.57	4.39	4.39	0.52855	Peptidase M28 (1);	0.000000	0.85682	D	0.000000	T	0.78059	0.4224	M	0.92970	3.365	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.84084	0.0386	10	0.87932	D	0	-26.4911	14.4999	0.67714	0.0:1.0:0.0:0.0	.	430	Q9UP52	TFR2_HUMAN	A	430	ENSP00000223051:G430A;ENSP00000420525:G430A	ENSP00000223051:G430A	G	-	2	0	TFR2	100064913	1.000000	0.71417	0.997000	0.53966	0.880000	0.50808	6.745000	0.74860	2.275000	0.75901	0.561000	0.74099	GGG	-	pfam_Peptidase_M28		0.607	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	protein_coding	OTTHUMT00000356392.3	C	NM_003227	-		100226977	-1	no_errors	ENST00000223051	ensembl	human	known	74_37	missense	SNP	1.000	G
UNC79	57578	genome.wustl.edu	37	14	94066938	94066938	+	Silent	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr14:94066938C>T	ENST00000393151.2	+	25	3396	c.3396C>T	c.(3394-3396)ttC>ttT	p.F1132F	UNC79_ENST00000555664.1_Silent_p.F1132F|UNC79_ENST00000256339.4_Silent_p.F955F|UNC79_ENST00000553484.1_Silent_p.F1132F			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1132					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GTCTTGACTTCCAGTTTGATA	0.378																																																	0								ENSG00000133958						71.0	67.0	68.0					14																	94066938		2203	4300	6503	UNC79	SO:0001819	synonymous_variant	0			-	HGNC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3396C>T	14.37:g.94066938C>T		Somatic	0	31	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	31	27.91	B5MDL6|Q6ZUT7	Silent	SNP	NA	NA	NA	NA	NA	NA	superfamily_P-loop_NTPase,superfamily_ARM-type_fold	p.F1132	ENST00000393151.2	37	c.3396		14																																																																																			-	superfamily_ARM-type_fold		0.378	UNC79-006	KNOWN	basic	protein_coding	UNC79	protein_coding	OTTHUMT00000412766.1	C	XM_028395	-		94066938	+1	no_errors	ENST00000553484	ensembl	human	known	74_37	silent	SNP	1.000	T
SKI	6497	genome.wustl.edu	37	1	2235884	2235884	+	Missense_Mutation	SNP	G	G	C			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr1:2235884G>C	ENST00000378536.4	+	5	1699	c.1627G>C	c.(1627-1629)Gag>Cag	p.E543Q		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	543					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		GGCGGAGCTGGAGCACCTGCG	0.692																																					Ovarian(177;144 1678 13697 20086 27838 40755)												0								ENSG00000157933						22.0	19.0	20.0					1																	2235884		2164	4272	6436	SKI	SO:0001583	missense	0			-	HGNC	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.1627G>C	1.37:g.2235884G>C	ENSP00000367797:p.Glu543Gln	Somatic	0	61	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	65	112	36.72	Q5SYT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_c-SKI_SMAD4-bd_dom,pfam_Transform_Ski,superfamily_SAND_dom-like,superfamily_DNA-bd_dom_put	p.E543Q	ENST00000378536.4	37	c.1627	CCDS39.1	1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919669	0.52653	.	.	ENSG00000157933	ENST00000378536	D	0.96300	-3.97	4.37	4.37	0.52481	.	0.122854	0.52532	D	0.000061	D	0.96784	0.8950	M	0.62723	1.935	0.45747	D	0.998646	D	0.60575	0.988	P	0.57204	0.815	D	0.96301	0.9221	10	0.40728	T	0.16	-17.8688	16.0534	0.80777	0.0:0.0:1.0:0.0	.	543	P12755	SKI_HUMAN	Q	543	ENSP00000367797:E543Q	ENSP00000367797:E543Q	E	+	1	0	SKI	2225744	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.547000	0.82146	2.249000	0.74217	0.561000	0.74099	GAG	-	NULL		0.692	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKI	protein_coding	OTTHUMT00000004070.1	G	NM_003036	-		2235884	+1	no_errors	ENST00000378536	ensembl	human	known	74_37	missense	SNP	1.000	C
CELSR3	1951	genome.wustl.edu	37	3	48697124	48697124	+	Missense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr3:48697124G>T	ENST00000164024.4	-	1	3224	c.2944C>A	c.(2944-2946)Cag>Aag	p.Q982K	CELSR3_ENST00000544264.1_Missense_Mutation_p.Q982K	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	982	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GCTGAGATCTGCAGGACACTG	0.532																																																	0								ENSG00000008300						62.0	61.0	61.0					3																	48697124		2203	4300	6503	CELSR3	SO:0001583	missense	0			-	HGNC	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.2944C>A	3.37:g.48697124G>T	ENSP00000164024:p.Gln982Lys	Somatic	0	64	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	72	20.88	O75092	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.Q982K	ENST00000164024.4	37	c.2944	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	G	20.2	3.946335	0.73672	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.01665	4.7;4.7	5.78	5.78	0.91487	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.07593	0.0191	L	0.39692	1.235	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.81914	0.984;0.995	T	0.28332	-1.0047	9	0.49607	T	0.09	.	19.9981	0.97395	0.0:0.0:1.0:0.0	.	982;1052	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	K	982	ENSP00000164024:Q982K;ENSP00000445694:Q982K	ENSP00000164024:Q982K	Q	-	1	0	CELSR3	48672128	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.733000	0.93635	0.561000	0.74099	CAG	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.532	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	protein_coding	OTTHUMT00000257523.1	G	NM_001407	-		48697124	-1	no_errors	ENST00000544264	ensembl	human	known	74_37	missense	SNP	1.000	T
STK32C	282974	genome.wustl.edu	37	10	134059421	134059421	+	Nonsense_Mutation	SNP	T	T	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr10:134059421T>A	ENST00000368625.4	-	2	425	c.340A>T	c.(340-342)Aag>Tag	p.K114*	STK32C_ENST00000368622.1_5'UTR					serine/threonine kinase 32C											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|ovary(2)|skin(1)	23		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		AAGCTGCCCTTCCCAATGGCC	0.632																																																	0								ENSG00000165752						81.0	70.0	74.0					10																	134059421		2203	4300	6503	STK32C	SO:0001587	stop_gained	0			-	HGNC	AK057849	CCDS7666.1	10q26.3	2004-07-22			ENSG00000165752	ENSG00000165752			21332	protein-coding gene	gene with protein product							Standard	NM_173575		Approved	PKE, MGC23665, YANK3	uc001lle.1	Q86UX6	OTTHUMG00000019285	ENST00000368625.4:c.340A>T	10.37:g.134059421T>A	ENSP00000357614:p.Lys114*	Somatic	0	58	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	33	59.76		Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K114*	ENST00000368625.4	37	c.340		10	.	.	.	.	.	.	.	.	.	.	T	36	5.790705	0.96945	.	.	ENSG00000165752	ENST00000298630;ENST00000368625;ENST00000368620	.	.	.	4.34	4.34	0.51931	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.0979	0.42486	0.0:0.0:0.0:1.0	.	.	.	.	X	101;114;151	.	ENSP00000298630:K101X	K	-	1	0	STK32C	133909411	1.000000	0.71417	0.991000	0.47740	0.961000	0.63080	3.176000	0.50863	1.960000	0.56953	0.533000	0.62120	AAG	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom		0.632	STK32C-201	KNOWN	basic	protein_coding	STK32C	protein_coding		T	NM_173575	-		134059421	-1	no_errors	ENST00000368625	ensembl	human	known	74_37	nonsense	SNP	0.996	A
ABCF1	23	genome.wustl.edu	37	6	30545854	30545854	+	Splice_Site	DEL	A	A	-	rs555740367		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr6:30545854delA	ENST00000326195.8	+	4	330	c.218delA	c.(217-219)caa>ca	p.Q73fs	ABCF1_ENST00000376545.3_Splice_Site_p.Q73fs|ABCF1_ENST00000396515.4_Splice_Site_p.Q73fs	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	73					inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						TCTCAGCAGCAAAAAAAAAAG	0.493																																																	0								ENSG00000204574		,	66,405,3793		0,0,66,1,403,1662	64.0	70.0	68.0		,	5.5	1.0	6		71	105,634,7515		0,1,104,0,633,3389	no	codingComplex-near-splice,codingComplex-near-splice	ABCF1	NM_001090.2,NM_001025091.1	,	0,1,170,1,1036,5051	A1A1,A1A2,A1R,A2A2,A2R,RR		8.9532,11.046,9.6661	,	,	30545854	171,1039,11308	2203	4300	6503	ABCF1	SO:0001630	splice_region_variant	0				HGNC	AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.217-1A>-	6.37:g.30545854delA		Somatic	0	26	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	34	15.00	A2BF75|O14897|Q69YP6	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.K76fs	ENST00000326195.8	37	c.218	CCDS34380.1	6																																																																																			-	NULL		0.493	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABCF1	protein_coding	OTTHUMT00000076137.3	A			Frame_Shift_Del	30545854	+1	no_errors	ENST00000326195	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
SNX14	57231	genome.wustl.edu	37	6	86215639	86215639	+	3'UTR	SNP	G	G	T	rs369009161		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr6:86215639G>T	ENST00000314673.3	-	0	3063				SNX14_ENST00000505648.1_3'UTR|SNX14_ENST00000508980.1_5'UTR|SNX14_ENST00000346348.3_3'UTR|SNX14_ENST00000369627.2_3'UTR|SNX14_ENST00000513865.1_3'UTR	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14						protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TACCACCCTCGCACAGCAGAA	0.294																																																	0								ENSG00000135317						58.0	57.0	58.0					6																	86215639		2202	4297	6499	SNX14	SO:0001624	3_prime_UTR_variant	0			-	HGNC	AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.*46C>A	6.37:g.86215639G>T		Somatic	0	23	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	24	17.24	B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000314673.3	37	NULL	CCDS5004.1	6																																																																																			-	-		0.294	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX14	protein_coding	OTTHUMT00000041393.2	G	NM_153816	-		86215639	-1	no_errors	ENST00000508980	ensembl	human	known	74_37	rna	SNP	0.003	T
GSC	145258	genome.wustl.edu	37	14	95235493	95235493	+	Missense_Mutation	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr14:95235493C>T	ENST00000238558.3	-	2	626	c.417G>A	c.(415-417)atG>atA	p.M139I		NM_173849.2	NP_776248.1	P56915	GSC_HUMAN	goosecoid homeobox	139					dorsal/ventral neural tube patterning (GO:0021904)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|gastrulation (GO:0007369)|middle ear morphogenesis (GO:0042474)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|neural crest cell fate specification (GO:0014036)|signal transduction involved in regulation of gene expression (GO:0023019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)			skin(1)	1		all_cancers(154;0.0896)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.202)|Epithelial(152;0.239)		TGCCCACGTTCATGTAGGGCA	0.687																																					Pancreas(105;2165 2186 4892 18008)												0								ENSG00000133937						21.0	14.0	16.0					14																	95235493		2194	4290	6484	GSC	SO:0001583	missense	0			-	HGNC		CCDS9930.1	14q32.13	2011-06-20	2007-07-11			ENSG00000133937		"""Homeoboxes / PRD class"""	4612	protein-coding gene	gene with protein product		138890				7916327	Standard	NM_173849		Approved		uc001ydu.3	P56915		ENST00000238558.3:c.417G>A	14.37:g.95235493C>T	ENSP00000238558:p.Met139Ile	Somatic	0	32	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	Q86YR1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.M139I	ENST00000238558.3	37	c.417	CCDS9930.1	14	.	.	.	.	.	.	.	.	.	.	C	18.86	3.712954	0.68730	.	.	ENSG00000133937	ENST00000238558	T	0.28895	1.59	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.26448	0.0646	L	0.27053	0.805	0.80722	D	1	P	0.38504	0.634	B	0.38562	0.276	T	0.03981	-1.0987	10	0.36615	T	0.2	-33.2807	18.1505	0.89672	0.0:1.0:0.0:0.0	.	139	P56915	GSC_HUMAN	I	139	ENSP00000238558:M139I	ENSP00000238558:M139I	M	-	3	0	GSC	94305246	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.746000	0.85057	2.305000	0.77605	0.456000	0.33151	ATG	-	NULL		0.687	GSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSC	protein_coding	OTTHUMT00000410746.1	C		-		95235493	-1	no_errors	ENST00000238558	ensembl	human	known	74_37	missense	SNP	1.000	T
CCDC158	339965	genome.wustl.edu	37	4	77288467	77288467	+	Missense_Mutation	SNP	T	T	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr4:77288467T>A	ENST00000388914.3	-	11	1962	c.1810A>T	c.(1810-1812)Atg>Ttg	p.M604L		NM_001042784.1	NP_001036249.1	Q5M9N0	CD158_HUMAN	coiled-coil domain containing 158	604										breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(1)	56						TTTAGTTCCATCCGCCTATCA	0.398																																																	0								ENSG00000163749						107.0	104.0	105.0					4																	77288467		1870	4090	5960	CCDC158	SO:0001583	missense	0			-	HGNC	BC035224	CCDS43242.1	4q21.1	2009-04-06			ENSG00000163749	ENSG00000163749			26374	protein-coding gene	gene with protein product						12477932	Standard	NM_001042784		Approved	FLJ25770	uc003hkb.4	Q5M9N0	OTTHUMG00000160916	ENST00000388914.3:c.1810A>T	4.37:g.77288467T>A	ENSP00000373566:p.Met604Leu	Somatic	0	25	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	20	28.57	Q8IYQ1|Q8N7D4|Q8N7E3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Prefoldin	p.M604L	ENST00000388914.3	37	c.1810	CCDS43242.1	4	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.612036	0.00835	.	.	ENSG00000163749	ENST00000388914	T	0.24908	1.83	5.66	3.91	0.45181	.	0.104625	0.38217	N	0.001770	T	0.09379	0.0231	N	0.01874	-0.695	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13202	-1.0518	10	0.27785	T	0.31	.	8.6425	0.33985	0.079:0.0:0.7686:0.1525	.	604	Q5M9N0	CD158_HUMAN	L	604	ENSP00000373566:M604L	ENSP00000373566:M604L	M	-	1	0	CCDC158	77507491	0.999000	0.42202	0.747000	0.31113	0.230000	0.25150	2.992000	0.49417	0.740000	0.32651	-0.656000	0.03901	ATG	-	NULL		0.398	CCDC158-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC158	protein_coding	OTTHUMT00000362694.2	T	NM_001042784	-		77288467	-1	no_errors	ENST00000388914	ensembl	human	known	74_37	missense	SNP	0.913	A
CRLF2	64109	genome.wustl.edu	37	X	1331587	1331587	+	5'UTR	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chrX:1331587G>T	ENST00000467626.1	-	0	29				CRLF2_ENST00000381567.3_5'Flank|CRLF2_ENST00000381566.1_5'Flank			Q9HC73	CRLF2_HUMAN	cytokine receptor-like factor 2						immunoglobulin secretion involved in immune response (GO:0002380)|inflammatory response (GO:0006954)|T-helper 2 cell cytokine production (GO:0035745)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|lung(9)	20		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				GATCACTCATGACTCATAAGC	0.478			"""Mis, T"""	"""P2RY8, IGH@"""	"""B-ALL, Downs associated ALL"""																																			Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	64109	cytokine receptor-like factor 2		L	0								ENSG00000205755						136.0	147.0	144.0					X																	1331587		692	1591	2283	CRLF2	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AF142570	CCDS75944.1, CCDS75945.1	Xp22.3 and Yp11.3	2011-10-07			ENSG00000205755	ENSG00000205755		"""Pseudoautosomal regions / PAR1"""	14281	protein-coding gene	gene with protein product		300357, 400023				11237741, 11474172	Standard	NM_022148		Approved	CRL2, TSLPR	uc004cpk.2	Q9HC73	OTTHUMG00000067432	ENST00000467626.1:c.-1006C>A	X.37:g.1331587G>T		Somatic	0	52	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q9H5R3	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000467626.1	37	NULL		X																																																																																			-	-		0.478	CRLF2-002	KNOWN	mRNA_end_NF|basic	processed_transcript	CRLF2	protein_coding	OTTHUMT00000144414.1	G	NM_022148	-		1331587	-1	no_errors	ENST00000467626	ensembl	human	known	74_37	rna	SNP	0.001	T
DPYSL5	56896	genome.wustl.edu	37	2	27121387	27121387	+	Missense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr2:27121387G>T	ENST00000288699.6	+	2	178	c.20G>T	c.(19-21)aGc>aTc	p.S7I	DPYSL5_ENST00000401478.1_Missense_Mutation_p.S7I	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	7					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AACTCAGCCAGCGTGAGGATC	0.547																																																	0								ENSG00000157851						222.0	202.0	209.0					2																	27121387		2203	4300	6503	DPYSL5	SO:0001583	missense	0			-	HGNC	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.20G>T	2.37:g.27121387G>T	ENSP00000288699:p.Ser7Ile	Somatic	0	54	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	58	19.44	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.S7I	ENST00000288699.6	37	c.20	CCDS1730.1	2	.	.	.	.	.	.	.	.	.	.	G	14.80	2.644399	0.47258	.	.	ENSG00000157851	ENST00000450961;ENST00000288699;ENST00000401478;ENST00000431402;ENST00000434719	T;D;D;T;T	0.86097	-1.16;-2.07;-2.07;-1.16;-1.16	4.61	4.61	0.57282	Metal-dependent hydrolase, composite domain (1);	0.135724	0.64402	D	0.000004	D	0.84165	0.5412	L	0.47190	1.495	0.34278	D	0.681772	B	0.29988	0.264	B	0.40066	0.318	D	0.89090	0.3482	10	0.87932	D	0	-29.0347	13.0768	0.59091	0.0:0.1627:0.8373:0.0	.	7	Q9BPU6	DPYL5_HUMAN	I	7	ENSP00000407174:S7I;ENSP00000288699:S7I;ENSP00000385549:S7I;ENSP00000399581:S7I;ENSP00000413075:S7I	ENSP00000288699:S7I	S	+	2	0	DPYSL5	26974891	0.998000	0.40836	1.000000	0.80357	0.977000	0.68977	3.197000	0.51028	2.286000	0.76751	0.561000	0.74099	AGC	-	superfamily_Metal-dep_hydrolase_composite		0.547	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL5	protein_coding	OTTHUMT00000214187.2	G	NM_020134	-		27121387	+1	no_errors	ENST00000288699	ensembl	human	known	74_37	missense	SNP	1.000	T
