#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ENSG_ID	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ens_Gene	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_GMAF	i_HGNC	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_Normal_Alt_Count	i_Normal_Ref_Count	i_Normal_VAF	i_ORegAnno_bin	i_PurityEst	i_RNA_Tum_Ref_count	i_RNA_Tum_VAF	i_RNA_Tum_Var_count	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_Tier	i_Tumor_Alt_Count	i_Tumor_Ref_Count	i_Tumor_VAF	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_WGS_Norm_Ref_count	i_WGS_Norm_VAF	i_WGS_Norm_Var_count	i_WGS_Tum_Ref_count	i_WGS_Tum_VAF	i_WGS_Tum_Var_count	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_rs_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ZNF547	284306	genome.wustl.edu	37	19	57889153	57889153	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr19:57889153G>T	ENST00000282282.3	+	4	959	c.809G>T	c.(808-810)tGc>tTc	p.C270F	AC003002.4_ENST00000597658.1_Intron	NM_173631.2	NP_775902.2	Q8IVP9	ZN547_HUMAN	zinc finger protein 547	270					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	12		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CCTTATGGTTGCAGTGAATGT	0.418																																																	0								ENSG00000152433						131.0	119.0	123.0					19																	57889153		2203	4300	6503	ZNF547	SO:0001583	missense	0			-	HGNC	AK055662	CCDS33131.1	19q13.43	2013-01-08				ENSG00000152433		"""Zinc fingers, C2H2-type"", ""-"""	26432	protein-coding gene	gene with protein product							Standard	NM_173631		Approved	FLJ31100	uc002qol.3	Q8IVP9		ENST00000282282.3:c.809G>T	19.37:g.57889153G>T	ENSP00000282282:p.Cys270Phe	Somatic	0	112	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	65	19.75	A8K5Z9|Q96NC4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C270F	ENST00000282282.3	37	c.809	CCDS33131.1	19	.	.	.	.	.	.	.	.	.	.	G	17.44	3.389479	0.61956	.	.	ENSG00000152433	ENST00000391704;ENST00000282282	D	0.85088	-1.94	1.87	0.773	0.18516	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93792	0.8015	H	0.96365	3.81	0.21256	N	0.999747	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.84690	0.0722	9	0.87932	D	0	.	9.46	0.38778	0.0:0.2215:0.7784:0.0	.	270;270;270	Q8IVP9-2;C9JTQ3;Q8IVP9	.;.;ZN547_HUMAN	F	270	ENSP00000282282:C270F	ENSP00000282282:C270F	C	+	2	0	ZNF547	62580965	1.000000	0.71417	0.003000	0.11579	0.868000	0.49771	4.543000	0.60684	0.342000	0.23796	0.491000	0.48974	TGC	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZNF547-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF547	protein_coding	OTTHUMT00000465787.1	G	NM_173631	-		57889153	+1	no_errors	ENST00000282282	ensembl	human	known	74_37	missense	SNP	0.321	T
MSLNL	401827	genome.wustl.edu	37	16	824427	824427	+	Missense_Mutation	SNP	G	G	A	rs182148221	byFrequency	TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr16:824427G>A	ENST00000442466.1	-	7	760	c.761C>T	c.(760-762)gCg>gTg	p.A254V	MSLNL_ENST00000293892.3_Missense_Mutation_p.A605V			Q96KJ4	MSLNL_HUMAN	mesothelin-like	254					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(15)|ovary(2)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	36						CTGCACCTGCGCCCACAGGTG	0.721																																																	0								ENSG00000162006						10.0	12.0	12.0					16																	824427		1878	4074	5952	MSLNL	SO:0001583	missense	0			-	HGNC			16p13.3	2008-08-06	2008-07-04	2008-07-04	ENSG00000162006	ENSG00000162006			14170	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 37"""	C16orf37			Standard	NG_032123		Approved	MPFL		Q96KJ4		ENST00000442466.1:c.761C>T	16.37:g.824427G>A	ENSP00000415767:p.Ala254Val	Somatic	0	15	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	10	9	52.63		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Mesothelin	p.A605V	ENST00000442466.1	37	c.1814		16	.	.	.	.	.	.	.	.	.	.	G	6.418	0.445255	0.12164	.	.	ENSG00000162006	ENST00000543963;ENST00000442466;ENST00000293892	T;T;T	0.11495	2.77;2.77;2.77	4.35	-8.03	0.01114	.	1.416370	0.04549	N	0.389496	T	0.05364	0.0142	.	.	.	0.09310	N	1	B	0.19817	0.039	B	0.10450	0.005	T	0.38023	-0.9680	9	0.48119	T	0.1	-0.0712	1.2425	0.01966	0.1907:0.1203:0.3279:0.3611	.	254	Q96KJ4	MSLNL_HUMAN	V	304;254;605	ENSP00000441381:A304V;ENSP00000415767:A254V;ENSP00000293892:A605V	ENSP00000293892:A605V	A	-	2	0	MSLNL	764428	0.000000	0.05858	0.046000	0.18839	0.184000	0.23303	-1.369000	0.02578	-0.960000	0.03613	-0.390000	0.06520	GCG	-	pfam_Mesothelin		0.721	MSLNL-202	KNOWN	basic|appris_candidate	protein_coding	MSLNL	protein_coding		G	NM_001025190	-		824427	-1	no_errors	ENST00000293892	ensembl	human	known	74_37	missense	SNP	0.020	A
CCDC151	115948	genome.wustl.edu	37	19	11537380	11537380	+	Silent	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr19:11537380G>A	ENST00000356392.4	-	6	813	c.726C>T	c.(724-726)ctC>ctT	p.L242L	CCDC151_ENST00000586836.1_Silent_p.L51L|CCDC151_ENST00000545100.1_Silent_p.L188L|CCDC151_ENST00000591179.1_Silent_p.L182L	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	242										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						TCTCCAAGTTGAGGCTCTCGT	0.617																																																	0								ENSG00000198003						45.0	49.0	47.0					19																	11537380		2065	4213	6278	CCDC151	SO:0001819	synonymous_variant	0			-	HGNC		CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.726C>T	19.37:g.11537380G>A		Somatic	0	172	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	46	73	38.66	B4DXT0|Q96CG5	Silent	SNP	NA	NA	NA	NA	NA	NA	NULL	p.L242	ENST00000356392.4	37	c.726	CCDS42501.1	19																																																																																			-	NULL		0.617	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC151	protein_coding	OTTHUMT00000458800.1	G	NM_145045	-		11537380	-1	no_errors	ENST00000356392	ensembl	human	known	74_37	silent	SNP	0.012	A
PPP1R21	129285	genome.wustl.edu	37	2	48734478	48734478	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr2:48734478C>T	ENST00000294952.8	+	19	2196	c.2039C>T	c.(2038-2040)tCt>tTt	p.S680F	PPP1R21_ENST00000281394.4_Missense_Mutation_p.S669F|PPP1R21_ENST00000476199.1_3'UTR|PPP1R21_ENST00000449090.2_Missense_Mutation_p.S638F	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	680						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						GAACTTACGTCTCAGTTGCAG	0.383																																																	0								ENSG00000162869						162.0	145.0	151.0					2																	48734478		2203	4300	6503	PPP1R21	SO:0001583	missense	0			-	HGNC	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.2039C>T	2.37:g.48734478C>T	ENSP00000294952:p.Ser680Phe	Somatic	0	203	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	151	29.11	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KLRAQ/TTKRSYEDQ_C,pfam_Unchr_KLRAQ/TTKRSYEDQ_N,superfamily_Ferritin-like_SF	p.S680F	ENST00000294952.8	37	c.2039	CCDS46278.1	2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407072	0.83230	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.01	5.01	0.66863	.	0.049827	0.85682	D	0.000000	T	0.74604	0.3738	L	0.59436	1.845	0.50039	D	0.999847	D;D;D	0.58970	0.966;0.984;0.958	P;P;P	0.62184	0.69;0.899;0.563	T	0.72814	-0.4179	9	0.40728	T	0.16	-12.3636	18.8654	0.92290	0.0:1.0:0.0:0.0	.	638;680;669	E1B6W7;Q6ZMI0;Q6ZMI0-2	.;PPR21_HUMAN;.	F	669;680;638	.	ENSP00000281394:S669F	S	+	2	0	KLRAQ1	48587982	0.998000	0.40836	0.423000	0.26634	0.964000	0.63967	7.045000	0.76585	2.751000	0.94390	0.655000	0.94253	TCT	-	pfam_KLRAQ/TTKRSYEDQ_C		0.383	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R21	protein_coding	OTTHUMT00000251238.4	C	NM_152994	-		48734478	+1	no_errors	ENST00000294952	ensembl	human	known	74_37	missense	SNP	0.923	T
PRRC2A	7916	genome.wustl.edu	37	6	31599565	31599565	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr6:31599565C>T	ENST00000376033.2	+	16	3349	c.3115C>T	c.(3115-3117)Cgg>Tgg	p.R1039W	PRRC2A_ENST00000376007.4_Missense_Mutation_p.R1039W	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1039	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						GAGGGGTTTTCGGGGGACCTA	0.632																																																	0								ENSG00000204469						12.0	16.0	14.0					6																	31599565		1504	2701	4205	PRRC2A	SO:0001583	missense	0			-	HGNC	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3115C>T	6.37:g.31599565C>T	ENSP00000365201:p.Arg1039Trp	Somatic	1	161	0.61		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	38	110	25.68	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_BAT2_N	p.R1039W	ENST00000376033.2	37	c.3115	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	C	10.48	1.361179	0.24684	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.02345	4.33;4.33	5.04	4.1	0.47936	.	0.000000	0.46758	D	0.000277	T	0.07234	0.0183	L	0.55213	1.73	0.47123	D	0.999328	D	0.89917	1.0	D	0.87578	0.998	T	0.07214	-1.0784	10	0.87932	D	0	-6.3657	14.7418	0.69461	0.1542:0.8458:0.0:0.0	.	1039	P48634	PRC2A_HUMAN	W	1039;1028;1039;1039;264	ENSP00000365175:R1039W;ENSP00000365201:R1039W	ENSP00000365175:R1039W	R	+	1	2	PRRC2A	31707544	0.952000	0.32445	1.000000	0.80357	0.998000	0.95712	0.562000	0.23531	2.640000	0.89533	0.655000	0.94253	CGG	-	NULL		0.632	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	protein_coding	OTTHUMT00000259319.1	C	NM_080686	-		31599565	+1	no_errors	ENST00000376007	ensembl	human	known	74_37	missense	SNP	1.000	T
PLCD3	113026	genome.wustl.edu	37	17	43196223	43196223	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr17:43196223C>T	ENST00000322765.5	-	5	985	c.872G>A	c.(871-873)cGc>cAc	p.R291H	PLCD3_ENST00000540511.1_5'UTR	NM_133373.3	NP_588614.1	Q8N3E9	PLCD3_HUMAN	phospholipase C, delta 3	291					angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(2)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)|stomach(2)|urinary_tract(2)	17						CTGCTGGGCGCGGGCCAGTGT	0.652																																																	0								ENSG00000161714						17.0	21.0	20.0					17																	43196223		1970	4118	6088	PLCD3	SO:0001583	missense	0			-	HGNC	AC002117	CCDS74077.1	17q21	2012-04-20			ENSG00000161714	ENSG00000161714	3.1.4.11		9061	protein-coding gene	gene with protein product		608795				10702670, 9056492	Standard	NM_133373		Approved		uc002iib.3	Q8N3E9	OTTHUMG00000168029	ENST00000322765.5:c.872G>A	17.37:g.43196223C>T	ENSP00000313731:p.Arg291His	Somatic	0	104	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	24	83	22.22	Q8TEC1|Q8TF37|Q96FL6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_C2_dom,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.R291H	ENST00000322765.5	37	c.872		17	.	.	.	.	.	.	.	.	.	.	C	8.304	0.820624	0.16678	.	.	ENSG00000161714	ENST00000322765	T	0.17370	2.28	3.77	-3.8	0.04307	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);EF-hand-like domain (1);	0.377362	0.26696	N	0.022970	T	0.06462	0.0166	.	.	.	0.09310	N	0.999992	B	0.11235	0.004	B	0.10450	0.005	T	0.36407	-0.9749	9	0.14252	T	0.57	.	6.5418	0.22385	0.1203:0.5167:0.0:0.363	.	291	Q8N3E9	PLCD3_HUMAN	H	291	ENSP00000313731:R291H	ENSP00000313731:R291H	R	-	2	0	PLCD3	40551749	0.000000	0.05858	0.532000	0.27989	0.769000	0.43574	-0.235000	0.09016	-0.634000	0.05538	0.462000	0.41574	CGC	-	pfam_PLipase_C_EF-hand-like		0.652	PLCD3-201	KNOWN	basic|appris_principal	protein_coding	PLCD3	protein_coding		C	NM_133373	-		43196223	-1	no_errors	ENST00000322765	ensembl	human	known	74_37	missense	SNP	0.405	T
RP11-764K9.1	0	genome.wustl.edu	37	9	68400679	68400680	+	lincRNA	INS	-	-	AGCTA	rs370189578		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr9:68400679_68400680insAGCTA	ENST00000417843.2	-	0	1139_1140																											aagcagagctggcaaatagtta	0.421																																																	0								ENSG00000225411																																			RP11-764K9.1			0				Clone_based_vega_gene																													9.37:g.68400679_68400680insAGCTA		Somatic	NA	NA	NA		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			-	-		0.421	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	lincRNA	OTTHUMT00000129817.2	-				68400680	-1	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	INS	0.017:0.017	AGCTA
FHL1	2273	genome.wustl.edu	37	X	135291453	135291453	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chrX:135291453C>A	ENST00000345434.3	+	6	821	c.740C>A	c.(739-741)cCc>cAc	p.P247H	FHL1_ENST00000535737.1_Intron|FHL1_ENST00000394155.2_Missense_Mutation_p.P247H|FHL1_ENST00000370676.3_Intron|FHL1_ENST00000370683.1_Intron|FHL1_ENST00000394153.2_Intron|FHL1_ENST00000543669.1_Intron|FHL1_ENST00000539015.1_Intron|FHL1_ENST00000370690.3_Intron			Q13642	FHL1_HUMAN	four and a half LIM domains 1	247					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					GCTAGGAAGCCCCCAGTGTGC	0.582											OREG0019943	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000022267						57.0	52.0	54.0					X																	135291453		1568	3582	5150	FHL1	SO:0001583	missense	0			-	HGNC	U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.740C>A	X.37:g.135291453C>A	ENSP00000071281:p.Pro247His	Somatic	0	62	0.00	1617	0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	27	32	45.76	B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.P247H	ENST00000345434.3	37	c.740	CCDS55507.1	X	.	.	.	.	.	.	.	.	.	.	c	10.43	1.348247	0.24426	.	.	ENSG00000022267	ENST00000394155;ENST00000345434	T;T	0.64991	-0.13;-0.13	3.85	3.85	0.44370	.	0.629993	0.16645	N	0.205463	T	0.37517	0.1006	N	0.08118	0	0.23632	N	0.997245	B	0.26445	0.149	B	0.17433	0.018	T	0.13176	-1.0519	10	0.23891	T	0.37	.	10.3036	0.43667	0.0:1.0:0.0:0.0	.	247	Q13642	FHL1_HUMAN	H	247	ENSP00000377710:P247H;ENSP00000071281:P247H	ENSP00000071281:P247H	P	+	2	0	FHL1	135119119	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.012000	0.49575	2.187000	0.69744	0.421000	0.28195	CCC	-	NULL		0.582	FHL1-002	KNOWN	basic|CCDS	protein_coding	FHL1	protein_coding	OTTHUMT00000058461.1	C	NM_001449	-		135291453	+1	no_errors	ENST00000345434	ensembl	human	known	74_37	missense	SNP	1.000	A
MAML3	55534	genome.wustl.edu	37	4	140641346	140641346	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr4:140641346C>T	ENST00000509479.2	-	5	3404	c.2548G>A	c.(2548-2550)Gca>Aca	p.A850T	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					TGCGCAGCTGCGGTGGCCATC	0.587																																																	0								ENSG00000196782						202.0	208.0	206.0					4																	140641346		2133	4253	6386	MAML3	SO:0001583	missense	0			-	HGNC	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.2548G>A	4.37:g.140641346C>T	ENSP00000421180:p.Ala850Thr	Somatic	0	68	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	14	80.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Neuroggenic_mastermind-like_N	p.A850T	ENST00000509479.2	37	c.2548	CCDS54805.1	4	.	.	.	.	.	.	.	.	.	.	C	0.702	-0.790350	0.02884	.	.	ENSG00000196782	ENST00000509479;ENST00000538400	T	0.24350	1.86	5.81	4.07	0.47477	.	0.319207	0.29480	N	0.012021	T	0.16557	0.0398	L	0.38838	1.175	0.50171	D	0.999853	B;B	0.13145	0.007;0.007	B;B	0.06405	0.002;0.002	T	0.08432	-1.0722	10	0.15066	T	0.55	.	6.5435	0.22392	0.256:0.6085:0.0:0.1355	.	850;846	E7EVW8;Q96JK9	.;MAML3_HUMAN	T	850;157	ENSP00000421180:A850T	ENSP00000421180:A850T	A	-	1	0	MAML3	140860796	0.164000	0.22935	0.033000	0.17914	0.055000	0.15305	0.521000	0.22893	0.773000	0.33404	0.655000	0.94253	GCA	-	NULL		0.587	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	protein_coding	OTTHUMT00000364934.2	C		-		140641346	-1	no_errors	ENST00000509479	ensembl	human	known	74_37	missense	SNP	0.170	T
CPSF7	79869	genome.wustl.edu	37	11	61188968	61188968	+	Missense_Mutation	SNP	C	C	T	rs200597857		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr11:61188968C>T	ENST00000394888.4	-	3	339	c.167G>A	c.(166-168)cGc>cAc	p.R56H	CPSF7_ENST00000340437.4_Missense_Mutation_p.R99H|CPSF7_ENST00000448745.1_Missense_Mutation_p.R56H|CPSF7_ENST00000439958.3_Missense_Mutation_p.R56H|CPSF7_ENST00000541963.1_Missense_Mutation_p.R56H	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	56					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						TGGCTCCTGGCGAACAGGAGG	0.522																																																	0								ENSG00000149532	C	HIS/ARG,HIS/ARG,HIS/ARG	0,4404		0,0,2202	216.0	184.0	195.0		167,167,296	5.7	1.0	11		195	3,8595	3.0+/-9.4	0,3,4296	yes	missense,missense,missense	CPSF7	NM_001136040.2,NM_001142565.1,NM_024811.3	29,29,29	0,3,6498	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging,probably-damaging,probably-damaging	56/472,56/463,99/515	61188968	3,12999	2202	4299	6501	CPSF7	SO:0001583	missense	0			-	HGNC		CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.167G>A	11.37:g.61188968C>T	ENSP00000378352:p.Arg56His	Somatic	0	200	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	68	102	40.00	B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R99H	ENST00000394888.4	37	c.296	CCDS44619.1	11	.	.	.	.	.	.	.	.	.	.	C	20.1	3.939512	0.73557	0.0	3.49E-4	ENSG00000149532	ENST00000340437;ENST00000394888;ENST00000439958;ENST00000448745;ENST00000477890;ENST00000539952;ENST00000544585;ENST00000413232;ENST00000541963;ENST00000450000;ENST00000449811;ENST00000413184	T;T;T	0.44482	0.92;0.92;0.92	5.68	5.68	0.88126	Nucleotide-binding, alpha-beta plait (1);	0.377447	0.29152	N	0.012989	T	0.53514	0.1801	L	0.36672	1.1	0.46874	D	0.999231	D;D;D;D	0.76494	0.999;0.998;0.997;0.997	D;P;P;P	0.63033	0.91;0.865;0.818;0.818	T	0.48875	-0.8996	10	0.45353	T	0.12	.	17.5851	0.87979	0.0:1.0:0.0:0.0	.	56;56;99;56	F5H1W4;Q8N684;Q8N684-3;Q8N684-2	.;CPSF7_HUMAN;.;.	H	99;56;56;56;56;56;56;56;56;56;56;56	ENSP00000391359:R56H;ENSP00000392400:R56H;ENSP00000414295:R56H	ENSP00000345412:R99H	R	-	2	0	CPSF7	60945544	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	3.047000	0.49854	2.679000	0.91253	0.650000	0.86243	CGC	-	NULL		0.522	CPSF7-006	KNOWN	basic|CCDS	protein_coding	CPSF7	protein_coding	OTTHUMT00000347835.2	C	NM_024811	rs200597857		61188968	-1	no_errors	ENST00000340437	ensembl	human	known	74_37	missense	SNP	1.000	T
GSPT2	23708	genome.wustl.edu	37	X	51486909	51486909	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chrX:51486909G>A	ENST00000340438.4	+	1	429	c.187G>A	c.(187-189)Gta>Ata	p.V63I		NM_018094.4	NP_060564.2	Q8IYD1	ERF3B_HUMAN	G1 to S phase transition 2	63					cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational termination (GO:0006415)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Ovarian(276;0.236)					CGTGCCTAACGTACACGCCGC	0.692																																																	0								ENSG00000189369						37.0	34.0	35.0					X																	51486909		2201	4300	6501	GSPT2	SO:0001583	missense	0			-	HGNC	AI285711	CCDS14336.1	Xp11.22	2008-05-14			ENSG00000189369	ENSG00000189369			4622	protein-coding gene	gene with protein product		300418				10575220	Standard	NM_018094		Approved	eRF3b, FLJ10441	uc004dpl.3	Q8IYD1	OTTHUMG00000021538	ENST00000340438.4:c.187G>A	X.37:g.51486909G>A	ENSP00000341247:p.Val63Ile	Somatic	1	131	0.76		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	35	56	38.46	Q9H909|Q9NVY0|Q9NY44	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Ataxin-2_C,superfamily_P-loop_NTPase,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_B-barrel,prints_EF_GTP-bd_dom	p.V63I	ENST00000340438.4	37	c.187	CCDS14336.1	X	.	.	.	.	.	.	.	.	.	.	G	15.83	2.949538	0.53186	.	.	ENSG00000189369	ENST00000340438	T	0.35236	1.32	3.63	2.76	0.32466	Ataxin-2, C-terminal (1);	0.000000	0.64402	D	0.000001	T	0.27731	0.0682	L	0.47016	1.485	0.50632	D	0.999889	B	0.27882	0.192	B	0.24974	0.057	T	0.05903	-1.0857	10	0.31617	T	0.26	-0.2274	8.5224	0.33285	0.1214:0.0:0.8786:0.0	.	63	Q8IYD1	ERF3B_HUMAN	I	63	ENSP00000341247:V63I	ENSP00000341247:V63I	V	+	1	0	GSPT2	51503649	1.000000	0.71417	0.818000	0.32626	0.990000	0.78478	3.390000	0.52523	0.915000	0.36847	0.519000	0.50382	GTA	-	pfam_Ataxin-2_C		0.692	GSPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSPT2	protein_coding	OTTHUMT00000056587.1	G		-		51486909	+1	no_errors	ENST00000340438	ensembl	human	known	74_37	missense	SNP	0.998	A
KIF19	124602	genome.wustl.edu	37	17	72346862	72346862	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr17:72346862T>A	ENST00000389916.4	+	12	1543	c.1405T>A	c.(1405-1407)Tcc>Acc	p.S469T		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	469					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GCATGAGAAGTCCCGCCGGGC	0.612																																																	0								ENSG00000196169						51.0	51.0	51.0					17																	72346862		2203	4300	6503	KIF19	SO:0001583	missense	0			-	HGNC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.1405T>A	17.37:g.72346862T>A	ENSP00000374566:p.Ser469Thr	Somatic	0	169	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	72	88	43.64	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.S469T	ENST00000389916.4	37	c.1405	CCDS32718.2	17	.	.	.	.	.	.	.	.	.	.	t	6.617	0.482314	0.12581	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	T;T	0.73897	-0.79;-0.54	5.75	2.06	0.26882	.	.	.	.	.	T	0.57007	0.2024	L	0.31420	0.93	0.21553	N	0.999644	B;B;B;B	0.15141	0.011;0.012;0.0;0.0	B;B;B;B	0.17098	0.017;0.007;0.002;0.002	T	0.37888	-0.9686	9	0.13470	T	0.59	.	6.1932	0.20536	0.2718:0.0:0.3687:0.3595	.	469;427;427;469	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	T	427;469	ENSP00000449134:S427T;ENSP00000374566:S469T	ENSP00000374566:S469T	S	+	1	0	KIF19	69858457	0.696000	0.27757	0.923000	0.36655	0.023000	0.10783	0.854000	0.27791	0.419000	0.25927	-0.462000	0.05337	TCC	-	NULL		0.612	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	protein_coding	OTTHUMT00000319644.2	T	NM_153209	-		72346862	+1	no_errors	ENST00000389916	ensembl	human	known	74_37	missense	SNP	0.594	A
PTEN	5728	genome.wustl.edu	37	10	89685305	89685305	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr10:89685305T>A	ENST00000371953.3	+	3	1557	c.200T>A	c.(199-201)aTa>aAa	p.I67K		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	67	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		I -> R (in CWS1).		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(6)|p.R55fs*1(5)|p.Y27fs*1(2)|p.I67K(1)|p.I67T(1)|p.I67del(1)|p.V54fs*29(1)|p.I67R(1)|p.R55_L70>S(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CATTACAAGATATACAATCTG	0.279		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																													yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	57	Whole gene deletion(37)|Deletion - Frameshift(9)|Unknown(6)|Substitution - Missense(3)|Deletion - In frame(1)|Complex - deletion inframe(1)	prostate(16)|central_nervous_system(13)|skin(7)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|endometrium(3)|ovary(3)|urinary_tract(2)|breast(2)|stomach(1)|soft_tissue(1)	GRCh37	CM981666	PTEN	M		ENSG00000171862						40.0	42.0	41.0					10																	89685305		2184	4274	6458	PTEN	SO:0001583	missense	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	-	HGNC	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.200T>A	10.37:g.89685305T>A	ENSP00000361021:p.Ile67Lys	Somatic	0	166	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	104	29	78.20	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_dom,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.I67K	ENST00000371953.3	37	c.200	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	T	25.4	4.630510	0.87660	.	.	ENSG00000171862	ENST00000371953	D	0.98777	-5.13	5.46	5.46	0.80206	Phosphatase tensin type (1);	0.000000	0.85682	D	0.000000	D	0.99336	0.9767	H	0.94771	3.58	0.80722	D	1	D	0.76494	0.999	D	0.68483	0.958	D	0.98725	1.0710	9	.	.	.	-11.9292	15.5246	0.75894	0.0:0.0:0.0:1.0	.	67	P60484	PTEN_HUMAN	K	67	ENSP00000361021:I67K	.	I	+	2	0	PTEN	89675285	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.448000	0.80631	2.072000	0.62099	0.533000	0.62120	ATA	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Phosphatase_tensin-typ		0.279	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	protein_coding	OTTHUMT00000049241.1	T	NM_000314	-		89685305	+1	no_errors	ENST00000371953	ensembl	human	known	74_37	missense	SNP	1.000	A
SYK	6850	genome.wustl.edu	37	9	93624510	93624510	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr9:93624510G>A	ENST00000375754.4	+	4	749	c.601G>A	c.(601-603)Ggc>Agc	p.G201S	SYK_ENST00000375747.1_Missense_Mutation_p.G201S|SYK_ENST00000375746.1_Missense_Mutation_p.G201S|SYK_ENST00000375751.4_Missense_Mutation_p.G201S	NM_003177.5	NP_003168.2	P43405	KSYK_HUMAN	spleen tyrosine kinase	201	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of JUN kinase activity (GO:0007257)|adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|B cell receptor signaling pathway (GO:0050853)|beta selection (GO:0043366)|blood coagulation (GO:0007596)|blood vessel morphogenesis (GO:0048514)|cell proliferation (GO:0008283)|cellular response to molecule of fungal origin (GO:0071226)|defense response to bacterium (GO:0042742)|enzyme linked receptor protein signaling pathway (GO:0007167)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte activation involved in immune response (GO:0002366)|leukocyte cell-cell adhesion (GO:0007159)|leukotriene biosynthetic process (GO:0019370)|lymph vessel development (GO:0001945)|macrophage activation involved in immune response (GO:0002281)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of bone resorption (GO:0045780)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of arachidonic acid secretion (GO:0090237)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of neutrophil degranulation (GO:0043313)|regulation of phagocytosis (GO:0050764)|regulation of platelet activation (GO:0010543)|regulation of platelet aggregation (GO:0090330)|regulation of superoxide anion generation (GO:0032928)|serotonin secretion by platelet (GO:0002554)|viral process (GO:0016032)	B cell receptor complex (GO:0019815)|cytosol (GO:0005829)|early phagosome (GO:0032009)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|integrin binding (GO:0005178)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)|skin(2)|stomach(2)	26						AGACAACAACGGCTCCTACGC	0.597			T	"""ETV6, ITK"""	"""MDS, peripheral T-cell lymphoma"""																																			Dom	yes		9	9q22	6850	spleen tyrosine kinase		L	0								ENSG00000165025						93.0	71.0	78.0					9																	93624510		2203	4300	6503	SYK	SO:0001583	missense	0			-	HGNC	L28824	CCDS6688.1, CCDS47992.1	9q22	2013-02-14			ENSG00000165025	ENSG00000165025		"""SH2 domain containing"""	11491	protein-coding gene	gene with protein product		600085				8082894, 1423621	Standard	XM_005252147		Approved		uc004aqz.3	P43405	OTTHUMG00000020200	ENST00000375754.4:c.601G>A	9.37:g.93624510G>A	ENSP00000364907:p.Gly201Ser	Somatic	0	127	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	78	79	49.37		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,superfamily_Kinase-like_dom,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.G201S	ENST00000375754.4	37	c.601	CCDS6688.1	9	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986427	0.93044	.	.	ENSG00000165025	ENST00000375754;ENST00000375751;ENST00000375747;ENST00000375746	D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42	4.89	4.89	0.63831	SH2 motif (5);	0.108919	0.64402	D	0.000007	D	0.96303	0.8794	M	0.86420	2.815	0.80722	D	1	P;P;D	0.62365	0.831;0.946;0.991	B;P;P	0.51193	0.264;0.521;0.662	D	0.96976	0.9712	10	0.72032	D	0.01	.	16.9994	0.86378	0.0:0.0:1.0:0.0	.	201;201;201	P43405-2;P43405;C3W981	.;KSYK_HUMAN;.	S	201	ENSP00000364907:G201S;ENSP00000364904:G201S;ENSP00000364899:G201S;ENSP00000364898:G201S	ENSP00000364898:G201S	G	+	1	0	SYK	92664331	1.000000	0.71417	0.953000	0.39169	0.915000	0.54546	5.282000	0.65615	2.555000	0.86185	0.643000	0.83706	GGC	-	pfam_SH2,smart_SH2,pirsf_Tyr_kinase_non-rcpt_SYK/ZAP70,pfscan_SH2,prints_SH2		0.597	SYK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYK	protein_coding	OTTHUMT00000053018.1	G		-		93624510	+1	no_errors	ENST00000375746	ensembl	human	known	74_37	missense	SNP	1.000	A
RTL1	388015	genome.wustl.edu	37	14	101348435	101348435	+	Silent	SNP	G	G	A	rs531913473	byFrequency	TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr14:101348435G>A	ENST00000534062.1	-	1	2749	c.2691C>T	c.(2689-2691)acC>acT	p.T897T	MIR432_ENST00000606207.1_RNA|MIR433_ENST00000384837.1_RNA|MIR127_ENST00000384876.1_RNA|MIR431_ENST00000385266.1_RNA|MIR136_ENST00000385207.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	897					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						CTCTCTTGCCGGTTTGGTCGT	0.582																																																	0								ENSG00000254656						32.0	30.0	31.0					14																	101348435		692	1591	2283	RTL1	SO:0001819	synonymous_variant	0			-	HGNC		CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2691C>T	14.37:g.101348435G>A		Somatic	1	133	0.75		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	62	31.11	E9PKS8	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.T897	ENST00000534062.1	37	c.2691	CCDS53910.1	14																																																																																			-	NULL		0.582	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	protein_coding	OTTHUMT00000395127.1	G	NM_001134888	-		101348435	-1	no_errors	ENST00000534062	ensembl	human	known	74_37	silent	SNP	0.000	A