CNBD1	168975	genome.wustl.edu	37	8	88296985	88296985	+	Missense_Mutation	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr8:88296985C>T	ENST00000518476.1	+	7	902	c.851C>T	c.(850-852)aCa>aTa	p.T284I		NM_173538.2	NP_775809.1	Q8NA66	CNBD1_HUMAN	cyclic nucleotide binding domain containing 1	284										breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(4)|urinary_tract(1)	32						TCGGTGGTGACAGAAGACGAT	0.368																																																	0								ENSG00000176571						71.0	67.0	68.0					8																	88296985		1849	4088	5937	CNBD1	SO:0001583	missense	0			-	HGNC	AK093121	CCDS55259.1	8q21.3	2005-08-09				ENSG00000176571			26663	protein-coding gene	gene with protein product							Standard	NM_173538		Approved	FLJ35802	uc003ydy.2	Q8NA66		ENST00000518476.1:c.851C>T	8.37:g.88296985C>T	ENSP00000430073:p.Thr284Ile	Somatic	0	37	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,pfscan_cNMP-bd_dom	p.T284I	ENST00000518476.1	37	c.851	CCDS55259.1	8	.	.	.	.	.	.	.	.	.	.	C	4.837	0.155584	0.09236	.	.	ENSG00000176571	ENST00000518476	D	0.96940	-4.18	5.25	2.02	0.26589	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.602886	0.14910	N	0.291339	D	0.93288	0.7861	L	0.57536	1.79	0.09310	N	1	B	0.32302	0.363	B	0.28232	0.087	D	0.87861	0.2664	10	0.72032	D	0.01	-8.0556	7.7631	0.28963	0.0:0.689:0.0:0.311	.	284	Q8NA66	CNBD1_HUMAN	I	284	ENSP00000430073:T284I	ENSP00000430073:T284I	T	+	2	0	CNBD1	88366101	0.005000	0.15991	0.079000	0.20413	0.070000	0.16714	0.560000	0.23500	0.614000	0.30107	-0.218000	0.12543	ACA	-	superfamily_cNMP-bd-like		0.368	CNBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNBD1	protein_coding	OTTHUMT00000375113.2	C	NM_173538	-		88296985	+1	no_errors	ENST00000518476	ensembl	human	known	74_37	missense	SNP	0.003	T
TRPM4	54795	genome.wustl.edu	37	19	49713967	49713967	+	Splice_Site	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr19:49713967G>A	ENST00000252826.5	+	22	3455	c.3329G>A	c.(3328-3330)cGg>cAg	p.R1110Q	TRPM4_ENST00000355712.5_Splice_Site_p.R756Q|TRPM4_ENST00000427978.2_Splice_Site_p.R965Q	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	1110	Calmodulin-binding.				calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GCCCCTGCAGGGGTTTACCTT	0.617																																																	0								ENSG00000130529						31.0	39.0	36.0					19																	49713967		2199	4298	6497	TRPM4	SO:0001630	splice_region_variant	0			-	HGNC	AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.3329-1G>A	19.37:g.49713967G>A		Somatic	0	79	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	40	71	36.04	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom	p.R1110Q	ENST00000252826.5	37	c.3329	CCDS33073.1	19	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974186	0.34848	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	T;T;T	0.50813	0.73;0.73;0.73	4.96	1.53	0.23141	.	0.557618	0.16542	N	0.209920	T	0.48519	0.1504	L	0.45581	1.43	0.26801	N	0.969206	D;D;D;D	0.58620	0.971;0.983;0.969;0.967	P;P;P;P	0.53649	0.543;0.731;0.649;0.522	T	0.36578	-0.9742	9	.	.	.	.	8.7436	0.34571	0.077:0.0:0.5521:0.3709	.	756;936;965;1110	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	Q	1110;965;756	ENSP00000252826:R1110Q;ENSP00000407492:R965Q;ENSP00000347944:R756Q	.	R	+	2	0	TRPM4	54405779	0.963000	0.33076	0.716000	0.30569	0.001000	0.01503	0.294000	0.19047	0.221000	0.20879	-2.048000	0.00412	CGG	-	NULL		0.617	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	protein_coding	OTTHUMT00000465543.2	G	NM_017636	-	Missense_Mutation	49713967	+1	no_errors	ENST00000252826	ensembl	human	known	74_37	missense	SNP	0.799	A
C14orf177	283598	genome.wustl.edu	37	14	99183433	99183433	+	Splice_Site	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr14:99183433G>T	ENST00000325812.2	+	4	619	c.200G>T	c.(199-201)gGt>gTt	p.G67V		NM_182560.2	NP_872366.2	Q52M58	CN177_HUMAN	chromosome 14 open reading frame 177	67										endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	13		Melanoma(154;0.128)				CCCCCTCCAGGTGAGTGCTCT	0.498																																																	0								ENSG00000176605						84.0	78.0	80.0					14																	99183433		2203	4300	6503	C14orf177	SO:0001630	splice_region_variant	0			-	HGNC	AK098639	CCDS9948.1	14q32.2	2012-05-30			ENSG00000176605	ENSG00000176605			26375	protein-coding gene	gene with protein product						12477932	Standard	NM_182560		Approved	FLJ25773	uc001yfz.2	Q52M58	OTTHUMG00000167745	ENST00000325812.2:c.200-1G>T	14.37:g.99183433G>T		Somatic	0	41	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	63	27	70.00	Q8N7D2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.G67V	ENST00000325812.2	37	c.200	CCDS9948.1	14	.	.	.	.	.	.	.	.	.	.	G	2.031	-0.422393	0.04734	.	.	ENSG00000176605	ENST00000325812;ENST00000541516	T;T	0.51817	0.85;0.69	3.23	0.257	0.15574	.	.	.	.	.	T	0.25005	0.0607	N	0.08118	0	0.58432	D	0.999992	P	0.50943	0.94	P	0.46275	0.51	T	0.06881	-1.0802	8	.	.	.	.	4.0102	0.09619	0.1185:0.0:0.4661:0.4154	.	67	Q52M58	CN177_HUMAN	V	67	ENSP00000321360:G67V;ENSP00000440687:G67V	.	G	+	2	0	C14orf177	98253186	0.001000	0.12720	0.001000	0.08648	0.000000	0.00434	0.326000	0.19646	0.041000	0.15688	-0.822000	0.03109	GGT	-	NULL		0.498	C14orf177-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf177	protein_coding	OTTHUMT00000396078.1	G	NM_182560	-	Missense_Mutation	99183433	+1	no_errors	ENST00000325812	ensembl	human	known	74_37	missense	SNP	0.001	T
FAM111B	374393	genome.wustl.edu	37	11	58892377	58892377	+	Frame_Shift_Del	DEL	A	A	-			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr11:58892377delA	ENST00000343597.3	+	4	998	c.807delA	c.(805-807)tcafs	p.S269fs	FAM111B_ENST00000529618.1_Frame_Shift_Del_p.S239fs|FAM111B_ENST00000411426.1_Frame_Shift_Del_p.S239fs	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	269							catalytic activity (GO:0003824)	p.A273fs*9(1)|p.K272delK(1)|p.A273fs*26(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TGGACATTTCAAAAAAAAAAG	0.313																																																	3	Deletion - Frameshift(1)|Deletion - In frame(1)|Insertion - Frameshift(1)	kidney(2)|ovary(1)						ENSG00000189057																																			FAM111B	SO:0001589	frameshift_variant	0				HGNC	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.807delA	11.37:g.58892377delA	ENSP00000341565:p.Ser269fs	Somatic	0	17	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	15	16.67	B4E2G2|Q6P661	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	superfamily_Trypsin-like_Pept_dom	p.K272fs	ENST00000343597.3	37	c.807	CCDS7972.1	11																																																																																			-	NULL		0.313	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM111B	protein_coding	OTTHUMT00000393974.1	A	NM_198947			58892377	+1	no_errors	ENST00000343597	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
LNPEP	4012	genome.wustl.edu	37	5	96360291	96360291	+	Missense_Mutation	SNP	C	C	G			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr5:96360291C>G	ENST00000231368.5	+	15	3320	c.2628C>G	c.(2626-2628)ttC>ttG	p.F876L	LNPEP_ENST00000395770.3_Missense_Mutation_p.F862L	NM_005575.2	NP_005566.2	Q9UIQ6	LCAP_HUMAN	leucyl/cystinyl aminopeptidase	876					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|membrane organization (GO:0061024)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|early endosome lumen (GO:0031905)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	34		all_cancers(142;7e-07)|all_epithelial(76;9.52e-10)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0269)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.072)		GCTGGTCATTCCTTTTGGGCA	0.423																																																	0								ENSG00000113441						89.0	81.0	84.0					5																	96360291		2203	4300	6503	LNPEP	SO:0001583	missense	0			-	HGNC	D50810	CCDS4087.1, CCDS43346.1	5q15	2011-07-25			ENSG00000113441	ENSG00000113441	3.4.11.3		6656	protein-coding gene	gene with protein product	"""cystinyl aminopeptidase"", ""placental leucine aminopeptidase"""	151300				8550619	Standard	NM_175920		Approved	CAP, PLAP, P-LAP	uc003kmw.1	Q9UIQ6	OTTHUMG00000128719	ENST00000231368.5:c.2628C>G	5.37:g.96360291C>G	ENSP00000231368:p.Phe876Leu	Somatic	0	49	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	52	20.00	O00769|Q15145|Q59H76|Q9TNQ2|Q9TNQ3|Q9UIQ7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.F876L	ENST00000231368.5	37	c.2628	CCDS4087.1	5	.	.	.	.	.	.	.	.	.	.	C	11.05	1.523481	0.27299	.	.	ENSG00000113441	ENST00000231368;ENST00000395770	T;T	0.04970	3.52;3.52	5.96	5.07	0.68467	.	0.233064	0.52532	D	0.000068	T	0.07007	0.0178	L	0.38953	1.18	0.45594	D	0.99853	B	0.18461	0.028	B	0.24848	0.056	T	0.19353	-1.0308	10	0.51188	T	0.08	.	10.3068	0.43685	0.0:0.8442:0.0:0.1558	.	876	Q9UIQ6	LCAP_HUMAN	L	876;862	ENSP00000231368:F876L;ENSP00000379117:F862L	ENSP00000231368:F876L	F	+	3	2	LNPEP	96386047	0.999000	0.42202	0.996000	0.52242	0.091000	0.18340	0.576000	0.23744	1.467000	0.48044	0.655000	0.94253	TTC	-	NULL		0.423	LNPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNPEP	protein_coding	OTTHUMT00000250624.1	C	NM_005575	-		96360291	+1	no_errors	ENST00000231368	ensembl	human	known	74_37	missense	SNP	1.000	G
OR4C3	256144	genome.wustl.edu	37	11	48346842	48346842	+	Missense_Mutation	SNP	T	T	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr11:48346842T>A	ENST00000319856.4	+	1	371	c.350T>A	c.(349-351)aTc>aAc	p.I117N		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						GGGAGAACCATCTCTTATGAG	0.443																																																	0								ENSG00000176547						257.0	243.0	248.0					11																	48346842		2201	4298	6499	OR4C3	SO:0001583	missense	0			-	HGNC	AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.350T>A	11.37:g.48346842T>A	ENSP00000321419:p.Ile117Asn	Somatic	0	119	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	130	9.09	B2RNF2|Q6IFB3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I117N	ENST00000319856.4	37	c.350	CCDS31489.1	11	.	.	.	.	.	.	.	.	.	.	T	15.56	2.868990	0.51588	.	.	ENSG00000176547	ENST00000319856	T	0.01369	4.97	5.78	5.78	0.91487	GPCR, rhodopsin-like superfamily (1);	0.122041	0.36815	N	0.002381	T	0.13286	0.0322	H	0.98133	4.155	0.09310	N	0.999997	P	0.45176	0.852	P	0.55345	0.774	T	0.28202	-1.0051	10	0.87932	D	0	.	14.2031	0.65716	0.0:0.0:0.0:1.0	.	90	Q8NH37	OR4C3_HUMAN	N	117	ENSP00000321419:I117N	ENSP00000321419:I117N	I	+	2	0	OR4C3	48303418	1.000000	0.71417	0.029000	0.17559	0.817000	0.46193	4.605000	0.61119	2.245000	0.73994	0.391000	0.25812	ATC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.443	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C3	protein_coding	OTTHUMT00000390557.1	T	NM_001004702	-		48346842	+1	no_errors	ENST00000319856	ensembl	human	known	74_37	missense	SNP	0.314	A
SCRN3	79634	genome.wustl.edu	37	2	175292593	175292593	+	Missense_Mutation	SNP	G	G	T	rs145699077|rs79038555	byFrequency	TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr2:175292593G>T	ENST00000272732.6	+	8	1327	c.1245G>T	c.(1243-1245)caG>caT	p.Q415H	SCRN3_ENST00000548921.1_3'UTR|SCRN3_ENST00000409673.3_Missense_Mutation_p.Q408H	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	415							dipeptidase activity (GO:0016805)	p.N417fs*>4(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			AAATTTATCAGTCAAATTTAT	0.323																																																	1	Deletion - Frameshift(1)	urinary_tract(1)						ENSG00000144306						67.0	56.0	60.0					2																	175292593		2203	4290	6493	SCRN3	SO:0001583	missense	0			-	HGNC	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.1245G>T	2.37:g.175292593G>T	ENSP00000272732:p.Gln415His	Somatic	0	39	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	32	15.79	B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C69	p.Q415H	ENST00000272732.6	37	c.1245	CCDS2258.1	2	.	.	.	.	.	.	.	.	.	.	G	14.09	2.432315	0.43122	.	.	ENSG00000144306	ENST00000409673;ENST00000272732	T;T	0.08546	3.08;3.08	5.63	1.87	0.25490	.	1.083350	0.06890	N	0.804042	T	0.04998	0.0134	N	0.19112	0.55	0.09310	N	1	B;B	0.30709	0.291;0.052	B;B	0.28232	0.087;0.054	T	0.43845	-0.9366	9	.	.	.	0.6761	2.0969	0.03670	0.284:0.1694:0.4342:0.1123	.	408;415	B4DI11;Q0VDG4	.;SCRN3_HUMAN	H	408;415	ENSP00000387142:Q408H;ENSP00000272732:Q415H	.	Q	+	3	2	SCRN3	175000839	0.002000	0.14202	0.113000	0.21522	0.782000	0.44232	-0.109000	0.10840	0.338000	0.23692	-0.140000	0.14226	CAG	-	NULL		0.323	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCRN3	protein_coding	OTTHUMT00000255451.2	G	NM_024583	rs79038555		175292593	+1	no_errors	ENST00000272732	ensembl	human	known	74_37	missense	SNP	0.001	T
DSG2	1829	genome.wustl.edu	37	18	29122725	29122725	+	Silent	SNP	A	A	C			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr18:29122725A>C	ENST00000261590.8	+	14	2453	c.2244A>C	c.(2242-2244)gcA>gcC	p.A748A	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	748					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			CGAAGACCGCAAGGGCCACAG	0.512																																																	0								ENSG00000046604						86.0	93.0	91.0					18																	29122725		2045	4201	6246	DSG2	SO:0001819	synonymous_variant	0			-	HGNC	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.2244A>C	18.37:g.29122725A>C		Somatic	0	50	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	27	44.90	Q4KKU6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.A748	ENST00000261590.8	37	c.2244	CCDS42423.1	18																																																																																			-	NULL		0.512	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG2	protein_coding	OTTHUMT00000447506.1	A	NM_001943	-		29122725	+1	no_errors	ENST00000261590	ensembl	human	known	74_37	silent	SNP	0.000	C
PAPPA	5069	genome.wustl.edu	37	9	119130031	119130031	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr9:119130031G>T	ENST00000328252.3	+	19	4972	c.4603G>T	c.(4603-4605)Gag>Tag	p.E1535*	PAPPA_ENST00000534838.1_Nonsense_Mutation_p.E573*	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1535	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CACACGGGTAGAGGTGAGTGA	0.557																																																	0								ENSG00000182752						102.0	70.0	81.0					9																	119130031		2203	4300	6503	PAPPA	SO:0001587	stop_gained	0			-	HGNC		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.4603G>T	9.37:g.119130031G>T	ENSP00000330658:p.Glu1535*	Somatic	0	35	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	29	12.12	B1AMF9|Q08371|Q68G52|Q9UDK7	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.E1535*	ENST00000328252.3	37	c.4603	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	G	45	12.034991	0.99629	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	.	.	.	5.43	-0.901	0.10540	.	0.371002	0.32147	N	0.006510	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-5.7963	13.3271	0.60465	0.0874:0.6977:0.2149:0.0	.	.	.	.	X	1535;573	.	ENSP00000330658:E1535X	E	+	1	0	PAPPA	118169852	0.942000	0.31987	0.273000	0.24645	0.731000	0.41821	0.434000	0.21494	-0.497000	0.06641	0.650000	0.86243	GAG	-	NULL		0.557	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	protein_coding	OTTHUMT00000055546.1	G	NM_002581	-		119130031	+1	no_errors	ENST00000328252	ensembl	human	known	74_37	nonsense	SNP	0.372	T