DCAF8L2	347442	genome.wustl.edu	37	X	27765400	27765408	+	In_Frame_Del	DEL	GAGGAGGAG	GAGGAGGAG	-	rs371896121		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	GAGGAGGAG	GAGGAGGAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chrX:27765400_27765408delGAGGAGGAG	ENST00000451261.2	+	5	787_795	c.388_396delGAGGAGGAG	c.(388-396)gaggaggagdel	p.EEE145del		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	145	Glu-rich.			Missing (in Ref. 1; AAI57860). {ECO:0000305}.						central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						ggaggaggaagaggaggaggaggaggagg	0.56														2184	0.578543	0.5855	0.3213	3775	,	,		4069	0.4018		0.4026	False		,,,				2504	0.3855																0								ENSG00000189186																																			DCAF8L2	SO:0001651	inframe_deletion	0				HGNC		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.388_396delGAGGAGGAG	X.37:g.27765409_27765417delGAGGAGGAG	ENSP00000462745:p.Glu145_Glu147del	Somatic	NA	NA	NA		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RXH9|J3KT06	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.EEE133in_frame_del	ENST00000451261.2	37	c.388_396	CCDS59162.1	X																																																																																			-	NULL		0.560	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	protein_coding	OTTHUMT00000056143.4	GAGGAGGAG	XM_293354			27765408	+1	no_errors	ENST00000451261	ensembl	human	known	74_37	in_frame_del	DEL	0.007:0.003:0.002:0.002:0.001:0.000:0.000:0.000:0.000	-
PCDH12	51294	genome.wustl.edu	37	5	141335172	141335172	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr5:141335172C>T	ENST00000231484.3	-	1	3455	c.2245G>A	c.(2245-2247)Gcc>Acc	p.A749T	AC005740.6_ENST00000607378.1_RNA|PCDH12_ENST00000512221.1_5'Flank	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	749					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGTTGTAGGCCCTGTTGTCC	0.572																																																	0								ENSG00000113555						69.0	60.0	63.0					5																	141335172		2203	4300	6503	PCDH12	SO:0001583	missense	0			-	HGNC	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2245G>A	5.37:g.141335172C>T	ENSP00000231484:p.Ala749Thr	Somatic	0	76	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	6	55	9.84	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A749T	ENST00000231484.3	37	c.2245	CCDS4269.1	5	.	.	.	.	.	.	.	.	.	.	C	13.86	2.362786	0.41902	.	.	ENSG00000113555	ENST00000231484	T	0.52983	0.64	4.9	4.9	0.64082	.	0.058951	0.64402	D	0.000002	T	0.48909	0.1526	M	0.66939	2.045	0.45634	D	0.998565	D	0.56035	0.974	P	0.47673	0.554	T	0.41088	-0.9528	10	0.22706	T	0.39	.	10.6323	0.45543	0.1912:0.8088:0.0:0.0	.	749	Q9NPG4	PCD12_HUMAN	T	749	ENSP00000231484:A749T	ENSP00000231484:A749T	A	-	1	0	PCDH12	141315356	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	2.888000	0.48594	2.571000	0.86741	0.561000	0.74099	GCC	-	NULL		0.572	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH12	protein_coding	OTTHUMT00000251858.1	C	NM_016580	-		141335172	-1	no_errors	ENST00000231484	ensembl	human	known	74_37	missense	SNP	1.000	T
DDX41	51428	genome.wustl.edu	37	5	176938889	176938889	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr5:176938889C>T	ENST00000507955.1	-	17	2295	c.1772G>A	c.(1771-1773)cGg>cAg	p.R591Q	DOK3_ENST00000501403.2_5'Flank|DOK3_ENST00000357198.4_5'Flank|DOK3_ENST00000377112.4_5'Flank|DOK3_ENST00000312943.6_5'Flank	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	591					apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			GTCAGTGATCCGATGACCCAG	0.622																																																	0								ENSG00000183258						86.0	81.0	82.0					5																	176938889		2203	4300	6503	DDX41	SO:0001583	missense	0			-	HGNC	AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.1772G>A	5.37:g.176938889C>T	ENSP00000422753:p.Arg591Gln	Somatic	0	87	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	49	53	48.04	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Znf_CCHC,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R591Q	ENST00000507955.1	37	c.1772	CCDS4427.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.234815	0.95207	.	.	ENSG00000183258	ENST00000330503;ENST00000507955	T;T	0.76316	-1.01;-1.01	5.89	4.11	0.48088	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (1);	0.121727	0.56097	N	0.000021	D	0.89399	0.6704	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	D	0.90578	0.4527	10	0.87932	D	0	-15.4515	12.4707	0.55785	0.0:0.8643:0.0:0.1357	.	591	Q9UJV9	DDX41_HUMAN	Q	609;591	ENSP00000330349:R609Q;ENSP00000422753:R591Q	ENSP00000330349:R609Q	R	-	2	0	DDX41	176871495	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	7.306000	0.78905	0.827000	0.34685	0.655000	0.94253	CGG	-	superfamily_Znf_CCHC		0.622	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX41	protein_coding	OTTHUMT00000253432.2	C	NM_016222	-		176938889	-1	no_errors	ENST00000507955	ensembl	human	known	74_37	missense	SNP	0.999	T
CFAP45	25790	genome.wustl.edu	37	1	159846347	159846347	+	Splice_Site	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr1:159846347G>A	ENST00000368099.4	-	10	1415	c.1351C>T	c.(1351-1353)Cgg>Tgg	p.R451W	CCDC19_ENST00000426543.2_Splice_Site_p.R366W|CCDC19_ENST00000476696.1_5'UTR	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			CCCTCCTACCGAAGAATCCTC	0.532																																																	0								ENSG00000213085						74.0	71.0	72.0					1																	159846347		2203	4300	6503	CCDC19	SO:0001630	splice_region_variant	0			-	HGNC																												ENST00000368099.4:c.1352+1C>T	1.37:g.159846347G>A		Somatic	1	109	0.91		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	56	18	75.68		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R451W	ENST00000368099.4	37	c.1351	CCDS30914.1	1	.	.	.	.	.	.	.	.	.	.	g	20.2	3.949467	0.73787	.	.	ENSG00000213085	ENST00000368099;ENST00000426543	T;T	0.10477	2.87;2.87	5.16	3.18	0.36537	.	0.325231	0.34046	N	0.004306	T	0.19604	0.0471	M	0.77820	2.39	0.42943	D	0.99435	D	0.89917	1.0	D	0.85130	0.997	T	0.00149	-1.1987	9	.	.	.	-20.446	7.2612	0.26203	0.0:0.1555:0.555:0.2895	.	451	Q9UL16	CCD19_HUMAN	W	451;366	ENSP00000357079:R451W;ENSP00000403044:R366W	.	R	-	1	2	CCDC19	158112971	0.986000	0.35501	1.000000	0.80357	0.953000	0.61014	0.904000	0.28491	2.571000	0.86741	0.486000	0.48141	CGG	-	NULL		0.532	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC19	protein_coding	OTTHUMT00000085979.1	G		-	Missense_Mutation	159846347	-1	no_errors	ENST00000368099	ensembl	human	known	74_37	missense	SNP	1.000	A
IDO1	3620	genome.wustl.edu	37	8	39776355	39776355	+	Missense_Mutation	SNP	G	G	C			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr8:39776355G>C	ENST00000518237.1	+	4	964	c.325G>C	c.(325-327)Gtt>Ctt	p.V109L	IDO1_ENST00000522495.1_Missense_Mutation_p.V109L|RP11-44K6.4_ENST00000522970.1_RNA|RP11-44K6.3_ENST00000517623.1_RNA	NM_002164.5	NP_002155.1	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	109					cellular nitrogen compound metabolic process (GO:0034641)|cytokine production involved in inflammatory response (GO:0002534)|female pregnancy (GO:0007565)|kynurenic acid biosynthetic process (GO:0034276)|multicellular organismal response to stress (GO:0033555)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response (GO:0002678)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of type 2 immune response (GO:0002830)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|swimming behavior (GO:0036269)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytosol (GO:0005829)|smooth muscle contractile fiber (GO:0030485)|stereocilium bundle (GO:0032421)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)	p.V109F(1)		central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(2)	12					L-Tryptophan(DB00150)|Melatonin(DB01065)	AAATATTGCTGTTCCTTACTG	0.343																																																	1	Substitution - Missense(1)	endometrium(1)						ENSG00000131203						103.0	102.0	102.0					8																	39776355		1871	4101	5972	IDO1	SO:0001583	missense	0			-	HGNC	M34455	CCDS47847.1	8p12-p11	2009-01-07	2009-01-07	2009-01-07		ENSG00000131203	1.13.11.52		6059	protein-coding gene	gene with protein product		147435	"""indoleamine-pyrrole 2,3 dioxygenase"""	IDO, INDO		2109605, 8404046	Standard	NM_002164		Approved		uc003xnm.3	P14902		ENST00000518237.1:c.325G>C	8.37:g.39776355G>C	ENSP00000430950:p.Val109Leu	Somatic	0	174	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	83	27.83	Q540B4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Indolamine_dOase	p.V109L	ENST00000518237.1	37	c.325	CCDS47847.1	8	.	.	.	.	.	.	.	.	.	.	G	14.02	2.409673	0.42715	.	.	ENSG00000131203	ENST00000519154;ENST00000522495;ENST00000518237	T;T;T	0.46063	0.88;0.88;0.88	5.85	-7.17	0.01511	.	1.068660	0.07252	N	0.866132	T	0.45617	0.1351	L	0.61218	1.895	0.29693	N	0.840762	P	0.42375	0.778	B	0.42245	0.381	T	0.53056	-0.8492	9	.	.	.	-7.6856	22.4628	0.99972	0.1181:0.0:0.8819:0.0	.	109	P14902	I23O1_HUMAN	L	109	ENSP00000428716:V109L;ENSP00000430505:V109L;ENSP00000430950:V109L	.	V	+	1	0	IDO1	39895512	0.000000	0.05858	0.241000	0.24154	0.905000	0.53344	-0.585000	0.05794	-1.634000	0.01537	-0.484000	0.04775	GTT	-	pfam_Indolamine_dOase		0.343	IDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDO1	protein_coding	OTTHUMT00000376987.1	G	NM_002164	-		39776355	+1	no_errors	ENST00000518237	ensembl	human	known	74_37	missense	SNP	0.461	C
AK9	221264	genome.wustl.edu	37	6	109996917	109996917	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr6:109996917G>A	ENST00000424296.2	-	2	108	c.32C>T	c.(31-33)cCt>cTt	p.P11L	AK9_ENST00000285397.5_Missense_Mutation_p.P11L|AK9_ENST00000341338.6_5'UTR|AK9_ENST00000368948.2_Missense_Mutation_p.P11L	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	11					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)	p.P11H(2)									ATCTGCAAAAGGATACTCTTC	0.328																																																	2	Substitution - Missense(2)	large_intestine(2)						ENSG00000155085						63.0	66.0	65.0					6																	109996917		2203	4294	6497	AK9	SO:0001583	missense	0			-	HGNC	AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.32C>T	6.37:g.109996917G>A	ENSP00000410186:p.Pro11Leu	Somatic	0	204	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	101	161	38.55	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Adenylate_kin,pfam_YHS_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P11L	ENST00000424296.2	37	c.32	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099706	0.76983	.	.	ENSG00000155085	ENST00000424296;ENST00000368948;ENST00000285397;ENST00000532976	T;T;T;T	0.72051	-0.46;-0.62;-0.35;-0.43	5.15	5.15	0.70609	.	0.224630	0.46145	D	0.000301	T	0.64638	0.2616	M	0.61703	1.905	0.80722	D	1	P;P	0.50443	0.493;0.935	B;P	0.44990	0.234;0.466	T	0.66500	-0.5908	9	.	.	.	-9.2772	17.768	0.88484	0.0:0.0:1.0:0.0	.	11;11	Q5TCS8-2;Q5TCS8	.;AKD1_HUMAN	L	11	ENSP00000410186:P11L;ENSP00000357944:P11L;ENSP00000285397:P11L;ENSP00000436325:P11L	.	P	-	2	0	AKD1	110103610	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	6.012000	0.70767	2.567000	0.86603	0.591000	0.81541	CCT	-	NULL		0.328	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AK9	protein_coding		G	NM_001145128	-		109996917	-1	no_errors	ENST00000424296	ensembl	human	known	74_37	missense	SNP	0.999	A
AHNAK	79026	genome.wustl.edu	37	11	62294150	62294150	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr11:62294150G>A	ENST00000378024.4	-	5	8013	c.7739C>T	c.(7738-7740)tCc>tTc	p.S2580F	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2580					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				GTCAGGCATGGAGATCTTGGG	0.483																																																	0								ENSG00000124942						205.0	210.0	208.0					11																	62294150		2202	4299	6501	AHNAK	SO:0001583	missense	0			-	HGNC	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.7739C>T	11.37:g.62294150G>A	ENSP00000367263:p.Ser2580Phe	Somatic	0	345	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	249	10.11	A1A586	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S2580F	ENST00000378024.4	37	c.7739	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	g	16.42	3.117379	0.56505	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.02301	4.35	4.66	4.66	0.58398	.	.	.	.	.	T	0.21509	0.0518	H	0.96889	3.9	0.35522	D	0.801516	D	0.71674	0.998	D	0.80764	0.994	T	0.53613	-0.8414	9	0.72032	D	0.01	-10.1704	15.3664	0.74526	0.0:0.0:1.0:0.0	.	2580	Q09666	AHNK_HUMAN	F	669;2580	ENSP00000367263:S2580F	ENSP00000244934:S669F	S	-	2	0	AHNAK	62050726	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	2.664000	0.46783	2.142000	0.66516	0.479000	0.44913	TCC	-	NULL		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	protein_coding	OTTHUMT00000395572.1	G	NM_024060	-		62294150	-1	no_errors	ENST00000378024	ensembl	human	known	74_37	missense	SNP	1.000	A
MUC16	94025	genome.wustl.edu	37	19	9076876	9076876	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr19:9076876C>T	ENST00000397910.4	-	3	10773	c.10570G>A	c.(10570-10572)Gaa>Aaa	p.E3524K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	3525	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGCTCACTTCCGCAGGAGAT	0.517																																																	0								ENSG00000181143						219.0	208.0	212.0					19																	9076876		2125	4220	6345	MUC16	SO:0001583	missense	0			-	HGNC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.10570G>A	19.37:g.9076876C>T	ENSP00000381008:p.Glu3524Lys	Somatic	0	265	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	79	112	41.36	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.E3524K	ENST00000397910.4	37	c.10570	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	6.386	0.439332	0.12104	.	.	ENSG00000181143	ENST00000397910	T	0.02682	4.2	1.76	-0.5	0.12012	.	.	.	.	.	T	0.01695	0.0054	N	0.08118	0	.	.	.	B	0.20052	0.041	B	0.23574	0.047	T	0.42344	-0.9457	8	0.87932	D	0	.	4.1325	0.10156	0.0:0.6006:0.0:0.3994	.	3524	B5ME49	.	K	3524	ENSP00000381008:E3524K	ENSP00000381008:E3524K	E	-	1	0	MUC16	8937876	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-0.026000	0.12392	-0.070000	0.12908	0.313000	0.20887	GAA	-	NULL		0.517	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	protein_coding	OTTHUMT00000402806.1	C	NM_024690	-		9076876	-1	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	SNP	0.000	T
VPS51	738	genome.wustl.edu	37	11	64877351	64877351	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr11:64877351G>A	ENST00000279281.3	+	7	1926	c.1834G>A	c.(1834-1836)Gtc>Atc	p.V612I	TM7SF2_ENST00000279263.7_5'Flank|TM7SF2_ENST00000540748.1_5'Flank|VPS51_ENST00000527646.1_3'UTR|AP003068.9_ENST00000528887.1_RNA|TM7SF2_ENST00000345348.5_5'Flank	NM_013265.2	NP_037397.2	Q9UID3	VPS51_HUMAN	vacuolar protein sorting 51 homolog (S. cerevisiae)	612					autophagy (GO:0006914)|lipid transport (GO:0006869)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)											TGTGCGGGCCGTCATGAAGCG	0.652																																																	0								ENSG00000149823						30.0	33.0	32.0					11																	64877351		2199	4297	6496	VPS51	SO:0001583	missense	0			-	HGNC	AF024631	CCDS8093.1	11q13.1	2012-07-19	2012-07-19	2012-07-19	ENSG00000149823	ENSG00000149823			1172	protein-coding gene	gene with protein product	"""fat-free homolog (zebrafish)"""	615738	"""chromosome 11 open reading frame 3"", ""chromosome 11 open reading frame 2"""	C11orf3, C11orf2		9286704, 20685960	Standard	NM_013265		Approved	ANG2, ANG3, FFR	uc001ocr.2	Q9UID3	OTTHUMG00000165600	ENST00000279281.3:c.1834G>A	11.37:g.64877351G>A	ENSP00000279281:p.Val612Ile	Somatic	0	162	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	48	35	57.83	Q6PJV5|Q7L8A6|Q8WZ35|Q96DF4|Q96GR3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_COG8,pfam_Vacuolar_sorting-assoc_54,pfam_COG_su2_N,pfam_RZZ-complex_Zw10,superfamily_Cullin_repeat-like_dom	p.V612I	ENST00000279281.3	37	c.1834	CCDS8093.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.318506	0.95682	.	.	ENSG00000149823	ENST00000279281	.	.	.	4.9	4.9	0.64082	.	0.061993	0.64402	D	0.000004	T	0.79616	0.4476	M	0.82132	2.575	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.81059	-0.1104	9	0.51188	T	0.08	-4.6496	15.6121	0.76733	0.0:0.0:1.0:0.0	.	612	Q9UID3	FFR_HUMAN	I	612	.	ENSP00000279281:V612I	V	+	1	0	C11orf2	64633927	1.000000	0.71417	0.998000	0.56505	0.838000	0.47535	9.118000	0.94355	2.544000	0.85801	0.484000	0.47621	GTC	-	NULL		0.652	VPS51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS51	protein_coding	OTTHUMT00000385217.1	G	NM_013265	-		64877351	+1	no_errors	ENST00000279281	ensembl	human	known	74_37	missense	SNP	1.000	A
BCL11A	53335	genome.wustl.edu	37	2	60688425	60688425	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr2:60688425C>T	ENST00000335712.6	-	4	1849	c.1622G>A	c.(1621-1623)cGc>cAc	p.R541H	BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000356842.4_Missense_Mutation_p.R541H|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000538214.1_Missense_Mutation_p.R507H|BCL11A_ENST00000358510.4_Missense_Mutation_p.R507H|BCL11A_ENST00000537768.1_Missense_Mutation_p.R210H	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	541					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			GGGCAGGGCGCGGCTCTCGTC	0.701			T	IGH@	B-CLL																																			Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	0								ENSG00000119866						16.0	16.0	16.0					2																	60688425		2192	4280	6472	BCL11A	SO:0001583	missense	0			-	HGNC	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1622G>A	2.37:g.60688425C>T	ENSP00000338774:p.Arg541His	Somatic	0	22	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	12	7	63.16	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R541H	ENST00000335712.6	37	c.1622	CCDS1862.1	2	.	.	.	.	.	.	.	.	.	.	C	0.571	-0.841169	0.02692	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.09163	3.01;3.28;3.18;3.29;3.22	5.46	4.59	0.56863	.	3.037560	0.01050	N	0.004455	T	0.28466	0.0704	L	0.54323	1.7	0.53688	D	0.999979	D;P;P;D;D	0.76494	0.998;0.874;0.53;0.999;0.999	P;B;B;P;P	0.58013	0.831;0.116;0.231;0.769;0.769	T	0.00205	-1.1922	10	0.35671	T	0.21	-3.0723	12.1836	0.54226	0.0:0.9202:0.0:0.0798	.	507;210;507;541;541	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	H	541;566;507;210;541;507	ENSP00000349300:R541H;ENSP00000438303:R507H;ENSP00000443712:R210H;ENSP00000338774:R541H;ENSP00000351307:R507H	ENSP00000338774:R541H	R	-	2	0	BCL11A	60541929	0.998000	0.40836	0.966000	0.40874	0.038000	0.13279	3.505000	0.53356	1.313000	0.45069	-0.142000	0.14014	CGC	-	NULL		0.701	BCL11A-001	KNOWN	basic|CCDS	protein_coding	BCL11A	protein_coding	OTTHUMT00000251579.2	C	NM_022893	-		60688425	-1	no_errors	ENST00000335712	ensembl	human	known	74_37	missense	SNP	1.000	T
DCHS1	8642	genome.wustl.edu	37	11	6643466	6643466	+	Silent	SNP	C	C	G			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr11:6643466C>G	ENST00000299441.3	-	21	9852	c.9441G>C	c.(9439-9441)ctG>ctC	p.L3147L	RP11-732A19.5_ENST00000526456.1_RNA|TPP1_ENST00000528657.1_5'Flank|TPP1_ENST00000299427.6_5'Flank|TPP1_ENST00000533371.1_5'Flank|TPP1_ENST00000534644.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	3147					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAATGGCTGTCAGCGCACCTG	0.632																																																	0								ENSG00000166341						14.0	15.0	15.0					11																	6643466		2183	4265	6448	DCHS1	SO:0001819	synonymous_variant	0			-	HGNC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.9441G>C	11.37:g.6643466C>G		Somatic	0	83	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	47	12	79.66	O15098	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L3147	ENST00000299441.3	37	c.9441	CCDS7771.1	11																																																																																			-	NULL		0.632	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	protein_coding	OTTHUMT00000257258.1	C	NM_003737	-		6643466	-1	no_errors	ENST00000299441	ensembl	human	known	74_37	silent	SNP	0.998	G
GLIS1	148979	genome.wustl.edu	37	1	54060320	54060320	+	Missense_Mutation	SNP	C	C	T	rs375119770		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr1:54060320C>T	ENST00000312233.2	-	3	822	c.256G>A	c.(256-258)Gtc>Atc	p.V86I		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						ATGGAGGTGACGTCGGAGGAG	0.677																																																	0								ENSG00000174332	C	ILE/VAL	0,4366		0,0,2183	22.0	24.0	23.0		256	-2.7	0.0	1		23	2,8508		0,2,4253	no	missense	GLIS1	NM_147193.2	29	0,2,6436	TT,TC,CC		0.0235,0.0,0.0155	benign	86/621	54060320	2,12874	2183	4255	6438	GLIS1	SO:0001583	missense	0			-	HGNC	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.256G>A	1.37:g.54060320C>T	ENSP00000309653:p.Val86Ile	Somatic	0	160	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	110	129	45.83		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V86I	ENST00000312233.2	37	c.256	CCDS582.1	1	.	.	.	.	.	.	.	.	.	.	C	1.188	-0.636164	0.03557	0.0	2.35E-4	ENSG00000174332	ENST00000312233	T	0.06768	3.26	4.53	-2.72	0.05968	.	1.439070	0.04405	N	0.364996	T	0.03477	0.0100	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43065	-0.9414	10	0.02654	T	1	.	11.5804	0.50887	0.0:0.5575:0.0:0.4425	.	86	Q8NBF1	GLIS1_HUMAN	I	86	ENSP00000309653:V86I	ENSP00000309653:V86I	V	-	1	0	GLIS1	53832908	0.001000	0.12720	0.046000	0.18839	0.987000	0.75469	-0.105000	0.10907	-0.444000	0.07170	0.563000	0.77884	GTC	-	NULL		0.677	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS1	protein_coding	OTTHUMT00000022109.1	C	NM_147193	-		54060320	-1	no_errors	ENST00000312233	ensembl	human	known	74_37	missense	SNP	0.002	T
DUXAP8	503637	genome.wustl.edu	37	22	16150827	16150827	+	RNA	SNP	C	C	T	rs199764989		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr22:16150827C>T	ENST00000447898.1	-	0	1287																											GCTGGTGCCACTTTGTGTATC	0.438																																																	0								ENSG00000206195																																			AP000525.9			0			-	Clone_based_vega_gene																													22.37:g.16150827C>T		Somatic	0	12	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	6	40.00		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000447898.1	37	NULL		22																																																																																			-	-		0.438	AP000525.9-002	KNOWN	basic	lincRNA	ENSG00000206195	processed_transcript	OTTHUMT00000276780.1	C		rs199764989		16150827	-1	no_errors	ENST00000413768	ensembl	human	known	74_37	rna	SNP	0.027	T
SOX17	64321	genome.wustl.edu	37	8	55372529	55372529	+	Missense_Mutation	SNP	T	T	C			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr8:55372529T>C	ENST00000297316.4	+	2	1423	c.1219T>C	c.(1219-1221)Tat>Cat	p.Y407H		NM_022454.3	NP_071899.1	Q9H6I2	SOX17_HUMAN	SRY (sex determining region Y)-box 17	407	Sox C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00849}.				angiogenesis (GO:0001525)|canonical Wnt signaling pathway (GO:0060070)|cardiac cell fate determination (GO:0060913)|cardiogenic plate morphogenesis (GO:0003142)|cell migration involved in gastrulation (GO:0042074)|common bile duct development (GO:0061009)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cell differentiation (GO:0060956)|endocardium formation (GO:0060214)|endoderm formation (GO:0001706)|endodermal cell fate determination (GO:0007493)|endodermal digestive tract morphogenesis (GO:0061031)|gall bladder development (GO:0061010)|heart formation (GO:0060914)|heart looping (GO:0001947)|inner cell mass cellular morphogenesis (GO:0001828)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth (GO:0030308)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell differentiation (GO:0045597)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein destabilization (GO:0031648)|protein stabilization (GO:0050821)|regulation of cardiac cell fate specification (GO:2000043)|regulation of embryonic development (GO:0045995)|regulation of stem cell division (GO:2000035)|regulation of stem cell proliferation (GO:0072091)|regulation of transcription from RNA polymerase II promoter involved in definitive endodermal cell fate specification (GO:0060807)|regulation of transcription, DNA-templated (GO:0006355)|renal system development (GO:0072001)|rostrocaudal neural tube patterning (GO:0021903)|signal transduction involved in regulation of gene expression (GO:0023019)|spermatogenesis (GO:0007283)|stem cell fate specification (GO:0048866)|vasculogenesis (GO:0001570)	nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			endometrium(6)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)	18		Lung NSC(129;0.109)|all_epithelial(80;0.176)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;1.9e-07)|Epithelial(17;1.7e-05)|all cancers(17;0.000159)			CTCCGCGGTATATTACTGCAA	0.597																																																	0								ENSG00000164736						43.0	47.0	46.0					8																	55372529		2203	4300	6503	SOX17	SO:0001583	missense	0			-	HGNC	AB073988	CCDS6159.1	8q11.23	2014-09-04			ENSG00000164736	ENSG00000164736		"""SRY (sex determining region Y)-boxes"""	18122	protein-coding gene	gene with protein product		610928				11786926	Standard	NM_022454		Approved		uc003xsb.4	Q9H6I2	OTTHUMG00000164377	ENST00000297316.4:c.1219T>C	8.37:g.55372529T>C	ENSP00000297316:p.Tyr407His	Somatic	0	93	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	23	56	29.11		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Sox_C_TAD,pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.Y407H	ENST00000297316.4	37	c.1219	CCDS6159.1	8	.	.	.	.	.	.	.	.	.	.	T	22.7	4.325994	0.81580	.	.	ENSG00000164736	ENST00000297316	D	0.90788	-2.73	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.94941	0.8364	M	0.79011	2.435	0.47584	D	0.999466	D	0.89917	1.0	D	0.81914	0.995	D	0.95495	0.8572	10	0.87932	D	0	.	14.5265	0.67892	0.0:0.0:0.0:1.0	.	407	Q9H6I2	SOX17_HUMAN	H	407	ENSP00000297316:Y407H	ENSP00000297316:Y407H	Y	+	1	0	SOX17	55535082	1.000000	0.71417	0.946000	0.38457	0.901000	0.52897	7.544000	0.82117	2.035000	0.60131	0.528000	0.53228	TAT	-	pfam_Sox_C_TAD		0.597	SOX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX17	protein_coding	OTTHUMT00000378526.2	T		-		55372529	+1	no_errors	ENST00000297316	ensembl	human	known	74_37	missense	SNP	0.998	C
ZNF519	162655	genome.wustl.edu	37	18	14105364	14105364	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr18:14105364G>A	ENST00000590202.1	-	3	1327	c.1175C>T	c.(1174-1176)aCt>aTt	p.T392I	ZNF519_ENST00000589498.1_Intron|RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	392					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						CTGATGCTGAGTAACGTATGA	0.423																																																	0								ENSG00000175322						111.0	111.0	111.0					18																	14105364		2203	4300	6503	ZNF519	SO:0001583	missense	0			-	HGNC	BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.1175C>T	18.37:g.14105364G>A	ENSP00000464872:p.Thr392Ile	Somatic	0	104	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	62	62	50.00		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T392I	ENST00000590202.1	37	c.1175	CCDS32797.1	18	.	.	.	.	.	.	.	.	.	.	G	7.399	0.632409	0.14322	.	.	ENSG00000175322	ENST00000309305	.	.	.	0.646	-0.519	0.11939	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19167	0.0460	N	0.21324	0.655	0.09310	N	1	B	0.31790	0.34	B	0.28232	0.087	T	0.15464	-1.0436	8	0.40728	T	0.16	.	3.8367	0.08897	0.5839:0.0:0.4161:0.0	.	392	Q8TB69	ZN519_HUMAN	I	392	.	ENSP00000307908:T392I	T	-	2	0	ZNF519	14095364	0.000000	0.05858	0.175000	0.22980	0.502000	0.33828	-1.175000	0.03102	-0.192000	0.10432	0.089000	0.15464	ACT	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.423	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	protein_coding	OTTHUMT00000459037.1	G	NM_145287	-		14105364	-1	no_errors	ENST00000590202	ensembl	human	known	74_37	missense	SNP	0.000	A
GJD4	219770	genome.wustl.edu	37	10	35896211	35896212	+	Intron	INS	-	-	TGCTCT	rs374363365|rs112029096|rs374368221|rs56119205	byFrequency	TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr10:35896211_35896212insTGCTCT	ENST00000321660.1	+	2	222				RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa						cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						gaaCTACCTGATGCTGTGAGTA	0.426														4393	0.877196	0.6536	0.9395	5008	,	,		19886	0.9603		0.9801	False		,,,				2504	0.9438																0								ENSG00000273312																																			RP11-425A6.5	SO:0001627	intron_variant	0				Clone_based_vega_gene	AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.65-294->TGCTCT	10.37:g.35896211_35896212insTGCTCT		Somatic	NA	NA	NA		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	Q8N2R7	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000321660.1	37	NULL	CCDS7191.1	10																																																																																			-	-		0.426	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000273312	protein_coding	OTTHUMT00000047576.1	-	NM_153368			35896212	-1	no_errors	ENST00000609313	ensembl	human	known	74_37	rna	INS	0.000:0.000	TGCTCT
TM4SF1	4071	genome.wustl.edu	37	3	149093526	149093526	+	Missense_Mutation	SNP	G	G	T	rs11555560		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr3:149093526G>T	ENST00000305366.3	-	2	525	c.208C>A	c.(208-210)Ctg>Atg	p.L70M	TM4SF1-AS1_ENST00000484046.1_RNA|TM4SF1-AS1_ENST00000496491.1_RNA|TM4SF1_ENST00000472441.1_5'Flank	NM_014220.2	NP_055035.1	P30408	T4S1_HUMAN	transmembrane 4 L six family member 1	70						integral component of plasma membrane (GO:0005887)				endometrium(3)|large_intestine(1)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			TCCTGTTCCAGCCCAATGAAG	0.502																																																	0								ENSG00000169908						153.0	135.0	141.0					3																	149093526		2203	4300	6503	TM4SF1	SO:0001583	missense	0			-	HGNC	M90657	CCDS3143.1	3q21-q25	2005-03-21	2005-03-21		ENSG00000169908	ENSG00000169908			11853	protein-coding gene	gene with protein product		191155	"""transmembrane 4 superfamily member 1"""	M3S1		1565644	Standard	NM_014220		Approved	L6	uc003exb.1	P30408	OTTHUMG00000159597	ENST00000305366.3:c.208C>A	3.37:g.149093526G>T	ENSP00000304277:p.Leu70Met	Somatic	0	55	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	15	21	41.67	Q6IB51	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_L6_membrane	p.L70M	ENST00000305366.3	37	c.208	CCDS3143.1	3	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908318	0.52333	.	.	ENSG00000169908	ENST00000305366;ENST00000383054	T	0.34472	1.36	5.77	1.95	0.26073	.	0.113866	0.38605	N	0.001630	T	0.34513	0.0900	L	0.49571	1.57	0.80722	D	1	P	0.47604	0.898	P	0.47573	0.55	T	0.05484	-1.0882	10	0.49607	T	0.09	-4.5099	6.6614	0.23016	0.2525:0.0:0.6332:0.1143	.	70	P30408	T4S1_HUMAN	M	70	ENSP00000304277:L70M	ENSP00000304277:L70M	L	-	1	2	TM4SF1	150576216	0.877000	0.30153	0.322000	0.25334	0.979000	0.70002	1.190000	0.32126	0.350000	0.24002	0.655000	0.94253	CTG	-	pfam_L6_membrane		0.502	TM4SF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF1	protein_coding	OTTHUMT00000356368.1	G		-		149093526	-1	no_errors	ENST00000305366	ensembl	human	known	74_37	missense	SNP	0.536	T