ATRX	546	genome.wustl.edu	37	X	76872172	76872172	+	Missense_Mutation	SNP	T	T	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chrX:76872172T>A	ENST00000373344.5	-	22	5689	c.5475A>T	c.(5473-5475)aaA>aaT	p.K1825N	ATRX_ENST00000395603.3_Missense_Mutation_p.K1787N|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1825					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						GAGGCAAGAATTTTGTTAATG	0.313			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	1	Unknown(1)	bone(1)						ENSG00000085224						121.0	107.0	112.0					X																	76872172		2202	4291	6493	ATRX	SO:0001583	missense	0			-	HGNC	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5475A>T	X.37:g.76872172T>A	ENSP00000362441:p.Lys1825Asn	Somatic	0	84	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	26	25.71	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K1825N	ENST00000373344.5	37	c.5475	CCDS14434.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.51|12.51	1.960493|1.960493	0.34565|0.34565	.|.	.|.	ENSG00000085224|ENSG00000085224	ENST00000373344;ENST00000395603|ENST00000400866	D;D|.	0.94000|.	-3.33;-3.33|.	5.66|5.66	3.88|3.88	0.44766|0.44766	SNF2-related (1);|.	0.000000|.	0.85682|.	U|.	0.000000|.	T|T	0.60301|0.60301	0.2258|0.2258	L|L	0.53780|0.53780	1.695|1.695	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;0.997|.	D;D|.	0.91635|.	0.999;0.969|.	T|T	0.54629|0.54629	-0.8265|-0.8265	10|5	0.37606|.	T|.	0.19|.	-8.825|-8.825	11.0114|11.0114	0.47665|0.47665	0.0:0.8429:0.0:0.1571|0.0:0.8429:0.0:0.1571	.|.	1787;1825|.	P46100-4;P46100|.	.;ATRX_HUMAN|.	N|I	1825;1787|114	ENSP00000362441:K1825N;ENSP00000378967:K1787N|.	ENSP00000362441:K1825N|.	K|N	-|-	3|2	2|0	ATRX|ATRX	76758828|76758828	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	1.788000|1.788000	0.38714|0.38714	0.535000|0.535000	0.28714|0.28714	-0.488000|-0.488000	0.04728|0.04728	AAA|AAT	-	pfam_SNF2_N,superfamily_P-loop_NTPase		0.313	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	protein_coding	OTTHUMT00000058860.2	T	NM_000489	-		76872172	-1	no_errors	ENST00000373344	ensembl	human	known	74_37	missense	SNP	1.000	A
CETP	1071	genome.wustl.edu	37	16	57017287	57017287	+	Silent	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr16:57017287C>T	ENST00000566128.1	+	15	1443	c.1176C>T	c.(1174-1176)ctC>ctT	p.L392L	CETP_ENST00000200676.3_Silent_p.L457L|CETP_ENST00000379780.2_Silent_p.L397L					cholesteryl ester transfer protein, plasma											NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(4)|skin(3)	23						GCGTGAGCCTCTTCGACATCA	0.592																																																	0								ENSG00000087237						106.0	97.0	100.0					16																	57017287		2198	4300	6498	CETP	SO:0001819	synonymous_variant	0			-	HGNC	M30185	CCDS10772.1, CCDS67032.1	16q13	2012-10-02			ENSG00000087237	ENSG00000087237		"""BPI fold containing"""	1869	protein-coding gene	gene with protein product	"""BPI fold containing family F"""	118470				3600759, 2334701	Standard	NM_000078		Approved	BPIFF	uc002eki.2	P11597	OTTHUMG00000133279	ENST00000566128.1:c.1176C>T	16.37:g.57017287C>T		Somatic	0	41	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	11	64.52		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C,pirsf_Cholesteryl_ester_transfer	p.L457	ENST00000566128.1	37	c.1371		16																																																																																			-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C,pirsf_Cholesteryl_ester_transfer		0.592	CETP-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	CETP	protein_coding	OTTHUMT00000432305.1	C	NM_000078	-		57017287	+1	no_errors	ENST00000200676	ensembl	human	known	74_37	silent	SNP	0.999	T
OR4N5	390437	genome.wustl.edu	37	14	20612593	20612593	+	Missense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr14:20612593G>T	ENST00000333629.1	+	1	699	c.699G>T	c.(697-699)aaG>aaT	p.K233N	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K233R(1)		endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		CTGAAGGAAAGAGCAAGGCTA	0.498																																																	1	Substitution - Missense(1)	lung(1)						ENSG00000184394						148.0	148.0	148.0					14																	20612593		2203	4300	6503	OR4N5	SO:0001583	missense	0			-	HGNC		CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.699G>T	14.37:g.20612593G>T	ENSP00000332110:p.Lys233Asn	Somatic	0	71	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	20	55	26.67	Q6IF11	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.K233N	ENST00000333629.1	37	c.699	CCDS32031.1	14	.	.	.	.	.	.	.	.	.	.	G	5.016	0.188655	0.09547	.	.	ENSG00000184394	ENST00000333629	T	0.00169	8.63	3.88	-1.61	0.08399	GPCR, rhodopsin-like superfamily (1);	0.146929	0.31427	N	0.007668	T	0.00468	0.0015	M	0.89163	3.01	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.47182	-0.9137	10	0.72032	D	0.01	.	5.0411	0.14460	0.3894:0.1461:0.4645:0.0	.	233	Q8IXE1	OR4N5_HUMAN	N	233	ENSP00000332110:K233N	ENSP00000332110:K233N	K	+	3	2	OR4N5	19682433	0.000000	0.05858	0.048000	0.18961	0.383000	0.30230	-1.280000	0.02804	-0.489000	0.06716	-0.753000	0.03488	AAG	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.498	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N5	protein_coding	OTTHUMT00000410347.1	G		-		20612593	+1	no_errors	ENST00000333629	ensembl	human	known	74_37	missense	SNP	0.003	T
SYCP1	6847	genome.wustl.edu	37	1	115487553	115487553	+	Nonsense_Mutation	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr1:115487553C>T	ENST00000369522.3	+	25	2344	c.2104C>T	c.(2104-2106)Cga>Tga	p.R702*	SYCP1_ENST00000369518.1_Nonsense_Mutation_p.R702*	NM_001282541.1|NM_003176.2	NP_001269470.1|NP_003167.2	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	702					chiasma assembly (GO:0051026)|lateral element assembly (GO:0051878)|meiotic DNA repair synthesis (GO:0000711)|reciprocal meiotic recombination (GO:0007131)|regulation of protein localization (GO:0032880)|sperm chromatin condensation (GO:0035092)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)|male germ cell nucleus (GO:0001673)|transverse filament (GO:0000802)	DNA binding (GO:0003677)	p.R702*(1)	RGS22/SYCP1(2)	NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AATTGATAAGCGATGTCAACA	0.249																																																	1	Substitution - Nonsense(1)	large_intestine(1)						ENSG00000198765						39.0	40.0	40.0					1																	115487553		2201	4285	6486	SYCP1	SO:0001587	stop_gained	0			-	HGNC	D67035	CCDS879.1, CCDS72840.1	1p13-p12	2009-03-12			ENSG00000198765	ENSG00000198765			11487	protein-coding gene	gene with protein product	"""cancer/testis antigen 8"""	602162				9560255	Standard	XM_005271154		Approved	HOM-TES-14, SCP1, CT8	uc001efr.3	Q15431	OTTHUMG00000012057	ENST00000369522.3:c.2104C>T	1.37:g.115487553C>T	ENSP00000358535:p.Arg702*	Somatic	0	44	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	44	16.98	O14963|Q5VXJ6	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SCP-1	p.R702*	ENST00000369522.3	37	c.2104	CCDS879.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.826235	0.96996	.	.	ENSG00000198765	ENST00000369522;ENST00000536734;ENST00000455987;ENST00000369518	.	.	.	4.91	3.9	0.45041	.	0.080155	0.50627	D	0.000118	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.3104	15.5178	0.75840	0.1479:0.8521:0.0:0.0	.	.	.	.	X	702	.	ENSP00000358531:R702X	R	+	1	2	SYCP1	115289076	0.995000	0.38212	1.000000	0.80357	0.987000	0.75469	1.957000	0.40392	2.268000	0.75426	0.650000	0.86243	CGA	-	pfam_SCP-1		0.249	SYCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP1	protein_coding	OTTHUMT00000033386.1	C	NM_003176	-		115487553	+1	no_errors	ENST00000369518	ensembl	human	known	74_37	nonsense	SNP	0.985	T
C2orf50	130813	genome.wustl.edu	37	2	11284204	11284204	+	Silent	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr2:11284204G>A	ENST00000381585.3	+	3	738	c.456G>A	c.(454-456)aaG>aaA	p.K152K	C2orf50_ENST00000405022.3_Silent_p.K152K			Q96LR7	CB050_HUMAN	chromosome 2 open reading frame 50	152										breast(1)|large_intestine(1)|upper_aerodigestive_tract(1)	3	all_hematologic(175;0.0797)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.0997)|OV - Ovarian serous cystadenocarcinoma(76;0.134)		GGGCCCGGAAGAAGAAGCTGG	0.612																																																	0								ENSG00000150873						42.0	41.0	41.0					2																	11284204		2203	4300	6503	C2orf50	SO:0001819	synonymous_variant	0			-	HGNC	AK057872	CCDS1678.1	2p25.1	2012-08-02			ENSG00000150873	ENSG00000150873			26324	protein-coding gene	gene with protein product						12477932	Standard	NM_182500		Approved	FLJ25143	uc010yjj.1	Q96LR7	OTTHUMG00000119057	ENST00000381585.3:c.456G>A	2.37:g.11284204G>A		Somatic	0	38	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	34	20.93	A8K9W3|D6W503	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.K152	ENST00000381585.3	37	c.456	CCDS1678.1	2																																																																																			-	NULL		0.612	C2orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf50	protein_coding	OTTHUMT00000239268.1	G	NM_182500	-		11284204	+1	no_errors	ENST00000381585	ensembl	human	known	74_37	silent	SNP	1.000	A
RNF212	285498	genome.wustl.edu	37	4	1087327	1087328	+	Intron	INS	-	-	CTGCCCAGGCTGGAGCCAGCC	rs376912904|rs386670461|rs142232513|rs539986150|rs138488801	byFrequency	TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr4:1087327_1087328insCTGCCCAGGCTGGAGCCAGCC	ENST00000433731.2	-	4	308				RNF212_ENST00000333673.5_In_Frame_Ins_p.241_241S>WLAPAWAA|RNF212_ENST00000382968.5_Intron			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		CAGAGCCTGTGACCTCCACGGC	0.619																																																	0								ENSG00000178222																																			RNF212	SO:0001627	intron_variant	0				HGNC	AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997	ENST00000433731.2:c.247-2701->GGCTGGCTCCAGCCTGGGCAG	4.37:g.1087327_1087328insCTGCCCAGGCTGGAGCCAGCC		Somatic	NA	NA	NA		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfscan_Znf_RING	p.S241in_frame_insWLAPAWAA	ENST00000433731.2	37	c.722_721	CCDS46996.1	4																																																																																			-	NULL		0.619	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF212	protein_coding	OTTHUMT00000359124.2	-	NM_194439			1087328	-1	no_errors	ENST00000333673	ensembl	human	known	74_37	in_frame_ins	INS	0.085:0.000	CTGCCCAGGCTGGAGCCAGCC
RP11-469N6.1	0	genome.wustl.edu	37	11	134605647	134605647	+	lincRNA	SNP	A	A	G	rs113767151	byFrequency	TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr11:134605647A>G	ENST00000513405.1	+	0	158																											GCTGGGGTTCATGGGCAGAGT	0.627													N|||	2898	0.578674	0.6218	0.5865	5008	,	,		8811	0.6786		0.5318	False		,,,				2504	0.4601																0								ENSG00000251226																																			RP11-469N6.1			0			-	Clone_based_vega_gene																													11.37:g.134605647A>G		Somatic	0	113	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	62	8.82		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000513405.1	37	NULL		11																																																																																			-	-		0.627	RP11-469N6.1-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000251226	lincRNA	OTTHUMT00000382010.2	A		rs113767151		134605647	+1	no_errors	ENST00000513405	ensembl	human	known	74_37	rna	SNP	0.010	G
SLC26A8	116369	genome.wustl.edu	37	6	35945038	35945038	+	Silent	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr6:35945038G>A	ENST00000490799.1	-	9	1469	c.1116C>T	c.(1114-1116)ctC>ctT	p.L372L	SLC26A8_ENST00000394602.2_Silent_p.L267L|SLC26A8_ENST00000355574.2_Silent_p.L372L	NM_052961.3	NP_443193.1			solute carrier family 26 (anion exchanger), member 8											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(16)|ovary(3)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	46						CCAGAAATATGAGCAGAAAGG	0.418																																																	0								ENSG00000112053						121.0	118.0	119.0					6																	35945038		2203	4300	6503	SLC26A8	SO:0001819	synonymous_variant	0			-	HGNC	AF331522	CCDS4813.1, CCDS4814.1	6p21	2013-07-18	2013-07-18		ENSG00000112053	ENSG00000112053		"""Solute carriers"""	14468	protein-coding gene	gene with protein product		608480	"""solute carrier family 26, member 8"""			11834742, 11829495	Standard	NM_001193476		Approved		uc003olm.3	Q96RN1	OTTHUMG00000014586	ENST00000490799.1:c.1116C>T	6.37:g.35945038G>A		Somatic	0	61	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	37	42.19		Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom	p.L372	ENST00000490799.1	37	c.1116	CCDS4813.1	6																																																																																			-	pfam_Sulph_transpt		0.418	SLC26A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A8	protein_coding	OTTHUMT00000040325.2	G		-		35945038	-1	no_errors	ENST00000355574	ensembl	human	known	74_37	silent	SNP	0.094	A
TP53	7157	genome.wustl.edu	37	17	7578266	7578266	+	Missense_Mutation	SNP	T	T	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr17:7578266T>A	ENST00000269305.4	-	6	772	c.583A>T	c.(583-585)Atc>Ttc	p.I195F	TP53_ENST00000413465.2_Missense_Mutation_p.I195F|TP53_ENST00000359597.4_Missense_Mutation_p.I195F|TP53_ENST00000455263.2_Missense_Mutation_p.I195F|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.I195F|TP53_ENST00000420246.2_Missense_Mutation_p.I195F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195F(20)|p.0?(8)|p.?(6)|p.I195fs*14(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102F(1)|p.I195fs*52(1)|p.L194fs*52(1)|p.I63fs*14(1)|p.I195fs*50(1)|p.I102fs*14(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.I195L(1)|p.P98_E105>Q(1)|p.I63F(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.H193_I195>AP(1)|p.I195fs*12(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCCACTCGGATAAGATGCTGA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	60	Substitution - Missense(23)|Whole gene deletion(8)|Deletion - In frame(6)|Insertion - Frameshift(6)|Complex - deletion inframe(6)|Unknown(6)|Deletion - Frameshift(4)|Complex - frameshift(1)	upper_aerodigestive_tract(8)|breast(8)|large_intestine(6)|biliary_tract(5)|skin(5)|lung(5)|oesophagus(4)|bone(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|urinary_tract(2)|liver(2)|stomach(1)|soft_tissue(1)						ENSG00000141510						99.0	89.0	92.0					17																	7578266		2203	4300	6503	TP53	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	-	HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.583A>T	17.37:g.7578266T>A	ENSP00000269305:p.Ile195Phe	Somatic	0	48	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	32	42.86	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I195F	ENST00000269305.4	37	c.583	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	17.86	3.493726	0.64186	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99824	-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	D	0.000004	D	0.99802	0.9915	M	0.85099	2.735	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.998;0.998;0.997;0.998;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.989;0.955;0.972;0.988;0.99;0.992	D	0.96806	0.9593	10	0.87932	D	0	-18.4587	13.709	0.62656	0.0:0.0:0.0:1.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195F;ENSP00000352610:I195F;ENSP00000269305:I195F;ENSP00000398846:I195F;ENSP00000391127:I195F;ENSP00000391478:I195F;ENSP00000425104:I63F;ENSP00000423862:I102F	ENSP00000269305:I195F	I	-	1	0	TP53	7518991	1.000000	0.71417	0.895000	0.35142	0.030000	0.12068	6.159000	0.71856	2.183000	0.69458	0.533000	0.62120	ATC	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	T	NM_000546	-		7578266	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	SNP	0.999	A
FAM86B1	85002	genome.wustl.edu	37	8	12044046	12044046	+	Missense_Mutation	SNP	A	A	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr8:12044046A>T	ENST00000448228.2	-	5	504	c.455T>A	c.(454-456)tTc>tAc	p.F152Y	FAM86B1_ENST00000321602.8_Intron|FAM86B1_ENST00000534520.1_Intron|FAM86B1_ENST00000533513.1_3'UTR|FAM86B1_ENST00000533852.2_Missense_Mutation_p.F186Y	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1	152										kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		AGGGTCGCTGAAGATGTATGC	0.612																																																	0								ENSG00000186523						29.0	33.0	31.0					8																	12044046		1475	2611	4086	FAM86B1	SO:0001583	missense	0			-	HGNC	BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.455T>A	8.37:g.12044046A>T	ENSP00000407067:p.Phe152Tyr	Somatic	0	393	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	96	433	18.15		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Nicotinamide_N-MeTfrase-like	p.F152Y	ENST00000448228.2	37	c.455	CCDS59512.1	8	.	.	.	.	.	.	.	.	.	.	-	16.70	3.195089	0.58017	.	.	ENSG00000186523	ENST00000431227;ENST00000448228;ENST00000526708	T	0.06528	3.29	1.17	1.17	0.20885	.	.	.	.	.	T	0.18551	0.0445	M	0.74647	2.275	0.80722	D	1	D;D	0.89917	0.977;1.0	D;D	0.97110	0.954;1.0	T	0.01715	-1.1289	9	0.42905	T	0.14	.	6.488	0.22099	1.0:0.0:0.0:0.0	.	152;186	Q8N7N1;E9PN63	F86B1_HUMAN;.	Y	186;152;186	ENSP00000407067:F152Y	ENSP00000444227:F186Y	F	-	2	0	FAM86B1	12081455	1.000000	0.71417	0.689000	0.30133	0.026000	0.11368	7.511000	0.81718	0.788000	0.33755	0.145000	0.16022	TTC	-	pfam_Nicotinamide_N-MeTfrase-like		0.612	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	protein_coding	OTTHUMT00000383317.1	A	NM_032916	-		12044046	-1	no_errors	ENST00000448228	ensembl	human	known	74_37	missense	SNP	1.000	T
FLI1	2313	genome.wustl.edu	37	11	128642855	128642855	+	Missense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr11:128642855G>T	ENST00000527786.2	+	4	1053	c.564G>T	c.(562-564)ttG>ttT	p.L188F	FLI1_ENST00000281428.8_Missense_Mutation_p.L122F|FLI1_ENST00000534087.2_Missense_Mutation_p.L155F|FLI1_ENST00000344954.6_Missense_Mutation_p.L155F|FLI1_ENST00000525560.1_Intron	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	188	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		AAGTGCTGTTGTCACACCTCA	0.537			T	EWSR1	Ewing sarcoma																																			Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	0								ENSG00000151702						151.0	155.0	154.0					11																	128642855		2091	4210	6301	FLI1	SO:0001583	missense	0			-	HGNC	M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.564G>T	11.37:g.128642855G>T	ENSP00000433488:p.Leu188Phe	Somatic	0	29	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	32	11.11	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.L188F	ENST00000527786.2	37	c.564	CCDS44768.1	11	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192195	0.38707	.	.	ENSG00000151702	ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.13	3.21	0.36854	Sterile alpha motif/pointed domain (2);Pointed domain (3);	0.074103	0.42821	D	0.000643	T	0.26702	0.0653	M	0.65975	2.015	0.52501	D	0.999953	B;B	0.14805	0.003;0.011	B;B	0.24541	0.046;0.054	T	0.11941	-1.0567	9	.	.	.	.	2.997	0.06001	0.1369:0.2753:0.4464:0.1414	.	188;122	Q01543;Q01543-2	FLI1_HUMAN;.	F	155;188;155;122	ENSP00000339627:L155F;ENSP00000399985:L188F;ENSP00000432950:L155F;ENSP00000281428:L122F	.	L	+	3	2	FLI1	128148065	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.807000	0.27140	1.115000	0.41800	0.655000	0.94253	TTG	-	pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom		0.537	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLI1	protein_coding	OTTHUMT00000386226.2	G	NM_002017	-		128642855	+1	no_errors	ENST00000527786	ensembl	human	known	74_37	missense	SNP	0.997	T
FRMD1	79981	genome.wustl.edu	37	6	168463585	168463585	+	Missense_Mutation	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr6:168463585G>A	ENST00000283309.6	-	7	923	c.859C>T	c.(859-861)Cac>Tac	p.H287Y	FRMD1_ENST00000440994.2_Missense_Mutation_p.H219Y|FRMD1_ENST00000432403.1_5'UTR|FRMD1_ENST00000537786.1_Missense_Mutation_p.H58Y	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	287	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		TGGTAGATGTGCACTCCCCTG	0.627																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												0								ENSG00000153303						117.0	102.0	107.0					6																	168463585		2203	4300	6503	FRMD1	SO:0001583	missense	0			-	HGNC		CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.859C>T	6.37:g.168463585G>A	ENSP00000283309:p.His287Tyr	Somatic	0	45	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	46	8.00	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.H287Y	ENST00000283309.6	37	c.859	CCDS5306.1	6	.	.	.	.	.	.	.	.	.	.	G	15.92	2.973943	0.53720	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000537786	D;D;D	0.81821	-1.54;-1.54;-1.54	2.89	1.93	0.25924	FERM domain (1);	0.275088	0.30028	U	0.010590	T	0.77698	0.4169	L	0.56769	1.78	0.27941	N	0.937519	D;D;D;D	0.64830	0.971;0.994;0.993;0.971	P;P;P;P	0.62649	0.788;0.885;0.905;0.893	T	0.71066	-0.4700	10	0.51188	T	0.08	.	10.2824	0.43548	0.0:0.0:0.7927:0.2072	.	199;287;219;159	B7Z8G9;Q8N878;Q8N878-2;Q5SZU5	.;FRMD1_HUMAN;.;.	Y	287;219;58	ENSP00000283309:H287Y;ENSP00000414115:H219Y;ENSP00000440078:H58Y	ENSP00000283309:H287Y	H	-	1	0	FRMD1	168206434	1.000000	0.71417	0.004000	0.12327	0.729000	0.41735	4.683000	0.61679	0.343000	0.23821	0.313000	0.20887	CAC	-	pfscan_FERM_domain		0.627	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	protein_coding	OTTHUMT00000362513.2	G	NM_024919	-		168463585	-1	no_errors	ENST00000283309	ensembl	human	known	74_37	missense	SNP	1.000	A
SMPD1	6609	genome.wustl.edu	37	11	6411691	6411691	+	5'UTR	SNP	C	C	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr11:6411691C>A	ENST00000342245.4	+	0	31				SMPD1_ENST00000299397.3_5'UTR|SMPD1_ENST00000356761.2_5'UTR|SMPD1_ENST00000533196.1_3'UTR|SMPD1_ENST00000527275.1_5'Flank	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal						cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	TGCTTTGCGGCCGGCCGCGGA	0.721																																																	0								ENSG00000166311																																			SMPD1	SO:0001623	5_prime_UTR_variant	0			-	HGNC	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.-138C>A	11.37:g.6411691C>A		Somatic	0	14	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	8	38.46	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000342245.4	37	NULL	CCDS44531.1	11																																																																																			-	-		0.721	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMPD1	protein_coding	OTTHUMT00000384205.1	C	NM_000543	-		6411691	+1	no_errors	ENST00000533196	ensembl	human	known	74_37	rna	SNP	0.002	A
RIN2	54453	genome.wustl.edu	37	20	19981949	19981950	+	3'UTR	INS	-	-	AGG			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr20:19981949_19981950insAGG	ENST00000255006.6	+	0	3353_3354				RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_3'UTR	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2						endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						TGCAGTGCGTCAGGTGATTCTC	0.381																																																	0								ENSG00000132669																																			RIN2	SO:0001624	3_prime_UTR_variant	0				HGNC	AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.*370->AGG	20.37:g.19981950_19981952dupAGG		Somatic	0	39	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	49	33.78	Q00425|Q5TFT8|Q9BQL3|Q9H071	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000255006.6	37	NULL	CCDS56182.1	20																																																																																			-	-		0.381	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	protein_coding	OTTHUMT00000078212.1	-				19981950	+1	no_errors	ENST00000484638	ensembl	human	known	74_37	rna	INS	0.983:0.793	AGG
GRM1	2911	genome.wustl.edu	37	6	146625761	146625761	+	Missense_Mutation	SNP	A	A	G			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr6:146625761A>G	ENST00000282753.1	+	3	1200	c.965A>G	c.(964-966)gAc>gGc	p.D322G	GRM1_ENST00000392299.2_Missense_Mutation_p.D322G|GRM1_ENST00000507907.1_Missense_Mutation_p.D322G|GRM1_ENST00000361719.2_Missense_Mutation_p.D322G|GRM1_ENST00000355289.4_Missense_Mutation_p.D322G|GRM1_ENST00000492807.2_Missense_Mutation_p.D322G			Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1	322					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|cell death (GO:0008219)|cellular response to electrical stimulus (GO:0071257)|dimeric G-protein coupled receptor signaling pathway (GO:0038042)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|G-protein coupled receptor dimeric complex (GO:0038037)|G-protein coupled receptor homodimeric complex (GO:0038038)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)			NS(2)|breast(5)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(54)|ovary(7)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	126		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)		GGATGGGCAGACAGAGATGAA	0.433																																																	0								ENSG00000152822						61.0	52.0	56.0					6																	146625761		2203	4300	6503	GRM1	SO:0001583	missense	0			-	HGNC	U31215	CCDS5209.1, CCDS47497.1, CCDS64548.1	6q24	2014-06-12			ENSG00000152822	ENSG00000152822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4593	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 85"""	604473				9076744, 9376535	Standard	NM_001278064		Approved	GPRC1A, mGlu1, MGLUR1, PPP1R85	uc010khw.2	Q13255	OTTHUMG00000015752	ENST00000282753.1:c.965A>G	6.37:g.146625761A>G	ENSP00000282753:p.Asp322Gly	Somatic	0	67	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	69	13.58	B9EG79|F8W805|Q13256|Q14757|Q14758|Q5VTF7|Q5VTF8|Q9NU10|Q9UGS9|Q9UGT0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Metabotropic_Glu_rcpt_Homer-bd,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3_mtglu_rcpt_1,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_5	p.D322G	ENST00000282753.1	37	c.965	CCDS5209.1	6	.	.	.	.	.	.	.	.	.	.	A	22.9	4.350479	0.82132	.	.	ENSG00000152822	ENST00000361719;ENST00000392299;ENST00000492807;ENST00000282753;ENST00000355289;ENST00000507907	D;D;D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77;-1.77;-1.77	6.06	6.06	0.98353	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.85314	0.5668	L	0.51422	1.61	0.80722	D	1	P;D;D	0.59767	0.917;0.979;0.986	P;P;D	0.63283	0.709;0.828;0.913	D	0.85863	0.1411	10	0.49607	T	0.09	.	16.6245	0.84952	1.0:0.0:0.0:0.0	.	322;322;322	F8W805;Q13255;Q13255-2	.;GRM1_HUMAN;.	G	322	ENSP00000354896:D322G;ENSP00000376119:D322G;ENSP00000424095:D322G;ENSP00000282753:D322G;ENSP00000347437:D322G;ENSP00000425599:D322G	ENSP00000282753:D322G	D	+	2	0	GRM1	146667454	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.306000	0.78905	2.323000	0.78572	0.528000	0.53228	GAC	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I		0.433	GRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM1	protein_coding	OTTHUMT00000042574.1	A	NM_000838	-		146625761	+1	no_errors	ENST00000282753	ensembl	human	known	74_37	missense	SNP	1.000	G
DCC	1630	genome.wustl.edu	37	18	50451640	50451640	+	Missense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr18:50451640G>T	ENST00000442544.2	+	5	1501	c.885G>T	c.(883-885)ttG>ttT	p.L295F	DCC_ENST00000412726.1_Missense_Mutation_p.L143F	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	295	Ig-like C2-type 3.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GAAGCAACTTGCTTATCTCCA	0.373																																																	0								ENSG00000187323						130.0	129.0	130.0					18																	50451640		2203	4300	6503	DCC	SO:0001583	missense	0			-	HGNC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.885G>T	18.37:g.50451640G>T	ENSP00000389140:p.Leu295Phe	Somatic	0	41	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	3	27	10.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L295F	ENST00000442544.2	37	c.885	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	G	11.16	1.558247	0.27827	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	D;D	0.92048	-2.96;-2.96	5.76	3.66	0.41972	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000023	D	0.96349	0.8809	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.969;1.0	D	0.96268	0.9196	10	0.87932	D	0	.	9.812	0.40828	0.2455:0.0:0.7545:0.0	.	143;295	E7EQM8;P43146	.;DCC_HUMAN	F	295;228;143	ENSP00000389140:L295F;ENSP00000397322:L143F	ENSP00000304146:L228F	L	+	3	2	DCC	48705638	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	0.900000	0.28431	1.441000	0.47550	0.460000	0.39030	TTG	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom		0.373	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	protein_coding	OTTHUMT00000255996.3	G	NM_005215	-		50451640	+1	no_errors	ENST00000442544	ensembl	human	known	74_37	missense	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158585053	158585053	+	Silent	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr1:158585053C>T	ENST00000368147.4	-	48	6921	c.6741G>A	c.(6739-6741)caG>caA	p.Q2247Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2247					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCAACCCAAGCTGGTAGAGCT	0.542																																																	0								ENSG00000163554						153.0	161.0	158.0					1																	158585053		2119	4244	6363	SPTA1	SO:0001819	synonymous_variant	0			-	HGNC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6741G>A	1.37:g.158585053C>T		Somatic	0	111	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	29	76	27.62	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.Q2247	ENST00000368147.4	37	c.6741	CCDS41423.1	1																																																																																			-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.542	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	protein_coding	OTTHUMT00000051851.3	C	NM_003126	-		158585053	-1	no_errors	ENST00000368147	ensembl	human	known	74_37	silent	SNP	1.000	T
ALOX12	239	genome.wustl.edu	37	17	6905883	6905883	+	Intron	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr17:6905883G>A	ENST00000251535.6	+	8	1214				AC027763.2_ENST00000573939.1_3'UTR|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000575727.1_Missense_Mutation_p.H52Y|RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000399540.2_Missense_Mutation_p.H52Y|AC027763.2_ENST00000574377.1_Missense_Mutation_p.H64Y	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase						aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						aaagcagtatgattgcttaag	0.433																																																	0								ENSG00000215067																																			AC027763.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1161+753G>A	17.37:g.6905883G>A		Somatic	0	41	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	15	68.09	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.H64Y	ENST00000251535.6	37	c.190	CCDS11084.1	17	.	.	.	.	.	.	.	.	.	.	G	0.330	-0.956584	0.02267	.	.	ENSG00000215067	ENST00000399540	T	0.01335	5.0	0.545	-0.805	0.10879	.	.	.	.	.	T	0.01523	0.0049	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.47368	-0.9123	5	0.41790	T	0.15	.	.	.	.	.	.	.	.	Y	52	ENSP00000382455:H52Y	ENSP00000382455:H52Y	H	-	1	0	AC027763.2	6846607	.	.	0.046000	0.18839	0.102000	0.19082	.	.	-0.398000	0.07679	-0.680000	0.03767	CAT	-	NULL		0.433	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215067	protein_coding	OTTHUMT00000219922.2	G		-		6905883	-1	no_errors	ENST00000574377	ensembl	human	putative	74_37	missense	SNP	0.066	A
LOC285556	285556	genome.wustl.edu	37	4	100570993	100570993	+	Missense_Mutation	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr4:100570993G>A	ENST00000511828.1	-	1	4812	c.4813C>T	c.(4813-4815)Cct>Tct	p.P1605S																								GTCTGTTGAGGCTGTGCCTGC	0.622																																																	0								ENSG00000248713																																			RP11-766F14.2	SO:0001583	missense	0			-	Clone_based_vega_gene																												ENST00000511828.1:c.4813C>T	4.37:g.100570993G>A	ENSP00000427555:p.Pro1605Ser	Somatic	0	59	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	35	33.96		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.P1605S	ENST00000511828.1	37	c.4813		4	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215939	0.39201	.	.	ENSG00000248713	ENST00000511828	T	0.40756	1.02	4.15	3.28	0.37604	.	.	.	.	.	T	0.36386	0.0965	L	0.27053	0.805	.	.	.	.	.	.	.	.	.	T	0.49762	-0.8905	6	0.34782	T	0.22	.	11.6995	0.51562	0.0:0.1805:0.8194:0.0	.	.	.	.	S	1605	ENSP00000427555:P1605S	ENSP00000427555:P1605S	P	-	1	0	RP11-766F14.2	100790016	0.854000	0.29725	0.615000	0.29064	0.735000	0.41995	1.821000	0.39041	1.062000	0.40625	0.563000	0.77884	CCT	-	NULL		0.622	RP11-766F14.2-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC285556	protein_coding	OTTHUMT00000365456.1	G		-		100570993	-1	no_errors	ENST00000511828	ensembl	human	putative	74_37	missense	SNP	0.924	A