DCHS1	8642	genome.wustl.edu	37	11	6653374	6653374	+	Silent	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr11:6653374G>A	ENST00000299441.3	-	6	3780	c.3369C>T	c.(3367-3369)agC>agT	p.S1123S	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1123	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCGGCCCACGCTGGTCCCTG	0.602																																																	0								ENSG00000166341						65.0	65.0	65.0					11																	6653374		2201	4295	6496	DCHS1	SO:0001819	synonymous_variant	0			-	HGNC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.3369C>T	11.37:g.6653374G>A		Somatic	0	107	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	59	13	80.82	O15098	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S1123	ENST00000299441.3	37	c.3369	CCDS7771.1	11																																																																																			-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.602	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS1	protein_coding	OTTHUMT00000257258.1	G	NM_003737	-		6653374	-1	no_errors	ENST00000299441	ensembl	human	known	74_37	silent	SNP	0.895	A
AP1AR	55435	genome.wustl.edu	37	4	113189426	113189439	+	Frame_Shift_Del	DEL	GGCTGGAGTGGGAA	GGCTGGAGTGGGAA	-			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	GGCTGGAGTGGGAA	GGCTGGAGTGGGAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr4:113189426_113189439delGGCTGGAGTGGGAA	ENST00000274000.5	+	10	1125_1138	c.770_783delGGCTGGAGTGGGAA	c.(769-783)gggctggagtgggaafs	p.GLEWE257fs	AP1AR_ENST00000309703.6_Frame_Shift_Del_p.GLEWE224fs	NM_018569.4	NP_061039.3	Q63HQ0	AP1AR_HUMAN	adaptor-related protein complex 1 associated regulatory protein	257					cellular protein localization (GO:0034613)|negative regulation of cell motility (GO:2000146)|negative regulation of receptor recycling (GO:0001920)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|vesicle targeting, trans-Golgi to endosome (GO:0048203)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|transport vesicle (GO:0030133)	AP-1 adaptor complex binding (GO:0035650)|kinesin binding (GO:0019894)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)	9						GATTCCAATGGGCTGGAGTGGGAAAATGATTTTG	0.407																																																	0								ENSG00000138660																																			AP1AR	SO:0001589	frameshift_variant	0				HGNC	AL136628	CCDS3696.1, CCDS47125.1	4q25	2009-09-28	2009-09-25	2009-09-25	ENSG00000138660	ENSG00000138660			28808	protein-coding gene	gene with protein product	"""gamma1-adaptin brefeldin A resistance"""	610851	"""chromosome 4 open reading frame 16"""	C4orf16		15775984	Standard	NM_018569		Approved	PRO0971, 2C18, gamma-BAR	uc003iaj.4	Q63HQ0	OTTHUMG00000132849	ENST00000274000.5:c.770_783delGGCTGGAGTGGGAA	4.37:g.113189426_113189439delGGCTGGAGTGGGAA	ENSP00000274000:p.Gly257fs	Somatic	NA	NA	NA		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RCV7|Q96GG6|Q9H0V0|Q9P1L4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	NULL	p.G257fs	ENST00000274000.5	37	c.770_783	CCDS3696.1	4																																																																																			-	NULL		0.407	AP1AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1AR	protein_coding	OTTHUMT00000256323.2	GGCTGGAGTGGGAA	NM_018569			113189439	+1	no_errors	ENST00000274000	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:0.976:0.999:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000	-
TP53	7157	genome.wustl.edu	37	17	7578213	7578213	+	Frame_Shift_Del	DEL	A	A	-			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr17:7578213delA	ENST00000269305.4	-	6	825	c.636delT	c.(634-636)tttfs	p.F212fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.F212fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.F212fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	212	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> I (in sporadic cancers; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in a sporadic cancer; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.F212fs*3(6)|p.?(5)|p.R213fs*35(3)|p.F212L(2)|p.D208fs*1(1)|p.R209_R213delRNTFR(1)|p.F119fs*3(1)|p.T211fs*28(1)|p.D207_R213delDDRNTFR(1)|p.D207_V216del10(1)|p.T211_S215delTFRHS(1)|p.F80fs*3(1)|p.R120fs*35(1)|p.R209fs*6(1)|p.R81fs*>11(1)|p.D208_V216delDRNTFRHSV(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACTATGTCGAAAAGTGTTTC	0.532		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	36	Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(5)|Unknown(5)|Substitution - Missense(2)	large_intestine(8)|upper_aerodigestive_tract(5)|biliary_tract(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|oesophagus(3)|central_nervous_system(2)|stomach(1)|soft_tissue(1)|liver(1)|lung(1)|breast(1)	GRCh37	CD011205	TP53	D		ENSG00000141510						134.0	120.0	125.0					17																	7578213		2203	4300	6503	TP53	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;		HGNC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.636delT	17.37:g.7578213delA	ENSP00000269305:p.Phe212fs	Somatic	0	121	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	94	31	75.20	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R213fs	ENST00000269305.4	37	c.636	CCDS11118.1	17																																																																																			-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.532	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	protein_coding	OTTHUMT00000367397.1	A	NM_000546			7578213	-1	no_errors	ENST00000269305	ensembl	human	known	74_37	frame_shift_del	DEL	0.000	-
HTATIP2	10553	genome.wustl.edu	37	11	20385381	20385382	+	In_Frame_Ins	INS	-	-	GCGGCG	rs566196056	byFrequency	TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr11:20385381_20385382insGCGGCG	ENST00000419348.2	+	1	93_94	c.24_25insGCGGCG	c.(25-27)gcg>GCGGCGgcg	p.9_9A>AAA	HTATIP2_ENST00000451739.2_5'UTR|HTATIP2_ENST00000443524.2_Intron|HTATIP2_ENST00000421577.2_Intron|HTATIP2_ENST00000530266.1_Intron|HTATIP2_ENST00000531058.1_5'Flank|HTATIP2_ENST00000532505.1_5'Flank|HTATIP2_ENST00000532081.1_5'Flank	NM_001098520.1	NP_001091990.1			HIV-1 Tat interactive protein 2, 30kDa											large_intestine(2)|lung(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	8						CGGCGCTGAGCGCGGCGGCGGC	0.752														48	0.00958466	0.0333	0.0029	5008	,	,		11513	0.002		0.0	False		,,,				2504	0.0																0								ENSG00000109854																																			HTATIP2	SO:0001652	inframe_insertion	0				HGNC	AF039103	CCDS7852.1, CCDS44553.1, CCDS53613.1	11p15.1	2011-09-14	2002-08-29		ENSG00000109854	ENSG00000109854	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	16637	protein-coding gene	gene with protein product	"""Tat-interacting protein (30kD)"", ""short chain dehydrogenase/reductase family 44U, member 1"""	605628	"""HIV-1 Tat interactive protein 2, 30 kDa"""			9482853, 9174052, 19027726	Standard	NM_006410		Approved	TIP30, CC3, FLJ26963, SDR44U1	uc001mpx.2	Q9BUP3	OTTHUMG00000166015	ENST00000419348.2:c.31_36dupGCGGCG	11.37:g.20385382_20385387dupGCGGCG	ENSP00000392985:p.AlaAla13dup	Somatic	NA	NA	NA		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA		In_Frame_Ins	INS	NA	NA	NA	NA	NA	NA	pfam_Semialdehyde_DH_NAD-bd	p.12in_frame_insAA	ENST00000419348.2	37	c.24_25	CCDS44553.1	11																																																																																			-	NULL		0.752	HTATIP2-001	KNOWN	basic|CCDS	protein_coding	HTATIP2	protein_coding	OTTHUMT00000387443.1	-	NM_001098521			20385382	+1	no_errors	ENST00000419348	ensembl	human	known	74_37	in_frame_ins	INS	0.320:0.178	GCGGCG
SRCAP	10847	genome.wustl.edu	37	16	30721935	30721935	+	Intron	SNP	T	T	C			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr16:30721935T>C	ENST00000262518.4	+	9	1519				SRCAP_ENST00000395059.2_Intron|SRCAP_ENST00000344771.4_Intron|SNORA30_ENST00000384028.1_RNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein						histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCCTTGATTGTATTCTTGCCC	0.478																																																	0								ENSG00000206755						110.0	94.0	99.0					16																	30721935		876	1991	2867	SNORA30	SO:0001627	intron_variant	0			-	HGNC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1135-140T>C	16.37:g.30721935T>C		Somatic	0	106	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	72	20.88	B0JZA6|O15026|Q7Z744|Q9Y5L9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262518.4	37	NULL	CCDS10689.2	16																																																																																			-	-		0.478	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA30	protein_coding	OTTHUMT00000255523.1	T	NM_006662	-		30721935	+1	no_errors	ENST00000384028	ensembl	human	known	74_37	rna	SNP	0.000	C
FRMPD1	22844	genome.wustl.edu	37	9	37744414	37744414	+	Silent	SNP	C	C	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr9:37744414C>A	ENST00000539465.1	+	16	2978	c.2385C>A	c.(2383-2385)ccC>ccA	p.P795P	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Silent_p.P795P			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	795						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		CTGCAGAACCCAGTGCCACAA	0.507																																																	0								ENSG00000070601						105.0	115.0	112.0					9																	37744414		2203	4300	6503	FRMPD1	SO:0001819	synonymous_variant	0			-	HGNC	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.2385C>A	9.37:g.37744414C>A		Somatic	0	207	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	106	171	38.27	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_FERM_central,pfam_PDZ,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.P795	ENST00000539465.1	37	c.2385	CCDS6612.1	9																																																																																			-	NULL		0.507	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FRMPD1	protein_coding	OTTHUMT00000402969.1	C	NM_014907	-		37744414	+1	no_errors	ENST00000377765	ensembl	human	known	74_37	silent	SNP	0.144	A
PSMC3IP	29893	genome.wustl.edu	37	17	40725008	40725008	+	Missense_Mutation	SNP	T	T	G			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr17:40725008T>G	ENST00000393795.3	-	8	740	c.632A>C	c.(631-633)aAc>aCc	p.N211T	MLX_ENST00000435881.2_3'UTR|PSMC3IP_ENST00000590760.1_Missense_Mutation_p.N86T|PSMC3IP_ENST00000253789.5_Missense_Mutation_p.N199T|MLX_ENST00000346833.4_3'UTR|PSMC3IP_ENST00000587209.1_Missense_Mutation_p.N148T|MLX_ENST00000246912.4_3'UTR	NM_001256015.1|NM_001256016.1|NM_016556.3	NP_001242944.1|NP_001242945.1|NP_057640.1	Q9P2W1	HOP2_HUMAN	PSMC3 interacting protein	211					DNA recombination (GO:0006310)|meiotic nuclear division (GO:0007126)|regulation of RNA biosynthetic process (GO:2001141)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			endometrium(2)|large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(2)	7		all_cancers(22;0.00426)|Breast(137;0.00116)|all_epithelial(22;0.0395)		BRCA - Breast invasive adenocarcinoma(366;0.13)		GAGTGTGACGTTGTAATCTTC	0.522																																																	0								ENSG00000131470						137.0	126.0	130.0					17																	40725008		2203	4300	6503	PSMC3IP	SO:0001583	missense	0			-	HGNC	AB030304, NM_013290, BC008792	CCDS11431.1, CCDS45688.1, CCDS59289.1	17q21.2	2012-04-10				ENSG00000131470		"""Proteasome (prosome, macropain) subunits"""	17928	protein-coding gene	gene with protein product	"""TBP-1 interacting protein"""	608665				7490091, 10806355, 11739747	Standard	NM_016556		Approved	TBPIP, GT198, HUMGT198A	uc002iai.3	Q9P2W1		ENST00000393795.3:c.632A>C	17.37:g.40725008T>G	ENSP00000377384:p.Asn211Thr	Somatic	0	79	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	28	50	35.90	C5ILB7|Q14458|Q8WXG2|Q96HA2	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_TBPIP,pfam_BlaI_family	p.N211T	ENST00000393795.3	37	c.632	CCDS45688.1	17	.	.	.	.	.	.	.	.	.	.	T	15.29	2.789391	0.49997	.	.	ENSG00000131470	ENST00000393795;ENST00000253789	T;T	0.45668	0.89;0.91	5.9	4.82	0.62117	.	0.342215	0.36815	N	0.002385	T	0.36441	0.0967	L	0.55481	1.735	0.09310	N	1	B;B	0.27853	0.191;0.072	B;B	0.29267	0.1;0.046	T	0.23976	-1.0173	10	0.36615	T	0.2	-11.1207	8.4787	0.33030	0.0:0.199:0.0:0.801	.	199;211	Q9P2W1-2;Q9P2W1	.;HOP2_HUMAN	T	211;199	ENSP00000377384:N211T;ENSP00000253789:N199T	ENSP00000253789:N199T	N	-	2	0	PSMC3IP	37978534	0.990000	0.36364	0.007000	0.13788	0.372000	0.29890	2.828000	0.48120	2.260000	0.74910	0.528000	0.53228	AAC	-	NULL		0.522	PSMC3IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMC3IP	protein_coding	OTTHUMT00000450427.1	T	NM_013290	-		40725008	-1	no_errors	ENST00000393795	ensembl	human	known	74_37	missense	SNP	0.040	G
USP27X	389856	genome.wustl.edu	37	X	49641821	49641821	+	5'Flank	SNP	C	C	G			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chrX:49641821C>G	ENST00000508866.2	+	0	0				USP27X-AS1_ENST00000437322.2_lincRNA	NM_001145073.1	NP_001138545.1	A6NNY8	UBP27_HUMAN	ubiquitin specific peptidase 27, X-linked						ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			endometrium(7)	7						ATTTTTCCCACGAGGACTACT	0.343											OREG0019777	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0								ENSG00000234390																																			USP27X-AS1	SO:0001631	upstream_gene_variant	0			-	HGNC	AW851065	CCDS65260.1	Xp11.23	2007-10-05	2005-08-08			ENSG00000273820		"""Ubiquitin-specific peptidases"""	13486	protein-coding gene	gene with protein product			"""ubiquitin specific protease 27, X chromosome"", ""ubiquitin specific protease 27, X-linked"""			12838346	Standard	NM_001145073		Approved	USP27	uc004dop.3	A6NNY8			X.37:g.49641821C>G	Exception_encountered	Somatic	0	39	0.00	963	0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	11	12	47.83		RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000508866.2	37	NULL		X																																																																																			-	-		0.343	USP27X-001	KNOWN	basic|appris_principal	protein_coding	USP27X-AS1	protein_coding	OTTHUMT00000060837.3	C	XM_372213	-		49641821	-1	no_errors	ENST00000437322	ensembl	human	known	74_37	rna	SNP	0.000	G