BPIFB3	359710	genome.wustl.edu	37	20	31647706	31647706	+	Silent	SNP	T	T	G			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr20:31647706T>G	ENST00000375494.3	+	4	396	c.396T>G	c.(394-396)ggT>ggG	p.G132G	AL121756.1_ENST00000579962.1_RNA	NM_182658.1	NP_872599.1	P59826	BPIB3_HUMAN	BPI fold containing family B, member 3	132	Leu-rich.				innate immune response (GO:0045087)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										GCCCCCTTGGTGGCCTTCTGC	0.677																																																	0								ENSG00000186190						50.0	38.0	42.0					20																	31647706		2203	4300	6503	BPIFB3	SO:0001819	synonymous_variant	0			-	HGNC	AF549189	CCDS13212.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186190	ENSG00000186190		"""BPI fold containing"""	16178	protein-coding gene	gene with protein product		615717	"""chromosome 20 open reading frame 185"""	C20orf185		11971875, 21787333	Standard	NM_182658		Approved	dJ726C3.4, LPLUNC3, RYA3	uc002wym.1	P59826	OTTHUMG00000032234	ENST00000375494.3:c.396T>G	20.37:g.31647706T>G		Somatic	0	46	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	46	28.12	Q5TDX7	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.G132	ENST00000375494.3	37	c.396	CCDS13212.1	20																																																																																			-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N		0.677	BPIFB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB3	protein_coding	OTTHUMT00000078654.2	T	NM_182658	-		31647706	+1	no_errors	ENST00000375494	ensembl	human	known	74_37	silent	SNP	0.997	G
PI4KA	5297	genome.wustl.edu	37	22	21065645	21065645	+	Silent	SNP	A	A	G	rs444310		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr22:21065645A>G	ENST00000572273.1	-	51	5963	c.5733T>C	c.(5731-5733)ggT>ggC	p.G1911G	PI4KA_ENST00000414196.3_Silent_p.G721G|PI4KA_ENST00000255882.6_Silent_p.G1969G			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1911	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.G1911G(1)		breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GGATGATATGACCCTTCTTGT	0.587																																					GBM(136;1332 1831 3115 23601 50806)												1	Substitution - coding silent(1)	stomach(1)						ENSG00000241973	G	,	1543,2565		564,415,1075	105.0	128.0	120.0		2163,5733	1.5	1.0	22	dbSNP_80	120	936,7236		280,376,3430	no	coding-synonymous,coding-synonymous	PI4KA	NM_002650.2,NM_058004.3	,	844,791,4505	GG,GA,AA		11.4537,37.5609,20.1873	,	721/855,1911/2045	21065645	2479,9801	2054	4086	6140	PI4KA	SO:0001819	synonymous_variant	0			-	HGNC	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.5733T>C	22.37:g.21065645A>G		Somatic	0	118	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	9	68	11.69	Q7Z625|Q9UPG2	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.G1969	ENST00000572273.1	37	c.5907		22																																																																																			-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.587	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	protein_coding		A	NM_058004	rs444310		21065645	-1	no_errors	ENST00000255882	ensembl	human	known	74_37	silent	SNP	0.992	G
MIS18BP1	55320	genome.wustl.edu	37	14	45673327	45673327	+	Missense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr14:45673327G>T	ENST00000310806.4	-	17	3842	c.3384C>A	c.(3382-3384)aaC>aaA	p.N1128K		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	1128					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						CAGAATCAGAGTTCGAAAAAT	0.313																																																	0								ENSG00000129534						29.0	31.0	30.0					14																	45673327		2199	4276	6475	MIS18BP1	SO:0001583	missense	0			-	HGNC	AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.3384C>A	14.37:g.45673327G>T	ENSP00000309790:p.Asn1128Lys	Somatic	0	41	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.N1128K	ENST00000310806.4	37	c.3384	CCDS9684.1	14	.	.	.	.	.	.	.	.	.	.	G	17.31	3.356523	0.61293	.	.	ENSG00000129534	ENST00000310806	T	0.23348	1.91	5.66	1.75	0.24633	.	0.353750	0.35040	N	0.003492	T	0.27313	0.0670	M	0.62723	1.935	0.39402	D	0.966608	P	0.46395	0.877	B	0.43360	0.417	T	0.10109	-1.0644	10	0.72032	D	0.01	-6.1164	9.3895	0.38363	0.3785:0.0:0.6215:0.0	.	1128	Q6P0N0	M18BP_HUMAN	K	1128	ENSP00000309790:N1128K	ENSP00000309790:N1128K	N	-	3	2	MIS18BP1	44743077	0.999000	0.42202	0.995000	0.50966	0.993000	0.82548	0.738000	0.26158	0.327000	0.23409	0.555000	0.69702	AAC	-	NULL		0.313	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	protein_coding	OTTHUMT00000276795.2	G		-		45673327	-1	no_errors	ENST00000310806	ensembl	human	known	74_37	missense	SNP	0.935	T
MTUS1	57509	genome.wustl.edu	37	8	17612997	17612997	+	Missense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr8:17612997G>T	ENST00000262102.6	-	2	544	c.320C>A	c.(319-321)gCa>gAa	p.A107E	MTUS1_ENST00000381862.3_Missense_Mutation_p.A107E|MTUS1_ENST00000381869.3_Missense_Mutation_p.A107E|MTUS1_ENST00000519263.1_Missense_Mutation_p.A107E	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1	107					cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		ACCTACAAGTGCAGGACACTG	0.418																																																	0								ENSG00000129422						122.0	111.0	115.0					8																	17612997		1918	4125	6043	MTUS1	SO:0001583	missense	0			-	HGNC	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.320C>A	8.37:g.17612997G>T	ENSP00000262102:p.Ala107Glu	Somatic	0	58	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	59	21.33	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_Ferritin-like_SF	p.A107E	ENST00000262102.6	37	c.320	CCDS43717.1	8	.	.	.	.	.	.	.	.	.	.	g	14.79	2.640302	0.47153	.	.	ENSG00000129422	ENST00000381869;ENST00000262102;ENST00000519263;ENST00000381862	T;T;T;T	0.32023	2.38;2.43;2.38;1.47	3.98	0.911	0.19343	.	0.408875	0.19863	N	0.104400	T	0.19927	0.0479	N	0.19112	0.55	0.09310	N	1	B;P;P	0.51351	0.16;0.944;0.944	B;P;P	0.47981	0.104;0.563;0.563	T	0.09729	-1.0661	10	0.66056	D	0.02	-6.0596	2.7822	0.05364	0.4086:0.0:0.3884:0.203	.	107;107;107	Q9ULD2-5;Q9ULD2-2;Q9ULD2	.;.;MTUS1_HUMAN	E	107	ENSP00000371293:A107E;ENSP00000262102:A107E;ENSP00000430167:A107E;ENSP00000371286:A107E	ENSP00000262102:A107E	A	-	2	0	MTUS1	17657277	0.000000	0.05858	0.000000	0.03702	0.127000	0.20565	0.233000	0.17911	0.161000	0.19458	0.558000	0.71614	GCA	-	NULL		0.418	MTUS1-001	KNOWN	basic|CCDS	protein_coding	MTUS1	protein_coding	OTTHUMT00000375247.1	G	XM_372031	-		17612997	-1	no_errors	ENST00000262102	ensembl	human	known	74_37	missense	SNP	0.000	T
EYS	346007	genome.wustl.edu	37	6	65098712	65098712	+	Silent	SNP	G	G	A	rs541973291		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr6:65098712G>A	ENST00000370621.3	-	29	6475	c.5949C>T	c.(5947-5949)aaC>aaT	p.N1983N	EYS_ENST00000370616.2_Silent_p.N1983N|RP11-349P19.1_ENST00000424274.1_RNA|EYS_ENST00000503581.1_Silent_p.N1983N			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1983	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TCAGCTCAGCGTTACATGGAT	0.338													T|||	1	0.000199681	0.0	0.0	5008	,	,		12901	0.0		0.0	False		,,,				2504	0.001																0								ENSG00000188107						177.0	142.0	153.0					6																	65098712		692	1591	2283	EYS	SO:0001819	synonymous_variant	0			-	HGNC		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5949C>T	6.37:g.65098712G>A		Somatic	0	27	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	20	27.59	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.N1983	ENST00000370621.3	37	c.5949		6																																																																																			-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.338	EYS-001	KNOWN	basic	protein_coding	EYS	protein_coding	OTTHUMT00000351351.3	G	XM_294050	-		65098712	-1	no_errors	ENST00000370616	ensembl	human	known	74_37	silent	SNP	0.264	A
BX119917.1	0	genome.wustl.edu	37	X	71372202	71372209	+	RNA	DEL	CGCGCGCA	CGCGCGCA	-	rs6625958|rs72357649|rs72197346|rs59980083|rs6625957|rs200056633|rs10856127		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	CGCGCGCA	CGCGCGCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chrX:71372202_71372209delCGCGCGCA	ENST00000401114.1	-	0	55_62																											TGTGCATGCGCGCGCGcacacacacaca	0.495																																																	0								ENSG00000215933																																			BX119917.1			0				Clone_based_ensembl_gene																													X.37:g.71372202_71372209delCGCGCGCA		Somatic	NA	NA	NA		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000401114.1	37	NULL		X																																																																																			-	-		0.495	BX119917.1-201	NOVEL	basic	miRNA	ENSG00000215933	miRNA		CGCGCGCA				71372209	-1	no_errors	ENST00000401114	ensembl	human	novel	74_37	rna	DEL	0.000:0.000:0.000:0.000:0.000:0.001:0.015:0.009	-
LRTM1	57408	genome.wustl.edu	37	3	54952665	54952665	+	Missense_Mutation	SNP	C	C	A	rs200994023		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr3:54952665C>A	ENST00000273286.5	-	3	1021	c.859G>T	c.(859-861)Gcc>Tcc	p.A287S	CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000474759.1_Intron|LRTM1_ENST00000493075.1_Missense_Mutation_p.A211S|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000490478.1_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	287						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		ATGACAGTGGCAATGGCATGA	0.577																																																	0								ENSG00000144771	C	SER/ALA,	0,4406		0,0,2203	170.0	123.0	139.0		859,	5.6	0.3	3		139	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	CACNA2D3,LRTM1	NM_020678.2,NM_018398.2	99,	0,1,6502	AA,AC,CC		0.0116,0.0,0.0077	probably-damaging,	287/346,	54952665	1,13005	2203	4300	6503	LRTM1	SO:0001583	missense	0			-	HGNC	AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.859G>T	3.37:g.54952665C>A	ENSP00000273286:p.Ala287Ser	Somatic	0	48	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	43	25.86	Q8IUU2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.A287S	ENST00000273286.5	37	c.859	CCDS2876.1	3	.	.	.	.	.	.	.	.	.	.	C	19.55	3.848636	0.71603	0.0	1.16E-4	ENSG00000144771	ENST00000273286;ENST00000493075	T;T	0.54279	0.58;0.95	5.64	5.64	0.86602	.	0.051485	0.85682	D	0.000000	T	0.64046	0.2563	M	0.78049	2.395	0.58432	D	0.999999	D	0.56035	0.974	P	0.47673	0.554	T	0.67530	-0.5647	10	0.48119	T	0.1	.	19.6909	0.96000	0.0:1.0:0.0:0.0	.	287	Q9HBL6	LRTM1_HUMAN	S	287;211	ENSP00000273286:A287S;ENSP00000419772:A211S	ENSP00000273286:A287S	A	-	1	0	LRTM1	54927705	1.000000	0.71417	0.291000	0.24904	0.082000	0.17680	7.472000	0.80996	2.643000	0.89663	0.561000	0.74099	GCC	-	NULL		0.577	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM1	protein_coding	OTTHUMT00000351399.1	C	NM_020678	rs200994023		54952665	-1	no_errors	ENST00000273286	ensembl	human	known	74_37	missense	SNP	1.000	A
NUMBL	9253	genome.wustl.edu	37	19	41173893	41173898	+	In_Frame_Del	DEL	TGCTGT	TGCTGT	-	rs59088184|rs79747129|rs71173669|rs141662737	byFrequency	TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	TGCTGT	TGCTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr19:41173893_41173898delTGCTGT	ENST00000252891.4	-	10	1472_1477	c.1305_1310delACAGCA	c.(1303-1311)caacagcag>cag	p.435_437QQQ>Q	NUMBL_ENST00000598779.1_In_Frame_Del_p.394_396QQQ>Q|NUMBL_ENST00000540131.1_In_Frame_Del_p.394_396QQQ>Q	NM_004756.3	NP_004747.1	Q9Y6R0	NUMBL_HUMAN	numb homolog (Drosophila)-like	435	Poly-Gln.				adherens junction organization (GO:0034332)|axonogenesis (GO:0007409)|cytokine-mediated signaling pathway (GO:0019221)|lateral ventricle development (GO:0021670)|nervous system development (GO:0007399)|neuroblast division in subventricular zone (GO:0021849)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of neurogenesis (GO:0050769)|protein metabolic process (GO:0019538)	cytoplasm (GO:0005737)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)	16			Lung(22;0.000393)|LUSC - Lung squamous cell carcinoma(20;0.00105)			ctgctgctgctgctgttgctgttgct	0.66														2856	0.570288	0.7821	0.428	5008	,	,		15157	0.4653		0.5149	False		,,,				2504	0.5501																0								ENSG00000105245																																			NUMBL	SO:0001651	inframe_deletion	0				HGNC	AF015401	CCDS12561.1	19q13.13-q13.2	2008-07-17	2001-11-28			ENSG00000105245			8061	protein-coding gene	gene with protein product		604018	"""numb (Drosophila) homolog-like"""			9225980, 9303539	Standard	XM_006723471		Approved	NUMB-R, CTG3a, CAG3A, TNRC23, NUMBR, NUMBLIKE	uc002oon.3	Q9Y6R0		ENST00000252891.4:c.1305_1310delACAGCA	19.37:g.41173899_41173904delTGCTGT	ENSP00000252891:p.Gln445_Gln446del	Somatic	NA	NA	NA		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q7Z4J9	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.QQ439in_frame_del	ENST00000252891.4	37	c.1310_1305	CCDS12561.1	19																																																																																			-	pirsf_Numb/numb-like		0.660	NUMBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMBL	protein_coding	OTTHUMT00000462749.2	TGCTGT	NM_004756			41173898	-1	no_errors	ENST00000252891	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000:1.000:1.000:0.998	-
LOC150776	150776	genome.wustl.edu	37	2	132277977	132277977	+	RNA	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr2:132277977G>A	ENST00000438378.2	+	0	2616					NR_026922.1																						CTGACCGAGCGGGGGAAGCTG	0.642																																																	0								ENSG00000152117																																			AC093838.4			0			-	Clone_based_vega_gene																													2.37:g.132277977G>A		Somatic	1	130	0.76		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	30	119	20.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000438378.2	37	NULL		2																																																																																			-	-		0.642	AC093838.4-001	KNOWN	basic	processed_transcript	LOC150776	pseudogene	OTTHUMT00000331819.7	G		-		132277977	+1	no_errors	ENST00000438378	ensembl	human	known	74_37	rna	SNP	0.760	A
ZNF584	201514	genome.wustl.edu	37	19	58928651	58928651	+	Missense_Mutation	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr19:58928651G>A	ENST00000306910.4	+	4	1289	c.766G>A	c.(766-768)Gca>Aca	p.A256T	CTD-2619J13.16_ENST00000596296.1_lincRNA|ZNF584_ENST00000593920.1_Missense_Mutation_p.A211T|ZNF584_ENST00000599238.1_3'UTR	NM_173548.1	NP_775819.1	Q8IVC4	ZN584_HUMAN	zinc finger protein 584	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(3)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		all_cancers(17;5.3e-17)|all_epithelial(17;3.71e-12)|Lung NSC(17;8.3e-05)|Colorectal(82;0.000147)|all_lung(17;0.000386)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0271)		CCGCAAAGACGCACTTGTTCT	0.468																																																	0								ENSG00000171574						94.0	81.0	85.0					19																	58928651		2203	4300	6503	ZNF584	SO:0001583	missense	0			-	HGNC	AK097218	CCDS12979.1	19q13.43	2013-01-08			ENSG00000171574	ENSG00000171574		"""Zinc fingers, C2H2-type"", ""-"""	27318	protein-coding gene	gene with protein product							Standard	NM_173548		Approved	FLJ39899	uc002qsp.3	Q8IVC4		ENST00000306910.4:c.766G>A	19.37:g.58928651G>A	ENSP00000306756:p.Ala256Thr	Somatic	0	45	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	15	55.88	A8K203	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A256T	ENST00000306910.4	37	c.766	CCDS12979.1	19	.	.	.	.	.	.	.	.	.	.	G	0.567	-0.842919	0.02671	.	.	ENSG00000171574	ENST00000306910;ENST00000354635	T	0.36157	1.27	3.78	1.33	0.21861	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19685	0.0473	L	0.27944	0.81	0.09310	N	1	P	0.43750	0.816	B	0.38880	0.284	T	0.08493	-1.0719	9	0.14656	T	0.56	.	5.8921	0.18919	0.0:0.1864:0.4315:0.3821	.	256	Q8IVC4	ZN584_HUMAN	T	256;115	ENSP00000306756:A256T	ENSP00000306756:A256T	A	+	1	0	ZNF584	63620463	0.000000	0.05858	0.015000	0.15790	0.289000	0.27227	-0.567000	0.05916	0.899000	0.36444	0.555000	0.69702	GCA	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.468	ZNF584-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF584	protein_coding	OTTHUMT00000467022.1	G	NM_173548	-		58928651	+1	no_errors	ENST00000306910	ensembl	human	known	74_37	missense	SNP	0.000	A
KRT86	3892	genome.wustl.edu	37	12	52651996	52651996	+	Intron	SNP	C	C	T	rs150823320	byFrequency	TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr12:52651996C>T	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGGACTTGATCTGCTCCTTCT	0.577																																																	0								ENSG00000135477																																			KRT121P	SO:0001627	intron_variant	0			-	HGNC	X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+8784C>T	12.37:g.52651996C>T		Somatic	0	179	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	127	30.22	P78387	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			-	-		0.577	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	protein_coding		C	NM_002284	-		52651996	-1	no_errors	ENST00000529785	ensembl	human	known	74_37	rna	SNP	1.000	T