GCM1	8521	genome.wustl.edu	37	6	52993032	52993032	+	Missense_Mutation	SNP	A	A	G			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr6:52993032A>G	ENST00000259803.7	-	6	1494	c.1283T>C	c.(1282-1284)aTg>aCg	p.M428T	RP11-506E9.3_ENST00000566420.1_RNA	NM_003643.3	NP_003634.2	Q9NP62	GCM1_HUMAN	glial cells missing homolog 1 (Drosophila)	428					anatomical structure morphogenesis (GO:0009653)|astrocyte fate commitment (GO:0060018)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|cell differentiation involved in embryonic placenta development (GO:0060706)|positive regulation of syncytium formation by plasma membrane fusion (GO:0060143)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|skin(1)	24	Lung NSC(77;0.0755)					GTTCAGAAGCATATCATTGTT	0.433																																																	0								ENSG00000137270						182.0	184.0	183.0					6																	52993032		2203	4300	6503	GCM1	SO:0001583	missense	0			-	HGNC	D88613	CCDS4950.1	6p21-p12	2008-08-29	2001-11-28	2002-09-27	ENSG00000137270	ENSG00000137270			4197	protein-coding gene	gene with protein product		603715	"""glial cells missing (Drosophila) homolog a"""	GCMA		8962155	Standard	NM_003643		Approved	hGCMa	uc003pbp.3	Q9NP62	OTTHUMG00000014871	ENST00000259803.7:c.1283T>C	6.37:g.52993032A>G	ENSP00000259803:p.Met428Thr	Somatic	0	79	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	68	42.37	Q4VAQ7|Q5T0X0|Q99468|Q9P1X3	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tscrpt_reg_GCM_motif,superfamily_Tscrpt_reg_GCM_motif,pfscan_Tscrpt_reg_GCM_motif	p.M428T	ENST00000259803.7	37	c.1283	CCDS4950.1	6	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.124119	0.00342	.	.	ENSG00000137270	ENST00000259803	T	0.73789	-0.78	5.82	0.569	0.17340	.	0.324027	0.31312	N	0.007874	T	0.30541	0.0768	N	0.20986	0.625	0.27007	N	0.964777	B	0.17852	0.024	B	0.10450	0.005	T	0.06607	-1.0817	10	0.25106	T	0.35	-21.5481	2.4929	0.04615	0.6084:0.1281:0.1399:0.1235	.	428	Q9NP62	GCM1_HUMAN	T	428	ENSP00000259803:M428T	ENSP00000259803:M428T	M	-	2	0	GCM1	53100991	0.194000	0.23325	0.981000	0.43875	0.009000	0.06853	0.624000	0.24462	1.046000	0.40249	0.533000	0.62120	ATG	-	NULL		0.433	GCM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCM1	protein_coding	OTTHUMT00000040953.1	A		-		52993032	-1	no_errors	ENST00000259803	ensembl	human	known	74_37	missense	SNP	0.761	G
MAP3K7CL	56911	genome.wustl.edu	37	21	30505648	30505648	+	Intron	SNP	G	G	A	rs570708356		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr21:30505648G>A	ENST00000399947.2	+	7	647				MAP3K7CL_ENST00000399926.1_5'UTR|MAP3K7CL_ENST00000545939.1_Intron|MAP3K7CL_ENST00000399928.1_5'UTR|MAP3K7CL_ENST00000399935.2_5'UTR|MAP3K7CL_ENST00000399934.1_5'UTR|MAP3K7CL_ENST00000341618.4_Intron|MAP3K7CL_ENST00000339024.4_5'UTR|MAP3K7CL_ENST00000286791.5_Missense_Mutation_p.R131Q|MAP3K7CL_ENST00000399925.1_5'UTR	NM_020152.2	NP_064537.1	P57077	M3KCL_HUMAN	MAP3K7 C-terminal like							cytosol (GO:0005829)|nucleus (GO:0005634)											AGGAGAAGGCGGAGGCTCAGG	0.537													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17181	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000156265																																			MAP3K7CL	SO:0001627	intron_variant	0			-	HGNC	AF269161	CCDS13584.1, CCDS68182.1, CCDS74775.1	21q22.3	2013-02-22	2013-02-22	2013-02-22	ENSG00000156265	ENSG00000156265			16457	protein-coding gene	gene with protein product		611110	"""chromosome 21 open reading frame 7"""	C21orf7			Standard	NM_020152		Approved	TAKL, TAK1L, TAKL-1, TAKL-2, TAKL-4	uc002ynf.3	P57077	OTTHUMG00000078806	ENST00000399947.2:c.371-15862G>A	21.37:g.30505648G>A		Somatic	0	110	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	74	96	43.53	D3DSE0|Q8TCL9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	NULL	p.R131Q	ENST00000399947.2	37	c.392	CCDS13584.1	21	.	.	.	.	.	.	.	.	.	.	G	7.776	0.708403	0.15239	.	.	ENSG00000156265	ENST00000286791	T	0.52057	0.68	4.36	-0.859	0.10685	.	.	.	.	.	T	0.48537	0.1505	.	.	.	0.50171	D	0.999854	.	.	.	.	.	.	T	0.47824	-0.9087	6	0.87932	D	0	.	4.5265	0.11983	0.3365:0.1806:0.4068:0.0761	.	.	.	.	Q	131	ENSP00000286791:R131Q	ENSP00000286791:R131Q	R	+	2	0	C21orf7	29427519	0.938000	0.31826	0.023000	0.16930	0.309000	0.27889	0.228000	0.17814	-0.377000	0.07930	-2.563000	0.00173	CGG	-	NULL		0.537	MAP3K7CL-001	KNOWN	basic|CCDS	protein_coding	MAP3K7CL	protein_coding	OTTHUMT00000171865.2	G	NM_020152	-		30505648	+1	no_errors	ENST00000286791	ensembl	human	known	74_37	missense	SNP	0.025	A
XKR7	343702	genome.wustl.edu	37	20	30584527	30584527	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr20:30584527G>T	ENST00000562532.2	+	3	1181	c.1007G>T	c.(1006-1008)tGg>tTg	p.W336L		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	336						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			GTGGCCCACTGGTGCGTCATG	0.572																																																	0								ENSG00000260903						89.0	77.0	81.0					20																	30584527		2203	4300	6503	XKR7	SO:0001583	missense	0			-	HGNC	AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.1007G>T	20.37:g.30584527G>T	ENSP00000477059:p.Trp336Leu	Somatic	0	73	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	44	12	78.57	Q9NUG5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Transport_prot_XK	p.W336L	ENST00000562532.2	37	c.1007	CCDS33459.1	20	.	.	.	.	.	.	.	.	.	.	g	22.1	4.250348	0.80024	.	.	ENSG00000101321	ENST00000217299	T	0.67345	-0.26	4.89	4.89	0.63831	.	0.060671	0.64402	D	0.000001	D	0.84929	0.5581	M	0.91459	3.21	0.80722	D	1	D	0.71674	0.998	D	0.69654	0.965	D	0.87905	0.2693	10	0.54805	T	0.06	.	17.408	0.87479	0.0:0.0:1.0:0.0	.	336	Q5GH72	XKR7_HUMAN	L	336	ENSP00000217299:W336L	ENSP00000217299:W336L	W	+	2	0	XKR7	30048188	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.866000	0.99616	2.427000	0.82271	0.556000	0.70494	TGG	-	pfam_Transport_prot_XK		0.572	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	protein_coding	OTTHUMT00000078597.3	G	NM_001011718	-		30584527	+1	no_errors	ENST00000562532	ensembl	human	known	74_37	missense	SNP	1.000	T
SCN5A	6331	genome.wustl.edu	37	3	38592282	38592282	+	Missense_Mutation	SNP	C	C	A	rs199473636		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr3:38592282C>A	ENST00000333535.4	-	28	5730	c.5581G>T	c.(5581-5583)Gtc>Ttc	p.V1861F	SCN5A_ENST00000451551.2_Missense_Mutation_p.V1807F|SCN5A_ENST00000443581.1_Missense_Mutation_p.V1860F|SCN5A_ENST00000413689.1_Missense_Mutation_p.V1861F|SCN5A_ENST00000449557.2_Missense_Mutation_p.V1807F|SCN5A_ENST00000423572.2_Missense_Mutation_p.V1860F|SCN5A_ENST00000455624.2_Missense_Mutation_p.V1828F|SCN5A_ENST00000414099.2_Missense_Mutation_p.V1843F|SCN5A_ENST00000425664.1_Missense_Mutation_p.V1843F|SCN5A_ENST00000450102.2_Missense_Mutation_p.V1807F|SCN5A_ENST00000464652.1_5'Flank			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1861	Interaction with FGF13.				AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TCCCCCAGGACCCTTTTGGTG	0.562																																																	0								ENSG00000183873						139.0	147.0	144.0					3																	38592282		2064	4212	6276	SCN5A	SO:0001583	missense	0			-	HGNC	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5581G>T	3.37:g.38592282C>A	ENSP00000328968:p.Val1861Phe	Somatic	1	265	0.38		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	84	111	43.08	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.V1861F	ENST00000333535.4	37	c.5581	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733430	0.69189	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96940	-4.04;-4.06;-4.06;-4.14;-4.06;-4.04;-4.06;-4.18;-4.14;-4.14	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.97511	0.9185	L	0.61218	1.895	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.998;0.998;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.995;0.993;0.996;0.998;1.0;0.999	D	0.96791	0.9582	10	0.32370	T	0.25	.	18.0868	0.89460	0.0:1.0:0.0:0.0	.	1807;1828;1843;1861;1860;1861	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	F	1843;1860;1861;1807;1860;1843;1861;1828;1807;1807	ENSP00000398962:V1843F;ENSP00000398266:V1860F;ENSP00000410257:V1861F;ENSP00000388797:V1807F;ENSP00000397915:V1860F;ENSP00000416634:V1843F;ENSP00000328968:V1861F;ENSP00000399524:V1828F;ENSP00000403355:V1807F;ENSP00000413996:V1807F	ENSP00000328968:V1861F	V	-	1	0	SCN5A	38567286	1.000000	0.71417	0.999000	0.59377	0.810000	0.45777	7.646000	0.83445	2.504000	0.84457	0.563000	0.77884	GTC	-	NULL		0.562	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	protein_coding	OTTHUMT00000377958.1	C	NM_198056	-		38592282	-1	no_errors	ENST00000333535	ensembl	human	known	74_37	missense	SNP	1.000	A
SSBP3	23648	genome.wustl.edu	37	1	54691919	54691920	+	IGR	INS	-	-	GAA	rs149942557|rs376690110|rs10625539	byFrequency	TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr1:54691919_54691920insGAA	ENST00000371320.3	-	0	2077				SSBP3_ENST00000326956.7_5'UTR	NM_145716.2	NP_663768.1	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3						head morphogenesis (GO:0060323)|hematopoietic progenitor cell differentiation (GO:0002244)|midbrain-hindbrain boundary initiation (GO:0021547)|positive regulation of anterior head development (GO:2000744)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prechordal plate formation (GO:0021501)|protein complex assembly (GO:0006461)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|protein complex (GO:0043234)	single-stranded DNA binding (GO:0003697)			central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	11						GAGAGGAGGAGGGTGTCCTGGG	0.658														2209	0.441094	0.528	0.3934	5008	,	,		14635	0.3085		0.4304	False		,,,				2504	0.5051																0								ENSG00000157216																																			SSBP3	SO:0001628	intergenic_variant	0				HGNC		CCDS590.1, CCDS591.1, CCDS30726.1	1p32.3	2008-02-05	2001-11-28		ENSG00000157216	ENSG00000157216			15674	protein-coding gene	gene with protein product		607390	"""single-stranded DNA-binding protein 3"""			12079286	Standard	NM_145716		Approved	CSDP, SSDP, FLJ10355, SSDP1	uc001cxe.4	Q9BWW4	OTTHUMG00000008264		1.37:g.54691919_54691920insGAA		Somatic	0	10	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	5	6	45.45	A8K0A9|Q5T860|Q5T861|Q9BTM0|Q9BWW3	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000371320.3	37	NULL	CCDS591.1	1																																																																																			-	-		0.658	SSBP3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SSBP3	protein_coding	OTTHUMT00000022721.1	-	NM_018070			54691920	-1	no_errors	ENST00000326956	ensembl	human	known	74_37	rna	INS	0.706:0.379	GAA
DOCK1	1793	genome.wustl.edu	37	10	129231688	129231688	+	Missense_Mutation	SNP	G	G	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr10:129231688G>T	ENST00000280333.6	+	48	5102	c.4993G>T	c.(4993-4995)Gac>Tac	p.D1665Y		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1665					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.D1665Y(1)		NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		ACCAGGCTCCGACGGGTGAGT	0.597																																																	1	Substitution - Missense(1)	central_nervous_system(1)						ENSG00000150760						55.0	59.0	58.0					10																	129231688		1986	4159	6145	DOCK1	SO:0001583	missense	0			-	HGNC	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4993G>T	10.37:g.129231688G>T	ENSP00000280333:p.Asp1665Tyr	Somatic	0	142	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	76	16	82.61	A9Z1Z5	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DOCK_C,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,superfamily_Cyt_c-like_dom,smart_SH3_domain,pfscan_SH3_domain	p.D1665Y	ENST00000280333.6	37	c.4993		10	.	.	.	.	.	.	.	.	.	.	G	18.58	3.654812	0.67472	.	.	ENSG00000150760	ENST00000280333	T	0.03951	3.75	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.20740	0.0499	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.75020	0.965;0.985;0.965	T	0.00148	-1.1989	10	0.62326	D	0.03	.	18.5284	0.90981	0.0:0.0:1.0:0.0	.	1665;1731;1665	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	Y	1665	ENSP00000280333:D1665Y	ENSP00000280333:D1665Y	D	+	1	0	DOCK1	129121678	1.000000	0.71417	0.870000	0.34147	0.505000	0.33919	8.850000	0.92190	2.605000	0.88082	0.655000	0.94253	GAC	-	NULL		0.597	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	DOCK1	protein_coding	OTTHUMT00000050979.2	G	NM_001380	-		129231688	+1	no_errors	ENST00000280333	ensembl	human	known	74_37	missense	SNP	0.999	T
ARHGEF7	8874	genome.wustl.edu	37	13	111955453	111955453	+	Missense_Mutation	SNP	A	A	G			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr13:111955453A>G	ENST00000218789.5	+	21	2608	c.2111A>G	c.(2110-2112)aAt>aGt	p.N704S	ARHGEF7_ENST00000375736.4_Missense_Mutation_p.N645S|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.N730S|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.N645S|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.N720S			Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	0					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			GATGAGACCAATCTATAAGGG	0.517																																																	0								ENSG00000102606						83.0	82.0	82.0					13																	111955453		2203	4300	6503	ARHGEF7	SO:0001583	missense	0			-	HGNC	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000218789.5:c.2111A>G	13.37:g.111955453A>G	ENSP00000218789:p.Asn704Ser	Somatic	0	79	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	52	12	81.25	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_CH-domain,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CH-domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain	p.N730S	ENST00000218789.5	37	c.2189		13	.	.	.	.	.	.	.	.	.	.	A	12.13	1.845265	0.32606	.	.	ENSG00000102606	ENST00000370623;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737	T;T;T;T;T	0.55760	0.5;0.51;0.51;0.51;0.53	5.06	5.06	0.68205	.	.	.	.	.	T	0.41166	0.1147	L	0.29908	0.895	0.80722	D	1	B	0.20459	0.045	B	0.23574	0.047	T	0.23404	-1.0189	9	0.15499	T	0.54	.	14.8349	0.70175	1.0:0.0:0.0:0.0	.	720	B7Z6G2	.	S	730;704;645;645;720	ENSP00000359657:N730S;ENSP00000218789:N704S;ENSP00000364888:N645S;ENSP00000397068:N645S;ENSP00000364889:N720S	ENSP00000218789:N704S	N	+	2	0	ARHGEF7	110753454	1.000000	0.71417	0.946000	0.38457	0.230000	0.25150	8.430000	0.90283	1.904000	0.55121	0.459000	0.35465	AAT	-	NULL		0.517	ARHGEF7-001	NOVEL	basic	protein_coding	ARHGEF7	protein_coding	OTTHUMT00000045805.3	A	NM_001113511	-		111955453	+1	no_errors	ENST00000370623	ensembl	human	known	74_37	missense	SNP	1.000	G