CDK9	1025	genome.wustl.edu	37	9	130549788	130549788	+	Intron	SNP	C	C	G			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr9:130549788C>G	ENST00000373264.4	+	3	274				MIR3960_ENST00000583311.1_RNA|CDK9_ENST00000480353.1_Intron|CDK9_ENST00000373265.2_Intron	NM_001261.3	NP_001252.1	P50750	CDK9_HUMAN	cyclin-dependent kinase 9						cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|DNA repair (GO:0006281)|gene expression (GO:0010467)|negative regulation of cell cycle arrest (GO:0071157)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of DNA repair (GO:0006282)|regulation of histone modification (GO:0031056)|replication fork arrest (GO:0043111)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|positive transcription elongation factor complex b (GO:0008024)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA binding (GO:0003677)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			lung(1)	1						TCCCCTCTTTCTCACCCAGTT	0.512																																																	0								ENSG00000136807						156.0	139.0	144.0					9																	130549788		2203	4300	6503	CDK9	SO:0001627	intron_variant	0			-	HGNC	L25676	CCDS6879.1	9q34.1	2011-11-08	2007-11-21		ENSG00000136807	ENSG00000136807		"""Cyclin-dependent kinases"""	1780	protein-coding gene	gene with protein product		603251	"""cyclin-dependent kinase 9 (CDC2-related kinase)"""	CDC2L4		8170997, 9356449	Standard	NM_001261		Approved	PITALRE, C-2k, TAK	uc004bse.2	P50750	OTTHUMG00000020715	ENST00000373264.4:c.175-9C>G	9.37:g.130549788C>G		Somatic	0	44	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	35	16.67	Q5JU24|Q5JU25|Q5U006|Q96TF1	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000373264.4	37	NULL	CCDS6879.1	9																																																																																			-	-		0.512	CDK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK9	protein_coding	OTTHUMT00000054235.1	C		-		130549788	+1	no_errors	ENST00000491521	ensembl	human	known	74_37	rna	SNP	0.001	G
OR51G1	79324	genome.wustl.edu	37	11	4945070	4945070	+	Missense_Mutation	SNP	C	C	T	rs568109165		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr11:4945070C>T	ENST00000321961.2	-	1	567	c.500G>A	c.(499-501)cGc>cAc	p.R167H	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005237.1	NP_001005237.1	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G, member 1	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(3)|skin(4)|soft_tissue(1)	25		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTATTGGAAGCGCTTCAGGAG	0.507													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22545	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000176879						74.0	63.0	67.0					11																	4945070		2201	4298	6499	OR51G1	SO:0001583	missense	0			-	HGNC	AB065793	CCDS31366.1	11p15.4	2012-08-09			ENSG00000176879	ENSG00000176879		"""GPCR / Class A : Olfactory receptors"""	14738	protein-coding gene	gene with protein product				OR51G3P			Standard	NM_001005237		Approved		uc010qyr.2	Q8NGK1	OTTHUMG00000066532	ENST00000321961.2:c.500G>A	11.37:g.4945070C>T	ENSP00000322546:p.Arg167His	Somatic	0	48	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	38	26.42	B9EGW8|Q6IFH6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R167H	ENST00000321961.2	37	c.500	CCDS31366.1	11	.	.	.	.	.	.	.	.	.	.	C	13.40	2.225213	0.39300	.	.	ENSG00000176879	ENST00000321961	T	0.00137	8.68	4.3	4.3	0.51218	GPCR, rhodopsin-like superfamily (1);	0.339670	0.17791	U	0.161894	T	0.00412	0.0013	M	0.66560	2.04	0.09310	N	0.999999	D	0.89917	1.0	D	0.75484	0.986	T	0.59161	-0.7506	10	0.48119	T	0.1	.	13.6022	0.62026	0.0:1.0:0.0:0.0	.	167	Q8NGK1	O51G1_HUMAN	H	167	ENSP00000322546:R167H	ENSP00000322546:R167H	R	-	2	0	OR51G1	4901646	0.000000	0.05858	0.988000	0.46212	0.100000	0.18952	-0.157000	0.10085	2.226000	0.72624	0.557000	0.71058	CGC	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.507	OR51G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51G1	protein_coding	OTTHUMT00000142345.1	C	NM_001005237	-		4945070	-1	no_errors	ENST00000321961	ensembl	human	known	74_37	missense	SNP	0.181	T
IMPACT	55364	genome.wustl.edu	37	18	22029853	22029853	+	Missense_Mutation	SNP	G	G	T	rs542157006		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr18:22029853G>T	ENST00000284202.4	+	10	971	c.830G>T	c.(829-831)cGc>cTc	p.R277L		NM_018439.3	NP_060909	Q9P2X3	IMPCT_HUMAN	impact RWD domain protein	277					negative regulation of protein phosphorylation (GO:0001933)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00018)|all_epithelial(16;1.5e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)					GGACCAGATCGCTTTAAACAT	0.378																																																	0								ENSG00000154059						133.0	117.0	122.0					18																	22029853		2203	4300	6503	IMPACT	SO:0001583	missense	0			-	HGNC	AB026264	CCDS11886.1	18q11.2-q12.1	2012-12-07	2012-12-07		ENSG00000154059	ENSG00000154059			20387	protein-coding gene	gene with protein product	"""RWD domain containing 5"""	615319	"""Impact homolog (mouse)"""			11116084	Standard	NM_018439		Approved	RWDD5	uc002kvh.4	Q9P2X3	OTTHUMG00000131943	ENST00000284202.4:c.830G>T	18.37:g.22029853G>T	ENSP00000284202:p.Arg277Leu	Somatic	0	50	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	31	11.43	A8MXG0|Q49AM0|Q9H2X4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Impact_N,pfam_RWD-domain,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pfscan_RWD-domain	p.R277L	ENST00000284202.4	37	c.830	CCDS11886.1	18	.	.	.	.	.	.	.	.	.	.	G	18.05	3.535957	0.64972	.	.	ENSG00000154059	ENST00000284202	T	0.64260	-0.09	5.93	5.93	0.95920	Ribosomal protein S5 domain 2-type fold (1);Impact, N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.87309	0.6145	H	0.97440	4.005	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.91058	0.4883	10	0.87932	D	0	.	19.1136	0.93328	0.0:0.0:1.0:0.0	.	277	Q9P2X3	IMPCT_HUMAN	L	277	ENSP00000284202:R277L	ENSP00000284202:R277L	R	+	2	0	IMPACT	20283851	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.250000	0.95477	2.810000	0.96702	0.655000	0.94253	CGC	-	pfam_Impact_N,superfamily_Ribosomal_S5_D2-typ_fold		0.378	IMPACT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPACT	protein_coding	OTTHUMT00000254901.1	G	NM_018439	-		22029853	+1	no_errors	ENST00000284202	ensembl	human	known	74_37	missense	SNP	1.000	T
SKI	6497	genome.wustl.edu	37	1	2235296	2235296	+	Missense_Mutation	SNP	G	G	C			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr1:2235296G>C	ENST00000378536.4	+	4	1301	c.1229G>C	c.(1228-1230)aGc>aCc	p.S410T		NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	410					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		TCCTACAAGAGCTTTGAGACA	0.687																																					Ovarian(177;144 1678 13697 20086 27838 40755)												0								ENSG00000157933						13.0	17.0	16.0					1																	2235296		2134	4206	6340	SKI	SO:0001583	missense	0			-	HGNC	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.1229G>C	1.37:g.2235296G>C	ENSP00000367797:p.Ser410Thr	Somatic	0	74	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	76	113	40.21	Q5SYT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_c-SKI_SMAD4-bd_dom,pfam_Transform_Ski,superfamily_SAND_dom-like,superfamily_DNA-bd_dom_put	p.S410T	ENST00000378536.4	37	c.1229	CCDS39.1	1	.	.	.	.	.	.	.	.	.	.	G	13.84	2.358057	0.41801	.	.	ENSG00000157933	ENST00000378536	D	0.95949	-3.86	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.95175	0.8436	L	0.50333	1.59	0.44485	D	0.997428	D	0.67145	0.996	P	0.57620	0.824	D	0.93131	0.6533	10	0.06891	T	0.86	-20.2775	16.7915	0.85590	0.0:0.0:1.0:0.0	.	410	P12755	SKI_HUMAN	T	410	ENSP00000367797:S410T	ENSP00000367797:S410T	S	+	2	0	SKI	2225156	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.950000	0.70265	2.264000	0.75181	0.561000	0.74099	AGC	-	NULL		0.687	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKI	protein_coding	OTTHUMT00000004070.1	G	NM_003036	-		2235296	+1	no_errors	ENST00000378536	ensembl	human	known	74_37	missense	SNP	1.000	C
PIK3C2G	5288	genome.wustl.edu	37	12	18715824	18715824	+	Missense_Mutation	SNP	A	A	T	rs368585306		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr12:18715824A>T	ENST00000266497.5	+	25	3693	c.3655A>T	c.(3655-3657)Aat>Tat	p.N1219Y	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.N1219Y|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.N1260Y			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1219	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				GAAATCCAGTAATGTAAGTTT	0.368																																																	0								ENSG00000139144						98.0	97.0	97.0					12																	18715824		1860	4105	5965	PIK3C2G	SO:0001583	missense	0			-	HGNC	AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3655A>T	12.37:g.18715824A>T	ENSP00000266497:p.Asn1219Tyr	Somatic	0	34	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	13	16	44.83	A1L3U0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_dom,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.N1260Y	ENST00000266497.5	37	c.3778	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.482555	0.00163	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.26518	1.73;1.73;1.73	4.14	-3.66	0.04489	Phox homologous domain (5);	0.843042	0.10337	N	0.686794	T	0.09774	0.0240	N	0.17082	0.46	0.09310	N	1	B;B;B	0.14012	0.009;0.007;0.009	B;B;B	0.18263	0.021;0.012;0.021	T	0.38243	-0.9670	10	0.02654	T	1	-0.0476	4.4453	0.11595	0.5507:0.2654:0.0944:0.0895	.	1259;1260;1219	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	Y	1219;1219;1260	ENSP00000404845:N1219Y;ENSP00000266497:N1219Y;ENSP00000445381:N1260Y	ENSP00000266497:N1219Y	N	+	1	0	PIK3C2G	18607091	0.000000	0.05858	0.000000	0.03702	0.319000	0.28217	-0.521000	0.06245	-0.697000	0.05092	0.482000	0.46254	AAT	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox		0.368	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	protein_coding	OTTHUMT00000401316.1	A	NM_004570	-		18715824	+1	no_errors	ENST00000538779	ensembl	human	known	74_37	missense	SNP	0.000	T
VPS35	55737	genome.wustl.edu	37	16	46696380	46696380	+	Nonsense_Mutation	SNP	A	A	C			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr16:46696380A>C	ENST00000299138.7	-	15	1900	c.1842T>G	c.(1840-1842)taT>taG	p.Y614*	RP11-93O14.2_ENST00000569353.1_RNA	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	614					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TTTCATCTTCATACAGAGAAA	0.423																																																	0								ENSG00000069329						100.0	93.0	95.0					16																	46696380		2203	4300	6503	VPS35	SO:0001587	stop_gained	0			-	HGNC	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.1842T>G	16.37:g.46696380A>C	ENSP00000299138:p.Tyr614*	Somatic	0	61	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	32	31.91	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_VPS35,superfamily_ARM-type_fold	p.Y614*	ENST00000299138.7	37	c.1842	CCDS10721.1	16	.	.	.	.	.	.	.	.	.	.	.	38	6.735249	0.97801	.	.	ENSG00000069329	ENST00000299138;ENST00000541330	.	.	.	5.77	3.44	0.39384	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.5121	9.4594	0.38776	0.847:0.0:0.153:0.0	.	.	.	.	X	614;479	.	ENSP00000299138:Y614X	Y	-	3	2	VPS35	45253881	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.793000	0.38764	0.415000	0.25817	0.459000	0.35465	TAT	-	pfam_VPS35,superfamily_ARM-type_fold		0.423	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS35	protein_coding	OTTHUMT00000255742.3	A		-		46696380	-1	no_errors	ENST00000299138	ensembl	human	known	74_37	nonsense	SNP	1.000	C
ANKRD35	148741	genome.wustl.edu	37	1	145561425	145561425	+	Silent	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr1:145561425G>A	ENST00000355594.4	+	10	1200	c.1113G>A	c.(1111-1113)caG>caA	p.Q371Q		NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	371										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCATGGAGCAGGGTTGTCCTA	0.572																																					Melanoma(9;127 754 22988 51047)												0								ENSG00000198483						37.0	39.0	38.0					1																	145561425		2203	4300	6503	ANKRD35	SO:0001819	synonymous_variant	0			-	HGNC	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.1113G>A	1.37:g.145561425G>A		Somatic	0	21	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	8	24	25.00	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.Q371	ENST00000355594.4	37	c.1113	CCDS919.1	1																																																																																			-	NULL		0.572	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD35	protein_coding	OTTHUMT00000038515.1	G	NM_144698	-		145561425	+1	no_errors	ENST00000355594	ensembl	human	known	74_37	silent	SNP	0.999	A
ANGEL1	23357	genome.wustl.edu	37	14	77275799	77275799	+	Frame_Shift_Del	DEL	T	T	-			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr14:77275799delT	ENST00000251089.2	-	2	364	c.252delA	c.(250-252)aaafs	p.K84fs	ANGEL1_ENST00000554941.1_5'UTR	NM_015305.3	NP_056120.2	Q9UNK9	ANGE1_HUMAN	angel homolog 1 (Drosophila)	84										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	22			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0285)		GGGCTAGTCCTTTATCTATAA	0.567																																																	0								ENSG00000013523						41.0	42.0	42.0					14																	77275799		2203	4300	6503	ANGEL1	SO:0001589	frameshift_variant	0				HGNC	AF111169	CCDS9852.1	14q24.3	2014-06-17		2005-08-04	ENSG00000013523	ENSG00000013523			19961	protein-coding gene	gene with protein product				KIAA0759		11943475	Standard	NM_015305		Approved	Ccr4e	uc001xsv.3	Q9UNK9	OTTHUMG00000171494	ENST00000251089.2:c.252delA	14.37:g.77275799delT	ENSP00000251089:p.Lys84fs	Somatic	0	44	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	2	14	12.50	B4DWL7|O94859|Q8NCS9	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.G85fs	ENST00000251089.2	37	c.252	CCDS9852.1	14																																																																																			-	NULL		0.567	ANGEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGEL1	protein_coding	OTTHUMT00000413712.2	T	NM_015305			77275799	-1	no_errors	ENST00000251089	ensembl	human	known	74_37	frame_shift_del	DEL	0.782	-
FLJ36000	284124	genome.wustl.edu	37	17	21911364	21911364	+	lincRNA	SNP	T	T	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr17:21911364T>A	ENST00000581223.2	+	0	2089					NR_027084.1																						TCCTTGTGCGTGTGTTTGTTT	0.483																																																	0								ENSG00000266795																																			RP11-744K17.9			0			-	Clone_based_vega_gene																													17.37:g.21911364T>A		Somatic	0	21	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	14	51.72		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581223.2	37	NULL		17																																																																																			-	-		0.483	RP11-744K17.9-001	KNOWN	basic	lincRNA	FLJ36000	lincRNA	OTTHUMT00000451067.1	T		-		21911364	+1	no_errors	ENST00000581223	ensembl	human	known	74_37	rna	SNP	0.005	A
SMARCA4	6597	genome.wustl.edu	37	19	11094868	11094868	+	Missense_Mutation	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr19:11094868C>T	ENST00000429416.3	+	3	322	c.41C>T	c.(40-42)cCa>cTa	p.P14L	SMARCA4_ENST00000541122.2_Missense_Mutation_p.P14L|SMARCA4_ENST00000590574.1_Missense_Mutation_p.P14L|SMARCA4_ENST00000444061.3_Missense_Mutation_p.P14L|SMARCA4_ENST00000589677.1_Missense_Mutation_p.P14L|SMARCA4_ENST00000413806.3_Missense_Mutation_p.P14L|SMARCA4_ENST00000450717.3_Missense_Mutation_p.P14L|SMARCA4_ENST00000344626.4_Missense_Mutation_p.P14L|SMARCA4_ENST00000358026.2_Missense_Mutation_p.P14L	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4	14	Necessary for interaction with SS18L1/CREST. {ECO:0000250}.				aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				ACTCCTCGGCCAGGTCCTTCC	0.697			"""F, N, Mis"""		NSCLC																																			Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)						ENSG00000127616						28.0	35.0	32.0					19																	11094868		2200	4298	6498	SMARCA4	SO:0001583	missense	0			-	HGNC	D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.41C>T	19.37:g.11094868C>T	ENSP00000395654:p.Pro14Leu	Somatic	0	94	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	44	49.43	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SNF2_N,pfam_Bromodomain,pfam_BRK_domain,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,pfam_Gln-Leu-Gln_QLQ,superfamily_P-loop_NTPase,superfamily_Bromodomain,smart_Gln-Leu-Gln_QLQ,smart_HAS_subgr,smart_BRK_domain,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Bromodomain,prints_Bromodomain,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Bromodomain	p.P14L	ENST00000429416.3	37	c.41	CCDS12253.1	19	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099488	0.76983	.	.	ENSG00000127616	ENST00000429416;ENST00000358026;ENST00000421844;ENST00000344626;ENST00000541122;ENST00000444061;ENST00000450717;ENST00000413806	D;D;D;D;D;D;D	0.89123	-2.44;-2.47;-2.44;-2.41;-2.41;-2.42;-2.41	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.92047	0.7480	L	0.43152	1.355	0.80722	D	1	D;D;D;D;D;D;D	0.71674	0.998;0.998;0.998;0.998;0.998;0.998;0.998	D;D;D;D;D;D;D	0.73708	0.981;0.981;0.981;0.981;0.981;0.981;0.981	D	0.92495	0.6003	10	0.59425	D	0.04	-13.389	17.1334	0.86732	0.0:1.0:0.0:0.0	.	14;14;14;14;14;14;14	B1A8Z6;B1A8Z4;B1A8Z7;Q9HBD4;B1A8Z5;A7E2E1;P51532	.;.;.;.;.;.;SMCA4_HUMAN	L	14	ENSP00000395654:P14L;ENSP00000350720:P14L;ENSP00000343896:P14L;ENSP00000445036:P14L;ENSP00000392837:P14L;ENSP00000397783:P14L;ENSP00000414727:P14L	ENSP00000343896:P14L	P	+	2	0	SMARCA4	10955868	1.000000	0.71417	0.956000	0.39512	0.887000	0.51463	7.534000	0.82004	2.563000	0.86464	0.655000	0.94253	CCA	-	NULL		0.697	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	protein_coding	OTTHUMT00000452638.2	C	NM_003072	-		11094868	+1	no_errors	ENST00000358026	ensembl	human	known	74_37	missense	SNP	1.000	T
DLC1	10395	genome.wustl.edu	37	8	13162758	13162758	+	Intron	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr8:13162758G>A	ENST00000276297.4	-	5	1758				DLC1_ENST00000316609.5_Intron|DLC1_ENST00000511869.1_Silent_p.F456F	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CGAGAAAACAGAACCAAAATG	0.284																																																	0								ENSG00000164741						75.0	79.0	78.0					8																	13162758		2202	4297	6499	DLC1	SO:0001627	intron_variant	0			-	HGNC	AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1348+19C>T	8.37:g.13162758G>A		Somatic	0	58	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	39	15.22	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F456	ENST00000276297.4	37	c.1368	CCDS5989.1	8																																																																																			-	NULL		0.284	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	protein_coding	OTTHUMT00000207632.2	G	NM_182643, NM_006094	-		13162758	-1	no_errors	ENST00000511869	ensembl	human	novel	74_37	silent	SNP	0.000	A
GPC5	2262	genome.wustl.edu	37	13	92345903	92345903	+	Missense_Mutation	SNP	G	G	A	rs373404359		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr13:92345903G>A	ENST00000377067.3	+	3	1160	c.788G>A	c.(787-789)gGc>gAc	p.G263D		NM_004466.4	NP_004457.1	P78333	GPC5_HUMAN	glypican 5	263					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(4)|endometrium(6)|kidney(4)|large_intestine(7)|lung(34)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				CACTGCCAAGGCCTGGCGCTC	0.532																																																	0								ENSG00000179399	G	ASP/GLY	0,4406		0,0,2203	81.0	72.0	75.0		788	4.6	1.0	13		75	1,8599		0,1,4299	no	missense	GPC5	NM_004466.4	94	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	263/573	92345903	1,13005	2203	4300	6503	GPC5	SO:0001583	missense	0			-	HGNC	AF001462	CCDS9468.1	13q32	2011-08-01			ENSG00000179399	ENSG00000179399		"""Proteoglycans / Cell Surface : Glypicans"""	4453	protein-coding gene	gene with protein product	"""glypican proteoglycan 5"""	602446				9070915, 20304703, 19556317, 15057823	Standard	NM_004466		Approved		uc010tif.2	P78333	OTTHUMG00000017200	ENST00000377067.3:c.788G>A	13.37:g.92345903G>A	ENSP00000366267:p.Gly263Asp	Somatic	0	45	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	26	16	61.90	B2R726|O60436|Q9BX27	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Glypican	p.G263D	ENST00000377067.3	37	c.788	CCDS9468.1	13	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965687	0.53507	0.0	1.16E-4	ENSG00000179399	ENST00000377067	T	0.65732	-0.17	5.45	4.59	0.56863	Glypican, conserved site (1);	0.153488	0.64402	D	0.000019	T	0.77671	0.4165	M	0.82056	2.57	0.27952	N	0.937099	P	0.44281	0.831	P	0.57244	0.816	T	0.73238	-0.4046	10	0.66056	D	0.02	0.4806	16.3565	0.83236	0.0:0.1651:0.8349:0.0	.	263	P78333	GPC5_HUMAN	D	263	ENSP00000366267:G263D	ENSP00000366267:G263D	G	+	2	0	GPC5	91143904	1.000000	0.71417	0.993000	0.49108	0.473000	0.32948	5.309000	0.65774	2.566000	0.86566	0.585000	0.79938	GGC	-	pfam_Glypican		0.532	GPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC5	protein_coding	OTTHUMT00000045454.1	G	NM_004466	-		92345903	+1	no_errors	ENST00000377067	ensembl	human	known	74_37	missense	SNP	0.915	A
UNC80	285175	genome.wustl.edu	37	2	210837868	210837868	+	Missense_Mutation	SNP	A	A	G	rs201695718		TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr2:210837868A>G	ENST00000439458.1	+	55	8343	c.8263A>G	c.(8263-8265)Agc>Ggc	p.S2755G	UNC80_ENST00000272845.6_Missense_Mutation_p.S2750G|UNC80_ENST00000539183.1_Missense_Mutation_p.S201G	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2755					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GCGGATCATCAGCACATCCAG	0.587																																																	0								ENSG00000144406	A	GLY/SER,GLY/SER	0,1384		0,0,692	72.0	71.0	71.0		8263,8248	5.0	1.0	2		71	2,3180		0,2,1589	yes	missense,missense	UNC80	NM_032504.1,NM_182587.3	56,56	0,2,2281	GG,GA,AA		0.0629,0.0,0.0438	possibly-damaging,possibly-damaging	2755/3259,2750/3235	210837868	2,4564	692	1591	2283	UNC80	SO:0001583	missense	0			-	HGNC	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.8263A>G	2.37:g.210837868A>G	ENSP00000391088:p.Ser2755Gly	Somatic	0	36	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	21	16.00	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.S2755G	ENST00000439458.1	37	c.8263	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	A	18.98	3.738367	0.69304	0.0	6.29E-4	ENSG00000144406	ENST00000439458;ENST00000272845;ENST00000333907;ENST00000539183	T;T	0.34072	1.38;1.38	5.0	5.0	0.66597	.	.	.	.	.	T	0.50888	0.1642	L	0.39898	1.24	0.42711	D	0.993644	D;P	0.56035	0.974;0.954	D;D	0.70487	0.969;0.943	T	0.53308	-0.8457	9	0.66056	D	0.02	.	15.1687	0.72850	1.0:0.0:0.0:0.0	.	2750;2755	C9J1U3;Q8N2C7	.;UNC80_HUMAN	G	2755;2750;281;201	ENSP00000391088:S2755G;ENSP00000272845:S2750G	ENSP00000272845:S2750G	S	+	1	0	UNC80	210546113	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	6.864000	0.75494	2.235000	0.73313	0.533000	0.62120	AGC	-	NULL		0.587	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	protein_coding		A	NM_182587	rs201695718		210837868	+1	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	SNP	1.000	G
ALOX12	239	genome.wustl.edu	37	17	6905806	6905806	+	Intron	SNP	G	G	C			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr17:6905806G>C	ENST00000251535.6	+	8	1214				AC027763.2_ENST00000573939.1_3'UTR|AC027763.2_ENST00000399541.2_Intron|AC027763.2_ENST00000575727.1_Missense_Mutation_p.F77L|RP11-589P10.7_ENST00000572547.1_RNA|AC027763.2_ENST00000399540.2_Missense_Mutation_p.F77L|AC027763.2_ENST00000574377.1_Missense_Mutation_p.F89L	NM_000697.2	NP_000688.2	P18054	LOX12_HUMAN	arachidonate 12-lipoxygenase						aging (GO:0007568)|arachidonic acid metabolic process (GO:0019369)|cellular component movement (GO:0006928)|cellular response to lipid (GO:0071396)|establishment of skin barrier (GO:0061436)|fatty acid oxidation (GO:0019395)|hepoxilin biosynthetic process (GO:0051122)|hepoxilin metabolic process (GO:0051121)|leukotriene A4 metabolic process (GO:1901751)|linoleic acid metabolic process (GO:0043651)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxin B4 biosynthetic process (GO:2001306)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of platelet aggregation (GO:0090331)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of gene expression (GO:0010628)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|superoxide anion generation (GO:0042554)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|sarcolemma (GO:0042383)	arachidonate 12-lipoxygenase activity (GO:0004052)|hepoxilin A3 synthase activity (GO:0051120)|hepoxilin-epoxide hydrolase activity (GO:0047977)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)|urinary_tract(1)	19						TACTGACCTAGAAATACTGTG	0.512																																																	0								ENSG00000215067																																			AC027763.2	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	M35418	CCDS11084.1	17p13.1	2010-01-14			ENSG00000108839	ENSG00000108839	1.13.11.31	"""Arachidonate lipoxygenases"""	429	protein-coding gene	gene with protein product	"""platelet 12-LOX"""	152391				1570320	Standard	NM_000697		Approved	12S-LOX	uc002gdx.4	P18054	OTTHUMG00000102088	ENST00000251535.6:c.1161+676G>C	17.37:g.6905806G>C		Somatic	0	85	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	55	49	52.88	O95569|Q6ISF8|Q9UQM4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.F89L	ENST00000251535.6	37	c.267	CCDS11084.1	17	.	.	.	.	.	.	.	.	.	.	G	9.592	1.126318	0.20959	.	.	ENSG00000215067	ENST00000399540	T	0.51574	0.7	1.31	1.31	0.21738	.	.	.	.	.	T	0.44498	0.1296	.	.	.	0.09310	N	0.999993	.	.	.	.	.	.	T	0.42172	-0.9467	6	0.87932	D	0	.	5.9984	0.19507	0.0:0.0:1.0:0.0	.	.	.	.	L	77	ENSP00000382455:F77L	ENSP00000382455:F77L	F	-	3	2	AC027763.2	6846530	0.002000	0.14202	0.013000	0.15412	0.441000	0.31987	0.506000	0.22658	1.024000	0.39682	0.484000	0.47621	TTC	-	NULL		0.512	ALOX12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000215067	protein_coding	OTTHUMT00000219922.2	G		-		6905806	-1	no_errors	ENST00000574377	ensembl	human	putative	74_37	missense	SNP	0.016	C
PLXDC1	57125	genome.wustl.edu	37	17	37263888	37263888	+	Intron	SNP	A	A	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr17:37263888A>T	ENST00000315392.4	-	6	804				PLXDC1_ENST00000444911.2_Intron|PLXDC1_ENST00000539608.1_Intron|PLXDC1_ENST00000493200.1_Intron|PLXDC1_ENST00000394316.2_Intron	NM_020405.4	NP_065138.2	Q8IUK5	PLDX1_HUMAN	plexin domain containing 1						angiogenesis (GO:0001525)|spinal cord development (GO:0021510)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|tight junction (GO:0005923)	receptor activity (GO:0004872)			kidney(2)|large_intestine(6)|liver(1)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						CTTCGGGATGATGGGGAAGTT	0.607																																																	0								ENSG00000263818																																			CTD-2206N4.4	SO:0001627	intron_variant	0			-	Clone_based_vega_gene	AF279144	CCDS11333.1	17q21.1	2006-04-12			ENSG00000161381	ENSG00000161381			20945	protein-coding gene	gene with protein product	"""tumor endothelial marker 7 precursor"""	606826				10947988, 11559528	Standard	NM_020405		Approved	TEM3, TEM7	uc002hrg.2	Q8IUK5	OTTHUMG00000133183	ENST00000315392.4:c.593-110T>A	17.37:g.37263888A>T		Somatic	0	49	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	22	13	62.86	B2R7I8|Q5QCZ7|Q5QCZ8|Q5QCZ9|Q9HCT9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000315392.4	37	NULL	CCDS11333.1	17																																																																																			-	-		0.607	PLXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100131347	protein_coding	OTTHUMT00000256892.2	A	NM_020405	-		37263888	+1	no_errors	ENST00000578423	ensembl	human	known	74_37	rna	SNP	0.000	T
NEAT1	283131	genome.wustl.edu	37	11	65212047	65212047	+	lincRNA	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr11:65212047C>T	ENST00000384994.1	+	0	200					NR_030343.1				nuclear paraspeckle assembly transcript 1 (non-protein coding)																		CAGCAGAGCTCGTGGGGGGCT	0.682																																																	0								ENSG00000245532						7.0	7.0	7.0					11																	65212047		1525	3488	5013	NEAT1			0			-	HGNC	AF080092		11q13.1	2013-11-01	2009-07-24	2009-07-24	ENSG00000245532	ENSG00000245532		"""Long non-coding RNAs"", ""-"""	30815	non-coding RNA	RNA, long non-coding	"""trophoblast derived non-protein coding RNA"", ""nuclear enriched abundant transcript 1"", ""long intergenic non-protein coding RNA 84"", ""virus inducible non-coding RNA"""	612769	"""non-protein coding RNA 84"""	NCRNA00084		9253601, 9858482, 12565840	Standard	NR_028272		Approved	TncRNA, MENepsilon/beta, LINC00084, VINC	uc010rog.2		OTTHUMG00000166321		11.37:g.65212047C>T		Somatic	0	35	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	17	25	40.48		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000384994.1	37	NULL		11																																																																																			-	-		0.682	NEAT1-201	KNOWN	basic	miRNA	NEAT1	lincRNA		C	NR_028272	-		65212047	+1	no_errors	ENST00000501122	ensembl	human	known	74_37	rna	SNP	0.000	T
BRINP3	339479	genome.wustl.edu	37	1	190234179	190234179	+	Missense_Mutation	SNP	T	T	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr1:190234179T>A	ENST00000367462.3	-	4	665	c.434A>T	c.(433-435)gAg>gTg	p.E145V	RP11-547I7.1_ENST00000452178.1_RNA|BRINP3_ENST00000534846.1_Missense_Mutation_p.E43V	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	145	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											TGTGAGTGACTCCTCTCCTGC	0.378																																																	0								ENSG00000162670						73.0	62.0	66.0					1																	190234179		2203	4300	6503	BRINP3	SO:0001583	missense	0			-	HGNC	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.434A>T	1.37:g.190234179T>A	ENSP00000356432:p.Glu145Val	Somatic	0	47	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	23	52.94	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_MACPF,smart_MACPF	p.E145V	ENST00000367462.3	37	c.434	CCDS1373.1	1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.240724	0.79912	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	D;T	0.82984	-1.67;1.55	5.6	5.6	0.85130	Membrane attack complex component/perforin (MACPF) domain (2);	0.000000	0.85682	D	0.000000	D	0.90239	0.6948	M	0.76328	2.33	0.58432	D	0.999995	D;D	0.76494	0.999;0.999	D;D	0.81914	0.991;0.995	D	0.91325	0.5085	10	0.87932	D	0	.	13.7472	0.62883	0.0:0.0:0.0:1.0	.	43;145	B7Z260;Q76B58	.;FAM5C_HUMAN	V	145;43	ENSP00000356432:E145V;ENSP00000438022:E43V	ENSP00000356432:E145V	E	-	2	0	FAM5C	188500802	1.000000	0.71417	1.000000	0.80357	0.834000	0.47266	7.539000	0.82063	2.133000	0.65898	0.477000	0.44152	GAG	-	pfam_MACPF,smart_MACPF		0.378	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP3	protein_coding	OTTHUMT00000086278.1	T	NM_199051	-		190234179	-1	no_errors	ENST00000367462	ensembl	human	known	74_37	missense	SNP	1.000	A
DOCK8	81704	genome.wustl.edu	37	9	311953	311953	+	Splice_Site	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr9:311953G>A	ENST00000453981.1	+	6	640		c.e6-1		DOCK8_ENST00000469391.1_Splice_Site|DOCK8_ENST00000432829.2_Splice_Site			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TTCTCTCACAGGCAGGCCCCC	0.547																																																	0								ENSG00000107099						124.0	134.0	131.0					9																	311953		2203	4298	6501	DOCK8	SO:0001630	splice_region_variant	0			-	HGNC	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.529-1G>A	9.37:g.311953G>A		Somatic	0	56	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	53	22.06	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e6-1	ENST00000453981.1	37	c.529-1	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983054	0.53827	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.996	0.89184	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK8	301953	1.000000	0.71417	0.501000	0.27601	0.662000	0.39071	6.954000	0.76001	2.691000	0.91804	0.563000	0.77884	.	-	-		0.547	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	protein_coding	OTTHUMT00000171792.5	G	XM_036307	-	Intron	311953	+1	no_errors	ENST00000453981	ensembl	human	known	74_37	splice_site	SNP	0.979	A
USP50	373509	genome.wustl.edu	37	15	50835876	50835876	+	Silent	SNP	T	T	G			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr15:50835876T>G	ENST00000532404.1	-	3	536	c.363A>C	c.(361-363)ccA>ccC	p.P121P	USP50_ENST00000530218.1_Intron	NM_203494.4	NP_987090.2	Q70EL3	UBP50_HUMAN	ubiquitin specific peptidase 50	126	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(5)	13				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		TCGTAAATGCTGGGTAGAGGT	0.423																																																	0								ENSG00000170236						64.0	60.0	61.0					15																	50835876		1873	4114	5987	USP50	SO:0001819	synonymous_variant	0			-	HGNC	AI990110	CCDS53944.1	15q21.1	2008-02-05	2005-08-08			ENSG00000170236		"""Ubiquitin-specific peptidases"""	20079	protein-coding gene	gene with protein product			"""ubiquitin specific protease 50"""			12838346	Standard	NM_203494		Approved		uc021sky.1	Q70EL3		ENST00000532404.1:c.363A>C	15.37:g.50835876T>G		Somatic	0	45	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	15	61.54	E9PP86	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.P121	ENST00000532404.1	37	c.363	CCDS53944.1	15																																																																																			-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67		0.423	USP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP50	protein_coding	OTTHUMT00000395249.1	T		-		50835876	-1	no_errors	ENST00000532404	ensembl	human	known	74_37	silent	SNP	0.017	G