CDKN2D	1032	genome.wustl.edu	37	19	10677946	10677946	+	Missense_Mutation	SNP	C	C	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr19:10677946C>A	ENST00000393599.2	-	2	613	c.289G>T	c.(289-291)Ggg>Tgg	p.G97W	KRI1_ENST00000361821.5_5'Flank|KRI1_ENST00000537964.1_5'Flank|KRI1_ENST00000312962.6_5'Flank|CDKN2D_ENST00000335766.2_Missense_Mutation_p.G97W	NM_001800.3|NM_079421.2	NP_001791.1|NP_524145.1	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)	97					autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to retinoic acid (GO:0032526)|response to UV (GO:0009411)|response to vitamin D (GO:0033280)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)			endometrium(3)|lung(2)|ovary(1)	6			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			ACATCAGCCCCGTGCTCCACT	0.597																																																	0								ENSG00000129355						139.0	124.0	129.0					19																	10677946		2203	4300	6503	CDKN2D	SO:0001583	missense	0			-	HGNC		CCDS12244.1	19p13	2013-01-10				ENSG00000129355		"""Ankyrin repeat domain containing"""	1790	protein-coding gene	gene with protein product		600927				8575754	Standard	NM_079421		Approved	INK4D, p19	uc002mpa.3	P55273		ENST00000393599.2:c.289G>T	19.37:g.10677946C>A	ENSP00000377224:p.Gly97Trp	Somatic	0	67	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	47	27.69	Q13102|Q6FGE9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G97W	ENST00000393599.2	37	c.289	CCDS12244.1	19	.	.	.	.	.	.	.	.	.	.	c	17.85	3.489391	0.64074	.	.	ENSG00000129355	ENST00000335766;ENST00000393599	T;T	0.73469	-0.75;-0.75	4.96	3.93	0.45458	Ankyrin repeat-containing domain (3);	0.059626	0.64402	D	0.000003	D	0.89818	0.6825	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.91859	0.5498	10	0.87932	D	0	-13.7951	12.0037	0.53246	0.0:0.9138:0.0:0.0862	.	97	P55273	CDN2D_HUMAN	W	97	ENSP00000337056:G97W;ENSP00000377224:G97W	ENSP00000337056:G97W	G	-	1	0	CDKN2D	10538946	0.996000	0.38824	0.130000	0.21974	0.783000	0.44284	4.183000	0.58317	1.082000	0.41137	0.462000	0.41574	GGG	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.597	CDKN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN2D	protein_coding	OTTHUMT00000452030.1	C	NM_079421	-		10677946	-1	no_errors	ENST00000335766	ensembl	human	known	74_37	missense	SNP	0.998	A
POM121C	100101267	genome.wustl.edu	37	7	75044036	75044036	+	IGR	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr7:75044036C>T	ENST00000257665.5	-	0	5700				NSUN5P1_ENST00000393633.2_RNA			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C						mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						actgcGGATCCCGGATTCCCT	0.507																																																	0								ENSG00000223705																																			NSUN5P1	SO:0001628	intergenic_variant	0			-	HGNC		CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238		7.37:g.75044036C>T		Somatic	0	45	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	42	10	80.77	O75115|Q9Y2N3|Q9Y4S7	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000257665.5	37	NULL		7																																																																																			-	-		0.507	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	NSUN5P1	protein_coding	OTTHUMT00000343919.2	C	NM_001099415	-		75044036	+1	no_errors	ENST00000393633	ensembl	human	known	74_37	rna	SNP	0.037	T
RB1	5925	genome.wustl.edu	37	13	49039415	49039415	+	Frame_Shift_Del	DEL	T	T	-			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr13:49039415delT	ENST00000267163.4	+	23	2538	c.2400delT	c.(2398-2400)cctfs	p.P800fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	800	Domain C; mediates interaction with E4F1.|Interaction with LIMD1.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(11)|p.L797fs*1(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TACGGATTCCTGGAGGGAACA	0.418		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																													yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	27	Whole gene deletion(15)|Unknown(11)|Deletion - Frameshift(1)	bone(11)|haematopoietic_and_lymphoid_tissue(4)|breast(4)|adrenal_gland(1)|eye(1)|soft_tissue(1)|endometrium(1)|urinary_tract(1)|lung(1)|ovary(1)|liver(1)						ENSG00000139687						115.0	116.0	115.0					13																	49039415		2203	4300	6503	RB1	SO:0001589	frameshift_variant	0	Familial Cancer Database			HGNC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.2400delT	13.37:g.49039415delT	ENSP00000267163:p.Pro800fs	Somatic	0	85	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	32	29	52.46	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_RB_C,pfam_RB_A,pfam_RB_B,pfam_RB_N,superfamily_Cyclin-like,smart_Cyclin-like	p.G801fs	ENST00000267163.4	37	c.2400	CCDS31973.1	13																																																																																			-	pfam_RB_C		0.418	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	protein_coding	OTTHUMT00000044884.1	T				49039415	+1	no_errors	ENST00000267163	ensembl	human	known	74_37	frame_shift_del	DEL	1.000	-
WBP2NL	164684	genome.wustl.edu	37	22	42398850	42398854	+	Intron	DEL	TACTT	TACTT	-	rs133310|rs201279320|rs71751842|rs199509113	byFrequency	TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	TACTT	TACTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr22:42398850_42398854delTACTT	ENST00000328823.9	+	1	93				WBP2NL_ENST00000461730.1_3'UTR	NM_152613.2	NP_689826.2	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)			breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						GGATAGAAACTACTTTAAAGAACCA	0.468														2430	0.485224	0.2519	0.3473	5008	,	,		17791	0.8641		0.4742	False		,,,				2504	0.5194																0								ENSG00000183066																																			WBP2NL	SO:0001627	intron_variant	0				HGNC	BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270	ENST00000328823.9:c.62+3966TACTT>-	22.37:g.42398850_42398854delTACTT		Somatic	NA	NA	NA		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000328823.9	37	NULL	CCDS14029.1	22																																																																																			-	-		0.468	WBP2NL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP2NL	protein_coding	OTTHUMT00000322037.1	TACTT	NM_152613			42398854	+1	no_errors	ENST00000461730	ensembl	human	known	74_37	rna	DEL	0.001:0.003:0.012:0.016:0.015	-
RIMS2	9699	genome.wustl.edu	37	8	105235995	105235995	+	Missense_Mutation	SNP	T	T	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr8:105235995T>A	ENST00000339750.2	+	1	116	c.116T>A	c.(115-117)aTg>aAg	p.M39K	RIMS2_ENST00000436393.2_Intron|RIMS2_ENST00000507740.1_Intron|RIMS2_ENST00000262231.10_Intron|RIMS2_ENST00000406091.3_Intron			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	0	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TTTCCCTGCATGAACTCCCTG	0.637										HNSCC(12;0.0054)																																							0								ENSG00000176406						23.0	22.0	23.0					8																	105235995		876	1991	2867	RIMS2	SO:0001583	missense	0			-	HGNC	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000339750.2:c.116T>A	8.37:g.105235995T>A	ENSP00000342051:p.Met39Lys	Somatic	0	178	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	50	81	38.17	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.M39K	ENST00000339750.2	37	c.116		8	.	.	.	.	.	.	.	.	.	.	T	8.227	0.803786	0.16467	.	.	ENSG00000176406	ENST00000523362;ENST00000339750	T;T	0.16597	2.33;2.33	4.53	4.53	0.55603	.	.	.	.	.	T	0.31796	0.0808	.	.	.	0.42629	D	0.993371	.	.	.	.	.	.	T	0.04165	-1.0972	6	0.49607	T	0.09	.	13.7175	0.62705	0.0:0.0:0.0:1.0	.	.	.	.	K	39	ENSP00000428478:M39K;ENSP00000342051:M39K	ENSP00000342051:M39K	M	+	2	0	RIMS2	105305171	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.549000	0.82163	1.901000	0.55032	0.482000	0.46254	ATG	-	NULL		0.637	RIMS2-201	KNOWN	basic	protein_coding	RIMS2	protein_coding		T	NM_001100117	-		105235995	+1	no_errors	ENST00000339750	ensembl	human	known	74_37	missense	SNP	1.000	A
ANKRD20A5P	440482	genome.wustl.edu	37	18	14179480	14179480	+	RNA	SNP	C	C	G			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr18:14179480C>G	ENST00000581935.1	+	0	385							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						GGTACCGAATCCGGTACTCGG	0.627																																																	0								ENSG00000186481						8.0	8.0	8.0					18																	14179480		688	1584	2272	ANKRD20A5P			0			-	HGNC	BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14179480C>G		Somatic	0	216	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	72	190	27.38	Q4G1B6	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			-	-		0.627	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	pseudogene	OTTHUMT00000442833.1	C		-		14179480	+1	no_errors	ENST00000581181	ensembl	human	known	74_37	rna	SNP	0.001	G
UGT2B11	10720	genome.wustl.edu	37	4	70079984	70079984	+	Missense_Mutation	SNP	C	C	G	rs139371276	byFrequency	TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr4:70079984C>G	ENST00000446444.1	-	1	465	c.457G>C	c.(457-459)Gtt>Ctt	p.V153L	RP11-704M14.1_ENST00000505646.1_RNA|RP11-704M14.1_ENST00000504301.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	153					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						CAGGGAAAAACAGCATCTGCA	0.393													.|||	14	0.00279553	0.0098	0.0014	5008	,	,		19126	0.0		0.0	False		,,,				2504	0.0																0								ENSG00000213759	A	LEU/VAL	37,4369		0,37,2166	127.0	125.0	125.0		457	-3.9	0.0	4	dbSNP_134	125	1,8597		0,1,4298	no	missense	UGT2B11	NM_001073.1	32	0,38,6464	GG,GC,CC		0.0116,0.8398,0.2922	benign	153/530	70079984	38,12966	2203	4299	6502	UGT2B11	SO:0001583	missense	0			-	HGNC	AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.457G>C	4.37:g.70079984C>G	ENSP00000387683:p.Val153Leu	Somatic	0	250	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	178	57	75.74	Q3KNV9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.V153L	ENST00000446444.1	37	c.457	CCDS3527.1	4	.	.	.	.	.	.	.	.	.	.	-	0.005	-2.224876	0.00283	0.008398	1.16E-4	ENSG00000213759	ENST00000446444	T	0.63580	-0.05	1.96	-3.91	0.04168	.	1.117190	0.07132	U	0.845681	T	0.33498	0.0865	N	0.20483	0.58	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.11324	-1.0592	10	0.23302	T	0.38	.	6.5423	0.22387	0.2739:0.5443:0.0:0.1818	.	153	O75310	UDB11_HUMAN	L	153	ENSP00000387683:V153L	ENSP00000387683:V153L	V	-	1	0	UGT2B11	70114573	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-8.771000	0.00017	-4.934000	0.00026	-3.955000	0.00015	GTT	-	pfam_UDP_glucos_trans		0.393	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B11	protein_coding	OTTHUMT00000251551.2	C	NM_001073	rs139371276		70079984	-1	no_errors	ENST00000446444	ensembl	human	known	74_37	missense	SNP	0.000	G
ABCC3	8714	genome.wustl.edu	37	17	48760996	48760996	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr17:48760996G>A	ENST00000285238.8	+	27	3913	c.3833G>A	c.(3832-3834)cGc>cAc	p.R1278H		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	1278					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	GAAGGCAGCCGCCCTCCCGAA	0.647																																																	0								ENSG00000108846						62.0	60.0	61.0					17																	48760996		2203	4300	6503	ABCC3	SO:0001583	missense	0			-	HGNC	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.3833G>A	17.37:g.48760996G>A	ENSP00000285238:p.Arg1278His	Somatic	1	170	0.58		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	97	66	59.51	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,tigrfam_Multidrug-R_assoc	p.R1278H	ENST00000285238.8	37	c.3833	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	g	14.28	2.488337	0.44249	.	.	ENSG00000108846	ENST00000285238	D	0.86097	-2.07	5.94	3.94	0.45596	.	0.260668	0.35936	N	0.002881	D	0.86447	0.5935	L	0.45137	1.4	0.39971	D	0.974798	D	0.89917	1.0	D	0.63113	0.911	D	0.85837	0.1395	10	0.59425	D	0.04	-10.2223	8.0485	0.30564	0.1364:0.1318:0.7317:0.0	.	1278	O15438	MRP3_HUMAN	H	1278	ENSP00000285238:R1278H	ENSP00000285238:R1278H	R	+	2	0	ABCC3	46115995	0.997000	0.39634	0.077000	0.20336	0.029000	0.11900	3.166000	0.50785	0.837000	0.34925	-0.141000	0.14075	CGC	-	superfamily_P-loop_NTPase,tigrfam_Multidrug-R_assoc		0.647	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	protein_coding	OTTHUMT00000368083.2	G	NM_020038	-		48760996	+1	no_errors	ENST00000285238	ensembl	human	known	74_37	missense	SNP	0.708	A
ITGA1	3672	genome.wustl.edu	37	5	52177853	52177853	+	Splice_Site	SNP	G	G	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr5:52177853G>T	ENST00000282588.6	+	7	1231	c.773G>T	c.(772-774)aGa>aTa	p.R258I		NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	258	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				GACACAGCAAGGTATATGGAT	0.353																																																	0								ENSG00000213949						47.0	50.0	49.0					5																	52177853		2203	4300	6503	ITGA1	SO:0001630	splice_region_variant	0			-	HGNC	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.773+1G>T	5.37:g.52177853G>T		Somatic	0	36	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	16	26	38.10	B2RNU0	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.R258I	ENST00000282588.6	37	c.773	CCDS3955.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.199645	0.94997	.	.	ENSG00000213949	ENST00000282588	D	0.82984	-1.67	5.31	5.31	0.75309	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.87613	0.6221	L	0.42529	1.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83499	0.0074	10	0.18710	T	0.47	.	18.9654	0.92694	0.0:0.0:1.0:0.0	.	258	P56199	ITA1_HUMAN	I	258	ENSP00000282588:R258I	ENSP00000282588:R258I	R	+	2	0	ITGA1	52213610	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.359000	0.79477	2.639000	0.89480	0.609000	0.83330	AGA	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.353	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA1	protein_coding	OTTHUMT00000253855.3	G	NM_181501	-	Missense_Mutation	52177853	+1	no_errors	ENST00000282588	ensembl	human	known	74_37	missense	SNP	1.000	T