MYO1E	4643	genome.wustl.edu	37	15	59443246	59443246	+	Intron	SNP	A	A	G			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr15:59443246A>G	ENST00000288235.4	-	26	3480				AC092757.1_ENST00000408169.1_RNA	NM_004998.3	NP_004989.2	Q12965	MYO1E_HUMAN	myosin IE						actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(6)|lung(10)|pancreas(2)|prostate(1)|urinary_tract(1)	33				all cancers(107;0.207)		acacacacacacacGCGCGCG	0.542																																																	0								ENSG00000221096																																			AC092757.1	SO:0001627	intron_variant	0			-	Clone_based_ensembl_gene	U14391	CCDS32254.1	15q21-q22	2011-09-27				ENSG00000157483		"""Myosins / Myosin superfamily : Class I"""	7599	protein-coding gene	gene with protein product	"""myosin-IC"""	601479				8884266	Standard	NM_004998		Approved	MYO1C, HuncM-IC, MGC104638	uc002aga.4	Q12965		ENST00000288235.4:c.3080+2542T>C	15.37:g.59443246A>G		Somatic	0	14	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	15	25.00	Q14778	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000288235.4	37	NULL	CCDS32254.1	15																																																																																			-	-		0.542	MYO1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000221096	protein_coding	OTTHUMT00000416024.1	A	NM_004998	-		59443246	-1	no_errors	ENST00000408169	ensembl	human	novel	74_37	rna	SNP	0.001	G
MSLN	10232	genome.wustl.edu	37	16	816740	816740	+	Missense_Mutation	SNP	G	G	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr16:816740G>A	ENST00000382862.3	+	13	1422	c.1327G>A	c.(1327-1329)Gcc>Acc	p.A443T	MSLN_ENST00000545450.2_Missense_Mutation_p.A435T|MSLN_ENST00000566549.1_Missense_Mutation_p.A435T|MSLN_ENST00000563941.1_Missense_Mutation_p.A435T	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	443					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				CACCCTGACCGCCTTCTACCC	0.652																																																	0								ENSG00000102854						74.0	74.0	74.0					16																	816740		2192	4286	6478	MSLN	SO:0001583	missense	0			-	HGNC	U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.1327G>A	16.37:g.816740G>A	ENSP00000372313:p.Ala443Thr	Somatic	0	69	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	21	48	30.43	D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mesothelin	p.A443T	ENST00000382862.3	37	c.1327	CCDS32356.1	16	.	.	.	.	.	.	.	.	.	.	G	1.577	-0.532543	0.04112	.	.	ENSG00000102854	ENST00000446427;ENST00000445361;ENST00000545450;ENST00000382862	T;T	0.12361	2.69;2.69	4.11	-4.79	0.03200	.	3.044690	0.01244	N	0.008686	T	0.06690	0.0171	N	0.11064	0.09	0.09310	N	1	B;B;B;B	0.25048	0.042;0.052;0.117;0.042	B;B;B;B	0.17433	0.01;0.018;0.01;0.01	T	0.35992	-0.9766	10	0.06891	T	0.86	-0.9712	11.4066	0.49902	0.2964:0.0:0.7036:0.0	.	434;443;435;435	Q13421-4;Q13421;Q13421-2;Q13421-3	.;MSLN_HUMAN;.;.	T	443;435;435;443	ENSP00000442965:A435T;ENSP00000372313:A443T	ENSP00000372313:A443T	A	+	1	0	MSLN	756741	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.079000	0.11357	-0.832000	0.04251	0.205000	0.17691	GCC	-	pfam_Mesothelin		0.652	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MSLN	protein_coding	OTTHUMT00000109253.2	G		-		816740	+1	no_errors	ENST00000382862	ensembl	human	known	74_37	missense	SNP	0.000	A
ELMSAN1	91748	genome.wustl.edu	37	14	74186107	74186107	+	Nonsense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr14:74186107G>T	ENST00000286523.5	-	12	3817	c.3035C>A	c.(3034-3036)tCa>tAa	p.S1012*	ELMSAN1_ENST00000394071.2_Nonsense_Mutation_p.S1012*	NM_194278.3	NP_919254.2	Q6PJG2	EMSA1_HUMAN	ELM2 and Myb/SANT-like domain containing 1	1012					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										TGCCCTTCGTGACTTCCCTGT	0.542																																																	0								ENSG00000156030						99.0	82.0	88.0					14																	74186107		2203	4299	6502	ELMSAN1	SO:0001587	stop_gained	0			-	HGNC	BF971739	CCDS9819.1	14q24.3	2012-09-25	2012-09-25	2012-09-25	ENSG00000156030	ENSG00000156030			19853	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 117"", ""chromosome 14 open reading frame 43"""	C14orf117, C14orf43			Standard	NM_194278		Approved	LSR68	uc001xou.3	Q6PJG2	OTTHUMG00000150359	ENST00000286523.5:c.3035C>A	14.37:g.74186107G>T	ENSP00000286523:p.Ser1012*	Somatic	0	43	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	40	9.09	Q6PK13|Q6PK59|Q6ZS23	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.S1012*	ENST00000286523.5	37	c.3035	CCDS9819.1	14	.	.	.	.	.	.	.	.	.	.	G	46	12.782560	0.99696	.	.	ENSG00000156030	ENST00000394071;ENST00000286523;ENST00000423556;ENST00000435371	.	.	.	5.78	5.78	0.91487	.	0.125654	0.36555	N	0.002535	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0609	11.3045	0.49327	0.0:0.1364:0.7222:0.1414	.	.	.	.	X	1012	.	ENSP00000286523:S1012X	S	-	2	0	C14orf43	73255860	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	3.198000	0.51035	2.739000	0.93911	0.561000	0.74099	TCA	-	NULL		0.542	ELMSAN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMSAN1	protein_coding	OTTHUMT00000317793.1	G	NM_194278	-		74186107	-1	no_errors	ENST00000286523	ensembl	human	known	74_37	nonsense	SNP	0.987	T
DNM1P34	729809	genome.wustl.edu	37	15	75592652	75592652	+	RNA	SNP	T	T	C			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr15:75592652T>C	ENST00000567292.1	-	0	1917							Q6PK57	DMP34_HUMAN	DNM1 pseudogene 34							microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										AGCACAGGCGTGCTGCAGCAG	0.582																																																	0								ENSG00000260357																																			DNM1P34			0			-	HGNC	AJ576251		15q24.2	2013-04-25			ENSG00000260357	ENSG00000260357			35181	pseudogene	pseudogene				DNM1DN8@			Standard	NG_009143		Approved	DNM1DN8-1, DNM1DN8-5	uc002azx.1	Q6PK57	OTTHUMG00000172673		15.37:g.75592652T>C		Somatic	0	25	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	17	26.09		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000567292.1	37	NULL		15																																																																																			-	-		0.582	DNM1P34-001	KNOWN	basic	processed_transcript	DNM1P34	pseudogene	OTTHUMT00000419799.1	T	NG_009143	-		75592652	-1	no_errors	ENST00000567292	ensembl	human	known	74_37	rna	SNP	0.009	C
MMP24	10893	genome.wustl.edu	37	20	33851607	33851607	+	Silent	SNP	C	C	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr20:33851607C>T	ENST00000246186.6	+	5	916	c.831C>T	c.(829-831)ttC>ttT	p.F277F	EDEM2_ENST00000540582.1_Intron|MMP24-AS1_ENST00000453892.1_RNA|MMP24-AS1_ENST00000456350.1_RNA|MMP24-AS1_ENST00000438751.1_RNA|MMP24-AS1_ENST00000566203.2_RNA|MMP24-AS1_ENST00000433764.1_RNA|MMP24-AS1_ENST00000454184.1_RNA	NM_006690.3	NP_006681.1	Q9Y5R2	MMP24_HUMAN	matrix metallopeptidase 24 (membrane-inserted)	277					cell-cell adhesion (GO:0098609)|cell-cell adhesion mediated by cadherin (GO:0044331)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|glial cell differentiation (GO:0010001)|neuronal stem cell maintenance (GO:0097150)|positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|large_intestine(1)|lung(2)|prostate(2)|skin(5)	14			BRCA - Breast invasive adenocarcinoma(18;0.00252)		Marimastat(DB00786)	ACGACCTCTTCCTGGTGGCTG	0.617																																																	0								ENSG00000125966						19.0	20.0	20.0					20																	33851607		2203	4300	6503	MMP24	SO:0001819	synonymous_variant	0			-	HGNC	AF131284	CCDS46593.1	20q11.2	2008-07-16	2005-08-08		ENSG00000125966	ENSG00000125966			7172	protein-coding gene	gene with protein product	"""membrane-type 5 matrix metalloproteinase"""	604871	"""matrix metalloproteinase 24 (membrane-inserted)"""			10363975	Standard	NM_006690		Approved	MT5-MMP	uc002xbu.2	Q9Y5R2	OTTHUMG00000032330	ENST00000246186.6:c.831C>T	20.37:g.33851607C>T		Somatic	0	82	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	64	42.86	B7ZBG8|Q9H440	Silent	SNP	NA	NA	NA	NA	NA	NA	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.F277	ENST00000246186.6	37	c.831	CCDS46593.1	20																																																																																			-	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo		0.617	MMP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP24	protein_coding	OTTHUMT00000078851.4	C	NM_006690	-		33851607	+1	no_errors	ENST00000246186	ensembl	human	known	74_37	silent	SNP	1.000	T
MMP26	56547	genome.wustl.edu	37	11	5012728	5012728	+	Splice_Site	SNP	T	T	C			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr11:5012728T>C	ENST00000380390.1	+	5	811		c.e5+2		MMP26_ENST00000300762.1_Splice_Site			Q9NRE1	MMP26_HUMAN	matrix metallopeptidase 26						collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(3)|stomach(1)	22		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)	Marimastat(DB00786)	CAGACACTGGTAAATGCCTTG	0.483																																																	0								ENSG00000167346						109.0	106.0	107.0					11																	5012728		2201	4298	6499	MMP26	SO:0001630	splice_region_variant	0			-	HGNC	AF230354	CCDS7752.1	11p15	2008-07-18	2005-08-08		ENSG00000167346	ENSG00000167346	3.4.24.1		14249	protein-coding gene	gene with protein product	"""matrilysin 2"""	605470	"""matrix metalloproteinase 26"""			10801841, 10824119	Standard	NM_021801		Approved	endometase, MGC126590, MGC126592	uc001lzv.3	Q9NRE1	OTTHUMG00000066442	ENST00000380390.1:c.595+2T>C	11.37:g.5012728T>C		Somatic	0	130	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	25	115	17.86	Q3MJ78|Q9GZS2|Q9NR87	Splice_Site	SNP	NA	NA	NA	NA	NA	NA	-	e4+2	ENST00000380390.1	37	c.595+2	CCDS7752.1	11	.	.	.	.	.	.	.	.	.	.	T	12.90	2.075326	0.36662	.	.	ENSG00000167346	ENST00000380390;ENST00000300762	.	.	.	3.81	3.81	0.43845	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.9902	0.36019	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MMP26	4969304	0.952000	0.32445	0.774000	0.31636	0.149000	0.21700	0.553000	0.23391	1.365000	0.46057	0.533000	0.62120	.	-	-		0.483	MMP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP26	protein_coding	OTTHUMT00000142058.3	T	NM_021801	-	Intron	5012728	+1	no_errors	ENST00000300762	ensembl	human	known	74_37	splice_site	SNP	0.992	C
SYNE2	23224	genome.wustl.edu	37	14	64532361	64532361	+	Missense_Mutation	SNP	G	G	T			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr14:64532361G>T	ENST00000344113.4	+	51	10636	c.10424G>T	c.(10423-10425)aGt>aTt	p.S3475I	SYNE2_ENST00000555002.1_Missense_Mutation_p.S109I|SYNE2_ENST00000554584.1_Missense_Mutation_p.S3508I|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Missense_Mutation_p.S3475I	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3475					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAATTTGTCAGTGAAGAAGTG	0.388																																																	0								ENSG00000054654						142.0	140.0	141.0					14																	64532361		1950	4141	6091	SYNE2	SO:0001583	missense	0			-	HGNC	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.10424G>T	14.37:g.64532361G>T	ENSP00000341781:p.Ser3475Ile	Somatic	0	43	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	54	8.47	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S3475I	ENST00000344113.4	37	c.10424	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	13.38	2.220471	0.39201	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002	T;T;T;T	0.59364	0.65;0.65;0.27;4.0	5.52	2.55	0.30701	.	0.420097	0.24917	N	0.034567	T	0.53610	0.1807	L	0.29908	0.895	0.80722	D	1	P;D	0.53885	0.938;0.963	P;P	0.55508	0.603;0.777	T	0.42275	-0.9461	10	0.30078	T	0.28	.	8.9018	0.35499	0.4027:0.0:0.5973:0.0	.	3475;3475	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	I	3475;3475;3508;3508;109	ENSP00000350719:S3475I;ENSP00000341781:S3475I;ENSP00000452570:S3508I;ENSP00000450831:S109I	ENSP00000261678:S3508I	S	+	2	0	SYNE2	63602114	0.998000	0.40836	0.993000	0.49108	0.990000	0.78478	0.692000	0.25482	0.321000	0.23259	0.585000	0.79938	AGT	-	NULL		0.388	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	protein_coding	OTTHUMT00000276994.2	G	NM_182914	-		64532361	+1	no_errors	ENST00000358025	ensembl	human	known	74_37	missense	SNP	0.999	T
SAMM50	25813	genome.wustl.edu	37	22	44359061	44359061	+	Intron	SNP	C	C	A			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr22:44359061C>A	ENST00000350028.4	+	2	178				SAMM50_ENST00000493161.1_3'UTR|SAMM50_ENST00000396202.3_Intron	NM_015380.4	NP_056195.3	Q9Y512	SAM50_HUMAN	SAMM50 sorting and assembly machinery component						cellular protein metabolic process (GO:0044267)|protein import into mitochondrial outer membrane (GO:0045040)|protein targeting to mitochondrion (GO:0006626)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrial sorting and assembly machinery complex (GO:0001401)|mitochondrion (GO:0005739)				endometrium(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				ttgaagggaacaactactgaa	0.443																																																	0								ENSG00000100347																																			SAMM50	SO:0001627	intron_variant	0			-	HGNC	AK001087	CCDS14055.1	22q13.31	2013-08-21	2013-08-21	2005-11-20	ENSG00000100347	ENSG00000100347			24276	protein-coding gene	gene with protein product		612058	"""sorting and assembly machinery component 50 homolog (S. cerevisiae)"""			15644312	Standard	NM_015380		Approved	CGI-51, TRG-3, YNL026W, OMP85, TOB55	uc003bej.3	Q9Y512	OTTHUMG00000150557	ENST00000350028.4:c.22-105C>A	22.37:g.44359061C>A		Somatic	0	17	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	3	76.92	Q53HC4|Q56VW7|Q969Y9|Q96I46|Q9NW85|Q9UQM9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000350028.4	37	NULL	CCDS14055.1	22																																																																																			-	-		0.443	SAMM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMM50	protein_coding	OTTHUMT00000318898.2	C	NM_015380	-		44359061	+1	no_errors	ENST00000493161	ensembl	human	known	74_37	rna	SNP	0.000	A
PDCL	5082	genome.wustl.edu	37	9	125585434	125585434	+	Missense_Mutation	SNP	A	A	C			TCGA-KF-A41W-01A-11D-A24N-09	TCGA-KF-A41W-11A-11D-A24N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a4bb569a-6cf7-4dfc-98d7-12cfaac76cdc	0cc19c64-6b2f-4150-a12f-d6fd1d3a10e7	g.chr9:125585434A>C	ENST00000259467.4	-	3	380	c.215T>G	c.(214-216)tTg>tGg	p.L72W		NM_005388.4	NP_005379.3	Q13371	PHLP_HUMAN	phosducin-like	72					heterotrimeric G-protein complex assembly (GO:1902605)|intracellular signal transduction (GO:0035556)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)	receptor signaling protein activity (GO:0005057)			endometrium(1)|large_intestine(2)|lung(5)|skin(1)|stomach(1)	10						CTCTGTCTCCAACTGCTTGAA	0.542																																																	0								ENSG00000136940						189.0	171.0	177.0					9																	125585434		2203	4300	6503	PDCL	SO:0001583	missense	0			-	HGNC	AF083325	CCDS6845.1	9q12-q13	2008-07-21			ENSG00000136940	ENSG00000136940			8770	protein-coding gene	gene with protein product		604421				10095058	Standard	NM_005388		Approved	PhLP, DKFZp564M1863	uc004bmz.2	Q13371	OTTHUMG00000020624	ENST00000259467.4:c.215T>G	9.37:g.125585434A>C	ENSP00000259467:p.Leu72Trp	Somatic	0	101	0.00		0.6228761874565415	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	96	10.28	Q4VXB6|Q96AF1|Q9UEW7|Q9UFL0|Q9UNX1|Q9UNX2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,prints_Phosducin	p.L72W	ENST00000259467.4	37	c.215	CCDS6845.1	9	.	.	.	.	.	.	.	.	.	.	A	23.5	4.425523	0.83667	.	.	ENSG00000136940	ENST00000259467	T	0.60171	0.21	5.98	4.83	0.62350	Thioredoxin-like fold (1);Phosducin, thioredoxin-like domain (1);Phosducin, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.76807	0.4039	M	0.83483	2.645	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.79783	-0.1658	10	0.87932	D	0	-13.8773	12.7461	0.57281	0.8628:0.1372:0.0:0.0	.	72;72	Q4VXB6;Q13371	.;PHLP_HUMAN	W	72	ENSP00000259467:L72W	ENSP00000259467:L72W	L	-	2	0	PDCL	124625255	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	8.845000	0.92153	1.065000	0.40693	0.460000	0.39030	TTG	-	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold		0.542	PDCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCL	protein_coding	OTTHUMT00000053956.1	A	NM_005388	-		125585434	-1	no_errors	ENST00000259467	ensembl	human	known	74_37	missense	SNP	1.000	C