PCDHGA11	56105	genome.wustl.edu	37	5	140801354	140801354	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr5:140801354C>T	ENST00000398587.2	+	1	593	c.560C>T	c.(559-561)aCg>aTg	p.T187M	PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.T187M|PCDHGB7_ENST00000398594.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	187	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T187M(1)		breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGGCAGAACGGATGGGGCC	0.547																																																	1	Substitution - Missense(1)	large_intestine(1)						ENSG00000253873						38.0	40.0	40.0					5																	140801354		1959	4156	6115	PCDHGA11	SO:0001583	missense	0			-	HGNC	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.560C>T	5.37:g.140801354C>T	ENSP00000381589:p.Thr187Met	Somatic	0	39	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	14	36	28.00	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T187M	ENST00000398587.2	37	c.560	CCDS47294.1	5	.	.	.	.	.	.	.	.	.	.	c	0.111	-1.138391	0.01742	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.21191	2.02;2.02	6.03	2.31	0.28768	Cadherin (3);Cadherin-like (1);	0.376486	0.14673	U	0.305202	T	0.17238	0.0414	M	0.61703	1.905	0.09310	N	1	P;B;B	0.34815	0.47;0.4;0.451	B;B;B	0.28784	0.069;0.094;0.064	T	0.21690	-1.0238	10	0.51188	T	0.08	.	3.7329	0.08500	0.0898:0.473:0.1984:0.2387	.	187;187;187	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	M	187	ENSP00000381589:T187M;ENSP00000428333:T187M	ENSP00000381589:T187M	T	+	2	0	PCDHGA11	140781538	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.650000	0.05378	-0.044000	0.13491	-0.797000	0.03246	ACG	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.547	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	protein_coding	OTTHUMT00000376974.1	C	NM_018914	-		140801354	+1	no_errors	ENST00000398587	ensembl	human	known	74_37	missense	SNP	0.000	T
CFDP1	10428	genome.wustl.edu	37	16	75327732	75327732	+	3'UTR	DEL	A	A	-	rs149574560		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr16:75327732delA	ENST00000283882.3	-	0	1150					NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1						cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						TTCAATGTAGAAAAAAAAAAG	0.303																																																	0								ENSG00000153774																																			CFDP1	SO:0001624	3_prime_UTR_variant	0				HGNC	AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.*118T>-	16.37:g.75327732delA		Somatic	0	71	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	7	46	13.21	O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	RNA	DEL	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000283882.3	37	NULL	CCDS10916.1	16																																																																																			-	-		0.303	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFDP1	protein_coding	OTTHUMT00000269031.2	A	NM_006324			75327732	-1	no_errors	ENST00000570103	ensembl	human	known	74_37	rna	DEL	0.940	-
SRCAP	10847	genome.wustl.edu	37	16	30721932	30721932	+	Intron	SNP	T	T	G			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr16:30721932T>G	ENST00000262518.4	+	9	1519				SRCAP_ENST00000395059.2_Intron|SRCAP_ENST00000344771.4_Intron|SNORA30_ENST00000384028.1_RNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein						histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			AAACCCTTGATTGTATTCTTG	0.478																																																	0								ENSG00000206755						106.0	91.0	96.0					16																	30721932		876	1991	2867	SNORA30	SO:0001627	intron_variant	0			-	HGNC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1135-143T>G	16.37:g.30721932T>G		Somatic	0	105	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	19	68	21.84	B0JZA6|O15026|Q7Z744|Q9Y5L9	RNA	SNP	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262518.4	37	NULL	CCDS10689.2	16																																																																																			-	-		0.478	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA30	protein_coding	OTTHUMT00000255523.1	T	NM_006662	-		30721932	+1	no_errors	ENST00000384028	ensembl	human	known	74_37	rna	SNP	0.456	G
FBN1	2200	genome.wustl.edu	37	15	48703246	48703277	+	Frame_Shift_Del	DEL	AGTCTTTGTCATATTTGTCTTCTAGTTGGTTA	AGTCTTTGTCATATTTGTCTTCTAGTTGGTTA	-	rs371939796|rs199846998		TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	AGTCTTTGTCATATTTGTCTTCTAGTTGGTTA	AGTCTTTGTCATATTTGTCTTCTAGTTGGTTA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr15:48703246_48703277delAGTCTTTGTCATATTTGTCTTCTAGTTGGTTA	ENST00000316623.5	-	66	8981_9012	c.8526_8557delTAACCAACTAGAAGACAAATATGACAAAGACT	c.(8524-8559)cttaaccaactagaagacaaatatgacaaagactacfs	p.NQLEDKYDKDY2843fs	FBN1_ENST00000561429.1_5'Flank	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2843					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.E2846K(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CCACTGAGGTAGTCTTTGTCATATTTGTCTTCTAGTTGGTTAAGTTCTTTCT	0.362																																																	1	Substitution - Missense(1)	cervix(1)	GRCh37	CD000605|CD055684	FBN1	D		ENSG00000166147																																			FBN1	SO:0001589	frameshift_variant	0				HGNC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8526_8557delTAACCAACTAGAAGACAAATATGACAAAGACT	15.37:g.48703246_48703277delAGTCTTTGTCATATTTGTCTTCTAGTTGGTTA	ENSP00000325527:p.Asn2843fs	Somatic	NA	NA	NA		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	NA	NA	NA	B2RUU0|D2JYH6|Q15972|Q75N87	Frame_Shift_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.N2843fs	ENST00000316623.5	37	c.8557_8526	CCDS32232.1	15																																																																																			-	pirsf_FBN		0.362	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	protein_coding	OTTHUMT00000417355.1	AGTCTTTGTCATATTTGTCTTCTAGTTGGTTA				48703277	-1	no_errors	ENST00000316623	ensembl	human	known	74_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:1.000:0.980:0.975:0.898:0.828	-
PPP1R21	129285	genome.wustl.edu	37	2	48734480	48734480	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr2:48734480C>T	ENST00000294952.8	+	19	2198	c.2041C>T	c.(2041-2043)Cag>Tag	p.Q681*	PPP1R21_ENST00000281394.4_Nonsense_Mutation_p.Q670*|PPP1R21_ENST00000476199.1_3'UTR|PPP1R21_ENST00000449090.2_Nonsense_Mutation_p.Q639*	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	681						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						ACTTACGTCTCAGTTGCAGCT	0.388																																																	0								ENSG00000162869						159.0	142.0	148.0					2																	48734480		2203	4300	6503	PPP1R21	SO:0001587	stop_gained	0			-	HGNC	AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.2041C>T	2.37:g.48734480C>T	ENSP00000294952:p.Gln681*	Somatic	0	208	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	61	149	29.05	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Nonsense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_KLRAQ/TTKRSYEDQ_C,pfam_Unchr_KLRAQ/TTKRSYEDQ_N,superfamily_Ferritin-like_SF	p.Q681*	ENST00000294952.8	37	c.2041	CCDS46278.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.402834	0.98796	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	5.01	5.01	0.66863	.	0.102965	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-17.7888	18.8654	0.92290	0.0:1.0:0.0:0.0	.	.	.	.	X	670;681;639	.	ENSP00000281394:Q670X	Q	+	1	0	KLRAQ1	48587984	1.000000	0.71417	0.895000	0.35142	0.968000	0.65278	7.045000	0.76585	2.751000	0.94390	0.655000	0.94253	CAG	-	pfam_KLRAQ/TTKRSYEDQ_C		0.388	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R21	protein_coding	OTTHUMT00000251238.4	C	NM_152994	-		48734480	+1	no_errors	ENST00000294952	ensembl	human	known	74_37	nonsense	SNP	1.000	T
ALDH5A1	7915	genome.wustl.edu	37	6	24502780	24502780	+	Silent	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr6:24502780C>T	ENST00000357578.3	+	2	529	c.384C>T	c.(382-384)taC>taT	p.Y128Y	ALDH5A1_ENST00000348925.2_Silent_p.Y128Y|ALDH5A1_ENST00000546278.1_Silent_p.Y40Y|ALDH5A1_ENST00000491546.1_Intron	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	128					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	GGAAGTGGTACAATTTAATGA	0.368																																																	0			GRCh37	CM033317	ALDH5A1	M		ENSG00000112294						133.0	122.0	126.0					6																	24502780		2203	4300	6503	ALDH5A1	SO:0001819	synonymous_variant	0			-	HGNC	L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.384C>T	6.37:g.24502780C>T		Somatic	0	189	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	105	74	58.66	B2RD26|G5E949|Q546H9|Q8N3W6	Silent	SNP	NA	NA	NA	NA	NA	NA	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_Succ_semiAld_DH	p.Y128	ENST00000357578.3	37	c.384	CCDS4555.1	6																																																																																			-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_Succ_semiAld_DH		0.368	ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH5A1	protein_coding	OTTHUMT00000040007.2	C		-		24502780	+1	no_errors	ENST00000348925	ensembl	human	known	74_37	silent	SNP	0.989	T
EIF5B	9669	genome.wustl.edu	37	2	99977775	99977777	+	In_Frame_Del	DEL	TGA	TGA	-			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	TGA	TGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr2:99977775_99977777delTGA	ENST00000289371.6	+	4	613_615	c.411_413delTGA	c.(409-414)agtgat>agt	p.D142del		NM_015904.3	NP_056988.3	O60841	IF2P_HUMAN	eukaryotic translation initiation factor 5B	142	Poly-Asp.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of translational initiation (GO:0006446)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						ACTCTGGGAGTGATGATGATGAT	0.345																																					Colon(162;2388 2567 2705 3444)												0								ENSG00000158417																																			EIF5B	SO:0001651	inframe_deletion	0				HGNC	AF078035	CCDS42721.1	2q11.2	2012-09-20			ENSG00000158417	ENSG00000158417			30793	protein-coding gene	gene with protein product	"""translation initiation factor IF2"""	606086				10200264, 10432305	Standard	XM_005264075		Approved	IF2, KIAA0741, DKFZp434I036, FLJ10524	uc002tab.3	O60841	OTTHUMG00000153242	ENST00000289371.6:c.411_413delTGA	2.37:g.99977784_99977786delTGA	ENSP00000289371:p.Asp142del	Somatic	0	33	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	4	18	18.18	O95805|Q53RV7|Q53SI8|Q9UF81|Q9UMN7	In_Frame_Del	DEL	NA	NA	NA	NA	NA	NA	pfam_EF_GTP-bd_dom,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_B-barrel,superfamily_TIF_IF2_dom3,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.D141in_frame_del	ENST00000289371.6	37	c.411_413	CCDS42721.1	2																																																																																			-	NULL		0.345	EIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF5B	protein_coding	OTTHUMT00000330364.2	TGA	NM_015904			99977777	+1	no_errors	ENST00000289371	ensembl	human	known	74_37	in_frame_del	DEL	1.000:1.000:1.000	-
CRIP3	401262	genome.wustl.edu	37	6	43275460	43275460	+	Missense_Mutation	SNP	C	C	T			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr6:43275460C>T	ENST00000274990.4	-	4	222	c.218G>A	c.(217-219)gGc>gAc	p.G73D	ZNF318_ENST00000607252.1_5'UTR|CRIP3_ENST00000372569.3_Missense_Mutation_p.G73D			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	73					T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			CAAGTAGGAGCCTACACCACC	0.627																																																	0								ENSG00000146215						45.0	49.0	48.0					6																	43275460		2203	4300	6503	CRIP3	SO:0001583	missense	0			-	HGNC	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.218G>A	6.37:g.43275460C>T	ENSP00000274990:p.Gly73Asp	Somatic	0	137	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	43	107	28.67	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.G73D	ENST00000274990.4	37	c.218		6	.	.	.	.	.	.	.	.	.	.	C	19.82	3.899114	0.72754	.	.	ENSG00000146215	ENST00000372569;ENST00000274990	D;D	0.92595	-3.07;-3.07	5.52	4.66	0.58398	.	0.066033	0.64402	D	0.000017	D	0.90349	0.6980	N	0.24115	0.695	0.58432	D	0.99999	D;D	0.89917	0.991;1.0	P;D	0.97110	0.634;1.0	D	0.92517	0.6021	10	0.87932	D	0	-29.7215	12.2124	0.54388	0.0:0.917:0.0:0.083	.	73;73	Q6Q6R5;Q6Q6R5-3	CRIP3_HUMAN;.	D	73	ENSP00000361650:G73D;ENSP00000274990:G73D	ENSP00000274990:G73D	G	-	2	0	CRIP3	43383438	0.998000	0.40836	1.000000	0.80357	0.630000	0.37929	3.076000	0.50081	1.464000	0.47987	0.655000	0.94253	GGC	-	NULL		0.627	CRIP3-004	KNOWN	basic	protein_coding	CRIP3	protein_coding	OTTHUMT00000313968.1	C		-		43275460	-1	no_errors	ENST00000274990	ensembl	human	known	74_37	missense	SNP	1.000	T
TEKT4	150483	genome.wustl.edu	37	2	95540568	95540568	+	Missense_Mutation	SNP	G	G	A			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr2:95540568G>A	ENST00000295201.4	+	4	898	c.761G>A	c.(760-762)tGc>tAc	p.C254Y	AC097374.2_ENST00000568768.1_RNA	NM_144705.2	NP_653306.1	Q8WW24	TEKT4_HUMAN	tektin 4	254					cell projection organization (GO:0030030)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	28						GACAATCTGTGCCGTGCCCAG	0.721																																																	0								ENSG00000163060						19.0	23.0	21.0					2																	95540568		2192	4291	6483	TEKT4	SO:0001583	missense	0			-	HGNC	AK097438	CCDS2005.1	2q11.2	2008-02-05			ENSG00000163060	ENSG00000163060			31012	protein-coding gene	gene with protein product							Standard	XM_005263876		Approved	MGC27019	uc002stw.1	Q8WW24	OTTHUMG00000130396	ENST00000295201.4:c.761G>A	2.37:g.95540568G>A	ENSP00000295201:p.Cys254Tyr	Somatic	0	298	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	154	52	74.76		Missense_Mutation	SNP	NA	NA	NA	NA	NA	NA	pfam_Tektin,prints_Tektin	p.C254Y	ENST00000295201.4	37	c.761	CCDS2005.1	2	.	.	.	.	.	.	.	.	.	.	.	0.001	-2.962157	0.00049	.	.	ENSG00000163060	ENST00000295201	T	0.02345	4.33	2.18	-4.36	0.03645	.	1.035520	0.07578	N	0.919703	T	0.01156	0.0038	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.47262	-0.9131	10	0.36615	T	0.2	-5.3851	2.9338	0.05808	0.4031:0.0:0.1656:0.4312	.	254	Q8WW24	TEKT4_HUMAN	Y	254	ENSP00000295201:C254Y	ENSP00000295201:C254Y	C	+	2	0	TEKT4	94904295	0.000000	0.05858	0.030000	0.17652	0.090000	0.18270	-0.784000	0.04633	-1.727000	0.01368	0.466000	0.42574	TGC	-	pfam_Tektin		0.721	TEKT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEKT4	protein_coding	OTTHUMT00000252777.1	G	NM_144705	-		95540568	+1	no_errors	ENST00000295201	ensembl	human	known	74_37	missense	SNP	0.001	A
SRCAP	10847	genome.wustl.edu	37	16	30721934	30721935	+	Intron	INS	-	-	C			TCGA-LI-A67I-01A-31D-A307-09	TCGA-LI-A67I-10A-01D-A307-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	002585e4-d695-47b6-af2c-3429073bc0b4	3f1693c5-913e-4965-a931-af97a11388c6	g.chr16:30721934_30721935insC	ENST00000262518.4	+	9	1519				SRCAP_ENST00000395059.2_Intron|SRCAP_ENST00000344771.4_Intron|SNORA30_ENST00000384028.1_RNA	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein						histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ACCCTTGATTGTATTCTTGCCC	0.48																																																	0								ENSG00000206755																																			SNORA30	SO:0001627	intron_variant	0				HGNC	AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.1135-140->C	16.37:g.30721934_30721935insC		Somatic	0	106	0.00		0.780186203605339	NA	NA	NA	WXS	Illumina HiSeq 2500	Phase_IV	tier1	18	73	19.78	B0JZA6|O15026|Q7Z744|Q9Y5L9	RNA	INS	NA	NA	NA	NA	NA	NA	-	NULL	ENST00000262518.4	37	NULL	CCDS10689.2	16																																																																																			-	-		0.480	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORA30	protein_coding	OTTHUMT00000255523.1	-	NM_006662			30721935	+1	no_errors	ENST00000384028	ensembl	human	known	74_37	rna	INS	0.001:0.000	C
